diff --git "a/deduped/dedup_0227.jsonl" "b/deduped/dedup_0227.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0227.jsonl"
@@ -0,0 +1,80 @@
+{"text": "In establishing structure-function relationships for membrane transport proteins, the interpretation of phenotypic changes can be problematic, owing to uncertainties in protein expression levels, sub-cellular localization, and protein-folding fidelity. A dual-label competitive transport assay called \"Transport Specificity Ratio\" (TSR) analysis has been developed that is simple to perform, and circumvents the \"expression problem,\" providing a reliable TSR phenotype (a constant) for comparison to other transporters.Escherichia coli GABA (4-aminobutyrate) permease (GabP) as a model carrier, it is demonstrated that the TSR phenotype is largely independent of assay conditions, exhibiting: (i) indifference to the particular substrate concentrations used, (ii) indifference to extreme changes (40-fold) in transporter expression level, and within broad limits (iii) indifference to assay duration. The theoretical underpinnings of TSR analysis predict all of the above observations, supporting that TSR has (i) applicability in the analysis of membrane transport, and (ii) particular utility in the face of incomplete information on protein expression levels and initial reaction rate intervals . The TSR was used to identify gab permease (GabP) variants that exhibit relative changes in catalytic specificity (kcat/Km) for [14C]GABA (4-aminobutyrate) versus [3H]NA (nipecotic acid).Using the constant that reflects innate molecular properties of the transition state, and provides a reliable index of the difference in catalytic specificity that a carrier exhibits toward a particular pair of substrates. A change in the TSR phenotype, called a \u0394(TSR), represents a specificity shift attributable to underlying changes in the intrinsic substrate binding energy (\u0394Gb) that translocation catalysts rely upon to decrease activation energy . TSR analysis is therefore a structure-function tool that enables parsimonious scanning for positions in the protein fold that couple to the transition state, creating stability and thereby serving as functional determinants of catalytic power .The TSR phenotype is an easily measured  However, without a productive conspiracy among catalysis-promoting residues in the protein fold, transport proteins would be non-catalytic . Inasmuch as \"... catalytic power will always appear as a result of increased transition state stabilization (lower free energy) ...\" GABA and [3H]NA compete for uptake at the GabP active site. Therefore as a practical matter it is necessary to establish conditions under which an adequate signal may be obtained from both isotope channels. This can be accomplished empirically by mixing the labelled substrates in different proportions  the trading of [3H]NA for [14C]GABA is expected to substantially alter the fraction of active sites occupied by GABA versus NA Nevertheless, it is clear that the calculated TSR parameter is indifferent to the precise substrate concentration ratio. Moreover, at a fixed substrate ratio (7 parts NA to 3 parts GABA), the absolute substrate concentrations may also be varied over a wide range (here 17.5-fold) without affecting the calculated TSR parameter  indicate that there is great latitude in choosing substrate concentrations for TSR measurements, it is nevertheless pragmatic to select robust initial velocity conditions wherein the substrate concentration ratio is such that equal disintegration rates are seen in both isotope channels (broken line) when the control  transporter is studied. Variant transporters, exhibiting relative increases or decreases in specificity for the two substrates, will then be easily visualized as an inequality between the disintegration rates seen in the two isotope channels .lac-controlled expression of the plasmid-borne GabP gene. Growth in the presence of increasing IPTG concentrations caused the uptake of [3H]NA and [14C]GABA to increase in proportion to the GabP expression-level  phenotype \u2013 the TSR. Fundamental to TSR analysis is the notion that transport catalysts use substrate binding energy to lower the translocation energy barrier (activation energy) [S] \u00a0\u00a0\u00a0 (2)m), wherein the familiar Michaelis-Menten relationship (Equation 3) reduces to the form of a second-order rate law (Equation 4), and the apparent rate constant may be evaluated as k = kcat/Km (units M-1sec-1).Free carrier and substrate (C + S) are dominant under non-saturating, second-order conditions . The alternative Michaelis-Menten form turns out to be very useful for analysing the uptake of two labelled substrates that compete for transport at the same active site.E. coli GabP exposed simultaneously to arbitrary concentrations of its transported substrates [14C]GABA and [3H]NA. These competing substrates, present simultaneously in the same reaction vessel, will necessarily be in equilibrium with precisely the same concentration of free carrier (but unknown concentrations of carrier-substrate complexes), allowing algebraic elimination of [C] (Equation 5) when a ratio is taken between two instances of Equation 4 (one for each substrate).Consider the bstrates ,9, [14C]cat/Km) values has two consequences. First, since (kcat/Km) is formally a measure of catalytic specificity GABA and [3H]NA in different proportions, or in fixed proportion over a broad concentration range . Thus, arbitrary carrier saturation levels are not expected to compromise TSR measurements. Since uncharacterized mutant collections may be expected to contain transporter variants with highly divergent Km values, the saturation-independence of TSR analysis should be of value in high-throughput screening situations where little kinetic information may be available to guide the choice of assay conditions. However, to be of general value the results obtained with GabP must extrapolate to other transporters.Figure nge Fig. . Indeed,) \u2013 between the free reactants (C + S) and the transition state (CS\u2021). This fundamental reality can also be appreciated from the perspective that under non-saturating conditions ([S] << Km), there are no complexes to consider , and thus even complicated mechanisms reduce to the simple case (Equation 4) in which the reaction proceeds directly from the free reactants in solution to the transition state (C + S \u2192 Products). Thus, the simple second-order reaction scheme, C + S \u2192 Products, will probably never be \"too simple\" for the purpose of performing the TSR analysis \u2013 even though complicated transport kinetics will feature many complexes that TSR analysis seems to ignore. In truth, the missing complexes are merely irrelevant (not ignored) to the value of  .Why the deceptively simple TSR analysis should have broad applicability can be understood from further consideration of Figure of  Fig.  since thIt is worth mentioning that TSR analysis has \"fool-proof\" qualities that derive from its inherent insensitivity to several sources of error that can seriously compromise transport measurements that rely upon a single labelled substrate. TSR calculations may be expected to \"self-correct\" any sources of error that have proportionally the same effect on the measurement of both isotopes \u2013 for such errors cannot affect the isotope ratio used to calculate the TSR parameter.Figure constant, should be of considerable practical significance for high-throughput screening operations wherein carrier expression levels could be both highly variable and impractical to document in real-time.In order to demonstrate the expression-independent nature of the TSR parameter, IPTG was used to simulate the wide range of expression levels (40-fold) that might be encountered in an uncharacterized collection of transporter variants. Whereas the single-isotope signals Fig.  are seentotal in the sense desired for meaningful kinetic characterization, which assumes (Equation 3) that Ctotal consists entirely of active molecules. The possibility of partial denaturation precludes assigning a molecular interpretation to shifts in either velocity or Vmax. In contrast, TSR analysis is unaffected by the presence of inactive molecules, and theoretically will always report reliably on the innate specificity properties of the active site per se \u2013 even if the measured signal emanates from a minor fraction of the carrier molecules visualized on an immunoblot.Since TSR phenotypes are expression-independent, structure-function information gleaned from a rapid first-pass screen will remain valid irrespective of results that might be obtained from a subsequent immunoblot analysis. Immunoblots do not in any event determine C14C] and [3H] initial rate segments in their uptake time course . Plairelative differences in transition state binding energies (Equation 9) that can be visually represented as a change in the relative position of (separation between) the hypothetical binding isotherms for either substrate . This point is important, and can be illustrated by examining the implications of the figure The \u0394(TSR) phenotypes illustrated in Fig. ate Fig. . It is iCalculated TSR values for the N302C and INS Ala 320 variants are, respectively about 2.5 and 16. That these numbers are both greater than 1 indicates (Equation 9) that the hypothetical transition state binding isotherm for GABA would lie to the left  phenotype always means the same thing \u2013 there has been a change in the transition state stability for translocation of one or both substrates.It is to be noted that since absolute specificity changes can occur in the absence of a relative specificity shift , some catalytic residues may be detectable only by more complicated kinetic studies, or possibly through independent TSR experiments with structurally distinct substrate pairs. Since the TSR parameter is a synchrony with) the catalyzed reaction, and (iii) collectively can make million-fold contributions to catalytic specificity (transition state stabilization) even though their locations are spatially distant from the active site in enzymes of known structure  is a function of transition state stabilization ( + \u0394Gb), phenotypic changes in the TSR phenotype should report on structural perturbations that compromise as yet undiscovered networks that couple energetically to the transition state.Apart from its delightful simplicity and self-correcting behaviour, the TSR (or rather the ability to observe \u0394(TSR) phenotypes) is also attractive as a facile means of expanding interest in \"coupled promoting motions\" that are networked together in support of catalysis . Such neeductase ,12-14]; eductase ). Inasmucat/Km) by many orders of magnitude  occurring in synchrony ...\"  nipecotic acid (40 Ci/mmol) was a custom synthesis from Moravek Biochemicals ; [14C]GABA was from Dupont-New England Nuclear ; Ultima Gold \u2122 scintillation cocktail was from Packard BioScience ; the anti-Penta-His monoclonal antibody was from QIAGEN ; the goat anti-mouse alkaline phosphatase antibody was from Kirkegaard and Perry Laboratories ; isopropyl-\u03b2-D-thiogalactopyranoside (IPTG) was from Anatrace ; Immobilon-P\u2122 transfer membranes (0.45 um) were from Millipore ; the chemiluminescence reagent for alkaline phosphatase detections, Western Lightning, was from Perkin-Elmer Life Sciences, Inc. ; NA was from Research Biochemicals International ; Miller's Luria Broth medium was from Gibco-BRL ; agar and ampicillin were from Fisher Biotech ; bicinchoninic acid protein determination reagents were from Pierce ; cellulose acetate filters  were from either Millipore  or MicronSep,  from OSMONICS Inc. ; NA (2.1 \u03bcCi/ml) and 15 \u03bcM [14C]GABA (0.3 \u03bcCi/ml). This solution was found to support equal rates of [14C] and [3H] label accumulation in the Cys-less GabP control strain [3H]NA (1.2 \u03bcCi/ml) and 30 \u03bcM [14C]GABA (0.6 \u03bcCi/ml). This solution was found to support equal rates of [14C] and [3H] label accumulation by the wild type GabP [Transport reactions were initiated by mixing 20 \u03bcl of a 5-fold concentrated substrate stock solution with 80 \u03bcl of prewarmed C]GABA 0. \u03bcCi/ml. Stop Solution (KPi Buffer containing 20 mM HgCl2), and then vacuum-filtered (0.45 micron pore). The reaction vessel was then rinsed with 1 ml of Wash Buffer (KPi Buffer containing 5 mM HgCl2) and this was applied to the same filter. Finally, 4 ml of the Wash Buffer was applied to the filter. The filter was then dissolved in Ultima Gold\u2122 scintillation cocktail and the [3H] and [14C] radioactivity  analyzed with a Packard BioScience Tri-Carb 2900 TR liquid scintillation counter using stored Ultima Gold\u2122 quench curves and automatic quench compensation.A 60 or 120 Hz metronome was used to time the reactions, which were rapidly quenched with 1 ml of ice-cold E. coli strain, SK45, was grown and prepared for transport experiments as indicated above except that a series of different cell suspensions were prepared spanning a range from 20 to 125 percent of that described above. Dual-label transport experiments carried out with these different suspensions produced a linear standard curve for GabP-independent \"background uptake\" of [3H]NA and [14C]GABA as a function of protein content. The protein content of GabP-positive test strains could then be used to obtain the appropriate background subtraction by extrapolation from the standard curve. Test strain protein contents were always similar (within 10 percent) because when cell pellets were resuspended steps were taken to assure approximately equal turbidity levels.The GabP-negative 3H]NA and [14C]GABA. The background-corrected velocity replicates were used to calculate replicate TSR values (Equation 6) from which the mean TSR and standard errors (S.E.M.) shown in the figures were obtained.Replicate (n = 3), background-corrected, dual-substrate uptake velocities (moles/time) were inferred from measured disintegration rates for filter-bound [E. coli cells were probe-sonicated to produce plasma membrane vesicles, which were then separated from soluble components and unbroken cells by differential centrifugation as previously described [escribed . Plasma escribed . Immunob"}
+{"text": "Laser Interstitial ThermoTherapy (LITT) is a well established surgical method. The use of LITT is so far limited to homogeneous tissues, e.g. the liver. One of the reasons is the limited capability of existing treatment planning models to calculate accurately the damage zone. The treatment planning in inhomogeneous tissues, especially of regions near main vessels, poses still a challenge. In order to extend the application of LITT to a wider range of anatomical regions new simulation methods are needed. The model described with this article enables efficient simulation for predicting damaged tissue as a basis for a future laser-surgical planning system. Previously we described the dependency of the model on geometry. With the presented paper including two video files we focus on the methodological, physical and mathematical background of the model.In contrast to previous simulation attempts, our model is based on finite element method (FEM). We propose the use of LITT, in sensitive areas such as the neck region to treat tumours in lymph node with dimensions of 0.5 cm \u2013 2 cm in diameter near the carotid artery. Our model is based on calculations describing the light distribution using the diffusion approximation of the transport theory; the temperature rise using the bioheat equation, including the effect of microperfusion in tissue to determine the extent of thermal damage; and the dependency of thermal and optical properties on the temperature and the injury. Injury is estimated using a damage integral. To check our model we performed a first in vitro experiment on porcine muscle tissue.We performed the derivation of the geometry from 3D ultrasound data and show for this proposed geometry the energy distribution, the heat elevation, and the damage zone. Further on, we perform a comparison with the in-vitro experiment. The calculation shows an error of 5% in the x-axis parallel to the blood vessel.The FEM technique proposed can overcome limitations of other methods and enables an efficient simulation for predicting the damage zone induced using LITT. Our calculations show clearly that major vessels would not be damaged. The area/volume of the damaged zone calculated from both simulation and in-vitro experiment fits well and the deviation is small. One of the main reasons for the deviation is the lack of accurate values of the tissue optical properties. In further experiments this needs to be validated. Laser radiation is now used routinely in surgery to incise, coagulate, or vaporize tissues. The laser light power is converted into heat in the target volume with ensuing coagulative necrosis, secondary degeneration and atrophy, and tumour shrinkage with minimal damage to surrounding structures . The useClinical studies have yet to demonstrate that LITT is practical for the palliation of hepatic and nasopharyngeal tumours e.g. -9). The . The 9])Modelling the laser-tissue interaction is beneficial for the analysis and optimisation of the parameters governing planned laser surgical procedures. Nevertheless, we still lack an adequate model that grants accuracy. Most of the models suggested depend greatly on simplifications of the real problem, either in the geometry they offer or in the system of equations they use. Some models, which use the bioheat equation, neglect the role of the changes in the tissue properties during temperature elevation process , which dThis paper describes in detail the bases for a modelling method to simulate the effect of LITT for the treatment in various indications near large vessels, such as the carotid artery in the neck region. We thereby propose the use of LITT, frequently applied in the treatment of liver tumours , in moreThe actual response of tissue to laser irradiation is a time-dependent phenomenon. Initially, there are thermal and possibly photochemical changes of the tissue at the molecular level. Next are changes in tissue perfusion caused by thermally induced vascular relaxation and/or vessel damage. Heat deposited at the application site is transferred to adjacent structures. This may be desirable for coagulation purposes \u2013 or it may cause unexpected thermal damage to otherwise viable tissues adjacent to the irradiation site. The rate of heat transfer depends on the composition and organization of tissues involved. Blood perfusion during and after irradiation has significant effects on the size of the damage zone.We discuss in this paper our mathematical approach, its considerations and restrictions. In the main part we present the mathematical and physical backgrounds used to achieve the model. Then we present and discuss the results of our simulation in comparison with the results of our in-vitro experiment.Our model of LITT considers both optical and thermal effects. It is based on calculations describing the light distribution using the diffusion approximation of the transport theory; the temperature rise using the bioheat equation, including the effect of microperfusion in tissue to determine the extent of thermal damage, and the dependence of thermal and optical properties on the temperature and the injury. Injury is estimated using a damage integral, which depends on the temperature elevation history. The order and flow of the modelling steps are described in the following sections in detail.The head and neck area consists of complex anatomical structures in close proximity. In sonographic 3D volume datasets of the neck area the sternocleidomastoideus muscle and the neck vessels  serve as leading structures . Because3 shown in Fig. One can easily segment the carotid artery from 3D sonographical, MRI or CT volume datasets. For the segmentation of our 3D ultrasound dataset Fig  we used Commercially available laser applicator fibres for thermotherapy frequently have a water jacket to cool the surface. The applicator is assumed to be a cylinder, and the cooling effect is implemented as a boundary condition at the diffuser surface.The tissue surrounding the vessel is treated as a homogeneous muscle tissue. According to the geometry described using a mesh is generated to perform a finite element method calculation Fig. . The modIn most tissues, both absorption and scattering are present simultaneously. A mathematical description of the absorption and scattering characteristics of light can be performed analytically or by using the transport theory. Transport theory has been extensively used when dealing with laser-tissue interactions. Furthermore, experimental results have confirmed its validity in most cases .2 10600 nm laser is less than 350 \u03bcm. This leads us to the possibility of applying light diffusion approximation to the transport theory , D the diffusion coefficient [cm], and Q the source term [W cm-3]. \u03bca is the absorption coefficient and \u03bc's the reduced scattering coefficient in tissue. The roman number (I) indicates the position in Fig. \u03bcs is described by \u03bc's = \u03bcs (1-g), with g being the anisotropy factor incorporating the effects of directionally dependent scattering.erm W cm-. \u03bca is t\u03bca for visible and for near infrared radiation ranges between 0.001 mm-1 < \u03bca < 10 mm-1 for biological tissues. While for the scattering coefficient \u03bcs is in the order of 1 mm-1 <\u03bcs < 100 mm-1  is the tissue average volumetric blood perfusion rate , and cb the specific heat of blood [J kg-1 C-1]. The coefficients \u03c1, k and wb are functions of temperature T.where As a basis for the optical and thermal parameters for the simulations, we used values published by Mueller et al. . EspeciaIn order to make the model adaptable to individual shapes of segmented vessels, we considered the geometry of a large vessel as a volume in which an incompressible fluid (blood) flows. The direction of the blood flow and the initial speed profile are implemented as boundary conditions. The incompressible Navier-Stokes equation for the blood (Newtonian fluid) reads:\u03b7 is the dynamic viscosity [kg s m-1], \u03c1 the density [kg m-3], u the velocity field, p the pressure [N/m2], and F a volume force field such as gravity.Here, u = u(r)) and eq. 5 is reduced to the following:Implementing the Navier-Stokes equation in the model allows us to present a time-periodic change in the blood flow rate, i.e., to simulate the beat cycle effect in the vessel. The main effect here on the result of the simulation lies in the accuracy of the estimated heat elevation in the tissue: A continuous blood flow has a different profile than the cycled flow , which yields a different final cooling effect. For vessels away from the heart, the pumping cycle does not clearly appear; it tends to be a normal laminar flow. In this case  in a large vessel the bioheat equation becomes:The heat convection between tissue and a large vessel occurs as a direct energy transfer rather than perfusion. The vessel is a heat sink in the treated volume. Therefore, the perfusion term in the bioheat equation has to be modified to consider heat conduction and blood flow. A new term, the so-called ood flow . ConsideThe thermal damage in cells and tissue is described mathematically by a first-order thermal-chemical rate equation, in which temperature history determines damage. Damage is considered to be a unimolecular process, whereby native molecules transform into a denatured/coagulated state through an activated state leading to cell death ,19. DamaA [s-1] is the frequency factor, Ea [J/mole] the activation energy, R [J mole-1 K-1] the universal gas constant, and T [K] the temperature. C and C are the concentrations of the undamaged molecules at the beginning and at time \u03c4, respectively. Damage \u03a9  is a function of the observer's definition of damage. In [The activation energy mage. In  a limit Heat capacity is assumed to be constant over a wide temperature range. The temperature dependence of thermal conductivity and density is taken into consideration by the following linear approximations   and leads to reduction in penetration depth. The actual property set is calculated from the actual damage value as well as the optical properties in the native and coagulated tissue states  . In the first loop step \u03a9 is zero, and it starts to increase according to the rise in temperature, i.e., the different optical properties have as their starting point native tissue and as end point coagulated tissue. The actual value lies between both limits as determined according to \u03a9.\u2022 In the second step, the temperature distribution in the tissue caused by laser energy deposition is estimated by solving the two bioheat equations for tissue and large vessel. The source term in both equations is defined by the absorbed energy at each mesh point Fig.  from the) from the Navier-Stokes equation (either eq.5 or eq. 6). In our solved model, because we suggested treatment as taking place in the neck near the carotid vessel, we considered to use eq. 6 for obtaining the speed field, which is valid for laminar flow.\u2022 A by-step here is the estimation of the blood speed field .\u2022 After estimating the heat distribution and the damage value, we perform a backward step to calculate the new values of the properties according to eq. 9 through eq. 12, which are updated in the equations set for the next loop iteration.tn and a corresponding sequence of values for the dependent variable  so that each \u03c6n, Tn,... approximates the solution at tn [hn = tn+1 - tn so that the estimated error in the numerical solution is controlled by a specified tolerance [t in this case) [For our calculations we used FEMLAB's standard mesh generator with its default settings for modelling . The meson at tn . Modern olerance . The \"flis case) . There iLight is considered to be emitted from an interstitial fibre with a fibre-diameter of 1 mm; it was modelled as an isotropically radiating cylindrical source Fig. .In the real treatment a cooling process using a special cooling catheter is performed to keep the temperature at the surface of the applicator low, preventing damage at its surface. A special boundary condition at the applicator surface should be applied in order to simulate this cooling effect. In the model this is realized by setting the outer surface temperature of the applicator to a constant value .At the modelled volume surfaces the insulation boundary conditions, optical and thermal, are used,n is the outward unit vector normal to the surface. This means the gradients of light fluence rate and of temperature vanish at the surface. Even though this condition is more suitable for light fluence rate, as small amount of radiations reach the surface, but in general the temperature and light fluence rate will not be constant. The need to set this condition in this way is because that the numerical solver demands defined fixed boundary conditions, which sometimes do not agree with the real situation.where wb over the entie tissue is set to 1.4\u00b710-6kg of blood s-1 cm-3 for T < 60\u00b0C and to 0 when T \u2265 60\u00b0C, which is to be considered as a normal result of stopping the blood perfusion according to temperature elevation in the tissue [\u03b7, to 3.5\u00b7103kg\u00b7s\u00b7m-1. To evaluate the damage, \u03a9, the activation energy Ea is set to 670000 J/mol and the frequency factor A to 9.4\u00b710104s-1 [According to the NCRP-data  the perfe tissue . In orde10104s-1 ,35. Dama10104s-1 .UltraSPARC IIIi processor.The simulation takes around 2 hours on Sun Blade 2000 with Solaris 9 OS, 6 GB RAM and 3. The tube inner diameter is 5 mm and the outer diameter is 7 mm. The blood and the laser cooling liquid had the room temperature of 21.4\u00b0C while the sample itself 17.6\u00b0C. A laser power of 30 W and blood average flow speed of 40 ml\u00b7s-1 were used. We measured the exact distance between the laser applicator and the tube edge, 3 mm, at the end of the experiment after performing the cut in the sample. We fixed our application time to 300 s.We performed a single in-vitro experiment to check our model. The setup is shown in Fig. In the simulation model we omit the perfusion term, as there is no perfusion to be considered in-vitro. We simulated the tube (blood vessel) with diameter of 6 mm. All other experimental conditions are implemented in the model as they are in the experiment.Because of the lack of data, which describe the properties of the porcine tissues, in all literature available to us, we used the same data presented in Table The highest temperature and widest damage are reached in front of the centre of the applicator. Taking into account the perpendicular surface to the applicator at centre, which is the most critical in the volume as all effects participate together: applicator, vessel, and blood flow, we complete the comparisons of the results between the experiment and the simulation using this plane. Hence, we made a cut in the probe at the level equivalent to this plane.Coagulation of tissue is immediately apparent and always indicates lethal thermal effect . Anyhow,A comparison in the z-direction needs an up-down cut (y-z plane) through the applicator position perpendicular to the tube/vessel, which was not possible after the cut in x-y direction.In  we preseFig. Fig. The dimensions of the damage zone, which may be considered the target goal of the simulation, can be calculated directly by producing grided axes in all the 3D and 2D results as well as with routines written especially for this aim.Fig. Fig. 2, while our model shows a damaged zone of 2.1*1.45 cm2. We obtain calculation errors of 5% in the x-axis parallel to the blood vessel, and of 20% in the y-direction perpendicular to the vessel. This deviation happens mainly due to inaccurate optical properties values.Fig. To date most simulation models of LITT have used the Monte-Carlo method (MC) to calculate the light distribution, then combine its results with Finite Difference method (FDM) to calculate the heat distribution. Because of its formulation, this combination fits very well for a radially symmetric problem. A weakness arises, however, when dealing with asymmetric volumes in real human anatomy. Arbitrarily curved surfaces separate the different tissues. Consequently, calculations from the FDM becomes so complex that errors start to appear in the results presented stemming from the dependency of FDM on dividing the volume into voxels. One way to overcome this is to increase the voxels' number. Indeed, this leads to less error at the tissue-separating surfaces, although it increases the resources and calculation steps, making the procedure inconvenient. In principle, combining MC and FEM (instead of FDM) is possible theoretically, and seems to be promising as it overcomes the latter problems, but to our knowledge has not implemented yet. From another perspective, MC solution converges to the exact solution of the transport equation only when the number of traced photons increases infinitely ,21, whicBecause we are dealing with an asymmetric geometry, we chose the FEM. It allows us to define and refine the mesh in the volume of interest in order to obtain more precise results. Furthermore, using a FEM mesh we are able to adapt individually the mesh for each patient's dataset. Never the less, it was not necessary to combine methods, FEM is used for all equations.The model we propose depends on the following considerations:\u2022 The coupling of a set of time-dependent equations, which simulate the whole process of the LITT treatment Fig. . The set\u2022 We consider the functional dependence of the various tissue properties at the various spatial and temporal points, according either to the tissue type, or temperature, or the damage value \u2013 or even a combination thereof.\u2022 We take into account the irreversible changes in the tissue stemming from the treatment as they directly affect the solution of the set of equations.Our model remains a mathematical model, meaning errors could appear from the considerations and simplifications made to realize it. Generally, such errors appear because of the following reasons:\u2022 The inaccuracy of the optical, thermal, and damage properties are main point in the model's set of equations. In fact, these properties play a key role in the accuracy of the model's results. Many methods have been presented to calculate these properties ,19,21, b\u2022 An error appears because of machine performance limitations: The available memory limits the number of mesh nodes and the degrees of freedom (DOF) used to build the model. This causes a deviation from an otherwise accurate result . On the \u2022 Absolute tolerance: All numerical methods have an allowed error (absolute tolerance) that reflects the criterion of the convergence. Normally, different solvers use different tolerances. In our model we used the FEMLAB's default tolerance value of 0.01 which leads to a final error of 1%, considered as a reasonable value for modelling.One way to follow these errors and deviations from a real treatment result is to estimate them and to eliminate their effects from the final results of the model. This can be realized and implemented in the model by adding an error-correcting factor from the first degree (or even higher) in the set of equations correcting the result of each equation at each time step. These corrective factors should be measured practically by comparing the results of the model and the results from real experiments on test tissues or probes.\u03bca for both native and coagulated different biological tissues are close. Baring that in mind, and knowing that the value of the scattering coefficient \u03bcs becomes normally, for biological tissue, 10 times greater than its starting value, i.e. native state, we can judge that as soon as the damage zone appears and the moving from native to coagulated state according to eq. 11, eq. 12, and eq. 13 the deviation in the calculations will increase as well.Our experiment shows a deviation of 5% in x-direction and 20% in y-direction. As the main reason for this deviation we propose inaccurate values for the optical tissue properties. Fig. Thus, accurate values of the different tissue properties, and especially the optical properties are key points in obtaining realistic results from the simulation. One promising technique for determination of optical properties was presented by Dam et al. . There mFinally, beside the error obtained from the optical properties, which affect all directions, both cutting the tissue with scalpel and the opening induced a tissue movement. This movement is a reason for deviation, especially in y-direction, as we perform the cutting in this direction.For several years now LITT has been a well-known and approved therapy system for tumour ablation in the liver and some other anatomical regions. Minimally invasive LITT procedures use a Nd:YAG 1064 nm laser. Therapy planning, however, remains unsolved and is still a challenging issue. Today's simulations are based on symmetric geometries. Without exact therapy planning systems, the usage of LITT is limited to homogeneous tissues or the respective surgeon's experience.The finite element technique proposed in this paper can overcome both limitations. We propose a model to validate in the future the LITT method in other anatomic regions.The model enables the efficient simulation for predicting the damaged zone induced with the diffuser of the LITT. The simulation is performed for tissue ablation near vessels, though obviously FEM is not limited to this. Exemplarily, we implemented the model for tissue ablation near the carotid artery in the neck region using an approximation for the artery shape. We describe the bases necessary to calculate the effects of the temperature rise caused by the absorption of light energy in the tissue, using the bioheat equation and including the cooling effects of vessel blood flow and micro-perfusion in tissue in order to determine the extent of thermal damage. The shape of the carotid artery is derived from a real segmented geometry based on, but not limited to, 3D ultrasound.Experimentally, we performed a laser irradiation in a porcine muscle tissue sample. The results of our model diverge between 5% to 20% from the lesion obtained in the experimental work. From the authors' point of view two major reasons can be identified. The lack of accurate data describing the thermal and optical properties leads definitely to deviations. Furthermore the cut of the probe with scalpel induces a certain tissue shift, especially in the y-direction.Anyhow, more experiments with different conditions are necessary to be able to carry out a statistical study and find the exact origin of the deviation, and, if necessary, define an error correction factors and add them to equation set. But that does not set aside the desire of accurate values for the properties of the tissue.From another hand, still our model practical, it presents a step in using segmented data as basis for much more detailed surgical therapy planning. Combining LITT and adequate planning system could increase both the anatomical application range and the quality of therapy procedures.Animated gif file, the Geometry. The animated gif shows the 3D ultrasound volume together with the carotid artery segmented using 3D Slicer software [software . The movClick here for fileAnimated gif file, The heat distribution and the damage zone in the volume. The video stream demonstrates the temperature rise inside the tissue. The video stream shows where, how, and when this damage appears. The damage zone is shown in grey colour. The gif file can be played using the internet browser.Click here for file"}
+{"text": "Investigation of bioheat transfer problems requires the evaluation of temporal and spatial distributions of temperature. This class of problems has been traditionally addressed using the Pennes bioheat equation. Transport of heat by conduction, and by temperature-dependent, spatially heterogeneous blood perfusion is modeled here using a transport lattice approach.We represent heat transport processes by using a lattice that represents the Pennes bioheat equation in perfused tissues, and diffusion in nonperfused regions. The three layer skin model has a nonperfused viable epidermis, and deeper regions of dermis and subcutaneous tissue with perfusion that is constant or temperature-dependent. Two cases are considered: (1) surface contact heating and (2) spatially distributed heating. The model is relevant to the prediction of the transient and steady state temperature rise for different methods of power deposition within the skin. Accumulated thermal damage is estimated by using an Arrhenius type rate equation at locations where viable tissue temperature exceeds 42\u00b0C. Prediction of spatial temperature distributions is also illustrated with a two-dimensional model of skin created from a histological image.The transport lattice approach was validated by comparison with an analytical solution for a slab with homogeneous thermal properties and spatially distributed uniform sink held at constant temperatures at the ends. For typical transcutaneous blood gas sensing conditions the estimated damage is small, even with prolonged skin contact to a 45\u00b0C surface. Spatial heterogeneity in skin thermal properties leads to a non-uniform temperature distribution during a 10 GHz electromagnetic field exposure. A realistic two-dimensional model of the skin shows that tissue heterogeneity does not lead to a significant local temperature increase when heated by a hot wire tip.The heat transport system model of the skin was solved by exploiting the mathematical analogy between local thermal models and local electrical (charge transport) models, thereby allowing robust, circuit simulation software to obtain solutions to Kirchhoff's laws for the system model. Transport lattices allow systematic introduction of realistic geometry and spatially heterogeneous heat transport mechanisms. Local representations for both simple, passive functions and more complex local models can be easily and intuitively included into the system model of a tissue. Heat transfer in biological systems is relevant in many diagnostic and therapeutic applications that involve changes in temperature. For example, in hyperthermia the tissue temperature is elevated to 42\u201343\u00b0C using microwave ,2, ultraContact heating is used in transcutaneous blood gas monitoring, in which oxygen is transported out of the vasodilated capillary bed to a surface mounted oxygen sensor. Heating is used to achieve vasodilation. In 1851 it was already known that \"skin breathing\" occurs, in which oxygen diffuses out of ambient air into the body, supplying of order 1% of the body's oxygen uptake . TypicalInitial clinical demonstration with neonates occurred in 1969 when a polarographic electrode placed on the head was used to measure oxygen partial pressure . Since tSpatially distributed heating of skin and deeper tissue by electromagnetic fields and ultrasound is also of established interest -20. MicrIn hyperthermia, tissue is heated to enhance the effect of conventional radio- or chemotherapy. By delivering thermal energy, the tissue is stimulated to increase the blood flow by thermoregulation in order to remove the excess heat. The common method to produce local heating in the human body is the use of electromagnetic waves.\u03c9 . Alternatively, \u03c9 can be replaced by \u03c9m, the nondirectional mass flow associated with perfusion. Perfusion is valid on the spatial scale of ~100 \u03bcm. The contributions of heat conduction and perfusion are combined in the Pennes bioheat equation  exposure ).-2 10 GHz pulse for 3 s. The layer of air farthest from the skin was set at 25\u00b0C and the core (2 cm below the surface) was set to 37\u00b0C. This resulted in the skin/air interface having a steady-state temperature of 34\u00b0C before the microwave exposure. The skin/air interface has a power transmission coefficient (|Tsa|2Re{Za/Ze}) of 0.49 at 10 GHz. Applying 10 GHz microwave results in an essentially linear rise in temperature, in agreement with prediction using other methods. When the input power level is less than 5 W cm-2, the peak surface temperature is less than 42\u00b0C. When the microwave exposure is turned off, relaxation of the skin temperature occurs over a time scale of several seconds. Onset of tissue damage occurs when the local tissue temperature reaches 42\u00b0C. The distribution of tissue damage with depth is shown for different power densities  with a hot tip that is inserted into the epidermis is also modeled. The model assumes that the tip of the metal wire  is enclosed in a thermally insulating material . The skin model contains stratum corneum, epidermis and dermis. As before, the core temperature (37\u00b0C) is fixed at 2 cm from the skin surface by extending the subcutaneous layer. Before heating the wire conducts heat outwardly to the air, consistent with the isotherms. The temperature at the hot wire tip is increased to 45\u00b0C at t = 10 s. The temperature contours at different time points is shown in Fig. The use of transport lattice approach for predicting heat transport in spatially heterogeneous structures is further illustrated with a two-dimensional model of the skin. The model is derived from an image of a histological section of skin Fig. . The temin vivo and in vitro studies have shown that the tissue response to heat stress is strongly temperature-dependent [Both ependent ,64,65. Wependent . In ordeAs shown in Fig. et al. [et al. [A more comprehensive non-linear temperature dependent perfusion model has been applied in modeling hyperthermia. Tompkins et al.  used tem [et al.  employedWe present a modular approach to modeling in which the skin is represented by three homogeneous layers, each with many interconnected local, steady state models that account for the local heat storage (heat capacity), local heat dissipation  and local transport by both conduction and perfusion Fig. . The exiAs shown in Fig. Prolonged exposure to elevated temperatures can cause tissue damage by, for example, protein alteration or denaturation, often followed by recognizable changes in the optical properties of tissue . The ratWhen skin is exposed to a 10 GHz pulse of 3 s duration, the tissue damage indicator near the skin surface may be as high as 0.08, which suggests some damage at high power levels Fig. . This exTransport of heat by conduction, and by temperature-dependent, spatially heterogeneous blood perfusion, is predicted using a transport lattice model. This approach uses interconnected, local, steady state models for transport and storage, to together represent the Pennes bioheat equation. The thermal system model of the skin was solved by exploiting the mathematical analogy between local thermal models and local electrical (charge transport) models, thereby allowing robust, circuit simulation software to obtain solutions to Kirchhoff's laws for the system model. The skin model has a nonperfused viable epidermis, and deeper regions of dermis and subcutaneous tissue with perfusion that was constant or temperature-dependent. Spatially distributed heating and surface heating cases were considered. Accumulated thermal damage was estimated by using an Arrhenius type relation at locations where viable tissue temperature exceeds 42\u00b0C. Prediction of spatial temperature distributions was also illustrated with a two-dimensional model of skin created from an image. Validation of the transport lattice approach using experimental data is necessary for practical application of this method.TRG constructed and solved the several transport lattice models and wrote much of the manuscript. DAS computed the reflected and transmitted power in the skin layers, contributed to construction and solution of the models, and to writing of the manuscript. GTM provided guidance and advice with respect to thermal modeling, and helped write the manuscript. JCW conceived the local transport lattice model for solving the bioheat equation, provided overall guidance and helped with interpretation of results and writing the manuscript. All authors read the final manuscript."}
+{"text": "Temperature is a frequently used parameter to describe the predicted size of lesions computed by computational models. In many cases, however, temperature correlates poorly with lesion size. Although many studies have been conducted to characterize the relationship between time-temperature exposure of tissue heating to cell damage, to date these relationships have not been employed in a finite element model.We present an axisymmetric two-dimensional finite element model that calculates cell damage in tissues and compare lesion sizes using common tissue damage and iso-temperature contour definitions. The model accounts for both temperature-dependent changes in the electrical conductivity of tissue as well as tissue damage-dependent changes in local tissue perfusion. The data is validated using excised porcine liver tissues.The data demonstrate the size of thermal lesions is grossly overestimated when calculated using traditional temperature isocontours of 42\u00b0C and 47\u00b0C. The computational model results predicted lesion dimensions that were within 5% of the experimental measurements.When modeling radiofrequency ablation problems, temperature isotherms may not be representative of actual tissue damage patterns. The mitigation of primary and metastatic tumors by radiofrequency ablation is a developing research area. The goal of ablation is to necrose treatment volumes by raising the temperature of targeted tissues. Ablation probes are inserted percutaneously, laparoscopically, or during surgery into cancerous tumors. Once positioned, high frequency alternating current (450\u2013550 kHz) is delivered through an uninsulated electrode into the surrounding tissues to a dispersive ground pad that is applied to the patient. The electromagnetic energy is converted to heat by resistive heating.While the usage of radiofrequency ablation devices is well established, efforts to optimize treatment strategies are ongoing. An important consideration in optimizing ablation is determining what treatment volumes are necessary and acceptable. In liver ablation, for example, treatment volumes generally extend a centimeter beyond the dimensions of a tumor -3. Sincein vitro and in vivo in animal models show wide variations, since many of the key parameters (i.e. tissue perfusion) cannot be controlled  = 0 \u00a0\u00a0\u00a0 (Eq.1)\u2207\u00b7} \u00a0\u00a0\u00a0 (Eq.4)- 6.584 \u00d7 10whereN) = N [10.394-2.3776 N + 0.68258 N2 - 9.13538 N3 + 1.0086 \u00d7 10-2 N4]\u03c3 . The thermal properties of liver used in the model were acquired from Tungjitkusolmun et al.[;N is the normality of an electrically equivalent sodium chloride solution, un et al. and Duckun et al..o) is applied to the conducting tip of the ablation probe. The outer surface of the model serves as an electrical ground return (V = 0). An electrically insulating boundary condition is applied to the non-conducting portions of the probe such that n\u00b7(\u03c3\u2207 V) = 0; where n is the unit vector normal to the surface, \u03c3 is the electrical conductivity, and V is the voltage at the insulating surface. A thermal boundary condition of T = Tamb is applied to the outer surfaces of the model to simulate ambient temperature. Since the thermal mass of the probe is small compared to the surrounding tissue, we assumed that heat conduction into the probe itself was minimal. Thus, all other surfaces of the ablation probe are considered to have a thermally insulating boundary condition such that n\u00b7(k \u2207 T) = 0.A source voltage  and Matlab  to calculate temperature and tissue damage. While conventional finite element models effectively solve field solutions using a nonuniform geometrical mesh, tissue exposure calculations are integrated at each point in the model over the course of ablation and are more easily calculated using uniform rectilinear grids. As shown in Figure -3 cubic meters of blood/ cubic meter of tissue/ second) [Given the axial symmetry of the problem, we used a 2D-axisymmetric mesh consisting of 13,641 nodes and 26,880 elements. The Femlab 'Fldaspk' ordinary differential equation solver was used to achieve convergence. This is a robust variant of the traditional ODE15s stiff differential equation solver used in solving finite element problems in Matlab. Ablations were simulated at source voltages of 0, 2.5, 5, 7.5, 10, 12.5, 15, 17.5, 20, 22.5, 25, 27.5, and 30 volts. For each of the source voltages, we varied the initial level of tissue perfusion at 0%, 20%, 40%, 60%, 80%, and 100% normal tissue perfusion (6.4 \u00d7 10 second) . AmbientTo validate the computational model, experimental measurements were made in 6 freshly excised porcine liver sections. A single needle ablation probe with a 2 cm uninsulated tip was inserted 3 cm into each liver tissue. Since commercial RF ablation generators operate using either constant temperature or constant power feedback algorithms, an experimental constant voltage RF generator 500 kHz) was used 00 kHz wa,59. ThisComputational model calculations were made at 20, 25, and 30 volts following the same experimental protocol. Ambient temperature for these calculations was 22\u00b0C instead of the 37\u00b0C temperature used in the main simulations. The calculated lesion sizes were directly compared with the measurements in tissue.Table -3 mb3/ mt3/s), the electrical conductivity changes as much as 260% using a 30 volt source. The electrical conductivity is indirectly a function of tissue perfusion since tissue perfusion is zero in the necrosed treatment volume. Tissue perfusion lowers the tissue temperature outside the treatment volume which helps to conduct heat away from temperatures within the ablated area..Table 2, where \u03c3 is the electrical conductivity, \u03c1 is the tissue density, and |E| is the magnitude of the electric field. The data shows that the SAR is highest with increasing source voltage with no tissue perfusion. Initially, this seems counterintuitive as one would expect a higher maximum SAR for perfused flows, where a greater amount of power is needed to compensate for the convective heat loss. This observation can be explained by the large changes in the electrical conductivity (Table Table 2), whereas cell damage exhibits an S-shaped curve. Figure Figure Figure Figure A comparison of lesion volumes with no tissue perfusion computed using 63% and 100% iso-damage threshold contours and 42\u00b0C, 47\u00b0C, 60\u00b0C, and 90\u00b0C isothermal contours is presented for the cases of no tissue perfusion Table . The senTable To validate the computational model, ablation experiments were performed at room temperature (22\u00b0C) in excised porcine liver tissue using 20, 25, and 30 volt constant voltage radiofrequency sources (500 kHz). Ablations were made for a 15 minute exposure time. Figure To date, several computational studies have been performed to described the rate of lesion growth in radiofrequency ablation applications. In many cases, these studies use surrogate endpoints such as temperature isotherms and thermal dosing to calculate equivalent expressions for lesion size. While many models exists that account for far-more elaborate parameters such as tissue perfusion through large blood vessels, the interpretation of such models is difficult since most do not account for transient changes in tissue properties and often report tissue temperature only ,56,57,60In this study, we created a computational simulation that tested some of the basic assumptions made in modeling lesion growth problems. We developed a model where tissue perfusion and the electrical conductivity are allowed to vary at each time step and spatial position as a function of tissue damage and temperature. These simulations are significantly more time-consuming since gross simplifications to heating mechanisms are not made. Although our model geometry is simpler than others that appear in the literature, we chose to ignore large vessels since their position and impact are highly variable. We chose a simpler geometry so that the impact of damage-dependent tissue perfusion and temperature-dependent electrical conductivity could be assessed more directly.The damage-dependent tissue perfusion accounts for physiological observations of tissue coagulation and local cessation of blood flow. Unlike thermal dosing, where thermal injury is calculated globally over the entire duration of an ablation, tissue damage is calculated at every time step. The intermediate tissue damage that results at every timestep influences the local tissue perfusion and creates a moving boundary condition which changes the local heat sink properties. Ignoring the intermediate timesteps causes tissue perfusion to remain constant throughout the entire ablation, which results in an underestimation of the true lesion size. The use of temperature-dependent electrical conductivity greatly affects modeling results, as the electrical conductivity has been shown to increase dramatically over the course of tissue heating . When coAn important outcome of this study is the demonstration that, temperature isotherms and tissue damage patterns are not synonymous. Traditional use of temperature isotherms that are used to define lesion size rely on coagulation temperature for protein (42\u201347\u00b0C) and grossly overestimate lesion dimensions. Our studies show that temperature decrease is gradual, while tissue damage decreases rapidly as a function of distance. It is this sharp decrease in tissue damage that causes lesion boundaries to appear fuzzy, as predicted by our model. The results also demonstrate that ablation lesions continue to grow after the applied power is terminated. Lesions continue to grow while temperature envelopes collapse after ablation since sufficiently high temperature are present to accrue tissue damage. In nearly all cases, lesions continued to grow several minutes following the ablation. A comparison of the resulting lesion dimensions between fully perfused and non-perfused tissues show that the lesion width decreases 38\u201346% and the lesion depth decreases 18\u201320% when tissue perfusion is accounted for in the model. Previous studies have shown that tissue perfusion can account for as much as 50% change in the size of the lesions generated during ablation .An important observation in this study is the resemblance of the 60\u00b0C isocontour to lesion size. While the 42\u00b0C and the 47\u00b0C isotemperature contours are poor indicators of lesion size, 60\u00b0C is highly correlated with the lesion volumes. Seemingly, this would suggest that time-intensive tissue damage calculations need not be made since a critical temperature of 60\u00b0C can be used to identify lesion size. However, this is only true if the calculated temperature is a function of both transient changes in tissue perfusion and the electrical conductivity. In the absence of either of these phenomena, lesion sizes calculated at 60\u00b0C would underestimate lesion size.The validation data demonstrate that the model accurately accounts for the behavior of lesion growth in tissue. There are, however, a few limitations to this model. First, it is well established that temperature elevation of tissues results in the denaturing of proteins, which may drastically change the electrical conductivity of tissue in a nonlinear fashion ,57. PrelA second limitation in our model is that it is only valid for temperatures below 100\u00b0C. At temperatures above 100\u00b0C, tissues begin to boil and generate gas. When this occurs, some of the energy that contributes to temperature increase is used to change the water content of tissues into gas. At substantially higher temperatures, the composition of gas may be highly complex as tissue begins to burn and break down. Although gas generation is commonly seen in clinical use of radiofrequency ablation, impedance rises due to tissue charring limit the progressive rise in temperature. The complexity of multi-phasic ablation was beyond the scope of this study.The mention of commercial products, their sources, or their use in connection with material reported herein is not to be construed as either an actual or implied endorsement of such products by the Department of Health and Human Services."}
+{"text": "In 2001 the Intergovernmental Panel on Climate Change  concluded that climate is changing, humans are contributing, weather has become more extreme, and biological systems on all continents and in the oceans are responding to the warming. From the fourth IPCC assessment  and the Arctic Climate Impact Assessment (ACIA 2004), we now know that the deep oceans have accumulated 22 times more heat than has the atmosphere, ice melt is accelerating, wind patterns are shifting (that\u2019s particularly ominous), and nonlinear surprises are very likely in store for the climate system and for the impacts on systems such as forests and coral reefs . The implications for public health and well-being are daunting, as illustrated in articles throughout this month\u2019s Environews section.With weather turbulence turning heads on Wall Street, an emerging evangelical voice calling for \u201ccreation care,\u201d the specter of \u201cpeak oil,\u201d and a barrage of energy bills mounting Capitol Hill (the U.S. Congress), we appear to be on the verge of really taking the first steps toward confronting our energy budget. The goal of stabilizing atmospheric concentrations of greenhouse gases requires a 60\u201380% reduction of emissions over the coming few decades.What follows are some considerations for crafting a comprehensive plan and some financial and policy instruments for implementation. Comparing life-cycle costs\u2014the health, ecologic, and economic dimension\u2014of proposed solutions can help differentiate safe solutions from those warranting further study, and from those with risks prohibiting wide-scale adoption. Solutions meeting multiple goals merit high ratings.Energy conservation (demand side management) is clearly the first place to start. \u201cSmart\u201d urban growth; a smart grid (with optimizing meters and switches); hybrid vehicles; heat capture from utilities or \u201ccogeneration\u201d (two-thirds of produced energy is lost as heat); \u201cgreen buildings\u201d; and walking, biking, and improving public transport can get us halfway there\u2014and save money.Distributed generation (DG)\u2014power produced near the point of use\u2014with solar, wind, wave, geothermal heat pumps, and fuel cells can be fed into grids where they exist and, via \u201cnet metering\u201d regulations, generate income for the individual producer. Where energy is scarce and grids are few, stand-alone systems\u2014augmented with human power and stored in improved batteries\u2014can pump water, irrigate fields, power clinics, light homes, cook food, and drive development. Clean DG also improves resilience in the face of more weather extremes , reduces carbon emissions , stimulates green industries, and creates jobs.Biofuels hold a great deal of promise. However, converting corn to ethanol means less corn for animals and us, and may yield no net energy gain. Sugar ferments without adding energy (yeast suffices). But large plantations can deplete soils and groundwater and, in the Amazon, sugar for alcohol is pushing land clearing for soybean production deeper into the rainforest. In Indonesia, monoculture plantations of trees that produce palm oil are transforming and degrading vast swaths of prime forest, setting the stage for spreading fires and releasing biologically stored carbon from trees and peat. Cellulosic conversion of range grasses by microbe-generated enzymes may work, but land considerations still hold; recycling farm waste and garbage may yield the best results overall.Building green buildings with healthy surroundings will create a critical syzygy, aligning clean energy production with sustainable forestry  and green chemistry .2) can be separated from natural gas or methane (CH4) to use in fuel cells.While it is unrealistic to think we can meet all of our energy needs without some fossil fuel use, natural gas is the cleanest burning and may be the best back-up source during the transition. Also, hydrogen gas . Financial institutions  often have the longest time-line perspectives. Finance can be thought of as the central nervous system of the global economy: It is feeling the pain of huge losses from weather extremes, with insured losses rising from $400 million a year in the 1980s to $83 billion in 2005 (Epstein and Mills 2005), and they are cogitating on their response. Enlightened, self-interested actions of investors and insurers\u2014through requirements for loans, influence on building codes, and reduced premiums for proactive directors and officers of firms, for example\u2014could ripple through the entire global economy.Governments must provide the incentives and create the infrastructure for the new economy. Credits for \u201cclean tech\u201d industries, progressive procurement practices , and tax benefits for commercial models that defray upfront capital costs are among the incentives needed to launch infant industries and drive market shifts. Aligning rules, regulations, and rewards\u2014and dismantling the enormous financial and bureaucratic disincentives\u2014can help erect the necessary scaffolding for the low carbon economy.Finally, the United States must sign the Kyoto Protocol (United Nations 1998). Under its umbrella, we can help create a substantive global fund for adaptation and mitigation that can make the clean energy transition a \u201cwin\u2013win\u2013win\u201d for energy, the environment, and the global economy."}
+{"text": "Just past its 50th birthday, commercial nuclear energy is experiencing a tentative rejuvenation that could result in a greater role as a global source of electricity. Skeptics still harbor many of the objections that have slowed or stopped the construction of new nuclear power plants, but rising concerns about the cost and security of energy supplies and global climate change have reframed the debate in terms more favorable for nuclear power advocates.As a result, the question of whether governments should encourage the construction of new nuclear power plants is no longer off the table in developed countries such as Australia, the United Kingdom, and the United States. For other developed countries such as France and Japan, and for countries with fast-growing economies such as China and India, nuclear energy has remained a central component of energy policy. For example, to achieve its goal of generating 4% of electricity from nuclear power, China plans to add more than 30 new nuclear plants by 2020 to the 11 currently in operation or under construction. India\u2019s goal is to supply 25% of its electricity from nuclear power by 2050.Worldwide there are now 440 nuclear power reactors operating in 31 countries and producing a combined capacity of 367 gigawatts electric, or about 16% of the world\u2019s supply of electricity. The Vienna-based International Atomic Energy Agency (IAEA)\u2014the agency of the United Nations chartered to promote cooperation on nuclear issues\u2014estimates that at least 60 new nuclear plants will be constructed in the next 15 years. Given the world\u2019s growing demand for electricity, however, this added capacity will still account for only 17% of global electricity use.One central issue facing policy makers and electric utilities is the question of how to meet the rapidly growing worldwide demand for electricity while not increasing global greenhouse gas emissions. The U.S. Department of Energy\u2019s Energy Information Administration tracks world energy trends and projects a 75% increase in global electricity use between 2000 and 2020. By 2050 a tripling of use is probable. Electricity production currently is responsible for an estimated one-third of all greenhouse gas emissions.In terms of human welfare, this growth in electricity usage is desirable as reflected in the strong correlation between electricity consumption per capita and the United Nations\u2019 human development index, which combines indicators of health, education, and economic prosperity. Overall energy consumption per capita in the developing world is less than one-fifth that in the developed world, and as developing countries industrialize, they will tend to seek the least expensive supply to meet their electricity needs. In most cases this means coal-fired plants, which produce significantly more greenhouse gases\u2014primarily carbon dioxide\u2014than other carbon-based sources such as natural gas\u2013fired generators. Nuclear and noncarbon-based renewable sources such as wind and solar power do not directly create greenhouse gases.Global climate change and the 2005 entry into force of the Kyoto Protocol to the United Nations Framework Convention on Climate Change have spurred new thinking about the potential value of nuclear energy by both environmental groups and the nuclear energy industry. Recently, several prominent environmentalists have publicly supported nuclear energy, including former Anglican bishop Hugh Montefiore, a long-time trustee of Friends of the Earth, and Patrick Moore, cofounder of Greenpeace.Their support has alienated them from many in their former organizations, but indicates a more nuanced challenge to nuclear energy by some environmental activists, who are perhaps more willing to consider the nuclear option but still do not think it\u2019s the wisest choice. Organizations such as the Natural Resources Defense Council and the Union of Concerned Scientists now talk in terms of the proper role of government in energy policy and ensuring the safe operation of nuclear plants, rather than whether nuclear power should even be considered.The potential for building new nuclear power plants is quite different in different countries. For example, the role of nuclear power is unlikely to change substantially in countries with a flat demand for electricity, such as Japan, which now relies on nuclear power for 30% of its electric capacity and expects to see a population decline, or France, with a stable population and a power industry that is 80% nuclear. On the other hand, the United States, which currently operates 103 nuclear power plants and relies on nuclear energy for 20% of its electricity, expects to see a rising population and consequent greater demand. Developing countries offer the potential for considerably more use of nuclear power, especially as much of their populations will be urban, providing a concentrated market for large electric-generating plants.So in answer to the question of whether nuclear power makes economic sense, it simply depends\u2014\u201cin some countries it does, in others it does not,\u201d says Alan McDonald, a staff expert in planning and economic studies at the IAEA. \u201cIn countries like China and India, you need [every source of power] you can get. Asia has major pollution problems and energy needs. Sometimes it seems to be a matter of national preferences. In countries like Austria and Denmark, nuclear power is anathema; in others like Germany, opinions may be changing. In the United States, Wall Street is very skeptical and will watch developments closely.\u201dRelative costs of nuclear energy vary depending on what options and factors are being considered, but in general, McDonald says, the up-front costs of nuclear energy are very high while the cost of operation is relatively low. Thus, countries with government-owned electric utilities have an advantage in new power plant construction because they can fund investments more easily than investor-owned utilities, which are subject to the capital markets and the demand for rapid returns on investments.\u201cUntil the Kyoto Protocol, the environmental value of nuclear energy could not be translated into financial terms,\u201d says McDonald. \u201cBut now, obtaining greenhouse gas emission permits for a new coal-fired plant in Europe can cost more than the coal itself. Although the United States is not bound by Kyoto, U.S. investors may see the writing on the wall. If the treaty is changed and nuclear power becomes part of the international market mechanism that allows credit for clean energy sources and the trading of carbon emission credits, that would be a big incentive.\u201dBut more nuclear power doesn\u2019t come without potential security threats of another sort. \u201cIf the world sees a big increase in nuclear energy, there will be an increased risk of [nuclear arms] proliferation\u2014all things being equal,\u201d McDonald notes. Indeed, the director general of the IAEA, Mohamed ElBaradei, says that recent revelations about undeclared uranium enrichment activities and reprocessing of spent fuel, along with the discovery of an international illicit market in nuclear technologies, underlines the need for improved controls. On 7 October 2005 ElBaradei and the IAEA were awarded the 2005 Nobel Peace Prize for their efforts to stop the spread of nuclear weapons and prevent North Korea and Iran from acquiring nuclear arms.In response to the threat of proliferation, the IAEA has developed a model Additional Protocol that signatories can add to their IAEA Safeguards Agreements, which address questions of traceability and verification of nuclear materials. The Additional Protocol strengthens safeguards, protects nuclear materials and facilities, and bolsters the systems of nuclear export controls. So far more than 100 countries have added the protocol to their agreements. The IAEA further proposes that future reactor technologies be designed to be more resistant to proliferation, and that the international enrichment and reprocessing of nuclear fuel be centralized in a few countries under a structure that guarantees supply to member nations.The question of whether nuclear energy should play a significant role in future electric power generation cannot be separated from its history, the role played by governments, or the nuclear fuel cycle itself. The cycle has always been a focus of concern, from the potential hazards of uranium mining operations, through the processing of uranium into fuel, to the controlled fission process in the reactor core, and finally to the disposal or reprocessing of the fuel and related waste products.The civilian nuclear power industry was created through U.S. government\u2013electric utility industry cooperation that officially began with the Atomic Energy Act of 1954. Until that point, all U.S. atomic energy resources had been devoted to military activities. President Dwight Eisenhower\u2019s \u201cAtoms for Peace\u201d speech to the United Nations in December 1953 led to the U.S. government\u2019s financial and technical support of commercial nuclear energy. The government also enacted the Price-Anderson Act of 1957, requiring nuclear power operators to carry the maximum insurance offered by private insurance companies but also limiting their liability\u2014a stipulation demanded by the utility companies before they would invest in building nuclear power plants.The U.S. Navy first developed the now widely used pressurized-water reactor for propulsion in submarines. This design became the basis for the first commercial nuclear plant at Shippingport, Pennsylvania, which began operation in 1957. In the Soviet Union, reactors designed for producing plutonium for weapons were modified and new ones developed to generate heat and electricity. The first such reactor began producing electricity for the city of Obninsk in 1954.The fostering of nuclear energy was woven into many U.S. foreign policy initiatives during the early days of the Cold War. The United States sponsored the creation of the IAEA as the global manager of nuclear technology and materials, it supported international research reactors and isotopes for nuclear medicine and agriculture, and it helped create a nuclear energy industry in Europe, where coal production was declining and other sources of electric power were limited.The U.S. commercial nuclear power industry flourished from the mid-1960s through the early 1970s, although the power plants operating then were not economical compared to other sources at the time. Nuclear energy advocates argued that, with moderate and selective government assistance, the technology could cross the economic threshold into widespread acceptance by the utility industry. The U.S. Atomic Energy Commission\u2014which then combined the functions of today\u2019s Nuclear Regulatory Commission (NRC) and Department of Energy\u2014estimated that the United States would exhaust its oil and coal supplies within 100 years and that nuclear energy was the best replacement for fossil fuels in electricity production. The commission optimistically estimated that by 2000 as much as two-thirds of the nation\u2019s electric power could come from nuclear energy.The peak year for achieving this scenario in the United States was 1973, when 50 orders were placed for new nuclear plants, although in the following years leading up to 1979, cancellations began to exceed new orders. Then, in March 1979, a series of operator errors and miscommunications led to the partial core meltdown in the pressurized-water reactor at Three Mile Island Unit 2. The accident did not result in major damage outside of the core and primary cooling system, and according to all official estimates, the radiation released during the accident was minimal, well below levels that have been associated with health effects from radiation exposure. However, a panicked evacuation of nearby residents took place, followed by extensive investigations and a government-subsidized 10-year cleanup effort. The notoriety of the accident, combined with the high cost of construction, slow regulatory processes, and political opposition, essentially halted the growth of the U.S. nuclear industry. Although numerous nuclear power plants that had been under construction at the time eventually came online, no new U.S. plants were ordered.The devastating accident at Chernobyl Unit 4 in April 1986 could have been the death knell of the industry worldwide. The steam explosion, fire, and nuclear fuel melting at the site were the result of a flawed reactor design operated by inadequately trained personnel who violated safety procedures. The reactor design widely used for nuclear power in the Soviet Union did not include the containment system used with most Western reactors, and so substantial quantities of radioactive material, dust, and gases escaped into the atmosphere.Chernobyl\u2019s Legacy: Health, Environmental, and Socio-Economic Impacts and Recommendations to the Governments of Belarus, the Russian Federation, and Ukraine, estimates that around 4,000 people have died or will die as the result of exposure related to the accident. The report observes that \u201cmental health is the largest public health problem created by the accident,\u201d referring to affected residents\u2019 subsequent poverty, substance abuse problems, and \u201cparalyzing fatalism,\u201d manifested as negative self-assessments of health, belief in a shortened life expectancy, lack of initiative, and dependency on assistance from the state.The Chernobyl site is now entombed in a concrete structure known as the Sarcophagus, but it is not stable for the long term and is not air-or watertight . The accident was a deeply traumatic experience for the 350,000 people who relocated from the area. A 30-square-kilometer area around the site remains closed because of high levels of contamination. About 50 people were killed in the initial accident and emergency response. A September 2005 IAEA report, Even with the resulting public outcry against nuclear power, the world did not halt new construction of nuclear power plants. However, some European countries such as Belgium, Germany, and Sweden began to reconsider their plans for nuclear energy, and eventually developed policies to phase out existing plants. Now some of these countries are under the gun to find replacement energy sources. Sweden, for example, aims to be nuclear-free by 2010, having taken a second reactor offline in June 2005 (the first was closed in 1999). But the remaining 10 plants still supply about half of Sweden\u2019s domestic energy production, according to the World Nuclear Association.The Future of Nuclear Power: An Interdisciplinary MIT Study, spelled out the major areas of concern surrounding nuclear energy and proposed a plan that the authors hoped would allow the United States to resume development of nuclear power in order to reduce greenhouse gas emissions. The study identified the four critical problems that must be overcome for nuclear power to succeed\u2014cost, safety, waste, and proliferation. It also offered policy recommendations for making the nuclear energy option commercially viable, including steps to lower cost and a limited production tax credit to \u201cfirst movers,\u201d private sector investors who build and then operate new nuclear plants.An influential 2003 report out of the Massachusetts Institute of Technology (MIT), \u201cOur recommendations are basically holding up,\u201d says study cochair Ernest Moniz, who is codirector of MIT\u2019s Laboratory for Energy and the Environment and former undersecretary for energy during the Clinton administration. \u201cOn the positive side, new regulatory approaches are being developed, the industry\u2019s intent is to build a new reactor, there are more open discussions with environmental groups, and the Energy Policy Act became law,\u201d he says. \u201cOn the negative side, the situation with spent fuel management is worse\u2014Yucca Mountain casts a shadow over any decision. And the non-proliferation situation in Iran is a real problem.\u201dThe fate of Nevada\u2019s Yucca Mountain nuclear burial site is unclear. In the face of sustained resistance from the state and citizens groups, the federal government has slowed in its effort to build a long-term geological repository for commercial spent fuel and high-level radioactive waste. Opposition to the Yucca Mountain project is based on a long history of Nevada being a nuclear weapons testing grounds, resentment at becoming a repository for toxic waste generated elsewhere in the country, and concerns that the site is not geologically stable enough to guarantee that the radioactivity will remain confined over the required 10,000-year span. But several more such sites will be needed in future decades if a significant number of new nuclear power plants are built.Moniz says the MIT study endorses a robust research and development program and tax credits for the nuclear industry. This is because, in the past, there has been considerable regulatory uncertainty, causing prohibitively high financial risk for utility investors. In addition, the true cost of burning carbon-based fuels has not been internalized, meaning that if the health and environmental costs of pollution and greenhouse gases could be factored in, nuclear energy would be very competitive. As a result, public subsidy of noncarbon-based energy sources is justified.The comprehensive Energy Policy Act of 2005 that Moniz cites provides loan guarantees to develop energy technologies, including nuclear power, that avoid, reduce, or sequester greenhouse gases. It also provides a tax credit of 1.8\u00a2 per kilowatt hour for 6,000 megawatts of capacity at new nuclear power plants . Important to the industry, the act provides investment protection against delays in licensing and startup that are beyond the control of industry, including litigation.The act also provides several billion dollars for nuclear energy research and development, which translates into work on a more cost-efficient and inherently safer generation of reactors known as Generation IV. These reactors achieve greater safety through passive technologies that automatically shut down the reactor in an emergency, bypassing the risk of operator error . They are also more efficient and relatively more cost-effective than their Generation III predecessors. In another bow to the environment, the act funds construction of a cogeneration reactor that will produce both electricity and hydrogen, which advocates hope will be a new, carbon-free fuel for automobiles\u2014the single largest source of greenhouse gas emissions.Finally, the act funds a central nuclear energy program of the Bush administration: Nuclear Power 2010. The program was unveiled in 2002 as a government\u2013industry cost-sharing plan to identify three sites for new nuclear power plants, develop Generation III reactors, and develop a single-license process with the NRC for approval of both plant construction and operation, thereby removing much of the delay and uncertainty for investors.In response, three consortia of electric utility companies, reactor suppliers, and construction firms have made proposals. None are yet committed to building a new nuclear plant. The consortia are led by Dominion Resources, Exelon and Entergy (via the NuStart Energy Development consortium), and the Tennessee Valley Authority. These consortia represent operators of 67 of the nation\u2019s nuclear plants, and their proposals have all focused on building a new plant on sites where plants already operate\u2014in much the same way that a consortium of 10 electric utilities built the Yankee Rowe plant, one of the first commercial nuclear plants, in the 1950s.The consortia embrace a number of different reactor vendors and designs, some of which have already been certified by the NRC. The final decision on building a nuclear power plant will depend on factors as they stand later this decade, including the power market, the status of permanent spent fuel storage, and the ability of the participants to obtain financing without adversely affecting their credit ratings.\u201cThe industry\u2019s interest is very real,\u201d says Russ Bell, a senior project manager for new plant development at the Nuclear Energy Institute, a utility trade association. \u201cThe utilities are [participating in consortia and spending money on preliminary designs and siting plans] because the economics are turning in favor of nuclear, especially over the long term. [The Kyoto Protocol] is not driving us, but it makes sense and there is increasing concern about pollution in the United States and more stringent environmental regulations.\u201dBell says the industry is getting what it needs from the Energy Policy Act and is looking to government to do no more than jumpstart new builds after so much time has passed. He acknowledges the long time horizon for building new plants in the United States. Assuming that any of the consortia meet the 2010 goal of being licensed to build and operate a plant, another four to five years will pass before construction is complete and electricity flows. Meanwhile, the electric utility industry will continue to improve operating performance of existing nuclear power plants and apply for license extensions.Originally licensed for 40 years, the first operating license issued by the NRC will expire in 2006, approximately 10% will expire by the end of 2010, and more than 40% will expire by 2015. The decision to seek license renewal is strictly voluntary, and nuclear power plant owners must decide whether they are likely to satisfy NRC requirements and whether license renewal is more cost-effective than shutting down and pursuing other sources of energy. The NRC has now granted 35 plants the right to operate for another 20 years. Three-quarters of the nation\u2019s plants have received, have applied for, or are expected to apply for an extension.The New York Times.The question of plant life extension can bring the relationship between nuclear energy and greenhouse gases into sharp focus. For example, the governors of nine Northeast states have proposed an agreement to cap greenhouse gas emissions from all power plants in their states. Two nuclear power plants in the region, one in Vermont and one in New Jersey, are up for life extension, yet if these plants are shut down, the result would be increased reliance on carbon-based fuels. This could potentially triple greenhouse gas emissions in Vermont and double them in New Jersey, according to the 14 September 2005 edition of \u201cWe are not fundamentally opposed to nuclear power,\u201d says David Lochbaum, a nuclear safety engineer at the Union of Concerned Scientists, \u201cbut there are better choices. In addition, we now have spent nuclear fuel in storage places where it is not meant to be. It\u2019s not a health threat yet, but it could be.\u201dLochbaum is also concerned about the oversight role played by the NRC. \u201cThe NRC budget has been cut for a decade,\u201d he notes. \u201cIt is understaffed to support a nuclear resurgence. And the industry still has operational troubles at some plants.\u201dThese concerns are echoed by Thomas Cochran, director of the nuclear program at the Natural Resources Defense Council and an advisory committee member on the MIT study. \u201cThe Energy Policy Act was the result of successful lobbying by the nuclear industry,\u201d he says. \u201cThey will probably build a few plants and then the issue is, are you back to where you are today?\u201d Cochran does not believe that the subsidy or the economics will work for nuclear power. \u201cIt\u2019s not helpful to just say you are for or against nuclear,\u201d he says. \u201cUltimately you must make a decision on real policy to address global warming, and a carbon tax is the best way.\u201dThe objective of a carbon tax would be to internalize the environmental costs and hope for an open competitive market for energy. \u201cTo balance the energy market, you either tax a pollutant or regulate it,\u201d says Cochran. \u201cIf public policy was made correctly, it would help the nuclear industry.\u201dIs there a real, economically justified \u201cnuclear resurgence,\u201d or simply a steady growth in some regions to meet rising demand for electricity? Nothing happens quickly in the world of power plant construction. Yet major investments by government and industry can change the bases of electricity supplies in the time frame of a decade or two. France closed its last coal mine in 2004, and its transition from 15% to 80% nuclear-based electricity was accomplished in 20 years. A sense of optimism and urgency now surrounds the question of whether to pursue nuclear power. How this translates into results should unfold at a brisk, measurable pace."}
+{"text": "Active Magnetic Resonance Imaging implants are constructed as resonators tuned to the Larmor frequency of a magnetic resonance system with a specific field strength. The resonating circuit may be embedded into or added to the normal metallic implant structure. The resonators build inductively coupled wireless transmit and receive coils and can amplify the signal, normally decreased by eddy currents, inside metallic structures without affecting the rest of the spin ensemble. During magnetic resonance imaging the resonators generate heat, which is additional to the usual one described by the specific absorption rate. This induces temperature increases of the tissue around the circuit paths and inside the lumen of an active implant and may negatively influence patient safety.This investigation provides an overview of the supplementary power absorbed by active implants with a cylindrical geometry, corresponding to vessel implants such as stents, stent grafts or vena cava filters. The knowledge of the overall absorbed power is used in a finite volume analysis to estimate temperature maps around different implant structures inside homogeneous tissue under worst-case assumptions. The \"worst-case scenario\" assumes thermal heat conduction without blood perfusion inside the tissue around the implant and mostly without any cooling due to blood flow inside vessels.The additional power loss of a resonator is proportional to the volume and the quality factor, as well as the field strength of the MRI system and the specific absorption rate of the applied sequence. For properly working devices the finite volume analysis showed only tolerable heating during MRI investigations in most cases. Only resonators transforming a few hundred mW into heat may reach temperature increases over 5 K. This requires resonators with volumes of several ten cubic centimeters, short inductor circuit paths with only a few 10 cm and a quality factor above ten. Using MR sequences, for which the MRI system manufacturer declares the highest specific absorption rate of 4 W/kg, vascular implants with a realistic construction, size and quality factor do not show temperature increases over a critical value of 5 K.The results show dangerous heating for the assumed \"worst-case scenario\" only for constructions not acceptable for vascular implants. Realistic devices are safe with respect to temperature increases. However, this investigation discusses only properly working devices. Ruptures or partial ruptures of the wires carrying the electric current of the resonance circuits or other defects can set up a power source inside an extremely small volume. The temperature maps around such possible \"hot spots\" should be analyzed in an additional investigation. Magnetic Resonance (MR) images. These effects arise either from the different susceptibility of tissue and metal, generating a discontinuity of the local field strength at the interface, or from the Faraday cage effect, which is set up by induced eddy currents on the metallic implant structure  is the electric conductivity, \u03c1 [kg/m3] is the mass density, E [V/m] is the amplitude of a sinusoidal time dependent electric field and r is the position vector. Assuming that the amplitude of the electric field only arises by induction from a uniform, linearly polarized magnetic field with amplitude Bm [T] and angular frequency \u03c9 [rad/s] in a homogeneous body of rotational symmetry, the following equation holds  is the MR-sequence repetition time, N is the number of identical excitations during TR and \u03c4 [s] is the duration of one excitation pulse. cdc equals to the time ratio of \"rf-on\" to \"rf-on + rf-off\" during an MR scan. cpwm corrects for rf-pulses which are not rectangular in shape and is the ratio between the energy of the MR excitation pulse and the energy of a rectangular shaped pulse with identical amplitude and identical duration.The duty cycle factor B1 or a linearly polarized magnetic field with amplitude Bm for excitation is amplified inside an aMRIi with respect to the used resonance circuit. Because of the shape of vascular implants and to simplify calculations, a solenoid is chosen as inductor of the resonator and is investigated as a magnetic antenna. For the theoretical estimation, the axis of the solenoid resonator is assumed to be parallel to a sinusoidal linearly polarized magnetic field with amplitude Bm, or equivalently to be in the plane of a circularly polarized magnetic field with magnitude B1. For the resonance case (2\u03c0\u03bd0 = \u03c90 = (LC)-1/2), where the overall resistance of the resonator is just R, the following equation can be derived from the law of induction, Ohms law and the definition of the quality factor Q of a resonator,A circularly polarized magnetic field with magnitude Vind [V] and Vself [V] are the induced and self-induced voltage respectively, Z [\u03a9] is the impedance, R [\u03a9] is the resistance, L [H] is the inductance of the inductor and \u03b1res and \u03b1 are the flip angles inside the resonator inductance and outside the resonator respectively. The total magnetic field inside the resonator arises from both components Bm and Bres. For large quality factors (Q>>1) Bres dominates Bm. With Eqs it is possible to calculate the magnetically induced SAR and with the SAR the corresponding power loss inside a resonator. But this takes into account only power losses due to eddy currents and not the total power loss of a resonator.where The overall power loss P [W] also includes the electric losses on and around the resonator. It is given by the following basic equation ,Wtotal [J] is the energy stored inside the resonator.where Wtotal can be expressed by the energy stored in the magnetic field of maximum amplitude using the following basic relations of a solenoid inductance with nr turns ,The total energy B1 the total power loss can be calculated by combining Eqs.  towhere V, A, \u2113 with index imp are the volume, cross section and length of the implant inductor. For a pulsed MR sequence with excitation magnitude cdc, cpwm and B12. For a specific sequence on a MRI system with a definite resonance frequency, the extra power is proportional to the quality factor Q and the volume Vimp of the inductance (Eq. (7)). The proportionality to the quality factor Q may be surprising, because it states that for better quality factors the power loss is larger. This is due to the total energy of the resonator, which depends quadratically on the field strength inside the resonator. This field strength is proportional to the exciting field B1 (or Bm) as well as the quality factor Q. Combining Eq. (5) and Eq. (6) alters the inverse proportionality to Q (Eq. (5)) to a proportionality (Eq. (7)) with respect to the field established by the transmit coil. Examining the power loss with respect to the magnetic field inside the resonator confirms the inverse proportionality to Q.A comparison of Eqs.  shows that for a certain resonator tuned to the resonance frequency of a specific MR field strength, the supplementary absorbed power is proportional to the SAR of the MR sequence due to the identical dependence on E [J] between two simulation cells with a specific contact area A [m2], temperature difference \u0394T [K] and heat diffusion path length \u0394x [m] for a time interval \u0394t [s] is given by the equation for heat conduction as,All temperature increases are calculated as temperature difference maps by using a simulation volume divided into many small simulation cells. The energy exchange \u0394\u03bb [W/(m K)] is the thermal conductivity.where tot of one cell during a time interval \u0394t is the sum of exchanges of this cell with all adjacent cells with non zero contact area and the energy change due to the power loss pcell inside the cell. From this total energy change the temperature difference \u0394T* can be calculated,The total energy change \u0394Ec [J/(kg K)] is the specific thermal capacity of the cell material and Vcell is the cell volume.where \u03b2-test) version of Teechart 7 used within the Delphi and Kylix environment. The simulation describes the time developing temperature difference maps around an aMRIi with cylindrical geometry for a constant total power loss P.This investigation did not use any commercially available finite volume package. The simulation is self-coded for problems with cylindrical geometry in Kylix and Delphi, a software development environment, based on object oriented Pascal. The graphical outputs are mostly generated by an evaluation . Most of the cells have contact to 4 adjacent cells with contact areas different from zero ). These contact areas as well as the volumes of the cells (Eq. (10c)) only vary with the index r.The entire simulation volume is assumed as a cylinder with length  Figures , 3. Beca Figures , 3. UsinAl[r] [m2] is the contact area in both cylinder axis directions (from index x to x-1 and to x+1) whereas Ar[r] [m2] is the contact area in radial direction from index r to r+1. The contact area in radial direction from index r to r-1 is identical to the area Ar[r-1]. A last \"shell\" with cells as heat (energy) sink is placed as one boundary of the simulation volume at r = m + 1 and x = n + 1. These cells always keep a constant temperature (\u0394T = 0), even when receiving energy during one simulation step. Partly the simulations use a second heat sink representing a blood flow through the inner volume of the implant. For this second heat sink the temperature differences of all cell elements below a radius rflow*\u0394r are also kept zero independent of the energy transfer from the cell elements with higher index r. This approximation assumes that the energy applied to the inner cylinder volume with blood flow is completely transported away from the simulation volume during one time step \u0394t. At r = 1 and x = 1 as well as at r = m + 1 and x = n + 1 the simulated volume has its boundaries. The symmetry and the use of cylinder coordinates imply that cells with index r = 1 or x = 1 can not exchange energy with cells at a lower index. For x = 1 the symmetry plane defines an identical temperature at index x = -1, ) the physical parameters \u03bb, \u03c1 and c can be set freely. For all other cell elements they are set as tissue. The presented simulations use different metal parameters for heat generating cells . This change \u0394Etot of one cell is the sum of five different energies. One is due to the power loss pcell = p defined for a cell element at index r and x. The four others are energy exchanges (Eq. (8), depending on the contact areas ) and the temperature differences between adjacent cells with respect to the equivalent heat diffusion length through the material of the examined region. From \u0394Etot  the temperature change \u0394T* is calculated according to Eq. (9b). This value is added to the prior value ) for each cell during the whole iteration process. The entire simulated time tsim consists of q iterations with time interval \u0394t (tsim = q * \u0394t).The simulation starts with a temperature field rwire, which is heated by a constant power density P* [W/m], defined as power per wire length [W/m]. After reaching the thermal equilibrium, the power associated with P* penetrates through every cylinder surface surrounding the linear power source independent of the radius r (with r>rwire). The temperature difference \u0394T between the wire surface and a point at radial position R can be calculated in a homogeneous medium from the equation for heat conduction.One test of the principal correctness of the self-coded simulation is possible by a comparison of the simulation results with those of an analytical solution. An easy straightforward analytical solution is available for an endless linear wire with radius P* and with energy exchange only in radial direction should approach, after sufficient time, similar temperature differences between the wire surface and a point at distance (R-rwire) , because of the assumed thermal equilibrium. A simulation for a wire with power loss ) Figure .The implemented algorithm was controlled with different checks, beside the afore-mentioned comparison with an analytical model. First, the total energy uptake of the heat sink surface is added up during all iteration steps. This energy summed with the energy stored inside the simulation volume must equal the total applied energy. The energy inside the simulation volume is calculated independently from the finite volume algorithm by using the final temperature increase, the specific heat, the density and the volume of each cell.Second, the algorithm was tested as to whether it provided similar results for identical geometries with different spatial resolution, different time resolution as well as a different size of the simulation volume surrounding the implant.\u03c1, \u03bb, c) from Table Lsim and radius Rsim. A cylindrical implant with sizes Limp and Rimp is placed at the center of this volume. The simulation is calculated for three different models.The cylindrical simulation volume basically is assumed as homogeneous tissue with the physical parameters , could certify a realistic estimation.P* with Eq. (7). Using this power density P* it is possible to calculate the temperature difference between the wire surface and the difference between the wire surface and a specific radial distance after reaching the thermal equilibrium according to the model of Eq.(11). The results are summarized in Figure rwire. In radial direction, just a few cells are sufficient to describe the heat generating wire; the radial resolution \u0394r is chosen in such a way that n \u0394r - \u0394r/2 is equal to rwire. This choice takes into consideration that the center of the last cell is the reference radius rwire for the theoretical description according to Eq. (11). For the comparison with theory, the temperature increase in a simulation cell is set to a radial position just half between the walls of a simulation cell. During the temporal development the simulated radial temperature differences increasingly approach the analytical solution for the thermal equilibrium.For a given MRI sequence and a given resonator with known geometry it is possible to calculate the power loss density For sufficiently short time steps \u0394t, the simulations show the expected behavior that the temperature increases monotonically in each simulation cell. For overly large time steps the energy flow out of a cell during a time step can become larger than the energy loss inside it. This leads to a physical incorrect situation with decreasing temperatures inside a cell. For this case the simulation produces huge deviations and the temperature differences oscillate in an unpredictable fashion during the temporal development.Increasing the simulation volume without changing the spatial and temporal resolution as well as the size of the implant generates only slight changes see  at the cAn improved spatial resolution without changes of the heat generating volume modifies the results very little Figures ; 10b,d. Q normalized volumetric power loss density PV = P/(Q VImp) for resonators exposed to an MRI sequence with maximum SAR  to 50 cm3, . The achievable quality factor is low in ionic surroundings, such as tissue, but increases with the insulation of the solenoid wire . For thin insulations, which are necessary for the retention of the mechanical properties of the vascular implants, the achievable quality factor is below 5. However, the simulation as a worst case scenario partly uses quality factors far above this value to test the safety of the implants also for these conditions. As examples, the resonators described in Table According to Eq. (7) the with AR Table  can be closs was verified experimentally. Figures For the three differently shaped prototype examples Table  the heatTwo rings are the worst case for resonator no 1 from Table For resonator no 2 Table  6 rings The temperature peaks at the power generating rings become negligible for six or more rings after ten minutes simulated time. Therefore it was reasonable to choose a cylinder shell as power generating source. The simulations with a homogenous power dissipating cylinder shell instead of rings are shown from Figure imp is taken as equal to rwire. The condition that the wire is endless can be realized in two ways. The first way is to choose a very long Limp and to evaluate the temperature increases only at positions on the center plane (index x = 1) and at radial distances r small compared to Limp. The second way is to modify the simulation software in such a way that the energy transfer in axial direction is excluded. This can be done by considering only volume elements of the center plane (index x = 1) and setting the heat sink shell temperature (index x = 2) after each iteration not to zero, but to the same value as at index x = 1 for all r respectively.The simulation of an endless wire uses the first of the three above mentioned models. Especially, the radius RThe second way has been realized. The common and expected result was that during the temporal development the simulated radial temperature differences increasingly approach the analytical solution for the thermal equilibrium (Eq. (11)). One comparison between a simulated and the analytical result is shown in Figure A correct simulation of an endless wire should deliver results similar to the analytical curve of Eq. (11) using an implementation of the algorithm with no energy exchange in longitudinal (x) direction. The physical model of such a linear wire claims that the temperature difference between the wire and a cell at a certain distance increases monotonically with that distance. The theoretically calculated curve is valid after reaching the thermal equilibrium. With increasing simulated time the calculated curves show an increasingly close coincidence with the prediction of Eq.(11) Figure , indicatP* is safe for active magnetic implants  does not affect the results very much as long as the temperature maps appears smooth ) with the total power loss (Eq. (7)). For all example prototypes in Table Achievable quality factors were derived from the construction of experimental solenoid resonator prototypes Table . The quaant (Eq. ) with thant (Eq. ) with thQ of 5 for resonator no 1 and therefore the maximum power loss. For resonator no 2 (Q = 12.5) and no 3 (Q = 80) the chosen value is far beyond the reachable inside an ionic surrounding. These high values for resonator 2 and 3 are chosen to pronounce the safety statement for smaller resonators with quality factor values well above achievable values. The unrealistic high quality factors do not show physiologically critical temperature increases. For resonator number 1 (with a large volume) a realistic value was chosen, because in this case the temperature increase reaches physiologically dangerous values.Realistic values for the quality factor of a resonator placed in ionic surroundings such as tissue are below 5 for all example resonators of Table 3 and quality factors of 3 to 4 were used. After excision and histopathologic examination, the tissue did not show any indications of heating after several MRI investigations. This is in coincidence with the simulation results, because even for small resonators with a much higher quality factor no dangerous heating was calculated.Part of the simulation results could be confirmed on stents implanted inside the aorta of rabbits ,10. SmalTen minutes of simulated time is 5 minutes less than the critical time according to the FDA regulations for imaging of the trunk assuming a SAR of 4 W/kg. But all simulations show only small changes after 10 minutes. Therefore it is unnecessary to increase the simulation time further. Nevertheless, one example of 15 minutes simulated time is given in the movie see  and showsim and Rsim, the second calculation uses doubled values of Lsim and Rsim without changing the spatial resolution or the other simulation parameters. This approach shifts the heat sink to a larger distance from the heat generating cell elements. As expected the heat sink layer drags down the temperature increase in its vicinity, but the effect is small if the volume is adequately chosen. The differences for identical cells between both simulations are shown by alternating both views a few times at the end of the movie (see The weak influence on the distance between power generating cells and heat sink (the outer most layer) is also shown in the movie see . The difovie see .For all three example resonators Table  the firsTherefore resonator 1 is assumed as a solenoid with 2 turns Figure . The simFor 6 or 12 rings and after 600 s calculated simulation time, the peak values near the location of the power generating rings inside the tissue become more and more negligible. Therefore a model using a power generating cylinder shell is appropriate for resonators with a reasonable number of turns.For resonators no 2 and no 3, the cylinder shell simulation did not show any unsafe heating and is similar to the ring calculations. Neglecting the peaks of the ring simulation the maximum temperature increase is nearly identical.Only the simulation for resonator no 1 with two rings reaches a critical temperature value above 5 K, all others stay below this value. For a large number of rings or, stated more precisely, a high wire density at the cylinder surface, it is possible to use the cylinder shell model . The reduced temperature increase for resonator no 1 and for various sizes of the cooling blood flow is shown in Figure With respect to the overall power absorption greater than 100 Watts inside the human body during MRI investigations with a maximum SAR, one additional Watt inside the entire body is negligible.1. Secondly, to some extent no blood flow inside the inductor (vessel) of the implant is included. Thirdly, no blood perfusion inside the tissue around the resonator is taken into account. Lastly, too large quality factors are used.This investigation assumes a \"worst-case scenario\" in different ways. Firstly, the resonator is assumed being perfectly aligned within the plane of the excitation field B1.For most \"normal\" cases, intact active implants will therefore be less critical, but it is not possible to exclude the worst case conditions. Pathologies  may alter blood flow and perfusion in the area directly adjacent to the current paths of the resonator and certainly the resonator can be perfectly aligned to the plane of the exciting rf-field B3, which may be dangerous, if the tissue around the wires of the implant is not exposed to blood flow or sufficient blood perfusion. To reduce the risk for such active implants, the quality factor has to be low. This reduces also the amplification of the MR signal the resonator is made for and can thus be dispensed with altogether.Especially for resonators with a large volume (such as resonator no 1) and with a small number of rings it is possible to reach critical temperature increases above 5 K Figures , 11. ForAs the above simulations assume properly working resonance circuits without any failures on the electric paths of the system, one worst case scenario was not presented. Defects such as ruptures or partial ruptures may generate a relatively high resistance over very short distances. The current flow through this resistance can produce a large power loss inside an extremely small volume. This can generate a very high power density which, even for small implants, may induce physiologically critical temperature increases for a small volume. In fact the analysis of these \"hot spots\" is important, because ruptures of stent struts are likely and a high power density can occur also for smaller implants. An additional investigation estimating the maximum possible power loss inside such \"hot spots\" and the resulting temperature maps around them is necessary to check the safety of active implants under these circumstances. This is being prepared for future publication.The study protocols for the cited animal experiments were approved by the responsible authority .MB has drafted the investigation, written the manuscript, coded the simulation and contributed to the theory and part of the cited experimental work.WV has drafted the theoretical part of the manuscript and reviewed the manuscript. Also part of the cited experimental tests for power loss, quality factor measurements and prototype constructions are from WV.JS was responsible for the cited animal experiments and provided the in vivo images of prototypes in an animal model. He has also contributed to the medical background and has reviewed the manuscript.DG has enabled and reviewed the manuscript, contributed to the medical background, and was helpful during the investigation with discussions.Movie with an example of a time developing temperature map This movie (animated GIF) shows the time development over a period of 900 s, which is the maximum permitted time for the imaging of the trunk with an SAR of 4 W/kg (manufacturer declaration, sequence of Table Click here for file"}
+{"text": "Computer models of the electrical and mechanical actions of the heart, solved on geometrically realistic domains, are becoming an increasingly useful scientific tool. Construction of these models requires detailed measurement of the microstructural features which impact on the function of the heart. Currently a few generic cardiac models are in use for a wide range of simulation problems, and contributions to publicly accessible databases of cardiac structures, on which models can be solved, remain rare. This paper presents to-date the largest database of porcine left ventricular segment microstructural architecture, for use in both electrical and mechanical simulation.Cryosectioning techniques were used to reconstruct the myofibre and myosheet orientations in tissue blocks of size ~15 \u00d7 15 \u00d7 15 mm, taken from the mid-anterior left ventricular freewall, of seven hearts. Tissue sections were gathered on orthogonal planes, and the angles of intersection of myofibres and myosheets with these planes determined automatically with a gradient intensity based algorithm. These angles were then combined to provide a description of myofibre and myosheet variation throughout the tissue, in a form able to be input to biophysically based computational models of the heart.Several microstructural features were common across all hearts. Myofibres rotated through 141 \u00b1 18\u00b0 (mean \u00b1 SD) from epicardium to endocardium, in near linear fashion. In the outer two-thirds of the wall sheet angles were predominantly negative, however, in the inner one-third an abrupt change in sheet angle, with reversal in sign, was seen in six of the seven hearts. Two distinct populations of sheets with orthogonal orientations often co-existed, usually with one population dominating. The utility of the tissue structures was demonstrated by simulating the passive and active electrical responses of two of the tissue blocks to current injection. Distinct patterns of electrical response were obtained in the two tissue blocks, illustrating the importance of testing model based predictions on a variety of tissue architectures.This study significantly expands the set of geometries on which models of cardiac function can be solved. Computer modelling of the heart's electrical and mechanical action is a rapidly maturing field of study. Whole-heart and tissue-segment modelling of the time-dependent spread of electrical activation, and mechanical contraction , relies Ventricular myocardium has been shown to have a complex laminar structure, in which myocytes are grouped by perimysial collagen into branching sheets approximately four cells thick ,10-15. EThis paper presents the development of a database  of tissuThe model construction methods are based on those used by Costa et al. , and LeG1, X2, X3) was defined as aligned with the local circumferential (X1), longitudinal (X2), and radial (X3) axes of the LV  axis, could be used to assess the degree of tissue shrinkage sustained during the fixation and freezing processes. Geometrical measurements made in the frozen tissue were later scaled in an isotropic fashion according to these measurements.A cardiac coordinate system X, X2, X3 1-X2 plane) are collected every 500 \u03bcm from block a, and used to characterise the variation in myofibre angle throughout the ventricular wall. From block b, a single slice is taken in the base-apex (X2-X3) plane, followed by serial sections (collected every 200 \u03bcm) in the circumferential (X1-X3) plane  are then taken from both tissue blocks, transferred onto glass slides, and photographed. Serial sections in the plane of the epicardium X-X2 plane2-X3) plane slice is shown at upper-left. To the right of this section are three representative circumferential (X1-X3) plane slices, registered to the base-apex slice at three X2 locations. Beneath are five epicardial (X1-X2) plane sections showing fibre angle orientations at different transmural depths in the tissue. Microstructural angles can be measured from sections in each of the three planes. Under the assumption that myofibres run in-plane to the epicardium (imbrication angle is zero), angles measured in the epicardial plane slices represent myofibre orientation. Angles measured on the base-apex and circumferential plane slices represent the local angle of intersection of myolaminae with the slice plane. Microstructural angles are determined in each plane automatically from tissue section images using a gradient intensity algorithm [1 axis, whilst \u03b2' and \u03b2\" angles were both measured relative to the X3 axis. Angles were signed positive or negative in accordance with previously developed convention [Tissue sections from one processed myocardial tissue block (Ex07) are shown in Figure lgorithm ,21. Appllgorithm , the micnvention .3 direction, whilst \u03b2' and \u03b2\" both varied in X2 and X3 directions.The model allowed variation in \u03b1 along the XMyolamina orientation was usually difficult to discern from base-apex and circumferential sections immediately adjacent to the epi- and endo-cardium, where coupling of adjacent laminae is known to be tightest ,22. In tComplete sets of \u03b2' and \u03b2\" angles are shown for the same tissue block (Ex07) in Figure 3 location) could then be combined with measured \u03b2' or \u03b2\" angles at the same transmural depth to derive sheet angles (\u03b2) at that depth, using the formulae [A continuous description of fibre angle variation through the wall was generated by fitting 10 linear finite elements to the fibre angle data  field generated by the current sink (cathode) is simulated first in the absence of any cellular response to the current. Subsequently, the actively propagated wavefront generated by the cathodal current is examined by simulation of the activation time (AT) field over the model volumes. A simple cubic model of the cardiac action potential is utilised for the active models [gil = 0.263, git = 0.0263, gin = 0.008, gel = 0.263, get = 0.245, and gen = 0.1087. Membrane capacitance of the models was set to 0.01 \u03bcF/mm2, and membrane conductivity to 0.004 mS/mm2. The cubic action potential model had a resting potential of -85 mV, a threshold potential of -80 mV, and a plateau potential of 15 mV.Current of 0.03 mA is withdrawn from the extracellular space of two example model tissues, at a point located centrally in the model volume (~8.5 mm below the epicardium). Equal magnitude (but opposite sign) current is uniformly distributed amongst all the tissue boundaries except for the epicardium, to match the experimental case of recordings taken from an open chest pig. The steady-state extracellular potential (e models . The conThe model geometries reconstructed from the remaining six (Ex01-06) heart segments, each from a different pig, are presented in Figure 2) axis.Measurements of electrode locations preceding and following the fixation and freezing processes revealed that the tissue blocks shrunk on average 10 \u00b1 8% (mean \u00b1 SD) along the longitudinal (XAll seven tissue segment models are available on the web  for rese\u03a6e) and activation time (AT) fields are shown on the central base-apex plane for both tissues. Figure \u03a6e and AT, with anisotropy in the fields being aligned with the microstructural axes of each tissue model. Predominantly negative sheet angles in the vicinity of the stimulus site in Ex01 determine the bottom-left to top-right slant of the fields for this tissue. Conversely, Ex06 exhibits predominantly positive sheet angles in the same region, and the fields for this tissue are accordingly slanted in the opposite direction.The results of the passive and active bidomain simulations are shown in Figure The last two decades have seen a dramatic increase in the use of computational models of the electrical and mechanical action of the heart on geometrically realistic model domains. One of the first studies to incorporate realistic anatomical features into a model environment solved electrical propagation on a three-dimensional network of cardiac fibres reconstructed from histological sections . Later, 3 volume). The trade-off for using cryosectioning techniques is that to allow for modelling over a three-dimensional block of tissue, an assumption that the tissue structure is constant over small distances in the third  dimension must be applied. Support for such an assumption comes from the observation that myofibre angles generally vary little in the circumferential direction, over distances of 1\u20132 cm. However, the myosheet angle field tends to be more discontinuous than that of myofibres. The circumferential plane sections taken in this study give some indication of the variation in sheet angle field in the circumferential direction, in the region of the sections where absolute fibre angle is greater than 45\u00b0. In a qualitative sense, five of the seven hearts examined for this study displayed a reasonably constant sheet angle field in the X1 direction over 10 mm from the central base-apex plane. The other two hearts did contain significant variations in the field, and in one of these there was complete reversal of sheet angles within the |\u03b1|>45\u00b0 range, over the distance of 10 mm. Figure In this study traditional cryo-sectioning techniques were chosen to allow reconstruction of a plane of tissue structure from blocks of porcine LV. The methods used require destructive tissue sectioning in three planes in order to build the tissue description of a single base-apex plane. In our case, the attraction of MRI in enabling full three-dimensional reconstruction of fibre and sheet angle fields was out-weighed by several factors. Although the case for the ability of DTMRI to accurately reconstruct cardiac fibre fields is compelling ,7,29, it1-X2 plane), and hence imbrication angles  are uniformly assumed to be zero. This assumption is supported by observations made in our lab of negligible fibre imbrication in the rat LV freewall [The validity of equations 1 and 2 used in the model construction relies on the assumption that myofibres run in plane with the epicardium  ,15. The gle Fig.  is due tComparison between our tissue structures, and those determined in dog hearts at very similar location , can be Transmural fibre variation was also measured by Streeter and Bassett, in the left ventricles of six pig hearts . Whilst 1-X2) plane section of Figure Occasional pockets of fibres with variant angle were observed in our tissue sections also, an example of which is seen in an epicardial X1-X plane seIn summary, this study contributes the largest database of porcine LV segment microstructure that is available for use by the cardiac research community. The key limitations of this study are (1) the inability to measure changes in the laminar architecture in the circumferential axis of the tissue blocks, and (2) the reliance on the assumption of zero fibre imbrication angle. To address these limitations whilst preserving high spatial resolution of the laminar architecture, development of a new technique involving repetitive milling, etching, and staining, in a semi-automated fashion, through blocks of wax-embedded tissue, is underway in our laboratory, and promises to yield fully three-dimensional reconstructions of moderate sized tissue blocks in the future."}
+{"text": "Radiofrequency ablation is an interventional technique that in recent years has come to be employed in very different medical fields, such as the elimination of cardiac arrhythmias or the destruction of tumors in different locations. In order to investigate and develop new techniques, and also to improve those currently employed, theoretical models and computer simulations are a powerful tool since they provide vital information on the electrical and thermal behavior of ablation rapidly and at low cost. In the future they could even help to plan individual treatment for each patient. This review analyzes the state-of-the-art in theoretical modeling as applied to the study of radiofrequency ablation techniques. Firstly, it describes the most important issues involved in this methodology, including the experimental validation. Secondly, it points out the present limitations, especially those related to the lack of an accurate characterization of the biological tissues. After analyzing the current and future benefits of this technique it finally suggests future lines and trends in the research of this area. Radiofrequency (RF) techniques have been used to heat biological tissues for many years. However, in recent years its use for new medical applications has expanded enormously . To illuRadiofrequency ablation (RFA) is a (more or less invasive) interventional technique that in recent years has come to be employed in very different medical fields, such as the elimination of cardiac arrhythmias (using catheter or intraoperatively) , or the From a procedural point of view, RFA generally uses a pair of electrodes: an active electrode with a small surface area that is placed on the target zone, and a larger dispersive electrode to close the electrical circuit. On occasions, bipolar ablation is conducted with two active electrodes. In addition, using the same biophysical foundation described for RF ablation, other surgical fields use it to treat other pathologies, e.g. the correction of refractive errors in ophthalmology , the theIn order to investigate and develop new techniques, and also to improve those currently employed, research can call upon clinical and experimental (ex vivo and/or in vivo) studies, phantoms and theoretical models. The latter are a powerful tool in this type of investigation, since they provide vital information on the electrical and thermal behavior of ablation rapidly and at low cost, quantifying the effect of various extrinsic and intrinsic factors on the electrical current and temperature distribution. Consequently, they facilitate the assessment of the feasibility of new electrode geometries, and new protocols for delivering electrical power. Despite the fact that several research groups are currently using computer modeling to investigate RF ablation procedures, to date no review articles have been published on this topic. A previous review by Strohbehn and Roemer  dealt wiTo date, theoretical modeling applied to the study of RF heating techniques have mainly focused on relatively new therapies, such as cardiac ablation , cancer More recently, other researchers have developed models for RF cardiac ablation. The first was proposed by Haines and Watson  and was During the last 10 years, another two groups became interested in theoretical RF ablation modeling. The Duke University group -46 develThis section deals with the main steps in the building and use of a theoretical model in studies on RF heating. These steps are basically: 1) observation and simplification of the physical situation, 2) arrangement of the mathematical equations which rule the thermal and electrical phenomena, 3) determination of the boundary conditions, both electrical and thermal, 4) obtaining the physical characteristics  of the biological tissues and other materials included in the model, 5) choosing a numerical method in order to computationally or analytically achieve a solution, and 6) conducting the post-processing of the computed results. Since most models are based on the Finite Element Method (FEM), the following steps have been tailored to this methodology.The theaters in which RF ablation is performed are often too elaborate and it is therefore absolutely necessary to begin by studying this problem in detail and then to carry out appropriate simplifications. These could include, for instance, looking for planes or axes of symmetry see Fig. , which wThe second step consists of setting the equations governing the physical phenomenon of electrical-thermal heating. All the models of RF heating are based on a time domain analysis of a coupled electric-thermal problem. The spatial distribution of temperature in the tissues is obtained by solving the so-called Bio-heat equation :\u03c1 is the mass density (kg/m3), c is the specific heat (J/Kg\u00b7K), k is the thermal conductivity (W/m\u00b7K), T is the temperature (\u00b0C), q is the heat source (W/m3), Qp is the perfusion heat loss (W/m3), and Qm is the metabolic heat generation (W/m3). This last term is always ignored since it has been shown to be insignificant for ablation [Qp as it is negligible in some cases of RF heating, such as non vascular tissues [Qp is always considered in cases of tissues with a high degree of perfusion, such as liver [Qp is incorporated in some models [where ablation . Likewis tissues ,48,49. Oas liver ,40,54,55as liver . Regardie models ,27,28,62e models ,44,52,63e models . This teQp = \u03c9b\u00b7cb\u00b7(T - Tb) \u00a0\u00a0\u00a0 (2)\u03c9b is the blood perfusion per unit volume (kg/m3\u00b7s), cb, is the specific heat of blood (J/Kg\u00b7K), and Tb is the blood temperature (\u00b0C). In general, \u03c9b has been assumed as uniform throughout the tissue. However, in a few studies its value was increased with heating time because of vasodilation and capillary recruitment [where ruitment  or annulruitment .q (Joule loss) is given byAt the frequencies employed in RF ablation (300 kHz \u2013 1 MHz) and within the area of interest , the tissues can be considered purely resistive, because the displacement currents are negligible. For this reason, a quasi-static approach is usually employed to resolve the electrical problem ,66. Thenq = J\u00b7E \u00a0\u00a0\u00a0 (3)J is the current density (A/m2), and E is the electric field intensity (V/m). The values of these two vectors are evaluated using Laplace's equation:where \u03c3 \u2207V = 0 \u00a0\u00a0\u00a0 (4)\u2207 \u00b7 V is the voltage (V) and \u03c3 is the electrical conductivity (S/m). By using the quasi-static approach, the values of \"direct-current\" (DC) voltage calculated from the model correspond with the root mean squared (r.m.s.) value of the RF voltage actually employed.where The equations (l)-(4) give the solution of an electrical-thermal coupled problem which generally represents adequately the RF ablation of biological tissues. However, some models have incorporated additional terms into the Bio-heat equation or have employed extra equations which describe other physical phenomena. For instance, in order to improve the prediction of the temperature in the circulating blood during RF cardiac ablation, the Mass Equation and Momentum Equation have been employed to solve a thermal-flow coupled problem ,63; otheOnce the thermal and electrical equations have been stated, it is necessary to set the boundary conditions, both thermal and electrical. RF ablation is typically performed using a constant-voltage. In this case, the electrical boundary conditions can be of two types: null current (Neumann boundary condition) at the symmetry axis ,49,52,68Thermal conditions can be of two types: 1) null thermal flux (Neumann boundary condition), for instance, at the symmetry axis and plane ,52; 2) cIn addition, a value for the initial temperature has to be considered for transient thermal analyses. This value is frequently equal to those chosen in the experiments with which the computer simulations will be later compared. Almost all the studies modeling clinical RF ablations considered normothermic values of 37\u00b0C -46,71,72\u03c1), specific heat (c), thermal conductivity (k), and electrical conductivity (\u03c3). All these values are usually taken from the scientific literature [\u03c3, and at the appropriate temperature. If no previous data are available for a certain tissue, it is possible to consider the characteristics of a histologically comparable tissue.In order to build the complete theoretical model, the value of four physical characteristics have to be set for all the material of the model: mass density  during heating and have found that this phenomenon follows an Arrhenius model which allows the modeling of irreversible changes in \u03c3. Likewise, the parameter k has been traditionally considered constant. Only a few models incorporated a linear relation with temperature [k-T.An important issue that has received little attention to date is the relationship between tissue characteristics and temperature. Although some RF ablation models did not consider any relationship ,35,44,60f +2%/\u00b0C ,59,62,80f +2%/\u00b0C ,55. Howef +2%/\u00b0C . For thif +2%/\u00b0C  have recperature ,51,53,62perature  have exp\u03c3 by a factor of 10000 between 100 and 102\u00b0C . However, this approximation does not take into account the irreversible behavior of \u03c3, and hence the results do not match the real situation, which is without doubt much more complex. For this reason, other modeling studies decided to end the computer simulation when the maximal temperature in the tissue reached 100\u00b0C [On the other hand, many RF ablation procedures involve a temperature of nearly 100\u00b0C. In values of this order, it is known that non-linear phenomena occur, such as desiccation and vaporization (bubble formation) . Since ged 100\u00b0C ,52,60, oed 100\u00b0C ,41,43,69ed 100\u00b0C .More recently, some interesting attempts have been made to quantify the relationship between temperature and specific heat , and to To obtain the solution of the equations governing the physical phenomena during RF ablation it is necessary to chose a calculation method. Sometimes, the geometry of the model  is simple enough, and these equations can be solved by analytic methods ,22. HoweConcerning the use of the FEM, although some groups have developed their own software ,24, mostSome groups have recently employed FEMLAB (COMSOL in the present version) in their modeling studies ,55,59. TMost FEM programs have numerous advantages for building, solving and post-processing models , however three key issues have to be take into account in order to obtain accurate solutions. Two of them are related to the discretization processes carried out during FEM: 1) spatial discretization of the model region by creating a mesh  see Fig. , and 2) Regarding the outer dimensions of the model, the correct choice is a compromise between a model that is large enough to yield a valid solution and small enough to require reasonable computing time and memory . A sensiLikewise, the optimum mesh size and time step are determined by a similar procedure called a \"convergence test\" which is described in detail in . In thisThe determination of the optimum values of mesh size, time step and outer dimensions is actually a combined process, since any sensitivity and convergence test for determining one parameter is implicitly employing a value used by the others. For this reason, it seems appropriate to conduct a more or less iterative process, for instance, to consider initially a tentative spatial and temporal solution . Then, a computer analysis is conducted to determine the appropriate values of the outer dimensions. Finally, once these values have been obtained, convergence tests are performed to determine adequate spatial and temporal discretization .The simplest RF ablation model is an electrical-thermal coupled problem. Therefore, the output variables are always electrical (voltage and current density) and thermal (temperature and heat flux). In some analyses, only electrical variables such as current density ,39,55,71Regarding thermal variables, temperature distribution is the most plotted result, due to its apparent association with thermal injury ,69,71,72Some modeling studies used an isothermal line to assess the tissue lesion boundary from the temperature distribution. Although different values have been used for this boundary, such as 48\u00b0C ,62 or 59Nevertheless, since it is known that the biological damage is a function of both temperature and time, several authors have partially quantified it. Despite the fact that tissue damage can be associated with many different reactions, each with its own rate coefficient, it may be approximated in a single process . As propT is the temperature (K) calculated at each point of the model region, R is the gas constant (8.3134 J/mole\u00b7K), A (s-1) is the frequency factor (a measure of molecular collisions) [\u0394E (J/mole) is an activation energy barrier which tissue constituents must surmount to denature [A and \u0394E are kinetic coefficients evaluated for each tissue type from experimental data, using both microscopic measurements (e.g. protein denaturation by means of scattering increase or birefringence loss) [where lisions) , and \u0394E denature . Both A ce loss) ,94, and ce loss) ,98. At tce loss) .So far, various theoretical models for RF ablation have employed this formulation to assess tissue damage, sometimes using skin data  due to tOnce the theoretical models have been built, and although they are based on equations which correspond to well characterized phenomena, some type of experimental validation should be conducted to guarantee the results obtained from computer simulations. Many modeling studies have included experimental work that focused on the validation of theoretical models ,59,70-72Firstly, concerning the material employed, the experiments can be conducted by following either of two methodologies: 1) using real biological tissue  placed with precision around the ablation zone ,47,105. Since the use of small temperature sensors (thermocouples and thermistors) or thermographic image can have limitations in some cases, other experimental techniques have been proposed to obtain information on temperature distributions. For instance, Verdaasdonk and Borst  introducAlternative methods of temperature measurement based on magnetic resonance imaging (MRI) have recently been employed for RFA of tumors in order to 1) interactively guide the RF electrode to the target, and 2) monitor the effect of therapy . In factWhen temperature measurement was not possible or appropriate, some studies compared the computed temperature distributions  to the macroscopic and/or histological samples of the heated tissue. For example, the macroscopic assessment of cardiac tissue was based on the degree of discoloration in the lesion zone ,71, whicFinally, some studies have considered the basal value and/or the time evolution of electrical variables during the heating in order to compare the computed and experimental values. Since the total impedance between the active and dispersive electrodes decreases during heating, the evolution of this parameter has occasionally been employed to experimentally validate theoretical models ,24,116.Some RF hepatic ablation procedures involve the use of a simultaneous saline infusion in the tissue ,117,118.RF ablation procedures are conducted using an electrical generator very similar to those normally employed in electrosurgical practice. This generator can operate in different modes such as pulsed  versus cOn the other hand, no theoretical models have been proposed that include the effect of the impedance output of the RF generator, i.e. the electrical boundary conditions used in the active electrode implicitly considered as ideal electrical sources. This issue could be significant since the current RF generators present output impedances which could be similar to the value of the load impedance (tissue impedance). This means that during an actual RF heating, the resulting decrease in the tissue impedance could cause a mismatching of the two impedances, and hence significant errors in the computer results .Another interesting question is the modeling of the control algorithm employed in RF generators that use constant temperature. Recently, Haemmerich and Webster  have impEven though great efforts have been made to obtain an accurate value for each of the characteristics of different biological tissues, it is important to take two issues into account. On one hand, the dispersion of the values of the biological characteristics can become very important, due to the variability between individual values, and the changing environmental and physiological conditions. Some modeling studies have assessed the impact of these changes on temperature distributions considering increments and/or reductions of up to 100% ,49,70,80On the other hand, to date, theoretical RF ablation models and their corresponding computer simulations have only been related to the comparative thermal dosimetry . The aimIn conclusion, it does not seem either important or urgent to obtain the precise characteristics of each type of biological tissue. However, it is urgent and necessary to know the relationship between tissue characteristics and temperature, in order to accurately model certain RF heating techniques. In fact, as was stated at the end of the section \"Physical characteristics of biological tissues\", there is at present a considerable lack of understanding of the changes in the physical characteristics of biological tissues during intense heating, i.e. when temperature reaches \u2248100\u00b0C. In these conditions, it seems obvious that all the characteristics will experience sizeable, and probably irreversible, changes in value. It is therefore both urgent and important to conduct experimental studies to assess these behaviors. This is especially necessary in the modeling of RF ablation procedures in which very high temperatures are reached, such as hepatic RF ablation using saline irrigation ,118 or RThe computer modeling of RF ablation offers several unquestionable advantages over the experimental approach. For this reason, it has become an essential tool to complement experimental studies on RF ablation techniques. Not only is it less expensive and faster than ex vivo and in vivo experiments, but it also allows the time evolution and spatial distribution of physical variables to be analyzed. These values are impossible to monitor due to the lack of suitable transducers. These advantages will provide inestimable help to the research and development processes of the manufacturers of RF ablation systems. This is an important advantage, but in addition, and as I have gathered from my experience of cooperation with surgeons, radiologists, and cardiologists, RF ablation models offer valuable assistance in explaining the biophysical phenomena involved in the RF heating of biological tissues. In other words, the models are excellent didactic tools that enable the users of RF ablation systems to become familiar with the equipment and procedures, and thus indirectly enhance the safety and efficacy of the therapies.A number of studies have recently proposed that theoretical modeling might be useful not only as a support in the design and understanding of the phenomenon, but also to provide guidance during the ablation procedure. For instance, various models have been developed for predicting lesion size during catheter cardiac ablation using previous information  ,33. ConcFinally, although all the foregoing is related to radiofrequency ablation, the methodology described is very similar to those employed to study other thermal techniques for destroying biological tissues. In fact, numerous computer modeling studies have also been published on techniques such as laser-induced interstitial thermotherapy (LITT) -122, higThe future of theoretical RF ablation modeling appears to lie in:Accurate modeling of the electrical and thermal characteristics of biological tissues, not only those that are temperature-dependent, but also time-dependent, i.e. to quantify the relations between the values of the characteristics and the thermal damage function. In addition, these relations offer irreversible effects above a certain thermal level (\u224870\u201380\u00b0C), or over a specific value of a thermal damage function [\u03c3) of a biological tissue considering a thermal level of \u224870\u00b0C as the threshold of irreversible behavior (red line). This behavior has been experimentally assessed. However, it is known that a tissue temperature value of \u224890\u00b0C is associated with a high degree of tissue desiccation, and thus to a significant increase in electrical impedance [\u03c3). Thus, it seems reasonable to consider a second thermal threshold (probably around 90\u2013100\u00b0C) which involves a more or less abrupt drop in \u03c3 . All these relations should be studied in future experimental work.1) function ,83. Thismpedance   ion size , and theion size  may implion size . As a coion size ,37 and aion size ,139 and ion size . The dation size .3) Determining the parameters (frequency factor and energy) of the thermal damage function for different types of tissues . For this purpose, it is possible to use the classical methods , or to croscopy . Finallycroscopy .4) Conducting research on new histological markers of thermal injury to allow consistent experimental validation using ex vivo and in vivo samples. These markers would allow different histological changes to different isothermal lines to be compared [compared ,141,142.5) Development of fast computer simulation of ablation models to predict tissue temperature and hence to provide simultaneous guidance during a procedure [rocedure ,143. In rocedure , theoretto obtain a more accurate model of the behavior of the tissue during the simultaneous application of RF energy and saline perfusion. This is a truly complex phenomenon and to date only a one-dimensional model has been developed [6) Finally, it is especially important eveloped . In facteveloped . The saleveloped ).On the other hand, it seems that certain other lines of research are of low priority, due to their currently high cost in human resources and computational power, as well as to an apparent lack of utility, as is the case, for instance, of large-scale modeling including an entire human torso to study RF cardiac and hepatic ablation. Another questionable issue would be the inclusion of an extremely realistic geometry in the models, since the key question of any model is its simplicity, and only the genuinely significant aspects should be included.Radiofrequency ablation (RFA) is a surgical technique that in recent years has come to be employed in very diverse medical fields. In order to study, investigate and develop new techniques and to improve those currently employed, research can make use of clinical and experimental studies, phantoms, and theoretical models. The latter are a powerful tool in this kind of investigation, since they rapidly and economically provide an understanding of the electrical and thermal behavior involved in ablation. In the last 10 years several groups have developed theoretical models for the study of RF ablation. In this review, the methodology of the modeling has been explained, including the experimental validation. At present, certain important limitations impede the complete and accurate development of the model, especially under conditions of high temperature (\u2248100\u00b0C) or simultaneous saline perfusion. In spite of this, modeling has grown to such an extent that it has become an essential tool in assisting experimental studies on RF ablation techniques."}
+{"text": "In radiofrequency (RF) ablation, the heating of cardiac tissue is mainly resistive. RF current heats cardiac tissue and in turn the catheter electrode is being heated. Consequently, the catheter tip temperature is always lower - or ideally equal - than the superficial tissue temperature. The lesion size is influenced by many parameters such as delivered RF power, electrode length, electrode orientation, blood flow and tissue contact. This review describes the influence of these different parameters on lesion formation and provides recommendations for different catheter types on selectable parameters such as target temperatures, power limits and RF durations. RF current is applied to the tissue via a metal electrode at the tip of the catheter, with a large skin electrode serving as indifferent electrode. The current density patterns in the tissue are determined by electrode size and geometry, electrode contact and local tissue properties. Also, of course, the current density will be proportional to the current (I) delivered by the RF generator, which, for constant resistance (R) of the electrode-tissue volume conductor is proportional to the square root of the RF power , and increases proportional to the heat capacity of the local medium. In addition, when temperature differences between adjacent areas develop because of differences in local current density or local heat capacity, heat will conduct from \"hotter\" to \"colder\" areas, causing the temperature of the former to decrease and that of the latter to increase. Additionally, heat loss to the blood pool at the surface and to intramyocardial vessels determine the temperature profile within the tissue.The heating occurs especially in the proximity of the active electrode due to its relatively small surface area causing locally high current density as compared to the site of the indifferent electrode. Typically, living tissue will be permanently destroyed at temperatures of approximately 45\u00b0 to 50\u00b0 C sustained for several seconds .The tissue surface is cooled by the blood flow and thus the highest temperature during radiofrequency delivery occurs slightly below the surface.The impact of the target temperature on lesion size was evaluated by the author in an in vitro study. A 4-mm tip catheter  was positioned in a parallel orientation to porcine epicardium either with 0.5 N or 1.0 N contact force. A total of 48 lesions was produced with different target temperatures of 50, 60, 70 and 80\u00b0 C . Each setting was repeated 6 times and the average values were used for evaluation. The results are given in With increasing target temperature the delivered power, tip temperature and lesion dimension increased. Lesions created with a target temperature of 50\u00b0 C were very small and nearly unrecognizable.These results indicate that the lesion size could be well predicted by measuring tip temperature. However, the in vitro experiments were performed under stable flow conditions. In the in vivo situation, the flow is dependent on the ablation site and also varying over the heart cycle. These cooling effects have a strong impact on the catheter tip temperature and thus on the delivered power and also on lesion size.Petersen et al. evaluated the impact of convective cooling on lesion dimension . In vitrWith increasing flow, i.e. increasing convective cooling, lesion depth, width and volume increased due to increasing power consumption to reach and maintain target temperature. Note, that the tip temperature was not different and is thus a poor indicator for lesion size if the flow condition is not stable.Petersen et al. induced a total of 13 lesions in 6 pigs either at the left ventricular apex or at the mid-septum of the left ventricle  The major part is dissipated as electrical heating of the intracavitary blood, convective heat losses from electrode to blood, electrical heating of tissue outside the lesion volume and in electrical resistance of catheter and skin and fat layers at the indifferent electrode.Changing the 4-mm tip electrode orientation from parallel to perpendicular decreases the proportion of the electrode tip area that is in contact with the tissue and increases the proportion of the tip area that is exposed to the convective cooling of the surrounding fluid. The larger lesion volume in the perpendicular electrode orientation suggests that cooling by flow around the electrode has greater impact than contact area. However, one would expect a significantly higher power delivery in the group with larger lesion volume. This can be explained by the fact, that only a minor fraction of the energy delivered by the generator is used for the lesion production itself. [Chan et al. published results based on in vivo data that are in conflict with those described by Petersen  and a liIn 26 dogs 144 lesions were created either in a parallel or perpendicular orientation in the right atrium with a target temperature of 75\u00b0 C for 60 s using different tip lengths. The orientation was confirmed by fluoroscopy and intravascular ultrasound. For reasons of comparison only the results for the 4-mm tip catheter are given in The lesion volume was larger for the parallel orientation as compared to the perpendicular orientation which is in contradiction with the results from the in vitro study performed by Petersen et al.. However, all lesions were markedly smaller than in the previously summarized studies mainly due to the small lesion depth. The lesions were produced in the right atrium and the atrial wall is rather thin. The lesions would have been deeper in thicker tissue-note that 10 out of 14 for the perpendicular orientation and 9 out of 14 for the parallel orientation were transmural.Chugh et al. who performed similar experiments in the left ventricle confirmed this . They anThe lesion depth was markedly higher than that of the atrial applications and similar to the values that Petersen et al. reported. Although there was a trend that the lesions produced in the parallel orientation were larger the difference did not reach statistical significance.Based on these studies one may conclude that lesion depth is only little affected by catheter tip orientation using 4-mm long tip catheters but that lesions are slightly longer in the parallel orientation as compared to the perpendicular orientation.Petersen et al. evaluated the impact of electrode tip length on lesion size in 34 pigs . LesionsThe lesion volume increased with increasing tip length for tip lengths between 2 and 10-mm. The lesion volume produced with an 8-mm long tip was about twice as big than that with a 10-mm tip catheter and even 3 times as big than that produced with a 4-mm tip catheter. Further increase in tip length did not result in further increase in lesion volume. With a very long catheter tip a large part is exposed to the blood flow and more energy is dissipated into the blood stream. Note that the average temperature decreased with increasing tip length and was thus a poor (or no) indicator for lesion volume. It is the amount of power that is effectively delivered to the tissue that determines lesion size. In addition, the depth did not differ between 4 and 8-mm tip catheters, the produced lesions are only wider but not necessarily deeper. Also, the applied average power was \"only\" 49 W for lesions created with an 8-mm tip catheter. Limiting the wattage to 50 W may reduce the likelihood of coagulum formation without compromising lesion size.Langberg et al., who also produced lesions in the left ventricle using either 4-mm, 8-mm or 12-mm tip catheters, confirmed these results in part . The tarThe power required to achieve a steady state temperature of 80\u00b0 C was directly proportional to electrode size. The lesions produced by the 8-mm tip electrode were nearly twice as deep and four times as large as those made with a conventional 4-mm tip electrode. Lesions produced by the 12-mm tip electrode were intermediate in size and sometimes associated with charring and crater formation. Langberg et al. stated furthermore that ablations with larger tip electrodes caused a drop in arterial pressure and more ventricular ectopy than those with a 4-mm tip electrode.The main difference to the results published by Petersen et al. is that lesions produced with the 8-mm tip catheter were also much deeper than those produced with the 4-mm tip catheter in the Langberg study. In concordance to the Petersen study, the use of a very large electrode did not further increase lesion size, and the tip temperature was even negatively correlated with lesion size. The clinical relevance of the fact that 8-mm tip catheters produce larger lesions was demonstrated by Tsai et al. [Simmers et al. evaluated the relation between RF duration and lesion size and published their results in 1994 [These results indicate that the lesion is predominantly generated within the first 10 seconds of energy delivery and reaches a maximum after 30 s. Further extension of RF delivery during power controlled RF delivery does not seem to further increase lesion size.It is difficult to evaluate the impact of electrode-tissue contact in the in vivo situation since the contact pressure between electrode and tissue cannot be assessed by fluoroscopy and a direct indicator for tissue contact is lacking at present. Some studies have been published where the influence of the electrode-tissue contact has been investigated in a well controllable in vitro environment. However, the conclusions out of these studies need to be drawn carefully to avoid misleading interpretations.The author produced in vitro ablations on porcine myocardium with a 7F, 4-mm tip electrode with different electrode-tissue contact forces and a target temperature of 70\u00b0 C for 30 s (50 max. output) ,11. A thmoderate contact force further increase in contact force results in progressively smaller lesions because less amount of RF power is required to reach target temperature. Between 0.2 and 0.9 N  the lesion depth is not much affected by the contact force and increasing contact force is balanced by decreasing applied power. These experiments were performed under stable flow conditions and in conclusion it seems likely that the flow around the electrode is of greater impact on lesion size than that of the electrode-tissue contact.It is the amount of RF delivered effectively into the tissue that determines tissue heating and thus lesion generation. With increasing electrode-tissue contact a higher amount of RF power can be effectively brought into the tissue resulting in increasing lesion depth. At a certain Irrigation has been introduced to avoid overheating at the tissue-electrode interface, thus allowing the delivery of higher amounts of RF power for a longer duration to create relatively large lesions.Skrumeda et al. compared lesions created with a standard 4-mm tip catheter (RF Marinr) with those created with an irrigated tip catheter (RF Sprinklr) in animal experiments . Three aWith a standard electrode, lesions were larger with a target temperature of 90\u00b0 C as compared to those created with a target temperature of 70\u00b0 C, however, a coagulum was observed in 95% of applications with a target temperature of 90\u00b0 C. The largest irrigated lesions were formed using 50 W (986\u00b1357 mm3) but were associated with craters in 54% and coagulum in 27% of the applications, respectively. Large lesions without craters and coagulum were created with irrigation using 20 W for 10 minutes (602\u00b1175 mm3). Skrumeda et al. concluded that irrigated ablation created larger lesions than standard ablation and that large lesions may be created without craters using moderate power and long duration !Petersen et al. compared lesions produced by standard temperature controlled RF delivery (TC) with those produced by either power controlled RF delivery (PC) with a high irrigation flow rate (20 ml/min) or temperature controlled RF delivery with a low irrigation flow rate (1 ml/min) . The resPetersen et al. demonstrated that lesion size and tissue temperatures were significantly higher during irrigated tip ablation compared to standard temperature controlled RF delivery (p<0.05). Lesion volume correlated positively with tissue temperature (r=0.87). The maximum recorded tissue temperature was always 1 mm from the ablation electrode. Crater formation only occurred at tissue temperatures of greater than 100\u00b0 C.Based on the results of this in vitro study it may be concluded that irrigated temperature controlled RF delivery yields relatively large lesions without crater formation if a moderate target temperature between 60 and 70\u00b0 C and a low irrigation flow rate of 1ml/min are chosen. A target temperature of greater than 70\u00b0 C may result in tissue overheating and crater formation.Weiss et al. investigated the influence of different flow rates on lesions produced on the thigh muscle in six sheep . A totalThe tissue temperatures at 7-mm depth, the lesion depth and width were not significantly different between the 3 different flow rates. The diameter measured at the surface was significantly smaller following RF applications with an irrigation flow rate of 20 ml/min due to increased cooling at the surface, which resulted also in lower tissue temperatures at a depth of 3.5 mm. Neither audible pops nor thrombus formation was observed in all applications. Based on these results a flow rate of 10 ml/min may be recommended when operating an irrigated catheter in the power controlled mode with a target power of about 30 W. The application of more than 30 W may require a higher flow rate to avoid excessive heat development at the superficial tissue layers.Jais et al. published the results of a prospective randomized comparison of irrigated tip versus conventional tip catheters for ablation of atrial flutter .Cavotricuspid ablation was performed with a conventional (n=26) or an irrigated tip catheter (n=24). RF was applied for 60 seconds with a temperature-controlled mode: 65\u00b0C to 70\u00b0C up to 70 W with a conventional catheter or 50\u00b0C up to 50 W  with the irrigated tip catheter. Complete bidirectional isthmus block was achieved for all patients. Four patients crossed over from conventional to irrigated tip catheters. The number of applications, procedure duration, and x-ray exposure were significantly higher with the conventional than with the irrigated tip catheter: 13\u00b110 versus 5\u00b13 pulses, 53\u00b141 versus 27\u00b116 minutes, and 18\u00b114 versus 9\u00b16 minutes, respectively. No significant side effects occurred, and the coronary angiograms of the first 30 patients after ablation was unchanged.Jais et al. concluded that irrigated tip catheters were found to be more effective than and as safe as conventional catheters for flutter ablation, facilitating the rapid achievement of bidirectional isthmus block.Yamane et al. used an irrigated tip catheter for the ablation of accessory pathways resistant to conventional catheter ablation .Among 314 accessory pathways in 301 consecutive patients, conventional ablation failed to eliminate accessory pathway conduction in 18 accessory pathways in 18 patients (5.7%), 6 of which were located in the left free wall, 5 in the middle/posterior-septal space, and 7 inside the coronary sinus (CS) or its tributaries. Irrigated tip catheter ablation was subsequently performed with temperature control mode , a moderate saline flow rate (17 ml/min), and a power limit of 50 W (outside CS) or 20 to 30 W (inside CS) at previously resistant sites. Seventeen of the 18 resistant accessory pathways (94%) were successfully ablated with a median of 3 applications using irrigated tip catheters. A significant increase in power delivery was achieved  with irrigated tip catheters, irrespective of the accessory pathway location, particularly inside the CS or its tributaries. No serious complications occurred.Yamane et al. concluded that irrigated tip catheter ablation is safe and effective in eliminating accessory pathway conduction resistant to conventional catheters, irrespective of the location.Nabar et al. used irrigated tip catheters for ablation of ventricular tachycardias that were resistant to conventional catheter ablation .Eight patients  in whom the clinical target VT (cycle length 430\u00b197 msec) could not be ablated using a conventional 4-mm tip RF ablation catheter underwent additional attempts to ablate this VT using an irrigated tip catheter. Ablation of the clinical target VT using an irrigated tip catheter was attempted from the left ventricle in 6  and from the right ventricle in 2 patients , by entrainment, activation, or pace mapping. A mean of 6\u00b15 (range 2 to 15) pulses was delivered. Target VT ablation was successful in 5 patients (63%). After successful ablation, at a mean follow-up of 6.5\u00b14 months and while taking antiarrhythmic drugs, all 5 patients were free of VT recurrences. Nabar et al. concluded that the clinical target VT could be ablated using an irrigated tip catheter in 5 (63%) of the 8 patients in whom ablation using a conventional RF catheter was unsuccessful.The target temperature for 4-mm tip catheters should be less than 80\u00b0 C. Since tissue temperature can be markedly higher than tip temperature a higher target temperature may increase the incidence of tissue overheating associated with crater formation and coagulum formation. The lesion size is poorly correlated to tip temperature in the in vivo situation. In high flow areas the tip is cooled and more RF power is delivered to the tissue to reach target temperature resulting in relatively large lesions and vice versa. Consequently, in high flow areas in the heart the difference between tip temperature and tissue temperature is large and a lower target temperature should be considered  whereas in low flow areas the tissue temperature is much better reflected by the tip temperature and a higher target temperature could be considered .The duration could be limited to 30 seconds for non-irrigated 4-mm tip electrodes. The lesion is formed within the first 30 seconds predominantly. A longer duration does not create larger lesions.A larger portion of 8-mm tip catheters is exposed to the blood and thus cooled by the blood flow and a relatively large difference between tip temperature and tissue temperature can be expected. Consequently, a moderate target temperature  should be chosen and the RF power may be limited to 50-60W to avoid tissue overheating and coagulum formation.An irrigation flow rate of 10ml/min may be selected in a power controlled mode with a delivered power of up to 30 W. The irrigation flow rate should be increased to 15-20 ml/min when more than 30 W are delivered to avoid excessive heat development at the superficial tissue layers.The RF duration in power controlled mode with irrigated tip catheters should be considered to be longer than 30 s. Instead of increasing the power to achieve the desired effect (which increases the likelihood of crater formation) the duration could be increased. Skrumeda demonstrated lesions of similar size with 20 W for 300 s as with 50 W for 30 s. Consequently, a moderate power of 20-35W with relatively long RF duration of 60-300 seconds should be considered to achieve relatively large lesions with a limited risk of crater formation."}
+{"text": "Active magnetic resonance imaging implants, for example stents, stent grafts or vena cava filters, are constructed as wireless inductively coupled transmit and receive coils. They are built as a resonator tuned to the Larmor frequency of a magnetic resonance system. The resonator can be added to or incorporated within the implant. This technology can counteract the shielding caused by eddy currents inside the metallic implant structure. This may allow getting diagnostic information of the implant lumen (in stent stenosis or thrombosis for example). The electro magnetic rf-pulses during magnetic resonance imaging induce a current in the circuit path of the resonator. A by material fatigue provoked partial rupture of the circuit path or a broken wire with touching surfaces can set up a relatively high resistance on a very short distance, which may behave as a point-like power source, a hot spot, inside the body part the resonator is implanted to. This local power loss inside a small volume can reach \u00bc of the total power loss of the intact resonating circuit, which itself is proportional to the product of the resonator volume and the quality factor and depends as well from the orientation of the resonator with respect to the main magnetic field and the imaging sequence the resonator is exposed to.First an analytical solution of a hot spot for thermal equilibrium is described. This analytical solution with a definite hot spot power loss represents the worst case scenario for thermal equilibrium inside a homogeneous medium without cooling effects. Starting with this worst case assumptions additional conditions are considered in a numerical simulation, which are more realistic and may make the results less critical. The analytical solution as well as the numerical simulations use the experimental experience of the maximum hot spot power loss of implanted resonators with a definite volume during magnetic resonance imaging investigations. The finite volume analysis calculates the time developing temperature maps for the model of a broken linear metallic wire embedded in tissue. Half of the total hot spot power loss is assumed to diffuse into both wire parts at the location of a defect. The energy is distributed from there by heat conduction. Additionally the effect of blood perfusion and blood flow is respected in some simulations because the simultaneous appearance of all worst case conditions, especially the absence of blood perfusion and blood flow near the hot spot, is very unlikely for vessel implants.3. Even temperature increases in the range of thermal ablation are reached for substantial volumes. MR sequence exposure time and hot spot power loss are the primary factors influencing the volume with critical temperature increases. Wire radius, wire material as well as the physiological parameters blood perfusion and blood flow inside larger vessels reduce the volume with critical temperature increases, but do not exclude a volume with critical tissue heating for resonators with a large product of resonator volume and quality factor.The analytical solution as worst case scenario as well as the finite volume analysis for near worst case situations show not negligible volumes with critical temperature increases for part of the modeled hot spot situations. MR investigations with a high rf-pulse density lasting below a minute can establish volumes of several cubic millimeters with temperature increases high enough to start cell destruction. Longer exposure times can involve volumes larger than 100 mmind < 2 cm3) are definitely save. Stents for coronary vessels or resonators used as tracking devices for interventional procedures therefore have no risk of high temperature increases. The finite volume analysis shows for sure that also conditions not close to the worst case reach physiologically critical temperature increases for implants with a large product of inductance volume and quality factor (Q Vind > 10 cm3). Such resonators exclude patients from exactly the MRI investigation these devices are made for.The worst case scenario assumes thermal equilibrium for a hot spot embedded in homogeneous tissue without any cooling due to blood perfusion or flow. The finite volume analysis can calculate the results for near and not close to worst case conditions. For both cases a substantial volume can reach a critical temperature increase in a short time. The analytical solution, as absolute worst case, points out that resonators with a small product of inductance volume and quality factor (Q V Metallic implants often cause distortions inside magnetic resonance images. These effects arise either from the different susceptibility of tissue and metal, disturbing the gradient for spatial encoding, or from induced eddy currents on the metallic implant structure forming a Faraday cage -4. An adThis technology has the great advantage of amplifying the signal only, where it is needed, i. e. inside the Faraday cage. The signal or contrast behavior of the rest of the image plane (volume) is unaffected by these devices. Up to now, active MRI implants have not been tested in clinical trials, but active MRI stents have been investigated in rabbits ,10. Examhs of a hot spot more efficiently than a pure tissue surrounding does. A finite volume analysis respects these situations more precisely and can investigate, whether failures of such resonators can cause unsafe conditions during MRI acquisitions even with some additional temperature reduction mechanisms. A robust and easy-to-implement algorithm is used for the risk analysis, because this simulation does not have to predict exact temperature increases, contrary to planning algorithms for therapies like hyperthermia or thermal ablations. Instead the analytical solution gives the principal risk for the worst case. The finite volume calculations should evaluate, if the risk also exists using a metallic wire inside homogeneous tissue and even with cooling due to blood perfusion superior to the physiological values and blood flow. Danger in our understanding means, that a substantial part of tissue volume is heated to a temperature, which can induce cell death. The simulations calculate temperature maps developing in time around a defect. From these temperature maps a critical volume with temperatures exceeding a critical value can be calculated. In order to increase the speed of the calculation the finite volume simulation assumes a cylindrical symmetry associated with a linear wire. This involves, that the hot spot power loss is split into two equal parts, which diffuse into both of the assumed fracture surfaces of the metallic wire. The further heat distribution is assumed to arise from heat conduction only, or from heat conduction and blood perfusion \u2013 implementing an algorithm based on the idea of Pennes equation  of a resonator with his axis aligned perpendicular to the main magnetic field and exposed to a series of identical excitation pulses of an MRI investigation is given by  is the angular resonance frequency, \u03bc0 [Vs/(Am)] is the permeability of vacuum, Q is the quality factor of resonance circuit inside tissue, B1 [T] is the amplitude or magnitude of the magnetic field established by a linear or respectively circular polarized transmit coil of the MR system, Bind= B1 Q is the magnetic field inside the inductance of the resonator and Vind [m3] is the volume of the resonators inductance. In this investigation the inductance volume and the implant volume are assumed to be equal. The factor cdc is the duty cycle of pulsed MR sequences and equals the ratio of the duration \"rf excitation on\" during the total acquisition time and the total acquisition time itself. cpwm describes the pulse waveform modulation and is the ratio between the energy of one excitation pulse with a maximum amplitude/magnitude A and the energy of a rectangular excitation pulse with same length and identical amplitude/magnitude A. A detailed derivation of Eq. (1) is outlined in  is the inductance and R [\u03a9] the resistance of a resonance circuit. Thus the overall power loss (Eq. 1) is reduced by the factor Rov/(Rov+Rhs). Only the part Rhs/(Rov+ Rhs) of this reduced total power loss occurs at the break. It is given with respect to the total power loss of the intact resonator Ploss byThe struts of stents, stent grafts or vena cava filters implanted in human vessels are exposed to perpetual changing forces and permanent movements, which can cause fatigue fractures ,14. A paPloss of Eq. 1 at Rhs = Rov yielding [and has the maximum value with respect to yielding sphere emitting a constant power P uniformly from the sphere surface inside a homogeneous medium surrounding the power emitting sphere disregarding blood perfusion. This model is a good approximation for a point-like power source. After reaching the thermal equilibrium the constant power penetrates through every spherical surface surrounding the power source in the sphere center independent of the radius r (with side condition r > rsphere). The temperature difference \u0394T [K] between a point at the hot spot surface and a point far away (\u221e) from the power source, which for a living system is a point with the normal body temperature, can be calculated in a homogeneous medium for a power loss P from the equation for heat diffusion,An analytical description of the thermal uptake around a hot spot with respect to the metallic structure, the electrical paths of the resonance circuit and different power loss mechanisms is not possible. An easy analytical description is possible for a sphere with radius r-1 K-1] is thermal conductivity. Equation 3b can be resolved for the critical radius rcrit, which describes the distance below that a critical temperature increase \u0394Tcrit is exceeded. From the critical radius rcrit the critical volume of the sphere with temperature increases above \u0394Tcrit can be calculated.where \u03bb, sometimes also cited as [(kg) of blood \u00d7 (m-3) of tissue \u00d7 (s-1)]), the heat transport due to blood flow in larger vessels, the metabolic heat production Qmet inside living tissue and the applied power Pex to the body from external sources. This investigation is a test on persisting dangerous conditions using near worst case assumptions and therefore uses simplifications. For the comparison with the analytical model only the heat transport by the thermal conductivity of tissue is considered. Other calculations also take into account the influence of the metallic wire as well as blood perfusion. Some simulations additionally estimate the volume with a critical temperature increase around a hot spot inside a vessel wall with a cooling blood flow inside the vessel lumen in a very short distance from the hot spot.During the last fifty years since Pennes publication ,16 on thThe simulations are not performed with commercially available software. The algorithm is self-coded for problems with cylindrical geometry in Kylix and Delphi, a software development environment, based on object oriented Pascal. The graphical outputs are mostly generated by an evaluation version of Teechart 7 (registered \u03b2-test) used within the Delphi and Kylix environment. The implemented algorithm is essentially the same as the one in the first part of the investigation , but it total simulation volume is a cylinder with length 2Lsim and diameter 2Rsim. This is adequate for a straight wire along the cylinder axis with radius rwire. The chosen geometry allows the use of cylinder coordinates  and reduces the calculation time taking advantage of two symmetries. Firstly, the model needs not to consider \u03c6 in cylindrical coordinates because of the cylindrical symmetry and can use finite volumes only dependent on r and x.The x-axis of the cylindrical coordinate system and divides the total simulation volume into two parts . The calculation volume with length Lsim and radius Rsim \u0394 \u00d7  on the cylinder axis. Each sub-cylinder of length \u0394 \u00d7 is divided in one inner cylinder with radius rwire (i = 1) and m-1 shells of thickness \u0394r.Secondly, a plane of mirror symmetry exists, which is orthogonal to the s Figure . The simm Figure  thereforE [J] between two simulation cells with a specific contact area A[m2], a temperature difference \u0394T [K] and a heat diffusion path length d[m] during a time interval \u0394t [s] is given by the equation for heat conduction asThe energy exchange \u0394E for a cell C has to be chosen such, that it is positive for receiving energy and negative for an outgoing energy. The total energy change \u0394Etot of one cell during a time interval \u0394t is the sum of all exchanges with adjacent cells with non-zero contact area and the energy change due to a heating power pcell inside the cell.For the following, the sign of \u0394pcell is non-zero only at the hot spot, i. e. in the two cells at the assumed two fracture surfaces of the wire. The temperature increase \u0394T*[K] of one cell during one iteration step can be calculated byVcell [m3] is the cell volume and \u03c1[kg/m3] is the density of the material of Vcell.where c[J/(kg K)] is the specific thermal capacity of the cell material, Each cell C , except those at i = 1  has contact to 4 adjacent cells with contact areas different from zero (Eqs. 7a-c). These contact areas as well as the volumes of the cells (Eq. 7d) only vary with the index i.x(i) = \u03c0\u00b7\u230a(rwire + (i - 1)\u00b7\u0394r)2 - (rwire + (i - 2)\u00b7\u0394r)2\u230b \u00a0\u00a0\u00a0 i = 2, 3, 4,....,m \u00a0 \u00a0 \u00a0(7b)Ar(i) = 2\u00b7\u03c0\u00b7(rwire + (i - 1)\u00b7\u0394r)\u00b7\u0394x \u00a0\u00a0\u00a0 i = 1, 2, 3,...,m \u00a0 \u00a0 \u00a0(7c)Acell(i) = Ax[i]\u00b7\u0394x \u00a0\u00a0\u00a0 i = 1, 2, 3,...,m \u00a0 \u00a0 \u00a0(7d)Vx(i) is the contact area in both directions of the cylinder axis (from any index j to j-1 and to j+1) whereas Ar(i) is the contact area in radial direction from index i to i+1. The contact area in radial direction from index i to i-1 is identical to the area Ar(i-1). At i = n and j = m the calculation volume has boundaries. These boundaries are implemented as boundary cells at index m+1 (r-direction) and n+1 (x-direction), which work as an ideal heat sink. The boundary condition for this heat sink is dT/dt = 0, which keeps the temperature of our boundary volume constant (\u0394T = 0), even when receiving energy during one simulation step with duration \u0394t. The condition \u0394T = 0 at the outermost cells can describe on one hand, the behavior of the human body to keep its temperature nearly constant by regulating the energy transport. In our model this temperature regulation allows to shift the condition \u0394T = 0 closer to the hot spot. On the other hand \u0394T = 0 can also be a model for rapid heat transport through flow inside a larger vessel near the hot spot. A fast blood flow, which transports immediately all applied energy to the entire blood pool with an infinite thermal capacity, can be simulated by a situation, where the hot spot is close to boundary cells, which keep the temperature constant even if receiving energy. At i = 1 as well as j = 1 the calculation volume has boundaries without energy exchange. For index i = 1 no cells with lower index i  exist and therefore no energy exchange is possible. For index j = 1 with cell center position \u0394x/2 the symmetry plane defines an identical temperature at \u2013 \u0394x/2  during one iteration step with duration \u0394t. The distribution from this (these) power receiving cell(s) to adjacent cell elements is only due to heat conduction on the wire and through tissue during an iteration step. Additionally part of the energy of each cell can be transported out of the total simulation volume by blood perfusion. The calculation volume consists of a two dimensional field of cells C .The applied energy \u0394x and r) to the center of the adjacent cell, the heat conduction for such an interface takes place over two different materials with only part of the diffusion length for each of the materials . Because the thermal conductivity of tissue is much lower compared to that of metal (table wire+\u0394r)/2.All metal wire cell elements have the index i = 1. They all have identical freely definable physical parameters \u03bb, \u03c1 and c. The parameters for all other cell elements are set to the values of tissue . The simulation starts at t = 0 with a temperature field \u0394T = 0 for all indices i and j respectively. For each iteration step with duration \u0394t the total energy change \u0394Etot  for each cell C is calculated according to Eqs. 4, 5 respecting the related contact areas (Eqs. 7a-7c) and the corresponding diffusion lengths. From \u0394Etot  the temperature increase \u0394T* is calculated according to Eq. 6 respecting Eq. 7d. This value is added to the prior value according toThe entire simulated time Tnew  = \u0394Told  + \u0394T* \u2013 wb \u00b7 \u0394Told  \u00b7 \u0394t \u00a0 \u00a0 \u00a0 (8)\u0394b. It describes which part per second of a tissue volume is exchanged by perfusion against new blood from the arterial blood pool. The new part has to be heated from \u0394T = 0 to the increased temperature level and therefore the temperature increase of the cell volume C is reduced. The implementation of Eq. 8 is similar to the use of Pennes equation. In contrast to Pennes equation, Eq. 8 neither assumes different physical parameters of blood and tissue, which would lead to an additional factor modulating wb, nor uses a temperature dependent blood perfusion parameter, which increases with enlarged temperatures. It is sufficient to perform a simulation with an overall increased constant blood perfusion to check the persistence of physiological critical circumstances. Furthermore no metabolic heat production is assumed. The calculated \u0394T is assigned to the arithmetic mean of inner and outer cell limits with respect to x and r, respectively.for each cell during the whole iteration process. Eq. 8 respects a perfusion term wWtotal = Ptsim) is compared to the energy stored inside the simulation volume, computed from the final temperature increases of each cell respecting the heat capacity, added with the energy, that has left the simulation volume to any heat sink and the energy needed during the total simulation process for heating up blood from the arterial blood pool due to the perfusion term of Eq. 8. Thirdly, the algorithm was tested, whether it provides similar results for identical geometries with different spatial or different temporal resolution as well as for different sizes of the total simulation volume surrounding the hot spot.The implemented algorithm was controlled with different checks. Firstly, the numerical simulation for a tissue only environment is compared to the analytical model. Secondly, for each numerical simulation the totally applied energy at the end of the simulation , but as well on the orientation of the resonator with respect to the main magnetic field and the SAR of the applied MRI sequence. Prior experimental experiences [Q, the resonator volume and the knowledge of the applied MRI sequence the maximum hot spot power Phs can be calculated according to Eqs. 1 and 2. Alternatively, Eqs. 1 and 2 can be used to calculate the smallest inductance volume of a resonator, which effects \u2013 using worst case conditions for the quality factor (Q = 5) and MRI sequence (const = 4 mW/cm3) \u2013 a certain critical hot spot power loss.The variable parameter for the analytical model according to Eq. 3b is the hot spot power eriences  reveal qb = 0.00125 m3 m-3 s-1 [Temperature maps were calculated depending on different physical parameters respecting partly blood perfusion and blood flow inside a vessel near the hot spot. Unless otherwise noted, the following standard parameters were used for the simulation: titanium wire with 50\u03bcm radius, hot spot power of 100 mW, normal perfusion rate w m-3 s-1 , simulat1. Spatial and temporal resolution: The metal tissue interface is a critical part of the simulation. The simulations with varying spatial resolution in both directions as well as a better temporal resolution allow the assessment of the temperature differences at the metal tissue interface.2. Time development:a. Temperature maps for a tissue-only simulation: The pure tissue temperature maps were calculated with normal blood perfusion  and the quality factor Q of the resonance circuit. A larger hot spot power is equivalent to a better quality factor and/or a larger inductance volume. Also a decreased hot spot power can simulate a resonator not perfectly aligned perpendicular to the main magnetic field or an MRI sequence without maximum SAR.3. Hot spot power: The final temperature maps were calculated with varying hot spot power loss 4. Material: The final temperature maps were calculated for four different metals of the linear wire  to test influences of the thermal conductivity.5. Radius: The final temperature maps were calculated with varying radius of a titanium wire (30 \u03bcm \u2013 500 \u03bcm) to check the influence of the increased heat transport capability of a metallic wire with a larger radius.3 m-3 s-1 to 0.02 m3 m-3 s-1) for tissue.6. Perfusion rate: The final temperature maps were calculated with normal and increased perfusion rates  or blood flow. Figure crit the critical volume Vcrit can be easy calculated.The analytical model describes the worst case in all aspects, because it assumes an indefinite exposure time to the excitations of an MRI sequence without respecting any blood perfusion  a linear relation between the hot spot power Phs and the volume of the implants inductance Vind exists, where the constant of proportionality is determined by the maximum quality factor Qmax of a resonator inside tissue and the maximum power loss density PV of table Qmax = 5 [Phs and Vind is that of Figure A certain hot spot power can be converted into the smallest inductance volume capable of setting up this hot spot power Qmax = 5  the line3 can develop a hot spot power above 2 mW, which is, according to Figure 3; this means they are safe even under worst case conditions.Looking at the graph in Figure wire = 50 \u03bcm are set to those of tissue and the parameter of blood perfusion wb is set to zero (Eq. 8). Even though the cylindrical geometry is not the best choice for a spherical problem, the simulation results should converge to the analytical solution, if the simulation time is sufficiently long and the simulation volume is sufficiently large. Figure Figure As long as the temporal resolution is high enough to prevent the simulation results from an oscillatory behavior, an increased temporal resolution does not change the calculated maps. Therefore it is sufficient to use the lowest possible temporal resolution for a certain spatial resolution.An increased spatial resolution as well as an increased thermal conductivity of the wire always requires an increased temporal resolution to exclude erroneous results. With better spatial resolution in radial direction (keeping the wire diameter constant) the wire temperature curve and the tissue temperature directly adjacent to the wire approach to each other with a predominant increase of the tissue temperature. A better spatial resolution just in axial direction changes mainly the maximum temperature increase on the wire. This is obvious, because with a shorter cell volume in axial direction, the center of the cell moves closer to the hot spot, where the analytical model has an infinite temperature increase. Changing both spatial resolutions by the same factor combines the two effects; it leaves the temperature increase on the wire nearly unchanged and reduces the differences between wire and tissue temperatures figure . For allr- and x-direction respectively, as well as the critical volume with temperature increases above 5 K. At the end of the movie, two views are shown alternately at a simulated time of 900 s. Both views are identical in all simulation parameters except the simulation volume. The size of the simulation volume is doubled in x direction as well as in r direction. This shifts the energy (heat) sink further away from the hot spot itself. One of the alternating results was calculated using a 250 \u00d7 250 matrix for a size up to 12.5 mm for r and x respectively. The second map was calculated for a 500 \u00d7 500 matrix for a size up to 25 mm for r and x respectively. Only the inner 250 \u00d7 250 points are plotted for the comparison of both calculations. It can be seen that the temperature distribution is almost identical apart from the fact, that for x \u2248 12.5 mm and r \u2248 12.5 mm the simulation with more cells shows a slight deviation from the zero line. The simulation with the smaller matrix shows a straight zero line at r250 and x250, which is obvious, because this is the boundary condition for this simulation. The small difference between both simulations points out, that the boundary condition with a heat sink works very well as long as the absolute value of the gradient at the boundary is low. The effect of the heat sinks can also be seen in the accumulated energy that has left the simulation volume to any heat sink during the simulated time . For the smaller simulation volume 71 J of the applied total energy of 90 J leave the simulation volume. For the larger volume the value is reduced to 45 J. Without blood perfusion the 'lost' energy for both volumes decreases to 67 J and 20 J respectively. The critical volume with temperature increases over 5 K is only moderately reduced by normal blood perfusion. Without blood perfusion it is 72 mm3 and 86 mm3 for the small and large volume respectively, whereas the critical volume with blood perfusion reaches 59 mm3 and 64 mm3 (see Movie 1 see  presents mm3 see .3 to 63 mm3).As comparison to the tissue-only simulation the second movie see  presentsPhs is linearly dependent on the quality factor Q, whereas assuming a constant Q, Phs is linearly dependent on the volume.The variation of the hot spot power corresponds \u2013 for a specific MRI sequence  to the near worst case situation with an exposure time of only 900 s and with a model of a metallic wire in tissue shifts the lowest hot spot power loss W Figure . For 100W Figure  and 200 W Figure  the simuBecause of the better thermal conductivity of a metallic wire compared to tissue, the introduction of the metallic wire, which is present for all real cases, lowers the risk of the analytical situation with the assumption of a hot spot inside homogeneous tissue. Various wire materials distribute the heat more or less efficiently in wire direction depending on the thermal conductivity. For example, iron has a thermal conductivity about four times as large as that of titanium table . However3 , a hot spot power of 100 mW causes a critical volume of 25 mm3 Figure . The mor3/(m3s) was used [b, which is much broader than the range determined by the temperature dependence. Figure b = 0.00125 m3/(m3s) under normal circumstances . The results show the expected decrease in the critical volume, but even the strongest blood perfusion can not suppress the formation of a critical volume.For all prior described simulations the constant perfusion value corresponding to the normal perfusion value of 0.00125 mwas used . In the was used . This fes Figure . It is i3 was calculated for a high power loss. This value of the critical volume is reached within a few seconds . Increasing the critical temperature to 10 K, 15 K or 20 K, yields minimal hot spot power losses of about 3 mW, 5 mW and 6. mW respectively. It is important to note, that the analytical solution overestimates the worst case in two parameters. Firstly an MR sequence lasts not long enough to reach the thermal equilibrium. Secondly no metallic wire with a better thermal conductivity is respected, which can distribute the energy of the hot spot more efficient and increases therefore the minimum necessary hot spot power. This is one reason for checking the analytical results with a finite volume analysis.total = Phstsim. The simulation results also increasingly approach the analytical solution for a sphere inside a homogenous medium for thermal equilibrium using only heat distribution due to thermal conductivity of tissue  during the simulated time is equal to the total applied energy We Figure . Movie 1e Figure  also indwire 50 \u03bcm) for such a simulation has to be smaller than 750 \u03bcs to inhibit oscillatory results. For iron with an fourfold better thermal conductivity the temporal resolution has to be below 300 \u03bcs. For this reason all calculations are done with 200 \u03bcs. For 900 s simulated time this spatial and temporal resolution requires 4.5 million temperature calculations for each of 200,000 cells. The calculation time using a PC with a 3 GHz processor was more than a day. A resolution twice as good in both directions as the prior described one was only tested once for titanium . The total power loss of a specific resonator can be calculated by multiplying this value with the inductance volume and the quality factor of the resonance circuit inside human tissue. As worst case volume a vena cava filter or a stent graft for an aortic aneurysm with 50 cm3 is assumed with a resonator quality factor of 4 . This r3 are reached in similar times. The maps of Figure The material of the wire is less important. With all materials substantial critical volumes can be reached Figure . The var3 in a few seconds.The radius of the metal wire modifies the results more efficiently than the material does, but also an unacceptably large wire radius of 0.5 mm (diameter of 1 mm) reduces the critical volume for a 100 mW hot spot power loss only to roughly one third Figure . The spe3/(m3s)  Figure . A non-n) Figure , which a3, which is reached within the order of 10 seconds , a defect can induce physiologically dangerous heating with starting cell destructions under worst case assumptions. To incorporate the normal anatomical situation of a cooling blood flow, we implement models with a heat sink near the hot spot. This approach is an attempt to model a situation without re-calcification, thrombosis or intima hyperplasia inside the vessel the resonator is implanted to. Such a situation has the cooling blood flow very close to the hot spot and is definitely away from a worse case assumption. The results show that even for this case a physiologically critical temperature increase for a non-negligible volume can be induced. The simulations evaluate a critical volume of more than 1 mms Figure .3 within a few seconds , which is of no advantage in overcoming any Faraday cage shielding, can reach a hot spot power loss of 50 mW . Such high hot spot power losses reach critical volumes larger than 1 mm3 in a few seconds. The analytical solution as well as the simulations show that the hot spot power is the dominating parameter for the safety investigation. The material or the radius of the wire (stent strut) does not reduce the worst case scenario significantly. Additionally, neither blood perfusion nor blood flow in the direct vicinity of the hot spot reduces the critical volume to an uncritical value as calculated by the numerical results. Considering the fast rise time of the temperatures directly adjacent to the hot spot, bursting cells as well as the increased temperature are very likely to induce a thrombosis shielding the blood flow more and more from the hot spot. A volume of a few cubic millimeters is reached by MR sequences with a high SAR within a few seconds.The analytical solution as worst case shows, that small active implants with r losses ,12 or faFor safety reasons, patients with such large active implants should be excluded from MRI investigations at the resonance frequency the resonator is made for. Such large devices are therefore useless in dealing with the Faraday cage effect disturbing the lumen information of metallic implants.Eventually large active implants can be safely constructed by using additional (passive) electronics, which shortcuts the resonator during the excitations of an MRI sequence and leaves the resonator operational during detection. Such electronics would exclude the flip angle amplification, but maintain the signal amplification during the detection phase.Another very important safety topic, that should be monitored carefully using active implants, is the achievable amplification homogeneity inside the lumen of such devices. Very low susceptibility artifacts as well as a homogeneous amplification are extremely important for the use of active implants as inductively coupled imaging coils. Although the usual stent materials  seem to be non magnetic, they are actually paramagnetic in contrast to the mostly diamagnetic tissue. For small active implants like stents for coronary vessels, which are safe concerning temperature effects, the susceptibility artifacts can inhibit the imaging of a substantial part of the stent lumen. For example a stent with a diameter of 3 mm constructed of a paramagnetic material may seem to have a wall thickness of more than 1 mm in MRI images (depending on the bandwidth of the sequence), although the actual thickness is about 0.1 mm. Such a stent in fact does not benefit from an active technology. A large part of the stent lumen and unfortunately the one near the vessel wall, where critical situations most likely occur, is hidden by susceptibility artifacts for numerous sequences.For a serious interpretation of the implant lumen a sufficiently homogeneous rf magnetic field inside the resonator coil is also necessary. The well known coil types  perform quiet well, if they have their ideal geometry. They probably perform worse, if their usual geometry is changed to an expandable version, which is necessary for an implantation by a catheter. An additional distortion of the field homogeneity is unpreventable, if the expansion of the coil by inflation of a balloon is not perfect. As a consequence, the MR sensitivity inside the lumen may vary significantly within a very small region. This can lead to severe misinterpretations of the acquired images. For safety reasons the spatial amplification of active devices has to be investigated depending on not ideal geometries as well as on not perfect expansions. Small active magnetic resonance implants may have a high potential for a non invasive follow up. But before clinical trials numerous unanswered questions must be addressed.Movie 1 of the time developing temperature map for tissue. This movie (animated GIF) shows the time development for the case of a hot spot in tissue without wire and with blood perfusion over a period of 900 s, which is the maximum permitted time for imaging the trunk with an SAR of 4 W/kg (sequence of table Click here for fileMovie 2 of the time developing temperature map for titanium wire. This movie (is movie  is very is movie . InsteadClick here for file"}
+{"text": "Computational discovery of transcription factor binding sites (TFBS) is a challenging but important problem of bioinformatics. In this study, improvement of a Gibbs sampling based technique for TFBS discovery is attempted through an approach that is widely known, but which has never been investigated before: reduction of the effect of local optima.Saccharomyces cerevisiae. It is noteworthy that the marked improvement of the efficiency presented in this paper is attributable solely to the improvement of the search method.To alleviate the vulnerability of Gibbs sampling to local optima trapping, we propose to combine a thermodynamic method, called simulated tempering, with Gibbs sampling. The resultant algorithm, GibbsST, is then validated using synthetic data and actual promoter sequences extracted from Simulated tempering is a powerful solution for local optima problems found in pattern discovery. Extended application of simulated tempering for various bioinformatic problems is promising as a robust solution against local optima problems. One of the most important and challenging problems in post-genomic stage of bioinformatics is the automated TFBS discovery ; computaOptimization problems with large numbers of parameters are generally prone to the problem of local optima, and discovery of TFBS  is no exception. In particular, one of the most promising types of stochastic pattern discovery methods in terms of its flexibility and wide range of application, generically called Gibbs sampling , is knowIn pattern discovery and bioinformatics in general, improvement of search methods in the solution space has been neither systematic nor satisfactory. The method most frequently tried is the simulated annealing(SA) -6. FrithIn general, there has been a real disparity between the lack of interest in improving the search methods and the strong interest in creating new models for TFBS discovery. Moreover, the active introduction of new ideas into this field is making the disparity even stronger, because many of the new ideas are related to increasing the number of parameters. For example, automated phylogenetic footprinting ,10 is a temperature\" T, the introduction of which into a local-alignment problem has already been reported [T adaptively to the current score of alignments. By changing T, ST adopts continuously changing search methods ranging from a fast deterministic-like search to a random-like search, reducing the possibility of being trapped in local optima. This principal is schematically shown in Fig. GibbsST. The validation of our algorithm is also presented on synthetic test data and promoter sequences of Saccharomyces cerevisiae.In this paper, we demonstrate that simulated tempering (ST) , which ireported . The novT, into the \"classic\" Gibbs sampling algorithm proposed by Lawrence et al. [N of input sequences have exactly one occurrence (the OOPS-model) of the pattern, which is always Wm bp long, and negative strands are not considered.In this section, we introduce a temperature, e et al.  The detaA, and a current PWM (Position Weight Matrix), qi,j, which are iteratively updated as a Markov chain until the convergence to a pattern. The alignment A is represented by the starting points of aligned segments, xk, which form a gapless sequence block. The first half of an iterative step is the re-calculation of elements of the current PWM according to the current alignment, excluding the k-th row. Then in the second half of a step, the k-th row of the current alignment is updated by sampling a new value of xk according to weights derived from qi,j. Let l(1), l(2), ... denote the entire sequence of the row to be updated. We set the probability of the new starting point being x proportional toThe algorithm holds a current local alignment, x-th substring (x ~ x - 1 + Wm -th letters) of the k-th input sequence comes from the probabilistic model represented by the current PWM, and p0,1,2,3 . The T is a positive value which is the \"temperature\" of the system. Note that the computational complexity of the single step of the optimization is not changed by introducing the temperature.where T is extremely large. Since k circulates all N of input sequences, this is a maximization of \u03b2 \u2211 \u2211 qi,j log after all. Hence, the Gibbs sampling introduced here has the relative entropy of the pattern PWM against the background model as its goal-function (or score) to be maximized, and so does our algorithm.It is easy to see that the above introduced iteration step maximizes potential U, which is currently ( \u2013 relative entropy). Because we are not proposing a new definition of U, we do not evaluate the sensitivity and specificity of our new algorithm. In principle, the sensitivity and specificity must be independent from the search method in the limit of large step number.However, following the convention of statistical physics, we refer to TFBS discovery as a minimization of the T = \u03b2 = 1, it is reduced to the classic Gibbs sampling without the idea of temperature. In this case, there always is a finite probability of selection of non-optimal x, which gives rise to the escape from the local minima. However, the magnitude of the escape probability may not be sufficient for deep local minima, because the probability is ultimately limited by the pseudocount.When T is large enough, the x selection is almost random , and the algorithm is very inefficient despite the high immunity to the local minima problem. When T \u2192 0, on the other hand, a very quick convergence to local minima only results, because the movement in the solution space is a \"steepest-descent\" movement. In simulated annealing, the temperature is initially set to an ideally large value, Th, where essentially no barrier exists in the potential landscape, and then slowly lowered. There is a theoretical guarantee that SA converges to the global minimum when the temperature decreases slowly enough [The temperature strongly affects the behavior of the optimization algorithm. It is easy to see that when y enough . HoweverU.Simulated tempering is an accelerated version of simulated annealing and has two main features. First, the temperature of the system is continuously adjusted during the optimization process and may be increased as well as decreased. Second, the adjustment of temperature is performed without detailed analysis of the potential landscape. Temperature control is performed by introducing the second Markov chain  that is coupled with NT temperature levels, T0 <T1 <T2 ... <Th). During the optimization, the temperature is updated accordingly to the transition rates, R, given by a Metropolis-Hastings-like formula:In ST, the temperature of the system takes one of the R(Ti \u2192 Ti + 1) \u221d 1/(1 + S+) \u00a0\u00a0\u00a0 (2)R(Ti \u2192 Ti - 1) \u221d S-/(1 + S-), \u00a0\u00a0\u00a0 (3)S\u00b1 is given bywhere Zi are a normalizing factor usually called the partition function of the system, defined asThe U defined for neighboring values of Ti must be overlapped to ensure finite transition rates between these temperature levels. This mainly requires small temperature intervals.How should the temperature levels be decided in ST? Unlike the case of simulated annealing, no conclusive theory or rule is known for the decision of algorithmic parameters of simulated tempering, except for the requirement of small temperature intervals. According to the equations above, the equilibrium distributions of Ti to explore. However, considering the success of classic Gibbs sampling , we can safely assume that Th ~ 1 for the current problem. Moreover, a good starting point has already been pointed out by Frith et al. [T. Then, we extend the temperature range toward low temperature regime, retaining access to the high-temperature regime by increasing the temperature interval.The temperature levels must be decided empirically, which leaves us a vast combination of h et al. . In theiT0 and small temperature interval. Small T0 lowers |T| and accelerates convergence until the temperature interval becomes too large for a smooth transition between temperature levels. The third possibility, increasing the number of temperature levels, NT, will be briefly examined in the discussion.The point of this experimental design is to investigate the trade-off between small GibbsST\", into a C++ code. By default, the code randomly selects 50 local alignments as initial values and starts independent GibbsST optimization runs from them. The results from these multiple runs are merged  upon output. It is unrealistic to expect the current version of GibbsST to reach global optima from the fewer number of initial values. Also, the merging of multiple runs reduces the scatter of the resultant convergence profile, which is useful for evaluating our algorithm.We implemented our new algorithm, called \"d, is quite limited by our validation scheme (see Methods).In this section, our algorithm is tested on various synthetic test datasets. The performance of our algorithm is evaluated as a function of the temperature settings, and the optimal performance will be compared to that of classic Gibbs sampling. Such an empirical approach is crucially important for ST because there is no conclusive theory regarding the determination of temperature levels of ST. Basically, our model for synthetic TFBS is the one proposed in the \"motif-challenge\" problem , althougWm) is known, a performance coefficient of the current answer can be defined. In this paper, we use a performance coefficient based on the segment overlap between two alignments [Since our current goal is to make our algorithm less prone to the local optima problem, it is highly desirable that the synthetic datasets are well-characterized in terms of their global optimum alignment. If the true global optimum in a dataset , and proposal of Frith et al. (T = 0.9) were compared. To evaluate the average performance over various inputs, 100 independent datasets were generated and analyzed for each condition. The other algorithmic parameters were the same for all combinations.With 7 different modes our discovery code was applied to the synthetic datasets generated under the conditions shown in Table T in a GibbsST iteration. This data obtained by TLC5 shows that the transition of temperature levels was smooth, suggesting that all TLCs tested were appropriate regarding their temperature intervals. Also, the plot illustrates how GibbsST solves the local optima problem; the optimization process encountered a series of local optima (shown by arrows), but GibbsST escaped from those local optima by increasing the temperature for a brief period, then resumed optimization exploiting the efficiency at lower temperature.Fig. Fig. T was fixed to 0.9, the performance was significantly improved in all cases tested. However, the extent of performance improvement was always smaller than that of GibbsST. It is interesting to note that T = 0.9 performed slightly poorer than TLC2 .When T0 than that of TLC5 seems to deserve serious consideration.We can conclude that GibbsST achieves a substantial improvement in performance over existing Gibbs sampling methods when the pattern length is small and the pattern-variation level is high. It is difficult to decide the optimal temperature setting because there is very little difference in performance among TLC3, 4 and 5, although TLC5 shows the best performance. For a further performance improvement, the use of lower T methods, that is, conventional Gibbs sampling with the temperature fixed to a lower value than 1, be a substitute for GibbsST? Certainly, temperature reduction of only 10% showed a considerable performance improvement in Fig. T methods and the superiority of GibbsST, several fixed-T methods  are shown in comparison to the GibbsST algorithm in Fig. Wm = 12, d = 3) was prepared and used in this experiment because a dataset with a rough score landscape  is ideal for the current objective. In addition, a special temperature set  is used to explore the possibility of lower temperatures. Fig. Can the fixed-T = 0.5 setting shows a dramatically fast score increase in this region. However, the score increase of T = 0.5 eventually slows down: it is overtaken by T = 0.6 at ~200 steps, and by T = 0.7 at ~700 steps. In general, the greater the performance of a temperature setting is in the initial phase, the earlier the score ceases to improve. As a consequence, the scores of T = 0.5, T = 0.6 and T = 0.7 are stagnant in the final phase of optimization (right inset) and are perfectly in reverse order of their performance in the initial stage. The most probable reason for the fast score increase's subsequent performance deterioration is, of course, the local optima in the search space. Our proposal, GibbsST, is immune to such a general trend: its performance in the initial phase is not much poorer than that of best fixed-T methods, but its score in the final phase is better than any other setting tested. Considering that a small score difference may correspond to vastly different alignments in a rough score landscape of biological sequences, this level of difference in the final score is more than sufficient to clarify the superiority of GibbsST over fixed-T methods.Lowering the temperature seems to be an ideal method to improve the convergence, as long as the score increase in the first 100 steps is concerned (left inset): the T methods do have simplicity and a limited usability as a substitute of GibbsST, a crucial problem exists in employing lowered and fixed temperature in Gibbs sampling. The temperature dependence of the behavior of the optimization process, like that shown in Fig. T setting better than GibbsST exists, the fixed-T setting is not likely to be available. The optimal temperature's possible dependence on characteristics of input sequences (discussed later) further complicates the situation, and increases the possibility of exceedingly lowered temperature. Consequently, the fixed-T method is very inconvenient as an acceleration method in pattern discovery problems. In addition to the fact GibbsST outperforms all sampling scheme tested in Fig. Although fixed-In this section, we demonstrate the usefulness of our algorithm for making more realistic TFBS predictions. Although our algorithm was quite effective for synthetic datasets, the statistical characteristics of natural promoter sequences may be very different from those assumed for synthetic datasets. Such a difference may demand further adjustment of the algorithmic parameters of simulated tempering (such as the temperature levels) according to the realistic potential landscape of natural promoters.Saccharomyces cerevisiae for use in this test. There are two main reasons for this choice. First, very comprehensive information is available for this eukaryote from the Saccaromyces Cerevisiae Promoter Databases(SCPD) [We selected six transcription factors of es(SCPD) . The proSaccharomyces cerevisiae and their flanking regions as examples, Friberg et al. [The second reason is related to the characterization of test data in terms of the global optimum. Using eight real TFBS of g et al.  comparedg et al. , which wThe transcription factors we selected, reb1 , rap1 2, pdr1 2, mig1 2, mcm1 2, and abfWm was specified (by the \"-w\" option).The results are shown in Fig. Wm and a larger variation among sites is not changed. Also, the best-performing temperature setting (TLC5) was generally unchanged from the case of the synthetic dataset. Although other settings performed best in some cases (rap1 and abf1), further consideration is required since some cases also showed a marked degradation of the overall performance. When T is fixed to 0.9, the results are classifiable into two categories. In the first category, which includes reb1, rap1, and abf1, the performance of T = 0.9 is identical to that in the synthetic datasets: the performance is better than T = 1.0 and worse than that of TLC2. In the second category, the result deviates surprisingly from that observed for synthetic datasets: the performance actually deteriorated when the temperature was lowered. For mcm1 and pdr1, encouraging the search algorithm to perform locally efficient sampling (by lowering the temperature) reduces the algorithm's efficiency in a global sense. A natural interpretation of this phenomenon is that the datasets of these two TFBS bear an especially complicated score landscape, which is confirmed later in Fig. Still, the performance superiority of GibbsST over classic Gibbs sampling is clear in a majority of the tested cases. The general trend of a larger improvement for smaller It is worthwhile to take a close look at the result for pdr1, because it is quite different from the results for other transcription factors. The time courses of the relative score and performance coefficient in the first 100 steps are shown in the left and right halves of Fig. The result for abf1 is also interesting because of the low performance coefficient. In Fig. The reason for the low performance coefficient is revealed by close examination of this alignment. The three segments marked in the alignment closely resemble the known abf1 sites, but they have no biological evidence in SCPD. These biologically non-confirmed sites engender the large disparity between the high score and low performance coefficient observed for abf1. Nevertheless, the high efficiency of GibbsST in convergence to a high-quality alignment is remarkable. We conclude that these data illustrate the strength of GibbsST in terms of the fast alignment improvement. They also show the limit of our current validation scheme in terms of the dependence on the \"correct\" answer.The local optima dependence of optimization algorithms can also be analyzed as initial value dependence. An index of initial value dependence is the ratio of \"successful\" initial values to all initial values tested for a condition. This index is connected directly to the number of (random) initial values required  for finding one pattern in the solution space. We define the initial value as \"successful\" when a run started from an initial value reaches 99% of the score of the known global optimum  at somewhere before 1600 steps.Wm = 16, d = 2, TLC1 was optimal in terms of the local minima resistance. The \"classic\" algorithm was optimal for Wm = 16, d = 1, but the difference between the \"classic\" algorithm and TLC1 was small. For these Wm = 16 cases, the overall performance improvement of TLC3,4, and 5 shown in Fig. The resultant index for synthetic TFBS is shown in the upper half of Fig. Wm < 12 and large levels of pattern variation are expected. In such a case, a possibly lower minimum temperature than that of TLC5 should be considered for further performance improvement (as in TLC6). Temperature settings TLC3, TLC4 and TLC5 will work well for longer and rigid patterns (The precise best among these selections depends on input data). When Wm \u2265 16, TLC5 remains the best selection, but a better temperature setting should be devised for these cases regarding the initial value dependence. Alternatively, GibbsST should be tested for Wm = 16 test data with larger pattern variations.As shown in the lower half of Fig. The performance of computational TBFS discovery can be enhanced by means of improvement of the search method in its own right. We assumed that a good search method must have resistance to local optima, to yield solution of better quality in fewer iterative steps. We also assumed that a good search method must not be strongly sensitive to the initial values. These goals were realized and demonstrated by our new algorithm, GibbsST. In the long run, this approach frees up computational resources for more biologically appropriate modeling of TFBS.Wm are important. There is no fundamental difficulty in incorporating these functions into GibbsST. The standard method of estimation of the P-value [Many functions should be added to GibbsST. For example, non-OOPS occurrence models, better background models and automatic adjustment or scanning of  P-value ,29 can aAlthough we employed the relative entropy in the present work, there is a wide range of possible score functions to be combined with GibbsST. Because it is independent of the biological model, GibbsST only requires evaluation ofZ, for its temperature selection section. Any U is compatible with ST because evaluation of U is a totally encapsulated part of the algorithm. However, it should be noted that the concern about the computational complexity of the score function is reduced because of the substantial improvement of efficiency by ST. We can now employ score functions with more complex representation of biological specificity of binding sites. We are especially interested in rareness-based score functions [for its Gibbs sampling section, and the partition function, unctions , becauseNT, that is, the use of numerous small temperature steps. The problem with this simple idea is that temperature adjustments by means of small temperature steps would be unable to keep up with the rapid change of the alignment score. In fact, we frequently observed this phenomenon and the resulting severe degradation of performance during our preliminary testing of GibbsST. In other words, sudden and large changes in the value of the goal function are the most noteworthy features of TFBS discovery based on Gibbs sampling, when its combination with simulated tempering is considered.Lower minimum temperatures and more sophisticated temperature scheduling should be tested, especially when GibbsST is applied to long rigid patterns. One trivial possibility that should be addressed is increasing d) compared to their length (Wm) This fact is attributable to the shorter distance in the solution space between highly variable patterns and background noise compared to long and rigid patterns. This condition coincides with objectives of biological interest: sequence motifs with large variation. However, we were unable to validate GibbsST in a so-called \"twilight-zone\" of sequence pattern detection mainly because our test scheme depends on the success of MEME, although it is strongly anticipated that the performance gain in the twilight zone is even larger than that observed in the presented data. A better method of validation is necessary to advance our method in this direction. This direction should be advanced in combination with the better score function, evaluation of sensitivity, and specificity in an integrated manner.This is only one example of the many possibilities of algorithmic design that should be explored before GibbsST is extended to other interesting problems of bioinformatics. We confined our study to the simplest of the tempering schemes and to elementary optimization of the temperature levels. Several improvements of the tempering scheme itself -33 are yIntroduction of different methods into GibbsST is possible and promising. According to our preliminary test, the overall efficiency of GibbsST with the best temperature setting measured by the performance coefficient profile is roughly comparable to that of GibbsMotifSampler , a conveSeed-based initialization in search methods, that is, a preprocessing to find promising partial patterns, is quite useful to highlight the advantage of GibbsST. Even when not explicitly defined as such, all seed-based approaches assume that all partially correct solutions in the search space can be recognized and kept track of. In other words, a seed-based approach always assumes the availability of a complete catalog of all the deep basins illustrated in Fig. Our new algorithm for TFBS discovery, GibbsST, is based on an adaptive adjustment of the search stringency and shows a much increased resistance to local optima. By combining Gibbs sampling and simulated tempering, GibbsST creates a robust platform for difficult pattern detection in biological sequences.T).Our current test code of GibbsST is implemented with the following algorithmic details. The row to be updated is selected in a round-robin fashion. The code internally prepares the minus strands of all input sequences such that the minus strands can be incorporated to the selection of new segment positions, if necessary. As mentioned above, the background model considers only the base composition (though the 2nd- or 3rd-order Markov model is fully compatible with ST), and the base composition is unchanged during the iteration. The temperature transition is carried out after each row update . The value of pseudocount in PWM is always fixed to 1.0 . The current code is principally designed for investigation of local optima issues with many simplifications (e.g. Wm must be specified by the user). Nevertheless, the code would be practical enough for realistic TFBS discovery if a proper combination of options is selected. A web server of this code will be available [The number, length, and initial value selection method (random or Hamming distance based \"seed\") of independent runs can be changed by runtime options. Also, runtime options for temperature transition schemes are available, including the classic mode was fixed to 600 bp, and the number of windows was adjusted such that an appropriate level of sensitivity was available.The biological datasets were prepared as follows: beginning from the transcription initiation point, 1000 bp upstream regions were obtained from SCPD for each gene regulated by the target transcription factors. Removal of non-target TFBS and low-complexity sequences were not performed. The lists of correct binding sites were also obtained from SCPD (many of them are on minus strands). Minor manual editing was necessary on binding sites with length variation for conformity between the data and the current model (i.e. binding sites with variable length were removed). Then, a number of windows were randomly selected from these upstream regions such that each window contained at least one complete TFBS. The width of the windows ("}
+{"text": "The finite element method (FEM) has been used to simulate cardiac and hepatic radiofrequency (RF) ablation. The FEM allows modeling of complex geometries that cannot be solved by analytical methods or finite difference models. In both hepatic and cardiac RF ablation a common control mode is temperature-controlled mode. Commercial FEM packages don't support automating temperature control. Most researchers manually control the applied power by trial and error to keep the tip temperature of the electrodes constant.We implemented a PI controller in a control program written in C++. The program checks the tip temperature after each step and controls the applied voltage to keep temperature constant. We created a closed loop system consisting of a FEM model and the software controlling the applied voltage. The control parameters for the controller were optimized using a closed loop system simulation.We present results of a temperature controlled 3-D FEM model of a RITA model 30 electrode. The control software effectively controlled applied voltage in the FEM model to obtain, and keep electrodes at target temperature of 100\u00b0C. The closed loop system simulation output closely correlated with the FEM model, and allowed us to optimize control parameters.The closed loop control of the FEM model allowed us to implement temperature controlled RF ablation with minimal user input. P = constant), temperature-controlled mode (T = constant) and impedance-controlled mode (Z < constant) are commonly used. The electromagnetic energy is converted to heat by resistive heating. Tissue damage can occur at temperatures above 43\u00b0C with heating times of several hours; at 50\u00b0C cell necrosis occurs after ~3 min [Radio-frequency (RF) ablation has become of considerable interest as a minimally invasive treatment for primary and metastatic liver tumors. Hepatocellular carcinoma is one of the most common malignancies, worldwide with an estimated annual number of 500,000 deaths . Surgicar ~3 min . A commoResearchers have been using the finite element method (FEM) to simulate both cardiac and hepatic RF ablation -11. WhenRF ablation destroys tissue by thermal energy, which is converted from electric energy. The current flows from the conductive electrode through the tissue to a surface dispersive electrode. Tissue in close vicinity of the electrode tip is heated by resistive heating.The heating of tissue during RF ablation is governed by the bioheat equation:\u03c1 is the density (kg/m3), c is the specific heat (J/(kg\u00b7K)), and k is the thermal conductivity (W/(m\u00b7K)). J is the current density (A/m2) and E is the electric field intensity (V/m). Tbl is the temperature of blood, \u03c1bl is the blood density (kg/m3), cbl is the specific heat of the blood (J/(kg\u00b7K)), and wbl is the blood perfusion (1/s). hbl is the convective heat transfer coefficient accounting for the blood perfusion. Qm (W/m3) is the energy generated by metabolic processes and was neglected since it is small compared to the other terms [where er terms . EquatioTissue properties were assumed temperature independent and are described in more detail in . We usedwbl used in this model was 6.4\u00b710-3 1/s [Fig. 10-3 1/s .An input file was submitted to ABAQUS, in which geometry, material properties, step time and boundary conditions were specified. The applied voltage was one of the boundary conditions and remained constant during each step. ABAQUS created a results file in which temperatures of all nodes of the FEM model at the end of the step were written. We created a C++ program that reads the temperature at the electrode tip from the results file and creates a new input file where the applied voltage is set according to a control algorithm; the C++ program then calls ABAQUS and waits until the next step is completed. We implemented a PI controller in our control algorithm.Since the FEM model takes several hours to complete, using the FEM model to optimize control parameters was not feasible. Therefore we used a closed loop simulation to adjust parameters of the controller, and then used these parameters in the FEM model. Before implementing the controller, we analyzed the dynamic system (i.e. the FEM model) to be controlled. This system consisted of the ablation electrode, tissue, and dispersive electrode. The input variable of the system was the voltage applied to the electrode. The output variable was the temperature measured at the tip of the electrode. Initially, we determined the step response by applying a constant voltage of 25 V for 180 s. We then approximated the transfer function of this system by a time-discrete transfer function of the following form:a0, a1, a2, b1 and b2 of (2). Fig. a0 = 1.0, a1 = -0.959, a2 = 0.127, b1 = 1.734, b2 = -1.150. The sampling time of the approximated system was 10 s, since that was also the sampling time used later in the digital PI controller. This ensured a more accurate simulation model of the closed-loop control system.We used the control system simulation software ANA 2.52  to analyze the control system. This software allowed us to approximate the system from its step response by a recursive least square algorithm and gave the parameters Ts is the desired set tip temperature and Tt is the current tip temperature. The input of the PI controller e = Ts - Tt. The output of the PI controller u (corresponds to the applied voltage) is fed into the dynamic system.Once we had identified an approximation of the dynamic system (FEM model), we designed a feedback control system. There are different ways of controlling the tip temperature such as PID control, adaptive control, neural network prediction control and fuzzy logic control. We chose the relatively simple PI controller for our control system. Fig. The transfer function of the PI controller is:Equation (3) can be described in the time-domain by:To implement this controller in software, we have to use the discrete time-domain version of (4),Kp and Ki.The second term of (5) represents the approximation of the integral term in (4) by trapezoidal numerical integration. The behavior of the PI controller is determined by the two parameters We simulated the behavior of the closed-loop system with the software ANA. From in-vivo experiments in pigs with the RITA 500 generator and the Model 30 electrode we determined that it takes between 1 and 2 min for the tip temperature to reach a target temperature of 100\u00b0C, which is the temperature used in clinical cases at our institution. The RITA 500 generator does not allow recording of the tip temperature signal, so we don't have exact data of the tip temperature over time. We empirically chose parameters for the PI controller to minimize overshoot and obtain similar temporal behavior as in the in-vivo experiments.Kp = 0.02, Ki = 0.0064.The parameters we used for the PI controller were Fig. We implemented the PI controller with the parameters resulting from the control system simulation in a control program written in C++. The software control program determined the applied voltage and the step time. An input file for ABAQUS was created and ABAQUS solved the FEM model. ABAQUS created a result file, which included the temperatures at all nodes.The tip temperature was read from the result file by the control program. The program then determined the applied voltage and step size for the next step, and ABAQUS was restarted with the modified input file. With decreasing step size (i.e. time that ABAQUS simulated the model with constant voltage) total computation time gets longer. As a compromise, we chose 10 s as the initial step size. Note that the FEM solver divided each step into smaller increments, starting at 0.05s. Also, the FEM solver performed convergence tests to ensure that the increment size was sufficiently small.This scheme was repeated until the ablation had been simulated for the desired time. Fig. We simulated ablation for 12 min using the FEM model and the control program. The simulation took 250 min to run and was divided into 35 steps. The individual steps took between 6 and 11 min to run in ABAQUS. Without using the control program, manual interaction would be necessary after each step to manually change the input file for ABAQUS and apply a new input voltage and set the step size. In this case the operator would have to check the results file after each step , modify the input file and restart ABAQUS.Fig. In hepatic RF ablation, ablation times clinically used go up to 35 min. Since the heat-up period is comparably much smaller (1 to 2 min.), it is not of essential importance that the temporal behavior of the control algorithm reproduces the control algorithm used in clinical devices during the heat-up period. From our experience, the temperature distribution in the FEM model reaches close to steady state at the end of the simulation due to the long simulation times. As long as the tip temperature is kept within a small range around the target temperature after the initial heat-up period, the model results  should not differ significantly. However, with knowledge of the actual control parameters and algorithms of commercial devices (e.g. obtained from measurements), accurate simulations of these devices is possible using our methods.We implemented a closed loop control system to a FEM model, to automate simulation of temperature-controlled RF ablation. We further used a closed loop control system simulation to optimize control parameters. Previously, researchers often applied constant power, or used time-consuming trial-and-error methods to determine required voltage. Furthermore, if control parameters and algorithms of commercial devices are known or can be measured, an accurate simulation of commercial devices is possible.DH carried out computer simulations. JG participated in design of the study. All authors read and approved the final manuscript."}
+{"text": "It is known that some blood-sucking insects have the ability to reach vessels under the host skin with their mouthparts to feed blood from inside them. However, the process by which they locate these vessels remains largely unknown. Less than 5% of the skin is occupied by blood vessels and thus, it is not likely that insects rely on a \u201crandom search strategy\u201d, since it would increase the probability of being killed by their hosts. Indeed, heterogeneities along the skin surface might offer exploitable information for guiding insect's bites.Rhodnius prolixus can evaluate temperature discontinuities along the body surface in order to locate vessels before piercing the host skin. When placed over a rabbit ear, the bug's first bites were mostly directed towards the main vessels. When insects were confronted to artificial linear heat sources presenting a temperature gradient against the background, most bites were directly addressed to the warmer linear source, notwithstanding the temperature of both, the source and the background. Finally, tests performed using uni- and bilaterally antennectomized insects revealed that the bilateral integration of thermal inputs from both antennae is necessary for precisely directing bites.We tested whether the bug R. prolixus may be able to exploit the temperature differences observed over the skin surface to locate blood vessles. Bugs bite the warmest targets regardless of the target/background temperatures, suggesting that they do not bite choosing a preferred temperature, but select temperature discontinuities along the skin. This strategy seems to be an efficient one for finding blood vessels within a wide temperature range, allowing finding them on different hosts, as well as on different areas of the host body. Our study also adds new insight about the use of antennal thermal inputs by blood sucking bugs. Solenophagous insects such as mosquitoes, sucking lice and kissing bugs need to pierce the skin of their hosts in order to reach the interior of blood-vessels with their mouthparts Rhodnius prolixus, in addition of being a classical model for insect physiology studies, is a major vector of Chagas' disease, one of the main public health problems in Latin America R. prolixus St\u00e5l (1859) is the main vector of the disease The heat emitted by warm blooded animals is the main cue used by haematophagous bugs to locate a host at short distances R. prolixus, a solenophagous bug, obtains food directly from venules and arterioles R. prolixus can locate a blood vessel before contacting the host skin with its proboscis. Moreover, we provide evidence supporting the role of the thermal sense and the antennae in guiding this behaviour.In the present investigation, we show that When we confronted the bugs with the ear of a rabbit, we observed that 77% (24/31) of their first bites  were oriented towards a major vessel or up to 2 mm away from it. We conclude that this distribution of bites indicates that these insects exploit sensory cues associated to blood vessels to detect them before contacting the host skin with their proboscis. Vessels revealed to be the warmest areas on the rabbit's ear, as the temperature over them was 32.5\u00b10.5\u00b0C and gradually decreased to 31\u00b10.4\u00b0C up to 10 mm away.Subsequently, we evaluated whether heat is used as a cue for vessel location by performing two experiments in which linearly-shaped heat sources were presented over lower temperature backgrounds, i.e., bugs were confronted to a heated wire presented over a metal plate that acted as background. Both the wire and the plate could have their temperatures controlled independently.In the first experimental series, we kept the linearly shaped source at 36\u00b0C over a background at 33\u00b0C. These assays revealed that bites were aimed either to the linear heat source or to its proximity , with a In the second experimental series, the linearly shaped heat source was kept at 39\u00b0C and the background at 36\u00b0C. Again, most bites where directed towards the linear heat source. Consistently, we did not observe such a pattern when the linear source was presented at the same temperature as the background . The mean distance between the spot contacted by the proboscis and the warmer linear heat source was 2.6\u00b11.1 mm. In the control assays that presented both, linear source and background at 36\u00b0C, a significantly larger distance of 6.6\u00b11.3 mm was observed .Previous work on triatomines revealed that these insects prefer warm objects within a certain temperature range that can attract bugs and evoke proboscis extension On the other hand, our experiments revealed that insects were able to directly contact the warmer wire since the first bites . Thus, iIn a third series of experiments, we tested the ability of uni- and bilaterally antennectomized insects to locate the linearly shaped heat source. Results have confirmed that, as it happens during the approach of the insect to a thermal source R. prolixus to lack thermoreceptors other than those of the antennae, or at least not to have them on their proboscis The first possibility is apparently supported by previous work that revealed that antennectomy deeply affects the normal behaviour of other bugs. They stop responding to warm objects by approaching them, and change to visually following moving objects or even extending their proboscis towards them R. prolixus has been proposed, but not conclusively shown up to date R. prolixus. Furthermore, as indicated above, triatomine bugs are able to feed on blood at 3\u00b0C, provided that their antennae are conveniently stimulated by heat Different thermoreceptors than those known from the antenna would play a secondary role in guiding the proboscis. In fact, bilaterally antennectomized insects revealed to be unable to locate the heat source or even extend their proboscis The fact that intact bugs managed to finely determine the location of thermal sources and that unilaterally antennectomized bugs failed to aim their proboscis in a biased manner suggests that proboscis sensors, if any exist, are not involved in mediating this task. It is relevant to state that the proboscis is mostly retracted under the head of the bugs, while the antennae are mostly positioned forward. After a heat source is located at very short distance R. prolixus, they may be associated to functions other than targeting a heat source. The presence of different types of thermoreceptors associated to different kinds of thermosensitivity has been previously reported in insects. In a temperature gradient, Drosophila melanogaster flies loose their normal preference for 24\u00b0C when antennectomized, but continue avoiding temperatures above 31\u00b0C D. melanogaster depends on the expression of a single gene, painlessEven when thermoreceptors may exist outside the antennae of Triatoma infestans, when stimulated by a warm metal plate associated to a container offering cold blood R. prolixus. Our results revealed that that after performing several biting attempts on the linearly shaped heat source, the bugs started to bite apart from it. Thus, bugs do not limit their searches to the precise origin of their guiding stimuli, but extend them to nearby spots as an apparent strategy to increase their chances of contacting blood vessels in case their piercing attempts are unsuccessful.An interesting aspect of the behaviour of triatomines confronted to thermal sources is that when an insect does not succeed to pierce the skin at a spot, it begins to bite on the proximities. This behaviour was first observed in This study adds new insight about how haematophagous insects locate vessels hidden under the skin. Heat appears as a main cue for aiding insects to perform this task. Even though other signals, as odours, humidity and vibrations cannot be excluded, heat alone seems to be sufficient. This is not surprising if we consider that these insects possess a highly developed thermal sense that allows them to detect and locate a host and that heat is the most important cue for host location in triatomine bugs, being indispensable to evoke biting.As far as we know, this is the first evidence of the ability of a haematophagous insect to locate and subsequently probe the warmest sites on the host skin surface. We hypothesize that this capacity would improve the chances of finding a blood vessel, minimizing both the time consumed and the disturbance of the host. In addition, our work extends our comprehension about heat perception and the active use of heat cues by animals, a sensory capacity poorly understood.The use of the thermal sense has been relative neglected in other haematophagous insects. Actually, most efforts on the study of host associated cues in vectors of human diseases have been addressed to chemical cues and olfactory orientation, particularly for mosquitoes. Provided that most blood-sucking insects have been submitted to similar selective pressures associated to food finding, we should not be surprised if future research shows that heat is more relevant than believed to date as a cue for food finding in mosquitoes, tse-tse flies and other hematophagous arthropods.R. prolixus larvae starved for 30\u201345 days after moulting were used throughout the experiments. The insects had their eyes covered with black acrylic paint in order to prevent the use of visual cues. For the final experiment, 3 groups of 34 insects each, where either left-, right- antennectomized or kept intact as control and 20 bugs were bilaterally antenectomized. The antennectomy of the experimental insects was performed 24 h before the onset of assays.Fifth-instar ramus intermedius (diameter about 900 \u00b5m) and its surroundings were measured before every assay of the first experimental series (n\u200a=\u200a31) using a contact thermometer . The values presented are the mean temperature differences between each vessel and the tissues located 1 cm away from it. The reported temperature for the thermal sources, i.e., wire or flat background, represents the values programmed by means of electronic thermostats . These temperatures were measured for verification before and after each trial.The temperature on the skin surface over the vessel called The thermal source was an aluminium plate (flat background) and a nickel-chrome wire . The nickel-chrome wire (300 \u00b5m thickness) was fastened on the aluminium plate and both were thermostatized at specific temperatures (accuracy: 1\u00b0C). In the first experimental series that used artificial thermal sources, the temperatures of the wire and the background were 36\u00b0 and 33\u00b0C, respectively. In the corresponding control series, both thermal sources were presented at 33\u00b0C. In the second experimental series, the temperatures of the linear and the flat thermal sources were 39 and 36\u00b0C, respectively. In the control series for this experiment, both thermal sources were presented at 36\u00b0C.2 in order to restrict the access of the bugs to a direction parallel to the wire. In this manner, the stimulus was presented to the insects aligned with their longitudinal axis and, therefore, it was possible for us to assign their initial bites to the wire, the left or the right half of the flat source, in order to check if the distribution pattern observed in the experiments with intact insects was maintained.Each insect was placed into a receptacle located in one end of an acrylic rectangular box (24\u00d716\u00d78 cm) and released after 10 minutes. A square opening (2 cm wide) located on the substrate of the box, 10 cm away from the receptacle and in a central position of the box, allowed the insect to contact either the skin of the rabbit's ear or the artificial thermal sources. In the experiment presenting thermal sources to antennectomized insects, the arena was modified in order to allow the insects to reach the thermal source parallel to the heated wire. The new arena consisted of an acrylic corridor of 10\u00d71 cm in which the heated wire was presented in a central position parallel to the arena's longitudinal axis. The new flat thermal source was identical to the previous one, but its area was diminished to 1 cmA video camera sensitive to infrared (IR) light, was used to record their behaviour. The camera was mounted over the arena in a zenithal position relative to the thermal source, and the scene illuminated by a panel of IR emitting LEDs (900 nm), whose light cannot be perceived by these insects The behaviour of the insects in the 2\u00d72 cm window where the heat source was presented to them in the first experiment was videotaped and subsequently analysed. The biting activity of each bug was analyzed during an interval of 10 min that was initiated after its first bite. In the second experiment, the analysis was carried out having the image of the 1\u00d71 cm window projected on a TV screen. The location of the bites on this area was determined with 1 mm accuracy.To test the precision of the bites performed by bugs on the linearly shaped heat source, we employed a quite conservative method. We measured the distance of each contact of the proboscis from the wire performed by each indivual along 10 min and computed a mean distance per insect. These means were compared between test (temperature of the wire different from the background) and control (same temperature) groups. Provided that data did not meet normality assumptions, we used the Mann-Whitney test. It should be noted that after some unsuccessful attempts to obtain food, the insects started to bite in zigzag  along th"}
+{"text": "Cmc21 structure, but at the lower temperatures the space group is Pna21. Nevertheless the basic structure remains the same, with only small displacements of the atoms, amounting to an average of 25 pm between 120 and 293 K.The crystal structure of 2,2-trimethylenedioxy-4,4,6,6-tetrachlorocyclo triphosphazene has been determined at 120, 274 and 293 K. The result at 293 K confirms the room temperature Cmc21 symmetry.X-ray diffraction and DSC results indicate that the phase transition takes place in two steps between 274 \u2013 293 K and provides an understanding of previous NQR results. In the intermediate temperature range the molecules are displaced from their room temperature positions in such a way as to give an average structure with x-direction is coupled with a flexing motion about an axis defined by the nitrogen atoms in the N1 and N3 positions.The overall phase transition is consistent with the occurrence of a soft lattice mode at room temperature in which a large displacement of the molecule in the  Nitrogen was used as purge gas with a flow rate of 60 cm3/min. The reference crucible was an empty Al micro-crucible.Thermal measurements were made using a Shimadzu Differential Scanning Calorimeter (DSC60). Samples were examined under a polarising Olympus microscope at 100\u00d7 and good quality crystals were selected for the measurements. The selected crystals were then placed in custom made Al micro-crucibles and weighed on a Sartorius electronic microbalance. Since attention was paid to crystal quality the sample size used was small (0.326 mg). A second sample (1.982 mg) was also tested. Cooling to 323 K was performed using liquid nitrogen and samples were heated to room temperature at 5 K/min. A total number of 5 cycles were performed of cooling and heating. After the 52 using SHELXL-97 [Ueq). The temperature of the sample was controlled using an Oxford Cryosystems 700 series Cryostream Plus cryostat [Intensity data were recorded on a Nonius KappaCCD diffractometer situated at the window of Bruker Nonius FR591 rotating anode generator equipped with a molybdenum target (\u03bb Mo-k\u03b1 = 0.71073 \u00c5) and driven by COLLECT  and DENZHELXL-97 . Data wecryostat   and are submitted as Additional file To fully characterise the solid state thermal behaviour of compound programmer's manual. The libraries include interfaces to both the KappaCCD and the Oxford Cryosystems cryostream enabling a synergistic approach to the experiment. The software allows the following variables to be controlled; start temperature, final temperature, increment (determines the number of steps), ramp rate and dwell time . The type of diffraction experiment can be set as either full data collection or unit cell determination, and the usual choices of experimental parameters are available. In order to avoid time consuming processing of multiple data sets, data reduction is carried out automatically and therefore, once the experiment has been designed, it can be left to run with no further human input.Although a number of diffractometer manufacturers provide rudimentary control of low temperature devices via their data collection software, it is generally not flexible enough to carry out complex variable temperature experiments in an automated fashion. To address the problems posed by the chemistry under investigation in this study, it was necessary to write software that could automate the collection of multiple data sets under various temperature-change regimes. The application is written in Python and utilizes the Nonius Python libraries of the COLLECT  software35Cl NQR measurements [rd re-heat, the red trace to the 4th re-heat, and the blue trace to the 5th re-heat; for the latter the 1st endothermic peak (ca. 273 K) occurs over a relatively narrow temperature range and is followed immediately by a crystallisation peak  and then by the much narrower second endothermic peak (ca. 280 K). The thermal behaviour of the 5th re-heat indicates the presence of an intermediate phase and we assume that the two endothermic peaks define the temperature range of the intermediate structure. The melting of this thermally-cycled sample is a sharp single peak (melting temperature 427 K) as shown in Figure S1  showed the presence of two endothermic peaks even on the first heating from 143 K to 313 K and further cycling showed an increase in intensity of the first endothermic peak until both endothermic peaks were about equivalent  was first cooled to 143 K in the calorimeter and the DSC measured to 323 K revealing the presence of an endothermic event over a broad temperature range (263 \u2013 283 K), which coincides with the temperature region where a discontinuity had been previously observed in 6 mg was Although there is a very simple relationship between the low and room temperature structures of this compound, with one structure realisable from the other with only very small displacements of the atoms, the phase transition does not appear to follow the simple second-order model of Landau but is more complex, taking place in at least two stages over a temperature range of about fifteen degrees. The phenomenon of a two-stage transition occurring for such a simple symmetry relationship has been recognised previously . In suchCmc21, it must first be transformed to a non-standard setting of space group Pna21, namely Pbn21, by interchanging the a- and b-axes. Then, using International Tables [C-centred, the conventional cell remains the same.) This symmetry relationship is borne out by the actual structures, since the low-temperature structure is realisable from the other with only small displacements of the atoms, during which the asymmetric unit doubles and the molecular mirror plane disappears. In terms of the Wyckoff positions, atoms occupying the special positions (4a) in Cmc21 with fixed x-coordinate occupy general positions (4a) in Pbn21 with no such restriction, while atoms in the general positions (8b) of Cmc21 split into two separate sets of general positions (4a) in Pbn21.In order to compare the low temperature structure to the room temperature structure in l Tables  we find If we apply the phenomenological theory of such transitions , we can h + k) odd, the displacements of pairs of atoms  apart in the unit cell must be 180 degrees out-of-phase in the normal mode concerned. Given the loss of the mirror plane present in the high-temperature structure, we expect them to lie perpendicular to this plane, i.e. along the a-axis.Since the group-subgroup relationship is not to a translation-equivalent subgroup, we can locate where the propagation vector of this mode lies in reciprocal space away from the Brillioun zone origin, and so correlate it with the actual atomic displacements. Specifically, since the additional Bragg reflections of the low-temperature phase occur for  and the one containing , where v and w are small displacements. In order to carry out this analysis, since the three structure determinations chosen for comparison had each been refined independently in the standard setting of the appropriate space group, the cell axes and coordinates of the low temperature structures were transformed to bring each of the reference molecules into correspondence with each other and with the reference molecule at room temperature, fixing as identical the z-coordinates of the centre of mass in all three cases.Now three of these lattice modes involve displacements of the centre of mass, which correlate with the translations of the free molecule. These can be treated in an identical way as for an individual atom by the Aroyo-Perez-Mato method. However the other three are librational modes, which correspond to rotations of the free molecule. Taking as an example a libration x by 25 pm at 120 K and 17 pm at 274 K. Since the displacements of the atoms from their room temperature positions at 274 K proved to be uniformly two-thirds of those at 120 K, the subsequent analysis concentrated on comparing the structures at 120 K and 293 K. No satisfactory fit could be found of the low temperature molecule to the room temperature molecule by simple rotational displacements about the centre of mass. This difficulty was traced to an internal deformation of the molecule, when it became clear from the observed torsion angles that the molecule at 120 K was folded along the N1 \u2013 N3 axis. Using this model to fit the internal non-bonded distances indicated a folding angle of 9.1\u00b0, which was apportioned in transforming the coordinates in the ratio 0.35 : 0.65, the inverse ratio of the relevant moments of inertia about N1 \u2013 N3. After readjusting to the centre of mass, the positions of the non-hydrogen atoms in the two structures could be brought into good agreement (standard error 5 pm) by very small rotational adjustments.The centre of mass was found to be displaced along a. At 120 K they are much closer to spherical and quite normal in form, but at 274 K, as the transition is approached from the low temperature side, they also show greatly enhanced motion along the a-axis, consistent with there being a very shallow but asymmetric minimum in the potential function at that temperature.The displacements observed in the low-temperature structure are completely consistent with this soft mode model and the thermal ellipsoids in the various determinations, as modelled by ORTEP  and showi.e. there may be a ferroelastic aspect to the phase transition. Elongation or compression of the crystal in the appropriate direction should alter the form of the potential function for the normal mode in question. Since the displacements associated with the soft mode lie along a, we would predict the direction of maximum thermal expansion to lie in that direction, and as well as any actual isothermal shear. The lattice parameters were compared [a = 99(3), \u03b1b = 45(3) and \u03b1c = 44(3) \u00d7 10-6 K-1, with \u03b1a being by far the largest as would be expected. However there also appears to be a small isothermal shear, affecting mainly the a-axis, at about 295 K  odd reflections which appear at low-temperature, superimposed on a sharp high-temperature pattern (Figure As for X-ray diffraction, we observe in the transitional region a diffraction pattern with the presence of strong disorder diffuse scattering. For example the n Figure . This efCmc21, but there are large vibrational displacements in the x-direction, which couple to a flexing motion along the long molecular axis. At approximately 290 K there is a weak first order isosymmetric transition to an intermediate state in which the molecules occupy two symmetry related positions in close proximity to each other, i.e. the Wyckoff positions of Cmc21 break down to those of Pbn21, but these are occupied in a disordered fashion so as to maintain on average Cmc21 symmetry.The various observations may be interpreted in the following way in terms of cooling the crystal. Above room temperature the molecule lies in a crystallographic mirror plane in space group Pbn21.As the temperature is lowered further through this intermediate region, the two molecular sites move steadily apart, and their correlation in terms of the displacement directions of neighbouring molecules becomes progressively longer in range, until about 274 K the system undergoes a second weak first order transition, where the crystal assumes the ordered low temperature structure in 120 k CIF data.Click here for file274 k CIF data.Click here for file293 k CIF data.Click here for fileSupplementary data.Click here for fileSupplementary information.Click here for file"}
+{"text": "Endovenous laser treatment (ELT) has been recently proposed as an alternative in the treatment of reflux of the Great Saphenous Vein (GSV) and Small Saphenous Vein (SSV). Successful ELT depends on the selection of optimal parameters required to achieve an optimal vein damage while avoiding side effects. Mathematical modeling of ELT could provide a better understanding of the ELT process and could determine the optimal dosage as a function of vein diameter.The model is based on calculations describing the light distribution using the diffusion approximation of the transport theory, the temperature rise using the bioheat equation and the laser-induced injury using the Arrhenius damage model. The geometry to simulate ELT was based on a 2D model consisting of a cylindrically symmetric blood vessel including a vessel wall and surrounded by an infinite homogenous tissue. The mathematical model was implemented using the Macsyma-Pdease2D software . Damage to the vein wall for CW and single shot energy was calculated for 3 and 5 mm vein diameters. In pulsed mode, the pullback distance  was considered. For CW mode simulation, the pullback speed  was the variable. The total dose was expressed as joules per centimeter in order to perform comparison to results already reported in clinical studies.In pulsed mode, for a 3 mm vein diameter, irrespective of the pullback distance , a minimum fluence of 15 J/cm is required to obtain a permanent damage of the intima. For a 5 mm vein diameter, 50 J/cm (15W-2s) is required. In continuous mode, for a 3 mm and 5 mm vein diameter, respectively 65 J/cm and 100 J/cm are required to obtain a permanent damage of the vessel wall. Finally, the use of different wavelengths (810 nm or 980 nm) played only a minor influence on these results.The parameters determined by mathematical modeling are in agreement with those used in clinical practice. They confirm that thermal damage of the inner vein wall (tunica intima) is required to achieve the tissue alterations necessary in order to lead the vein to permanent occlusion. However, in order to obtain a high rate of success without adverse events, the knowledge of the vein diameter after tumescent anesthesia is recommended in order to use the optimal energy. As clearly demonstrated by our calculations, both pulsed and continuous mode operations of the laser can be efficient. An interesting observation in our model is that less amount of energy is required in pulsed mode than in continuous mode. Damaging the vein sequentially along its entire length may lead to permanent occlusion. However, the pulsed mode requires a very precise positioning of the fiber after each pullback and the duration of the treatment is much longer. For these reasons, continuous irradiation seems to be preferred by most clinicians. This model should serve as a useful tool to simulate and better understand the mechanism of action of the ELT Lower-extremity venous insufficiency is a common medical condition afflicting 25% of women and 15% of men in the United States and in Europe. Great saphenous vein (GSV) reflux is the most common underlying cause of significant varicose veins. Traditional treatment of GSV reflux has been surgical removal of the GSV. Although surgical ligation and stripping of the GSV has been the most durable treatment, it is associated with significant peri-operative morbidity. Less-invasive surgical treatments including high ligation of the GSV at the saphenofemoral junction (SFJ) have been attempted in the hope that gravitational reflux would be controlled while the vein is preserved for possible use as a bypass graft. Unfortunately, ligation of the GSV alone usually results in recurrent varicose veins. Even when high ligation has been combined with phlebectomy of varicose tributaries or retrograde sclerotherapy, recurrence has been the rule. Therefore, when it is determined that GSV reflux is the principal underlying problem, treatment should involve eliminating this source of reflux with ablation of any associated incompetent venous segments [In an attempt to reduce morbidity and improve recovery time, several minimally invasive techniques have been developed as alternatives to surgery in the last few years. Endovenous laser treatment (ELT) is one of the most promising of these new techniques -4. In 19Numerous studies have since demonstrated that this technique is both safe and efficacious. Several wavelengths have been proposed, respectively 810, 940, 980, 1064 and 1320 nm ,12. ThesConsequently, successful ELT must achieve permanent damage of the vessel wall, with both the endothelium (tunica intima) and also the outer layer (tunica externa) requiring sufficient heating. Conversely, to avoid side effects \"collateral\" damage of the perivenous tissue must be avoided. In this context, reports concerning temperatures reached inside vessel lumen during ELT are controversial. In the model studied by Zimmet and Min, peak temperatures (maximum: 50\u00b0C) of perivenous tissues generated during ELT  were unlikely to cause permanent damage to the perivenous tissues. Using another experimental model, Weiss showed that 100% of the laser  treated veins showed perforations.Mathematical modeling of ELT may provide a better understanding of the ELT process and help determine optimal dosage as a function of vein diameter. Although many other models address the laser treatments of blood vessels (Port Wine Stains for example) or Interstitial laser therapy, the mathematical modeling of ELT is yet to be proposed -19.The aim of this paper is to present a mathematical model using dynamic tissue changes based upon the Arrhenius damage model. Numerical simulations are compared to data previously reported in the literature. Optimal parameters emerging from these calculations can be taken in account for improving ELT clinical application.An opto-thermal model of ELT consists of calculations of light distribution, temperature rise and the extent of thermal damage. The following sections describe the manner in which each stage has been implemented in our calculations.The geometry used to simulate ELT was based on a 2D model consisting of a cylindrical blood vessel (radius: R) including a vessel wall (Thickness: T) and surrounded by infinite and homogenous tissue. Calculations were performed for different vein diameters  and at different distances from the center of the vein: in the tunica intima, in the tunica externa and at 1, 2 and 3 mm from the tunica externa.The different vein diameters were chosen since Ultra Sound images recorded after tumescent anesthesia have clearly showed that vein diameters can reach up to 5 mm figure .Since, a cylindrical blood vessel is going to be symmetrical from its axis, a 2D section along this axis was considered sufficient for the purposes of calculation (figure -2) of an isotropic point source emitting Plaser (W) within an infinite homogeneous medium can be expressed asThe light emitted from the fiber inserted in the vein was modeled as an isotropically radiating point source. As previously proposed by Lizuka et al, spatial distribution has been considered to be dominated by scattering processes . The ligPLaser (W) : power of the light sourcewhere: \u03bceff (mm-1) : effective attenuation coefficientr (mm) : radial distance from the sourceD (mm): optical diffusion distance\u03bceff is determined by the following equation\u03bca (mm-1) : absorption coefficient in tissuewhere \u03bc's (mm-1) : reduced scattering coefficient:  = \u03bcs (1 - g)\u03bcs (mm-1) : scattering coefficientg : anisotropy factor incorporating the effects of directionally dependent scattering.D (mm) is determined by the following equation:r is defined by the following equationWhere: x (mm): transverse dimensionz (mm): longitudinal dimension-3) is expressed as follows (Welch 1984):The absorbed power density (W.mmPabs = \u03bca\u03c6(r) \u00a0\u00a0\u00a0 (4)The first laser pulse is always applied at coordinates  in figure z' = z - zincinc (mm) is the absolute position of the fiber inside the vein. This position is calculated for each pulse by taking into account the pull-back distance.Where: zWhen simulating a continuous irradiation performed with a progressive pull-back of the fiber, the relative position of each irradiation is obtained by taking into account the pull-back speed:zinc = t \u00d7 v-1) is the pull back speed.where : v : temperature (\u00b0K)-3)\u03c1 : density of tissue (g mmC : specific heat of tissue (J. g-1.\u00b0K-1)Cp = C\u00b7\u03c1: heat capacity (J.mm-3.\u00b0K-1)k = thermal conductivity of tissue (W. mm-1.\u00b0K-1)r = radial distance (mm)t = time (s)Values used for calculation are reported in Table 13 cylinder , the energy required to reach 100\u00b0C is 13 J. The latent heat of vaporization of water is 2260 kJ/kg at 100\u00b0C. The relationship between pressure and temperature is given by the phase transition diagram of water. At normal pressure: 1.105 Pa and body temperature 37\u00b0C, water is in a liquid state. When the temperature increases, two phenomena can be observed: 1) pressure increases and the water stays in its liquid state, 2) pressure remains constant and water reaches its gaseous state, (steam or vapor) [3 cylinder, (steam or vapor) 119 J will be required. It is therefore unlikely that the blood will boil during ELT.In our analysis, we considered that the maximum temperature of blood would not exceed 100\u00b0C for all laser parameters. Water being the main constituent of blood, the latent heat of water was included in the calculations. It takes 4.18 J to raise the temperature of one gram of water by one degree C. When considering a 50 mmIf we consider the vessel to be a closed but deformable container, water evaporation will not occur, and consequently, water will return to its initial liquid state as soon as the temperature drops back to below 100\u00b0C. In conclusion, the assumption is that blood temperature stays around 100\u00b0C during laser irradiation is both valid and confirmed by previous studies .Thermal damage in cells and tissue can be described mathematically by a first-order thermal-chemical rate equation, in which temperature history determines damage. Damage is considered to be a unimolecular process, where native molecules transform into a denatured/coagulated state through an activated state leading to cell death. Damage is quantified using a single parameter \u03a9, which ranges on the entire positive real axis and is calculated from the Arrhenius law . Damage A (s-1) is the frequency factor,where Ea (J. mole-1) is the activation energy,R (J. mole-1.\u00b0K-1) is the universal gas constant,Ea and the frequency factor A are derived from thermodynamic variables. They describe the denaturation process of proteins and other cellular constituents. A ranges from 1040s-1 to 10105s-1, and Ea from 105J/mole to 106J/mole [The activation energy 06J/mole . Values T (\u00b0K) is the temperature.\u03a9 can be determined by the following equationC0 is the concentration of the undamaged molecules at the beginningwhere: C(t) is the concentration of the undamaged molecules at time \u03c4.\u03c4. Therefore, \u03a9 = 1 corresponds to an irreversible damage of 100% of the affected cells.The equation indicates that the measure of damage describes the probability of tissue being destroyed. It is the logarithm of the ratio of the initial concentration of undamaged tissue to the concentration once damage has accumulated, for the time interval t = 0 to t = The mathematical model was implemented using the Macsyma-Pdease2D software . This Finite Element CAD Software needs to specify the Partial Differential Equations, variables, geometry, and boundary conditions; PDEase2D creates both numerical output tables and plots. PDEase2D generates and refines the element grid, adaptively selects time steps, and iterates until it attains convergence in nonlinear problems. And because PDEase2D does automatic error analysis, you do not need to make several runs with different meshes to verify convergence. You can choose whether or not to override the automatic defaultsFor numerical simulations, parameters commonly used for ELT were used. A 600 \u03bcm laser fiber was considered. Two different vessel diameters were evaluated: 3 mm and 5 mm. Laser power (10 & 15 W), pulse duration , delay (or off-phase) between pulses  and pullback distances  were the variables. In this case, thermal energy is applied along the length of the vein by withdrawing the laser fiber in 3, 5 or 7 mm increments.For CW mode simulation, laser power  and pullback speed  were the variables.-3. The vein wall thickness was considered to be 0.4 mm. The initial temperature was set at 37\u00b0C. The listing of physical parameters used for numerical simulation is reported in Table An irregular 10 \u00d7 60 finite element grid was used. The time steps were 0.1s. The tolerances used to converge the solution were 10The product of pullback rate and power yields the total dose of energy delivered to a vein during treatment. Several studies have suggested that this parameter is a major determinant of treatment outcome -28. In oFigure The role of the laser wavelength was investigated. Figure Figure Figure Figures When using 3 mm increments, the vein is damaged homogenously along its length. When using 5 mm increments, damage is less homogeneous even though the tunica intima is always damaged. Finally, for 7 mm increments, it is evident that the vein is damaged sequentially along the entire length and consequently the energy applied is lower. Cinepak movies of real time isodamage distribution are also provided for figures Figure Figure Figure To date, mathematical modeling of ELT has never been proposed. This task was performed to assist in providing a better understanding of the ELT process and possibly to determine the optimal dosage as a function of vein diameter. Our model remains a mathematical model, implying that errors may appear owing to the considerations and simplifications required to realize it. Generally, such errors appear because of inaccuracy of the optical, thermal, and damage properties that are critical points in the model's set of equations. In fact, these properties play a key role in the accuracy of the results achieved. Many methods have been presented to calculate these properties but still we see differences in the values presented by the different groups, which reflect the difficulty of measuring these properties. The problem is increased by the reliance of the properties on different variables  over time. This makes the deviation neither linear nor regular .Before attempting to compare the parameters used for simulation to those usually reported in the literature, the following comments must be made:1) One of the main problems remains the knowledge of the vein diameters during ELT treatment. Since the vein diameter is considerably reduced after tumescent anesthesia, it should be systematically measured. A recent study by Desmyttere et al have demonstrated that after tumescent anesthesia, the vein diameter was usually reduced down to 5 mm or less .2) In contrast to the mode of action of VNUS closure (radiofrequency) where a significant shrinkage of the vessel wall is observed, Proebstle has clearly demonstrated that, when performing ELT, permanent occlusion, reported at 3 months or later, can be obtained by thermal damage of the tunica intima inner vein wall only . This obThe results of mathematical modeling for 810 and 980 nm shows 980 nm leads to a slightly greater damage of the tunica intima when compared to 810 nm. This is owed to its better absorption by blood at 980 nm. However, because of the inaccuracy on vein diameter, one can consider that the choice of the wavelength between 810 and 980 nm has no influence on the results. This is confirmed by the literature where 810, 940, 980 nm were used for ELT with similar parameters ,9,10. PrWhen using the continuous mode , Timperman, has treated 100 veins with an average energy of 95 J/cm . Follow-up and success at 1 week was 100%, 96% at 3 month follow-up and finally 95% at 9 month follow-up . Using 5In pulsed mode, it is often difficult to obtain details concerning parameters used for ELT. If power and pulse duration are usually reported, information concerning speed of fiber withdrawal is usually missing. Results reported in the literature are highly variable and tend to prove that this parameter is not well controlled by the operator. In a study performed in 476 limbs , Theivacumar et al observed that occlusion rates were significantly greater at higher energy levels . Using 5An interesting observation is that less energy is required in pulsed mode than in continuous mode because the vein is not heated along its entire length. However, as illustrated in figures At last, if steam formation during ELT has already been reported, the interpretation given by the authors is inappropriate . Steam bConsequently, the parameters determined through calculation in our model, especially the ones concerning the different outcome in relation with the different diameters, seem to confirm and explain the observations emerged by the clinical practiceThe parameters determined by mathematical modeling are in agreement with those used in clinical practice. They confirm that thermal damage of the inner vein wall (tunica intima) is required to achieve the tissue alterations necessary in order to lead the vein to permanent occlusion. However, in order to obtain a high rate of success without adverse events, the knowledge of the vein diameter after tumescent anesthesia is recommended in order to use the optimal energy. As clearly demonstrated by our calculations, both pulsed and continuous mode operations of the laser can be efficient. An interesting observation in our model is that less amount of energy is required in pulsed mode than in continuous mode. Damaging the vein sequentially along its entire length may lead to permanent occlusion. However, the pulsed mode requires a very precise positioning of the fiber after each pullback and the duration of the treatment is much longer. For these reasons, continuous irradiation seems to be preferred by most clinicians.This model should serve as a useful tool to simulate and better understand the mechanism of action of the ELTThe movie shows the isodamage distribution inside tissues using the following parameters: power: 15 W, pulse: 2s, delay: 2s, pull-back distance: 3 mm ; vein diameter: 3 mm; \u03bb = 980 nm. The movie belongs to Figure Click here for fileThe movie shows the isodamage distribution inside tissues using the following parameters: power: 15 W, pulse: 2s, delay: 2s, pull-back distance: 5 mm ; vein diameter: 3 mm; \u03bb = 980 nm. The movie belongs to Figure Click here for fileThe movie shows the isodamage distribution inside tissues using the following parameters: power: 15 W, pulse: 2s, delay: 2s, pull-back distance: 7 mm ; vein diameter: 3 mm; \u03bb = 980 nm. The movie belongs to Figure Click here for fileThe movie shows the isodamage distribution inside tissues using the following parameters: : power: 15 W, pull-back speed: 1.5 mm/s, vein diameter: 3 mm, \u03bb = 980 nm. The movie belongs to Figure Click here for file"}
+{"text": "We need a sensor to measure the convective heat transfer coefficient during ablation of the heart or liver.in vivo convective heat transfer coefficient, h in animals, using a Wheatstone-bridge circuit, similar to a hot-wire anemometer circuit. One arm is connected to a steerable catheter sensor whose tip is a 1.9 mm \u00d7 3.2 mm thin film resistive temperature detector (RTD) sensor. We used a circulation system to simulate different flow rates at 39\u00b0C for in vitro experiments using distilled water, tap water and saline. We heated the sensor approximately 5\u00b0C above the fluid temperature. We measured the power consumed by the sensor and the resistance of the sensor during the experiments and analyzed these data to determine the value of the convective heat transfer coefficient at various flow rates.We built a minimally invasive instrument to measure the h in W/(m2\u00b7K) were for distilled water 5100 to 13000, for tap water 5500 to 12300, and for saline 5400 to 13600. Theoretical values were 1900 to 10700.From 0 to 5 L/min, experimental values of in vivo h in animals and provides the least disturbance of flow.We believe this system is the smallest, most accurate method of minimally invasive measurement of  Radiofrequency (RF) catheter ablation has been used to treat many types of cardiac arrhythmias such as atrial tachyarrhythmias , atrioventricular nodal re-entrant tachycardia, Wolf-Parkinson-White syndrome, symptomatic supraventricular and ventricular tachycardia  -5 with hin vivo. Nerem et al. [Hot wire/film anemometer systems have been used to measure the blood velocity m et al.  used a hm et al.  developem et al.  performem et al.  analyzedh) is essential for the simulation of heat loss from the endocardium to the blood pool in the cardiac chambers [h ranging from 44 to 6090 W/(m2\u00b7K) for various locations in the cardiac chambers [in vivo measurement in animals. Because we did not find in vivo measurements of h in animals, we built our instrument, which is a Wheatstone-bridge circuit connected to a thin film resistive temperature detector (RTD) sensor, similar to a hot-wire anemometer circuit, and used it to measure the endocardial h first in vitro and then in vivo [In order to improve the electrodes and success rate of RF catheter ablation, researchers have used finite element method (FEM) modelling to simulate the ablation ,12,13. Tchambers ,13. Resechambers ,13-15, h in vivo .h might be advantageous, but will be very difficult to attain given the real geometry of the sensor and the operating conditions envisioned for its use. Of equal value, and far more realizable, is a sensor that can provide repeatable, reasonably accurate estimates of local h, exhibiting the variations in time and space expected in the in vivo application. We will demonstrate the sensor described provides repeatable results in in vitro experiments, which are consistent with an estimated lower bound on h from heat transfer correlations on an idealized geometry.Absolute accuracy in measuring heat transfer coefficient h inside the cardiac chambers, we performed in vitro experiments to ensure the capability of our measuring system, to test for any leakage current and to calibrate the system. The in vitro experiment setting was consisted of a circulation system ).In order to obtain the value of tem Fig. , the sentem Fig.  and 3, ttem Fig.  and the Fig. Since the tube was more than 20 times longer than the diameter of the tube, this suggests that the expected laminar flow was fully developed at the measuring point. As the fluid flowed past the sensor, it dissipated heat from the sensor and cooled the sensor by means of convection. The higher the flow rate, the faster the heat was dissipated.h, in vivo, it is important that the measuring system  will not create any leakage current while performing the h measurements. Since the electrical conductivity (\u03c3) of blood is around 0.60 to 0.67 S/m at 20 to 25\u00b0C [in vitro tests in fluid that has electrical conductivity similar to that of blood. Therefore, three different types of fluid were used: distilled water, tap water and saline. Distilled water (\u03c3 \u2248 10-4 to 10-3 S/m [in vitro experiments (as control experiments) in order to avoid having any leakage current during the experiment. Tap water , which 0.15 S/m ), which Rs, forming one arm of a Wheatstone bridge. This circuit maintained the resistance of the sensor (Rs) at a constant value, hence holding the temperature of the sensor constant (constant temperature mode). During the measurement, the sensor was heated approximately 5\u00b0C above the temperature of the flowing fluid . The electric power consumed by the sensor and the resistance of the sensor during the experiment were recorded and analyzed to yield the value of h.Fig. RS = RR (G - 2)/(G + 2) where RR is the total resistance of the upper right arm of the bridge, and G is the gain of the op amp [in vivo, higher temperatures may cause blood coagulation on the surface of the sensor and may damage the surrounding cells [in vitro tests. Dissipation of the heat occurred because the flowing fluid carried the warmed fluid away from the surface of the heated sensor. Increased velocity of the fluid reduced the fluid temperature next to the sensor and therefore the ohmic resistance of the sensor. Restoration of the sensor to its original working temperature was achieved by feedback controlled by the op amp. The sensor current increased to increase the power and the temperature of the sensor.The Wheatstone bridge had a resistive temperature detector (RTD) sensor in one arm of the bridge, and three wire-wound resistors (1 W), and a precision potentiometer in the other arms. A power operational amplifier supplied the power to the circuit and the sensor. The resistance of the sensor was maintained constant by the bridge at e op amp . The senng cells . TherefoV1) and the voltage across R1 and RS (VA)  = Qh \u00a0\u00a0\u00a0 (1)q is the heat flow (W), Qh is the electric power consumed by heating the sensor (W), h is the convective heat transfer coefficient (W/(m2\u00b7K)), A is the sensor area (m2), TS is the temperature of the heated sensor (K), and T\u221e is the temperature of the bulk fluid (K). However, since the sensor we used was not a bare Pt thin film, we calculated a correction.where: in vivo h, we required a catheter that could be externally steered and placed against cardiac chamber and vessel walls. The sensor  was at the tip of a cardiac ablation catheter and Loctite sealed the electric connection, covered the backside of the probe and rounded the sharp edges of the sensor. Fig. To measure Rc = Rs + 8.51 \u03a9, where Rs was the resistance of the bare sensor.When electrically connecting the bare sensor to a catheter, the overall resistance of the catheter sensor was greater than that of the bare sensor because of the added resistance of the lead wire. We used an adjustable temperature water bath and a digital multimeter (model# HP34401A) to plot the resistance versus the temperature shown in Fig. h for laminar flow, constant heat flux [It was important to consider the closest theoretical prediction possible in order to guide our experimental testing. Therefore, we calculated the value of forced eat flux , using:k is thermal conductivity (W/(m\u00b7K)), L is the length of the heated area , .where: Nu is the Nusselt number (dimensionless), x = 0 to x = L, and Re < 5 \u00d7 105 can be estimated from the following equation [The average Nusselt number (Nu) for laminar flow, constant heat flux from a flat plate heated from equation :1/2)(Pr1/3) \u00a0\u00a0\u00a0 (3)\u03b1 is the Womersley number (dimensionless), St is Strouhal number (dimensionless), \u03c1 is the density of fluid (kg/m3), \u03bc is dynamic viscosity (N\u00b7s/m2), \u03bd is the kinematic viscosity = \u03bc/\u03c1 (m2/s), CP is specific heat at constant pressure (J/(kg\u00b7K)), u is the velocity of the flow at the sensor location (m/s)where: Re is the Reynolds number (dimensionless), Pr is the Prandtl number (dimensionless), F = Flow, D is the diameter of the tube (m), f is a characteristic frequency of the waveform  (Hz), At is the cross-sectional area of the 20 mm diameter tube = \u03c0(0.01)2 = 3.1416 \u00d7 10-4m2.h, the values of Pr, \u03c1, \u03bc, CP, and k at 37\u00b0C and 39\u00b0C are listed in Table in vitro experiments, the unsteadiness of the flow was insignificant  and could be neglected. However, in physiological situations, a larger value of the Womersley number would be obtained, thus equations (4) and (5) must be adjusted according to the unsteadiness of the flow due to the heart rate.For the calculation of When placing a heated sensor in a still liquid, heat generated by the sensor is dissipated by free or natural heat convection. The average value of free or natural convection, caused by the fluid movement resulting from the change of the fluid density due to the heating process, can be calculated using :Tf), where:where the subscript f indicates that the properties in the dimensionless groups are evaluated at the film temperature (T\u221e is the fluid temperature (\u00b0C), Tw is the wall temperature (of the heated plane) (\u00b0C), and for constant heat flux surface:where: f is the Grashof number at the film temperature, Prf is the Prandtl number at the film temperature, g is acceleration of gravity (m/s2), \u03b2 is the temperature coefficient of thermal conductivity (1/K), x is the length of the exposed area of the heated sensor (= 3.2 \u00d7 10-3 m), \u0394T is temperature difference of the fluid and the wall (T\u221e - Tw), C is a constant, and can be evaluated by the value of GrfPrf, m is a constant, and can also be evaluated by the value of GrfPrf, h is the local free convective heat transfer coefficient (W/(m2\u00b7K)).where: Grh and Nuf can be analyzed according to Table xPrf is lower than 104, we used Fig. 7-7 of [C and m.For free convection from isothermal vertical planes, the values of local . 7-7 of   and 2\u00b7K).In a water bath with constant temperature of 39\u00b0C, a sensor was placed vertically. The sensor was heated to a constant 5\u00b0C above the water temperature. The free u, Re, Nu and Table h since a glass layer covers the top of the Pt thin film. A thermal circuit analogous to an electric circuit was used for this correction. We treated the heat transfer-rate (q) as a flow. We calculated the thermal resistances from the thermal conductivity, convective heat transfer coefficient, and thickness of the material and the area of the material. The temperature difference is analogous to the potential difference. The Fourier equation [We calculated a correction for the sensor to obtain a more accurate value of equation  may be wRG. The equivalent thermal resistance of the ceramic layer is RC and the equivalent thermal resistance of the Loctite layer is RL. Convection occurs on the surface of this layer, and is included in this thermal circuit as Rconv. Fig. RG, RC, RL and Rconv can be calculated using:When the sensor is heated, the heat from the Pt thin film conducts through this thin layer of glass, which is on the top of the Pt film. The equivalent thermal resistance of the glass layer is and dG is the thickness of the glass layer = 0.027 mm, kG is the thermal conductivity of the glass = 1.38 W/(m\u00b7K), dC is the thickness of the ceramic substrate = 0.45 mm, kC is the thermal conductivity of the ceramic = 6.06 W/(m\u00b7K), dL is the thickness of the Loctite = 1.00 mm, kL is the thermal conductivity of the Loctite = 0.55 W/(m\u00b7K), A is the surface area of the glass layer = the surface area of the ceramic substrate = 3.2 mm \u00d7 1.9 mm = 6.08 \u00d7 10-6 m2where: RL) and the thermal resistance of the ceramic substrate (RC) is parallel to the thermal resistance of the glass layer. Thus for the catheter sensor, we calculate h, using:Heat from the layer of thin film Pt also conducts through the ceramic substrate and Loctite layer as shown in Fig. A is the exposed surface area of the catheter sensor = 1.9 mm \u00d7 3.2 mmwhere h from 16 experiments (for each flow rate) at various flow rates in three different types of media: distilled water, tap water and saline. Table h and the standard deviations of the values of h from each flow rate. All of the in vitro experiments were performed at 39\u00b0C similar to the swine body temperature.Fig. h in W/(m2\u00b7K) were for distilled water 5100 to 13000, for tap water 5500 to 12300, and for saline 5400 to 13600  at 1 L/min, which was about 13% higher than the lowest value of h obtained from tap water). At the higher flow rates (from 4 L/min or higher), saline yielded the highest value of h (13600 W/(m2\u00b7K) at 5 L/min, which was about 9% higher than the lowest value of h obtained from tap water). No significant differences of h among these three media were found at any flow rate.The experimental results show that from 0 to 5 L/min, values of h results from the in vitro experiments of those three types of media yielded a higher value of approximately 1500 W/(m2\u00b7K) above the theoretical value.It is important to consider the closest theoretical prediction possible in order to guide our experimental testing. Therefore, we compared the experimental results with the theoretical values and found that at all flow rates, the h and tested it in distilled water, tap water and saline. The measured h varied significantly with flow rate, as theory suggests it should, but did not follow the square root dependence on Reynolds number that was expected. The present data varied approximately with the 0.3 power, whereas theory suggests 0.5.We have built an instrument for the measurement of Because of the small size of the sensor, the Grashof or Rayleigh Number and the Reynolds number (for the forced convection flows) were small. Most of the correlations were more reliable at the upper end of the Grashof or Reynolds number ranges, hence the experimental data agreed better with the theoretical calculation at higher flows.At the lower flow rate in stagnant liquid (at low Grashof Number), the experimental flow regime is uncertain. The natural convection correlation assumes a flat vertical surface, no edge effects, constant fluid properties, and no forced convection (fluid movement) at all, which are difficult to replicate. Most other experiments in natural convection attempt to achieve relatively large Grashof numbers, where the flow is strongly driven by free convection with negligible small amounts of forced convection. However, in our case, Gr was small, so normally negligible small forced convection had a big effect and could not be neglected.in vitro experiments, which suggested that this system should be safe to perform the measurement in vivo.The data changed slightly with the type of medium. All three data sets were within \u00b1 7% of the mean line . No leakage current was detected in all h at the tube wall in vitro because the tube wall was rigid and the sensor would have been forced away from the wall into flow streamlines different from those at the tube wall. This is the reason we measured h on the axis, with known flow. Once we calibrated h on the axis, we later used the sensor in vivo against the soft tissue of the endocardium or vessels to measure h. The sensor was small enough so that it indented the soft tissue to place the sensor face close to the wall contours and achieve minimal disruption of the flow streamlines at the endocardium or vessel wall. This enabled measurement of the value of h at the endocardium or vessel wall, which was less than the value of h away from the wall.We did not measure in vivo h in animals and provides the least disturbance of flow.We believe this system is the smallest, most accurate method of minimally invasive measurement of The author(s) declare that they have no competing interests.CT carried out the design of the test equipment, ran tests, and drafted the manuscript. LC ran tests. JGW conceived of the study, and participated in its design and coordination and helped to draft the manuscript. PVF contributed to the heat transfer sections. All authors read and approved the final manuscript."}
+{"text": "Techniques based on radio frequency (RF) energy have many applications in medicine, in particular tumour ablation. Today, mammography screening detects many breast cancers at an early stage, facilitating treatment by minimally invasive techniques such as radio frequency ablation (RFA). The breast cancer is mostly surrounded by fat, which during RFA-treatment could result in preferential heating of the tumour due to the substantial differences in electrical parameters. The object of this study was to investigate if this preferential heating existed during experimental in vitro protocols and during computer simulations.Excised breast material from four patients with morphologically diagnosed breast cancers were treated with our newly developed RFA equipment. Subsequently, two finite element method (FEM) models were developed; one with only fat and one with fat and an incorporated breast cancer of varying size. The FEM models were solved using temperature dependent electrical conductivity versus constant conductivity, and transient versus steady-state analyses.Our experimental study performed on excised breast tissue showed a preferential heating of the tumour, even if associated with long tumour strands. The fat between these tumour strands was surprisingly unaffected. Furthermore, the computer simulations demonstrated that the difference in electrical and thermal parameters between fat and tumour tissue can cause preferential heating of the tumour. The specific absorption rate (SAR) distribution changed significantly when a tumour was present in fatty tissue. The degree of preferential heating depended on tissue properties, tumour shape, and placement relative to the electrode. Temperature dependent electrical conductivity increased the thermal lesion volume, but did not change the preferential heating. Transient solutions decreased the thermal lesion volume but increased the preferential heating of the tumour.Both the computer model and the in vitro study confirmed that preferential heating of the tumour during RFA exists in breast tissue. However, the observed preferential heating in the in vitro studies were more pronounced, indicating that additional effects other than the difference in tissue parameters might be involved. The existing septa layers between the cancer tissue and the fatty tissue could have an additional electrical or thermal insulating effect, explaining the discrepancy between the in vitro study and the computer model. At least 10% of the women in the western world face the prospect of developing breast cancer. The tendency in modern treatment of these tumours is towards less invasive local treatment. Today breast conserving surgery (BCS) has become more common than mastectomy in many countries. BCS and mastectomy combined with radiation are associated with satisfactory long-term outcome. The survival rates after BCS of ductal carcinoma in situ is approximately 98%, whereas approximately 100% of these patents are cancer free after mastectomy . HoweverRFA devises induce thermal tissue necrosis in the target region. Temperature elevation is caused by ion agitation, which is converted into heat by the effect of friction. Current is generated by an applied voltage between two electrodes. For the monopolar regime, these are the non-isolated part of a treatment (active) electrode (see figure The absorbed power density at each point is:3), E = electric field (V/m), J = current density (A/m2) and \u03c3 = conductivity (1/(\u03a9\u00b7m)) (Vector variables have both a magnitude and a direction and are presented with an over-bar.). The total current through each closed surface enclosing one of the electrodes always equals the total current from the generator, independent of surface size. Hence, the heating will be concentrated in the region close to the active electrode, where the surface area is small and the current density is high. During experimental protocols with our electrode in in vitro muscle tissue, 87% of the total electrical energy is absorbed in an iso-potential volume with radius 2 cm  = 0 \u00a0\u00a0\u00a0(2)\u25bd\u00b7[\u03c3 and T is the temperature (\u00b0C). The thermal behaviour is governed by the bio-heat equation:3), c is the heat capacity (J/kg\u00b0C), k is the thermal conductivity (W/\u00b0C m), q is the electrical energy source, \u03c1b is the density of blood, Cb is the heat capacity of blood, \u03c9 is the blood perfusion, Tblood is the basal temperature of the blood, and Qm is the metabolic heat source. In an in-vitro situation, the metabolic heat source and the blood perfusion are set to zero.where \u03c1 is the tissue density  and a tissue-electrode boundary. In most cases tumour tissue is also included in the model, figure 00 mm andSeveral previous studies have investigated the thermal and electrical parameters of breast tissue -29. The in. The non-conducting part had an insulating boundary condition, i.e. the current component orthogonal to the surface is zero. The thermal boundary condition of the outer surface was set to 20\u00b0C, i.e. the initial temperature of the tissue. With our equipment, the temperature at the electrode boundary does not diverge far from the cooling media temperature. Thus, the thermal boundary condition of the electrode was set to the cooling media temperature, T = 20\u00b0C, to incorporate the electrode cooling in the model.The electrical boundary condition for the outer boundary was set to V = 0, representing the ground electrode. The electrical boundary condition for the conducting electrode was set to a source potential of V = Vin was adjusted to obtain a final maximum temperature of 100\u00b0C. Additionally, two controlled 15 min transient simulations were performed, cases 9 and 10. During these simulations, the maximum temperature was maintained at approximately 100\u00b0C throughout the whole treatment, by successively adapting the boundary condition Vin.Ten finite element method (FEM) ,33 modelA quadratic mesh consisting of Lagrange triangular elements was used for both the thermal and the electrical problems. The conservationof energy introduced by the source was checked and found highly reliable. This measurement serves as an indication of accuracy in the formulation. Furthermore, a common ad hoc procedure of successive mesh refinement was used, with the FEM solution considered converged when the difference in maximum temperature between successive calculations was less then 0.1% for a doubling of the number of elements. Thermal lesion size was determined using the 50\u00b0C margin. Even though the thermal lesion volume is dependent on both temperature and time of elevated temperature, similar lesion dimensions have been obtained using both thermal dose and threshold temperature .In a circular area around the electrode canal there was a well established coagulation necrosis, i.e. condensation and loss of nuclear details and homogenisation of the cytoplasm figure . The themax, using both temperature dependent and constant electrical conductivity. The temperature plot along the symmetry axis (r = 0) for different tumour dimensions (cases 4\u20138) using temperature dependent electrical conductivity can be observed in figure The power consumption, impedance, voltage and current during the treatment for each of the cases are shown in table The largest thermal lesions were created using temperature dependent electrical conductivity and steady state solving. Furthermore, temperature dependent electrical conductivity mimics the impedance behaviour in the in vitro studies, which demonstrated a decreasing impedance of up to 50%. Hence, only temperature dependent electrical conductivity was used to document the effect of tumour spatial shape and the influence of time dependence. The baseline impedance in the experimental studies varied between 80 and 200 \u03a9. During FEM simulation the baseline impedance varied between 51 and 373 \u03a9, using only tumour tissue or only fat tissue, respectively. Consequently, the electrical parameters in the in vitro experiments and in the FEM model correspond well. In the models with only fat tissue, the heat was shifted towards the tip and away from the electrode because of the cooling along the electrode shaft and the increased SAR created by the curvature of the electrode tip. The shift in temperature between corresponding models with and without tumour is primarily explained by the shift in absorbed electrical power density figures . In the The effects of temperature dependent electrical conductivity during RFA have been studied by Chang . TemperaWe have limited the computer model to include two tissue types: fat and tumour, giving a fair representation of the real situation. The electrical properties of glandular and connective tissue are similar to those of cancer. Thus, connective and glandular tissue are also preferentially heated by the RF-energy, which was confirmed in the in vitro studies. Hence, incorporation of glandular and connective tissue provides little additional information on the preferential heating of the tumour. To correctly mimic the SAR situation during RF ablation, a three dimensional model must be used, i.e. the iso-potential surface must increase with the distance squared from the electrode. This is for obvious reasons not the case in two dimensional or one dimensional Cartesian models. However, if the situation demonstrates rotational symmetry a two dimensional axially symmetric model can be used instead to significantly decrease calculation time and related computer resources. Non-linear models, transient analysis, and the use of different tissue types made rotational symmetry essential in our case. The tumour shapes considered are not claimed to be perfect representations of the true situation. A better representation would be a core tumour from which thin outgrowths extend. However, this configuration is impossible to achieve with rotational symmetry and with current limitations in our computational resources. Additionally, such a model would have too many variables to easily assess any conclusions. In this study the tumours introduced were shaped to present a similar situation as in the tumour strands extending from the core. We have, as a first step, developed a model with rotational symmetry and only two variables, thickness and length, which can demonstrate possible preferential heating of the tumour. Potential effects of temperature dependent thermal conductivity are not incorporated in this model. This phenomenon is usually not accounted for because of its low temperature coefficient, approximately 0.1%/\u00b0C for muscle tissue , and no Regarding the FEM simulations, a strict error analysis is not considered possible for this multi-field problem. An indication of accuracy in the formulation is the conservationof energy introduced by the source. This was checked and found highly reliable. This finding verified that the element approximation is able, in the limit, to reproduce the governing mathematical formulation. With respect to grading of the element mesh, a Cauchy convergence test was used to assess if the mesh had an appropriate size. The accuracy level in the two aspects of the simulations is thereby considerably higher than for the tissue material parameters used. The computer and experimental studies were performed in an in vitro situation, disregarding possible effects of blood perfusion. Thus, the lesion size is overestimated compared to the in vivo case. Furthermore, the preferential heating of the tumour is probably decreased due to the temperature dependent blood flow.We have shown that RFA of breast cancer in vitro results in preferential heating of the tumour during both the experimental and the computer simulation studies. However, during computer simulation of thin tumours, the preferential heating at the thermal lesion margin vanishes due to increased heat conduction from the tumour. Thus, the preferential heating of the tumour observed in the experimental studies was more pronounced, especially in the long outgrowths extending from the core tumour, indicating that additional effects other than just differences in electrical and thermal parameters must be involved. During cancer growth, fibrous septa membranes are produced by the tumour and existing membranes are pushed in front of the tumour, creating numerous thin membrane layers at the tumour interface. These septa layers between the cancer tissue and the fatty tissue could have an additional electrical or thermal insulating effect. Thermal insulating membranes would probably increase the temperature in the tumour in distant regions where they dominate.HW contributed with the initial idea that dissimilar tissue properties might result in preferential heating of the tumour. He also filed the ethical applications and performed the RF-ablation for the in vitro study with VE. VE initiated the study to investigate if dissimilar tissue parameters could invoke preferential heating of the tumour by FEM analysis, performed all FEM analysis and summoned the results in this paper. IS performed the mastectomies for the in vitro study and summarized the results for this study. BS advised on how to model a tumour i.e. shape, composition and location, etc. He also performed the histological investigation in the in vitro study. SR assisted on the general concept. AE advised and helped on many matters during the FEM modelling process. Additionally AE helped with the proofreading process and provided the needed facilities. All authors read and approved the final manuscript."}
+{"text": "Since its introduction in 1987, radiofrequency (RF) ablation has developed to become the treatment of choice for symptoms caused by atrio ventricular (AV) reentrant tachycardia, isthmus related atrial flutter, AV-nodal reentrant tachycardia and to some extent also for certain types of ventricular tachycardias. The introduction of new cardiac activation mapping systems has further contributed to the successful and safe application of RF ablation for various tachyarrhythmias.In 1979, the first catheter ablation was performed coincidentally when Fontaine et al. observed a complete AV block in a patient undergoing defibrillation while one defibrillator electrode was in electrical contact with a catheter electrode positioned at the bundle of His ,3. AlthoThe advantages of radiofrequency energy as compared to direct current are the generation of well circumscribed lesions without stimulation or sensory effects. In order to more appropriate titrate radiofrequency power, catheter tip temperature monitoring was investigated experimentally in 1989 by Hindricks et al. and Haines et al . In 1992In RF ablation, the heating of cardiac tissue is mainly resistive. RF current is applied to the tissue via a metal electrode at the tip of the catheter, with a large skin electrode serving as indifferent electrode. The current density patterns in the tissue are determined by electrode size and geometry, electrode contact and local tissue properties. Also, of course, the current density will be proportional to the current (I) delivered by the RF generator, which, for constant resistance (R) of the electrode-tissue volume conductor is proportional to the square root of the RF power (P = I2 R).Current flow through a resistive medium causes heating, which is proportional to the square of the current or, locally, to the square of the local current density. The temperature increase will locally be proportional to the energy applied per second , and increases inversely proportional to the heat capacity of the local medium. In addition, when temperature differences between adjacent areas develop because of differences in local current density or local heat capacity, heat will conduct from \"hotter\" to \"colder\" areas, causing the temperature of the former to decrease and that of the latter to increase. Additionally, heat loss to the blood pool at the surface and to intramyocardial vessels determine the temperature profile within the tissue.The heating occurs especially in the proximity of the active electrode due to its relatively small surface area causing locally high current density as compared to the site of the indifferent electrode. Typically, living tissue will be permanently destroyed at temperatures of approximately 45\u00b0 to 50\u00b0 C sustained for several seconds .The tissue surface is cooled by the blood flow and thus the highest temperature during radiofrequency delivery occurs slightly below the surface. In a numerical model, the temperature distribution during radiofrequency energy was simulated . The modThis temperature behavior was confirmed experimentally by Cao et al. who performed temperature measurements in vitro with multiple thermocouple needles at different depths and recorded the temperature behavior during ablation . The catThe heating of cardiac tissue by radiofrequency current thus depends on the current density distribution in the tissue, the tissue's heat capacity and heat conduction properties and heat convection.The catheter tip temperature in turn depends on the tissue temperature but also on convective cooling by the surrounding blood, and the tissue contact of the ablation electrode -15. In aRadiofrequency current heats cardiac tissue and in turn the catheter electrode is being heated. Consequently, the catheter tip temperature is always lower - or ideally equal - than the superficial tissue temperature.The catheter tip temperature, which is measured and used to control the radiofrequency power output, can be significantly lower than the tissue temperature ,17. KongOnly under standardized and stable experimental conditions of flow and electrode-tissue contact the tip temperature correlates to lesion size because increasing target temperature then increases power consumption and in turn increases lesion size ,14.During temperature controlled radiofrequency ablation tip temperature, tissue temperature and lesion size are affected by electrode-tissue contact and cooling effects by the blood flow. Petersen et al. investigated the effect of convective cooling on lesion dimensions . In vivoIt is important to understand that radiofrequency power delivered to the tissue determines lesion size and that the catheter tip temperature is poorly correlated to lesion size in vivo. With good contact between catheter tip and tissue and low cooling of the catheter tip the target temperature can be reached with little power resulting in fairly small lesions although a high tip temperature is being measured. In contrast, a low tip temperature can be due to a high level of convective cooling resulting in high power consumption to reach target temperature yielding relatively large lesions. This is best illustrated with active cooling of the catheter tip using irrigation during radiofrequency energy delivery. The tip temperature is usually below 40\u00b0 C but that allows the application of high power output for longer durations.Nakagawa et al. compared the lesion dimensions produced with saline-irrigated electrodes with those produced with non-irrigated electrodes in a canine thigh muscle preparation . With saWith high irrigation flow rates catheter tip temperature is not representative for tissue temperature and therefore feedback cannot be used to control power output. However, Petersen et al. demonstrated the feasibility of tip temperature controlled irrigated radiofrequency delivery with low irrigation flow rates yielding larger lesions compared to non-irrigated ablations  .A similar effect can be observed with large tip electrodes. With large electrode tips a larger area of the electrode tip is exposed to the blood flow than with standard tip lengths resulting in higher power consumption and lower tip temperatures yielding larger lesions .In addition to cooling effects, the electrode tissue-contact affects the catheter tip temperature and the difference between tip temperature and tissue temperature. Avitall et al. evaluated the influence of electrode tissue contact on temperature rise and lesion size under stable flow conditions in an in vivo animal model during constant power delivery . They deWith poor contact between electrode tip and tissue less electrode material is in contact with the tissue and heating of the tip by the tissue occurs at a smaller rate resulting in relatively low tip temperatures. As a consequence, the RF generator increases power output in order to reach target temperature.If the electrode-tissue interface temperature increases above the boiling point due to inadequately high power delivery, any liquids under the electrode will boil and vapor will form causing a popping sound. This is often associated with sudden impedance rise and catheter dislodgment and may cause significant tissue damage ,24. As eSince catheter tip temperature is affected by cooling effects and electrode-tissue contact it would be ideal to monitor in real time the tissue temperature during radiofrequency energy delivery. Recently, it was shown in an in vitro study that the lesion size becomes less dependent from cooling effects and electrode-tissue contact if the radiofrequency power is controlled by the tissue temperature instead of the catheter tip temperature . An extrMonitoring catheter tip temperature and closed loop control of power output are useful to avoid excessive heating at the tissue surface, that may result in coagulum formation, and to accomplish effective heating at the target area. However, the catheter tip temperature is affected by cooling effects and electrode-tissue contact and thus poorly correlated to lesion size. New means should be developed to assess tissue temperatures during radiofrequency delivery to achieve predictable and reproducible lesions."}
+{"text": "Computational modeling and experimentation in a model system for network dynamics reveal how network phase relationships are temperature-compensated in terms of their underlying synaptic and intrinsic membrane currents. Cancer borealis. The pyloric rhythm is a triphasic motor pattern in which the Pyloric Dilator (PD), Lateral Pyloric (LP), and Pyloric (PY) neurons fire in a repeating sequence. While the frequency of the pyloric rhythm increased about 4-fold (Q10\u223c2.3) as the temperature was shifted from 7\u00b0C to 23\u00b0C, the phase relationships of the PD, LP, and PY neurons showed almost perfect temperature compensation. The Q10's of the input conductance, synaptic currents, transient outward current (IA), and the hyperpolarization-activated inward current (Ih), all of which help determine the phase of LP neuron activity, ranged from 1.8 to 4. We studied the effects of temperature in >1,000 computational models  of a bursting neuron and the LP neuron. Many bursting models failed to monotonically increase in frequency as temperature increased. Temperature compensation of LP neuron phase was facilitated when model neurons' currents had Q10's close to 2. Together, these data indicate that although diverse sets of maximal conductances may be found in identified neurons across animals, there may be strong evolutionary pressure to restrict the Q10's of the processes that contribute to temperature compensation of neuronal circuits.Most animal species are cold-blooded, and their neuronal circuits must maintain function despite environmental temperature fluctuations. The central pattern generating circuits that produce rhythmic motor patterns depend on the orderly activation of circuit neurons. We describe the effects of temperature on the pyloric rhythm of the stomatogastric ganglion of the crab,  10's) of synapses and membrane currents. We used computational models to show that the experimentally measured Q10's can promote phase maintenance. We also showed that many model bursting neurons fail to burst over the entire temperature range and that phase maintenance is promoted by closely restricting the model neurons' Q10's. These results imply that although ion channel numbers can vary between individuals, there may be strong evolutionary pressure that restricts the temperature dependence of the processes that contribute to temperature compensation of neuronal circuits.The neural circuits that produce behaviors such as walking, chewing, and swimming must be both robust and flexible to changing internal and environmental demands. How then do cold-blooded animals cope with temperature fluctuations when the underlying processes that give rise to circuit performance are themselves temperature-dependent? We exploit the crab stomatogastric ganglion to understand the extent to which circuit features are robust to temperature perturbations. We subjected these circuits to temperature ranges they normally encounter in the wild. Interestingly, while the frequency of activity in the network increased 4-fold over these temperature ranges, the relative timing between neurons in the network\u2014termed phase relationships\u2014remained constant. To understand how temperature compensation of phase might occur, we characterized the temperature dependence (Q The nervous systems of cold-blooded animals must function across significant ranges of temperature despite the fact that the signal transduction pathways and synaptic and intrinsic membrane currents are all temperature-dependent. This is particularly intriguing because one would not expect all cellular processes to have the same temperature dependence, and therefore it is hard to imagine that functional circuit integrity would necessarily be easily maintained when temperature is altered. Nonetheless, temperature compensation, that is maintenance of constant function as temperature is altered, is an important property of circadian rhythms 10's that describe the changes in their rates as a function of temperature. Although the Q10 for many biological processes is \u223c2, Q10's for ion channels can vary from 1.5 to almost 100. For example, the Q10's for activation and inactivation of some K+ channels are 1.8\u20134.6 10's higher than 10 2+ channels have inactivation rates with Q10's as high as 19 10's that govern the intrinsic and synaptic conductances within a circuit be and still allow appropriate function to be maintained despite environmental temperature change? Which attributes of circuit performance are temperature dependent and which, if any, are temperature compensated?All biological processes have characteristic QCancer borealis, the crab used for this study, lives in the northern Atlantic Ocean, and can be found from Newfoundland to Florida C. borealis inhabit deeper waters (at depths of 800 m), they also are frequently found in both intertidal and subtidal ecosystems foraging for food C. borealis can experience temperature fluctuations ranging from 8\u00b0C to 24\u00b0C within a single day C. borealis is found at ocean temperatures ranging from 3\u00b0C to 16\u00b0C + current (IA) and the hyperpolarization-activated inward current (Ih) The stomatogastric ganglion (STG) of marine crustaceans generates two motor patterns that are responsible for the chewing and filtering of food The phase relationships of the network neurons are maintained relatively constant as a function of frequency 10's, we varied temperature in two different computational models, one of a bursting pacemaker neuron Although the pyloric rhythm is a \u201csimple\u201d neuronal circuit, its dynamics involve the activation and inactivation of many intrinsic and synaptic currents. To determine whether the biological results \u201cautomatically\u201d arise from the effects of temperature on membrane currents with similar QThe triphasic pyloric rhythm of the STG is shown in the extracellular recordings from the motor nerves exiting the STG in p\u200a=\u200a0.35, Mann-Whitney rank sum test, n\u200a=\u200a45 for the non-acclimated population) p<0.05, Levene test).All of the animals used in this study were acclimated to 11\u00b0C for at least 3 wk before use. The frequency of the pyloric rhythms from 23 animals at 11\u00b0C varied from 1.0 Hz to 1.5 Hz and exhibited a mean frequency of 1.20\u00b10.11 Hz (S.D.). The median pyloric frequency of these acclimated animals was not significantly different from that of a non-acclimated population described previously . Remarkably, although the frequency varied considerably as a function of temperature, the phase of firing of the pyloric neurons was virtually unaltered by temperature (n\u200a=\u200a7), as indicated by Q10's not significantly different from 1 .To quantify the effects of temperature on frequency and phase of the pyloric rhythm, we recorded from the motor nerves in seven preparations that were gradually warmed from 7\u00b0C to 23\u00b0C . Figure 2.32\u00b10.2 . Temperaperature , n\u200a=\u200a7, t from 1 . We did To gain further insight into how phase relationships might remain stable despite the increase in frequency as a function of temperature, we examined the intracellular waveforms of the pyloric neurons as a function of temperature. 10\u200a=\u200a0.92\u00b10.1, p\u200a=\u200a0.256, one-way repeated measures ANOVA; p<0.002, one-way repeated measures ANOVA), with a Q10 of 1.56\u00b10.17.Although the total IPSPs in LP are temperature compensated, this does not necessarily mean that the synaptic currents are also constant, as the IPSP waveform and amplitude depend on the other membrane conductances and time constants as well as the synaptic current. We measured the LP neuron input conductance in voltage clamp as a function of temperature by applying tetrodotoxin (TTX) and picrotoxin (PTX) to remove action potentials and block most of the synaptic inputs to the LP neuron. We then stepped the voltage from \u221260 mV to \u221280 mV in 5 mV steps, measured the resulting currents, and calculated the input conductance. The apparent lack of change in IPSP amplitude from 7\u00b0C to 23\u00b0C despite a nearly 2-fold increase in input conductance over that range was intriguing. Therefore, we voltage-clamped the LP neuron during the ongoing pyloric rhythm and directly measured the total Inhibitory Postsynaptic Currents (IPSCs) over the same range of temperatures. 10 of 2.29\u00b10.25 (n\u200a=\u200a7). 10\u200a=\u200a1.56\u00b10.17; The synaptic currents recorded at \u221260 mV are most relevant to understanding the membrane potential trajectories seen during the ongoing rhythm . AccordiA, and the hyperpolarization-activated inward current, Ih, on the phase at which the LP and PY neurons recover from inhibition Previous work demonstrated the importance of both the transient outward current, IA. IA was measured as the difference current between the outward currents evoked from a holding potential of \u2212100 mV and those evoked from \u221240 mV. The currents measured at voltages from \u221240 mV to +30 mV in 10 mV steps are shown at five temperatures from 7\u00b0C to 23\u00b0C  the Q10's of IA and Ih were replaced by the experimentally measured values , but the biologically measured Q10's decreased this effect  and increased the extent to which the LP maintained constant phase as a function of temperature.Taylor et al. d values  and 5. T10's to 1.5, 2.0, and 3.0 (10's for IA and Ih (blue) to the condition in which they had the experimentally determined values (red). These plots show that in the \u201cdefault\u201d (blue) condition, temperature affected the LP onset phase for all Q10's . For the blue condition, LP onset phase came later at high temperatures for Q10\u200a=\u200a1.5, became approximately temperature compensated for Q10\u200a=\u200a2.0, and became considerably \u201covercompensated\u201d for Q10\u200a=\u200a3.0 . Note that the differences between the red and blue conditions were smaller for larger Q10 values .We then examined the effects of changing all of the model QPoikilotherms often face considerable temperature fluctuations during a given day or over extended periods of time. This poses a series of interesting questions for the nervous system, as it needs to maintain its important functions despite these environmental perturbations. Many previous studies have documented the effects of temperature on a variety of behaviors and physiological processes 10's less than 2 are considered to be relatively temperature insensitive, and behaviors with emergent system Q10's less than 2 are conventionally termed \u201ctemperature compensated.\u201d The best known example of temperature compensation is that shown by the circadian rhythm, and its temperature compensation is considered one of its salient features. Although the molecular basis underlying circadian rhythms have been well-elucidated NeurosporaBy convention, processes with QAplysia neuromuscular system. In this preparation, the strength of neuromodulatory effects on muscle contraction was maintained over a temperature range from 15\u00b0C to 25\u00b0C. Paradoxically, the release of neuromodulators that modulate neuromuscular contraction decreased 20-fold when temperature was increased. However, the decrease in neuromodulator release was partially compensated by increased neuromodulator efficacy. Thus in this particular example, physiological temperature compensation is achieved by opposing temperature dependencies of related functions.Zhurov and Brezina In this study, we describe a form of temperature compensation that occurs in a rhythmically active neural circuit. When we rapidly varied the temperature of the in vitro stomatogastric nervous system, the pyloric network frequency varied about 4-fold, from \u223c0.7 Hz at low temperatures to \u223c2.9 Hz at 23\u00b0C . At the A and Ih\u2014have opposing functional roles, temperature compensation of the phase relationships of the pyloric neurons appears to emerge as a consequence of similar temperature dependencies of opposing cellular mechanisms. h activation and delayed by IA activation h and also favor the voltage-dependent deinactivation of IA. Consequently, as temperature increases, these opposing time and voltage-dependent processes, as a first approximation, may remain temporally scaled with each other. The LP off-phase is determined by the phase of PY onset, which is itself maintained constant, presumably by similar mechanisms.All of the component processes we measured increased in amplitude and/or rate with temperature. However, given that some of these component processes\u2014e.g., IA, and Ihh and deinactivation of IAAt constant temperature, the pyloric network phase relationships are also maintained despite changes in frequency Thus, the mechanisms that allow for phase maintenance at constant temperature seem to employ some of the same cellular mechanisms that promote temperature compensation. This is not necessarily surprising, because the strong evolutionary pressure that gave rise to robust phase maintenance may have also forced a set of solutions that would be robust enough to compensate for the frequency changes that arise from changes in temperature.The ability to maintain phase independent of frequency has been well-described in the neuronal control of swimming in lamprey, leech, and crayfish Our commonsense knowledge of the world may lead us to believe that achieving robust behavior in cold-blooded animals over a range of temperature is simpler than it is in fact. The non-trivial nature of this problem is revealed in the computational studies reported here. In both cases, we employed families of more than 1,000 model neurons that varied in terms of the maximal conductances of their underlying currents but were otherwise identical. These modeling studies illustrate the extent to which robust physiological behavior requires that the temperature dependence of the biological processes must be closely regulated.Many of the 1,270 pacemaker models  failed tA and Ih in determining phase in the pyloric network, without the computational studies shown in 10's of IA and Ih would favor temperature compensation of phase. The first result from these studies  and maintained in tanks containing artificial seawater at 11\u00b0C for 3 wk before use.C. borealis physiological saline was composed of 440 mM NaCl, 11 mM KCl, 13 mM CaCl2, 26 mM MgCl2, 11 mM Trizma base, and 5 mM Maleic acid, pH 7.4\u20137.5. All reagents were purchased from Sigma Aldrich.The stomatogastric nervous system was dissected out of the animals and pinned out in a Sylgard (Dow Corning) coated plastic Petri dish containing chilled saline (11\u00b0C). In all cases, we worked only with fully intact stomatogastric nervous system preparations that included the commissural and esophageal ganglia with two intact superior esophageal nerves and two intact inferior esophageal nerves.The preparations were continuously superfused with physiological saline. The temperature of the superfusing saline was controlled using a Peltier device purchased from Warner Instruments. The temperature was changed at about 1 degree/min when only extracellular recordings were made and about 1 degree/2\u20133 min when intracellular recordings were also made. As the temperature was increased we noticed that the ganglia swelled and/or moved. This often necessitated small movements of the intracellular electrodes  to maintain the intracellular recordings. When the electrodes were repositioned carefully, return to 11\u00b0C showed no changes in resting potential, firing properties, or input resistance. If the electrodes were not repositioned slightly, penetrations were usually lost with large temperature changes. The preparations were maintained at their target temperature for 10 min before data were taken.2SO4 and 20 mM KCl. Data were acquired using a Digidata 1200 data acquisition board (Axon Instruments) and analyzed using Clampfit 9.0 (Axon Instruments) Spike2 v 6.04 (Cambridge Electronic Design) and/or MATLAB 7.1 (Mathworks). Statistical analyses were performed using the SigmaPlot 10 and SigmaStat software packages (Jandel Scientific).Vaseline wells were placed around motor nerves and extracellular recordings were obtained using stainless steel pin electrodes placed in the wells and amplified using an A-M Systems differential amplifier. Intracellular recordings were obtained from cell bodies in the STG using 10\u201330 M\u03a9 glass microelectrodes pulled with a Flaming/Brown micropipette puller  The microelectrode solution contained 0.6 M KInput conductance was measured in two electrode voltage clamp by stepping the membrane from \u221260 mV to \u221280 mV in 5 mV steps, measuring the resulting currents, and then calculating the conductance.IPSCs were measured using two electrode voltage clamp during the ongoing rhythm. IPSCs were measured in the LP neuron at membrane potentials from \u221260 mV to \u2212120 mV in 5 mV steps. Each holding potential was maintained for 8\u201312 s, and the membrane potential was returned to \u221260 mV in between each voltage step for at least 8\u201312 s.h and IA were both measured in the presence of 10\u22127 M TTX, 10\u22125 M PTX, and 10\u22122 M TEA. Ih was measured at membrane potentials from \u221250 mV to \u2212120 mV in 5 mV steps using 12 s pulses with 12 s at \u221250 mV between each pulse. IA was measured as the difference current between steps taken from a holding potential of \u2212100 mV and those taken from a holding potential of \u221240 mV. Currents were recorded from \u221240 mV to +30 mV at 10 mV intervals using pulses of 1.5 s following a 1.5 s prepulse.I10. The Q10 is a conventional measure used to describe how much a given rate process changes over a 10\u00b0C temperature change and defined as [rate(T+10\u00b0)/rate(T)] p was plotted against temperature T in a semilog plot and the Q10 value was then extracted from the slope of the linear regression (m) 10 (seQ10) was calculated by propagation error from the slope and the standard error of the slope (sem) of the linear regression To characterize and compare the temperature dependencies of various parameters of the pyloric network, we used a modified Arrhenius equation to determine the temperature coefficient, Q10) of all channel activation and inactivation dynamics. For simplicity we set the Q10 of all the activation and inactivation rates equal to 2. All values for \u221em, \u221eh, m\u03c4, h\u03c4, and p are as found in Liu et al. 10.The model used to simulate bursting neurons has been previously described To create a population of model bursting neurons, we initiated 1,500 simulations with random initial values for all seven active conductances. Each model was subject to 1 h of simulated activity-dependent homeostatic regulation at the model's default temperature of 23.5\u00b0C. Models that showed poor bursting behavior after this period were excluded, resulting in a population of 1,270 model neurons that were bursting at 23.5\u00b0C and which had a variety of different values of the maximal conductances for the voltage-dependent currents. We then turned off the self-tuning function in these neurons and used them as a set of models with different underlying conductances to probe the extent to which they maintained functional bursting activity over a wide range of temperatures.Each model was run at 7, 11, 15, and 19\u00b0C\u2014the same temperatures used in the biological studies. Voltage traces from each of these simulations were analyzed to determine how the bursting behavior varied with temperature. Bursting behavior\u2014as measured by slow wave frequency\u2014was extracted from each simulation using auto-correlation of a 10 s sample of the voltage trace. Here we define slow wave frequency as low-frequency membrane oscillations. We identified the frequency of these oscillations as the lowest frequency peak in the autocorrelogram of the voltage waveform. If this peak had an autocorrelation less than 0.05, we instead used the frequency corresponding to the greatest autocorrelation (this is uncommon and corresponds to very irregular activity).To determine whether the bursting neurons maintained duty cycle as a function of temperature, we calculated the coefficient of variation (CV) of each model's duty cycle. The bounds used to define the population of model bursting neurons that exhibited \u201cconstant duty cycle\u201d were chosen to contain the central \u223c85% of the experimental data (PD off phase). Models exhibiting CVs of duty cycle across temperature within this bound were classified as having constant duty cycle, while those with CVs above this value were classified as having a \u201cnon-constant duty cycle.\u201d10's of IA and Ih affect LP phase onset were performed using the LP model described in Taylor et al. 10's could be associated with all voltage-gated and synaptic conductances. For each voltage-gated conductance, there was a Q10 for the maximal conductance, another for the activation rate, and another for the inactivation rate. The reference temperature was 10\u00b0C, as the model was originally designed to mimic LP's behavior at this temperature. Reversal potentials  were not changed with temperature, as these effects are small over the temperature range used.Simulations to determine how the Q"}
+{"text": "The review summarises the technological advances in the application of high-intensity focused ultrasound for small renal masses presumed to be cancer including the systematic review of its clinical application. Current progress in the area of magnetic resonance image guided ultrasound ablation is also appraised. Specifically, organ tracking and real time monitoring of temperature changes during the treatment are discussed. Finally, areas of future research interest are outlined. The advancements in new technologies for the management of renal cancer offer patients an opportunity for better and personalized care combined with shorter recovery time. Parallel progress in the fields of imaging science, biosensors, and computer technologies has made it possible to achieve an early diagnosis and improved point of care treatment for many cancers. The technological evolution, often driven by scientific and economic gains carry a potential to improve or replace traditional open surgical standards. A distinctive challenge in uro-oncology has been a rise in the detection of small asymptomatic renal masses due to cross-sectional imaging, specifically wide use of abdominal ultrasound. Most of these are malignant, however, a significant number are benign in nature and perhaps surgical removal is an over-treatment. Conversely, some of the small tumors may turn out to be aggressive in nature. Improvements in \u201cconverging technologies\u201d of minimally access surgery and imaging have made it possible to ablate these lesions without surgical removal. High intensity focused ultrasound (HIFU) energy is an emerging minimally invasive technology in addition to existent ablative technique using radiofrequency wave or freezing (cryoablation) for small renal masses. The promise to be delivered extracorporeally is an attractive attribute of this technology. This may have a specific potential in elderly patients unfit for surgical intervention\u2014a growing incidence of small renal masses diagnosed on routine imaging in this population.The present review is aimed at:Appraise the basic and advanced HIFU technology.Systematically review clinical effectiveness.\u22122, with operating frequencies of 0.8\u20133.2 MHz and thus selectively ablate a targeted tumor at net depth without any damage to the superficial tissues overlying the tumor or the surrounding parenchyma. The generated heat denatures the proteins and produces coagulative necrosis. The degree of necrosis depends on several factors: the applied power, the US frequency, transducer characteristics , exposure time, spatial distribution of the field, absorption properties of the tissue, attenuation in the intervening tissue, acoustic reflection and refraction, and finally the perfusion rate in the targeted tissue.HIFU is based on the principles of physical effect of ultrasound (US) energy on the tissue. A focused US beam causes mechanical vibrations in the tissues which produce heat. The thermal effect induces a rapid rise in the temperature within the focal volume of an US beam to cytotoxic levels by focal peak intensities from 5000 to 20,000 W cmThe second effect of focused US energy is the production of cavitation-induced cellular damage . This mechanism can also be exploited for mediated gene transfer and drug delivery.2 In addi\u22122 generated extracorporealy by either multiple or single piezoelectric elements is focused by lenses on the target lesion. There are two systems for extracorporeal HIFU used in experimental or clinical studies. The first one is from Storz Medical , where a parabolic reflector of 10-cm aperture focuses US energy generated by 1 MHz piezo up to a depth of 100 mm. The system has an integrated 3.5-MHz B-mode US transducer. The US beam is coupled into the body by a flexible polyurethane cushion filled with degassed water at 16 \u00b0C, which permits the variation of the skin-focal spot distance by altering its filling.[et al. using an agreed treatment protocol and by exposing the targeted areas up to six times, could achieve an estimated site energy intensity of up to 20,000 W cm\u22122, enough to create cavitation and even bubble formation on real-time diagnostic imaging. The latter has been proposed as a marker of successful tissue ablation.[Extracorporeal systems: The energy, usually of >10,000 W cmablation.et al. in a phase I study used laparoscopic approach through four 12-mm access ports. This was followed by the introduction of an 18-mm port  to introduce the laparoscopic HIFU system , which is composed of a treatment console, an articulated probe arm, a pump unit, and the laparoscopic probe.[2 aperture and a 35-mm focal length. Direct contact with the target provides a better assessment of the changes during the procedure and calibration, if required. In addition, the main advantage is that there are no acoustic interface between the probe and the tumor in contrast to extracorporeal HIFU.Intracorporeal probes using laparoscopic approach: Few technological issues with the application of extracorporeal HIFU have generated interest in an alternate intracorporeal technique using laparoscopic or transcutaneous approach. Klingler ic probe. HIFU eneTissue destruction depends on the level of temperature achievable at the target. Unpredictability of actual temperature changes at the focal point makes it essential to monitor the tissue destruction with real-time imaging during HIFU treatment. Moreover, this reduces the risk of any collateral damage and can be achieved by ultrasound (US) imaging or magnetic resonance imaging (MRI). During US monitoring, thermally induced gray-scale changes indicate temperature rise and hence tissue destruction, especially for peripheral tumors. Alternatively, MRI monitoring is used with images mapping temperature elevations. There are dedicated quantitative software programmes such as tissue change monitoring (TCM) system for Sonablate in prostate cancer treatment; however, use of this has not been described in the treatment of renal masses.Robotic-assisted MRI-guided HFU system: Robotic technology and computational devices are used to achieve preplanning and navigation of surgical devices based on imaging data. Several advantages of robotic technology are: high accuracy, precision, repeatability, and alterations in desired trajectory. Magnetic resonance imaging technique used during intervention can acquire high-quality imaging data that can be used to precisely target the lesions; control the temperature in order to achieve the optimal tissue necrosis and tracking the position of the lesions. The addition of robotic assistance adds precision to the procedure.MR-guided percutaneous interventions such as biopsies, drainage, and insertion of energetic probes for tumor ablation have been developed and clinically demonstrated with open bore, low field, and MR systems. MRI-guidet al. have introduced a robotic assist system dedicated for the GE Signa SP \u201cdouble donut\u201d open MRI[et al. reported on MRI compatible robotic for interaction with human arm motions.[Various image compatible robotics have been developed such as fluoroscopy and computed tomography (CT) image-guided kidney biopsies. Chinzei  open MRI and Gass motions. The deve motions.12 The MR motions..A sensitive search was developed with no language restriction. Studies reporting on HIFU both in the experimental and clinical settings were retrieved from following sources: PUBMED (1966\u20132009), EMBASE (1980\u20132009), and LILACS (1982\u20132009).There were 52 reports in the English literature describing use of HIFU in kidney/renal masses. The breakdown of selected experimental  and clinical (human) studies along with the countries of original studies are shown in Criteri a of pathological changes in the target tissue as an end point: Thermally induced histopathological changes remain the \u201cgold standard\u201d to assess the clinical effectiveness of ablative technologies in the target areas. HIFU energy causes progressive tissue changes in renal lesions. The immediate effects are intense congestion, hyperaemia, and alterations of the microcapillaries. The sub-cellular electron microscopy changes are: alterations of the mitochondria, ribosomes, and lysozymes. The process of necrosis sets in at day 2 and completes by day 7. At day 90, a complete fibrosis of the targeted area is observed.11 Microc5et al. demonstrated tissue damage in 67% of the 18 treated pig kidneys.[\u22121 obtained coagulative necrosis of variable degree in the targeted area.[Outcomes of transcutaneous approach: Selected studies describing use of percutaneous aided by laparoscopic approach of HIFU application are shown in  kidneys. In a difted area. Recentlyted area.et al. treated 19 patients with renal cell carcinoma before surgical removal, focusing HIFU to healthy renal tissue as well. Thermal damage of the removed specimen was variable and poor; seen just in 15 out of 19 specimens. Moreover, they could not correlate the energy administered and lesion size suggesting difficulties in achieving the desired energy sufficient enough to cause necrosis in the target lesions.[The results of the first human phase II study using the Storz system conducted by the University of Vienna were poor. Sixteen renal tumors treated with HIFU: 2 with curative intent and 14 prior to planned surgical resection. Histopathological necrosis as defined above of the specimens in terms of therapeutic effect was seen only in 9 out of 14 cases. All of these lesions had been exposed to the highest site intensities, and the histological damaged tissue only composed 15\u201335% of the targeted tissue.[ lesions.et al. reported significant symptomatic improvement (decrease in pain and cessation of hematuria) in palliative treatment of 13 advanced renal cell carcinoma applying percutaneous HIFU. They admitted that treatment was considered inadequate in 10 patients.[In an another phase II, two trial using the Chongqing system, Wu patients. Similar patients.et al. in a clinical phase I study, using laparoscopic HIFU approach treated 10 patients with solitary renal masses. Two of the renal lesions were 9 cm in size. In this case, HIFU was applied just as a marker lesion before radical laparoscopic nephrectomy. The remaining renal masses were of a median size of 2.2 cm and were treated with a \u201ccurative intent\u201d applying HIFU to the entire tumor with a margin of 2\u20133 mm of surrounding normal parenchyma. Laparoscopic partial nephrectomy was performed in seven of these tumors and one was left in situ in a patient with high comorbidities. The median HIFU treatment time was 19 min (range 8\u201342) in small renal masses. In the first two patients, close to an area of probe placement, just a 2\u20133 mm of vital tissue was seen on histopathology with coagulative necrosis in rest of the tumors. The authors explained this phenomenon to an excessive cooling of the probe during the procedure. They changed the treatment protocol for the rest of the treatment group on the basis of this observation. Complete necrosis was seen in the four remaining removed cases (57%). The nonexcised tumours were followed up by CT scans at 6-month intervals. The core biopsies of these lesions showed coagulative necrosis. There were no enhancement on follow-up imaging and shrinking of the lesion was observed.[Outcomes of laparoscopic approach: The selected outcomes of laparoscopic approach are shown in ed cases 7%. The nComplications: There have been no serious side effects in the treatment of renal cancer using HIFU; just twoThere have been significant encouraging technological improvements of HIFU treatment to manage small renal masses. Two prototype systems such as Storz and Chonqing Haifu have made it possible to conduct phase 1 and 2 studies in animal and patients. Although initial results are far from desired, these studies have shown the safety in targeting the renal tumors. Moreover, it is possible now to focus renal lesions using both extracorporeal and laparoscopic approaches as confirmed by histological evidence.Extracoporeal application of HIFU remains a challenge due to several factors. A combination of patient-related and technological limitations interfere with the power emitted by the US probe and the energy arriving to the targeted area. The focal length, type, and characteristics of the tissue to be crossed through by the energy waves, variable vascularization of the kidney and its mobility as well as the limitation of proximity of air (gut) or bone (ribs) are someThe second challenge of percutaneous HIFU application, possibly more important from clinical effectiveness point of view, in the absence of a relaible radiological method of monitoring the effect of HIFU in real time. The focus of ongoing research is to find more fixed devices coupled with respiratory movements trying to save absorption of US energy from nontargeted tissues such as ribs, fat, or muscles; MRI with its advantage of providing information within seconds of energy application, is being more extensively proposed as a guide to the treatment compared with regular US. Real-timMobility has been partly corrected using multichannel focused US systems, trying to combine motion tracking and feedback electronic steering of the HIFU beam and multiprobe systems of small-aperture confocal HIFU transducers that also theoretically permit more flexible targeting.The poor clinical outcomes, in particular inconsistent histopathological results, could be explained by the combination of drawbacks of the currently available HIFU technologies. A robust technological research guided by vigorous clinical evaluation is still needed before HIFU could be considered suitable for the clinical treatment of renal cancer. Till then this remains to be used in experimental settings.et al. reported a successful outcome of tissue necrosis just for peripheral tumors not larger than 3.5 cm in size.[Laparoscopic-guided application of HIFU facilitates resolutions of many of the problems facing the extracorporeal approach. Using such an approach, Klinger Postablation follow-up of Small Renal Masses SRM using radiology remains to be defined. Patients are generally followed-up by contrast-enhanced CT and MRI. The other methods such as PET and microbubble contrast-enhanced US are under evaluation. In additAmong the various advantages of HIFU applications; repeated use due to lack of cumulative dose effect remains the main attraction; however, need of general anesthesia, especially for laparoscopic approach limits this strategy. MRI-guided focused ultrasound would be optimal as it provides real-time temperature mapping alongside precise tumor delineation for target definition  and accuFocused US induces temporary change of vascular and cell membrane permeability and mechanically triggers the release process of drug delivery systems, i.e., liposomes and polyThe challenges and focus of future HIFU research for small renal masses are:Standardize the pulse and power levels which ascertain tissue death of malignant cells.Number of probes needed for transcuataneous or laparoscopic approach to cause optimal effect.Tracking movements of organs such as kidney in extracorporeal applicationOptimal time and extent of necrosis achievable without causing any unnecessary destruction to the normal tissue.Long-term follow-up to evaluate complications, recurrences free survival, quality of life, and cost effectiveness for the healthcare organization and society.Multicenter randomized controlled trails with the established techniques  considered as gold standard, evolvingHIFU is a fast improving technology with potential to establish itself as the most minimally invasive among the currently available techniques. Poor preliminary clinical results can be explained by the limitation of the technology which is an area of focused research. MRgFUS provides nonaccess thermal ablation with continuous temperature mapping and once fast organ tracking becomes available it has the potential to become an alternative to surgical resection of malignant renal tumors."}
+{"text": "MRI induced heating on PM leads is a very complex issue. The widely varying results described in literature suggest that there are many factors that influence the degree of heating and that not always are adequately addressed by existing testing methods.We present a wide database of experimental measurements of the heating of metallic wires and PM leads in a 1.5 T RF coil. The aim of these measurements is to systematically quantify the contribution of some potential factors involved in the MRI induced heating: the length and the geometric structure of the lead; the implant location within the body and the lead path; the shape of the phantom used to simulate the human trunk and its relative position inside the RF coil.We found that the several factors are the primary influence on heating at the tip. Closer locations of the leads to the edge of the phantom and to the edge of the coil produce maximum heating. The lead length is the other crucial factor, whereas the implant area does not seem to have a major role in the induced temperature increase. Also the lead structure and the geometry of the phantom revealed to be elements that can significantly modify the amount of heating.Our findings highlight the factors that have significant effects on MRI induced heating of implanted wires and leads. These factors must be taken into account by those who plan to study or model MRI heating of implants. Also our data should help those who wish to develop guidelines for defining safe medical implants for MRI patients. In addition, our database of the entire set of measurements can help those who wish to validate their numerical models of implants that may be exposed to MRI systems. Magnetic resonance imaging (MRI) has become the imaging procedure of choice for extensive clinical evaluation and diagnosis. Unlike conventional radiography and computed tomographic imaging, which make use of potentially harmful radiation (X-rays), MRI has many advantages, including its no ionizing nature and the unparallel ability to discriminate different soft tissues without contrast media. However, the substantial benefits of MRI are often denied to patients known to have implanted medical devices such as pacemakers (PM) and implantable cardioverter devices (ICD). The outstanding increases in both MRI usage and cardiac device-based therapy have resulted in an estimated 50\u201375% probability of a patient being indicated for an MRI over the lifetime of their device ,2.MRI induced heating is one of the known risks for implanted PM and ICD: the RF field energy generated during MRI procedures may be coupled into conductive leads in two major ways :1) The conductive lead acts as an antenna capable of receiving and supporting the frequency of the MRI unit's RF field (63.8 MHz for 1.5 Tesla systems or 127.6 MHz for 3.0 Tesla systems). This mechanism can create the resonant waves.2) The implant acts as an electrical \"short circuit\" to the electrical potentials induced within the body by the MRI RF field.Each of these effects induces a RF current which flows from the lead into the surrounding tissues. As a consequence of the high electrical resistance of these tissues, resistive heating is then generated at the lead-tissue interface, causing a temperature increase that could be dangerous for the patients.The scientific and medical literature clearly shows that the MRI-induced heating on metallic leads cannot be immediately neglected: Sommer et al.  demonstr\u00ae temperature probes on the tip of a PM lead (ref). In this paper we present a wide database of experimental measurements of the heating of metallic wires and PM leads in a 1.5 T RF coil. The aim of these measurements is to systematically quantify the contribution of some potential factors involved in the MRI induced heating: the length and the geometric structure of the lead; the implant location within the body and the lead path; the shape of the phantom used to simulate the human trunk and its relative position inside the RF coil. In addition, the data collected will serve as an open-access experimental database for numerical models validation.Such widely varying results indicate how the performance of an implanted or interventional device undergoing MRI is a very complex problem. While it is relatively easy to demonstrate a heating or induced voltage problem, it is far more difficult to prove a solution to these problems, due to the complex and unpredictable nature of the MRI interaction. Several factors influence the degree of heating: the whole body specific absorption rate, the patient position in the coil, the type of imaging sequence, the patient characteristics, the duration of imaging procedure, the body structure being imaged, the type and position of transmit coil, the lead design, the lead orientation within the patient, the degree of perfusion near the device, the temperature measurement procedure, the respiratory phase, etc. Many of these parameters are currently either not recognized or inadequately addressed by existing testing methods . In a prWe performed temperature measurements at the Center for Device and Radiological Health (CDRH), Food and Drug Administration (FDA) in Rockville, MD, USA. We used a full-size RF coil  with 16 legs forming the classic Birdcage configuration Figure . Tuning A schematic representation of the experimental set-up used is shown in Figure We used two geometries as human trunk simulator: a rectangular plastic box Figure  and a PVThe rectangular box phantom (35 \u00d7 61 \u00d7 19 cm deep) was filled to a depth of 11.5 cm with the gel. The dimensions conformed to the ASTM 2182 standard , except The human-shaped trunk simulator was designed and built at the Dept. of Technology and Health of the National Institute of Health in Rome. The simulator consists of a torso-shaped transparent PVC phantom of the size of a 45 kg female and of an internal volume of 25 liter. The pacemaker and its leads were fixed on a PVC grid placed inside the phantom Figure .Both the rectangular box and the human-shaped phantom were placed in various positions inside the RF coil: in this way, we could compare the heating induced on the same implant configurations, but with the phantom differently positioned respect to the coil. The MRI coil configuration and axes are shown in Figure configuration\" (config.) to refer to a single experimental set-up; for each configuration we measured the temperature increase and we estimated the local SAR. The proposed configurations were properly modified from one another in order to investigate the specific contributes to the heating of the four factors previously mentioned. Inside the rectangular box phantom we first simulated the implant with conductive wires (radius 0.5 mm) of various shapes and length; we tested both bare and insulated wires (insulation thickness 0.5 mm and 1 mm). For the insulated wires, the exposed tip length was 1 mm at only one end of the implant. then we replaced the metallic wires with a dual chamber PM  with its 62 cm-long leads. We tested both unipolar and bipolar leads , either attached or not to the PM can .The measurements we performed aimed at the identification of the major contributes involved in the heat generation: (1) the position of the implant inside the phantom, (2) the length of the wire and, the thickness of the insulation sheath, (3) the wire geometries (shape) and (4) its position of the implant including its lead with respect to the RF coil. In the following pages, we use the term \"In a real PM implant, since the length of the lead may not fit the patient's anatomy and size, the excess length may be wrapped near or around the PM can. As a consequence, the length of the lead and the area covered by the implant can significantly vary from patient to patient, thus creating many configurations of implants. In addition, some papers on MRI safety state that a higher heating is induced at the tips of implants which cover a large area ,10. FromFrequency resonance phenomena in various kinds of linear metallic leads and wires undergoing MRI procedures  have been hypothesized by several groups -15. ResoThe implants used in our measurements were placed inside a material with an electrical conductivity greater than zero; thus, the presence of an insulation sheath and its thickness may affect the amount of heating induced at the implant tip by concentrating the \"exiting\" current from the wire in the saline. We tested both bare wires and wires insulated with thermoplastic sheaths of two thicknesses (0.5 mm and 1 mm) (12 conf).In clinical practice, the PM chassis may be typically located in the left or right pectoral region of the patient, with a lead path that significantly changes in the two cases. Our interest was to understand if one implant location may be considered safer than the other, concerning the heating induced by the MRI exposure. To this aim, we shaped the metallic wires in order to simulate the two typical implants paths for a PM lead, corresponding to a left and right pectoral implant position. We compared the temperature increase in the two cases (70 config.). Left and right pectoral implants were also studied when using a real PM with its lead (32 conf). In addition, we reproduced several implant configurations, both with metallic wires and real PM leads, which do not correspond to a physiological implant condition, but which could give interesting result in order to understand how the geometry of the implant may affect the amount of the induced heating (114 config.).With regard to heating of pacemaker leads it has been discussed whether imaging of brain and abdomen may pose potentially less risk than imaging of the thorax . We trieFor most of the implant structures tested, we compared the temperature increases resulting for the same configurations but placed in different regions of the phantom. We studied this for metallic wires and with actual PM leads. In most of the previous studies published on MRI safety and compatibility with metallic implants, temperature measurements are performed inside human trunk simulators of quite simple geometry . In order to evaluate whether the phantom's shape and geometry is a factor that could affect the amount of heating induced by MRI procedures, we placed a PM lead with its can on the left and right sides of a human-shaped phantom, so to reproduce actual left and right pectoral implants: in this study we used bipolar leads, and the lead paths were chosen to mimic a physiological implant condition . The importance of the geometry of the phantom was studied by comparing the temperature increases resulting from the same configurations tested first inside the rectangular phantom, then in the human-shaped phantom (38 conf). The two phantoms had comparable total volume and were exposed to the same whole body SAR.In all our experiments we measured the temperature increase and SAR at the tip of a \"standard wire\" ., this wire was always placed in the same location and position inside the phantoms: in this way we had a parameter to evaluate the reproducibility of our measurements. We also used the same wire to create a map of the temperature increase and SAR deposition inside the rectangular phantom, by positioning it in the four corners of the simulator (8 config.). We placed the wires 2 cm far from the edges of the box, orientated both along the Z and Y axis of the coil  with four separate model SMM probes. These plastic fiber probes (1 mm diameter) minimize perturbations of RF fields. The Luxtron system was operated at 8 samples per second, with resolution of 0.1\u00b0C. The background noise was in the range of Luxtron resolution. The terminal portion of the temperature probes were placed in transversal contact (i.e. the probe is perpendicular to the body of the lead-wire axis) with the lead tip: this contact configuration was demonstrated to minimize the measurements error associated to the physical dimensions of the probes. Temperature was also sampled on the PM can and, when using a bipolar lead, on the ring. Data acquisition was performed using the analog output of the Luxtron thermometer, an A/D converter and a 16-bit acquisition card , installed on a standard notebook computer  In previous studies [Temperature measurements were performed using a fluoroptic studies ,17 the pEach configuration tested inside the RF coil was characterized by a temperature versus time behavior made up of three phases: an initial base signal with no excitation in the coil was acquired for a period of 60 s, followed by a 200 s of exposure and a 200 s cooling phase. As a preliminary study, we performed calorimetry with the rectangular box phantom filled with saline (without gelling agent) to measure the whole body average SAR delivered to the phantom. This allowed us to determine the total power absorbed by the phantom (whole body SAR) . The powWe produced a database of 374 experimental measurement results from our investigation of several parameters affecting MR-induced heating. Results are grouped as a function of the parameter investigated . A total of 58 configurations of implants are reported in this paper. The whole set of measurement data as well as the raw temperature data are provided as Excel sheets in the Additional file We studied an insulated, straight wire that was 25-cm long and parallel with axis of coil . This wire was placed in the middle of the rectangular box phantom. It produced no significant heating at its tip, whereas the temperature increase measured on the same wire placed close to the edge of the torso simulator was as high as 13\u00b0C Figure . The effThe local SAR values are consistent with the temperature increases: the highest power deposition is always reached in close proximity of the phantom edges.Inside the rectangular trunk simulator, we measured the temperature increases at the tip of three straight metallic wires of different length (15 cm 25 cm and 40 cm). Different locations were tested Figure . All theThe SAR value are substantially consistent with the temperature increases; the highest SAR was reached at the tip of the 25 cm long wire, when placed close to the border of the rectangular phantom Figure When the temperature increase are very small (<1\u00b0C), the SAR calculation with the method described in the previous section cannot be so accurate and leads to values not so significant.We observed that a leads that formed a square shape and therefore had a large \"loop area\" Figure  did not Experimental measurements of metallic wires in phantoms showed significant differences between left and right pectoral implants. In particular, with the exposed tip in the left region of the rectangular phantom , the right-implant wire, that is the wire shaped to simulate the lead path from the right pectoral region to the heart ventricle, produced a temperature increase of 2.6\u00b0C whereas for the left-implant wire  we measured a temperature increase barely higher than 1\u00b0C Figure . An oppoInside the human-shaped phantom we reproduced left and right pectoral implants of the pacemaker can, with the lead paths chosen to most closely approximate a physiological configuration for a dual chamber PM, simulating implantation in both atrium and ventricle. In agreement with the measurements on the rectangular box phantom, we found that right-pectoral implants produced a higher heating that left-pectoral implants, in most of the configurations we studied. We also investigated if the different structures of unipolar and bipolar PM leads may affect the amount of heating caused by MRI exposure. We compared temperature increases with the each of two leads attached separately to the same PM can. The leads were located in various regions inside the rectangular phantom, in order to see if this would produce different degrees of heating at their tips.We found that for locations in the phantom where low temperature increases occurred, the behavior of the two types of leads is quite similar, whereas for locations in the phantom where heating was higher, the temperature increase for bipolar leads was significantly greater than for unipolar leads. A maximum difference of 8.1\u00b0C was observed, for one-loop PM configurations and with the leads placed close the edges of the phantom Figure .In addition, we performed a group of measurements in order to evaluate how the presence of the PM can modifies the temperature increase at the lead tip. By comparing the results on PM leads that were either attached or unattached to a PM case, we observed a significant difference in the two situations. The presence of the PM can may either lead to an increase or decrease in the induced heating, depending on its position inside the phantom Figure . The samSeveral implant configurations were tested with the phantom placed at first in the center of the coil and then moved along the main coil axis towards the RF excited (driven) ring Figure  or the nWe previously observed that an implant located next to any of the edges of the phantom produces the highest temperature increase. Our interest was also to understand if the contribution to the heating was due to the fact that the implant was positioned near the edges of the phantom or near the leg of the RF coil. To this aim, we compared temperature measurements performed on implants located in the same position respect to the coil, but in different areas of the phantom (i.e. the phantom was moved but the implant was in a fixed location in the coil). A marked decrease in the heating was always observed when implants were moved from the edges to the center of the phantom, even without changing their positions respect to the RF coil.In addition, the presence of the tuning capacitors in the low-pass birdcage coil may cause a local increase in the E field. However, this high field regions are rather small, and may additionally contribute to the lead heating only when both the phantom and the implant are positioned very close to the inner side of the coil.Also with regard to the SAR, the position of the phantom inside the RF coil showed to be an important factor. For a typical PM implant configuration , the deposited power goes from 2217.5 W/kg with the phantom moved towards the excited ring, to 4432.9 W/kg with the phantom moved towards the non excited ring  with no insulation (bare wire), 0.5 mm thick insulation (single-sheath) and 1 mm thick insulation (double-sheath wire) thermoplastic sheaths. Different locations inside the rectangular phantom were tested  of the phantom nearest the inner wall of the RF coil; in addition, the low-pass structure of the coil may additionally contribute to the heating if the implant is close to the tuning capacitors placed along the legs. The other factor is the length of the lead. Others have stated that the magnetic field is believed to be a primary contributor to heating of the lead. Several papers in the literature ,10 choseThe comparison between left and right implant configurations, both with metallic wires and PM leads, confirms that the area covered by the implant is not a crucial element in MRI induced heating. Right implants covered an area significantly smaller than the left counterparts and the temperature increases are higher for the former than the latter ones.The influence of the insulation sheath on the MRI induced heating is still a widely discussed issue. The thickness of the silicone or polyurethane sheath of a PM lead (less than a millimeter) is very small compared to the wavelength (5 m) of the RF field used inside a MRI system. This would let us suppose that the presence of the insulation is not an important aspect to be considered in modeling the RF currents induced in the lead . ActuallHowever, when comparing temperature increases on short straight wires (15 cm long) exposed under identical conditions, the higher heating is observed for the bare wire, compared to insulated wire of the same length and shape. For the bare, short wire the temperature reached after long exposures (steady state) is high, but the initial rate of rise (SAR at the wire tip) is lower. Furthermore, for short straight wires, the heating seems to decrease as the thickness of the insulation sheath increases.The contribution of the lead structure (unipolar or bipolar) to the heating is strongly affected by the positioning of the lead itself inside the phantom: bipolar leads showed higher temperature increases than unipolar when placed close to the edge of the phantom; when placed in the central regions, heating was slightly higher for unipolar. Since this comparison was based on a limited number of positions and lead paths, no generalization or interpretation of these results can be attempted.Clinical MRI birdcage coils are designed to have a homogenous RF magnetic field over the entire body of a patient. We did studies to mimic MRI imaging of a part of the body different from the thorax, such as the head or the abdomen, for a pacemaker patient. The phantom was shifted along the main (Z) axis of the RF coil. For these conditions, the highest heating is obtained with an implant that crosses the isocenter of the coil. As the distance of the center of the implant from the isocenter increases, the heating gets lower. Particularly, a marked decrease in temperature occurs when part of the implant is shifted along the Z axis of the coil out from the ring of the RF coil.Temperature and SAR measurements we performed showed also the importance of the morphology of the phantom: the heating induced in the same implant configurations when placed in the rectangular phantom was higher than in the human-shaped phantom. The irregular surface of the human-shaped phantom implies a distance of the implant from the edges that varies point to point. This may partially explain such differences. Furthermore, the currents that are induced in the rectangular phantom, follow straight regular paths that provide a better coupling with straight metallic wires or leads. Our findings highlight the factors that have significant effects on RF-induced heating of implanted wires and leads. These factors must be taken into account by those who plan to study, model MRI heating of implants. Also our data should help those who wish to develop guidelines for defining safe medical implants for MRI patients. In addition, our database of the entire set of measurements can help those who wish to validate their numerical models of implants that may be exposed to MRI systems.Our study demonstrates how complex the MRI-induced heating phenomenon of pacemaker leads is and how many aspects are involved in this process. Experimental measurements inside a RF birdcage coil at 64 MHz revealed two major factors affecting the amount of lead tip heating: the length of the straight segments of the lead and their position inside the phantom. In particular, in order to have the worst case condition  inside a simulated torso, the following are necessary. The lead has to be placed parallel and next to the lateral edges of the phantom . The phantom has to be placed close to the inner wall of the RF coil, The length of the lead has to be close to the theoretical resonance length, at the frequency of the applied RF field . In addition the path of the lead has to be chosen as to obtain the best coupling with the E field distribution inside the phantom. With regards to the field generated by a birdcage RF coil typically used in most MRI scanners, the lead path which goes from the right pectoral region to the heart ventricle is the one that produces the best coupling with the E field. Other aspects play also an important role in MRI induced heating: the structure of the lead, the presence of the PM can, the geometry (shape) of the phantom and its position inside the coil. All these elements make it very time-consuming and expensive to perform extensive and exhaustive experimental measurements, as well as to develop accurate numerical models. Thus, while our presented data cannot be exhaustive, to our knowledge, they represent the largest database of MRI induced heating on thin metallic implants and pacemaker leads. The data are also intended to be used to validate numerical models.The mention of commercial products, their sources, or their use in connection with material reported herein is not to be construed as either an actual or implied endorsement of such products by the U.S. Food and Drug Administration. The opinions expressed by of the author are not those of the US Food and Drug administration.The author(s) declare that they have no competing interests.EM carried out the experimental measures and drafted the manuscript. MT realized the human shaped-phantom and participated in the acquisition of the experimental data. GC has made substantial contributions to conception and interpretation of data. FC participated in the design of the experimental set-up, interpretation of data and revised the manuscript. WK participated in the design and realization of the exposure system and discussed the methodological issues related. GM helped in the preparation of the gel and in setting up and calibrating the temperature acquisition system. HB revised the final manuscript and gave the final approval for publication. PB gave the final approval for publication.Temperature and SAR measures on metallic wires. The Excel file (2007 version) contains the temperature raw data collected during the RF exposure of metallic wires. For each configuration, which corresponds to a single column of the file, a schematic representation of the experimental set-up is reported. For each configuration, we also calculated the difference between the baseline and the highest temperature reached during the RF exposure (dT \u2013 \u00b0C), as well as the SAR (W/kg), from the slope of the initial temperature increase (see Methods section for details). The file is divided into 5 sheets, which refers to different shapes of the metallic wire: - straight wires; - left imp. wires ; - right imp. wires ; - bare wires; - left and right imp. wires . The first column of each sheet contains the time reference for the temperature values.Click here for fileTemperature and SAR measures on PM leads. The Excel file (2007 version) contains the temperature raw data collected during the RF exposure of PM leads. For each configuration, which corresponds to a single column of the file, a schematic representation of the experimental set-up is reported. For each configuration, we also calculated the difference between the baseline and the highest temperature reached during the RF exposure (dT - \u00b0C), as well as the SAR (W/kg), from the slope of the initial temperature increase (see Methods section for details). The file is divided into 5 sheets, which refers to different locations or structures of the lead: - left imp.-0,1,2 loops ; - right imp.-0,1,2 loops ; - Bipolar leads; - rect. VS human-shaped phantom (comparison between same configuration in the rectangular and in the human-shaped phantom). The first column of each sheet contains the time reference for the temperature values.Click here for file"}
+{"text": "Background. The purpose of this study was to evaluate the thermal and pressure effects using a Titan Sapphire chirped-pulse amplifier system configured to deliver ultrashort pulses of 180 femtoseconds (fs) in an inner ear model. Materials and Methods. Temperature increases and heat exchange processes in the fluid  were examined in a calorically and physiologically approximated cochlea model for applying laser parameters effective in the creation of footplate perforations. Results. In the effective energy density range, the highest temperature increases achieved with the Carbon dioxide (CO2) laser were about 11 degrees C. The lowest temperature maxima were 6 degrees C with the Er:YAG laser (Yttrium-Aluminum-Oxide doted with Erbium3+-ions) and <5degrees C with the femtosecond laser. Comparison of the laser-induced pressure with the limit graph published by Pfander indicated that the use of the fs laser is unobjectionable for fluences <1 J/cm2. Conclusions. Our investigations demonstrated that the application of the fs laser in middle ear surgery presents a new and promising addition to the range of ultrashort wavelength lasers used for this purpose. Perkins [Since the first stapedectomies were carried out by Shea in the late 1950s  reported Perkins  was the  Perkins , McGee [ Perkins , and Les Perkins . 2), and KTP (potassium titanium oxide phosphate) laser have been dominant in stapes surgery up to now; however, it is precisely the thermal stress and the associated potential for damage to the inner ear structures [Thermal laser systems such as argon, carbon dioxide  may be able to minimize or avoid these effects. In tissue that is exposed to ultrashort pulses so-called multiphoton processes occur  which bring about optical rupture and plasma formation. This plasma-induced photodisruption  eye surgery procedure. The ultrafast laser replaces the microkeratome mechanical knife that makes the initial cut in the cornea. This offers a highly controlled cut of uniform thickness, which is not possible with the mechanical knife . Work haThe outstanding precision of femtosecond laser could be demonstrated by analyzing laser generated cavities in human ossicles by electron microscopy. Even at pulse repetition rates of 3\u2009kHz, no thermal effects like melting zones could be found. At the cavities wall, still the opened bone channels could be recognized .Aim of the present study was to assess how far these expectations are fulfilled for a cochlear model, with special reference to any thermal damage.\u03bcJ and 1\u2009mJ, with a pulse frequency of <200\u2009fs at a central wavelength of 780\u2009nm and a repetition rate of max. 1.04\u2009kHz.The investigations were carried out using a Titan-sapphire laser. Based on the principle of passive \u201cKerr lens mode locking\u201d  this lasFor modeling purposes the cochlea was regarded as a fluid-filled target space (endolymph) embedded in a solid body with decelerated heat transfer (bone). The thermal adjustment of this open system when subjected to laser bombardment depends on laser-induced heat input and heat conduction to the environment; convection and radiation are relatively insignificant.The present system was based on that used by Jovanovic in studies involving inner ear model , 17. TemThe laser parameters used are given in \u03bcm, focus: 1/e\u00b2:380\u2009\u03bcm, Carl Zeiss, Oberkochen, Germany) and the CO2 laser, delivered by micromanipulator , which is known to generate the highest temperature [The laser beam was focussed on the fluid level of the inner ear model. In addition to the femtosecond, other lasers were used, namely, the Er:YAG laser \u03bb = 532\u2009nm), or the Argon laser (\u03bb = 514\u2009nm) appear to be suitable for middle ear and stapes surgery, respectively, as the expected generation of heat does not occur [2 laser (\u03bb = 10.6\u2009\u03bcm) or the Er:YAG laser (\u03bb = 2.94\u2009nm), achieve a high absorption rate in bone and surrounding tissue [In this respect, the concept of femtosecond laser application combines the advantages of the various laser types while dispensing with their respective disadvantages. Laser types currently used in middle ear surgery are either based on the principle of continuous wave technology or use relatively long pulse durations. In the latter case, however, the ablation process is dependent on the thermal and optical properties  of the material. The two parameters of wavelength and pulse duration therefore represent limiting factors. Owing to the low absorption of laser energy in water or bone within the visible green range , the KTPot occur . There ig tissue , 26 althg tissue . In contrast, when ultrashort pulses are applied, the ablation process is virtually independent of both, the material properties and the wavelength used. Moreover, the mechanical and thermal side effects are far less severe, since a large portion of the input energy is carried away with the ablated tissue . The tot2 laser of 0.2\u20131.8\u2009J (depending on pulse duration) [2 laser was reported to be safe when used in revision stapes surgery with fluoroplastic wire pistons, application of 6\u2009W to stainless steel pistons can disturb the inner ear function [in vitro investigation revealed maximum temperature values in the facial canal between 1.4\u00b0C and 15.2\u00b0C, values much higher than those recorded with fs laser in our experimental setting. Indeed, whereas the Er:YAG laser requires total energy of 0.35\u20130.75\u2009J for footplate perforation and the COuration) , 27, thefunction . Furtherfunction . In the 2 and KTP laser; it appears that thermal damage of the surrounding tissue can be virtually ruled out or at least minimized. This leads in turn to a substantial reduction in undesirable tissue reactions. The technique of multiphoton ablation allows precise spatial definition of the tissue ablation process, as it is entirely restricted to the focus area. The risk that direct laser bombardment will cause damage to deeper-lying structures (such as the utricle and saccule) following footplate perforation is thereby significantly reduced. Based on the above values, it can be inferred that for a given radiated power output, the fs laser releases only half the amount of heat emitted by the Er:YAG laser and less than COA drawback of the fs laser that has received criticism in this connection is that it is not conducive to coagulation. The extremely low temperature increase during the multiphoton ablation process means that there is no coagulation effect acting on the (possibly bleeding) mucosa. This disadvantage can, however, be offset by the use of vasoconstrictive substances applied to the footplate or to the ossicles, whenever required.Our investigations demonstrated that the application of the fs laser in middle ear surgery presents a new and promising addition to the range of ultrashort wavelength lasers used for this purpose.The concept of femtosecond laser application combines the advantages of the various laser types while dispensing with their respective disadvantages. This means that owing to the much lower energies required close to the threshold when tissue is ablated using the fs laser, the resulting pressure load on the inner ear\u2014and therefore the potential damage\u2014can be greatly reduced.Further studies are currently in preparation; predominantly using animal models. These are aimed at reviewing the effectiveness and safety of fs application. With the advent of this new technology in routine clinical practice, it can be expected that the system will undergo miniaturization, since clinical use is still prevented by the size of the laser setup."}
+{"text": "To map thermal parameters noninvasively, we propose temperature-change-based thermal tomography (TTT) that relies on relative temperature mapping using magnetic resonance imaging (MRI). Our approach is unique in two aspects: (1) the steady-state body temperature in thermal equilibrium is not restricted to be spatially invariant, and (2) absolute temperature mapping is not required. These two features are physiologically realistic and technically convenient. Our numerical simulation indicates that a (9 mm) Current approaches in literature, however, have a few significant drawbacks. First of all, the theoretical model in previous work /\u03b42} with the following parameters: \u0394T0 = 5\u00b0C, x0 = 25\u0394x, y0 = 24\u0394y, z0 = 17\u0394z, and \u03b4 = 9\u0394x. In x direction, that is, the dashed line in t = 200 s, one from FD simulation and the other with noise added.Now we use a finite-difference (FD) method  to simul\u03b11 is known to be 0.13 mm2 \u00b7 s\u22121 throughout the breast phantom, which means that we only need one set of temperature measurements to reconstruct the blood perfusion parameter \u03b12. This assumption is reasonable, since the value of \u03b11 does not vary significantly from tumor to normal tissues. Furthermore, the importance of the thermal diffusion term can be greatly reduced by choosing a relatively flat temperature distribution, which is the case for the initial Gaussian field used in \u03b11 has no impact on the temperature decay rate.We now treat the noise-added simulation results as MRI measurements data and use them to test our thermal reconstruction algorithm. In this letter, we assume that \u03b12 can be directly obtained through  can significantly amplify the already nonnegligible measurement noises. Fortunately, we can use numerical fitting to achieve significant noise reduction. As an example, we notice that with a uniform distribution of \u03b11, \u2207 \u00b7 (\u03b11\u2207\u2329\u0394T\u232a) becomes \u03b11\u22072\u2329\u0394T\u232a, which can be evaluated by polynomial fitting. More specifically, to evaluate \u22022\u2329\u0394T\u232a/\u2202x2 at cell , we use the polynomial \u2329\u0394T\u232a = a2(i \u2212 i0)2\u0394x2 + a1(i \u2212 i0)\u0394x + a0 to fit the temperature data at cells , with i in the range of i0 \u2212 2 \u2264 i \u2264 i0 + 2. After fitting, the value of \u22022\u2329\u0394T\u232a/\u2202x2 is simply given by the fitting coefficient a2. \u22022\u2329\u0394T\u232a/\u2202y2 and \u22022\u2329\u0394T\u232a/\u2202z2 can be similarly evaluated. Next, we consider the evaluation of T(t1) \u2212 T(t0) in (T(t1) \u2212 T(t0). After applying the aforementioned fitting schemes to  are also shown in \u03b12. We also observe that the numerical fitting introduces approximately 20% systemic errors to the thermal reconstruction. However, it is possible to reduce the systemic error by developing a more accurate noise reduction algorithm.In the absence of noise, the spatial distribution of  through . Howeverlication  is not a(t0) in . To elimhemes to , we can We emphasize that the advantages of TTT are derived primarily from its relative-temperature basis. By formulating a differential equation based on temperature changes , we remThe algorithm presented in this paper serves as a proof-of-concept validation and can be improved in future studies. For example, the method of five-point polynomial fitting can be replaced by other spatial filtering techniques that can effectively reduce the measurement noises. The exponential temporal fitting can also be replaced by more sophisticated filtering techniques such as the Wiener filter. The assumption of an initial Gaussian temperature distribution is also not necessary: We have verified the reconstruction algorithm  using dCompared with other methods of thermal tomography in current literature, the method presented in this paper is significantly simpler. For example, the method presented in  relies o3 tumor embedded in a human breast phantom. We believe that TTT can lead to new and noninvasive medical modalities for cancer detection and imaging.In conclusion, we have developed a temperature-change-based thermal tomography and established a simple and straightforward thermal reconstruction algorithm. Using realistic thermal parameters and assuming a temperature measurement accuracy of 0.5\u00b0C, we have successfully reconstructed the spatial distribution of a (9 mm)"}
+{"text": "We sought to evaluate agreement between a new and widely implemented method of temperature measurement in critical care, temporal artery thermometry and an established method of core temperature measurement, bladder thermometry as performed in clinical practice.Temperatures were simultaneously recorded hourly (n = 736 observations) using both devices as part of routine clinical monitoring in 14 critically ill adult patients with temperatures ranging \u22651\u00b0C prior to consent.The mean difference between temporal artery and bladder temperatures measured was -0.44\u00b0C , with temporal artery readings lower than bladder temperatures. Agreement between the two devices was greatest for normothermia (36.0\u00b0C to < 38.3\u00b0C) . The temporal artery thermometer recorded higher temperatures during hypothermia (< 36\u00b0C)  and lower temperatures during hyperthermia (\u226538.3\u00b0C) . The sensitivity for detecting fever (core temperature \u226538.3\u00b0C) using the temporal artery thermometer was 0.26 , and the specificity was 0.99 . The positive likelihood ratio for fever was 24.6 ; the negative likelihood ratio was 0.75 .Temporal artery thermometry produces somewhat surprising disagreement with an established method of core temperature measurement and should not to be used in situations where body temperature needs to be measured with accuracy. Accurate and precise temperature measurement is an important part of the clinical examination because an abnormal temperature reading can alter clinical management and patient prognosis. The ideMost authorities including the American College of Critical Care Medicine and the Infectious Diseases Society of America consider temperature to be most accurately measured by intravascular, esophageal or bladder thermometry. HoweverInfrared technology has been adapted to noninvasive temporal artery thermometry. Because the temporal artery has a high arterial perfusion rate that remains unchanged under most conditions, measurement of temperature via skin areas perfused by the temporal artery provides an easy, noninvasive estimate of core temperature. This haWe enrolled patients who were admitted to the medical-surgical ICU at Foothills Medical Centre between July 1, 2008 and November 28, 2008. We included patients who were 18 years of age or older, expected to stay in the ICU more than 24 hours and whose temperature was documented  in the medical record to have varied by at least 1\u00b0C (minimum range) in the 72 hours prior to being approached for consent. We selected these inclusion criteria to increase our prospects for capturing patients with dynamic temperature measurements. Patients were excluded if they: 1) were unable to provide consent and had no family member who could be approached for consent; 2) had any contraindication to bladder catheter thermometer placement and; 3) were diagnosed with an anatomic abnormality (e.g. skin abrasion or laceration) that would affect temperature measurement over the skin areas perfused by the temporal artery. The Conjoint Health Research Ethics Board at the University of Calgary approved the study protocol, and informed consent was obtained from either the patient or the closest family member before enrollment in the study.TemporalScanner  was used for the infrared detection of temporal artery temperatures. Temperature measurements were performed according to the manufacturer's instructions (yearly in service training for bedside nurses). The TemporalScanner's probe was placed flush on the center of the patient's forehead, activated, slid across the skin from the forehead to the hairline, lifted from the forehead to behind the ear lobe and the temperature recorded. We used bladder temperature as the reference standard based on evidence that bladder thermometers show excellent agreement with pulmonary artery catheter thermometers over a wide range of temperatures[\u00ae Foley Catheter temperature Sensor, Smiths Group PLC., Rockland, USA). Registered nurses inserted the catheters into patients who consented to participate. Both manufacturers reported calibrating the temporal artery (reported accuracy \u00b1 0.1\u00b0C in the range of 16 to 43\u00b0C) and bladder (reported accuracy \u00b1 0.2\u00b0C in the range of 5 to 45\u00b0C) thermometers prior to purchase. The clinical engineering department at the medical centre calibrated the temporal artery thermometers following purchase using the manufacturer's specifications.Temperatures were measured from the skin overlying the temporal artery and from within the bladder. The peratures,14 regarperatures. TemperaTemperature recordings were obtained from the temporal artery and bladder as part of routine clinical monitoring performed by registered bedside nurses. We ordeThe primary outcome was the agreement in temperature reading between the temporal artery thermometer and the bladder thermometer, with the latter considered as a reference standard. The secondary outcome was the accuracy (defined as the sensitivity and specificity) of the temporal artery thermometer to detect fever and hypothermia. Patient characteristics and temperature measurements were reported as means or medians for continuous variables, and as proportions for categorical variables. Temperature measurement agreement between methods was analyzed using the procedures described by Bland and Altman. Limits A preliminary analysis of data on two patients revealed a mean absolute difference between devices in temperature measured of 0.4\u00b0C with a standard deviation of 0.4\u00b0C. We therefore estimated that 14 patients with a minimum of 12 measurements would be needed to have 90% power to detect a conservative difference in temperatures measured of 0.3\u00b0C.Table A total of 760 temporal artery thermometer observations and 1,066 bladder thermometer observations were recorded from these 14 patients. Of these, 736 temporal artery and bladder temperature observations were recorded within one minute of each other and used for analysis. Table Figure Table We performed a prospective evaluation of the agreement in temperature assessment between a widely adopted new methodology, temporal artery thermometry and an established core measurement methodology, bladder thermometry as performed in clinical practice. The temOur data support previous studies that have noted a lack of agreement between temporal artery thermometry measurements and standard core temperature measurement sites: bladder, pulmonary artery, rectum, axillary and tympanic membrane-23. TempOur study adds to the existing literature by providing the single largest clinical evaluation (736 paired observations) of a temporal artery thermometer in critically ill adult patients with a wide temperature range (35.4 to 40.0\u00b0C) in a medical-surgical ICU. In the ICU, temperature measurement is an essential component of patient assessment and management decisions. Our data highlight that although the temporal artery thermometer is convenient to use, minimally invasive and provides rapid results it agrees insufficiently with an established core temperature measurement methodology to be clinically useful in patients where careful temperature monitoring is important . This is most clearly illustrated by the small mean difference between the temporal artery and bladder thermometers for normothermic temperatures, but much larger mean differences for hypothermic and hyperthermic temperatures. This would give the instrument low sensitivity and the inability to rule out either hypothermia or fever. Conversely, our data demonstrate that the high specificity of the instrument indicates that if a fever is identified with a temporal artery thermometer then it is likely a true positive. Our results are perhaps not surprising given that skin temperature measurement can be potentially affected by patient , instrument  and environmental  factors,11,25.The results of our study need to be interpreted within the context of its limitations. First, although a wide range of temperatures was recorded in our study, there were few recordings of hypothermia. Thus, statements about the performance of temporal artery thermometry under conditions of hypothermia are limited. Second, we employed a bladder thermometer as our reference standard. Although there is no universally accepted reference standard for measuring core temperature, some authorities consider a pulmonary artery thermometer to be the standard against which other devices should be compared. HoweverIn summary temporal artery thermometer measurements agreed with bladder thermometer measurements over normothermic temperature ranges, but demonstrated limited agreement for temperatures below 36\u00b0C and temperatures greater than or equal to 38.3\u00b0C. Temporal artery thermometry produces somewhat surprising disagreement with an established method of core temperature measurement and should not be used in situations where body temperature needs to be measured with accuracy.ICU: intensive care unit; CI: confidence interval.Funding sources had no role in the design, conduct, or reporting of this study and we are unaware of any conflicts of interest. Dr. Stelfox had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.HTS designed the study, collected, analyzed and interpreted the data, and drafted and revised the manuscript. SES designed the study, interpreted the data and revised the manuscript. WAG analyzed and interpreted the data and revised the manuscript. JC designed the study, interpreted the data and revised the manuscript. KL designed the study, interpreted the data and revised the manuscript. AL analyzed and interpreted the data and drafted and revised the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2253/10/13/prepub"}
+{"text": "Solid water is often the phantom material of choice for dosimetry procedures in radiotherapy high-energy X-ray and electron beam radiation calibration and quality assurance. This note investigates variation in heat conduction that can occur for a common commercially available solid water stack phantom when a temperature differential occurs between the phantom and ambient temperature. These variations in temperature can then affect radiation measurements and thus the accuracy of radiation dosimetry. In this manuscript, we aim to investigate the variations in temperature which can occur in radiation measurement incorporated (RMI) solid water phantoms, their thermal properties and the effects on radiation dosimetry which can occur because of temperature differentials. Results have shown that the rate of temperature change at a phantom center is a complex function but appears relatively proportional to the surface area of the phantom in normal clinical usage. It is also dependent on the thermal conductivity of any material in contact with the phantom; and the nature of the phantom construction, i.e., the number and thickness of slices within the phantom. A thermal time constant of approximately 20 min was measured for a 2-cm solid water phantom slice when located on a steel workbench in comparison to 60 min when located on a wooden workbench (linac couch insert). It is found that for larger solid water stack phantoms, a transient (within 1\u00b0C) thermal equilibrium exists at the center for up to 2 h, before the temperature begins to change. This is assumed to be due to the insulating properties of multiple slices within the stack, whereby very small air spaces are introduced inhibiting the heat conduction through the phantom material. It is therefore recommended that the solid water/phantom material is kept within the treatment room for closest thermal accuracy conditions or at least placed within the room approximately 10 h before dosimetry measurements. If these options are not available, a standard linear interpolation method for calculation of temperature should be used to minimize uncertainty of temperature measurements. This short note investigates the heating and cooling rates of a commonly used solid water material when moved from one temperature to another within ranges seen in a typical clinical radiotherapy department in Australia. These values are related to changes in dosimetric values obtained using standard temperature-pressure corrections over these temperature variations.The calibration of radiotherapy radiation beams using ionization chambers requires a considerable number of correction factors to change a charge reading into absorbed dose.\u20133 One suectively. The valuectively.\u20137 a smalAn RMI solid water phantom is used for experimental verification of temperature variations due to changes in ambient temperature conditions. The solid water stack coHeat flow through conduction can be expressed to a first-order approximation using Fourier's Law and is described by the equationwhere k = thermal conductivity, A is the cross-sectional area of the medium and T is the temperature differential. If we have two distinct temperatures at separate points within the medium, defined as T1 and T2, and the heat flow is through a material of thickness \u0394x, then the equation becomesThis can be used to derive cooling or heating rates and is defined by Newton's law of cooling, dT/dt = \u2212k(T1-T2) where dT/dt is the time-dependent temperature differential, k is a heat rate constant and T1 and T2 define the starting and end temperatures.Specifically, these equations then define that the cooling or heating rates of a material in thermal contact with another body of different temperature would follow an exponential change in temperature with time and that the rate of change is proportional to the surface area of the body in question. This work highlights the varying nature of heat conduction in a clinical environment for a radiotherapy phantom where the phantom material could be in contact with a number of materials of differing thermal conductivity. Ambient temperature, thermal conductivity of the phantom and material in contact with the phantom, as well as the number and thickness of slices within the phantom, all affect heat conduction. Epoxy materials (like solid water) can vary in their thermal conductivity, depending on the additives used in construction. The engineering toolbox website quotes aWhat does this mean for radiation dosimetry? On an average, a temperature change of approximately 3\u00b0C changes the charge reading recorded using an open-to-air ionization chamber by 1%. While variations in the order of 9\u00b0C would be uncommon in a clinical treatment room, these values have been measured as temperature differentials between our linear accelerator treatment rooms and equipment storerooms. Measurement of absorbed dose with a cool phantom (17\u00b0C) in ambient temperature of 25\u00b0C confirmed this prediction, whereby a miscalculation of 2.8% in absorbed dose would have occurred if the ambient temperature was used for calculation instead of the phantom temperature and thus ionization chamber temperature. The storeroom is kept cool (16-18\u00b0C) to aid in achieving longer life of computer equipment and longer shelf life of various accelerator parts and biomedical equipment; while the treatment room is kept warm (24-26\u00b0C) for patient comfort, with the patient being partially undressed for treatment procedures. The measurement of phantom temperatures is complicated by a complex nonlinear change associated with heating and cooling. A simple interpolation can result in a residual error due to the nonlinear temperature drift, but any interpolation is better than simply taking the initial or final temperature. In the worst case scenario measured by our experiments, the linear interpolation method performed over a 1-hour period could result in an approximate 2\u00b0C error in calculated temperature in solid water with an initial 10\u00b0C temperature differential using a 2 cm \u00d7 30 cm \u00d7 30 cm phantom size. For a phantom size of 30 cm \u00d7 30 cm \u00d7 30 cm, a maximum calculated error of approximately 1\u00b0C over a 2-hour period was found when the chamber was located anywhere within the phantom. This may be considered a reasonable uncertainty if the phantom cannot be kept inside the treatment room; however, a higher frequency of temperature measurement would be recommended. In essence, if the phantom material is kept in an area other than the measurement site, which may introduce thermal changes, the temperature measurements should be performed at short intervals within the phantom to minimize the effects of these variations. The time period of these measurements would be directly related to the amount of variation in temperature. Finally, if possible, it would be recommended to keep phantom material in the room that is used for measurements to minimize the effects of thermal variations on measurements of radiation dose calculated using open-to-air ionization chambers.It is well known that temperature variations occur between different rooms within the building in which the clinic is located, which may affect the temperature of a solid water phantom used for radiation dosimetry. This work investigated heat conduction, the heating and cooling rates of a solid water phantom, to quantify the time required for thermal equilibrium to occur within the phantom when temperature variations occur. Results show periods up to 10 h are required to allow a 30 cm \u00d7 30 cm \u00d7 30 cm solid water phantom to reach within 1\u00b0C of ambient room temperature. This was found to be relatively proportional to the phantom surface area; the thermal conductivity of materials placed in contact with the phantom; and the number and thickness of the phantom slices, which affect heat transfer within the phantom body itself. As such, it would behoove you to perform temperature measurement within the phantom material at the site of the open-to-air ionization chamber to accurately measure temperature for absorbed dose calculation. If unwanted large variations occur in ambient temperature within a hospital environment, administrators should be contacted and made aware of the difficulties that can arise in radiation dosimetry procedures. In essence, to minimize effects caused by inter-room temperature variations, phantom materials could be placed somewhere in the treatment room the day before dosimetry calibrations are performed."}
+{"text": "Since microvascular dysfunction with complete circulatory arrest and, thus, prolongation of tissue ischaemia is considered a potential mechanism for cell necrosis following hepatic cryosurgery, we determined the temperature necessary for induction of complete nutritive perfusion failure in cryothermia-treated rat livers. After localization of the cryoprobe with seven thermocouples and application of a single or double freeze\u2013thaw cycle, in vivo fluorescence microscopy of the cryoinjured left lobe was performed over a 2-h period using a computer-controlled stepping motor, which guaranteed analysis of the identical liver tissue segments with exact allocation of the thermocouples and thus determination of tissue temperature. Cryothermia resulted in a central non-perfused part of injury, surrounded by a heterogeneously perfused peripheral zone. The non-perfused area after single and double freezing continuously increased over the first 90-min period due to a successive shutdown of perfusion within the peripheral border zone. Analysis of the thermocouples' temperature at the end of freezing revealed the 0\u00b0C-front at 11.7 mm (single freeze\u2013thaw cycle) and 12.1 mm (double freeze\u2013thaw cycle) distant from the centre of the cryoprobe, which exactly corresponds with the initial (30 min) expansion of the area with nutritive perfusion failure. The increased non-perfused tissue area at 2 h conformed a critical border temperature between 8.29 \u00b1 1.63\u00b0C and 9.07 \u00b1 0.24\u00b0C. From these findings, we conclude that freezing of liver tissue to temperatures of at least < 0\u00b0C causes complete/irreversible perfusion failure, which consequently will result in cell death and tissue necrosis, and may thus be supposed as a prerequisite for the safe and successful application of cryosurgery in hepatic tumour ablation. \u00a9 2000 Cancer Research Campaign"}
+{"text": "Associations between ambient temperature and cardiovascular mortality are well established. This study investigated whether inflammation could be part of the mechanism leading to temperature-related cardiovascular deaths.The study population consisted of a cohort of 673 men with mean age of 74.6 years, living in the greater Boston area. They were seen for examination roughly every 4 years, and blood samples for inflammation marker analyses were drawn in 2000-2008 . We used a mixed effects model to estimate the associations between ambient temperature and a variety of inflammation markers . Random intercept for each subject and several possible confounders, including combustion-related air pollution and ozone, were used in the models.We found a 0 to 1 day lagged and up to 4 weeks cumulative responses in C-reactive protein in association with temperature. We observed a 24.9% increase  in C-reactive protein for a 5\u00b0C decrease in the 4 weeks' moving average of temperature. We observed similar associations also between temperature and soluble Intercellular Adhesion Molecule-1 , and between temperature and soluble Vascular Cell Adhesion Molecule-1 . Penalized spline models showed no deviation from linearity. There were no associations between temperature and other inflammation markers.Cumulative exposure to decreased temperature is associated with an increase in inflammation marker levels among elderly men. This suggests that inflammation markers are part of intermediate processes, which may lead to cold-, but not heat-, related cardiovascular deaths. The association between cardio-respiratory mortality and ambient temperature is well known. More recently, associations have been found especially between mortality and heat wave episodes -3, but aInflammation and vascular dysfunction are among the proposed mechanisms advancing cardiovascular events and atherosclerosis. There is evidence that increased levels of, for example, white blood cell count, a marker for inflammation, is a predictor of coronary events . IncreasInterleukin-6 and 1-beta (IL-1\u03b2) belong to the group of acute phase proteins and are released into circulation as a response to infections or injuries. Other commonly known acute phase proteins are interleukin 8 (IL-8), and tumor necrosis factor alpha (TNF\u03b1) . In a reWe therefore studied the possible associations between temperature and inflammation markers using data for the whole year, but controlling for season. To do so, we evaluated changes in the levels of high sensitive (hs) CRP, IL-1\u03b2, IL-6, IL-8, TNF\u03b1, sVCAM-1, sICAM-1 and white blood cell count (WBC) in association with a 5\u00b0C decrease in mean ambient temperature.The study population consisted of the Normative Aging Study cohort of men living in the Greater Boston area. The cohort was established by the Veterans Administration in 1963 when men aged 21-80 years, confirmed to be free of known chronic medical conditions, were enrolled [Of the biomarkers used in this study hs CRP, sVCAM-1 and sICAM-1 were assayed at Dr. Nader Rifai's laboratory at Children's Hospital, Boston, MA. High sensitive CRP concentrations in the serum were determined using an immunoturbidimetric assay on the Hitachi 917 analyzer , using reagents and calibrators from Denka Seiken  . Soluble\u00ae 100/200\u2122 System . This technology allows for sensitive and accurate measurement of up to 100 analytes simultaneously in 25 \u03bcl of serum. All samples from each participant were analyzed in duplicate and in one batch to avoid between-batch analytical variation. White blood cell count was determined using a standard automated electrical impedance hematology analyzer (Coulter Counter Model S-Plus Series - Coulter Electronics). The performance of the assays was monitored with standard quality control procedures including the analysis of blinded pooled samples.Interleukins -1\u03b2, -6, and -8, TNF\u03b1 and WBC were analyzed at Molecular Epidemiology Laboratory of Harvard School of Public Health. Interleukins in serum samples were determined by Chemiluminescent ELISA as previously described . TNF\u03b1 waFrom the data, we excluded visits with hs CRP levels that were greater than 10 mg/l because those are generally considered as clinically significant infectious inflammatory states . After eAmbient temperature (\u00b0C), relative humidity (%) and barometric pressure (millibar) measurements were derived from the Boston Logan Airport weather station located 8 km from the physical examination site. Continuous black carbon measurements were performed using an aethalometer  at the Harvard School of Public Health monitoring site, 1 km from the examination site. Ambient ozone was measured continuously at four monitoring sites in the Greater Boston area. Monitors were located in the cities of Boston, Chelsea, Lynn and Waltham and all of them conformed to US Environmental Protection Agency (EPA) standards. In the analyses we used the average of the four measurements.10-transformed to approximate normal distribution and to stabilize variance. We used mixed effects models to examine possible associations between ambient temperature and the levels of biomarkers. This method takes into account the weighted effect of repeated measurements. We do note that the estimated random intercepts for subjects with only one measurement are noisily estimated; however, the inferences for the fixed effects, such as temperatures, are appropriate in these models. Even though this method is used especially for dependent measures, mixed models do not require repeated measures for all subjects.All biomarker levels were loga priori chosen known or plausible confounders including specific personal and temporal characteristics. All models included random effects for subjects and fixed effects for body mass index , age, cigarette smoking (never/former/current), alcohol consumption (\u22652 drinks/day: yes/no), use of any antihypertensive medication and statins (yes/no), diabetes (yes/no), hypertension (yes/no), fasting blood glucose level , race and years of education. Models included also indicator variables for season (warm/cold), weekday, and sine and cosine terms for day of year to capture seasonality more effectively. Additionally, the 24-hour means of relative humidity and barometric pressure were considered as possible confounders. The analyses were performed with statistical software R 2.10.1. using the linear and non-linear mixed effects models library (nlme) [We adjusted models for y (nlme) .a priori to analyze single-lag days from 0 to 14, and the moving averages of 7, 14, 21 and 28 days. Moving average of 7 days included lag days 0 to 6 prior to the clinic visit and is referred as \"1 week\" in tables and figures, moving average of 14 days included lag days 0 to 13 and is referred as \"2 weeks\", etc.The effects of temperature on morbidity and mortality have been seen over lag periods up to 7-25 days ,27, but As secondary analyses, we studied interaction between temperature and obesity (BMI > 30 at the first visit in this dataset) to uncover possible effect modification, because obesity itself is considered as a low-grade inflammation state . BecauseAs sensitivity analyses, we inspected the linearity of the associations between temperature and biomarkers using plots created by generalized additive mixed model (gamm) with the mgcv library  in R, anThe mean (sd) ambient temperature over the study period was 12.4\u00b0C (9.0), and the indoor temperature for the measured period was 23.8\u00b0C (1.6). We used only one temperature measurement site for our analyses. However, the correlation between temperatures at Boston Logan Airport and T.F. Green Airport , that is a closer site to the study subjects living the furthest from Boston, was 0.96 (mean distance of the address of participants from airport was 18 km). This suggests that there is little variation in the temperature over the study area. Summary statistics of the environmental variables is in Table The age of the study subjects was within the range of 55-100 years, and 26.1% of them were obese (n = 176), with body mass index > 30 at the first visit. Of the 673 subjects, 245 had only one clinic visit, 276 had two visits, 151 had three visits, and one had four visits. More complete summarization of the study subjects' characteristics is provided in Table We found positive associations between decrease in ambient temperature and the levels of hs CRP, sICAM-1 and sVCAM-1 throughout all investigated lags Figure . To stud3 made the associations slightly stronger  in the levels of interleukins -1\u03b2, -6 and -8 for a 5\u00b0C decrease in temperature among elderly men.Click here for fileAssociations between temperature and inflammation markers. The % change  in the levels of white blood cell count and tumor necrosis factor \u03b1 for a 5\u00b0C decrease in temperature among elderly men.Click here for fileThe % change in the inflammation markers for a 5\u00b0C decrease in ambient temperature. The % change  in the levels of C-reactive protein, soluble vascular cell adhesion molecule-1, and soluble intercellular adhesion molecule-1 in association with a 5\u00b0C decrease in ambient temperature in models adjusted for room temperature.Click here for file"}
+{"text": "The quantitative end-point for many behavioral tests of nociception is the reaction time, i.e. the time lapse between the beginning of the application of a stimulus, e.g. heat, and the evoked response. Since it is technically impossible to heat the skin instantaneously by conventional means, the question of the significance of the reaction time to radiant heat remains open. We developed a theoretical framework, a related experimental paradigm and a model to analyze in psychophysical terms the \u201ctail-flick\u201d responses of rats to random variations of noxious radiant heat.2 laser was used to avoid the drawbacks associated with standard methods of thermal stimulation. Heating of the skin was recorded with an infrared camera and was stopped by the reaction of the animal. For the first time, we define and determine two key descriptors of the behavioral response, namely the behavioral threshold (T\u03b2) and the behavioral latency (L\u03b2). By employing more than one site of stimulation, the paradigm allows determination of the conduction velocity of the peripheral fibers that trigger the response (V) and an estimation of the latency (Ld) of the central decision-making process. Ld (\u223c130 ms) is unaffected by ambient or skin temperature changes that affect the behavioral threshold (\u223c42.2\u201344.9\u00b0C in the 20\u201330\u00b0C range), behavioral latency (<500 ms), and the conduction velocity of the peripheral fibers that trigger the response (\u223c0.35\u20130.76 m/s in the 20\u201330\u00b0C range). We propose a simple model that is verified experimentally and that computes the variations in the so-called \u201ctail-flick latency\u201d (TFL) caused by changes in either the power of the radiant heat source, the initial temperature of the skin, or the site of stimulation along the tail.A COThis approach enables the behavioral determinations of latent psychophysical  and neurophysiological (V) variables that have been previously inaccessible with conventional methods. Such an approach satisfies the repeated requests for improving nociceptive tests and offers a potentially heuristic progress for studying nociceptive behavior on more firm physiological and psychophysical grounds. The validity of using a reaction time of a behavioral response to an increasing heat stimulus as a \u201cpain index\u201d is challenged. This is illustrated by the predicted temperature-dependent variations of the behavioral TFL elicited by spontaneous variations of the temperature of the tail for thermoregulation. R), i.e. the time lapse between the beginning of the application of a nociceptive stimulus and the evoked response. Its measurement is straightforward when short duration tightly time-locked stimuli are delivered, e.g. electrical stimuli. However, the situation is more complex when the stimulus intensity is gradually increased while the stimulus is being delivered. This is the case with thermal stimulation, which is the most frequently used in behavioral tests of nociception  because it stimulates specific receptors, called nociceptors, in the skin Pain is a subjective sensory and emotional experience, which can be estimated in non-communicating individuals, only by examining the reaction elicited by a presumed noxious stimulus (that is termed \u201cnociceptive\u201d). The quantitative primary end-point for many behavioral tests of nociception in animals is the reaction time , biophysical (L\u03c4) and behavioral (L\u03b2) latencies. L\u03d5 is the duration of the skin heating process starting at the initial skin temperature T0. L\u03c4 is the transduction period, i.e. the time required for heat to be transduced by nociceptors into neuronal spikes. L\u03b2 is the sum of: (1) the peripheral latency (Lp) required for the nociceptive information to reach the central nervous system (CNS) through the nerves; (2) the \u2018decisional\u2019 latency (Ld) required for central decision-making process (CDP), initiated by the arrival (and/or the accumulation) in the CNS, of a sufficient amount of nociceptive information to order the triggering of the withdrawal; and (3) the motor latency (Lm), time from motoneuron activation up to the shortening of the muscle. In other words, at the time when the \u2018behavioral threshold\u2019 (T\u03b2) level of thermal stimulation is achieved, i.e. time tT\u03b2\u200a=\u200atR\u2212L\u03b2, the flow of information transmitted by the nociceptors is sufficient to trigger the behavioral response at time tR. Whether a response occurs depends on the state of the CDP occupying a time Ld. T\u03b2 is defined by the occurrence of a behavioral response, itself depending on a go/no-go signal given by the CDP. Note that, the permissive state of the CDP is basically stochastic in nature and influenced by many factors, such as behavioral conditioning circumstances. We will use the term \u2018apparent threshold\u2019 (AT) for the skin temperature reached at the end of the sequence of latencies summing up to tR.As any psychophysical process a priori unknown, from measurements of approachable quantities. To avoid the inconveniences of the conventional methods of thermal stimulation, a CO2 laser was used R, the so-called \u2018tail-flick latency\u2019 (TFL), elicited by changes in either the power of the radiant heat source, the initial temperature of the skin or the site of stimulation along the tail.We aimed to develop an original paradigm to infer the latent psychophysical variables L\u03b2 and T\u03b2, 0+a.t0.5 or, expressed in terms of temperature variation 0\u200a=\u200aa.t0.5 0.5;. the moment of the reaction defined by t\u200a=\u200atR and AT\u200a=\u200aT0+a.tR0.5. Considering squared temperature variations, \u0394T2 yields the following expressions (2\u200a=\u200a\u03b1.(tR\u2212L\u03b2) [equation 1] and \u0394AT2\u200a=\u200a\u03b1.tR [equation 2].When the skin is exposed to a constant power source of infrared radiation, the temperature increases with the square root of time, according to the law of radiant heat transfer T\u200a=\u200aT=\u200aa.t0.5 . This qu.t\u200a=\u200a\u03b1.t . Such te.t\u200a=\u200a\u03b1.t . Each be moments :. the beressions : \u0394T\u03b22\u200a=\u200a0 remains stable during the experimental procedure, we can infer T\u03b2 the behavioral threshold temperature and L\u03b2 the behavioral latency - which are presumably constant - from a series of trials where the power of the radiant heat source varies to produce an appropriate range of \u03b1  and the temperature of the skin (i.e. by T0).Because of the stochastic nature of the psychophysical responses, the points of intersection of each curve with the others constituted a cluster in the temperature vs. time plot. Analyzing the cluster in terms of density of intersections revealed the highest density at coordinates T\u03b2 and \u2212L\u03b2 . One canation 3] . When \u0394Aectively . Thus, t2vs. \u03b1 plots provided accurate calculations of T\u03b2 and L\u03b2 for each level of stimulation  of these fibers in the section of their course traveling in the tail was 0.91 (0.81\u20131.01) m/s that fits with the 0.5\u20130.9 m/s of unmyelinated polymodal nociceptors recorded in the coccygeal nerve of the rat L\u03b2 was directly proportional to D . The rec2\u200a=\u200af(\u03b1) plots (2) but increasing slopes (L\u03b2), as one would expect as the stimulation site moved distally. Comparing the bundles of straight lines over increasing skin temperatures, revealed a fall in both L\u03b2 and \u0394T\u03b22. The slope of the L\u03b2\u200a=\u200af(D) functions  plots  allowed unctions  fell as unctions . Finallyncreased .0 was slightly above ambient temperature Ta when Ta\u226425\u00b0C, and several degrees above when Ta\u226530\u00b0C (t\u200a=\u200af(T0) revealed a linear function best described by the equation Vt\u200a=\u200a0.041 T0\u22120.471, with Q10 between 20 and 30\u00b0C\u200a=\u200a2.3 (1.9\u20132.7) (c can then be easily deduced: Vc\u200a=\u200aVt+0.041 (Tc\u2212T0); on average, Vc\u200a=\u200a1.1 (1.0\u20131.2) m/s for a 38.1 (37.9\u201338.3)\u00b0C mean Tc. The dependency of the conduction velocity of peripheral fibers on temperature is a classical electrophysiological notion 10\u200a=\u200a1.8 and 2.1 were reported from the saphenous and aortic nerves, respectively The overall results are summarized in  Ta\u226530\u00b0C . Between Ta\u226530\u00b0C . The ind1.9\u20132.7) . In the 0+36.8 (2) and the surrounding non-stimulated areas (tail \u223c5000 mm2). Such imbalance is indisputably reflected in the firing of the corresponding populations of dorsal horn neurons, which means that the thermal picture of the tail received by the brain is more or less contrasted according to the basal temperature. Low background temperatures facilitate the detection of a nociceptive event - thus lowering the pain threshold -, while higher background temperatures blur the detection of a nociceptive event - thus increasing the pain threshold.The behavioral temperature threshold T\u03b2 exhibited a large inter-individual variability with a significant tendency to increase with the basal tail temperature, best described by the equation T\u03b2\u200a=\u200a0.27 T0+36.8 . This isSuch mechanisms could explain the tendency of the behavioral threshold to be lower for distal sites of stimulation (see above). During the experiments described in There is no reason to believe that the behavioral threshold corresponds to the mean threshold of primary nociceptors Using conventional radiant heat, thresholds in the 40\u201343\u00b0C range were reported In addition, the reported thresholds were in fact what we call here the apparent thresholds, dependent upon the steepness of the heat ramp. Tsuruoka et al. t to Vc (conduction velocity of the fibers that triggered the reaction in the part of their course within the core) change would occur approximately at the tail-trunk interface, but it can be determined statistically (Dc\u200a=\u200a90 mm) by considering the overall cluster of the intersection points of the straight lines L\u03b2\u200a=\u200af(D), obtained from different tail temperatures T0  with the ordinate: yc\u200a=\u200aLd+Lm\u200a=\u200ayt+Dc(1/Vt\u22121/Vc)  relationships with a large range of slopes presented an opportunity for the estimation of further, important, psychophysical variables. The first step was to estimate the length of the peripheral nerves where the conduction velocity increased . The Vtures T0 . The ava/Vc) See . Since L0 is set at 34\u00b0C. We did correct the calculation of Ld by taking into account the increased temperature of the nerve in the core. A further cause of rise in conduction velocity, albeit probably minor, was neglected because of uncertainty: the possible confluence of peripheral fibers that gives rise to larger common branches We provided evidence for the homogeneity of V along the tail and across animals, when TR , elicited by changing any of the parameters. In the classical tail-flick test, the principal source of variation introduced by experimenters is the power of heating of the electrical bulb used for achieving a predetermined range of TFL values - generally 2\u20134 seconds R\u200a=\u200a\u0394T\u03b22/\u03b1+L\u03b2, such computation produced hyperbolae when the basal temperature is stable (R\u200a=\u200af(\u03b1\u22121)] linearized this relationship (0)2 and L\u03b2, respectively. The latter is the reaction time that one would expect following instantaneous heating (\u03b1\u2192\u221e). Note the low impact of the stimulation site  and the very high impact of the basal skin temperature , elicited by changes in either the power of the radiant heat source, the initial temperature of the skin or the site of stimulation along the tail.We have developed a psychophysical approach of nociceptive reactions, based on the joint analysis of the stimulus and the response and on the measurement of three observable variables, namely the initial temperature TR mainly represents the time for the heating process L\u03d5 and, to a negligible extent, the transduction time L\u03c4 required to achieve the behavioral threshold of the reaction T\u03b2. L\u03c4 can be inferred from isolated primary afferent neuron recordings: Cesare and McNaughton R\u200a=\u200a variables that have been inaccessible with conventional methods. We believe that such an approach satisfies the repeated requests for improving nociceptive tests In summary, we provide here both a theoretical framework and an experimental paradigm, based mainly on random variations of the stimulus, which for the first time enable the behavioral determinations of latent psychophysical  and neurophysiological  weighing 275\u2013325 g in accordance with the National Institute of Health's \u2018Guide for the care and use of Laboratory animals\u2019, the European Communities Council Directive 86/609/EEC regulating animal research, and the ethics committee of the International Association for the Study of Pain The tail was depilated by means of a cream (Vichy\u00ae). Then the animal was habituated to this environment for one hour before the experiment. A colonic thermocouple was inserted 4 cm beyond the anal sphincter and fixed to the tank with adhesive tape. During the course of testing, stimulation was never applied during any behavior or postural adjustment of the animal.At the end of the experiment, the animal was sacrificed by an overdose of pentobarbital and autopsied. The L3 vertebra was carefully identified and the distances (D) between the stimulation sites and this vertebra were measured. This level was considered as the main entry zone in the cord for afferent signals from the tail as: (1) the four major nerves innervating the tail, namely the dorsolateral and ventrolateral tail nerves, project to dorsal horn superficial laminae of S2-Co2 segments The tail, as a source of radiant heat, is an important organ for thermoregulation in the rat 2LSD, SIFEC, Ferri\u00e8re, Belgium) for the following reasons We set aside the use of light bulbs because they give emissions in the visible and adjacent infrared parts of the electromagnetic spectrum, for which the skin is poorly absorbent and particularly reflective. In addition, by changing the voltage across the incandescent filament one changes also the emission spectrum of the electric light bulb. Since the transparency of skin to radiation depends on its wavelength 0+a.t0.5 (see 2\u200a=\u200athe slope \u03b1 of the straight lines in the right graphs of 2) and q the laser power (mW).During laser stimulation, the temperature increases proportionally with the square root of time according to the law of radiant heat transfer T\u200a=\u200aTt0.5 see  and 3A. 2. To reach a satisfactory level of reproducibility, the laser beam must be perpendicular to the stimulated surface because the angle of incidence influences power density. However, the skin is never flat and the tail is a conical cylinder. In order to minimize these sources of variability, the beam axis was targeted perpendicular to the axis of the tail. The beam was adjusted to 45\u00b0 with respect to the vertical, in order to elicit a contralateral withdrawal movement. Doing this allowed stimulation of the right and left side of the tail at a given rostro-caudal level.In practice, for a given surface of stimulation and a constant angle of incidence of the laser beam to the skin, the term a is proportional to q. It follows that \u03b1 is proportional to q2/ms range and the maximum temperature reached at the actual moment of the reaction was always lower than 70\u00b0C.We determined a range of powers of stimulation (100\u2013350 mW) provoking responses within less than 2.5 seconds without damaging the skin. In these conditions, the slope \u03b1 was in the 0.07\u20133.2\u00b0CFour (or 5) sites of stimulation, each 4 (or 3) cm from each other, were identified on each side of the tail. The left and the right side were stimulated alternatively with variable laser powers in the 100\u2013350 mW range. These powers were delivered in a pseudo-random order, 15\u201320 times per stimulation site. The stimuli were directed successively to the 8 (or 10) sites. A minimum of 5 minutes passed between stimulation of a given site and the next stimulation at the same site. We checked that there were no significant differences between data computed separately from either side of the tail  or from the two temporal halves of the experiment .2, stimulus duration of 2500 ms and initial skin temperature of 34\u00b0C. d\u200a=\u200a100 and surface skin temperature Td\u200a=\u200a0, i.e. \u0394Td\u200a=\u200aTd\u200a=\u200a100\u2212Td\u200a=\u200a0. It fits a rectangular hyperbola of the form \u0394Td\u200a=\u200a\u0394Tmax.t/(t\u0394Tmax/2+t), where \u0394Tmax represents the upper asymptote (i.e. maximum of \u0394T) and t\u0394Tmax/2 represents the time t at \u0394Tmax/2. The parameters are estimated by linearizing the rectangular hyperbola using the Hans-Woolf procedure The measurement of temperature at the skin surface is justified by convenience of use, non-invasive character and possibility of extrapolating the underlying subcutaneous temperatures by modeling. This temperature represents only an approximation of the temperature reached at the level of the nociceptors, which are located at the dermo-epidermal junction, at an average depth of 100 \u00b5m In other words, the difference in temperature between the skin surface and the dermo-epidermal junction at 100 \u00b5m depth is about 1\u00b0C and half of that difference is reached in about 100 ms. One can consider therefore that the temperature reached at the dermo-epidermal junction in our experiments was slightly lower, but indeed close to the measured surface temperature.max (i.e. maximum of \u0394T) increases linearly with laser power density Q. This allows to estimate easily, for a range of laser power densities used in the present experiments, the difference between skin surface temperature and the temperature at a skin depth of 100 \u00b5m by means of the following equation:Finally, \u0394T0.5 where K is a lumped constant equating [2(1\u2212r10.6)/(\u03c0.k.\u03c1.c)0.5]\u200a=\u200a6.564  camera  with a 500 \u00b5s integration time, which supplied images of 320\u00d7240 pixels at 172 Hz with a sensitivity of 0.02\u00b0C at 25\u00b0C. It was placed upright to the zone of stimulation and was controlled by the software Cirrus . It was calibrated by means of a black body . The software Altair  allowed the monitoring of the spatial and temporal evolution of the temperature at the level of the stimulated surface area with 0.3 mm and 5.8 ms resolutions, respectively See . The rec0 in this zone; (3) calculation of the temporal evolution of the warmest pixel in this zone until the image preceding the movement - the ordinate of the ultimate point of this curve constituting the apparent threshold AT. This pixel corresponded to the top of the Gauss curve, which characterizes the spatial profile of the thermal rise  transforming the temperature in difference with regard to the initial temperature \u0394T\u200a=\u200af(t); (2) rising to the square \u0394T2\u200a=\u200af(t); (3) checking the linearity of this curve; and (4) determining the value of the slope \u03b1 of this curve.The analysis of the thermographic films was made by means of the software Altair . This involved the following steps: (1) determination of the zone of interest in the recorded scene; (2) determination of the initial temperature Trise See . The rea0, AT and \u03b1 the slope of the linear function \u0394T2\u200a=\u200a\u03b1.t , the equation \u0394T2\u200a=\u200a\u03b1.t is transformed into \u0394T2x\u200a=\u200a\u03b1.(x+tR). Such a change of origin allows one to visualize the back timing of events and to identify the point  vs. x in two unknowns. Density distributions of the coordinates of intersections were computed with bin widths of 20 ms and 0.25\u00b0C, respectively. The value corresponding to the peak density of each distribution was considered as an estimate of the point having abscissa \u2212L\u03b2 and ordinate T\u03b2. It was visualized on a bivariate frequency histogram as shown in One can modify the representation by adjusting the origin of the time scale of each individual curve for heating to the actual moment of the reaction See . This baR of equation 2 in equation 1, we obtain after rearrangement: \u0394AT2\u200a=\u200a\u0394T\u03b22+L\u03b2.\u03b1 [equation 3]. By plotting \u0394AT2 as a function of \u03b1, the points aligned themselves quite well along a straight line  building the initial temperature T0 histogram; (2) exclusion of data for which T0 deviated from the mean by more than two standard deviations; (3) construction of the graph (AT\u2013T0)2\u200a=\u200af(\u03b1); (4) checking the linearity of the function (AT\u2013T0)2\u200a=\u200af(\u03b1); (5) Determination of T\u03b2 and L\u03b2By substituting \u03b1.tline See  and 3C, Conduction velocities were calculated on the basis of the linear relationship between the distance D from the stimulation site to the dorsal horn entry zone and the corresponding calculated psychophysical latency, L\u03b2\u200a=\u200af(D)\u200a=\u200ay+D/V, where y is the intercept with the ordinate and 1/V the slope of the straight line.0\u200a=\u200a34\u00b0C. But the temperature increases over the length (Dc) of the coccygeal nerve traveling within the core of the animal, which is maintained at 38\u00b0C by thermoregulation processes. Therefore, the decomposition of the peripheral latency into two components (Lp\u200a=\u200aLpt+Lpc) with different conduction velocities (Vt<Vc) appeared to be a reasonable assumption (see c)/Vt+Dc/Vc. The intercept y of the straight line with the ordinate of the function L\u03b2\u200a=\u200af(D) is increased by as much : yc\u200a=\u200ayt+Dc(1/Vt\u20131/Vc). This intercept corresponds to the part of the psychophysical latency that is not devoted to the progress of nociceptive signals along afferent fibers. This is a composite time that includes two successive distinct periods, namely Ld and Lm. Since Lm has been estimated as 4 ms c\u20134. In summary, both Lp and Ld can be estimated if one knows the relative contribution of the afferent path within the core of the animal, which means estimation of Dc and Vc.Knowing the distance D and the conduction velocity V of the fibers that trigger the reaction, one should be able to estimate the peripheral latency Lp\u200a=\u200aD/V. However, the conduction velocity of peripheral fibers is highly dependent on temperature, in a way which is equivalent across types, nerves and species tion see . The sloc and Vc is possible if data related to various initial temperatures of the skin T0 are available. The experiments described above were replicated with the rat being introduced to a chamber where the ambient temperature Ta was maintained stable during a given session, but changed over sessions in the 17\u201334\u00b0C range. The tail was not intentionally heated and was stimulated at 3\u20134 rostro-caudal levels. The temperature of the tail T0 was slightly above ambient temperature Ta for Ta\u226425\u00b0C, and several degrees above for Ta\u226532\u00b0C (See t\u200a=\u200af(T0) linear function best described by the equation Vt\u200a=\u200a0.041 T0\u20130.471, which provided the possibility of calculating the conduction velocities of fibers at core temperature Tc: Vc\u200a=\u200aVt+0.041 (Tc\u2013T0). The Vt to Vc change, which occurs at the tail-core interface where the temperature of the nerves increases from T0 to the core temperature Tc, can be estimated statistically in the D-L\u03b2 plot by considering the overall cluster of the intersection points of each straight line with the others , respectively.Estimation of both D32\u00b0C See . Between32\u00b0C See . In these others . A crossLeast squares linear regressions and one-way analyses of variance (ANOVA) were used for statistical purposes. Calculations were performed with the statistical software Staview\u2122 5.0 and Statgraphics\u2122 Plus 5. Other calculations were made with the software Mathcad\u2122 or Matlab\u2122. Results were considered significant at P<0.05. Data are expressed as means .Figure S12 laser stimulation. A. Examples of thermal imaging of the skin during CO2 laser stimulation. The thermometric camera provided a picture every 5.8 ms (sampling rate 172 Hz). A sample of 5 pictures is shown, filmed 58, 122, 103, 308, and 477 ms following the triggering of the stimulus . The edges of the tail of the animal are indicated by the white dotted lines. Image e was recorded just before the withdrawal response - B. Spatial profiles of the pictures shown in A. They were calculated on the rostro-caudal line passing through the center of the stimulation spot. Note they all fit a Gaussian curve. One can compare the radius of the stimulation spot with the radius of the laser beam. The radius of the beam is defined as the distance separating its z axis from the zone where its power is reduced to 1/e2\u200a=\u200a13.5% of its maximum. A corresponding radius of the stimulation spot resulted from these properties of the beam: the distance separating the z-axis of the heating spot from the zone where the difference of temperature is reduced to 13.5% of the maximum was 1.7 mm. The physical diameter of stimulation (3.4 mm) is shown as a yellow area. - C. Temporal evolution of the temperature of the warmest pixel during this laser stimulation. AT\u200a=\u200aapparent threshold; R\u200a=\u200abehavioral response; tR\u200a=\u200areaction time.Analysis of thermal imaging of the skin during CO(1.50 MB TIF)Click here for additional data file.Figure S20 at 18.5 , 30.9  and 36.0\u00b0C , respectively. Note the clear tendency of these curves to cross each other in a privileged zone (open circles) and the progressive shift of this zone both backward in time when the stimulation site moved from proximal to distal parts of the tail and upward when the ambient temperature increased (dashed lines).Individual heating curves corresponding to the example analyzed in (1.55 MB TIF)Click here for additional data file.Figure S3R\u200a=\u200af(D)\u200a=\u200a(T\u03b2\u2212T0)2/\u03b1+(D\u221290)/Vt+90/Vc+Ld+Lm\u200a=\u200a(T\u03b2\u2212T0)2/\u03b1+(D\u221290)/Vt+90/[Vt+0.041 (Tc\u2212T0)]+Ld+Lm. This opens the possibility of computing variations of tR introduced by moving the stimulation site along the tail. The graphs shows results of such a procedure, with the numerical values determined from the present study with the basal temperature of the tail stabilized at 34\u00b0C. The numerical values of \u03b1 was chosen as 0.045\u00b0C2/s in order to achieve the 2\u20134 seconds range, shown as a yellow area, for the TFL commonly reported in the literature for the classical tail-flick test in control situations c\u200a=\u200a38\u00b0C, T0\u200a=\u200a34\u00b0C, Vt\u200a=\u200a0.91 (0.81\u20131.01) m/s, Ld\u200a=\u200a132 (117\u2013146) ms, Lm\u200a=\u200a4 ms. The results of computation are shown as means \u00b195% C.I. . - A. The behavioral threshold T\u03b2 is considered as invariant . In those cases, the TFL increases slightly when the stimulation site moves distally along the tail, as one would intuitively expect. - B. Since there was a significant proximo-distal shift of T\u03b2 , even though the pathway for the afferent signals increases. In fact, this a priori paradoxical property has already been described Modeling and simulation of the tail-flick. Equation 1 can be written: tft of T\u03b2 , we intr(2.31 MB TIF)Click here for additional data file.Video S1A. An example of thermographic film of the tail of a rat placed in a conventional restrainer, recorded with a 320\u00d7240 pixels resolution at 1 Hz during 135 minutes. Steel rings maintained its tail. - B. Corresponding temporal evolution of the skin temperature recorded on 6 points distributed from the base to the tip of the tail (blue dots and corresponding traces). One observes phases of vasoconstriction and vasodilatation throughout the recording session. Note that the 10\u00b0C amplitude of the variations for the most distal points of the tail. As measured on an inert piece of wood , the ambient temperature was stable around 25\u00b0C. The central core temperature (Tc) is shown as upper black trace. - C. The dissipation of heat is regulated by abrupt variations of blood flow in a system of arterio-venous anastomoses, which form a double ladder. Anatomy adapted from (12.19 MB MOV)Click here for additional data file."}
+{"text": "A temperature sensitive variant (ts13) of African green monkey kidney cell line, carrying a temperature sensitive lesion in thymidine metabolism, was transformed by 40 \u03bcg/ml of methylnitrosourea (MNU) at the restricted temperature of 39\u00b75\u00b0C, whereas the same cell line was not transformed by MNU at the permissive temperature of 33\u00b0C. Results presented in this paper raise the possibility that clones of cells carrying a biochemical lesion might possibly contribute to carcinogenesis with respect to certain chemical carcinogens."}
+{"text": "Both radiofrequency (RF) and microwave (MW) ablation devices are clinically used for tumor ablation. Several studies report less dependence on vascular mediated cooling of MW compared to RF ablation. We created computer models of a cooled RF needle electrode, and a dipole MW antenna to determine differences in tissue heat transfer.We created Finite Element computer models of a RF electrode , and a MW antenna . We simulated RF ablation for 12 min with power controlled to keep maximum tissue temperature at 100 \u00baC, and MW ablation for 6 min with 75 W of power applied. For both models we considered change in electric and thermal tissue properties as well as perfusion depending on tissue temperature. We determined tissue temperature profile at the end of the ablation procedure and calculated effect of perfusion on both RF and MW ablation.Maximum tissue temperature was 100 \u00baC for RF ablation, and 177 \u00baC for MW ablation. Lesion shape was ellipsoid for RF, and tear-drop shaped for MW ablation. MW ablation is less affected by tissue perfusion mainly due to the shorter ablation time and higher tissue temperature, but not due to MW providing deeper heating than RF. Both MW and RF applicators only produce significant direct heating within mm of the applicator, with most of the ablation zone created by thermal conduction.Both RF and MW applicators only directly heat tissue in close proximity of the applicators. MW ablation allows for higher tissue temperatures than RF since MW propagation is not limited by tissue desiccation and charring. Higher temperatures coupled with lower treatment times result in reduced effects of perfusion on MW ablation. While ablation used for different diseases, here we consider tumor ablation, i.e. treatment of cancer. For tumor ablation, RFA is currently the most common thermal ablation therapy used in a clinical setting. Cryoablation, which is another fairly common tumor ablation modality, uses freezing instead of heat to kill tissue , Ww is the remaining tissue water mass per unit mass of tissue, 0 \u2264 Ww \u2264 0.73. The equation is based on the assumption that specific heat of solid tissue materials (proteins) is 1560 J/g\u2022C and specific heat of water is 4200 J/kg\u2022C ,cbl[J / Where To evaluate the relation between RFA and MWA we integrated each term over time. Please note, that even though the terms are not independent from each other (e.g. perfusion / conduction) we could determine the relationship between those terms; since we modeled RFA and MWA with and without perfusion; we could directly observe how perfusion and thermal conduction are interrelated.The temperature increase due to thermal conduction was calculated using the following equation:3SAR(W / kg ) ):In the same way, we determined temperature increase due to direct heating  \u2013 (8) equates to the total tissue temperature rise:and the final tissue temperature is:Even though tissue damage depends both on temperature and time , we founin vivo [2), and 36 mm for the unperfused RFM; diameters were 23 mm for the perfused MWM  and 26 mm for the unperfused MWM. For the 12 minutes RFM simulation with perfusion, thermal conduction dominates in the range from 12 to 19 mm radially . For the 6 minutes MWM simulation with perfusion, thermal conduction is dominating the range >20 mm radially . If temperature loss due to blood perfusion is not simulated, direct heating is dominating throughout the RFM  and MWM . We also determined the time dependent contribution of \u0394condT,\u0394SART,\u0394pQT. For the 0 minutes - 6 minutes time span in the RFM  direct heating was dominating the whole model, because the influence of blood perfusion has not yet ceased (temperatures <  50 \u00baC) . For the 0 minutes \u2013 3 minutes MWM  time span we can see that thermal conduction dominates the range from 9 mm \u2013 11 mm radially because temperatures > 50 \u00baC are already reached in this area. For the 6 minutes \u2013 12 minutes time span in the RFM  an the 3 minutes \u2013 6 minutes time span in the MWM  the relative contribution of direct heating is dominating in the whole model. We also determined the area and the contributed amount of direct heating to the increase of tissue temperature. Fig. (12) shows the influence of direct heating in the RF ablation simulation compared to the influence of direct heating in the MW ablation simulation. At each radial location, the fraction of total power within that radius  is plotted. For RF, 90% of total power is deposited within 5 mm; for MW, 90% of total power is deposited within 6 mm.Maximum temperatures were ~100 \u00baC in the RF model, and 177 \u00baC in the MW model; tissue charring and tissue vapor does not limit propagation of microwaves, so a higher temperature can be achieved compared to RF. These temperature values are comparable to temperatures measured in vivo , 6. The 5, 8). Our models suggest that the reason MWA is less affected by perfusion is likely that MW heating is not limited by tissue charring around the applicator. This results in higher temperatures during MWA . The resulting shorter application times make MWA less susceptible to perfusion effects as demonstrated by our models .While it has been previously suggested that MWA performs better next to large vasculature due to a larger direct heating area, we found that the volumes of direct heating are similar between RFA and MWA . For RF ablation thermal conduction is dominating in the range from 12 mm to 19 mm radially over the 12 minutes procedure while direct heating due to resistive losses is dominating elsewhere . The higher contribution of thermal conduction near the 50\u00baC-isotherm can be attributed to high temperature gradients occurring at the border of the perfusion zone (50\u00baC). Tissue cooling due to perfusion is highest just below 50\u00baC, and zero above 50\u00baC; this discontinuity in perfusion promotes high thermal gradients, and increased thermal flux near the coagulation zone boundary. Since this discontinuity of thermal gradients is missing in the non-perfused models, the thermal conduction term is significantly smaller near the coagulation zone boundary . Further notable is that thermal conduction contributes little during the first half of the RF and MW procedure , with more significant contribution during the second half . In fact, thermal conduction has similar contribution during both RF and MW ablation for the first 6 minutes .Initially direct heating is dominating everywhere for both RF and MW ablation since tissue temperature is uniform (i.e. no temperature gradient and no heat flux). The integrals of the different heating terms show that for MW ablation, direct heating due to dielectric losses is dominating up to a radius of 20 mm over the 6 minutes MW ablation. Further away thermal conduction and direct heating have similar contributions (Fig. Therefore, MWA may have clinical advantages close to large vasculature due to the shorter required treatment time compared to RFA.in vivo studies, MW coagulation zones are less affected by tissue perfusion compared to RF [During RF ablation tissue perfusion and thermal conduction contribute more towards tissue cooling and heating compared to MW ablation. This is mainly due to the longer session times necessary with RF ablation, as tissue temperatures are significantly lower compared to MW ablation. The reduced influence of thermal conduction and perfusion due to shorter session times may in part explain why ed to RF . The regThe authors declare that they have no competing interests.WS performed the RF modeling, did the post simulation analysis and wrote part of the paper; DY performed the MW modeling; BJW consulted on clinical issues and wrote part of the paper; FR consulted on mathematical issues and wrote part of the paper; DH planned and supervised the study, and wrote part of the paper."}
+{"text": "Unexplained disease etiology in hospitalized patients highlights the importance of surveillance to detect emerging novel pathogens. Toxoplasma encephalitis and subacute sclerosing panencephalitis showed notable declines. The average annual encephalitis case-fatality rate (4.6%) and the proportion of patients hospitalized with encephalitis with no identified pathogen  were stable during the study period. The nonnotifiable status of encephalitis in Australia and the high proportion of this disease with no known etiology may conceal emergence of novel pathogens. Unexplained encephalitis should be investigated, and encephalitis hospitalizations should be subject to statutory notification in Australia.Encephalitis is a clinical syndrome commonly caused by emerging pathogens, which are not under surveillance in Australia. We reviewed rates of hospitalization for patients with encephalitis in Australia\u2019s most populous state, New South Wales, from January 1990 through December 2007. Encephalitis was the primary discharge diagnosis for 5,926 hospital admissions; average annual hospitalization rate was 5.2/100,000 population. The most commonly identified pathogen was herpes simplex virus .  Many novel infectious diseases have been reported since 1940; most have been zoonoses originating from wildlife  and found that the hospitalization rate for viral encephalitis in UK hospitals was 1.5 cases per 100,000 population; 60% of cases were recorded as unidentified viral infection  to estimate the impact of both viral and nonviral encephalitis hospitalizations  are notifiable to public health units; thus, the occurrence of encephalitis is not well documented.A single, small study conducted in Australia\u2019s tropical Northern Territory found that 18 (53%) of 34 encephalitis patients admitted to the Royal Darwin Hospital during a 5-year period (1992\u20131996) had encephalitis with unexplained etiology , Australia\u2019s most populous state. We also describe trends in pathogen identification in patients hospitalized with encephalitis over the 18-year period 1990\u20132007.Data on hospital discharges, deaths, and population for NSW were obtained for 1990\u20132007 from the Health Outcomes and Information Statistical Toolkit, a collection of databases maintained by the Epidemiology and Surveillance Branch of the NSW Department of Health. The datasets used were from the Inpatient Statistics Collection library. Encephalitis-associated hospital stays were extracted for the period for patients for whom data were complete by using International Classification of Diseases, 9th revision, Clinical Modification codes  and International Classification of Diseases, 10th revision, Australian Modification .Data for encephalitis-associated deaths in NSW were extracted from the Australian Bureau of Statistics death library by using ICD-9 (1990\u20131997) and ICD-10 (1998\u20132006) codes. Data for deaths occurring in 2007 were unavailable at the time of extraction. Population statistics from the Australian Bureau of Statistics were accessed through the Health Outcomes and Information Statistical Toolkit for the same period.An encephalitis-associated hospital stay was defined as a hospitalization for which the primary discharge diagnosis was an ICD-9-CM or ICD-10-AM code for acute encephalitis. Relevant ICD-9-CM and ICD-10-AM codes were obtained by searching the alphabetical list of ICD codes for all codes that include the term enceph, but excluding nonencephalitis conditions  and including rabies. Additionally, 2 ICD-9-CM codes used for encephalitis-related conditions before July 1998 did not include the prefix enceph-, unlike nomenclatures used in ICD-10-AM encephalitis codes. One of these ICD-9-CM codes was 49.8, defined as other non\u2013arthropod-borne viral diseases of central nervous system \u2013other specified non\u2013arthropod-borne viral diseases of the central nervous system. The other code was 49.9, defined as other non\u2013arthropod-borne viral diseases of central nervous system \u2013unspecified non\u2013arthropod-borne viral diseases of the central nervous system. The use of these codes was found by comparing data extracted for 1998 and 1999. For these 2 years, coding was performed in both ICD-9-CM and ICD-10-AM, and data were then compared to identify the additional codes.The Table shows the ICD-9-CM and ICD-10-AM encephalitis-associated conditions with codes used for encephalitis hospitalizations during 1990\u20132007. These codes were further classified by investigators into encephalitis with known pathogens or unknown pathogens  by etiologic category, year, age, gender, and hospital location. Hospitalization rates and death rates were calculated by using annualized population estimates from the Australian Bureau of Statistics. Negative binomial regression was used to analyze trends for hospitalization rates of all encephalitis hospitalizations and for those caused by known and unknown pathogens. The regression was repeated with adjustment for age groups over time by using log of the population as an offset and age as a categorical covariate. Trends were represented as annual percentage changes in rates. Ethical clearance was given by Hunter New England Population Health and by the Australian National University Human Research Ethics Committee.Toxoplasma meningoencephalitis (221 admissions or 3.7%) were also common known etiologies. The etiology of 4,126 admissions  was unknown.From January 1990 through December 2007, encephalitis accounted for 5,926 hospitalizations in NSW. The average number of hospitalizations per year was 329 (range 281\u2013393). The most frequently identified etiology of encephalitis was herpes simplex virus infection, which accounted for 763 admissions (12.9%) . VaricelThe average annual rate of encephalitis hospitalization was 5.2 per 100,000 population (range 4.2\u20136.7) . The annThe case-fatality rate for encephalitis during 1990\u20132006 was 4.6/100 cases. The rate of encephalitis hospitalizations declined for admissions of patients with encephalitis with both known and unknown etiologies . A negatToxoplasma encephalitis was excluded, the rate for hospitalizations for men with encephalitis with identified etiologies  was similar to the rate for women .The proportion of cases with pathogens of known etiologies was higher for men than for women; the average hospitalization rate for men with encephalitis with a known etiology was 1.9/100,000 compared with 1.3/100,000 for women with encephalitis with a known etiology. In contrast, rates for patients with encephalitis with unknown etiologies were similar for men  and women . When the diagnosis of Toxoplasma encephalitis admissions.The proportion of hospitalizations with encephalitis with known etiology varied little among hospitals; a notable exception was a large Sydney hospital specializing in HIV-related medicine. For this hospital, the higher proportion of patient admissions with encephalitis with known etiology (50%) resulted from a high number of Toxoplasma encephalitis hospitalizations increased early in the study period and peaked in 1993 , encephalitis is of public health importance because rapid response to cases may prevent additional transmitted cases of the underlying etiologies. Currently, nearly 70% of encephalitis cases have no identified etiology, so encephalitis is presently not amenable to public health prevention and control measures. This trend of encephalitis with unidentified etiology is seen elsewhere in developed countries and seems to occur even in the presence of extensive laboratory testing ; however, these differences may result in part from differences in study methods. The US study included hospitalizations for which encephalitis was the primary, secondary, or other discharge diagnosis, whereas our study included only those cases for which encephalitis was the primary discharge diagnosis. Similarly, a study in the United Kingdom found a hospitalization rate of 1.5 per 100,000 per year. The UK study included only cases of viral encephalitis and thus used a smaller number of ICD codes in the data collection than our study. This selection could account for the lower number of cases, although a true difference cannot be ruled out.Our findings demonstrated a higher rate of encephalitis admissions that had no identified etiology (69.6%) in NSW than has been found in either the United States (59.5%) or the United Kingdom (60.0%). Although different methods of data extraction and different sample sizes may have contributed to these differences, a true difference in pathogens causing encephalitis could exist among these 3 countries. The high proportion of encephalitis cases with unknown etiology across all 3 countries emphasizes the limits of current diagnostic tools and/or the lack of systematic investigation of encephalitis cases. In Australia, the proportion of encephalitis deaths with no identified etiology increased from 47.0% during 1979\u20131992 to 57.2% during 1993\u20132006 . Although the datasets for hospital inpatients and for death registry data are not directly comparable, this relative increase in deaths from encephalitis with unknown etiology further emphasizes the need for enhanced routine surveillance.Toxoplasma encephalitis is likely associated with HIV infection in the early 1990s.Our data showed a higher rate of total encephalitis admissions for men (54.3%) compared with women (45.7%); this difference is largely due to a higher rate of toxoplasmosis encephalitis hospitalizations for men, a finding similarly observed in the US hospitalization data ; encephalitis hospitalization rates changed little for patients with this virus during the study period, a finding consistent with the US and UK studies  contained several new codes not present in ICD-9 (1990\u20131997), including codes for zoster encephalitis, listeria meningoencephalitis, and enteroviral encephalitis. Before 1998, ICD-9 codes must have been designated to conditions associated with the new ICD-10 codes; however, which codes were used cannot definitely be determined. Fortunately, hospitalizations coded with the unknown ICD-9 codes account for a small proportion (<6%) of all encephalitis cases reported .In addition to limitations due to the ICD coding changes, differences may exist in diagnostic criteria for encephalitis used by clinicians and in inconsistencies among hospitals regarding coding practices and hospital admission criteria. Our data represent hospital admissions, rather than cases of encephalitis. Although this study criterion is useful for estimating the impact of disease as it relates to hospital service provision, case-fatality rates will be underestimated by the use of hospital admission data, rather than true cases, as some patients had multiple hospital admissions. The proportion of encephalitis cases with known and unknown etiologies remained constant, despite the ICD coding system change.A previous study undertaken in the Northern Territory of Australia also found a high proportion (53%) of encephalitis cases with unknown etiologies (Acute encephalitis has heralded the emergence of multiple virulent pathogens ("}
+{"text": "This paper reviews the different applicators and electrodes employed to create localized heating in the cornea by means of the application of radiofrequency (RF) currents. Thermokeratoplasty (TKP) is probably the best known of these techniques and is based on the principle that heating corneal tissue  causes collagen to shrink, and hence changes the corneal curvature. Firstly, we point out that TKP techniques are a complex challenge from the engineering point of view, due to the fact that it is necessary to create very localized heating in a precise location , within a narrow temperature range (from 58 to 76\u00baC). Secondly, we describe the different applicator designs (i.e. RF electrodes) proposed and tested to date. This review is planned from a technical point of view, i.e. the technical developments are classified and described taking into consideration technical criteria, such as energy delivery mode (monopolar versus bipolar), thermal conditions (dry versus cooled electrodes), lesion pattern , and application placement . On one hand, it is necessary to create very localized heating in a precise location , keeping the endothelium thermally protected . The endothelium is a mono-cellular layer in the human eye which is non regenerable, and hence the temperature at this point should always be maintained at a safe level (e.g. lower than 45\u00baC). Consequently, the procedure requires an extremely high spatial resolution. The temperature at the epithelium is not so critical: some TKP techniques combine surface cooling to create a temperature profile with a low temperature at the epithelium . In contrast, other techniques  heat both the epithelium and the central stroma .Localized heating of the cornea has been employed since 1889 for different therapeutic and surgical objectives. The best known of these techniques is probably thermokeratoplasty (TKP), which is based on the principle that heating corneal tissue  causes collagen to shrink, and hence changes the corneal curvature [1).It is known that collagen shrinkage occurs at temperatures ranging from 58 to 76\u00baC. However, higher thermal levels, 79\u00baC or over, definitely lead to relaxation of the collagen and complete loss of its elasticity, inducing important keratocyte proliferation and accelerating collagen turnover (i.e. provoking a regression of the corrected refractive error) . TherefoIn order to create corneal heating, different kinds of energy sources have been tested, such as simple thermal conduction from pre-heated probes, known as thermokeratophores ,4, microLos Alamos Keratoplasty probe [circulating saline electrode (CSE), since, while the active electrode delivered RF currents (1.6 MHz) a flow of isotonic saline (at 37\u00baC) was infused over the cornea surface [2B).The first applicator designed for applying RF currents in the human cornea was described by Doss and Albillar  in 1980. surface ,12 (see The basic idea of the CSE was to improve the temperature profile obtained by the thermokeratophore during thermokeratoplasty (TKP). The thermokeratophore was a metallic probe preheated to a specific temperature range 90-130\u00baC) and placed on the cornea surface, i.e. the thermal lesion was created by thermal conduction from the thermokeratophore towards the corneal stroma. Consequently, the maximum temperature was reached at the cornea surface (\u224875\u00baC), while the central stroma remained at \u224845\u00baC . In cont0\u00baC and pThe CSE technique was also proposed using a bipolar system (i.e. without using a dispersive electrode). Several arrangements with a variable number of electrodes were proposed  but neve2A). The applicator, known as the localized current field (LCF) device, was also developed at Los Alamos Scientific Laboratory [Prior to the development of the CSE, some experimental studies were conducted by using a two-electrode applicator for delivering RF currents (2 MHz) in a bipolar system . The aim was the correction of hyperopia by producing steeping of the cornea by means of creating a series of eight spots of one millimeter in diameter distributed symmetrically around a seven millimeter diameter ring in the mid-periphery of the cornea. The electrode played the role of an active electrode, and a large-area disk was the dispersive electrode. In addition, a more complex applicator including up to eight electrodes was proposed to simultaneously create the circular lesion pattern [Around 1993, Mendez and Mendez-Noble  proposed pattern . Our gro pattern ,26. In a pattern  found so3A). The results suggested that the contact conditions between applicator and cornea surface should be balanced along the circular path in order to avoid zones with different lesion characteristics. In fact, it has been recognized that manual placement of the probe may involve human error, and hence the problem of controlling the contact between applicator and cornea has been broadly investigated in RF heating [Finally, we also conducted experimental research to assess the performance of a ring applicator for the rapid creation of a circular lesion pattern  . This behavior is especially advantageous for heating the cornea, since it allows direct heating of the central stroma. However, this electrode design offers additional advantages for cornea heating; since the electrode body is usually made of a conducting metal (e.g. stainless steel), the low thermal conductivity of this element compared to the thermal conductivity of the cornea facilitates the transmission of heat from the electrode tip to the anterior cornea . As a result, a high thermal gradient appears between the electrode tip and endothelium, which provides thermal protection to the endothelium .The electrical-thermal behavior of this kind of electrode has been extensively studied using computer modeling -38. The 5 shows the temperature profiles for intrastromal electrodes made from different materials, confirming the importance of the electrode body in diffusing the heat created at the electrode tip.We studied the effect of the thermal conductivity of the intrastromal electrode on the temperature profile in the cornea by means of theoretical modeling . Fig. 5 3B). To our knowledge this device was never experimentally assessed.Finally, regarding intrastromal electrodes, it is interesting to note Silvestrini\u2019s proposal  for an RDuring the study and development of applicators for RF heating of the cornea, theoretical models and computer simulations have played an important role. This methodology is advantageous, being both fast and cheap, for assessing the electrical and thermal behavior of RF applicators . For insEven though numerous RF applicator designs for cornea heating have been proposed and experimentally tested, to date only the needle-shaped intrastromal applicators have achieved clinical success ,32,43. FFrom the clinical and manufacturing point of view, these electrodes were initially manufactured by Refractec . This company currently develops and markets electrodes and an RF generator under the trade name of ViewPoint\u00ae CK System. The surgical procedure is known as Conductive Keratoplasty\u00ae (CK). In general, for the treatment of hyperopia, the lesion spots  are created following a full circular pattern . This lesion pattern acts like a belt, tightening the peripheral region of the cornea so that the central cornea becomes slightly raised .The Brazilian company Loktal Medical Electronics  has also developed similar electrodes (stainless steel tip of 90 \u00b5m in diameter and 350 \u00b5m in length) which are employed with an RF generator (Wavetronic Genius). To date, this equipment has been employed in a clinical study for treatment of advanced keratoconus . In thisBoth technologies  are based on delivering RF energy for a total time of 600 ms . During this period, the RF generator emits a train of pulses consisting of exponentially damped sinusoidal waves (350 kHz) ,32,38. TThis paper has reviewed the different applicators and electrodes employed to create localized heating in the cornea by means of the application of radiofrequency (RF) currents. Taking into consideration the extensive number of cornea heating techniques for purposes of refractive surgery proposed and tested to date , we believe that the problem has not yet been solved. Therefore, a great deal of research effort should be focused on finding the optimum RF applicator for cornea heating."}
+{"text": "Beauv.] seed cuticles. J-V characteristics showed ohmic conduction at low fields and space charge limited current at high fields. Charge mobility in ohmic region was 4.06 \u00d7 10\u22125\u2009\u2009(m2V\u22121s\u22121). Temperature-dependent conductivity measurements have been carried out in the temperature range 320\u2009K < T > 450\u2009K. Activation energy within a temperature of 320\u2009K\u2013440\u2009K was about 0.86\u2009eV. Variable range hopping (VRH) is the main current transport mechanism at the range of 330\u2013440\u2009K. The VRH mechanism was analyzed based on Mott theory and the Mott parameters: density of localized states near the Fermi-level N(EF) \u2248 9.04 \u00d7 1019\u2009\u2009(eV\u22121cm\u22123) and hopping distance R \u2248 1.44 \u00d7 10\u22127\u2009cm, while the hopping energy (W) was in the range of 0.72\u2009eV\u20130.98\u2009eV.Metal-sample-metal sandwich configuration has been used to investigate DC conductivity in 4\u2009 A recent surge in interest in molecule-based electronics has highlighted the need for a better understanding of conduction mechanism in biomaterials . Most bi Generally charge conduction in semiconducting polymers is thought to take place by hopping of charge carriers in an energetically disordered landscape . VRH conreliably explain conductance observations made with biopolymers ::(4)Nt=2\u03b5Vtr is the voltage at which the transition from ohmic to SCLC behavior takes place. Using experimental values of VTFL = 15\u2009V and Vtr = 6\u2009V obtained from J-V curve at 320\u2009K ..(5)n0=98p0 is the concentration of thermally activated holes expressed as shown in  is shown in Nv = 1019\u2009cm\u22123 which is within the range of the effective density of states for thin films of other organic semiconductors 1/2,T0=18.11\u03b1ellulose \u201344. Othetions in  and 15)(12)\u03c30=3e\u03b1R and the average energy, W, satisfy Mott's requirements  for variable range hopping at this temperature range. Degree of localization of the carriers in the trap states indicated by \u03b1R > 1, shows that the charges are highly localized. \u03b1R > 1 and W > kT, which agrees with Mott's condition for variable range. It can also be noted from W decreases and the average distance R increases, supporting the fact that when the phonon energy is insufficient (low temperature), carriers will tend to hop larger distances in order to locate in sites which are energetically closer than their nearest neighbours. J-V curves was found to be 4.06 \u00d7 10\u22125 (m2V\u22121s\u22121). Analysis of current density-electric field dependence showed that both Schottky and Poole-Frenkel emission cannot explain conduction mechanism in the high fields where SCLC was seen to be present. Plots of DC conductivity versus temperature were used to investigate Mott's VRH conduction model at a temperature range of 320\u2013440\u2009K. This model was originally developed for amorphous silicon by Mott and Davis. When applied to conducting polymers, it assumes that electron transport originates from localized or fixed states within the polymer chain. The charge transfer between the chains takes place by phononassisted hopping between two localized states. Analysis of semilogarithmic plots of ln(JT1/2) versus T \u22121/4  gave the following Mott parameters: the degree of disorder oT was in the order of 1010, the density of states N(EF) \u2248 1019\u2009 (eV\u22121cm\u22123) while the distance R \u2248 10\u22127\u2009cm and energy (W) were in the range of 0.72\u2009eV\u20130.98\u2009eV. The product \u03b1R and the average energy, W, satisfy Mott's requirements  for variable range hopping in this temperature range. The study has shown that the cuticle is a promising alternative to synthetic polymers used in electrical switching applications. Due to environmental concerns posed by nonbiodegradable synthetic polymers, exploring this material would provide information on how to use it in addressing environmental problems and as a precursor in the design of novel materials with electrical functionality such as the modern nonvolatile memory chips, biosensors, and biological transistors.DC conductivity measurements were performed at a temperature range of 320\u2009K\u2013450\u2009K. Conductivity increased with temperature. Activation energy within a wider range of temperature was about 0.86\u2009eV. Charge mobility analyzed from"}
+{"text": "The influence of brain temperature on clinical outcome after severe brain trauma is currently poorly understood. When brain temperature is measured directly, different values between the inside and outside of the head can occur. It is not yet clear if these differences are 'real' or due to measurement error.The aim of this study was to assess the performance and measurement uncertainty of body and brain temperature sensors currently in use in neurocritical care. Two organic fixed-point, ultra stable temperature sources were used as the temperature references. Two different types of brain sensor (brain type 1 and brain type 2) and one body type sensor were tested under rigorous laboratory conditions and at the bedside. Measurement uncertainty was calculated using internationally recognised methods.Average differences between the 26\u00b0C reference temperature source and the clinical temperature sensors were +0.11\u00b0C (brain type 1), +0.24\u00b0C (brain type 2) and -0.15\u00b0C (body type), respectively. For the 36\u00b0C temperature reference source, average differences between the reference source and clinical thermometers were -0.02\u00b0C, +0.09\u00b0C and -0.03\u00b0C for brain type 1, brain type 2 and body type sensor, respectively. Repeat calibrations the following day confirmed that these results were within the calculated uncertainties. The results of the immersion tests revealed that the reading of the body type sensor was sensitive to position, with differences in temperature of -0.5\u00b0C to -1.4\u00b0C observed on withdrawing the thermometer from the base of the isothermal environment by 4 cm and 8 cm, respectively. Taking into account all the factors tested during the calibration experiments, the measurement uncertainty of the clinical sensors against the  26\u00b0C and 36\u00b0C temperature reference sources for the brain type 1, brain type 2 and body type sensors were \u00b1 0.18\u00b0C, \u00b1 0.10\u00b0C and \u00b1 0.12\u00b0C respectively.The results show that brain temperature sensors are fundamentally accurate and the measurements are precise to within 0.1 to 0.2\u00b0C. Subtle dissociation between brain and body temperature in excess of 0.1 to 0.2\u00b0C is likely to be real. Body temperature sensors need to be secured in position to ensure that measurements are reliable. In rodent models of cerebral ischaemia, small 1\u00b0 to 2\u00b0C) increases in brain temperature significantly increase infarct volume \u00b0 to 2\u00b0C . In patiThe significance of raised brain temperature on outcome in neurocritical care (NCC) patients remains controversial ,9. StudiThe performance of three commonly used temperature sensors for brain and body temperature measurement was undertaken as a service evaluation. Ethical approval and patient consent were therefore not sought. The sensors were: brain type 1 ; brain type 2 ; and a widely used (body type) general purpose probe . Brain and body type sensors were of a thermistor type  but of dThe temperature measurement evaluation of these probes was undertaken through the use of ultra-stable organic triple-point temperature references of 26.862\u00b0C (based on diphenyl ether (DPE) and 36.314\u00b0C (based on ethylene carbonate (EC)) . These tGuide to the Expression of Uncertainty in Measurement [Uncertainty values were calculated according to guidelines given in the internationally accepted surement . BrieflyIn addition, the effect of a change in sensor position on the measurement (immersion test) was assessed. In this test the three types of sensors were immersed in turn into a column of liquid at a uniform temperature (at the base of the re-entrant well of the triple-point cell) and then withdrawn in 1 cm increments up the column. The immersion test was undertaken over a period of 15 minutes for one sensor of each sensor type. A further source of uncertainty was obtained by assessing the change in temperature values using a different readout system, that is, performing the measurement uncertainties but using a different bedside data acquisition system (of the type used on the NCC unit). These individual uncertainties are then processed according to internationally agreed methodology to determine the standard uncertainties . For a fuller explanation of uncertainties and how to develop rigorous uncertainty 'budgets' the interested reader is referred to reference .Average differences between the temperature of the DPE triple-point cell  and the temperature sensors were +0.11\u00b0C (brain type 1), +0.24\u00b0C (brain type 2) and -0.15\u00b0C (body type), respectively. For the EC triple-point cell  the differences were -0.02\u00b0C (brain type 1), +0.09\u00b0C (brain type 2) and -0.03\u00b0C (body type). Repeat calibrations the following day confirmed that these results were within the calculated uncertainties.The results of the immersion tests are given in Figure In previous work undertaken at this Centre  small temperature differences observed between body and brain sites  led us tIn this study of the reliability of body and brain temperature sensors used in the management of patients with severe brain trauma it was necessary to undertake rigorous quantification of all possible sources of measurement uncertainty. We considered the magnitude of each source of uncertainty separately to produce an overall assessment according to agreed international methods .For the limited number of sensors tested, the performance was within the manufacturer's specification for temperatures at near body temperature; all (brain and body) sensors were within 0.1\u00b0C of the 36\u00b0C reference temperature source. The body-type sensors tested at below normal body temperature (reference source 26.8\u00b0C) did not perform as well as the brain sensors (measurement error +0.24\u00b0C).in situ position. This effect was not observed with the brain temperature sensors, suggesting that the brain temperature sensors tested in this study are less susceptible to ambient temperature than were the body type sensors.One difference between the brain and body type sensors was that a change in position (immersion depth) of the body type sensor caused a change in the temperature readout Figure . Such anThe results of this study therefore provide important information of relevance to clinicians interested in the potential significance of changes in the relation between brain and body temperature .The result of this service evaluation of sensors in current use for the measurement of brain and body temperature in critically ill patients reveals that the temperature sensors (brain and body) are fundamentally accurate and the measurements are precise to within 0.1 to 0.2\u00b0C. Subtle dissociation between brain and body temperature in excess of 0.1 to 0.2\u00b0C is likely to be real. This should be confirmed with a larger study. Good clinical practice in human thermometry is to ensure that body temperature sensors are checked for secured positioning.\u2022 The brain temperature sensors are fundamentally accurate and the measurements are precise to within 0.1 to 0.2\u00b0C.\u2022 When seeking to determine the clinical significance of these subtle temperature differences it is essential that the sensors are firmly secured in position.\u2022 Observed dissociation between brain and body temperature in excess of 0.1 to 0.2\u00b0C are likely to be 'real' and not due to sensor performance.DPE: diphenyl ether; EC: ethylene carbonate; ICP: intracranial pressure; NCC: neurocritical care.The authors declare that they have no competing interests.CC conceived the idea for the study, participated in the sensor calibrations and evaluations and drafted the manuscript. GM provided the organic fixed-point reference sources, participated in the sensor calibrations, calculated the sensor measurement uncertainties and helped to draft the manuscript. The authors are equally responsible for the final manuscript."}
+{"text": "The two-step dilute acid hydrolysis (DAH) of softwood is costly in energy demands and capital costs. However, it has the advantage that hydrolysis and subsequent removal of hemicellulose-derived sugars can be carried out under conditions of low severity, resulting in a reduction in the level of sugar degradation products during the more severe subsequent steps of cellulose hydrolysis. In this paper, we discuss a single-step DAH method that incorporates a temperature profile at two levels. This profile should simulate the two-step process while removing its major disadvantage, that is, the washing step between the runs, which leads to increased energy demand.2SO4, which resulted in a total of 26.3 g solubilized C6 sugars per 100 g dry raw material. To estimate the remaining sugar potential, enzymatic hydrolysis (EH) of the solid fraction was also performed. EH of the solid residue increased the total level of solubilized C6 sugars to a maximum of 35.5 g per 100 g dry raw material when DAH was performed as described above (3 min at 210\u00b0C and 2 min at 211\u00b0C with 1% H2SO4).The experiments were conducted in a reactor with a controlled temperature profile. The total dry matter content of the hydrolysate was up to 21.1% w/w, corresponding to a content of 15.5% w/w of water insoluble solids. The highest measured glucose yield, , was obtained after DAH cycles of 3 min at 209\u00b0C and 6 min at 211\u00b0C with 1% HThe dual-temperature DAH method did not yield decisively better results than the single-temperature, one-step DAH. When we compared the results with those of earlier studies, the hydrolysis performance was better than with the one-step DAH but not as well as that of the two-step, single-temperature DAH. Additional enzymatic hydrolysis resulted in lower levels of solubilized sugars compared with other studies on one-step DAH and two-step DAH followed by enzymatic hydrolysis. A two-step steam pretreatment with EH gave rise to a considerably higher sugar yield in this study. The depletion of oil reserves and the effects of oil-based energy on the global climate have provided an incentive to search for alternative sources of energy. In particular the transport sector is dependent on oil-derived products. Ethanol is a potential substitute of gasoline as fuel for vehicles. It is currently derived from starch-rich substrates such as maize corn and plants with high sugar contents, such as sugarcane ,2.Another potential source of ethanol is lignocellulose ,4. Curre2 and H2SO4) before steam pretreatment, and also DAH [2SO4 and a two-step pretreatment method of an acid-impregnated lignocellulosic substrate followed by EH have been thoroughly explored [The raw material considered for this study was spruce, a type of softwood. Pretreatment of softwood has previously been investigated using methods such as impregnation with acid catalysts,  and furfural, which are formed under more severe conditions . This war yields .In this study, we addressed the drawbacks of two-step processes by introducing a new reactor design with improved controllability, which permitted temperature profiles to be used during DAH. The two-step DAH was simulated by a one-step process that involved raising the temperature during the hydrolysis; the first period was conducted at a lower temperature to hydrolyze the hemicellulose, then the temperature was increased, but with a reduced residence time. The aim was to obtain a high hydrolysis yield of cellulose without generating inhibitors that were detrimental to the fermentation .The primary objective of the study was to determine the efficiency of DAH using a dual temperature profile in a novel reactor setup. This was to be compared with single-level (regular hydrolysis) experiments so as to point out the effect of a more advanced temperature control; small reactors tend to suffer from temperature overshooting. Because the temperature behavior was of particular interest, a series of tests was conducted with an alternative temperature control strategy. Also, the EH of the slurry after DAH was investigated to estimate the potential increase in sugar yield that was obtainable when using EH as compared with DAH alone.Picea abies) was kindly provided by a local sawmill . The wood chips were milled and sieved to yield a suitable substrate for the acid hydrolysis (chips of 2.2 to 10 mm in size). This size reduction was necessary because of the diameter of the reactor's inlet valve and had a negligible effect on the pretreatment outcome [Fresh, chipped (20 mm long and approximately 5 mm thick) spruce . Three thermocouples measured the temperature in the chamber (TR), the space between the chamber wall and the mesh (TS), and the jacket (TJ). The pressure in the reactor was monitored by the pressure sensor PR  and an automation system  Laboratory Analytical Procedures (LAP) . After tThe slurry from the acid hydrolysis was subjected to EH to investigate the remaining sugar potential. An enzyme mixture of Celluclast 1.5L (58 filter paper units (FPU)/g and 17 IU/g of \u03b2-glucosidase) and Novozyme 188 (376 IU/g of \u03b2-glucosidase), both kindly donated by Novozymes A/S , was used. A water-insoluble solids (WIS) concentration of 2% w/w was chosen to avoid end-product inhibition in the determination of the potential sugar yield. A total of 10 g of WIS, 2.60 g of Celluclast and 0.46 g of Novozym were diluted in 0.1 mol/L of NaAc buffer to a total mass of 500 g. Hydrolysis was performed at 40\u00b0C and pH 4.8 for 72 h. The experiments were conducted in duplicate.Incorporating the parameters 'time' and 'temperature' , the sev1 (min) is the residence time at the reaction temperature and TR1 (\u00b0C) is the temperature in the reactor. The function is extended for acid conditions towhere tyielding the combined severity factor (CS) by subtracting the pH value based on the set acid concentration before the reaction.R (\u00b0C)) and durations (ti (min)), the severity factor was extended toTo have the same convenient form for comparing the results of one-step pretreatments at different consecutive temperature levels (TJ-TR) of up to 30\u00b0C were conducted. The obtained experimental data (not shown) led to the conclusion that the jacket temperature should be equal to the reactor temperature (TJ = TR).Before the DAH experiments were conducted, preliminary testing of the reactor was required to establish the operation procedure. Part of this commissioning work involved determining the influence of the jacket heating, which should compensate for the disproportionate heat loss of small reactors. In theory, a higher temperature in the jacket than in the reactor should reduce heat loss and therefore the steam consumption in the reactor, yielding a higher dry matter content after the reaction. Experimental shots with a temperature difference  steam valve was re-opened. Any condensate that formed in the proximity of this valve was then transferred into the chamber. This contributed to the lower DM of the two-level experiments compared with their single-level counterparts.The reactor heating was completed in a matter of seconds. The response of the temperature sensor was too slow to control the initial heating, which resulted in a temperature overshoot of 5-10\u00b0C. This problem was addressed by using the pressure sensor in the chamber in conjunction with a correlation between the saturation pressure of water and the temperature for the initial phase, which resulted in good accuracy, thereby eliminating most of the temperature overshooting. This control strategy was then substituted for the previous one.In total, 50 conditions were investigated Table . SamplesThe initial DM of the raw material was 41.7% w/w. The maximum DM content after hydrolysis, assuming a dilution by the steam condensate used to heat up the material, was estimated to be 34.7% (a heat capacity of spruce of 3.18 kJ/(kg K) at 100\u00b0C was assumed ). This dExperiments were also performed to evaluate the steam consumption of the empty reactor (data not shown). Because the jacket was already at the operating temperature when the reactor heating was started, no heat losses and therefore no condensation of steam was expected at the reactor walls. However, a major source of heat loss occurred at the material inlet and outlet valves, and the condensate formed diluted the material. Based on the experimental results with the empty reactor, the level of additional liquid could be calculated. As an example, without heat losses by the inlet and outlet valves, the DM would hypothetically increase from 20% to 25% w/w for sample 10  were found for a CS levels between 2.85 and 3.64. The maximum obtained value of solubilized C6 sugars was 22.6 g per 100 g raw material at a CS of 3.40 . Owing to the increase degradation of the hemicellulose-derived C6 sugars with increasing severity, the maximum yield of overall C6 sugars was produced at lower severity than that of the maximum glucose yields.et al. conducted two-stage DAH at 200\u00b0C for 5 min with 0.4% H2SO4; 215\u00b0C for 3 min at 0.4% H2SO4; 190\u00b0C for 3 min at 0.7% H2SO4; and 215\u00b0C for 3 min at 0.4% H2SO4 [Abies concolor) and 30% Ponderosa pine (Pinus ponderosa)) was only 33.9% w/w, whereas in our study the substrate had a glucan share 45.1% w/w which definitely affected the glucose yield that is, the solubilized monomeric glucose with respect to the dry raw material). Nguyen et al. found 44.8% and 42.6%, in contrast to the 33.9% we measured.Nguyen 4% H2SO4 . The repThe formation of sugar-derived degradation products increased significantly when the severity was increased: the pentoses xylose and arabinose were degraded to furfural, which was then further oxidized to formic acid . The levet al. reported that the highest inhibitor concentration for a two-step dilute acid pretreatment of softwood (spruce) occurred at 180\u00b0C for 10 min at 0.5% H2SO4 and 220\u00b0C for 2 min at 1% H2SO4 [et al., the substrate was washed after the first step, which reduced the level of C5 and C6 sugars (originating from the hemicellulose fraction) that were available for degradation in the second step. By contrast, in our two-level DAH procedure, washing between the steps was omitted.S\u00f6derstr\u00f6m 1% H2SO4 . The repSamples 1-14 were conducted as single-temperature experiments and sample 15-50 as dual temperature experiments. For some of the latter experiments, the temperatures in the two steps differed by less than 5\u00b0C and these were thus allocated to the single-level runs , the data points of single/dual-temperature DAH had a random scatter pattern. No trend with regard to yields, favoring one process or the other, could be established.et al. [Based on these results, both pretreatment methods were equivalent for this type of setup in terms of sugar yields and degradation product formation. Furthermore, no influence on the C6 sugar yield after EH was evident. It should be noted that the scattering of the data points was very low for this type of experiment, which supports the conclusions drawn from the analysis. The time required to conduct the pretreatment was well below 10 min. By contrast, the experiments conducted by S\u00f6derstr\u00f6m et al.  required2SO4, for 7 min at 202\u00b0C). Figure EH of the total slurry was performed for selected samples to evaluate which sugar yield was potentially obtainable. The highest level of solubilized hexoses, ), was found for DAH at a CS of 3.17 . The reported combined  glucose yield of 36 g per 100 g DM  was thus considerably higher than the results we obtained. Both the pretreatment and the EH performed better than the best case observed in our study.A previous study on a two-step dilute-acid pretreatment of softwood followed by EH was conducted by S\u00f6derstr\u00f6m et al. . The gluet al. on a single-stage dilute-acid pretreatment of softwood forest thinnings followed by EH resulted in a final glucose yield after EH of 33.3 g per 100 g DM , with 13.3 g per 100 g DM  available after pretreatment [2SO4. Although the results of the pretreatment were slightly inferior to ours with regard to glucose yield, EH performed much better, with an increase of about 20.0 g per 100 g DM, resulting in a larger amount of total available glucose.A similar study by Nguyen reatment . The preet al. and Nguyen et al. relied on the material being washed before EH. By contrast, we performed EH on the whole slurry without washing, which might partly explain the low yield in the hydrolysis step, which might be a result of possible inhibition of the enzymes [Both the studies conducted by S\u00f6derstr\u00f6m  enzymes . AnotherThe optimum CS range in our study was 2.85 to 3.64 for DAH, and 3.02 to 3.17 for the pretreatment and subsequent EH in terms of solubilized hexoses. The overlapping CS ranges open up opportunities for facility design. First a DAH process should be established, and in cases where additional EH is found to be more economical, the process can be extended with slight modifications of the earlier DAH conditions; we believe that this should increase the hexose sugar yield 34% to 55% of the total C6 sugar available.Samples hydrolyzed with a reactor control strategy that requires more time to reach the set reaction temperature, but avoids overshooting Table ., corresThree samples were enzymatically hydrolyzed with the modified setup. Although the initial sugar concentration was high, the increase due to EH was low, indicating a high conversion rate of cellulose to glucose during DAH. For example, at a CS of 3.51, approximately 29.5% more hexose sugars were available after EH, whereas at a CS of 3.50, with the previous reactor configuration, the hexose sugar yield due to EH increased by 35%.DAH with either single or dual temperature levels was investigated at varying temperatures and reaction times. The analysis of the experimental data led to the conclusion that the difference in performance between single- and dual-temperature DAH was minimal. Based on the defined CS both types of temperature profiles resulted in equivalent performances with respect to inhibitor levels and sugar yields. To estimate the remaining sugar potential, EH was conducted on selected samples. Again, single- and dual-temperature profiles gave comparable outcomes.The obtained results were compared with counterparts from DAH, two-step DAH and a two-step pretreatment followed by EH. The glucose yield was found to be higher than in DAH but lower than in the two-step DAH and the two-step pretreatment followed by EH. EH was much more efficient in DAH, two-step DAH and two-step pretreatment processes compared with single- or dual-temperature process. A possible explanation for this discrepancy could be a higher degree of inhibitor formation compared with the two-step pretreatment or EH of the native slurry used instead of the washed material used in the other studies.The procedure described in this paper requires fewer utilities (mainly process steam) and less equipment due to a shorter residence time and no washing step as demanded by the two-step pretreatment. However, the performance was inferior to that found in a study conducted by S\u00f6derstr\u00f6m, who found higher yields and lower levels of inhibitors.When increasing the temperature from one level to the next, the mesh inside the chamber had a beneficial effect, facilitating a faster heat distribution because the already partly degraded material was not clumped together at the bottom. With increasing reactor size, there is less heat loss per kg of material because the volume to surface ratio is improved. This should be considered when scaling up the process, because a drier hydrolysate has different, but not necessarily better, characteristics.Changing the reactor heating settings resulted in higher yields of glucose and total hexoses after DAH, thus increasing the robustness range of the process. Additional EH had reduced potential because less cellulose was available in the slurry. This indicates a promising pathway for future improvements. Further work is needed to confirm the enhancements on sugar yields after DAH.Although the established data did not clearly show a means of process improvement for the pretreatment with two temperature levels, a different temperature profile , changed chamber settings, or an alternative substrate might have a positive effect on the process performance, enabling it to approach the performance obtained by the two-step pretreatment.The authors declare that they have no competing interestsPB carried out the DAH, and EH experiments, performed the analysis and drafted the manuscript. OW conceived the study, and designed the reactor and control system. EJ carried out the EH experiments and analysis. MG designed the reactor and control system, and performed analysis. GZ conceived the study. All authors took part in planning the study, checking the results and writing the manuscript."}
+{"text": "Drosophila melanogaster Forkhead box type O (dFoxO) transcription factor is required for adult survival during fasting, and that the 5\u2032UTR of dfoxO has the ability to initiate IRES-mediated translation in cell culture. Previous work has shown that insulin negatively regulates dFoxO through AKT-mediated phosphorylation while dFoxO itself induces transcription of the insulin receptor dInR, which also harbors IRES. Here we report that IRES-mediated translation of both dFoxO and dInR is activated in fasted Drosophila S2 cells at a time when cap-dependent translation is reduced. IRES mediated translation of dFoxO and dInR may be essential to ensure function and sensitivity of the insulin signaling pathway during fasting.One way animals may cope with nutrient deprivation is to broadly repress translation by inhibiting 5\u2032-cap initiation. However, under these conditions specific proteins remain essential to survival during fasting. Such peptides may be translated through initiation at 5\u2032UTR Internal Ribosome Entry Sites (IRES). Here we show that the  Changes in nutrient availability produce contrasting physiological states of fasting and feeding. This variation in nutrition is managed at both cellular and systemic levels. One cellular response is to repress the overall level of 5\u2032cap-initiated translation http://ifr31w3.toulouse.inserm.fr/iresdatabase/]. The function of IRES in these cellular mRNAs has remained elusive, but their distribution among gene types suggests that IRES-dependent translation allows physiological adaptation to stress When deprived of glucose, yeast cells appear to maintain some proteins by translation initiation at Internal Ribosomal Entry Sites (IRES) within the 5\u2032 UTR Drosophila melanogaster have identified IRES, including the insulin-like receptor dInRdInR4E-BPdInR suggests that this signaling pathway functions as a homeostatic feedback network. It will increase insulin sensitivity by increasing receptor abundance in cells of peripheral tissues when circulating nutrients are low, and decrease insulin sensitivity when nutrients are high.Several genes of the fly dfoxO mRNA. We find that the 5\u2032UTR of dfoxO has the ability to initiate IRES-mediated translation, and that dfoxO-IRES translation is active when fasting decreases cap-dependent translation. Furthermore, translation is also initiated at the IRES of dInR in fasting cells. Cap-independent translational control of dFoxO and of dInR may be a molecular mechanism that allows fasting cells to acquire an insulin-sensitive state and thus adapt the cells to respond rapidly to re-feeding.Here we investigate the role IRES play in the maintenance of the insulin signal transduction pathway during fasting. We show that during fasting, when general levels of translation are reduced, the relative abundance of dFoxO protein increases, and that this increase occurs without changing the level of dfoxO reduces the capacity to survive upon amino acid depleted diet dfoxO null flies were insensitive to starvation when measured on the scale of days dfoxO during fasting, we studied the survival time of various homozygous null dfoxO flies maintained on media without yeast and sugar. The survival time of null homozygotes (21/21dfoxO) but not of heterozygotes (21/+dfoxO) was reduced by 50% on the nutrient depleted media  and (dInR) (dfoxO 5\u2032UTR-B inserted in forward orientation were similar in size to those with the dfoxO 5\u2032UTR-B in reverse orientation (The level of dFoxO protein may be preserved in fasted cells if IRES mediated translation is active when cap-dependent translation is repressed. To study entation . The effd (dInR) . Northerentation .dfoxO 5\u2032UTR inserted in the di-cistronic renilla/firefly construct (We starved Drosophila S2 cells transfected with onstruct . S2 celldfoxO-IRES-mediated translation (firefly) relative to cap-dependent translation (renilla)  . The incconstant . To testncreased  in fastencreased .FoxO protein is tightly regulated by post-translational modifications including phosphorylation, ubiquitination and acetylation. These regulate its sub-cellular localization, protein stability, DNA binding properties and transcriptional activity dfoxO IRES dependent translation remains unchanged. This finding suggests that the regulation of dFoxO translation by IRES may help retain essential cellular functions during Drosophila fasting.IRES mediated translation provides yeast cells with proteins needed to cope with starvation dFoxO is required for optimal survival during fasting and dFoxO protein remains constant when the level of total protein decreases in nutrient deprived flies. Based on analysis with S2 cells, this retention of dFoxO protein may in part be explained by IRES mediated translation when cap-dependent translation is otherwise depressed. Previous work has shown that dFoxO protein is dephosphorylated and active in nutrient deprived S2 cells dfoxO mutants 21dfoxO and w24dfoxO are described in 21dfoxO original stock is homozygote lethal but dfoxO null mutants are homozygous viable 21dfoxO with yw to eliminate second site mutations and generate homozygous viable lines. Afterward, 2dfoxO1 and w24dfoxO stocks were backcrossed to yw for four generations. In all trials yw were used as controls. To assess survival in fasting adults, newly eclosed adult flies were collected within 24 hour. Adults were aged for 4 days under controlled conditions  on normal media . At the age of 5 days, 10 females per vial and 10 vials per genotype were transfered into media for fasting (0.8% agarose w/v in PBS). Dead flies were scored in each vial at 6 hour intervals. Differences among survivorship were assessed by the log rank test The Lysates were generated separately from decapitated bodies of 120 two to four day-old females. Prior to analysis flies were maintained on normal diet or fasting diet for 48 hours. Cytoplasmic and nuclear extracts were prepared from lysed tissues by using the Active Motif Nuclear Extract Kit . Total protein concentration was determined using the BCA Protein Assay Kit  following the manufacturers' protocols. For Western blot analysis, 4 \u00b5g of total protein per lane were separated using NuPAGE 4\u201312% Bis-Tris Gel  and electrotransferred to PVDF membrane. Fasted and fed samples were loaded in the same gel. 3 different gels were blotted independently for dFoxO, Lamin and Hsp90. Each membrane was exposed at different times dependently on the antibody- specific antigen recognition.Antibodies were guinea pig anti-dFoxO , mouse anti-Lamin DMO , and rabbit anti-Hsp90 . Following blotting, the PVDF membranes were stained with Coomassie to verify that equal amounts of protein were transferred. Each experiment was repeated twice.yw females that had previously been maintained on a normal or fasting diet for 48 hours. For qPCR, three technical replicates were generated per biological sample. dfoxO mRNA was amplified by the primer pair caatctcgagtgcaatgtcgagga (forward) and ccctgagcatcagcaacattagca (reverse) using Superscript III Platinum SYBR Green One-Step qRT-PCR with ROX  on an ABI 7300 System and standardized against the RPL32 mRNA .cDNA was prepared from 25 decapitated bodies from each of three biological samples. Each sample used six to eight day-old dfoxO transcript are described in www.flybase.org (Schematic representation in dfoxO was amplified with the primers aaccatggctagaaagcagttaacgagtagtc (forward) and tttttccatggggtagaaaagttcgttgtgcagt (reverse) from clones LD14524, LD19191 and LD05569 (Berkeley Drosophila Genome Project) respectively. The amplified fragment was subcloned into pNEX3-eCFP \u2013eYFP (provided by John R. Dyer and Wayne S. Sossin acgcggaattcatggtgagcaagggcgaggagctg (forward) and ttgggcccggtaccttacttgtacagctcgtccatgccg (reverse), and subsequently subcloned into the pAc5.1/V5-HisA vector (Invitrogen) using the EcoRI (5\u2032) and ApaI (3\u2032) sites. To clone this dfoxO 5\u2032UTR into the renilla/firefly di-cistronic construct, the 5\u2032UTR was amplified as before and cloned into the pMARL vector 5\u2032UTR sequences of the Renilla-InR-5\u2032UTR-firefly and renilla-Antennapedia-5\u2032UTR-firefly constructs were kindly provided by Michael Marr and Robert Tjian The di-cistronic constructs were transfected into Drosophila S2 cells in serum free media Express Five\u00ae SFM (Invitrogen) using Effectene Transfection Reagent  following the manufacturer's instructions. Images  were collected using a Leica TCS SP2 AOBS Confocal Laser Scanning Microscope, 48 hours post-transfection. Samples were mounted in ProLong\u00ae Gold antifade reagents . Fluorescence was analyzed using the Leica Confocal Software Lite Version. Luciferase activity was measured by using the Dual-Glo\u2122 Luciferase Assay System (Promega) with a SpectraMax M5 microplate reader and SoftMax Pro 4.8. software  following the manufacturer's instructions. For starvation assays, 48 hours post-transfection, an equal number of cells from a transfection event were transferred to 1\u00d7 PBS or media for one hour, and measured for luciferase activity. Three technical replicates were used per treatment. Each transfection was repeated three times. The experiment was repeated twice.32P-labelled probe was synthesized by random primer using the DECAprime\u2122 II kit from Ambiom  following the manufacturer's instructions.Transfections were performed as described above. RNA was extracted with TRIzol\u00ae Reagent following the manufacturer's instructions . Northern blots were conducted with the NorthernMax\u00ae Kit following manufacturer's instructions . Purified RNA (15 \u00b5g per lane) was electrophoresed, blotted onto a nylon membrane and probed for firefly luciferase. Data are shown as the mean and standard deviation. An unpaired t-test was used for all comparisons. Differences were considered significant at p<0.05. Differences among survivorship were assessed by the log rank test"}
+{"text": "Interventional medical devices based on thermally responsive shape memory polymer (SMP) are under development to treat stroke victims. The goals of these catheter-delivered devices include re-establishing blood flow in occluded arteries and preventing aneurysm rupture. Because these devices alter the hemodynamics and dissipate thermal energy during the therapeutic procedure, a first step in the device development process is to investigate fluid velocity and temperature changes following device deployment.in vitro vascular model. Magnetic resonance imaging (MRI) techniques were used to assess the fluid dynamics and thermal changes associated with device deployment.A laser-heated SMP foam device was deployed in a simplified Spatial maps of the steady-state fluid velocity and temperature change inside and outside the laser-heated SMP foam device were acquired.Though non-physiological conditions were used in this initial study, the utility of MRI in the development of a thermally-activated SMP foam device has been demonstrated. The basis for the shape memory effect has been previously described in detail . Althoug 107 Pa)  as the p 107 Pa) .Encouraged by the shape memory behavior and biocompatibility ,6, many g of the SMP is above body temperature (37\u00b0C), an external heating mechanism such as laser  [in vitro model. Though the results of such an investigation do not necessarily provide a direct assessment of the physiological impact in an actual clinical procedure, they may be used to modify device properties , adjust heating parameters , and validate computational models which can be extended to simulate physiological conditions.When the Tthermal) ,14 or elthermal) ,14 heatiThe non-invasive methods of nuclear magnetic resonance (NMR) and magnetic resonance imaging (MRI) have been extensively used for chemical, material, biological, and medical applications. In MRI methods, a magnetic field gradient is used in conjunction with an NMR experiment to spatially encode spectral signatures based on numerous contrast parameters. These signatures may include structure , dynamics (relaxation times), or velocity (diffusion and flow). Spatial maps of fluid flow and temperature obtained by MRI can provide insight into the impact of the intervention.Our team has previously reported the use of various tools to study the fluid and thermal dynamics associated with the deployment of SMP devices under development. These tools include computational fluid dynamics models , flow vig of ~45\u00b0C, dye concentration of ~900 ppm (absorption coefficient ~10 cm-1), density of 0.020 g/cc, cell size of ~200-300 \u03bcm, and calculated volumetric void fraction of 98.4%, allowing for a theoretical volume expansibility from a fully collapsed state of 60\u00d7. Different foam properties, including Tg, may be achieved by adjusting the chemical composition.The chemically blown foam was based on SMP developed at Lawrence Livermore National Laboratory (LLNL) comprised of hexamethylene diisocyanate, N, N, N', N'-tetrakis(2-hydroxypropyl)ethylenediamine, and triethanolamine . Dye . Heating near Tg will induce shape recovery (expansion). In the case of SMP foams, the transition from the secondary to the primary shape is not sharp like a crystalline melting point; the elastic modulus falls gradually over a span of ~30\u00b0C with the nominal Tg approximately centered in the decline.A key property of the SMPs is their ability to maintain a secondary shape that is different than the original primary shape. The secondary shape is obtained by reforming the SMP while heated above Tin vitro [The SMP foam device used in this study was made specifically for use in the straight tube geometry, and does not necessarily represent a clinically-relevant design. Unlike the spherically shaped devices used previously to demonstrate the concept of aneurysm occlusion in vitro , the foain vitro ) and colg~81\u00b0C) was cast in a teflon tube (inner diameter = 300 \u03bcm) over a 100-\u03bcm-core cleaved optical fiber. The resulting SMP rod was then media blasted with 100-\u03bcm sodium bicarbonate particles to create a diffusing surface. A ST connector was added to the proximal end of the optical fiber for coupling to the laser light source, an 810-nm continuous-wave diode laser pigtailed into a 100-\u03bcm-core silica optical fiber . Nearly 90% of the light was emitted radially, with the remaining light emerging from the distal end of the diffuser. The SMP formulation was specifically designed to be optically transparent at the laser wavelength (absorption coefficient = 0.01 cm-1 at 810 nm).To fabricate the diffusing fiber, LLNL SMP  of MRI contrast agent  so that faster repetition time (TR) could be used, which shortens the experimental scan time. Images of the area occupied by the foam were acquired using a spin echo imaging sequence with a field of view (FOV) of 2 \u00d7 2 cm, imaging matrix of 128 \u00d7 128 (156 \u00d7 156 \u03bcm pixel resolution), TR of 400 ms, echo time (TE) of 7 ms, and an experiment acquisition time of 51 s. Fluid flow was turned off to acquire these images.t = 7 ms, \u03b4 = 1 ms, and g = 0 and 5 mT/m, where \u0394t is the time between the two motion encoding gradients, \u03b4 is the duration of the motion encoding gradients, and g is the strength of the gradients. The resulting scan time was 2 min and 8 s. After subtracting the phase images from the two different g values, the phase difference, \u0394\u03c6, was converted to velocity, V, using the formula V = \u0394\u03c6/(\u03b4\u0394t\u03b3g), where \u03b3 is the gyromagnetic ratio for protons (42.58 MHz/T) [Fluid flow images, depicting the three-dimensional velocity patterns, were acquired using a diffusion weighted, spin echo, phase encoding sequence. Four slices were acquired for each scan with a thickness of 2 mm and FOV = 0.5 \u00d7 0.5 cm, imaging matrix = 128 \u00d7 128 (39 \u00d7 39 \u03bcm pixel resolution), TR = 400 ms, and TE = 15.2 ms. For flow encoding, the following parameter values were used: \u03948 MHz/T) . In orde1), determining the diffusion constant over a specific region, or through the proton resonance frequency (PRF). The PRF method for determining temperature with MRI is the method of choice because it is independent of tissue composition, unlike measuring temperature with MRI techniques, such as spin-lattice relaxation time and the diffusion times, which are dependent on tissue composition. PRF utilizes the average hydrogen bond strength and can be determined from the phase in gradient echo strength, which is based on the chemical shift properties. The chemical shift is the separation of resonance frequencies from an arbitrary chosen resonance frequency and is caused by the shielding effects of the electronic environment of the nucleus. This means that nuclei in different chemical environments give rise to MRI signals at different frequencies. Since the chemical shift depends on temperature, changes in the strength of hydrogen bonding causes changes in chemical shifts, which can be used to measure changes in temperature. For these reasons, we used a gradient echo sequence. The gradient echo sequence was optimized by maximizing TE, TR, and gradient properties.There exist several methods of measuring the temperature with MRI, including observing changes in spin-lattice relaxation , where \u03b1 is the thermal coefficient (0.01 ppm/\u00b0C in water), B0 is the magnetic field strength, and TE is the echo time of the experiment [A gradient echo, phase encoding pulse sequence was employed to obtain spatial temperature maps. Acquisition parameters of TR = 90 ms, TE = 10 ms, and flip angle = 45\u00b0 were used. Two slices were acquired during each 46-s scan with a FOV = 1 \u00d7 1 cm, imaging matrix = 128 \u00d7 128 (78 \u00d7 78 \u03bcm pixel resolution), and a slice thickness of 2 mm. Temperature maps were obtained from the phase difference between an image at a reference temperature and an image with laser heating, with fluid flow turned on for both. The relationship between phase difference, \u0394periment -21. TempSteady-state x, y, and z components of the fluid velocity  were acquired immediately proximal, inside, and distal to the expanded SMP foam. Steady-state fluid temperature images were acquired immediately proximal to and inside the expanded SMP foam. Only measurements of the fluid were made; the MRI technique is not sensitive to temperature changes of the silicone tubing, SMP, or silica optical fiber. Due to the relatively long scan time (~2 min), no images were acquired during the initial laser-induced expansion of the SMP foam. While it may be possible to slightly increase the temporal resolution, the MRI system is not capable of imaging the continuously changing flow and temperature profiles as the foam expands.Steady-state fluid velocity images immediately proximal to and inside the expanded SMP foam are shown in Fig. Steady-state fluid temperature images at laser powers from 0 to 7 W immediately proximal to and inside the expanded SMP foam are shown in Fig. in vitro model was not intended to accurately represent actual physiological conditions. Consequently, the measured values are not necessarily expected to represent those encountered in a clinical scenario. However, under certain conditions the data may be somewhat relevant. For example, an actual clinical device could include a baffle or other means of temporarily reducing the flow  to facilitate thermal actuation of the SMP foam [Given the sub-physiological fluid flow rate (blood flow in the basilar artery is ~70-170 ml/min during the cardiac cycle ), non-puSMP foam , in whicin vitro model. In this case, fluid velocity and temperature at several laser powers under a steady flow condition were acquired non-invasively. This type of experiment can be used to enhance the device design and deployment parameters without necessarily providing clinically relevant measurements. For example, experiments performed using devices with different foam densities would provide a means of elucidating the impact of foam density on the flow and temperature. Similarly, the thermal impact of different dye concentrations in the foam can also be quantified. By repeating the experiments at different flow rates, the effect of flow rate on the temperature can be gauged; this is important, for example, for evaluating methods of temporarily reducing the flow  to facilitate thermal actuation. The information provided can be used to refine the device and deployment parameters for subsequent testing under more clinically relevant conditions. In addition, since the experimental data is free from perturbation by invasive probes, it is particularly well-suited for development or validation of computational models of fluid and thermal dynamics.The primary objective of this study was to illustrate the use of MRI as a tool in the preliminary stage of SMP foam device development using a simplified Even with the limitations of steady-state measurements of flow velocity and temperature, the results were our first snapshot of the environment in the foam. The thermal result of reaching a maximum temperature change of 4\u00b0C at 7 W is not a surprise. We have previously described that, using simulations , flowingin vitro model were acquired using MRI techniques. Despite the relatively low temporal resolution  which prevented image acquisition during laser-induced expansion of the foam, the post-expansion images contain useful information from a device development standpoint, potentially enabling quantitative comparison of different device designs. The non-invasive nature of MRI allowed measurement of the temperature rise and flow without introducing probes that perturb the system; this feature is particularly useful for comparison to computational models. Though non-physiological conditions were used in this initial study, the utility of MRI in the development of a thermally-activated SMP foam device has been demonstrated.Spatial maps of the steady-state fluid velocity and temperature change inside and outside a laser-heated SMP foam device in a simplified The authors declare that they have no competing interests.WS participated in the fabrication of the device, design and execution of the experiment, and writing of the manuscript. EG and JLH participated in the design and execution of the experiment and writing of the manuscript. TSW participated in the fabrication of the device. DJM participated in the design and supervision of the study. All authors read and approved the final manuscript."}
+{"text": "PLoS Biology. Humans, like all mammals (as well as birds), are \u201cwarm-blooded,\u201d or more correctly \u201chomeothermic,\u201d meaning we maintain our core body organs at a constant temperature. We expend considerable energy to do so, and may die when we cannot. In contrast, crabs, cod, caterpillars, and the like are \u201ccold-blooded,\u201d or \u201cpoikilothermic,\u201d with body temperatures that change with the environment they are in. When the mercury plunges, a poikilotherm, and everything that happens within it, merely slows down.At the most basic level, all those things happening within the poikilotherm are chemical reactions, and it is their precise coordination that allows the organism to keep on living. But chemists have long known that reactions differ in the degree to which they will speed up and slow down in response to temperature changes. So here is the problem the crab has that we do not: how does it make sure that processes relevant to a given behavior remain coordinated across a wide range of temperatures?Cancer borealis, a North Atlantic crab that flourishes in intertidal and subtidal ecosystems where the water temperature may swing as much as 15\u00b0C in a day and more than 20\u00b0C between winter and summer. Chewing and filtering of food is driven by a rhythmic motor pattern maintained by the coordinated firing of a small network of neurons. The neurons fire in a specific sequence with time lags between them. To maintain effective chewing and filtering, those temporal relationships should remain the same\u2014that is, they must remain \u201cin phase\u201d with each other, even if the overall frequency of firing changes with temperature.Lamont Tang, Eve Marder, and colleagues set out to answer this question for a group of neurons in 10\u201d. A reaction that doubles its rate with a 10-degree rise in temperature has a Q10 of 2, while one that changes not at all has a Q10 of 1. Thus, while the frequency had a Q10 of 2.3, the phase relationships had a Q10 of 1, displaying almost perfect \u201ctemperature compensation.\u201dThe authors began by confirming that this was so, showing that while the firing frequency increased almost four-fold between 7\u00b0C and 23\u00b0C, the phase relationships were unaltered. In the language of the physical chemist, a system's responsiveness to a temperature change is known as its \u201cQ10.They next asked what features of the system might account for this temperature compensation. Whether a neuron fires is determined by multiple physical properties, including the current flow through its ion channels, each of which has its own response to temperature change. Two kinds of these, called the transient outward current and the hyperpolarization-activated inward current, oppose each other, and the authors found that each had a high Q10 of the membrane currents was set to 1, but the phase was largely maintained when they substituted the experimentally measured Q10's from the two opposing currents.Turning to computer models of neuronal firing, they demonstrated that not all model neurons were able to adjust to temperature changes while maintaining an appropriate firing pattern. In a model of one of the crab's neurons, they found that temperature change altered the phase of the neuron when the QThis is no coincidence, the authors argue. Like all poikilotherms, the crab is subject to strong selective pressure in an environment where temperatures fluctuate, and selection of membrane ensembles that maintain neuronal firing integrity in the face of wide temperature swings is likely to be strongly favored. These exact results may not be found in other cold-blooded creatures, since the precise composition of their neuronal membranes may differ. But since both a crab and a cod must solve the same problem in the cold Atlantic waters, they may be more similar at the cellular level than they appear to be on your plate.Tang LS, Goeritz M, Caplan JS, Taylor AL, Fisek M, et al. (2010) Precise Temperature Compensation of Phase in a Rhythmic Motor Pattern. doi:10.1371/journal.pbio.1000469"}
+{"text": "To investigate heating during postimplantation localization of intracranial electroencephalograph (EEG) electrodes by MRI.A phantom patient with a realistic arrangement of electrodes was used to simulate tissue heating during MRI. Measurements were performed using 1.5 Tesla (T) and 3T MRI scanners, using head- and body-transmit RF-coils. Two electrode-lead configurations were assessed: a \u201cstandard\u201d condition with external electrode-leads physically separated and a \u201cfault\u201d condition with all lead terminations electrically shorted.Using a head-transmit\u2013receive coil and a 2.4 W/kg head-average specific absorption rate (SAR) sequence, at 1.5T the maximum temperature change remained within safe limits (<1\u00b0C). Under \u201cstandard\u201d conditions, we observed greater heating (\u22642.0\u00b0C) at 3T on one system and similar heating (<1\u00b0C) on a second, compared with the 1.5T system. In all cases these temperature maxima occurred at the grid electrode. In the \u201cfault\u201d condition, larger temperature increases were observed at both field strengths, particularly for the depth electrodes. Conversely, with a body-transmit coil at 3T significant heating (+6.4\u00b0C) was observed  at the grid electrode under \u201cstandard\u201d conditions, substantially exceeding safe limits. These temperature increases neglect perfusion, a major source of heat dissipation in vivo.MRI for intracranial electrode localization can be performed safely at both 1.5T and 3T provided a head-transmit coil is used, electrode leads are separated, and scanner-reported SARs are limited as determined in advance for specific scanner models, RF coils and implant arrangements. Neglecting these restrictions may result in tissue injury. J. Magn. Reson. Imaging 2008;28:1233\u20131244. \u00a9 2008 Wiley-Liss, Inc. MRI IS USEFUL for postimplantation localization of intracranial electroencephalograph (EEG) electrodes in epilepsy patients as it allows good visualization of implant positions in relation to neuroanatomy and avoids the ionizing radiation dose associated with computed tomography (CT) imaging.Implantation procedures can often involve a combination of electrodes of different types, namely subdural grid, strip, and depth electrodes. Strip electrodes consist of a set of disk-shaped electrode contacts imbedded in a silicon sheet that record electrical signals from the cortical surface, while grid electrodes are simply a set of strip electrodes joined together to record EEG signals from a larger area. Depth electrodes are thin rods with cylindrical contacts that penetrate cerebral tissue and can record directly from deep brain structures. Signals from the electrode arrays are recorded by means of several multi-channel flexible connecting leads, referred to herein as \u201ctails.\u201dAs for the case of recording scalp EEG during MRI , there aWhile some intracranial electrodes designed for use in epilepsy monitoring are thought safe for MRI procedures \u20136, and oWhile preliminary in vitro safety testing has also been performed ,7, theseWe, therefore, investigated MRI induced heating at 1.5 and 3T in a tissue-simulating test object containing a combination of depth, grid and strip electrodes aiming to replicate a realistic arrangement involving multiple implants. We additionally tested the effects of bilateral depth electrodes unintentionally coming into contact within the tissue, and the effects of electrical contact (short circuit) between the external electrode tails to simulate a worst case \u201cfault\u201d condition. We also considered the choice of head-only or whole-body MRI RF-transmit coil, because MRI systems using the latter are increasingly common.A Perspex phantom, similar to that described in Finelli et al ,16, was The specific electrodes tested were those commonly used at our own and many other institutions for intracranial EEG monitoring in patients with epilepsy. The depth electrodes  consist of Platinum contacts of 2.3-mm length with a radius of 1 mm, with nickel\u2013chromium wires in polyurethane tubing leading to nickel\u2013chromium tail contacts. There are a range of electrodes available which vary in terms of numbers of contacts and their separation. The electrodes used here were 1xSD-8PX , 2xSD-6PX . Grid and strip electrodes  have 4-mm diameter PtIr disks (2.3 mm exposed) within a silicon sheet with stainless steel (316) wires and nickel\u2013chromium tail contacts contained within polyurethane tubing. The strip used here was a T-WS-6PX , the grid was a T-WS-48PX .For all the experiments, 3 depth electrodes, 1 subdural grid, and 1 strip electrode were positioned within the head phantom  physically separated such that the terminations were an \u201copen circuit\u201d, as per the manufacturer's recommendation Fig. c, to simContinuous temperature measurements were made simultaneously from 4 positions using an MRI-compatible fluoroptic thermometer  at a rate of 0.5 Hz. A period from 1 min before to 4 min after the 6-min duration scan was used to determine maximum temperature changes. The tips of electrodes are generally considered the locations most likely to demonstrate the largest temperature change ,18. To fAll MRI sequence SAR values given below are those reported by the software of the particular system at scan time with an entered patient weight of 50 Kg. The limitations and implications of this approach are addressed in the discussion section.Measurements were performed in a 1.5T GE Signa MRI system  with the standard transmit\u2013receive birdcage head coil. A 6-min fast spin-echo (FSE) acquisition with a SAR value of 2.4 W/Kg (head average) was used to elicit the highest temperature changes likely in a structural imaging study. Sequence details were as follows: repetition time (TR) 4660 ms; echo time (TE) 104.4 ms; bandwidth (BW) 31.2 kHz; field of view (FOV) 24 \u00d7 18 cm; matrix 256 \u00d7 224; echo-train length (ETL) 24; 25 slices; slice thickness (ST) 5 mm; slice separation (SS) 1 mm; 8 averages. The temperature probes were sited at the following locations: the most distal (contact #1) and middle (contact #4) contacts of the 8-contact depth electrode on the LHS, the corner of the grid (contact #48) and at a reference position within the neck region of the phantom away from all electrodes  on the opposite side to the part of the electrode-contacts which were touching. The other two sensors remained at the grid corner (contact #48) and at a reference position within the neck region.Measurements were performed in a GE 3T Excite system (software level 12_M4) using the standard transmit\u2013receive birdcage head coil provided. A 6-min FSE acquisition with a SAR of 2.5 W/Kg (head-coil average), similar to that used at 1.5T, was used. Sequence details were as follows: TR 6000; TE 102; BW 31.5 kHz; FOV 22 \u00d7 22; matrix 512 \u00d7 256; 17 slices; ST 5 mm; SS 1.5 mm; averages 2. Again temperatures were recorded continuously during acquisition; in this case, only the \u201cnormal\u201d intracranial electrode arrangement was investigated. Temperature probes were sited at the following positions: the most distal (contact #1) and middle (contact #4) contact of the 8-contact depth electrode on the LHS, the corner of the grid (contact #48) and at a reference position within the neck region of the phantom away from all electrodes  using, first, a transmit\u2013receive birdcage head coil , and second, the manufacturer-supplied body-transmit coil together with the posterior half of a 12-element head-receive coil for signal reception. A high-SAR, 6-min FSE imaging sequence similar to that used with the GE systems was used. Sequence details were as follows: TR 6000 ms; TE 106 ms; BW 81.9 kHz; FOV 20 \u00d7 20 cm; 20% PE oversampling; matrix 512 \u00d7 410; 13\u201318 slices; ST 3 mm; SS 0.3 mm; NEX 2, ETL (Turbo factor) 17. This gave reported SARs of 2.4 W/Kg head-average for the head coil and 1.2 W/Kg exposed volume-average for the body coil with an identically prescribed protocol. One additional measurement was performed with the body coil in which SAR was maximized by using the maximum permitted number of slices within the TR together with an additional magnetization-transfer pulse achieving an exposed body-average SAR of 2.0 W/Kg with the body coil.In contradistinction to the GE MRI systems, which apparently estimate SARs solely based on the patient weight entered at the console, the Siemens system SAR estimation incorporates a measurement of patient-specific coil loading. Consequently it was found that the SAR values reported by the Siemens system software were quite dependant on the exact phantom position and electrode configuration. For consistency, for each head-coil measurement the number of slices was varied (between 13 and 18) to achieve a reported head-average SAR of 2.4 \u00b1 0.1 W/Kg.Again temperatures were recorded continuously during acquisition, in this case only the \u201cnormal\u201d intracranial electrode arrangement being investigated and were sited at the following locations: the most distal contact #1) and middle (contact #4) contacts of the 8-contact depth electrode on the LHS, the corner of the grid (contact #48) and at a reference position within the neck region of the phantom away from all electrodes  was examined by running the FSE sequence (exposed body-average SAR 1.2 W/Kg) with the landmark centered on the 8-contact depth electrode and subsequently with offsets of \u00b1100 mm along the scanner bore. These measurements were performed with the body-transmit coil and the electrode-tails bundled together in electrical contact. Temperature measurement locations were the most distal (contact #1) and middle (contact #4) contacts of the 8-contact depth electrode on the LHS, the corner of the grid (contact #48) and at a reference position within the neck region of the phantom away from all electrodes  witIn all cases with more than one temperature sensor on an implant, the values from the site of greatest temperature change are reported.The results of conducting the same experiment 5 times on separate days, requiring the phantom, temperature probes and electrodes to be repositioned relative to each other and the scanner are shown in Table With the electrode tails separated, the maximum \u0394T at all measurement points was always < 1\u00b0C Table a,b. The Very similar results to those above were obtained for the second configuration of the depth electrodes where the electrode tips were in direct contact within the gel (compare 1.5T results in Table The grid electrode was the site of greatest temperature increase +2.0\u00b0C) in the open circuit tail configuration  occurred at the grid electrode when the electrode tails were separated  occurred with the grid arranged horizontally near the gel surface   and exceMaximum \u0394T were highly reproducible with the electrode tails separated . However, other configurations led to temperature increases which exceed safety limits: Electrically short-circuiting the electrode tail terminations produced greater temperature increases, up to +3.0\u00b0C for the depth electrode in the fourth reproducibility measurement. Conversely, shorting opposing contra lateral depth electrode contacts within the gel did not significant alter \u0394T at 1.5T, which is attributable to the electrodes being effectively connected through the tissue simulating gel even when not in direct physical contact.The subdural grid electrodes demonstrated \u0394T of up to +0.7\u00b0C even in the open-circuit tail configuration suggesting that they are more strongly coupled to the RF field during \u201cstandard operation,\u201d and, therefore, with a head-transmit RF coil, they present the greatest risk of excessive heating.Whereas the overall temperature increases observed at 1.5T may be considered modest, it remains prudent to minimize the risk of excessive heating beyond safety guidelines due to unforeseen experimental circumstances by restricting the scanner-reported SAR of the MRI sequences used, by using a head-transmit coil only, and by rigorously maintaining the separation of the electrode tails as in Figure Although overall heating was greater for the 3T GE scanner than for the 1.5T GE system, the pattern was very similar, with the greatest \u0394T occurring with the tails shorted. In a pilot study with this \u201cfault\u201d condition, where a higher SAR sequence (3.8 W/Kg coil average) was used, heating to +6.9\u00b0C was recorded. It is, therefore, clear that without proper precautions potentially injurious \u0394T may occur. In the open-circuit tail configuration, the grid electrode was again the site of greatest \u0394T (+2.0\u00b0C). With this scanner it was possible to elicit \u0394T above the guidelines with both electrode tail configurations: to ensure patient safety in this case scanner-reported SAR should be limited to significantly less than 2.5 W/kg head-average.Temperature increases were less than for the 3T GE system but again the pattern was similar, with the greatest \u0394T, sufficient to exceed safety guidelines, occurring with the tails shorted. The grid electrode was again the site of greatest temperature increase (+0.9\u00b0C) with the open circuit tail configuration.Whereas the overall temperature increases observed with this scanner may also be considered modest in the specific case of using a head-transmit coil, the risk of tissue heating beyond safety guidelines due to unanticipated events may again be reduced by minimizing SAR and maintaining the electrical isolation of the electrode tails.For the Siemens 3T body-transmit coil, the greatest \u0394T (+6.4\u00b0C) occurred at the grid electrode when the electrode tails were separated, that is, under standard operating conditions. This level of heating far exceeds guidelines and approaches the level at which permanent tissue-damage could occur rapidly. Furthermore, with this coil it would be theoretically possible to prescribe scans with significantly greater SAR causing even higher \u0394T. Markedly lower temperature increases (+0.7\u00b0C) were observed at the depth electrode, but again this was obtained with the electrode tails separated. Shorting the electrodes tails resulted in lower \u0394T at all measurement points.These results suggest that when the entire length of the electrodes (including the tails) lies within the RF field, as occurs when using the body-transmit coil, interactions resulting in greater heating may occur. This is possibly due to a larger effective cross-sectional area of the circuit exposed to the body coil's RF field in the open circuit compared with that with the shorted-tail configuration. Also, due to the geometry of the head receive-only coil Fig. e used inWith the body-transmit coil, the dependence of \u0394T upon landmark position Table  suggesteChanging the position of the grid within the phantom had a significant effect on \u0394T: a fivefold increase in heating was recorded with the grid in a superficial position in the coronal plane compared with the other, sagittal orientations tested. This suggested that significant variations in heating can occur as a function of implant position and, or, orientation. The overall temperature changes in both cases remained modest (maximum +2.0\u00b0C) in these experiments with shorted electrode tails. However, our observations support the argument that either detailed, implant-arrangement specific tests are required, or that a suitable safety margin to account for electrode-orientation dependent variations should be factored in when local safe upper-SAR limits are defined.Our measurements broadly follow the principles of ASTM F 2182-02a , a standWe believe our experimental parameters were such as to provide realistic upper limits for \u0394T: The gel phantom is a conservative model for tissue heating; it is expected that \u0394Ts would be smaller in vivo, because brain temperature is cooled by perfusion ,34; a laThe EEG electrodes were arranged in a configuration typical of surgical procedures performed at our institution. The potential for underestimation of \u0394T due to experimental error was investigated by performing several experiments: a repeated measurement without moving the implant position; a repeated measurement while moving the electrode grid; changing landmark position . We have shown that moving the electrode grid within the test object, and variations in landmark position, did indeed cause changes in \u0394T. Experimenters should be aware that such changes may easily arise as a result of variations in implant positioning between individual patients, or deviations from a standard supine patient position relative to the scanner bore.Potential inaccuracies exist in studies of this type relating to the precise positioning of the temperature-sensing optical-fiber tips . We posiFor the depth electrodes, maximum \u0394Ts were similar at the tip and fourth electrode contact in most experiments with greater variance between the positions when the electrodes were shorted. This finding suggests that significant \u0394Ts are not restricted to the tip electrode contact as might be suggested by simple models ,18. PiloThe heating in excess of safety guidelines reported here was produced using a high SAR FSE sequence prescribed specifically to obtain large \u0394T. Such sequences, used here for experimental purposes, should not be used to image patients with these implants. A 6-min imaging sequence was chosen because it provides sufficient time to acquire most standard structural imaging data sets and corresponds to the duration of the IEC SAR limit . AlthougOur results are consistent with those obtained previously: MRI with a single depth electrode resulted in little measurable heating at 3T ,9,11, asFor the practical purpose of defining an imaging protocol on a specific scanner we locally determine an SAR limit based on the expected temperature changes for specific implantation configuration (see the SAR as a Dosimeter When Implants Are Present section). We include a fivefold safety margin to account for intra-scanner dependent variability in SAR estimation from patient dependent variations in implant position, patient weight, patient position and tissue distribution. This suggests that the expected temperature increase should not exceed +0.2\u00b0C at any location in our experiments. In the \u201cfault condition\u201d the maximum heating should also be limited to <1\u00b0C and the most conservative SAR value used. Taking the example of the experiment performed in this work using the 1.5T GE system, with the head-transmit coil where a maximum temperature increase of +0.7\u00b0C was recorded with a 2.4 W/Kg sequence in the \u201cstandard\u201d condition , or changes in the subject's exact position within the scanner may result in different heating patterns. Therefore, arrangements which substantially differ from these may require further specific safety investigation, as may modifications of the imaging protocol, such as a increasing the scan duration or number of slices. In any case, when setting local SAR limits, it is prudent to allow a conservative safety margin to avoid inter-patient variations in EEG-electrode placement, scan prescriptions or RF coil loading causing excessive tissue heating."}
+{"text": "The DBD also contributes to homo- and heterodimerization of nuclear receptors.NR2E3 (PNR) is an orphan nuclear receptor essential for proper photoreceptor determination and differentiation. In humans, mutations in NR2E3 have been associated with the recessively inherited enhanced short wavelength sensitive (S-) cone syndrome (ESCS) and, more recently, with autosomal dominant retinitis pigmentosa (adRP). NR2E3 acts as a suppressor of the cone generation program in late mitotic retinal progenitor cells. In adult rod photoreceptors, NR2E3 represses cone-specific gene expression and acts in concert with the transcription factors CRX and NRL to activate rod-specific genes. NR2E3 and CRX have been shown to physically interact in vivo situation by Bioluminescence Resonance Energy Transfer (BRET2). NR2E3 wild-type protein formed homodimers in transiently transfected HEK293T cells. NR2E3 homodimerization was impaired in presence of disease-causing mutations in the DBD, except for the p.R76Q and p.R104W mutant proteins. Strikingly, the adRP-linked p.G56R mutant protein interacted with CRX with a similar efficiency to that of NR2E3 wild-type and p.R311Q proteins. In contrast, all other NR2E3 DBD-mutant proteins did not interact with CRX. The p.G56R mutant protein was also more effective in abolishing the potentiation of rhodospin gene transactivation by the NR2E3 wild-type protein. In addition, the p.G56R mutant enhanced the transrepression of the M- and S-opsin promoter, while all other NR2E3 DBD-mutants did not.We analyzed NR2E3 homodimerization and NR2E3/CRX complex formation in an trans may account for the severe clinical phenotype in adRP patients.These results suggest different disease mechanisms in adRP- and ESCS-patients carrying NR2E3 mutations. Titration of CRX by the p.G56R mutant protein acting as a repressor in  NR2E3 (MIM#604485) is a photoreceptor-specific nuclear receptor (PNR) that belongs to the nuclear hormone receptor superfamily of ligand-modulated transcription factors 4 zinc fingers. The C-terminus of the first Cys4 zinc finger comprises the so-called P-box that specifically contacts nucleotides located in the DNA major groove. Three discriminatory amino acids (underlined below) determine DNA binding, EGCKS and EGCKG in NR2 family members and orphan NRs NGCSG sequence in NR2E3 and DGCSG in NR2E1 and NR2E2. The consensus core motif recognized by NR2E proteins appears to be AAGTCA4 zinc finger forms the so-called D-box, which is involved in DBD dimerization and recognition of the spacing between two adjacent core motifs. Third, the flexible D domain, or so-called hinge domain, links the DBD to the ligand-binding domain (LBD) and contains the nuclear localization signal which may overlap on the DBD. Fourth, the C-terminal E/F domain, or LBD, consists of a conserved secondary structure formed by 12 \u03b1-helixes, containing a strong dimerization function and the ligand-dependent AF-2 transactivation function.All nuclear receptors (NRs) share a common structural organization composed of four main domains in vitro DNA binding experiments suggested binding to a direct repeat of the core motif spaced by one nucleotide , the consensus binding site being 5\u2032-(A/G)AG(A/G)TCAAA(A/G)(A/G)TCA-3\u2032The first NRs most likely acted as monomers in a ligand-independent fashion 4 zinc finger of NR2E3 gene was shown to cause autosomal dominant (ad) retinitis pigmentosa (RP) (adRP), termed RP37 (MIM #611131) In humans, mutations in NR2E3 have first been associated with the recessively inherited enhanced short wavelength sensitive (S-) cone syndrome (ESCS) (MIM #268100) 2) rhodopsin, S- and M-opsin promoter reporter constructs. These analyses showed a distinct in vivo protein-protein interaction of the adRP-linked p.G56R mutant protein with CRX, comparable to that of wild-type NR2E3, but contrasting with the other ESCS-linked DBD mutants. This provided a novel molecular basis for the clinical differences seen in human patients affected by adRP versus those affected by ESCS In this study, we analysed by Bioluminescence Resonance Energy Transfer 2  fused to the C-terminus of NR2E3 (NR2E3-RLuc) and the Green Fluorescent Protein (GFP2) fused to the N-terminus of NR2E3 (GFP2-NR2E3). As negative controls, cells were transfected with vectors expressing 1) RLuc alone, 2) GFP2 and NR2E3-RLuc and 3) RLuc and GFP2-NR2E3. 2-NR2E3 fusion protein was correctly localized to the nucleus, whereas the GFP2 protein showed both cytosolic and nuclear expression. By BRET2 analysis, we were able to measure comparable GFP2 fluorescence levels in cells expressing either the GFP2 or the GFP2\u2013NR2E3 proteins, whereas low fluorescence levels were observed in controls transfected only with the RLuc expression vector  or the acceptor (RLuc) protein in the NR2E3 fusion protein. We transfected HEK293T cells with vectors expressing NR2E3 fused to the N-terminus or the C-terminus of either GFP2 or RLuc. Again, a significant increase in BRET2 ratios was observed in presence of all combinations of NR2E3 fusion proteins, while protein expression levels (NR2E3-GFP2 or GFP2-NR2E3 fluorescence) were comparable in each condition. These results suggested that the orientation of the fusions was not interfering with dimerization . This further confirmed the specificity of the NR2E3 homodimerization.To exclude the possibility that the increase in BRETperiment  and S1A.2 techniques. We transiently transfected HEK293T cells with vectors expressing GFP2 or NR2E3-GFP2, in presence of either RLuc or a fusion protein where the human CRX protein was fused in N-terminus of RLuc (Crx-RLuc). We were able to measure similar GFP2 fluorescence levels in cells expressing either GFP2 or NR2E3-GFP2, while low fluorescence levels were observed in control conditions with RLuc (2 ratio only in presence of both NR2E3-GFP2 and Crx-RLuc (2 ratios were lower in both control conditions (RLuc/NR2E3-GFP2 or Crx-RLuc/GFP2).As a physical interaction between NR2E3 and CRX through their respective DBDs was previous reported in vitro ith RLuc . We obseith RLuc . ImportaCrx-RLuc . BRET2 r2 ratios, i.e. the most efficient NR2E3/CRX protein interactions, were obtained when CRX was located in the C-terminus of the renilla (RLuc-Crx), while this ratio was significantly decreased when CRX was fused to the N-terminus of RLuc (Crx-RLuc). Similar protein expression levels (NR2E3-GFP2 or GFP2-NR2E3 fluorescence) were observed in all performed conditions. These results showed that the orientation of the fusion proteins was important and suggested that the N-terminal part of CRX, where the DBD is located, had to be accessible for efficient NR2E3/CRX interactions.We then tested whether the localization of CRX in the fusion protein was important for NR2E3/CRX protein interactions . The hig2 on the other hand (2 ratio even at low amounts of NR2E3-GFP2 (0.5 \u00b5g). Taken together, these results confirmed a specific in vivo interaction between NR2E3 and CRX.We also performed a dose-dependency experiment, in presence of a constant amount of either RLuc or Crx-RLuc on the one hand, and, increasing amounts of NR2E3-GFPher hand  and S1B.2 vectors. The different NR2E3 mutant proteins (GFP2-NR2E3MUT) showed proper nuclear localization and protein expression levels as tested in transiently transfected HEK293T cells  in presence of equal amounts of each NR2E3 mutant fused to GFP2 (GFP2-NR2E3MUT)  NR2E3-RLuc and GFP2 as negative controls , whereas the p.R76W mutation dramatically decreased it (30.5\u00b19.0%). In contrast, the p.R104Q mutation decreased dimerization (25.8\u00b15.2%), whereas the p.R104W mutation increased it strongly (173.5\u00b14.5%). The p.R311Q mutation located in the LBD did not alter dimerization, when compared to the wild-type NR2E3 protein.To test whether these mutations altered the homodimerization of NR2E3, we expressed wild-type NR2E3 fused to RLuc (NR2E3R2E3MUT) . For eaccontrols . Additio control . The NR22 (NR2E3MUT-GFP2)  CRX-RLuc and GFP2  . For negand GFP2 . Additio control . All ESCin vitro transcribed/translated in reticulocyte lysates and tested for DNA-binding by electrophoretic mobility-shift assay (EMSA) on the reported synthetic DR1 containing two AAGTCA half-sites We examined whether NR2E3 mutations affected DNA-binding. The pcDNA3.1/HisC-hNR2E3 wildtype and mutant plasmids were rhodopsin, S- and M-opsin gene expression, and NR2E3 further potentiates CRX/NRL-mediated transactivation of rhodopsin expression by about 3-fold, but represses CRX/NRL-mediated transactivation of S- and M-opsin expression We then tested the effect of the NR2E3 mutant proteins on CRX/NRL-mediated transactivation by transient transfection assays in HEK293T cells. CRX and NRL synergistically activate rhodopsin promoter fragment (BR225-Luc) was set to 100% for each experiment, and, by transfecting increasing amounts of NR2E3 mutant proteins, we tested their effect on rhodopsin transactivation . Higher NR2E3WT/NR2E3G56R ratios (2\u22362 and 2\u22363) did not further decrease rhodopsin promoter activity. Second, all six ESCS-linked DBD-mutants significantly repressed NR2E3WT-mediated rhodopsin transactivation, but to a lesser extent. Except for p.R104Q, this repression was significant at a NR2E3WT/NR2E3MUT ratio of 2\u22361 . At a NR2E3WT/NR2E3MUT ratio of 2\u22363, repression was significant for all DBD mutants . Third, the LBD-mutation p.R311Q did not alter wild-type NR2E3 transactivation at any NR2E3WT/NR2E3R311Q ratio.NR2E3-dependent potentiation of CRX/NRL-mediated transactivation of a bovine tivation . The ratS- and M-opsin gene expression, the different NR2E3 mutations segregated into three different groups (S- and M-opsin promoter activity being only about 50% of the wild-type one (p<0.0001 by ANOVA vs other mutants) S- and M-opsin promoter transactivation, when compared to NR2E3 wild-type (p<0.01 by ANOVA). Third, the LBD-mutant p.R311Q repressed S- and M-opsin promoter activity similarly to wild-type NR2E3.With respect to repression of CRX/NRL-mediated transactivation of t groups . First, 4-Zinc finger of the 3\u2032-monomer. This model allowed us to evaluate potential functions of the residues that are mutated in patients. Residues R76, R97 and R104 are predicted to directly interact with DNA , in contrast to the Crx-RLuc fusion protein, where high energy transfer was observed , modulation of NR2E3 homodimerization by mutations in the DBD could be an additional factor affecting 3T cells  and 2. W3T cells , but the2  ligase PIAS3 (protein inhibitor of activated Stat3) NR2E3 mutations occurring in patients affect SUMOylation or other posttranslational modifications and this, in turn, affects DNA binding or protein-protein interactions, remains elusive and will require further studies.Recently, the dual function of NR2E3 in mature rods, 2) vectors, encoding the humanized Renilla luciferase (hRluc) and the humanized green fluorescent protein 2 (hGFP2) were purchased from PerkinElmer-BioSignal . The plasmids pcDNA3.1/HisC-hNR2E3 and pcDNA3.1/HisC-hCRX expressing the human NR2E3 and CRX, respectively, were kindly provided by Shiming Chen 2-fusion proteins, PCR amplification (oligonucleotides available on request) of wild-type and mutants NR2E3 were subcloned, in the hGFP2-C3 or -N3 vectors, respectively. We obtained the GFP-NR2E3 and NR2E3-GFP vectors, which express chimeric proteins. All constructs were verified by nucleotide sequencing.Bioluminescence Resonance Energy Transfer  supplemented with 10% FCS, 100 U/ml penicillin and 100 \u00b5g/ml streptomycin . For BRET2 analyses, one day prior to the experiment, cells were seeded in 60-mm cell culture plates at 0.8\u00d7106 cells. One day after plating, each 60-mm plate was transfected with the Calcium Phosphate method  with 0.5 \u00b5g to 3 \u00b5g of plasmid depending of the experiment. The cells were harvested 48 h after transfection prior to Western blot and BRET2 analysis.Human embryonic kidney (HEK) 293T cells were cultured at 37\u00b0C in an atmosphere of 5% CO5 cells were distributed in black 96-well microplates  for fluorescence quantification. Filter sets were 485 nm for GFP2 excitation and 515 nm for emission. Cells expressing BRET2 donor alone (RLuc) were used to determine fluorescence background. Aliquots of cells expressing same levels of fluorescence were distributed in white 96-well microplates  for luminescence assay. The luciferase substrate Coelenterazine h, DeepBlueC,  was added at a final concentration of 5 \u00b5M. Filter sets were 410 nm for luciferase emission and 515 nm for GFP2 emission. BRET2 ratio is defined as: [emission at 515 nm)/(emission 410 nm)] \u2013 Cf, where Cf corresponds to (emission at 515 nm)/(emission 410 nm) for the control experiment with Rluc construct expressed with the concerned protein fused to the GFP2. BRET2 ratio is expressed as raw data in experiments showing all negative controls. Emitted fluorescence and luminescence were measured using the Envision\u00ae microplates reader . For the GFP2 fluorescence imaging, HEK293T cells were analyzed under microscope with excitation (\u03bbex\u200a=\u200a485 nm) and emission (\u03bbem\u200a=\u200a515 nm) filters.Transfected HEK293T cells were washed with phosphate-buffered saline (PBS), detached with trypsin/EDTA, and then washed twice with Dulbecco's Phosphate-Buffered Saline . Aliquots of 10HEK293T cells were cultured as described above. Then, they were washed in PBS, suspended in 100 \u00b5l sample buffer containing 20 mM Hepes, 0.5% Tween, phosphatase inhibitors cocktail 1 and 2  and Complete\u00ae protease inhibitors . Cells were lysed with 3 successive freezing-thawing cycles. The detergent-insoluble material was pelleted by centrifugation at 15,000 rpm for 5 min at 4\u00b0C. The supernatant containing protein cell lysates (30 \u00b5g) were used for western blotting. For Western blot analysis, proteins were electrically transferred to PVDF filters and incubated with anti\u2013NR2E3  or anti\u2013GFP . Secondary antibody, anti-rabbit-HRP , was used to detect protein expression. Immune complexes were detected by chemiluminescence using LumiGLO .rhodopsin promoter (BR225-Luc) M-opsin promoter (Mop250-Luc) HEK293T cells were cultured as described above. Cells were plated in 12-well plates and transfected at a confluence of 30% with the Calcium Phosphate method . Per well, 30 ng of each of the expression vectors pcDNA3.1/HisC-hNR2E3 , pcDNA3.1/HisC-hCRX and pMT-NRL were used, together with 500 ng of the luciferase reporter constructs for http://swissmodel.expasy.org) using DeepView 4.0 program Homology modeling was performed in project mode on the SWISS-MODEL server .All results were expressed as means\u00b1SEM of the indicated number of experiments. Statistical significance was calculated with the Student's Figure S12 analysis of NR2E3 homodimerization and interaction with CRX. Donor saturation curves were obtained by measuring BRET2 ratio in the presence of fixed quantities of donor and increasing amounts of acceptor. In panel A, HEK293T cells were transiently transfected with 3 \u00b5g of RLuc or NR2E3-RLuc vectors, and an increased concentration (0.5 \u00b5g to 3 \u00b5g) of GFP2-NR2E3 vector. While in panel B, HEK293T cells were transiently transfected with 3 \u00b5g of RLuc or Crx-RLuc vectors and with an increased concentration (0.5 \u00b5g to 2 \u00b5g) of NR2E3-GFP2 vector. We pooled 5 to 6 different experiments and expressed the BRET2 ratio ([emission at 515 nm)/(emission 410 nm)] - Cf, where Cf corresponds to (emission at 515 nm)/(emission 410 nm) for the control experiment with Rluc construct expressed with the concerned protein fused to the GFP2) in function of (GFP/GFP\u00b0)/RLuc where GFP\u00b0 correspond to the luminescence of the acceptor in cells expressing the BRET donr alone (RLuc). In both BRET2 experiments we reach a plateau with high acceptor concentration.BRET(1.03 MB EPS)Click here for additional data file.Figure S22-NR2E3 expression vectors. Fluorescence imaging under a Zeiss (Axiovert 200) inverted microscope was used to detect GFP2 fluorescence. Wild-type and mutant NR2E3 proteins were correctly localized to the nucleus.Nuclear localization of NR2E3 wild-type and mutant proteins. HEK293T cells were transiently transfected with GFP(3.73 MB EPS)Click here for additional data file.Figure S3WT-RLuc) and with mutants of NR2E3 fused to the GFP2 (GFP2-NR2E3MUT). Fluorescence of the GFP2 was measured to ensure an equal expression of GFP2 alone and GFP2-NR2E3x chimera proteins in each condition. 2-NR2E3WT/NR2E3WT-RLuc and as a mean\u00b1SEM of 3 experiments. (B) HEK293T cells were transiently transfected with vectors expressing the CRX fused to renilla luciferase (Crx-RLuc) and with mutants of NR2E3 fused to the GFP2 (NR2E3MUT-GFP2). Fluorescence of the GFP2 was measured to ensure an equal expression of GFP2 alone and GFP2-NR2E3x chimera proteins in each condition. 2-NR2E3WT/Crx-RLuc and as a mean\u00b1SEM of 2 experiments.Comparable expression levels of NR2E3 wild-type and mutant proteins in transiently transfected HEK293 cells. (A) HEK293T cells were transiently transfected with vectors expressing the wild-type NR2E3 (WT) fused to renilla luciferase (NR2E3(1.26 MB EPS)Click here for additional data file.Figure S42 titration curves of NR2E3 mutants in the NR2E3 dimerization. For each NR2E3 mutant, we transfected 293T cells with 2 \u00ce\u00bcg of RLuc alone (RLuc) or fused to NR2E3 (RLuc-NR2E3WT) and an increasing amount (0.5 to 4 \u00ce\u00bcg) of the NR2E3 wild-type or mutants fused to the GFP2 (GFP2-NR2E3WT or GFP2-NR2E3MUT). Sigmoidal regression curves were performed for all graphs.BRET(1.25 MB EPS)Click here for additional data file.Figure S52 titration curve of NR2E3 mutants in NR2E3/CRX interation. For each NR2E3 mutant we transfected 293T cells with 2 \u00ce\u00bcg of RLuc alone (RLuc) or fused to CRX (CRX-RLuc) and an increasing amount (0.5 to 4 \u00ce\u00bcg) of the NR2E3 wild-type or mutant fused to the GFP2 (NR2E3WT-GFP2 or NR2E3MUT-GFP2). Sigmoidal regression curves were performed for all graphs.BRET(2.03 MB EPS)Click here for additional data file.Figure S6in vitro transcribed/translated in reticulocyte lysates .; In vitro DNA-binding of NR2E3 proteins was tested on a radiolabeled consensus DR1 response element 5\u2032-CCTTTAAAAGTCAAAAGTCAACTTCCAA-3\u2032) and NR2E3RErev (5\u2032-TTCCGTTGGAAGTTGACTTTTGACTTTT-3\u2032). Radiolabeling by Klenow fill-in with 30 \u00ce\u00bcCi of [\u00ce\u00b1-32P]dATP (3000 Ci/mmol)  and subsequent probe purification on Sephadex G-50 columns was according to manufacturers instructions . DNA-binding reactions were carried out in 20 \u00ce\u00bcl of 10 mM Tris (pH 7.5), 160 mM KCl, 1 mM dithiothreitol (DTT), 10% glycerol, 10 \u00ce\u00bcg of sonicated salmon sperm DNA (Roche), 2 \u00ce\u00bcg of poly(dI-dC) and 1 \u00ce\u00bcl of programmed reticulocyte lysate. After a 15-min incubation on ice, 1 ng of 32P-labeled probe was added, and incubations were continued for an additional 15 min at room temperature. DNA-protein complexes were separated from free probe on a native 4% polyacrylamide gel in 0.5 x Tris/borate/EDTA (TBE) buffer. Gels were dried and revealed by phosphorimaging .Mutations in the DBD impair DNA binding. NR2E3 wild-type and mutants proteins were (1.73 MB EPS)Click here for additional data file.Figure S7Amino acid sequence alignment of human NR2E3 (PNR) and NR2B1 (RXR\u00ce\u00b1) DNA-binding domains (DBDs). The NR2E3 DBD (residues 47\u2013123 of SwissProt Acc. No. Q9Y5X4) exhibits a sequence identity of 57.1% (44 residues) and a sequence similarity of 80.5% (62 residues) with the RXR\u00ce\u00b1DBD (residues 135\u2013210 of SwissProt Acc. No. P19793). The main regions of the DBD, i.e. the two Cys4 Zn-fingers and the so-called T/A box, are indicated above the sequence alignment. Disease-causing mutations are indicated above the NR2E3 sequence. Given the high sequence homology, the structural data obtained for RXR\u00ce\u00b1 were also indicated on the NR2E3 sequence (1.00 MB EPS)Click here for additional data file.Figure S8http://swissmodel.expasy.org) Mutation analysis by homology modeling of the NR2E3 homodimer DNA-binding complex. Amino acids 47\u2013123 of human NR2E3 (SwissProt Acc. No. Q9Y5X4) were used for homology modelling on the SWISS-MODEL server with DeepView program ((5.25 MB EPS)Click here for additional data file.Table S1PCR primers used for NR2E3 mutagenesis.(1.43 MB EPS)Click here for additional data file."}
+{"text": "Caenorhabditis elegans has 12 pairs of amphid sensory neurons, which are involved in generating behaviors such as thermotaxis toward cultivation temperature, and chemotaxis toward chemical stimuli. This arrangement of known sensory neurons and measurable behavioral output makes C. elegans suitable for addressing questions of multi-sensory integration in the nervous system. Previous studies have suggested that C. elegans can process different chemoattractants simultaneously. However, little is known about how these organisms can integrate information from stimuli of different modality, such as thermal and chemical stimuli.Multi-sensory integration is necessary for organisms to discriminate different environmental stimuli and thus determine behavior. C. elegans during simultaneous presentation of thermal and chemical stimuli. First, we examined thermotaxis within the radial temperature gradient produced by a feedback-controlled thermoregulator. Separately, we examined chemotaxis toward sodium chloride or isoamyl alcohol. Then, assays for simultaneous presentations of 15\u00b0C (colder temperature than 20\u00b0C room temperature) and chemoattractant were performed with 15\u00b0C-cultivated wild-type worms. Unlike the sum of behavioral indices for each separate behavior, simultaneous presentation resulted in a biased migration to cold regions in the first 10 min of the assay, and sodium chloride-regions in the last 40 min. However, when sodium chloride was replaced with isoamyl alcohol in the simultaneous presentation, the behavioral index was very similar to the sum of separate single presentation indices. We then recorded tracks of single worms and analyzed their behavior. For behavior toward sodium chloride, frequencies of forward and backward movements in simultaneous presentation were significantly different from those in single presentation. Also, migration toward 15\u00b0C in simultaneous presentation was faster than that in 15\u00b0C-single presentation.We studied the behavior of a population of We conclude that worms preferred temperature to chemoattractant at first, but preferred the chemoattractant sodium chloride thereafter. This preference was not seen for isoamyl alcohol presentation. We attribute this phase-dependent preference to the result of integration of thermosensory and chemosensory signals received by distinct sensory neurons. Caenorhabditis elegans is composed of only 302 neurons [While awake, animals detect multiple sensory cues such as chemical and physical stimuli. The variety of sensory information in the environment requires integration of multiple cues within an animal's nervous system. Due to their complexity, neuronal mechanisms that support the multi-sensory integration are difficult to study. The anatomically characterized and compact nervous system of  neurons , which mC. elegans has a sensory organ called an amphid that contains 12 left-right homologous pairs of sensory neurons [C. elegans. A previous study revealed that sodium ions are detected mainly by ASEL neuron, with minor contributions by ASER and other neurons, whereas chloride ions are detected mainly by ASER neuron [ neurons -7. SodiuR neuron . In contR neuron .C. elegans can also detect physical stimuli, such as tactile and thermal cues [C. elegans [mal cues -11. AFD mal cues  and rece elegans . AFD neu elegans ,14. Lase elegans . Thermop elegans . However elegans ,17.C. elegans has been studied by examining chemotaxis behavior toward a test attractant within a uniform field of a second attractant [C. elegans nervous system. Moreover, these worms store temperature and food information during cultivation, so integration of physical and chemical information is thought to occur within their nervous system. Dusenbery et al. [C. elegans and showed temperature-dependent alteration in behavior. We extended this analysis to temperature-dependent behavior toward sodium acetate and ammonium chloride, and showed that information from thermosensory AFD neurons is necessary for proper chemotaxis [The simultaneous presentation of multiple chemoattractants in tractant ,8,18-22,tractant -25. In ty et al.  examinedemotaxis .C. elegans. During the simultaneous presentation assay, wild-type C. elegans showed preference to thermal cue in the early phase, and to sodium chloride in the late phase. This phase-dependent preference was not seen in simultaneous presentation of temperature and isoamyl alcohol. We attributed this phase-dependent preference of temperature to the neural integration of thermosensory and chemosensory signals received by distinct sensory neurons.In the present study, we examined taxis behavior during simultaneous presentation of thermal cue and chemoattractant in To set the conditions for the simultaneous presentation assay, we first confirmed thermotaxis and chemotaxis behaviors in separate assays. Figure Worms cultivated at 15\u00b0C, 20\u00b0C or 25\u00b0C showed dose-dependent chemotaxis indices at 20\u00b0C room temperature Fig. , right. C. elegans, we studied taxis behavior during simultaneous presentation of spatial temperature and chemical gradients. We used 15\u00b0C-cultivated wild-type worms. The region B  reduced after the peak at 20 min  peaked at 40 min. We summed thermotaxis indices for 15\u00b0C and chemotaxis indices for sodium chloride from separate single presentations .When 15\u00b0C (cultivation temperature) and 0.03 M sodium chloride were presented simultaneously, worms showed positive indices  for the first 40 min of assay, and they showed nearly zero indices thereafter  of simultaneous presentation of 15\u00b0C and 0.07 M sodium chloride Fig. , worms mSingle worms were tracked in the simultaneous presentation assay with a computer-driven tracking system. One example is shown in Figure When isoamyl alcohol replaced sodium chloride as the chemoattractant, preference to neither the temperature nor the isoamyl alcohol was observed. Under simultaneous presentation of 15\u00b0C and 1/10,000 dilution of isoamyl alcohol, the index was nearly zero, and was almost the same as the summed index derived from separate single presentations Fig. .When a higher concentration of isoamyl alcohol  was used, the time course of the simultaneous presentation index  than that for 0.03 M sodium chloride-single presentation (6.6 \u00b1 2.7\u00b0). The average angles for migration to 15\u00b0C and 0.07 M sodium chloride in simultaneous presentation were 26.1 \u00b1 10.4\u00b0 and 16.4 \u00b1 6.5\u00b0, respectively. These were not significantly different from that for 15\u00b0C-single presentation (9.3 \u00b1 1.4\u00b0) and that for 0.07 M sodium chloride-single presentation (14.4 \u00b1 2.6\u00b0). Other average angles ranged from 9.7 \u00b1 2.3\u00b0 to 32.1 \u00b1 14.1\u00b0, and there was no significant difference among these values.The angle formed between a worm, the center of attractant region, and the center of region C was also measured Fig. . We confFurthermore, the average angles at 20 min ranged from 12.7 \u00b1 3.0\u00b0 to 41.3 \u00b1 11.2\u00b0. There was no significant difference among them. The largest difference between the angle at 10 min and that at 20 min was seen for 0.07 M sodium chloride in simultaneous presentation (16.4 \u00b1 6.5\u00b0 at 10 min and 41.3 \u00b1 11.2\u00b0 at 20 min), while the angles at 10 min and 20 min for migration to 15\u00b0C in this simultaneous presentation were almost the same (26.1 \u00b1 10.4\u00b0 at 10 min and 29.8 \u00b1 10.3\u00b0 at 20 min). For 0.07 M sodium chloride-single presentation, the average angle at 20 min was 24.8 \u00b1 7.3\u00b0 which was smaller value than the case of simultaneous presentation, although the difference was not significant. Therefore, worms approached sodium chloride from a wide angle during the simultaneous presentation assay. These phenomena may correlate with the difference of temperature preference in the early phase of simultaneous presentation of temperature and sodium chloride or isoamyl alcohol.C. elegans. Both cryophilic and thermophilic behaviors were observed in the population thermotaxis assay. The simultaneous presentation of temperature and sodium chloride caused worms to exhibit phase-dependent preference for each sensory cue. However, in simultaneous presentation of the temperature and isoamyl alcohol, they did not exhibit phase-dependent preference. Behavioral analysis of single worms indicated that temperature affected the parameters of movement toward sodium chloride , while 0.07 M sodium chloride affected the slope of the distance-time curve for the migration toward 15\u00b0C.In this study, we demonstrated multi-sensory integration in the nervous system of wild-type We studied thermotaxis behavior on a radial temperature gradient with a population assay. In the single presentation assay, both cryophilic and thermophilic movements were observed, although thermophilic movement was slightly weaker and began about 20 min later than cryophilic movement. Our results suggest that worms cultivated at higher temperatures need some period of time to adjust to a new temperature. Furthermore, 25\u00b0C-cultivated worms only weakly migrated to the 25\u00b0C-region but migrated well toward the 23\u00b0C-region. This is consistent with a previous report that worms cultivated at a higher temperature prefer slightly lower than their cultivation temperature, within linear temperature gradient .We attempted to observe thermophilic behavior of a single worm using a computer-driven tracking system. Although 15\u00b0C-cultivated worms migrated to the 15\u00b0C-region and tracked isotherms well (n = 24), 25\u00b0C-cultivated worms did not migrate to the 23\u00b0C-region (n = 20) (data not shown) as reported previously . It is hC. elegans preferentially migrates to either attractant during simultaneous presentation of two distinct chemoattractants [C. elegans neurons is time-sensitive. Behavioral analyses of single worms  also indicate that the behavior toward sodium chloride is different between single and simultaneous presentations. It is possible that higher frequency of forward and backward movements for behavior toward 0.07 M sodium chloride and the tendency of large angles for sodium chloride at 20 min in simultaneous presentation prevent a fast approach to sodium chloride-region. In contrast, behavior toward the 15\u00b0C-region in simultaneous presentation showed a faster approach to this region compared to single presentation. These indicate that the two attractive stimuli quickly disperse worms, and then behavior toward sodium chloride is slowed by frequent forward and backward movements, while behavior toward 15\u00b0C is enhanced or less affected by the presence of sodium chloride. This could be a cause of the temperature preference in the early phase of population assay. Our results show that this integration of temperature and sodium chloride information may be different from that of temperature and isoamyl alcohol (See the last section of Discussion).Previous work has shown that ractants ,24,25. Iet al. [In the case of the late phase behavior, it would be interesting to suppose that a change of preference from low temperature 15\u00b0C) and starvation might have reflected some associative learning in the worms that migrated to the 15\u00b0C-region. Mohri \u00b0C and stet al. . AlthougDrosophila, conditioning with concurrent visual and olfactory cues reduced the threshold for unimodal memory retrieval, and there are crossmodal interactions between olfactory and visual learning [Analyses of behaviors concerning sensory integration have been reported in other invertebrates ,31. In tC. elegans revealed that memory of cultivation temperature [ttx-1 mutant that is defective in AFD neurons shows abnormal cultivation temperature-dependent chemotaxis [+ and Cl-, AWC neurons detect isoamyl alcohol, and AFD and AWC neurons detect temperature. ASE and AFD have mutual synaptic connections, while AWC and AFD have no connections. This difference between ASE and AWC for connection to AFD may affect the difference of temperature preference for sodium chloride and isoamyl alcohol in the early phase of simultaneous presentation. In simultaneous presentation of temperature and sodium chloride, worms might compare the temperature memory in AFD with the sensory information in ASE using their mutual connections, and the combined information is sent to AIY interneurons. Alternatively, the preference of cultivation temperature could be determined in AIY. In simultaneous presentation of temperature and isoamyl alcohol, sensory information received by AFD and AWC would be transmitted to and integrated in AIY interneurons.Recent calcium imaging studies in perature  or thermperature , is storemotaxis . Similaremotaxis . Howeveremotaxis . Part of2+ in ASE sensory neurons and AIY interneurons [ttx-3 mutant animals having defect in AIY interneurons also showed hen-1 like phenotype, AIY interneurons are required for integration. In our model, informational integration of temperature and sodium chloride might occur between AFD and ASE as well as in AIY.HEN-1 is involved in adaptation to sodium chloride and sensory integration of odorant diacetyl and Curneurons . BecauseBy contrast, in the late phase of simultaneous presentation, sodium chloride was preferable to temperature, while isoamyl alcohol was not. This behavior is complex because chemotaxis is affected by adaptation , and theWhy does the worm first prefer cultivation temperature, then prefer sodium chloride? For 15\u00b0C-cultivated worms, 15\u00b0C may be a metabolically suitable living temperature, even if food does not exist in that environment. Alternatively, associative memory between temperature and food could be stronger than that between chemoattractant and food, in the early phase of simultaneous presentation assay.C. elegans. During simultaneous presentation of temperature and chemoattractant, worms exhibited phase-dependent preference that differed with the kind of chemoattractant. Behavioral analysis of single worms indicated that temperature affected the frequency of forward and backward movements for behavior toward sodium chloride. Also the migration to 15\u00b0C-region became faster by the presence of 0.07 M sodium chloride. In the early phase of the assay, the angle for migration to sodium chloride was affected by simultaneously presented temperature. These findings suggest that behavioral preference is the result of integration of thermosensory and chemosensory signals received by distinct sensory neurons, and is time-dependent.We have demonstrated multi-sensory integration in the nervous system of wild-type C. elegans was carried out using established methods [C. elegans Bristol N2 was used as the wild-type strain. This was obtained from the Caenorhabditis Genetics Center.Handling and culturing of  methods . The nemE. Coli. The NGM plates were kept at 25\u00b0C for 3 h to allow worms to lay eggs. Adult worms were then removed from the plates, and the eggs that remained on the NGM plates were incubated at 15\u00b0C, 20\u00b0C or 25\u00b0C until they became young adults. Worms with fully-developed vulva, with no or few eggs in their uteri, and those that exhibited normal pharyngeal pumping were considered young adults and were used for each assay described below. Shortly before the assay, worms were collected in wash buffer  and washed three times with the same buffer in a 15 ml conical centrifuge tube. A few minutes elapsed while washing the worms, and the temperature during washing was the same as that of cultivation because the buffer was also incubated at each cultivation temperature.To obtain synchronously grown young adult hermaphrodites, about 30 gravid adult hermaphrodites were transferred to a nematode growth medium (NGM) plate seeded with A radial temperature gradient on an assay plate was produced by regulating a Peltier device monitored by computer for 1 h. The cupper plate (1 cm in diameter) attached to the Peltier device was contacted with the bottom of a 9-cm diameter assay plate at the center of region B (2 cm in diameter) Fig. . We set NB - NA)/Ntotal, where NA, NB and Ntotal refer to the number of worms in the regions A and B, and the total number of worms on the assay plate . Excess buffer was absorbed, and clumped worms were dispersed with a Kimwipe. Each behavioral experiment was performed for 90 min at 20\u00b0C room temperature under the thermoregulation, and a few experiments were performed at 15\u00b0C or 25\u00b0C room temperature. The room temperature was always monitored with a digital thermometer. The total number of worms in the assay plate was counted, alongside counts for worms in regions A, B and C. The thermotaxis index was calculated as follows: Thermotaxis index = /Ntotal, where ND and NE are the number of worms on each half of the assay plate . The index was calculated as follows: the index = /Ntotal. For each data point reported in this assay, we assayed at least 12 plates in at least three independent experiments performed on separate days.The chemotaxis index was calculated as follows: Chemotaxis index = (NB - NA)/Ntotal. The fraction of worms FRn  equals Nn/Ntotal  where Nother indicates the number of worms in areas other than in the A, B and C regions. The summed index was defined as summation of the behavioral indices obtained from single presentations temperature (15\u00b0C) and chemoattractant . Significant differences were detected using the unpaired Student's t-test.The concentration gradient of each chemoattractant was created as described before. These assay plates were set on a Peltier device to obtain a temperature gradient 1 h before each assay. On the assay plate, the peak of the radial temperature gradient was set at the opposite side of the peak of the concentration gradient of chemoattractant Fig. . Each exLocomotion of a single worm on the temperature gradient and/or the concentration gradient of chemoattractant was analyzed by a computer-driven tracking system , to whict-test. We measured the distance between worm and a circumference of a 1-cm diameter circle, and the angle formed by a worm (P), the center of attractant region (Q) and the center of region C (O) (see Fig. t-test, and that between the angles at 10 and 20 min under the same assay condition was detected using the paired Student's t-test.During this 90 min assay, we analyzed forward and backward movements in a period between the start of the assay and the time when the worm reached either attractant. This period ends when the worm arrives at a circumference of a 1-cm diameter circle, which is the same size as the cupper plate attached to the Peltier device in region B. Frequencies of forward and backward movements of an individual worm were obtained by counting the number of events in the period between the beginning of assay and the time when the worm reached the attractant region, and they were converted to the number/h. The mean \u00b1 SEM of the frequency was taken for the total worms. Average durations of forward and backward movements of an individual worm were obtained for same the period. Then the mean \u00b1 SEM was taken for the average durations of the total worms. Significant differences were detected using the unpaired Student's see Fig. . DistancRA carried out all the experiments. HO constructed the thermoregulator. RS conceived the study. RA and RS drafted the manuscript. All authors read and approved the final manuscript."}
+{"text": "COI gene sequences detected paraphyly in the Neotropical malaria vector Anopheles marajoara. The \"Folmer region\" detects a single taxon using a 3% divergence threshold.Cryptic species complexes are common among anophelines. Previous phylogenetic analysis based on the complete mtDNA white + 3' COI sequences) dataset and pairwise differentiation of COI fragments were examined. The population structure and demographic history were based on partial COI sequences for 294 individuals from 14 localities in Amazonian Brazil. 109 individuals from 12 localities were sequenced for the nDNA white gene, and 57 individuals from 11 localities were sequenced for the ribosomal DNA (rDNA) internal transcribed spacer 2 (ITS2).To test the paraphyletic hypothesis and examine the utility of the Folmer region, genealogical trees based on a concatenated . COI sequences at the 3' end were more variable, demonstrating significant pairwise differentiation (3.82%) compared to the more moderate 2.92% detected by the Folmer region. Lineage 1 was present in all localities, whereas lineage 2 was restricted mainly to the west. Mismatch distributions for both lineages were bimodal, likely due to multiple colonization events and spatial expansion . There appears to be gene flow within, not between lineages, and a partial barrier was detected near Rio Jari in Amap\u00e1 state, separating western and eastern populations. In contrast, both nDNA data sets  detected a single A. marajoara lineage.Distinct COI and absent in the nDNA suggest that the divergence is recent, and detectable only by the faster evolving mtDNA. A within subgenus threshold of >2% may be more appropriate among sister taxa in cryptic anopheline complexes than the standard 3%. Differences in demographic history and climatic changes may have contributed to mtDNA lineage divergence in A. marajoara.Strong support for combined data with significant differentiation detected in the  About 1.8 million species are known on Earth, including more than 1 million insects, 250,000 higher plants and 69,000 fungi , the truAnopheles .An 800-bp fragment of the and Conn . A 500-band Conn . The PCRA. albitarsis s.l. sequences were identified to species by multiple gene  comparisons to those deposited in GenBank: A. albitarsis , A. oryzalimnetes, formerly A. albitarsis B , A. marajoara , A. deaneorum , A. janconnae, [DQ076231/DQ076232] and A. albitarsis F [DQ228314/DQ228315].All white + COI) data set. ITS2 sequences were excluded from these analyses because of relatively limited sample size. Maximum Parsimony trees were generated in PAUP*, with one hundred replicates of a heuristic search performed with an initial random stepwise addition of sequences and TBR branch swapping. Branch support was estimated from 1,000 replicates of a bootstrap search. Bayesian inference (BI) analysis was performed with Mr. Bayes version 3.1 [white gene and COI respectively, determined with jModelTest [A. albimanus in the Albimanus Section of Nyssorhynchus (unpublished sequence) was chosen based upon its phylogenetic position in Sallum et al [COI fragment only and compared using \u03b8S values [Genealogical trees were estimated using the concatenated  using the AMOVA approach, into K groups to maximize the between group variation. SAMOVA estimates were computed for K = 2-13 with 1,000 simulated annealing steps from each of 100 sets of initial starting conditions.Genetic structure of two lineages was examined by analysis of molecular variance (AMOVA), a method of estimating population variance directly from molecular data, using Arlequin version 3.1.1 . In addiCOI lineages using the 648-bp 5' end and the 488-bp 3' end tested the utility of the Folmer region and the 3% species threshold using 10 to 13 individuals from each lineage, three closely related taxa and an outgroup (Anopheles darlingi). Anopheles darlingi is more appropriate than A. albimanus for sister taxa comparisons as both it, and A. marajoara, are in the Argyritarsis Section [Nyssorhynchus using 4-58 archived GenBank sequences for known species.A comparison of the pairwise divergences calculated by DnaSP between  Section . A speci Section  may be m Section . The staCOI haplotypes with a 93% sequence identity and 95% identity for each of the nuclear markers using TCS 1.13 [A statistical parsimony network estimated genealogical relationships among TCS 1.13 . HomoplaTCS 1.13 .COI sequences by species or lineage and locality were computed in DnaSP, Version 4.0 [DT [D and F [R2 [FS [D and both Fu and Li's D* and F* are the most effective tests to detect background selection, whereas Fu's FS and R2 are among the most powerful tests to detect population expansion [The differentiation and polymorphism statistics for sion 4.0 , and the 4.0 [DT , D and F[D and F , and R2 nd F [R2  which ar [R2 [FS , based oxpansion . All neuxpansion .The mismatch distribution (simulated in Arlequin) is a frequency distribution of the observed number of pairwise nucleotide differences. The shape of the distribution is highly informative and able to differentiate between a population expansion and equilibrium , whereasA. marajoara with varying levels of support . Within both lineages, smaller subdivisions, not related to geography, were apparent between the haplotypes that are separated by seven mutations in lineage 1 (between haplotypes 11 and 13) and 10 mutations in lineage 2 (haplotypes 48 and 49), illustrated in the network . Therefore, the estimate of the time to coalescence is 232,476 - 384,716 years ago, in the Pleistocene. A similar estimate using BEAST, the standard arthropod mtDNA mutation rate of 2.3% per million years [The estimated time to coalescence for the two  = 2Ne\u03bc,  and 4Ne lescence . Based uon years , an applon years . Althougon years , no dataon years .A. marajoara (2.94%) is marginally below the 3% BOLD threshold. However, it is comparable to among species comparisons within the Albitarsis Complex  of combined A. marajoara lineages likely represents an overlooked species complex.The between lineage variance for the Folmer region of the two lineages of arajoara .94% is marajoara .94% is marajoara .94% is mp = 0.0000) of the variance was explained by between-group variation of A. marajoara lineages 1 and 2. SAMOVA analysis, providing resolution for lineage 1 only, defined two groups that correspond to northeastern and western Amazonia, with 61.36% regional variation , compared with the white gene (1.0).AMOVA indicated that 61.94%  were shared among localities, and 32 (55.2%) were unique , 2 (n = 26), 3 (n = 20) and 5 (n = 78) of A. marajoara lineage 1, and haplotypes 43 (n = 9) and 46 (n = 9), 50 (n = 32), and 56 (n = 11) of A. marajoara lineage 2  and high gene flow. Lineage 1 contains a star shaped node surrounding haplotype 5, with short branches and an excess of singleton mutations, predominantly from the northeastern localities, which suggests a demographic expansion, background selection or selective sweep [d Figure . Of the ve sweep ,84. In cwhite gene and ITS2) containing comparative numbers of specimens of both COI-defined lineages identified a single A. marajoara lineage , where haplotypes D and T are present, separated by 11 mutation steps  was significant. In contrast, the positive values in lineage 2 indicate an excess of intermediate-frequency alleles in a population, which can result from either balancing selection or population bottlenecks [The high tlenecks . Only thThe mismatch distribution model for sudden expansion was marginally significant for both lineages. Both exhibited a bi-modal distribution Figure  with a cA. marajoara depicting separate lineages, distinct from A. janconnae. The more ancestral lineage 2 appears monophyletic, whereas moderate substructure within lineage 1 suggests paraphyly. Nuclear markers, however, consistently depict a single A. marajoara lineage. Discrepancies between mtDNA and nDNA are not enough to refute speciation, for example the newly recognized species A. janconnae and A. marajoara form a single lineage using the protein coding nuclear white gene and ITS2 sequences [COI sequences [A. janconnae as a separate taxon in the complex [A. marajoara in the present study suggests either the differentiation is restricted to the mitochondrial genome, or it is recent and not yet visible in the nuclear genome. Given that lineage 1 has a broader distribution and includes samples from near the type locality, lineage 1 would be more appropriately named A. marajoara s.s. The status of lineage 2 is not yet resolved; it may be a new cryptic species belonging to the complex as suggested by Wilkerson et al. (2005) from Manaus, Brazil [COI barcode region of the Albitarsis subgroup across South America.The combined sequence results support divergence in equences ,21, but equences  indicate complex . Nuclear complex , but see complex , thus th, Brazil  and confA. albitarsis s.s and A. oryzalimnetes). These data may support cryptic or incipient speciation [Nyssorhynchus because there is only moderate support between known species A. oryzalminetes and A. albitarsis s.s. If the average intraspecific variation of the Folmer region for the subgenus (11.6%) is used as a species threshold, the pairwise divergences of all sister taxa  do not exceed this standard. Such a high SST is likely to result in false negatives even among recognized species, therefore separate intraspecific values and interspecific divergences were examined for resolution, where intraspecific COI variation was <2% and interspecific variation was between 6-10%, comparable to other anopheline species differences [[Genetic variation between lineages was explained by 61.94% between group differences. Pairwise divergence estimates based on the 488-bp fragment confirmed 3.82% divergence between lineages . Miocene flooding [Climate, particularly rainfall, is a strong descriptor of broad-scale species-richness patterns in the tropics . Vasconcet al  noted a et al  explaineflooding  and subsA. marajoara abundance in this region. Clearing of forest, in combination with an increase in human and domestic animal host abundance, may have led to an A. marajoara population increase in Macap\u00e1, the capital of Amap\u00e1 -state, in northeastern Amazonian Brazil [Recent deforestation and habitat fragmentation resulting from the 1967 initiation of the single largest forest plantation in Latin America, an agro-forestry venture known as the Jari project  in northn Brazil .A. marajoara lineage 1 in the northeastern Amazon region coupled with the unimodal distribution and the star-like pattern of the haplotype network are consistent with a rapid population expansion in the northeast. A. marajoara tends to breed in marshy sunlit pools and may have expanded into the northeast where savannah and agricultural habitats would be favorable. The population expansion occurred during the Holocene, possibly indicating a recent colonization. This explanation is supported by the expansion of savannah during periods of fire-associated drought and extinction-recolonization of rainforest tree populations in lowland areas during the Holocene [Among the riverine localities, the hypothesis of sudden population expansion could not be rejected, although the mismatch distributions were smooth and bimodal for both lineages. The reduced genetic variation of Holocene -110. ModHolocene .Anopheles marajoara is an important vector in the savannah areas of South America [A. marajoara will continue to increase its regional importance in malaria transmission. Additional studies will be needed to determine whether the subdivision resulting in the two co-occurring lineages in A. marajoara is strictly the product of genetic variation and evolutionary processes impacted by geographical barriers, or variations in ecology and behaviour that may have lead to niche divergences and microallopatry [ America , and wit America ,15,112 illopatry -116. If The authors declare that they have no competing interests.SNM extracted DNA, performed all molecular procedures and analysis, and drafted the manuscript. MAL performed molecular procedures and analysis for eastern data and helped in manuscript preparation. RCW and MMP contributed in the design of the study, were involved in field collections and helped interpret data. JFR assisted in data analysis and interpretation. MAS and JBLP were involved in field collections and performed morphological identifications of samples with RCW. JEC participated in the design of the study, data analysis, drafting of the manuscript, general supervision of the research group and funding acquisition. All authors read and approved the final document.COI with fragment orientation and overlapComplete . Representative schematic of the COI gene, Folmer region and fragments; light blue bar indicating the region amplified by primers UEA3 and UEA10; the purple bar depicting fragment previously amplified from primers 2195D and C1-J-2195. *, denotes the piece of the COI that was used for the phylogeography and population structure analysis.Click here for fileDXY with Jukes Cantor pairwise divergence between species and lineages based upon the 648-bp Folmer region (below) and the 488-bp COI fragment (above).Click here for fileCOI haplotypes and genetic polymorphism statistics for A. marajoara lineages and A. oryzalimnetesDescription of shared . N, the number of sequences; 1-\u03a3fi2, haplotype diversity; \u03a0, nucleotide diversity; SD, standard deviation; P, polymorphic sites; and K, average number of differences. Underlining indicates shared haplotypes and bold indicates diversity among lineages or species.Click here for filewhite haplotypes and genetic polymorphism statistics for A. marajoara s.lDescription of shared .Click here for file"}
+{"text": "It is believed that depression impedes and motivation enhances functional recovery after neuronal damage such as spinal-cord injury and stroke. However, the neuronal substrate underlying such psychological effects on functional recovery remains unclear. A longitudinal study of brain activation in the non-human primate model of partial spinal-cord injury using positron emission tomography (PET) revealed a contribution of the primary motor cortex (M1) to the recovery of finger dexterity through the rehabilitative training. Here, we show that activity of the ventral striatum, including the nucleus accumbens (NAc), which plays a critical role in processing of motivation, increased and its functional connectivity with M1 emerged and was progressively strengthened during the recovery. In addition, functional connectivities among M1, the ventral striatum and other structures belonging to neural circuits for processing motivation, such as the orbitofrontal cortex, anterior cingulate cortex and pedunculopontine tegmental nucleus were also strengthened during the recovery. These results give clues to the neuronal substrate for motivational regulation of motor learning required for functional recovery after spinal-cord injury. Current basic researches on the neuro-rehabilitation focus mainly on neuronal plasticity and motor learning for functional restoration of affected limbs after neuronal damage such as spinal-cord injury and stroke. Depression is a common psychological problem after neuronal damage Recently, we showed the neuronal mechanisms of functional recovery in a non-human primate model of partial spinal cord injury  [5]\u2013[9].As described in previous study r- and p-values of correlation at the individual stages are indicated in Regions of interest (ROIs) for the contralesional ventral striatum co-VSt, , contralSummary of multiple comparisons of the whole brain regions of the 3 monkeys are shown in To confirm whether these brain sites are mutually correlated, we calculated correlation of signal intensity within these brain sites. In The present study has shown that the functional connectivity among the M1, the VSt and other structures belonging to the neural circuits for processing motivation emerged and were strengthened during recovery. The present study thus demonstrated plasticity in the functional connectivity of the motivational networks with the M1, which might be specifically correlated with the extent of functional recovery of finger dexterity after the spinal-cord injury.The VSt, in particular the NAc, has been shown to be important in information processing for motivation and reward. Neuronal activity It is important to examine how the \u201cfunctional connectivity\u201d of the motivational networks with the M1 observed in the present study emerged. One possibility that should be excluded is that it simply reflects the change in amount of reward. On this aspect, because the PET scans were performed after the success rate exceeded 80%, the amount of reward that the monkeys got during the sessions was constant both preoperatively and postoperatively, or slightly less only during the early recovery stage. Therefore, the correlation observed in this study was not likely to have resulted from pseudo-correlation between the increase in the reward amount and increased activity of M1, both of which might be parallel the recovery of success rate.On the other hand, task difficulty would be increased after spinal cord injury, which needs higher level of motivation to achieve the demanding task that requires activation of mesolimbic system. Task difficulty might also require higher level of M1 activation, that might lead to emergence of the correlation between the two areas. We assume this may not be the sole explanation of the present result, because correlation became higher at the later stage of recovery when performance of the task became easier, than the early phase, when the performing the task was difficult. Thus, at this stage, it is difficult to make clear explanation on how the correlation between the VSt and M1 emerged during the recovery from the spinal-cord injury. Further experiments are needed, such as recording of neural activity from VSt, and testing the effects of activation/inactivation of the VSt neural activity on the M1 activity and functional recovery of the hand dexterity. However, it might be suggested that functional recovery of finger dexterity requires skill learning and may require higher level of M1 activity, and increased synaptic efficacy in the pathways between M1 and motivation centers through the NAc might underlie such reorganization of the neural circuits involving the M1. Then a question may arise on how the M1 and NAc are connected with each other. By using transsynaptic labeling technique, it has been shown that the NAc provides strong multisynaptic projections to all the body-part representations in the M1 through the substantia innominata It has been reported that the dopaminergic system is essential for reinforcement learning Macaca mulatta  and a Macaca fuscata ] were used in the present study. The data of the present study were obtained for our previous studies Three monkeys H2O via a cannula placed into the sural vein, the scan was initiated automatically when the radioactivity in the brain reached greater than 30 kcps. The monkey was allowed to begin the behavioral task  at about 10 s before the start of the PET scan. During the scan, the monkeys performed a series of reach-grip-retrieve-eat movements every 5 s. PET data were collected for 80 s (one 40 s frame followed by four 10 s frames). Video recording of the scanning session was performed, and if the monkey did not start from the fixed starting point or did not start reaching immediately (within less than 15 frames\u200a=\u200a500 ms) after presentation of the food or did not move the hand directly to the food piece, the data from the session was excluded from analysis. Twenty scans were conducted in Monkey H and K in both tasks for every stage, and 24 scans were conducted in Monkey T.A series of PET scans was conducted during the intact and recovery stages as descried elsewhere 18F]FDG-PET image of each subject. PET images obtained from the scan sessions that satisfied the behavioral criteria were summated for their first 60 s epochs, and were used for statistical analysis by parametric mapping (SPM99) software .The reconstruction was performed on projection data, after which images were corrected for attenuation using a transmission scan with a 4.0 mm Hanning filter. Reconstructed brain images , which were scalped and smoothed with a 4.0 mm FWHM isotropic kernel, were processed using statistical analysis of the parametric mapping (SPM99) software. For the inter-subject analysis, brain shapes of individual monkeys were morphologically normalized to a pseudo-brain template MRI, which was constructed by averaging 8 brain MRI images from young adult male macaque monkeys using a [ware see . Regionsware see , which wware see , orbitofAt the end of the experiments, the monkeys were deeply anesthetized with an overdose of sodium pentobarbital  and perfused transcardially with 0.1 M phosphate-buffered saline , followed by 4% paraformaldehyde in 0.1 M PBS (pH 7.3) and, finally, the same fresh PBS containing 10%, 20% and then 30% sucrose. The spinal cords were removed from the bone immediately, saturated with 30% sucrose in 0.1 M PBS (pH 7.3), then cut serially into 50 \u00b5m thick coronal sections on the freezing microtome. The sections processed for Kl\u00fcver-Barrera staining or Nissl-staining with 1% Cresyl Violet were used for assessing the lesion extent.Video S1Recovery time course of finger dexterity after spinal cord injury.(WMV)Click here for additional data file.Figure S1Strength of functional connectivity with the co-VSt. Strength of functional connectivity derived from correlations between the rCBF value in the co-VSt and that in other regions during the precision grip task were calculated. The data were obtained from 3 monkeys. Brain areas with a significant positive correlated rCBF  are superimposed on a three-dimensional reconstruction of a template brain MRI of macaque monkeys that was made by our group. The significance level is given in terms of t values represented on a colored scale. (A), (B) (C) and (D) are results during the intact, early and late stages of recovery, and all recovery stages (including the data from both the early and late recovery stages), respectively. (a) to (g), coronal sections. (C) shows lateral views of the brain. Lines (d) to (f) in (C) indicate the levels of coronal sections of (a) to (g), respectively.(TIF)Click here for additional data file.Figure S2Strength of functional connectivity with the co-M1. The same arrangement as (TIF)Click here for additional data file.Figure S3Strength of functional connectivity with the co-OBF. The same arrangement as (TIF)Click here for additional data file.Figure S4Strength of functional connectivity with the rACC. The same arrangement as (TIF)Click here for additional data file.Figure S5Strength of functional connectivity with the cACC. The same arrangement as (TIF)Click here for additional data file.Figure S6Strength of functional connectivity with the ip-PPTN. The same arrangement as (TIF)Click here for additional data file.Table S1Statistical analysis of correlation of the rCBF between the co-VSt and the primary motor cortex at different stages before and after the spinal-cord injury. The values indicate Pearson's correlation coefficients (r) and p-values. r and p-values correspond with each scatter plot in (DOCX)Click here for additional data file.Table S2Statistical analysis of correlation of the rCBF in the co-VSt with that in other brain regions during the intact, early, late stage of recovery and recovery stage. The level of the coefficients was set at P<0.01 . t-values at the center of individual masses of activation are indicated.(DOCX)Click here for additional data file.Table S3Statistical analysis of correlation of the rCBF in the co-M1 with that in other brain regions during the intact, early, late stage of recovery and recovery stage. The same arrangement as (DOCX)Click here for additional data file.Table S4Statistical analysis of correlation of the rCBF in the co-OBF with that in other brain regions during the intact, early, late stage of recovery and recovery stage. The same arrangement as (DOCX)Click here for additional data file.Table S5Statistical analysis of correlation of the rCBF in the rACC with that in other brain regions during the intact, early, late stage of recovery and recovery stage. The same arrangement as (DOCX)Click here for additional data file.Table S6Statistical analysis of correlation of the rCBF in the cACC with that in other brain regions during the intact, early, late stage of recovery and recovery stage. The same arrangement as (DOCX)Click here for additional data file.Table S7Statistical analysis of correlation of the rCBF in the ip-PPTN with that in other brain regions during the intact, early, late stage of recovery and recovery stage. The same arrangement as (DOCX)Click here for additional data file.Text S1Supporting information for Methods.(DOCX)Click here for additional data file."}
+{"text": "Mycobacterium bovis Bacille Calmette-Guerin (BCG) fails to provide adequate protection against the disease in adults as well as against reactivation of latent infections or exogenous reinfections. It has been speculated that failure to generate adequate memory T cell response, elicitation of inadequate immune response against latency-associated antigens and inability to impart long-term immunity against M. tuberculosis infections are some of the key factors responsible for the limited efficiency of BCG in controlling TB.In spite of a consistent protection against tuberculosis (TB) in children, M. tuberculosis to boost the BCG induced immunity. \u2018BCG prime \u2013 DNA boost\u2019 regimen (B/D) confers robust protection in guinea pigs along with a reduced pathology in comparison to BCG vaccination . In addition, B/D regimen also confers enhanced protection in mice. Further, we show that B/D immunization in mice results in a heightened frequency of PPD and antigen specific multi-functional CD4 T cells (3+) simultaneously producing interferon (IFN)\u03b3, tumor necrosis factor (TNF)\u03b1 and interleukin (IL)2.In this study, we evaluated the ability of a DNA vaccine expressing \u03b1-crystallin- a key latency antigen of + Th1 cells with superior effector functions. We anticipate that this study would significantly contribute towards the development of superior booster vaccines for BCG vaccinated individuals. In addition, this regimen can also be expected to reduce the risk of developing active TB due to reactivation of latent infection.These results clearly indicate the superiority of \u03b1-crystallin based B/D regimen over BCG. Our study, also demonstrates that protection against TB is predictable by an increased frequency of 3 Mycobacterium tuberculosis as a human pathogen relies immensely on its ability to subvert the host immune responses and persist in a dormant state. M. bovis Bacille Calmette-Guerin (BCG) is currently the only tuberculosis (TB) vaccine approved for human use. It has been used to vaccinate more than 4 billion individuals worldwide and still continues to be a part of the childhood immunization program in most of the countries due to its ability to impart effective protection against TB in children M. tuberculosis while adapting to long-term persistence; however, BCG being an attenuated strain does not persist long enough to express these antigens. Thus, despite sharing a vast repertoire of antigens with M. tuberculosis, BCG fails to elicit an efficient response against these latency antigens The success of M. tuberculosis infection In the last five years, there has been a substantial progress in the development of new TB vaccines and many of these have already found their way into clinical trials or pre-clinical development cr, HspX, Rv2031c) M. tuberculosis to hypoxia, nutrient starvation as well as in the late stages of infection M. tuberculosis infection, even though, it could not surpass the protective efficacy of BCG, when employed alone in a prophylactic mode Previously, we have reported the development of DNA vaccine (DNAacr) expressing \u03b1-crystallin (aM. tuberculosis by aerosol route and lung and spleen bacillary load were determined at 10 (Exp-I) and 16 weeks (Exp-II) post-infection. At 10 weeks post-infection . However, when DNAacr was employed as a booster subsequent to BCG priming, the regimen conferred robust protection as was evident from a remarkable reduction in the bacillary load in the lungs and spleen , when compared to the unvaccinated animals , , at 12 weeks after the primary immunization, guinea pigs were infected with nfection , BCG vac animals . Moreovep<0.01), .10 and 1.47 log10, p<0.05, respectively; p<0.05). The influence of boosting was found to be antigen specific, since, boosting with vector DNA (B/V) did not show any significant improvement over BCG immunization  succumbed to the disease. In the BCG vaccinated animals, although no mortality was observed, the bacillary load in the lungs and spleens of these animals was observed to be as much as in the case of unvaccinated animals (surviving ones) indicating a considerable decline in the protection conferred by BCG vaccination on extending the post-challenge period to 16 weeks . Howevernization .On examining the influence of vaccination on pathological damage in various organs of guinea pigs at 10 weeks post-infection, we observed that unvaccinated animals exhibited severe pathology in lungs, liver and spleen characterized by the presence of numerous large and small sized tubercles . Vaccinap<0.01). However, in contrast to BCG and B/V vaccinated animals which, showed the presence of granulomas covering 35% and 30% of the lung sections, respectively, animals vaccinated with B/D regimen exhibited well-preserved alveolar spaces with only a few scattered areas of diffused infiltration in peribronchial and perivascular areas (5%)  . Similareas (5%) .Similarly, at 16 weeks post-infection, as expected, lungs and liver of unvaccinated animals exhibited extensive multi-focal coalescing granulomas with prominent central coagulative necrosis. In comparison, BCG as well as B/V vaccinated animals exhibited the presence of scattered areas of inflammation with discrete as well as coalescing granulomas with small necrotic centers in lungs  and 3B. in situ localization of Ag85 complex proteins, which serve as a marker for live bacilli, dead bacilli, bacillary remnants as well as secreted antigens p<0.001). Particularly, in concordance with the reduced bacillary load, animals immunized with B/D regimen exhibited minimal antigen load both at 10 and 16 weeks post-infection (p<0.05), (p<0.001) and granulomatous inflammation .In parallel, we also determined the antigen load in lung tissues by nfection . Commensnfection . BCG vacp<0.05), . The extAltogether, these observations suggest that vaccination with B/D regimen, in addition to exerting an efficient control on bacillary multiplication and imparting a markedly superior protection against pathological damage and fibrosis, the regimen was also efficient in meditating antigenic clearance from the site of infection.The non-availability of immunological reagents, a persistent caveat of guinea pig model, prohibited us from evaluating the T cell effector functions and their association with the protection imparted by various vaccination regimens. Hence, we evaluated the protective efficacy of B/D regimen in murine model also along with the associated immune responses.M. tuberculosis infection, we observed a significantly reduced bacillary load in the lungs and spleen of BCG vaccinated animals when compared with the unvaccinated animals , . Even in comparison to the BCG vaccinated animals, the animals vaccinated with B/D regimen exhibited a significantly reduced bacillary load , (At 4 weeks post tively), . A strikp<0.05),  indicatiet alFurther, we analysed the quality of T cell responses by measuring the cytokine production on a per-cell basis by FACS following a six-hour stimulation of splenocytes with PPD or \u03b1-crystallin. T cells were purified, stained for CD4 T cell surface marker along with IFN\u03b3, TNF\u03b1, and IL2 and were subjected to FACS analysis. Quality of immune responses was defined on the basis of expression of various combinations of these cytokines as described by Seder + (IFN\u03b3+TNF\u03b1+IL2+) and 2+ (TNF\u03b1+IL2+ and IFN\u03b3+IL2+) CD4 T cells when compared with the BCG vaccinated animals , although quantitatively, both BCG and B/D vaccinated animals exhibited a comparable frequency of CD4 T cells (data not shown), qualitatively, a marked functional heterogeneity was observed in terms of their ability to produce IFN\u03b3, TNF\u03b1 and IL2 . Notably animals . In addi animals . In cont\u03b1+ cells . Moreove antigen . These oM. tuberculosis is primarily dependent on the cell-mediated immune responses BCG has been the most widely used vaccine over the last several decades with more than 4 billion Individuals vaccinated with it worldwide. However, clinical trials and subsequent meta-analysis revealed its general ineffectiveness against TB in adults Rv2031c) based DNA vaccine booster subsequent to BCG priming is highly effective in improving the protection conferred by BCG. This heterologous prime boost regimen provides a superior and extended protection against M. tuberculosis infection in guinea pigs as well as in mice. According to our previous findings, \u03b1-crystallin based DNA vaccine, although, failed to surpass the protection conferred by BCG vaccine, when used as a standalone vaccine In this study, we show that \u03b1-crystallin  CD4 T cell responses along with production of overall larger quantities of IFN\u03b3, TNF\u03b1 and IL2 by these T cells. Furthermore, an increased frequency of 2+ CD4 T cells simultaneously producing TNF\u03b1 and IL2 in case of B/D regimen indicates the generation of a greater central memory response in comparison to BCG. Though, more extensive phenotyping of these 2+ T cells would have helped, previous studies have proposed that while, the central memory T cells produce IL2 alone or IL2 along with TNF\u03b1, the effector memory T cells produce IFN\u03b3 either alone or in combination with IL2 and TNF\u03b1 M. tuberculosis infection. Moreover, caution should be exercised to extrapolate the mouse immunogenicity data to guinea pigs due to inherently different responses of the two species to M. tuberculosis infection until the immunological reagents for guinea pigs become available and the involvement of multifunctional T cells in mediating protection is formally demonstrated in this species.Our observations in murine model further highlight the association between the enhanced protection by B/D regimen and the production of a heightened multi-functional . Mice experiments were reviewed and approved by the Institutional Animal Ethics Committee of University of Delhi South Campus, New Delhi, India (Permit number: 159/1999/CPCSEA). All animals were routinely cared for according to the guidelines of CPCSEA , India.M. bovis BCG  and M. tuberculosis  were grown to mid-log phase in Middle Brook 7H9 media and stocks were prepared as described 5 CFU of BCG  by i.d. route, (ii) BCG once, followed by a booster dose of DNAacr or vector  by i.m. route at 6 weeks (B/D or B/V) and (iii) 100 \u00b5l of saline by i.d. route (control group). Guinea pigs were challenged 12 weeks after the primary immunization with 50\u2013100 bacilli of M. tuberculosis H37Rv via the respiratory route in an aerosol chamber (Glasscol Inc.). Animals were euthanized at 10 weeks post-infection in Exp-I and at 16 weeks post-infection in Exp-II by intraperitoneal injection of Thiopentone sodium (100 mg/kg body weight) (Neon Laboratories Ltd.). After dissecting the animals, lungs, liver and spleen were scored for pathological changes as described previously 10 CFU/g.For evaluation of protective efficacy, two guinea pig experiments were performed. In each experiment, guinea pigs were immunized with (i) 5\u00d710Protection studies in mice were carried out once similarly as described for guinea pigs. To recapitulate, briefly, mice in groups of 4 were immunized and infected following the same protocol as used for guinea pigs. Immune responses were measured at 12 weeks post-immunization (at the time of infection). For evaluation of protective efficacy, bacillary load in lungs and spleen was determined at 4 weeks post-infection.At 12 weeks post-primary immunization, T cell responses were assessed by intracellular cytokine staining of CD4 T cells for IFN\u03b3, TNF\u03b1, and IL2. Briefly, spleen cells were isolated as described Following stimulation, cells were purified by using BD IMag\u2122 Mouse T Lymphocyte Enrichment Kit. Briefly, a cocktail of biotinylated antibodies was added to the cells that simultaneously bind erythrocytes and leukocytes but not T lymphocytes. The cells were then washed to remove excess antibodies followed by the addition of BD IMag\u2122 Streptavidin. Unlabelled T lymphocytes were then enriched by negative selection by placing them within the magnetic field of the BD IMagnet\u2122. Cells were washed and incubated with BD Fc Block\u2122 (CD16/CD32 mAb to block Fc binding). Subsequently, the cells were stained for cell surface marker, CD4 (FITC) along with intracellular cytokines, IFN\u03b3 (RPE), TNF\u03b1 (PerCPCy5.5) and IL2 (APC) by using the BD Cytofix/Cytoperm kit. Cells were washed twice with Cytoperm and finally resuspended in sheath fluid. Cells  were acquired by using a FACS Calibur flow-cytometer (by using Cell Quest Pro software) and analyzed by using FlowJo software (Tree Star). Cell frequency, median fluorescence intensity (MFI) and integrated MFI (iMFI\u200a=\u200a% frequency X MFI) for different cytokines were calculated. For cell stimulation and FACS analysis, cells pooled from all 4 mice from a group were used. All the reagents for cell isolation and antibodies employed in FACS analysis were obtained from BD Pharmingen.in situ localization of M. tuberculosis antigens in the sections of guinea pig lungs, immunohistochemical (IHC) staining was carried out and analysed for area and intensity of staining as described earlier For U test were employed for comparison of the quick score (Q) for IHC, gross pathological score and granuloma % across different groups. Correlation between different parameters was analysed by Spearman Rank Correlation test. Differences were considered significant, when p<0.05. For statistical analysis SPSS  and Prism 5  were employed.For comparison of the CFU one-way ANOVA was carried out followed by Tukey test. Non-parametric Kruskal-Wallis test, followed by Mann-Whitney"}
+{"text": "Mycobacterium bovis Bacille Calmette Guerin (BCG). To date only a few studies have explored the potential of latency-associated antigens to augment the immunogenicity of BCG.Efficient control of tuberculosis (TB) requires development of strategies that can enhance efficacy of the existing vaccine We evaluated the protective efficacy of a heterologous prime boost approach based on recombinant BCG and DNA vaccines targeting \u03b1-crystallin, a prominent latency antigen. We show that \u201crBCG prime - DNA boost\u201d strategy (R/D) confers a markedly superior protection along with reduced pathology in comparison to BCG vaccination in guinea pigs . In addition, R/D regimen also confers enhanced protection in mice. Our results in guinea pig model show a distinct association of enhanced protection with an increased level of interleukin (IL)12 and a simultaneous increase in immuno-regulatory cytokines such as transforming growth factor (TGF)\u03b2 and IL10 in lungs. The T cell effector functions, which could not be measured in guinea pigs due to technical limitations, were characterized in mice by multi-parameter flow cytometry. We show that R/D regimen elicits a heightened multi-functional CD4 Th1 cell response leading to enhanced protection.These results clearly indicate the superiority of \u03b1-crystallin based R/D regimen over BCG. Our observations from guinea pig studies indicate a crucial role of IL12, IL10 and TGF\u03b2 in vaccine-induced protection. Further, characterization of T cell responses in mice demonstrates that protection against TB is predictable by the frequency of CD4 T cells simultaneously producing interferon (IFN)\u03b3, tumor necrosis factor (TNF)\u03b1 and IL2. We anticipate that this study will not only contribute toward the development of a superior alternative to BCG, but will also stimulate designing of TB vaccines based on latency antigens. Mycobacterium tuberculosis to survive the hostile immune responses and persist in a non-replicating dormant state is fundamental to its success as a human pathogen. One third of the world's population is asymptomatically infected with M. tuberculosis and represents an enormous pool of latent tuberculosis (TB) infections. Reactivation of these latent infections, which is responsible for majority of TB cases, contributes significantly to the problems associated with the incidence, transmission and pathogenesis of TB M. bovis Bacille Calmette Guerin (BCG), which provides consistent protection against severe forms of child hood TB, loses its potency gradually resulting in an inadequate protection in adults and elderly people The ability of M. tuberculosis revealed that \u03b1-crystallin , a member of DosR-DosS/DosT dormancy regulon, represents one of the most abundantly produced proteins during exposure to hypoxia, nutrient starvation and transition of actively dividing bacilli to a dormant state Transcriptome and proteome analysis of M. tuberculosis infection, however, it could not surpass the protective efficacy of BCG M. tuberculosis challenge. In addition, we attempted to establish an association between the dynamic changes in the pulmonary cytokine milieu and vaccine-induced protection. Further, we delineated an association between multi-functional T cell responses and protective efficacy of these vaccine regimens. This study shows that vaccination regimens designed to target latency-associated antigens can elicit a superior protective immunity than BCG against TB.We have previously reported a DNA vaccine expressing \u03b1-crystallin (DNAacr) that protected guinea pigs against M. tuberculosis was prepared by transformation of BCG with a recombinant plasmid (pSD5.hsp65.acr) engineered to over-express \u03b1-crystallin under the transcriptional control of promoter of the hsp65 gene of M. leprae  when compared with the parental BCG strain , it maintained the saturation A600 nm for a considerably longer duration than the wild type BCG. In the death phase, while, BCG showed a sharp decline in A600 nm, the corresponding decline in the case of rBCG was considerably slower. The in vitro growth kinetics indicates that over-expression of \u03b1-crystallin in rBCG perhaps protects the aging bacteria to some extent against autolysis owing to the chaperonic activity of \u03b1-crystallin, which is known to stabilize the cell wall and intracellular structures. These observations are in coherence with a previous study, which showed a slower decline in the viability following the end of log-phase growth of recombinant M. tuberculosis over-expressing this protein To determine whether the higher production of \u03b1-crytallin by rBCG influences its  19 days . Both BCM. tuberculosis. For this, 12 weeks after the primary immunization, guinea pigs were infected with 50\u2013100 bacilli by aerosol route and euthanized at 10 weeks post-infection (Exp-I). As described in a seminal study by EU TB vaccine cluster, involving evaluation of 24 TB vaccine regimens in guinea pig model, the dose of infection employed in this study not only allowed induction of measurable clinical illness in 100% of control animals but also permitted discrimination with respect to BCG within a relatively short time frame (10 weeks) p<0.05)  and rBCG  resulted in a comparable reduction in bacillary load when compared to the unvaccinated animals. However, the \u2018rBCG prime-DNA boost\u2019 regimen (R/D) conferred a far greater protection with a markedly reduced bacillary count when compared to the unvaccinated animals . Moreover, the magnitude of protection by R/D regimen was especially noteworthy, as it resulted in 1.34 log10 and 1.72 log10 fewer bacilli in lungs and spleen, respectively in comparison to BCG vaccination (p<0.05),  . Immunizp<0.05), .10 fewer bacilli), but not in spleen, when compared to the unvaccinated animals. However, remarkably the R/D regimen continued to impart a significant protection as was evident from a substantially reduced bacillary load both in lungs (by 2.75 log10) and spleen (by 1.65 log10) in comparison to the BCG vaccinated animals (p<0.01), . As disease severity increased with time, one third of the unvaccinated animals (2/6) succumbed to the disease. Although, no mortality was observed in the BCG group, the bacillary load in the lungs and spleens of BCG vaccinated animals was observed to be as much as in the case of unvaccinated animals (surviving ones) indicating a considerable decline in the protection conferred by BCG vaccination on extending the post-challenge period to 16 weeks . In contp<0.01), . The infM. tuberculosis antigen load in lung tissues by in situ localization of Ag85 complex proteins that in addition to indicating the presence of live bacilli, served as a marker of dead bacilli, bacillary remnants as well as secreted antigens (a source of inflammation) p<0.001). Particularly, in concordance with the reduced bacillary load, animals vaccinated with R/D regimen exhibited a minimal antigen load both at 10 and 16 weeks post infection in comparison to saline and BCG immunized animals  encompassing scattered areas of necrosis in lungs along with lymphocytic infiltration in the hepatic lobules (\u223c43%) . AnimalsThe protective effect of \u03b1-crystallin based prime boost vaccination was further substantiated by pathological observations in Exp-II. While BCG and rBCG vaccinated guinea pigs exhibited an increased disease severity with time, animals vaccinated with R/D regimen exhibited minimal gross lesions in liver and spleen along with a considerably lower pulmonary pathology compared to BCG and rBCG vaccinated animals . Histolop<0.05), it remained markedly higher in comparison to R/D vaccinated animals  . At thisp<0.05), when compared to 10 weeks time point (p<0.05), while the levels of TNF\u03b1 and TGF\u03b2 remained unaltered. Notably, animals vaccinated with R/D regimen exhibited a marked up-regulation in the expression of all the cytokines investigated, with the highest up-regulation noticed in case of IL12, when compared to the 10 weeks time point  , a marked functional heterogeneity was observed in the CD4 T cell subsets isolated from different groups in terms of their ability to produce IFN\u03b3, TNF\u03b1 and IL2 . R/D vac animals . In addi animals .+ (IFN\u03b3+TNF\u03b1+ IL2+) and 2+ (producing any two cytokines) CD4 T cells in R/D vaccinated animals compared to BCG, rBCG and sham immunized animals  of 3+ CD4 T cells, integrated MFI (iMFI\u200a=\u200a%frequency\u00d7MFI) for all the three cytokines of these cells remained markedly higher in R/D vaccinated animals compared to rest of the groups , this regimen also slowed down the dissemination of bacilli to spleen to the extent that no bacillary growth was detected in spleen at 2 weeks post-infection. These observations are especially noteworthy, since, at such an early time point, BCG vaccination, as seen in this study  and spleen (p<0.01), respectively]. Moreover, the magnitude of protection in lungs by R/D regimen was especially noteworthy, as it resulted in 0.52 log10 fewer bacilli in lungs in comparison to BCG vaccination (p<0.05). At this time point, rBCG vaccination however conferred a comparable protection to that observed in case of BCG vaccination.By 4 weeks post-infection, all the vaccine regimens resulted in a marked reduction in lung and spleen bacillary load when compared to sham immunization . However10 and 1.1 log10 fewer bacilli in lungs (p<0.001) and spleen (p<0.01), respectively] , (10 (p<0.01) and 1.57 log10 (p<0.001) fewer bacilli, respectively], the reduction in splenic bacillary load was statistically significant only in case of rBCG group .Further, at 10 weeks post-infection, R/D regimen continued to impart the highest protection, as was evident from a markedly reduced bacillary load both in lungs and spleen in comparison to the unvaccinated animals [1.6 logctively] . Moreovep<0.05), . At thisM. tuberculosis infection.Altogether, the observations in the murine model indicate that the induction of a multifunctional Th1 cell response by R/D regimen significantly contributes to the enhanced protection against M. tuberculosis infection in guinea pigs. The pathology and cytokine expression data from guinea pigs support the protective potential of \u03b1-crystallin based prime boost approach. Further, the findings in murine model provide evidence for the importance of multi-functional CD4 Th1 response in protection against M. tuberculosis infection. Vaccination with R/D regimen not only induces a heightened multi-functional CD4 Th1 cell response, but also demonstrates a significant control on the bacillary multiplication in the early as well late phase of infection.Latency associated antigens have been proposed to be prospective candidates for vaccine development against TB, however, only a few studies to date have explored the vaccine potential of such antigens M. tuberculosis infection resulting in a large pool of latently infected individuals. In a recent study, Henao-Tamayo and colleagues reported that generation of inadequate central memory T cell response by BCG vaccine renders the host susceptible to TB infection or reactivation at the onset of adulthood et al. indicated that inability of BCG to provide sterilizing immunity against primary M. tuberculosis infection may also stem from the inadequate immune response that it generates against latency associated antigens, such as \u03b1-crystallin Two main caveats of BCG vaccine are related to its variable efficacy and inability to impart sterilizing immunity against M. tuberculosis infection et alVaccination induced alterations in the cytokine milieu dictate the outcome of the infection +) CD4 Th1 cell response in conferring protection against M. tuberculosis infection by R/D vaccination. Moreover, induction of a larger repertoire of both TNF\u03b1+IL2+ and IFN\u03b3+TNF\u03b1+ 2+ CD4 T cells by R/D regimen perhaps provides a reservoir of long-term central memory CD4 T cells as well as a pool of effector cells. In contrast, BCG vaccination, which results in a relatively lower proportion of 3+ and 2+ cytokine producing CD4 T cells, is limited in its ability to mediate an efficient and sustained protection. Although, the data from mice study, wherein we analysed the immunological responses on pooled samples need to be interpreted cautiously, it does indicate a crucial role of multifunctional CD4 T cell response against M. tuberculosis infection. Moreover, these findings are in coherence with a seminal study, which indicated that it is the ability of Th1 cells to produce multiple cytokines, which determines the potency of these cells in mediating protection against intracellular infections, such as Leishmania major and M. tuberculosisM. tuberculosis infection and a formal demonstration of the involvement of multifunctional T cells in mediating protection in guinea pigs is still awaited due to the unavailability of immunological regents for guinea pigs, the immunogenicity and protective efficacy studies in murine model do indicate a crucial role of multifunctional Th1 cell response in mediating protection against TB.Recent studies have emphasized that diseases, such as tuberculosis, leishmaniasis and HIV/AIDS, which particularly require Th1 response for an efficient control, rely considerably on the presence of multi-functional memory and effector T cells et al. reported that the immunomodulatory effect of an efficient booster vaccine remains unaltered irrespective of the time span between the primary BCG vaccination and boosting as these investigators found no significant difference in the magnitude of immune responses generated, when the booster was administered a few months or many years after BCG vaccination The \u2018rBCG prime - DNA boost\u2019 regimen employed in this study provides multiple advantages and possibilities in terms of its clinical relevance. Firstly, in this regimen, the use of rBCG in place of BCG in newborn children will not only preserve the valuable attributes of BCG, but will also result in an efficient immune response and superior protection against pulmonary TB. Secondly, a booster dose of DNA vaccine would further enhance and sustain the rBCG-induced immunity. In a significant finding, Pathan Guinea pig experiments were reviewed and approved by the Institutional Animal Ethics Committee of National JALMA Institute for Leprosy & Other Mycobacterial Diseases, Agra, India (Permit number: 101/1997/CPCSEA). Mice experiments were reviewed and approved by the Institutional Animal Ethics Committee of University of Delhi South Campus, New Delhi, India (Permit number: 159/1999/CPCSEA). All animals were routinely cared for according to the guidelines of CPCSEA , India.Mycobacteria - Escherichia coli shuttle plasmid pSD5.pro Rv2031c) under the transcriptional control of the promoter of hsp65 gene of M. leprae. Briefly, the gene encoding \u03b1-crystallin (Rv2031c) was PCR amplified by using M. tuberculosis H37Rv genomic DNA as the template and gene specific primers (forward- 5\u2032gggcatcatatggccaccaccc 3\u2032 and reverse- 5\u2032gggacgcgtcagttggtggaccggatgtg 3\u2032). The PCR amplicon was then cloned into pSD5.hsp65 at Nde I and Mlu I restriction sites and the resulting construct was designated as pSD5.hsp65.acr. The recombinant plasmid was electroporated into wild type M. bovis BCG and selected on MB7H11 plates containing Kanamycin (25 \u00b5g/ml).For preparation of rBCGacr, a M. tuberculosis (H37Rv strain), M. bovis BCG (Danish strain) and rBCG cells were grown to mid-log phase in Middle Brook 7H9 media and stocks were prepared as described 600 nm).BCG and rBCG were grown in MB7H9 broth supplemented with 1\u00d7 ADC and 0.2% Tween 80. Growth was assessed at the intervals of 24 hr for 19 days by measuring the absorbance of the culture spectro-photometrically at a wavelength of 600 nm  rBCG once, followed by a booster dose of DNA vaccine or vector  by i.m. route at 6 weeks (R/D and R/V) and (v) 100 \u00b5l of saline by i.d. route (control group). Guinea pigs were infected 12 weeks after the primary immunization with \u223c50\u2013100 bacilli of virulent M. tuberculosis H37Rv via the respiratory route in an aerosol chamber (Glasscol Inc.).For evaluation of protective efficacy two guinea pig experiments were carried out. Guinea pigs in groups of 5\u20136 were immunized with the following regimens:  5\u00d71010 CFU/g. For isolation of RNA to be used for real time RT-PCR studies, a portion of left cranial lung lobe was stored in RNA later (Ambion) at \u221220\u00b0C.Animals were monitored regularly for change in body weight and general body condition as an indicator of disease progression and were euthanized at 10 weeks  and 16 weeks  post-infection by intraperitoneal injection of Thiopentone sodium (100 mg/kg body weight) (Neon Laboratories Ltd.). After dissecting the animals, lung, liver and spleen were examined for gross pathological changes and scored by using the Mitchison scoring system in situ localization of M. tuberculosis antigens in the sections of guinea pig lungs, immunohistochemical (IHC) staining was carried out and analysed for area and intensity of staining as described earlier For Real time PCR was performed by using SYBR green PCR Master Mix (Applied Biosystems) by using the cDNA synthesized from total RNA isolated from the lungs of guinea pigs as described To further confirm the protective efficacy observed in guinea pig experiments, we carried out a similar protection study in mouse model. Mice in groups of 4 were immunized and infected following the same protocol as used for guinea pigs. At 2, 4 and 10 weeks post-infection, bacillary load in lungs and spleen was determined. Immune responses were evaluated at 12 weeks post-immunization (at the time of infection).Spleen cells were isolated as described Following stimulation, cells were washed with PBS containing 2% heat inactivated FBS and T lymphocytes were purified by using BD IMag\u2122 Mouse T Lymphocyte Enrichment Kit according to the manufacturer's instructions. Briefly, a cocktail of biotinylated antibodies were added to the cells that simultaneously bind erythrocytes and leukocytes but not T lymphocytes. The cells were then washed to remove excess antibodies followed by the addition of BD IMag\u2122 Streptavidin. Unlabelled T lymphocytes were then enriched by negative selection by placing them within the magnetic field of the BD IMagnet\u2122 as per the manufacturer's instructions. Cells were washed and incubated with BD Fc Block\u2122 (CD16/CD32 mAb to block Fc binding). Subsequently, the cells were stained for cell surface markers, CD4 (FITC) or CD8 (FITC) along with intracellular cytokines, IFN\u03b3 (RPE), TNF\u03b1 (PerCPCy5.5) and IL-2 (APC) by using the BD Cytofix/Cytoperm kit according to the manufacturer's instructions. Cells were washed twice with Cytoperm and finally resuspended in sheath fluid. Cells  were acquired by using a FACS Calibur flow-cytometer (by using Cell Quest Pro software) and analyzed by using FlowJo software (Tree Star). Cell frequency, median fluorescence intensity (MFI) and integrated MFI (iMFI\u200a=\u200a% frequency\u00d7MFI) for different cytokines were calculated. For cell stimulation and FACS analysis, cells pooled from all 4 mice from a group were used. All the reagents for cell isolation and antibodies for FACS staining were obtained from BD Pharmingen, except where mentioned otherwise.U test were employed for the comparison of gross pathological score, granuloma % and IHC score. Differences were considered significant, when p<0.05. For statistical analysis SPSS  and Prism 5 software  were used.For the comparison of CFU and % fold induction in mRNA expression level, One-way ANOVA was carried out followed by Tukey Test. Non-parametric Mann-Whitney"}
+{"text": "The traditional medicine, such as camel milk, is heavily used by the large sector of HCV patients to control the infection due to the high cost of the available standard therapy. Camel milk contains lactoferrin, which plays an important and multifunctional role in innate immunity and specific host defense against microbial infection. Continuing the analysis of the effectiveness of camel lactoferrin against HCV, the current study aimed to separate and purify the native N- and C-lobes from the proteolytically cleaved camel lactoferrin (cLF) and to compare their Lactoferrin and its digested N- and C-lobes were purified by Mono S 5/50 GL column and Superdex 200 5/150 column. The purified proteins were assessed through three venues: 1. To inhibit intracellular replication, HCV infected cells were treated with the proteins at different concentrations and time intervals; 2. The proteins were directly incubated with the viral particles  and then such neutralized viruses were used to infect cells; 3. The cells were protected with proteins before exposure to the virus. The antiviral potentials of the cLf and its lobes were determined using three techniques: 1. RT-nested PCR, 2. Real-time PCR, and 3. Flow cytometry.N- and C-lobes were purified in two consecutive steps; using Mono-S and Superdex 200 columns. The molecular mass of N- and C-lobes was about 40\u00a0kDa. cLF and its lobes could prevent HCV entry into Huh 7.5 cells with activity reached 100% through direct interaction with the virus. The inhibition of intracellular viral replication by N-lobe is 2-fold and 3-fold more effective than that of the cLF and C-lobe, respectively.Generated native N- and C-lobes from camel lactoferrin demonstrated a range of noticeably different potentials against HCV cellular infectivity. The anti-HCV activities were sorted as N-lobe\u2009>\u2009cLf\u2009>\u2009C-lobe. The body fluids, organs and tissues of animals contain a number of natural antimicrobial agents that kill various microbes or inhibit their growth. One of these antimicrobial agents is lactoferrin (LF). LF is a multifunctional glycoprotein which found in milk and other secretions, and is known to play an active role in innate immunity. LF exerts its antimicrobial activity against various pathogens including fungi, bacteria, and viruses ,2. LactoFlaviviridae family /(A) count of positive control\u2009\u00d7\u2009100% .Flow cytometric analysis was used to elucidate the antiviral activity of the cLF and its lobes against HCV. The cells were washed three times from debris and dead cells using RPMI 1640 media or 1.0\u00d7 PBS. Intracellular labeling was performed by indirect immunofluorescence. Cells were centrifuged and cell pellets were washed twice with 1.0\u2009\u00d7\u2009PBS containing 1% normal goat serum, cells were incubated with 4% paraformaldehyde for 10\u00a0min and 0.1% Triton X-100 in Tris HCl buffer pH\u00a07.4 for 6\u00a0min. After washing three times with 1.0\u2009\u00d7\u2009PBS, cells were incubated with monoclonal antibody  against HCV core  at room temperature for 1\u00a0h . The celP-value of \u22640.05 was considered statistically significant.Data were analyzed by Student\u2019s t-test. All experiments were repeated three times and each value represents the average of three determinations. Data are shown as means\u2009\u00b1\u2009SEM (the standard error of the mean) of three independent experiments. A Camel lactoferrin was purified from skimmed milk by chromatography on a cation-exchange MonoS 5/50 GL column and eluted by 0.0-1.0\u00a0M NaCl gradient. The peak containing cLF  after 0.5 or 1\u00a0h from incubation of enzyme and substrate as shown in Figure\u00a0N- and C-lobes of cLF were purified from cLf proteinase K digestion reaction using a cation-exchange Mono S 5/50 GL column. The results showed that the native N-lobe was eluted at 0.9\u00a0M NaCl while the C-lobe did not bind to resin Figure\u00a0A. The frCell proliferation was assayed by MTT method using Huh 7.5 cell-line to exclude any possibility that the elimination of the viral particles was caused by reducing the viability of the cells. The results revealed that both 0.5 and 1.0\u00a0mg/ml of N-lobe failed to exhibit any significant effect on the Huh7.5 cells viability after 7\u00a0days of incubation. However, both cLf and C-lobe induced a reduction in Huh 7.5 cell-viability after 7\u00a0days of incubation at concentrations of 0.5 and 1.0\u00a0mg/ml (Table\u00a05) Huh 7.5 cells were cultured, in duplicate; one of the cultures was inoculated with HCV infected sera pretreated with cLF, N- or C-lobe (0.5 or 1.0\u00a0mg/ml). The inoculated cells were cultured for seven days. At different proteins concentration used, a band of 174\u00a0bp was not amplified . Inhibition of viral replication was detected by amplification of viral RNA segments using the RT-PCR technique. Camel lactoferrin could inhibit the intracellular HCV replication at concentrations starting from 0.75, 1.0 and 1.25\u00a0mg/ml after 4\u00a0days  were effective in inhibiting oferrins . The antoferrins . HCV is oferrins , and infoferrins . The infoferrins ,47. The oferrins  and reacoferrins . Howeveroferrins .et al., [et al. [The current study attempted to separate and purify N- and C-lobes from the proteolytically digested camel lactoferrin and to evaluate potential inhibitory effects of these proteins on HCV entry into the Huh7.5 cells. Huh7.5 are normal HCV-susceptible cells ,51. Sepaet al.,  and is s [et al. , who estet al. [et al. [The N- and C-lobes were prepared by enzymatic hydrolysis of iron-saturated cLF. Different protein fragmentation profiles were generated by different enzymes . The best profile was produced by the proteinase K at ratio 1:50 after 60\u00a0min, where digested lactoferrin mostly produced polypeptides of 40\u00a0kDa and to less extend some low molecular mass peptides of <14\u2009\u00b7\u20094\u00a0kDa. The digested cLF was fractionated using a cation-exchange Mono S column. Both lobes were further purified by gel-filtration Superdex 200 column and identified as the C- and N-lobes based on their N-terminal sequences as previously reported . The molet al.  who used [et al.  who obta [et al. .The cytotoxicity of cLF and its N- and C-lobes was tested by the cell MTT proliferation assay. The highest cytotoxic effect was established for C-lobe  followed by intact cLf , whereas N-lobe possessed the lowest cytotoxic effects.Although the C-lobe is expected to be structurally similar to the N-lobe based on the amino acid similarity of 35% , their aIn vitro, the N-lobe was more potent than cLF and C-lobe in treatment of the HCV-infected cells. Here, it was able to inhibit the HCV replication inside infected Huh7.5 cells with the relative activity around 100% at concentrations from 0.25 to 1.25\u00a0mg/ml after 4\u00a0days. This inhibitory activity of cLF seems to be in agreement with the previous study, which used cLF to inhibit HCV (genotype 4) entry into human PBMCs [Native cLF or its N- and C-lobes are able to neutralize the HCV particles with relative efficiency of about 100%, suggesting that both the N-lobe and the C-lobe possess functional domains sufficient for the recognition of the E1 or E2 proteins in the HCV envelope or blocking the virus receptors on the cell surface. an PBMCs . The potan PBMCs , which man PBMCs  study coan PBMCs . Also, fan PBMCs ,30,39. Tet al., [2, and (C-s3-33)3 have been studied in details on PH5CH8 cell line [3 enhanced the ant-HCV activity compared with the monomeric C-s3-33 form, but the antiviral activity of the three forms was still several fold weaker than that of the original human lactoferrin [pI values (>9), which are important determinants of their antimicrobial potency [pI values of 9.15, 7.48, and 8.63, respectively. This, perhaps, explains why the N-lobe of camel lactoferrin was shown to have a superior potency over the intact lactoferrin and its C-lobe in the three experimental models analyzed in the current study.Beleid et al.,  had evalell line . It was toferrin . Besides potency . AccordipI values ranging from 5.99 to 10.06. This finding may agree with the results of the current study and previous reports [Generally, the lactoferrin is considered as a rich source for cationic and amphipathic peptides, which may use against wide range microbes . These p reports , which dKd approx.20-100 nM). T-lymphocytes and monocytes bind and internalize bound Lf much less efficient in comparison with the hepatocytes, which can take up ~5000 Lf molecules per cell, per second [2+-dependent manner, they were poorly internalized by hepatocytes as compared to the internalization of the C-lobe and the native lactoferrin [Since the blood circulating lactoferrin is cleared by the liver , lactofer second  through r second . Previour second . Althougtoferrin . This meIt also very likely that this difference in the biological activities of cLf and its lobes can be determined by the divergence in some of their structure-related characteristics. This hypothesis is supported by Figure\u00a0Our results demonstrated that there are at least three potential venues for the cLf and its lobes to serve as antiviral agents. Although the full-length cLF and its lobes possess different efficiencies, they all can protect the Huh7.5 against HCV infection, neutralize the intracellular HCV replication, and treat the infected Huh7.5 cells. HCV entry to the host cell is a complex, multistage process requiring action of four receptors, fusion, and endocytosis. HCV fusion depends on the E1 and E2 proteins, viral dose, and occurs within a specific pH range. Is the lactoferrin and/or its lobes iron sequestration or release have a role in the pH changes within the microenvironment around the cells during HCV cellular entry? It is still unclear how the lactoferrin and/or its lobes act against viral particles. Several mechanisms of action have been suggested for the LFs antiviral activities. Two of these mechanisms are 1) direct interaction between the viral molecules and LF, and 2) LF interaction with the cellular glycosaminoglycans  of the viral receptors. The most widely accepted hypothesis is the LF-viral receptor pathway . The binThe ubiquitous heparan sulfate proteoglycans (HSPGs), which are widely distributed on mammalian cells, have been identified as potential targets for a number of viruses -85, suchin vitro HCV (genotype 4a) entry into the Huh7.5 cells. This inhibition was not restricted only to the neutralization of the viral molecules, but the activity was extend to the suppression of the intracellular viral replication. Native cLF its N- and C-lobes also possess some protective effects on the cells themselves. These remarkable anti-HCV activities of camel Lf and its lobes require additional work to understand how they work during their extra- and intracellular antiviral action. Additional work is also needed to find safe ways of N-lobe delivery in vivo. It is also clear that the action of the lactoferrion and its lobes on the HCV cannot be completely understood without looking deeply into their structures.Our results demonstrated that the camel native lactoferrin and its N- and C-lobes have divergent inhibitory action against Authors declare that they have no competing interest.EME, conduct tissue culture, viral screening research, made protein purifications and all immunoassays; EME and EMR wrote the draft of manuscript, tabulated the data, and collected some references; MHL contributed with new reagents/analytical tools, help in manuscript revision, data organization, data analysis, EMR, design research, manuscript finalizing in its final form. EMR and VNU constructed the figures, revised the draft, and put together the final version. All the authors read and approved the final manuscript. This work is dedicated to the spirit of Dr. Nezar A Redwan.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6882/14/219/prepub"}
+{"text": "Nampt gene homozygous knockout (Nampt\u2212/\u2212) resulted in lethality at an early stage of mouse embryonic development and death within 5\u201310 days in adult mice accompanied by a 25.24\u00b12.22% body weight loss, after the tamoxifen induction of NamptF/F \u00d7 Cre mice. These results substantiate that Nampt is an essential gene for life. In Nampt\u2212/\u2212 mice versusNampt+/+ mice, biochemical assays indicated that liver and intestinal tissue NAD levels were decreased significantly; histological examination showed that mouse intestinal villi were atrophic and disrupted, and visceral fat was depleted; mass spectrometry detected unusual higher serum polyunsaturated fatty acid containing triglycerides. RNA-seq analyses of both mouse and human pediatric liver transcriptomes have convergently revealed that NAMPT is involved in key basic cellular functions such as transcription, translation, cell signaling, and fundamental metabolism. Notably, the expression of all eight enzymes in the tricarboxylic acid cycle were decreased significantly in the Nampt\u2212/\u2212 mice. These findings prompt us to posit that adult Nampt\u2212/\u2212 mouse lethality is a result of a short supply of ATP from compromised intestinal absorption of nutrients from digested food, which leads to the exhaustion of body fat stores.Nicotinamide phosphoribosyltransferase (NAMPT) is a pleiotropic protein implicated in the pathogenesis of acute respiratory distress syndrome, aging, cancer, coronary heart diseases, diabetes, nonalcoholic fatty liver disease, obesity, rheumatoid arthritis, and sepsis. However, the underlying molecular mechanisms of NAMPT in these physiological and pathological processes are not fully understood. Here, we provide experimental evidence that a  NAMPT catalyzes the condensation of nicotinamide with 5-phosphoribosyl-1-pyrophosphate to yield nicotinamide mononucleotide, an intermediate in the biosynthesis of NAD.2 In 2005, Fukuhara et al.3 reported Nampt as a Visfatin, which was enriched in visceral fat with insulin-mimetic function. The list of NAMPT's physiological roles is continuously growing. The dysregulation of NAMPT gene has been implicated in several human diseases.4 However, the underlying molecular mechanisms are not fully understood.Nicotinamide phosphoribosyltransferase (NAMPT) was initially named pre-B-cell colony-enhancing factor (PBEF)5 Recently, three groups reported that there are about 2000 core genes essential for life in several types of human cells.8 They also found that the essentiality of some genes is context-dependent and affects viability in a cell-type-specific manner.9 It is more logical to establish any essential gene in an animal model, by exploring the terminal phenotypes and the various molecular mechanisms underlying lethality. The mouse has long been regarded as an ideal model system for this purpose. Conservation between humans and mice is underscored by strong one-to-one orthologous relationships between genes of the two species.10 We have previously reported that the Nampt gene DNA coding sequence between mouse and human is 96% identical.11 Hence, the homozygous Nampt gene knockout in mice would offer an attractive model to decipher fully the Nampt gene's pleiotropic roles, by probing molecular mechanisms underlying lethality in adult mice.Loss-of-function experiments reveal the functions of a gene. The most dramatic phenotype is lethality, defining a gene as essential.Nampt gene homozygous knockout (Nampt\u2212/\u2212) resulted in mouse embryonic lethality at an early stage. We also established Nampt gene conditional knockout mice and found that induced Nampt\u2212/\u2212 adult mice died within 5\u201310 days, accompanied by a 25.24\u00b12.22% body weight loss. These results substantiate that Nampt is an essential gene in vivo. RNA-seq analyses of both mouse and human pediatric liver transcriptomes revealed that Nampt is involved in key basic cellular functions such as transcription, translation, cell signaling, and fundamental metabolism. Particularly, expression of all eight enzymes in the tricarboxylic acid cycle(TAC) in Nampt\u2212/\u2212 adult mice were decreased significantly, which suggests that depletion of cellular ATP energy sources may be the main culprit of adult Nampt\u2212/\u2212 mouse death.Here, we provide experimental evidence that the Nampt gene, we established the Nampt gene-trapped mouse model , Nampt heterozygous (Nampt+/\u2212), and Nampt knockout (Nampt\u2212/\u2212) mice as indicated in Nampt+/+, Nampt+/\u2212, and Nampt\u2212/\u2212 mice are presented in Nampt\u2212/\u2212 knockout mice, Nampt+/\u2212 male and female mice were bred. At embryonic day 11.5, Nampt+/+ and Nampt+/\u2212 embryos both have normal development with 40\u201345 pairs of somites, and normal embryo size. Nampt\u2212/\u2212 embryos are much smaller in size, and display unclear abnormal embryo structure . The Nampt gene spans over 36.9\u2009kb and contains 11 exons and 10 introns, thus preventing the convenient floxing of its entire gene. We decided to introduce loxP sites into introns flanking exon 2. A Neo selection cassette flanked by FRT sites was inserted adjacent of the loxP site within intron-1 as well (Namptflox(Neo) targeting vector was introduced into mouse embryonic stem cells (mES), which were then injected into C57BL/6 host blastocysts to generate chimeric mice (Namptflox(Neo)/+ heterozygous mice were crossed with the ACTB::FLPe deleter mouse line to remove the PGK-Neo cassette, which has been reported to interfere with gene expression , Namptflox/flox mice (n=10) displayed rapid weight loss. These mice became dehydrated, less active on day 3 after injection and reached >20% weight loss within 5\u201310 days before dying  in Nampt\u2212/\u2212 mice were identified, of which 2434 genes were upregulated and 2204 genes were downregulated . GO biological process showed that 1050 genes were involved in 106 metabolic processes and 272 genes were involved in 43 biosynthetic processes. In 91 metabolic processes and 40 biosynthetic processes, there were more downregulated genes than upregulated genes , whose conditional homozygous knockouts caused the death,13 between Nampt\u2212/\u2212versus Nampt+/+ mice, to determine whether the Nampt\u2212/\u2212 caused lethality is due to downregulation of these genes. Only the Rpa3 gene expression was significantly downregulated in Nampt\u2212/\u2212 mice versus Nampt+/+ mice , 2, 4-dienoyl CoA reductase genes , and the enoyl-CoA isomerase (Eci1) were all downregulated in Nampt\u2212/\u2212 mice compared with the Nampt+/+ control mice. This may explain the increased accumulation of serum high polyunsaturated fatty acid containing TGs in Nampt\u2212/\u2212 mice compared with the Nampt+/+ control mice , which catalyzes the formation of NAD+ from nicotinamide mononucleotide (NMN), was decreased significantly. Ectonucleotide pyrophosphatase/phosphodiesterase 3(Enpp3), which catalyzes the hydrolysis of pyrophosphate bonds in NAD+ to regenerate NMN, Nudix (nucleoside diphosphate linked moiety X)-type motif 12 (Nudt12), which cleaves NAD+ to AMP and NMN, and Nicotinamide riboside kinase 1 (Nmrk1), which catalyzes the nicotinamide-\u03b2-riboside to form NMN were all downregulated. Expression of three enzyme genes, Nt5c2: 5\u2032-nucleotidase, cytosolic II (Nt5c2), 5\u2032-nucleotidase, cytosolic IIIB (Nt5c3b), and Purine-nucleoside phosphorylase (Pnp), were all upregulated. Activation of these genes contributes to the generation of nicotinamide from NMN. All these interactions led to the decreased synthesis of NMN and hence NAD. Indeed, we found that NAD levels in liver tissue and jejunum tissue were decreased significantly in Nampt\u2212/\u2212 mice versus Nampt+/+ mice and paralleled to their body weight loss. In liver tissues, NAD levels are significantly lower in 20 and 15% body weight loss groups than the control group . In both tissues, NAD levels are decreased in 5% body weight loss group too.Nampt gene knockout on the expression of seven sirtuin genes. RNA-seq revealed that expression of Sirt3, 4, and 5 in mitochondria were decreased significantly while expression of Sirt1 in nuclei was increased significantly in Nampt\u2212/\u2212 mice versus Nampt+/+ mice  mice were embryonically lethal and Nampt\u2212/\u2212 adult mice died within 5\u201310 days with 25.24\u00b12.22% body weight loss. Although several groups \u2013 including ours \u2013 previously noted that Nampt gene homozygous knockout mice were embryonic lethal, none of them reported physical evidence.17 Here, we have presented the morphological and genotyping evidence of mouse embryos at both 8.5 and 11.5\u2009d.p.c. , a consortium of research groups in the San Francisco Bay Area funded as part of the NHLBI's Programs for Genomic Applications.34 The verified RRR084 clone was injected into C57BL/6N (NCI) blastocysts to generate chimeras in the Johns Hopkins University School of Medicine  transgenic facility. The generated chimeric Nampt+/\u2212 mice were genotyped by PCR of their tail DNAs. The chimeric Nampt+/\u2212 mice were backcrossed with C57BL/6J for 10 generations before their usage. All mice were fed an AIN-76 A diet and water ad libitum. They were housed under controlled conditions . All mouse experiments were conducted in accordance with the NIH guidelines and were approved by the University of Missouri Kansas City Animal Care and Use Committee.A mouse (129/Ola) embryonic stem (ES) cell line (RRR084) harboring characterized insertional mutation in the intron-7 of mouse Nampt gene mutant mouse embryos were obtained by timed pregnancy after breeding between Nampt+/\u2212 male and Nampt+/\u2212 female mice. Visual observation of a vaginal plug in female Nampt+/\u2212 mice after the mating was counted 0.5 days post coitum (d.p.c.). Mouse embryos at 8.5 or 11.5\u2009d.p.c. were harvested and fixed in 4% paraformaldehyde for 24\u2009h. The genotyping of mouse embryos was done by PCR amplification of yolk sac DNA. Mouse embryos at 8.5\u2009d.p.c. were also subjected to \u03b2-Gal staining.The early stages of Nampt gene target vector prepared in our lab, in which the exon 2 of Nampt gene was floxed, was electroporated into a B6-White Murine ES Cell Line  and injected into C57BL/6J mouse blastocysts in The Transgenic Animal Core, University of Missouri, Columbia, USA. The generated chimeric NamptF/F mice were verified by PCR analyses of their tail DNAs.A Nampt\u2212/\u2212 mice were generated by mating NamptF/F mice with B6.Cg-Tg(CAG-cre/Esr1*)5Amc/J followed by administering tamoxifen induction.Adult Formalin-fixed mouse intestinal tissue samples were embedded in paraffin, and 5-micron-thick sections were cut. Replicate sections were stained with hematoxylin and eosin (H & E) according to standard methods.35 and (http://www.metabolomicsworkbench.org/protocols/getprotocol.php?file_id=163). The analysis was conducted on a Waters Acquity UPLC coupled to a Waters Xevo G2-qTOF (quadrupole time-of-flight) mass spectrometer. The samples were analyzed in positive electrospray mode, and the data were acquired using the MSe acquisition format with a scan rate of 2\u2009Hz. High-energy MSe scans were ramped from 15\u2009eV to 30\u2009eV. A leucine enkaphlin (2\u2009\u03bcg/ml) solution was used as lockspray solution. Data processing, including chromatographic alignment and peak picking occurred in Progenesis QI 2.0. Potential markers were identified by matching the molecular ion (5\u2009p.p.m. error) and fragment ions (50\u2009p.p.m. error) to the lipidblast database using the database search feature within progenesis QI. Further processing occurred by exporting the data to EZinfo 3.0.The serum samples were collected and stored at \u221280\u2009\u00b0C until analyzed. The samples were extracted and subjected to the ultra-high performance liquid chromatography \u2013 high resolution mass spectrometry UHPLC-HRMS procedure as outlined by Oliver Fiehn's groupNampt\u2212/\u2212 mice using the MirVana kit  according to the manufacturer's instructions.Total mouse liver RNA was isolated from either the wild-type mice or 36 except that sequencing library from 1\u2009\u03bcg total mouse liver RNA of each sample was prepared using the Illumina TruSeq Stranded Total RNA Sample Prep Kit (cat. No. RS-122-2201) and 2 \u00d7 101 paired-end sequencing of high output run mode was performed using the HiSeq 1500 instrument. Each sample was sequenced to an average depth of ~63 million reads with >80% of bases above Q30. The resulting base calling (.bcl) files were converted to FASTQ files using Illumina's bcl2fastq v2.17.1.14 software. Mapping of RNA-seq reads and transcript assembly and abundance estimation were conducted using Tuxedo Suite pipeline (TopHat v1.3.0/Bowtie v0.12.7/Cufflinks v1.0.3) and reported in Fragments Per Kilobase of exon per Million fragments mapped (FPKM).RNA-seq of mouse liver RNAs was carried out in the Core of Genetic Research, Children's Mercy, Kansas City, KS, USA, according to the previously published protocolNampt\u2212/\u2212 mice were analyzed using DAVID (https://david.ncifcrf.gov/)37 and Ingenuity Pathway Analysis  as we described before.39 Briefly, genes with a significant expression change (P<0.05) in mouse liver expression in Nampt\u2212/\u2212 mice versus wild-type mice were loaded into IPA and they were associated with various pathways in Ingenuity's Knowledge Base for the analysis. The significance of the association between the data set and any pathway was measured in two ways: (i) the ratio of the number of molecules from the data set that map to the pathway divided by the total number of molecules that map to the pathway, and (ii) Fisher's exact test was used to calculate a P-value determining the probability that the association between the genes in the data set and the pathway in IPA is explained by chance alone. Transcription factor prediction database (DBD)40 and Database of Essential Genes (DEG)41 were used to annotate mouse transcript factors and essential genes for differentially expressed gene list.The pathway analysis of differentially expressed gene lists in Forty-eight, anonymized pediatric liver samples, ages 0 days to 17 years, were received from the following sources: the NICHD Brain and Tissue Bank at the University of Maryland ; the Liver Tissue Cell Distribution System (funded by NIH Contract #N01-DK-7-0004/HHSN267200700004C); and six samples were received from XenoTech, LLC , to whom we are grateful for their generous gift of tissue samples. Thirty-four prenatal human liver samples  were received from an additional NICHD-funded tissue retrieval center, the Central Laboratory for Human Embryology . All tissues were flash frozen and maintained at \u221280\u2009\u00b0C before isolation of DNA and RNA. All the samples were from anonymous, deceased donors, and the use of these tissues was declared as nonhuman subjects research by the University of Missouri-Kansas City Pediatric Health Sciences Review Board.RNA-seq analyses of human pediatric liver samples were carried out as described above for mouse liver transcriptome analyses.Mouse liver and jejunum tissues (10\u201330\u2009mg) were homogenized and the supernatants were applied for NAD+/NADH assays using a Fluorimetric NAD+/NADH assay kit .t-test. Three or more group comparisons were carried out using ANOVA followed by a Holm\u2013Sidak test, P<0.05 was considered statistically significant.Statistical analyses were performed using the Sigma Stat . Results are expressed as means\u00b1S.D. of more than three samples for each group from at least two independent experiments. Two group comparisons were done by unpaired"}
+{"text": "ACE gene mutation (Arg532Trp substitution in the N domain of somatic ACE) that increases blood ACE activity 7-fold and interrogated the mechanism by which this mutation significantly increases blood ACE levels. We hypothesized that this ACE mutation disrupts the binding site for blood components which may stabilize ACE conformation and diminish ACE shedding. We identified the ACE-binding protein in the blood as lysozyme and also a Low Molecular Weight (LMW) ACE effector, bilirubin, which act in concert to regulate ACE conformation and thereby influence ACE shedding. These results provide mechanistic insight into the elevated blood level of ACE observed in patients on ACE inhibitor therapy and elevated blood lysozyme and ACE levels in sarcoidosis patients.Angiotensin I-converting enzyme (ACE) hydrolyzes numerous peptides and is a critical participant in blood pressure regulation and vascular remodeling. Elevated tissue ACE levels are associated with increased risk for cardiovascular and respiratory disorders. Blood ACE concentrations are determined by proteolytic cleavage of ACE from the endothelial cell surface, a process that remains incompletely understood. In this study, we identified a novel  The extracellular domains of diverse membrane-anchored proteins, such as tumor necrosis factor \u03b1 receptor (TNFR-\u03b1), L-selectin, ACE are released from the cell surface as soluble proteins through a regulated proteolytic mechanism - ectodomain shedding. Cell surface proteases such as the ADAMs , as well as a variety of molecular intra-and extracellular interactions, regulate this process2+ carboxydipeptidase with two catalytic centers334Angiotensin-converting enzyme , a ZnWe identified several ACE gene mutations that increase blood ACE levels (5\u201314 fold) including a mutation in the stalk region leading to greater ACE cleavage efficiency from the cell surface11ACE gene mutation (Arg532Trp) that increases blood ACE activity (7-fold) and interrogated the mechanism by which this mutation significantly increases blood ACE levels. We proposed a novel regulation of ACE conformation, and as a consequence, ACE shedding via direct binding of circulating blood components - lysozyme and bilirubin to ACE.In this study, we identified a novel Prior reports included several intracellular ACE-binding proteins - GRP78 (BiP), ribophorin 1, specific protein kinase C isoformsWe now report the identification of lysozyme and bilirubin as ACE-binding blood components that act in concert to regulate ACE conformation and likely influence on ACE shedding. These results convey several biological and therapeutic ramifications including a potential explanation for elevated blood ACE level in patients on ACE inhibitor therapy.Screening for ACE activity in plasma from 84 patients with sarcoidosis resulted in the identification of a case (#38) with markedly increased ACE activity (7-fold vs. control) . We expl10ACE exons and identified the R532W substitution in the N domain of the mature ACE protein (http://www.ncbi.nlm.nih.gov/projects/SNP/) and found in 5 out of 6220 chromosomes tested.We next sequenced all  protein . This re protein  listed iWestern blot analysis on CHO cells expressing wild-type (WT) or mutant R532W ACEs demonstrated that this mutation failed to either alter ACE expression or impact ACE dimerization. We concluded that high plasma ACE activity in subject #38, carrier of ACE R532W mutation, is likely the result of changes in ACE shedding, possibly via conformational changes. This possibility was confirmed by the conformational fingerprinting of mutant R532W ACE, which revealed multiple conformational changes in the N and C domains and a striking decrease in the binding of mAb 6A12 , which iWhat is the mechanism of this novel mutation in the N domain of ACE, very far from the stalk region, where membrane-bound ACE is cleaved by a still unidentified ACE secretase? How could this mutation change the rate of ACE shedding of the R532W mutant? We have demonstrated previously, that the binding of two mAbs to different, but overlapping epitopes on the N domain of ACE, 9B9 and 3A5, far from the interface of the N-domain dimer, including Y465 residue, results in 2\u20134 fold increase in somatic ACE shedding21Dilution of human plasma/serum (as well as adding ACE inhibitor) led to the increase in the relative binding of several mAbs to epitopes on both N and C domains of ACE , whereasThe positions of epitopes, whose mAbs binding to ACE increased upon dilution of the human plasma, also gave some additional information. Highly overlapping epitopes of mAbs 1G12 and 6A12 on the N domain are located close to the epitope for mAb 1E10 on the adjacent C domain . TherefoACE shedding from CHO-ACE cells was inhibited 2\u20133-fold in the presence of human and bovine serum . R532W AThe effect of serum on the cleavage/secretion process of proteins from endothelial cells was studied in detail in the past. The total amount of proteins cleaved from their surface, especially higher MW proteins, dramatically increased in the presence of serum, likely due to protection of newly released proteins from degradationWe also compared the effects of compound BB-94 (batimastat), as well as mAbs 9B9 and 3A5 to ACEThe hypothesis about serum components, e.g. ACE-binding protein(s), which are able to stabilize ACE conformation thus preventing an excessive ACE shedding, likely allows us to correctly explain the well-known effect of ACE inhibitor treatment, namely, significant increase in ACE levels in the blood of patients26This effect of enalaprilat  on ACE expression and ACE shedding was further tested on several ACE expressing cells under serum-free growth conditions: artificial ACE-expressing cells, i.e. CHO, HEK and Rat Lung Microvascular Endothelial Cells (RLMVEC) transfected with recombinant human ACE, and natural ACE-expressing cells, HUVECTherefore, the binding of inhibitors to ACE results in conformational changes in the ACE molecule  on ACE conformation and shedding is the rate of shedding of the shorter, one-domain testicular ACE (tACE). This rate was reported to be several times higher in comparison with the full-size, two domain somatic ACE (sACE), which was expressed under identical conditions in CHO cells30Our data allows us to hypothesize an additional explanation of a much higher rate of shedding of tACE. As shedding of both ACEs was estimated in the presence of 10% FBS, this difference could be due to less tight binding of the hypothetical ACE-binding serum component (ACE-binding protein) to the one-domain tACE isoform compared to the two-domain sACE, which, in turn, could lead to a higher rate of shedding of tACE. Therefore, we tested the effect of sera on the shedding of both tACE and sACEs from the surface of CHO cells - the shedding of full-size, two-domain ACE was dramatically inhibited by the presence of 10% serum, 34.5\u2009+\u20096.5% from that in serum free-medium, which was equal to 20.2%/per24\u2009hours . The effWhat proteins in the blood potentially bind to ACE on the endothelial cell surface?\u2009An unidentified ~14\u2009kDa ACE-binding protein from human blood was previously reportedACE conformation was altered by exogenous human lysozyme , findingACE interaction with lysozyme, a well-studied protein, was unanticipated and had not previously been reported possibly reflecting weak binding constant of ACE-lysozyme interaction with very high association and dissociation rates of ACE-lysozyme complex  observed1415To further validate ACE-lysozyme interaction, we performed immunoprecipitation of CHO cells expressing testicular (tACE) or somatic (sACE) isoforms of human ACE with anti-ACE or anti-lysozyme antibodies. Lysozyme was co-precipitated with both ACEs by anti-ACE mAb, and both ACEs were co-precipitated with lysozyme by anti-lysozyme antibody . Flow cyThe ACE-lysozyme interaction potentially explains the parallel increase in blood ACE and lysozyme concentrations in patients with sarcoidosis349520ACE phenotyping of mice with altered lysozyme expression showed that circulating ACE activity was decreased (3-fold) only in the sera of lysozyme M-deficient mice  comparedCHO-ACE cells transiently transfected with plasmid encoding human lysozyme demonstrated decreased (3-fold) ACE shedding and reciprocally increased ACE content on the cell-surface . This unPreviously, we measured blood ACE activity in different speciesWe demonstrated that some low molecular weight (LMW) human plasma components also bind to human ACE, including endogenous ACE inhibitors  as well We tested the effects of human serum, depleted of this effector by filtration through a 3\u2009kDa filter, on ACE shedding from CHO-ACE cells. While the 3\u2009kDa serum filtrate alone did not affect ACE shedding (not shown), the rate of ACE shedding was 20\u201330% higher in the presence of heat-inactivated serum depleted of 3\u2009kDa components compared to the whole pre-heated serum . These d++ - N domain chloride binding site interactionThe effect of ACE inhibitor, enalaprilat, and EDTA on the conformation of ACE in the blood (containing both lysozyme and LMW ACE effector) and on the conformation of recombinant ACE, where both compounds are absent , as wellTo identify the LMW ACE effector(s) present in human blood, the 3\u2009kDa filtrate of human citrated plasma was analyzed by chromatography in combination with a mAb binding assay , as wellAn analysis of the fractions by mass spectrometry did not allow definitive identification of the ACE effectors from human blood as there were excessive number of compounds . As an alternative approach, we performed bioinformatic analysis of the human metabolome, containing more than 7000 compoundsBilirubin, as well as 3\u2009kDa filtrate of plasma, altered mAb 6A12 binding to ACE mutant, R532W, much stronger than to WT ACE . As the We attributed the single R532W substitution in the N domain of ACE, leading to significantly increased ACE shedding, to gross conformational changes of somatic, two-domain ACE and the inability for ACE to bind blood components (such as bilirubin and lysozyme), that normally stabilize ACE conformation on the cell membrane.Data on lysozyme sequence analysis , effectsThe mechanistic insights into ACE shedding elucidated may have clinical and biological significance. First, this may explain the long-observed increase in blood ACE protein in patients treated with ACE inhibitors25The ACE-lysozyme/bilirubin hypothesis may explain the paradoxical simultaneous increase in substance P and ACE concentration in patients with migraineOur data may also explain the low level of ACE in urineFinally, the ACE-lysozyme hypothesis may explain the parallel increase in blood lysozyme and ACE levels observed in patients with sarcoidosis, a systemic granulomatous disorder93420In conclusion, we have identified a novel ACE mutation, R532W, which is associated with elevated blood ACE levels. Bilirubin and lysozyme were identified as novel ACE-binding blood components that act in concert to regulate ACE conformation and possibly influence ACE shedding. Together, these results provide novel mechanistic insights into the elevated blood ACE levels observed in patients on ACE inhibitor therapy with additional biologically and clinically relevant ramifications.The study was approved by the Institutional Review Boards of the University of Chicago and the University of Illinois at Chicago. All corresponding procedures were carried out in accordance with institutional guidelines. Eighty four patients were chosen for the TRIDOM study of the genetics of pulmonary diseases unrelated to this report. After providing written informed consent from all patients, citrated plasma was obtained from patients for determination of ACE activity and immunochemical characterization of ACE. One patient (#38) was found to have plasma ACE activity higher than 150\u2009mU/ml  were coated with anti-ACE mAbs via goat anti-mouse IgG  bridgeGenomic DNA was isolated from the whole blood. All 26 exons of ACE gene were sequenced in patient #38 using pairs of primersAgeI cuts this 573\u2009bp PCR product from individual with native, wild-type ACE into two fragments of 347 and 226\u2009bp. In the case of R532W substitution, the restriction site for this restrictase disappeared and AgeI did not cut this PCR product.The restriction endonuclease st approach, ACE was covalently coupled to the dextran surface of CM5 biosensor chips to a density of 4000\u20135000 response units (RU) through amine groups (according to protocol). In the 2nd approach, mAb to ACE, clone 9B9\u22121. In control experiments, the configuration was an opposite: human lysozyme was immobilized on the biosensor and human lung ACE was applied over immobilized lysozyme (as described above). Data were prepared by the method of \u201cdouble referencing\u201d where parallel injections of analyte over a control dextran surface were performed as well as running buffer injections over both the immobilized ACE and control dextran surfaces. To confirm the specificity of ACE-lysozyme binding, the following purified proteins were used instead of lysozyme: human \u03b22\u2013microglobulin, B2M , and bovine serum albumin, BSA .Interaction of human ACE and human lysozyme was analyzed by SPR using optical biosensor Biacore 3000  at 25\u2009\u00b0C. Human ACE isolated from human lung using affinity chromatography on Lisinopril-Sepharose as inCHO cells or CHO cells, stably transfected with testicular CHO-tACE or somatCHO-tACE or CHO-sACE cells expressing recombinant isoforms of human ACE were incubated with tested mAbs at 4\u2009\u00b0C for 60\u2009min. The following mAbs were used: 1) mAb 9B9 (10\u2009\u03bcg/mL) directed to an epitope on the N domain of ACE and thus recognizing somatic ACE onlyin vivo mouse methods/experiments were approved by and performed in accordance with Cincinnati Children\u2019s Hospital Medical Center IACUC Committee guidelines and regulations. Four groups of mice, lysozyme-overexpressing transgenic mice (lysozymetg), lysozyme M-deficient mice (lysozyme M\u2212/\u2212), lysozyme M- and P-deficient mice (lysozyme MP\u2212/\u2212), and strain/age-matched wild-type (WT) mice were used. Lysozymetg mice (FVB/N strain) were generated by targeting expression of the rat lysozyme cDNA to the distal respiratory epithelium under the direction of the 3.7-kb human surfactant protein-C (SP-C) promoter\u2212/\u2212 mice were generated in the C57BL/6 background by insertion of the gene encoding enhanced green fluorescent protein into the lys locus, as previously reportedtg mice. Lysozyme MP\u2212/\u2212 mice were generated in the 129 Sv-Ev/Swiss Black background and speed-bred five generations into the FVB/N background . For each experiment, 5- to 6-week old mice were compared with WT FVB/N mice.All A model of human sACE was constructed using the model of porcine sACE based on electron microscopy (EM)224451606162GCG codon for Arg at position 532  by mutation of the Plasmids carrying the coding sequence for somatic Wild-Type (WT) ACE and above mentioned mutant were expressed in CHO and HEK cells using Plus Reagent  for transient transfection and generation of stable cell lines. Also for some experiments we used CHO cells transfected with 1) soluble somatic ACE, WT\u0394Samples for SDS electrophoresis were equilibrated to ACE activity of 200\u2009mU/ml (Hip-His-Leu as a substrate) and were run using gradient (4\u201315%) Tris-HCl pre-cast SDS PAGE gels . After electrophoretic transfer of proteins, the microporous PVDF-Plus membranes were incubated with mAbs to sequential epitopes on human ACE, suitable for detection of the denatured ACE, 3C5, 1D8, 5C860Plasmids carrying the coding sequence for human lysozyme  were transiently transfected in CHO-ACE expressing cellsThe results were considered to be statistically significant when the level of probability was 0.05 or less based on a non-parametric Mann-Whitney U-test.How to cite this article: Danilov, S. M. et al. Lysozyme and bilirubin bind to ACE and regulate its conformation and shedding. Sci. Rep.6, 34913; doi: 10.1038/srep34913 (2016)."}
+{"text": "Actin is a highly abundant protein in eukaryotic cells and dynamically changes its polymerized states with the help of actin-binding proteins. Its critical function as a constituent of cytoskeleton has been well-documented. Growing evidence demonstrates that actin is also present in nuclei, referred to as nuclear actin, and is involved in a number of nuclear processes, including transcriptional regulation and chromatin remodeling. The contribution of nuclear actin to transcriptional regulation can be explained by its direct interaction with transcription machineries and chromatin remodeling factors and by controlling the activities of transcription factors. In both cases, polymerized states of nuclear actin affect the transcriptional outcome. Nuclear actin also plays an important role in activating strongly silenced genes in somatic cells for transcriptional reprogramming. When these nuclear functions of actin are considered, it is plausible to speculate that nuclear actin is also implicated in embryonic development, in which numerous genes need to be activated in a well-coordinated manner. In this review, we especially focus on nuclear actin\u2019s roles in transcriptional activation, reprogramming and development, including stem cell differentiation and we discuss how nuclear actin can be an important player in development and cell differentiation. Figure 1A). It also binds to transcription regulators to control their activities . In addition to these functions of actin to support fundamental nuclear processes, nuclear actin influences cellular phenotypes through transcriptional regulation and chromatin alternation, exemplified by transcriptional activation of the osteogenic genes in differentiating mesenchymal stem cells . In this review, we summarize recent findings of functional roles of nuclear actin in transcriptional activation and chromatin remodeling. Currently, discovered functions of nuclear actin are executed in many different crucial cellular events such as transcription (Dynamic changes between globular (G-) and filamentous (F-) forms of nuclear actin affect these nuclear events. Nuclear actin polymerization is regulated by multiple mechanisms; more than 30 of actin-binding proteins that affect its polymerized states have been discovered in nuclei . It is ols MSCs;  or by rels MSCs;  . As a consequence, the amount of nuclear actin, regulated by IMPORTIN 9  . Even transcriptional reprogramming can be induced in the oil GV system after nuclear transplantation of somatic nuclei into oil GVs  . Hereaft oil GVs . Using tpression . Furtherpression . The knopression . These ron . Translocation of actin to nuclei is also observed when HL-60 cells differentiate toward macrophages after phorbol 12-myristate 13-acetate (PMA) treatment . Another recent study shows that nuclear actin is involved in lineage commitment of epidermal progenitor cells (EPCs) through the regulation of the transcriptional activity . In addition to these roles of nuclear actin in cell differentiation and lineage commitment, nuclear actin-binding proteins also serve as a key player for cell differentiation. In hematopoietic cells, WASP is localized in nuclei during T cell differentiation (H1 genes, such as IFNG and TBX21, and is important for differentiation (Considering nuclear roles of actin in transcriptional regulation, it is reasonable to speculate that nuclear actin is involved in cellular differentiation and development, which entail changes in transcriptional programs. Accumulating evidence indicates that this is indeed true at least in several different cell types. Induced accumulation of nuclear actin in MSCs causes transcriptional activation of the osteogenic genes osterix and osteocalcin, leading to the osteogenic phenotype. Mechanistically, YAP protein binds to and inhibits the osteogenic transcription factor RUNX2. The accumulation of nuclear actin induces nuclear export of YAP protein. As a result, RUNX2 is relieved from its repressive interaction with YAP and osteogenesis is enhanced in a RUNX2-dependent manner  (Figure reatment . In thisactivity . Upon inntiation . WASP suntiation . It is nntiation , althougntiation . DiffereXenopus laevis (Drosophila (Drosophila, nurse cells and GVs contain nuclear actin during oogenesis and nuclear actin rod formation is regulated by Fascin (Xenopus, a large amount of nuclear actin in GVs contribute to mechanical stability of the giant nucleus (Xenopus oocytes, is important for early embryonic development. Knockdown of maternal WAVE1 protein induces downregulation of Hox genes in gastrula embryos, which is rescued by nuclear WAVE1 expression (HoxB expression upon retinoic acid treatment has been shown in cultured cells (Hox gene expression and embryonic development (Nuclear actin is found in female germ cells of s laevis , Drosophosophila , and aviosophila . In the y Fascin . In Xeno nucleus , stabili nucleus  and tran nucleus . The amo nucleus . The abupression . In gooded cells . Howeverelopment . It is pelopment . Furtherin vivo cells and/or in the context of pathogenesis warrants further investigation.Recent studies have uncovered the implication of nuclear actin in a variety of nuclear processes, including basal transcription , transcrAll authors listed, have made substantial, direct and intellectual contribution to the work, and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The resulting AEG glycoconjugates 1a\u2013d were converted into the corresponding free acids 2a\u2013d in 97\u201398% yield by treatment with aqueous formic acid. The Fmoc group of compound 1c was removed and the intermediate amine 9 was condensed with 2a to afford the corresponding glycosylated AEG dipeptide 4 in 58% yield. All glycoconjugate building blocks showed the presence of cis and trans rotamers. Compounds 1a, 1b and 4 were subjected to temperature dependent 1H NMR spectroscopy in order to determine the coalescence temperature which resulted in calculated rotation barriers of 17.9\u201318.3 kcal/mol for the rotamers.Four glycoconjugate building blocks for the construction of combinatorial PNA like glycopeptide libraries were prepared in 75\u201379% yield by condensing  N-(2-aminoethyl)glycine (AEG) backbone to which sugar moieties were linked through either simple alkyl chains glycinate hydrochloride (5) which was synthesized in 39% yield from tert-butyl bromoacetate according to the procedure published by Thomson et al. [6a\u2013d were prepared from the corresponding tert-butyl esters as previously described [5 with acids 6a\u2013d was achieved with either N,N,N\u2032,N\u2032-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate (HBTU) or 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDCI)  , Table 1 removed . Such bytert-butyl ester groups of building blocks 1a\u2013d were removed under acid conditions with a 2:1 mixture of formic acid and dichloromethane at room temperature to give the corresponding free acids 2a\u2013d in 97\u201398% yield   .1a\u2013d and 2a\u2013d we also prepared dimer 4 from the glucose containing conjugate 2a and the N-acetylglucosamine containing conjugate 1c. Treatment of 1c with 20% piperidine in DMF at room temperature for 3.5 h gave partially protected compound 8 which was used for the next step without further purification. Coupling of 2a with crude 8 using HBTU, 1-hydroxytriazole (HOBt) and diisopropylethylamine (DIPEA) in DMF gave dipeptide 4 in 58% yield . The 1H NMR spectra of 1a and 1b in CDCl3 at room temperature revealed two separate doublets at 8.19 and 7.99 ppm for 1a and 8.26 and 7.99 ppm for 1b, respectively for the anomeric amide proton indicating the presence of two rotamers .Glycoconjugates rotamers . The sig1H NMR spectrum of the dimeric PNA glycoconjugate 4 in CDCl3 showed the presence of four different rotameric structures , however, sufficient separation of the two anomeric amide protons of the rotamers of 1a were observed and no cleavage of the Fmoc group occurred. H\u00f6ck et al. [d5 does not cause cleavage of Fmoc groups in peptides up to 120 \u00b0C.Since deuterochloroform is not suitable for temperature-dependent  as well . In DMSOtroscopy  the anomeratures \u201325. Indeup in 1a . In chlok et al.  could al1H NMR spectra (7.65\u20138.30 ppm area only) of 1a in the temperature range between 25 and 100 \u00b0C. Heating the sample caused a downfield shift of the anomeric amide protons with coalescence (Tc) at 90\u201395 \u00b0C (363\u2013368 K). Unfortunately, the amide signals partially overlapped with the proton signals of the Fmoc group at the coalescence temperature so that no exact coalescence temperature could be determined.1H NMR spectra (7.65\u20138.50 ppm area only) of 1b in the range between 25 and 100 \u00b0C. In this case the corresponding coalescence temperature (Tc) could be determined at 90\u201395 \u00b0C (363\u2013368 K).1H NMR spectra (9.10\u20137.80 ppm are only) of 4 in the range between 25 and 100 \u00b0C. In this case, the corresponding coalescence temperature (Tc) could also be determined at 90\u201395 \u00b0C (363\u2013368 K).cis/trans rotamers of 1a we measured the NOESY spectrum of conjugate 1a in CDCl3  from the proton NMR spectra above to the corresponding DCl3 see . The spebackbone .trans rotamer whereas the doublet at 8.01 ppm should belong to the cis rotameric structure.Nevertheless, crosspeaks between the amidic protons and the malonyl protons could be observed, and were used for an indirect assignment of the amidic doublets. Stronger NOE crosspeaks between the methylene protons of the side chain (3.20 ppm) and the methylene protons of the PNA backbone (3.93 ppm) indicated that the distance between these protons should be shorter in comparison to the distance of the protons with a chemical shift at 3.36 and 3.93 ppm. Therefore, the signal of the protons at 3.20 ppm and the doublet at 8.18 ppm belong to the G\u2021r values for building blocks 1a,b from the measured coalescence temperatures (Tc) by using the Eyring model [G\u2021c values of the dimeric glycoconjugate 4 could not be determined though because no unambiguous assignment of the rotameric structures to the corresponding specific proton signals could be made. Nevertheless, the rotation barriers of glycoconjugate 4 should be rather similar to the barriers of building blocks 1a,b due to the almost identical coalescence temperatures (Tc).In order to evaluate the rotation barrier around the tertiary peptide bond (C\u2013N bond) we calculated the corresponding \u0394ng model . The \u0394G\u2021 values (NHtrans \u2013 NHcis) were extracted from the corresponding 1H NMR spectra of the specific building blocks 1a,b in chlorobenzene-d5 at 25 \u00b0C (298 K). G\u2021c values and illustrates that there is only a small difference between the calculated \u0394G\u2021r values of building blocks 1a and 1b in chlorbenzene-d5. It is obvious that the different saccharide moieties do not significantly influence the rotation barrier around the tertiary peptide bond. Furthermore, the calculated \u0394G\u2021r values are in good accordance with those of other PNA derivates  [The respective \u0394cal/mol) \u201328.cis/trans rotamers of these glycopeptoids via temperature-dependent 1H NMR spectroscopy by determining the corresponding coalescence temperatures (Tc = 90\u201395 \u00b0C) and by calculating the specific rotation barrier (\u0394G\u2021r) using the Eyring model. The found \u0394G\u2021r values  were in good accordance with those of other known PNA-derivates . The PNA-based glycoprotein building blocks described here will be used in combination with previously described benzoic acid-based glycopeptoids to generate glycopeptide libraries of more complex nature by automated SPOT synthesis.We have described the efficient chemical synthesis of a series of novel PNA-based glycopeptoids. We also studied the File 1Experimental data.File 21a\u2013d, 2a\u2013d, 3, 4 and 7; 2D NMR spectra of building block 1a.NMR spectra of building blocks"}
+{"text": "N = 3) relative to pediatric patients without sepsis/pneumonia (N = 3), or adult to elderly patients with sepsis/pneumonia (N = 5). Among the older septic hearts, higher levels of cardiomyocyte OPN expression was seen only in conjunction with severe coronary arterial occlusion. This is the first study to document increased OPN expression in cardiomyocytes of pediatric subjects with sepsis or pneumonia. Our findings highlight a potentially important role for OPN in sepsis- or pneumonia-mediated cardiac dysfunction in pediatric patients.Sepsis and pneumonia are major causes of death in the United States, and their pathophysiology includes infection with inflammation and immune dysfunction. Both sepsis and pneumonia cause cardiovascular dysfunction. The expression of Osteopontin (OPN) in cardiomyocytes of patients with sepsis or pneumonia, and its role the induced cardiac dysfunction have not been thoroughly investigated. OPN is a matricellular protein synthesized by multiple diseased tissues and cells including cardiomyocytes. Here, we studied the expression of OPN protein using immunofluorescence in human myocardial autopsy tissues from pediatric and mid age or elderly patients with sepsis and/or pneumonia. Fourteen human myocardial tissues from six pediatric patients and eight mid-age or elderly patients were studied. Immunofluorescence was used to investigate the expression of OPN in paraffin-embedded heart sections co-stained with the myocyte markers Actin Alpha 1 (ACTA1) and Myosin Light Chain 2 (MLC2). A quantitative analysis was performed to determine the number of ACTA1 and MLC2 positive cardiomyocytes that express OPN. The results showed that OPN expression was significantly increased in cardiomyocytes in the hearts from pediatric patients with sepsis and/or pneumonia ( Osteopontin (OPN) is a matricellular protein synthesized by a range of tissues and cell types including immunological cells (macrophages and T cells) , fibroblTwo important conditions, sepsis  and pneuStreptococcus pneumonia  patients and eight adult or elderly (48\u201377 years old) patients. Table This study was carried out in accordance with the recommendations of the University of Miami Institutional Review Board (IRB protocol # 20180439). All autopsy specimens were de-identified and there was no need for consent forms.Immunofluorescence was used to investigate the OPN expression in paraffin-embedded sections. Samples were incubated for 45 min at 70 degrees, then dewaxed with two 5-min xylene washes and hydrated by 3-min graded ethanol washes of 100% (twice), 95%, 80%, and 70% followed by two 4-min water immersions. Antigen retrieval was then done by steaming the slides for 75 min in 1X Citrate Antigen Retrieval Buffer (Ab93678). Samples were rinsed with PBS then permeabilized with 0.2% Triton X-100 (Sigma-Aldrich) in PBS for 30 min, followed by blocking with 10% Donkey serum in TBST for 45 min. The samples were then incubated overnight at 4\u00b0C with three primary antibodies, Anti-Alpha Skeletal Muscle Actin, Alpha-Sr 1 (ACTA-1) , anti-hOPN , and anti-Myosin Light Chain (MLC2)  in blocking solution. ACTA-1 and MLC2 were used as cardiomyocyte markers. The following day the slides were washed with PBS then incubated for 1 h at room temperature with conjugated secondary antibodies Donkey anti-Mouse IgG, Alexa Fluor 568 , Donkey anti-Goat IGG, Alexa Fluor 647 , and Donkey anti-Rabbit IgG, Alexa Fluor 488  in blocking solution. DAPI was used to stain nuclei before mounting with ProLong Gold Antifade (Invitrogen P36934) and coverslips. After 2 days, the slides were scanned at 20 \u00d7 magnification using the Olympus VS120\u2013L100 Virtual Slide Microscope . At least five slides per specimen were stained to confirm results. Representative confocal images . The study was exempt because the samples used were all autopsy samples.CI, KP, and KJ-W performed the experiments. CI and KP analyzed the results. SG provided the pathology samples, clinical information, and data interpretation. CI and LS wrote the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Influenza A and B viruses mainly cause respiratory infectious disease. Till now, few tests are able to simultaneously detect both, especially in primary medical establishments.This study was designed to compare the performance of two different one-step-combined test strips for the detection of influenza A and B: one strip with fluorescent microspheres for tracers (FMT); and the other strip with colored microspheres for tracers (CMT). To test the strips, cultures of influenza A, B, and other pathogenic viruses were used, in addition to 1085 clinical specimens from symptomatic patients with respiratory infections. Real-time RT-PCR was also considered as a reference method used to detect the different results of FMT and CTM.P\u2009<\u20090.05). With the culture mixtures of Coxsackie virus (A16), enteric cytopathic human orphan virus (ECHO type30), enterovirus (EV71), rotavirus (LLR strain), and enteric adenovirus (AdV 41), specificity assessment demonstrated that there was no cross reaction during the usage of the two test strips as shown by the results which were negative. In the detection of influenza A in 1085 clinical specimens, the total coincidence rate was 96.7%, the positive coincidence rate was 97.1%, and the negative coincidence rate was 96.7%. In the case of influenza B detection, the total coincidence rate was 99.1%, the positive coincidence rate was 92.6%, and the negative coincidence rate was 98.5%. In addition, with influenza A or B real-time RT-PCR detection method, the results showed that, for influenza A, 26 of the 33 specimens that negative with CMT but positive with FMT, showed positive results, and none of the 3 specimens that positive with CMT but negative with FMT showed a positive result; For influenza B, 12 of the 15 specimens that negative with CMT but positive with FMT, showed positive results, and none of the 5 specimens that positive with CMT but negative with FMT showed a positive result.Detection thresholds for influenza A and B cultures using serial dilutions revealed that the sensitivity of FMT was higher than that of CMT (both FMT performed better than CMT in the combined detection of influenza A and B viruses. Influenza is caused by a type of virus that mainly attacks the upper respiratory tract (nose and throat). It can also affect parts of the lower respiratory tract such as bronchi and rarely lungs . There aFor the identification of the type of virus causing the influenza infections, several methods, such as immunological and molecular biological methods are used , 6. ImmuThe use of fluorescent microspheres for tracers is an emerging technique in antigen\u2013antibody reactions. They are based on immunochromatographic assays and have been used widely in several fields, such as medical science, food security and so on , 10. ComThe objective of the current study was to compare the fluorescent microspheretracers (FMT) with colored microspheretracers (CMT), and to discuss the efficiency of FMT in relation to CMT in combined influenza A\u2009+\u2009B detection. This will lead to a credible method for detecting influenza A and B infections and will benefit the clinical diagnostic and therapeutic fields, especially the primary medical establishments.Viruses used included influenza A (A/PR/8/34) and B (B/Guangzhou/01/2007), rotavirus (LLR strain), enteric adenovirus (AdV type 41), Coxsackie virus (A16), enteric cytopathic human orphan virus (ECHO) 116 (type 30), and enterovirus (EV71) were purchased from American Type Culture Collection (ATCC) or provided by Guangzhou Women and Children Medical Center. They were multiplied in cell cultures with Madin-Darby canine kidney (MDCK) cells, MA-104 cells, Hela cells, Hep-2 cells, rhabdomyosarcoma (RD) cells, and Vero cells which were bought from ATCC using Dulbecco\u2019s modified Eagle\u2019s medium (DMEM) (Gibco) or Rosewell Park Memorial Institute (RPMI) (Gibco) culture medium with 10% fetal bovine serum (FBS) (HyClone), and separately stored in the laboratory.Clinical specimens including both shallow nasal and NP swabs were collected from 1085 symptomatic patients with respiratory infections from the in- and out-patient wards at the Affiliated Hospital of Guangdong Medical University, and from the Guangzhou Women and Children Medical Center between March 2015 and February 2017. The study participants included 672 males and 413 females of the mean age 14.7\u2009\u00b1\u200918.3\u2009years. All the patients supplied written informed consent to participate. The study was approved by the ethics committee of the Affiliated Hospital of Guangdong Medical University (LL201403186259).During and after the data collection, all the authors had obtained the information that could identify individual participants.The combined influenza A\u2009+\u2009B fluorescent microspheres test strip (FMT) was supplied by Guangzhou Yuemo Biotechnology Co., Ltd. . The tracers were fluorescent microspheres  with excitation and emission wavelengths of 360\u2009nm and 615\u2009nm, respectively . The detection procedure was performed according to the manufacturer\u2019s instructions, and the detection mode is shown in Fig.\u00a0A CerTest influenza A\u2009+\u2009B blister test strip (CMT) was supplied by CerTest Biotec S.L.  for the qualitative detection of influenza type A and type B from nasal swab, nasopharyngeal wash and aspirate specimens. The tracer is a colored microsphere. The detection procedure was performed according to the manufacturer\u2019s instructions, and the detection mode is shown in Fig. Influenza A and B real-time RT-PCR detection kits were purchased from Guangdong Huayin Pharmaceutical Technology Co., Ltd. . The kits contain a specific ready-to-use system for the detection of the Influenza A or B by Reverse Transcription Polymerase Chain Reaction (RT-PCR) in the real-time PCR system. The master contains a Super Mix for the specific amplification of Influenza A or B virus RNA. The reaction is done in one step real time RT-PCR. The first step is a reverse transcription (RT), during which the Influenza A or B RNA is transcribed into cDNA. Afterwards, a thermostable DNA polymerase is used to amplify the specific gene fragments by means of polymerase chain reaction (PCR). Fluorescence is emitted and measured by the potical unit of the real time systems during PCR. An external positive control contained, allows the determination of the gene load. Followed, the testing process was according to the manufacturer\u2019s instructions. The tested clinical specimens were same to one-step-combined test strips for influenza A and B.5 plaque-forming units (PFU)/mL and 4.2\u2009\u00d7\u2009105 PFU/mL, respectively. Three drops (150\u2009\u03bcL each) of the viral culture mixture were synchronously applied to the sample loading well of the detection strips. The results were recorded within 10\u2009min.Influenza A and B were diluted two fold serial dilution and detected using the two strips. The initial concentrations of influenza A and B were 7.4\u2009\u00d7\u200910For specificity assessment, cultures of Coxsackie (A16), ECHO (type 30), entero- (EV71), rota (LLR strain), and enteric adeno (AdV 41) viruses were used.Clean bamboo sticks were used to effectively mix and liquefy the fresh specimens comprising mainly mucus, pus, and blood. A thin tube was used to aspirate three drops (150\u2009\u03bcL each) of the mixture, which was synchronously applied to each of the detection cards.P\u2009<\u20090.05 was considered statistically significant. Statistical analysis was performed with SPSS 15.0.The total coincidence rate, positive coincidence rate, and the negative coincidence rate of CMT and FMT were calculated to assess detection in the clinical specimens . StatistThe definition and way of calculation of total coincidence rate, positive coincidence rate, and negative coincidence rate as followed: Total coincidence rate\u2009=\u2009100%\u2009\u00d7\u2009[(FMT&CMT both positive+ FMT&CMT both negative)/total samples]; Compared to CMT, the positive coincidence rate of FMT\u2009=\u2009100%\u2009\u00d7\u2009[FMT&CMT both positive /(FMT&CMT both positive + CMT positive but FMT negative)], and the negative coincidence rate of FMT\u2009=\u2009100%\u2009\u00d7\u2009[FMT&CMT both negative /(FMT&CMT both negative + CMT negative but FMT positive)].8 (58\u2009\u00d7\u2009102 PFU/mL), the CMT results were negative, whereas viruses were still detected as positive result with FMT, till the dilutions of 1/29 (29\u2009\u00d7\u2009102 PFU/mL) as negative. After the two-fold serial dilutions of the influenza B cultures to 1/27 (16.4\u2009\u00d7\u2009102 PFU/mL), the CMT results were negative, whereas viruses were still detected as positive result with FMT, till the dilutions of 1/28 (8.2\u2009\u00d7\u2009102 PFU/mL) as negative. Statistical analysis revealed the sensitivity of FMT was significantly higher than that of CMT (both P\u2009<\u20090.05) , ECHO (type30) (3.3\u2009\u00d7\u2009106 TCID50/mL), entero- (EV71) (2.5\u2009\u00d7\u2009106 TCID50/mL), rota (LLR strain) (3.7 lgCCID50/mL), and enteric adeno (AdV 41) viruses (4.8\u2009\u00d7\u2009104 TCID50/mL) had no cross reaction, as shown by the test results which were negative.The detection results from the two test strips Table\u00a0 revealedBoth strips were used to detect 1085 specimens, and the results are presented in Tables\u00a0For influenza A detection, the total coincidence rate of CMT and FMT was 96.7% [(101\u2009+\u2009948)/1085)]. Compared to CMT, the positive coincidence rate of FMT was 97.1% [101/(101\u2009+\u20093)], and the negative coincidence rate of FMT was 96.7% [948/(948\u2009+\u200933)]. For influenza B detection, the total coincidence rate of CMT and FMT was 99.1% [(63\u2009+\u20091012)/1085)]. Compared to CMT, the positive coincidence rate of FMT was 92.6% [63/(63\u2009+\u20095)], and the negative coincidence rate of FMT was 98.5% [1012/(1012\u2009+\u200915)].For the different results of clinical specimens by CMT and FMT, an influenza A real-time RT-PCR detection kit was also used to detect influenza A again . The resAlso, for the different results of clinical specimens by CMT and FMT, an influenza B real-time RT-PCR detection kit was also used to detect influenza B again . The resThere is a gradual increase in the global usage of colloidal gold detection of influenza A and B in samples. However, these are rare combined detection products and possess technological limitations. In scientific research and clinical practice, the CerTest influenza A\u2009+\u2009B one step card test (CMT) has been welcomed . HoweverIn the current study, to assess the detection performance of combined influenza A\u2009+\u2009B fluorescent microsphere detection test strips, CMT and real-time RT-PCR were used as references. Using colored microspheres with different colors as tracers, CMT can produce meaningful results when used as diagnostic reagents in vitro. It can be used to determine the efficiency of detection. Therefore, colored microspheres for tracers based on immunochromatographic assays have gradually attracted attention in the medical science and food security fields \u201326. In aInfluenza A is the most common cause of severe acute respiratory infectious diseases in children , and theThe results indicate that the combined influenza A\u2009+\u2009B FMT detection strips were more sensitive than the CMT strips. Also, the detective procedures and timing of the FMT and CMT strips are similar. Based on the FMT strips have not been large-scale commercial application, the cost cannot be compared now. However, the FMT technique has some limitations which must be considered, such as the risk of false positive results. Therefore, caution should be used, especially while handling weakly positive specimens . AnotherThis study described a straightforward head-to head comparison of CMT and FMT test strips, which may be of great value to researchers involved in clinical diagnosis.Both FMT and CMT were able to detect both influenza A and B viruses with high specificity, but FMT had significantly higher detection sensitivity than CMT."}
+{"text": "Dysregulated signal transduction and activator of transcription-3 (STAT3) signalling in CD4+ T cells has been proposed as an early pathophysiological event in RA. We sought further evidence for this observation, and to determine its clinical relevance.Microarray technology was used to measure gene expression in purified peripheral blood CD4+ T cells from treatment-na\u00efve RA patients and disease controls newly recruited from an early arthritis clinic. Analysis focused on 12 previously proposed transcripts, and concurrent STAT3 pathway activation was determined in the same cells by flow cytometry. A pooled analysis of previous and current gene expression findings incorporated detailed clinical parameters and employed multivariate analysis.PIM1, BCL3 and SOCS3 , each of whose expression correlated strongly with paired intracellular phospho-STAT3. In a meta-analysis of 279 patients the same three genes accounted for the majority of the signature\u2019s ability to discriminate RA patients, which was found to be independent of age, joint involvement or acute phase response.In an independent cohort of 161 patients, expression of 11 of 12 proposed signature genes differed significantly between RA patients and controls, robustly validating the earlier findings. Differential regulation was most pronounced for the STAT3 target genes BCL3, SOCS3 and PIM1 in circulating CD4+ T cells is a discriminatory feature of early RA that occurs independently of acute phase response. The mechanistic and functional implications of this observation at a cellular level warrant clarification.The STAT3-mediated dysregulation of  Three STAT3-regulated genes discriminate RA independently of clinical parameters in early arthritis CD4+ lymphocytes.The mechanistic relevance of these genes\u2019 activation amongst early RA CD4+ lymphocytes awaits clarification.RA is a chronic disease of immune dysregulation the pathogenesis of which remains incompletely understood . An orchAberrant STAT3 signalling has a well-documented role in tumorigenesis via induction of pro-survival and cell cycle pathways . Our obsThe current investigation sought to validate the relevance of our previously described CD4+ T cell gene signature in a distinct early arthritis cohort. In particular, we determined the extent to which expression of STAT3-regulated genes was independently associated with a diagnosis of RA when considered alongside clinical parameters such as inflammation.During 2012\u201313, consecutive patients were recruited from the Newcastle Early Arthritis Cohort, which has been described in detail elsewhere , 15, 16,http://www.ncbi.nlm.nih.gov/geo; accession number GSE80513). Since the HT12v4 BeadChip annotation differed slightly from the WG6v3 array used for our original work, unique Illumina NuId references were used instead to map probes of identical sequence for this purpose.Total RNA was extracted from CD4+ T cells positively selected from monocyte-depleted whole blood within 4 h of blood draw as previously described . cRNA gePhosflow cytometry was performed on freshly drawn, unstimulated whole blood obtained contemporaneously with that used for CD4+ T cell RNA extraction. Anti-CD4-APC-eFluor 780 (SK3) , anti-Stat3 (pY705)-Alexa Fluor 647 (4/P-STAT3) and anti-CD3-Pacific Blue (UCHT1)  were used along with appropriate buffers and controls in the staining protocol as previously described . Again, only the expression of BCL3, SOCS3 and PIM1 stood out as being >1.2-fold up-regulated in early RA on univariate analysis of this combined cohort (Rheumatology online). Hierarchical clustering confirmed that these three genes alone accounted for the majority of the previously noted clustering effect, once more discriminating a subgroup that was significantly enriched for RA , we used logistic regression to confirm that the up-regulation of BCL3, PIM1 and SOCS3 observed in early RA was independent of these clinical parameters  or 12-gene signature over clinical parameters alone, results of multivariate analyses summarized as composite receiver-operating characteristic curves were compared (P < 0.001). Interestingly, however, the three-gene signature accounted for a substantial component of this effect . Considered together, these findings suggest that up-regulated expression of BCL3, SOCS3 and PIM1 in circulating CD4+ T cells of early RA patients is independent of potentially confounding clinical parameters, and accounts for much of the previously described 12-gene signature\u2019s discriminatory ability for early RA.Considering the potentially confounding influence of age, swollen or tender joint count, and, in particular, acute phase response (compared . Hence, BCL3, PIM1 and SOCS3. Each of these genes is known to be regulated by STAT3, and their expression correlated significantly with paired CD4+ T cell phospho-STAT3 levels. Indeed, hierarchical clustering suggested that the ability of the 12-gene signature to discriminate RA patients in this replication cohort was almost entirely accounted for by these three genes alone. The reproducibility of this component of the original gene signature in two independent studies separated by 5 years is remarkable given the heterogeneity of the patient population presenting to early arthritis clinics. Furthermore, the signature is robust to replacement of 1987 ACR classification criteria [BCL3, PIM1 and SOCS3 gene expression with diagnostic outcome are independent of clinical parameters such as age and systemic inflammation. Rather than being mere bystander phenomena, our data could indicate a direct role for STAT3-regulated gene induction in RA pathogenesis, for example via altered T cell effector function. This possibility remains the subject of ongoing investigation.In this validation study, we confirmed the ability of our previously proposed CD4+ T cell gene expression signature to identify RA patients amongst unselected, treatment-na\u00efve early arthritis clinic attendees. Normalized gene expression differed significantly between RA patients and disease controls for 11 out of the 12 signature genes, but the fold-changes were most striking for criteria  used to criteria . FinallyBCL3, PIM1 and SOCS3 [A growing body of evidence now highlights IL-6-mediated dysregulation of CD4+ T cell STAT3 signalling during RA development , 25. Amond SOCS3 . Such dand SOCS3 .Even more tantalizing is the possibility, suggested by our data, that the identified IL-6-mediated transcriptional programme might itself mark a molecular mechanism by which susceptible CD4+ T cells switch to adopt a pathogenic phenotype. Such speculation stems from a functional consideration of the three component signature genes we have identified. BCL3 is an atypical I\u03baB family member which has, until recently, been little studied in human T cell biology , 29. ParPIM1 and SOCS3 is specifically described [Taken together, it is of interest that the robust three-gene CD4+ T cell signature we now validate parallels the STAT3-dependent transcriptional pattern observed in the malignant S\u00e9zary cells of individuals with the leukaemic variant of cutaneous T cell lymphoma, in which up-regulated escribed , 38. By escribed . The extkez003_Supplementary_DataClick here for additional data file."}
+{"text": "NaCl also improved 5-hydroxymethylfurfural (5-HMF) generation from D-glucose as well as rehydration of 5-HMF to levulinic and formic acid. KI favored other pathways toward formic acid production from D-glucose, reaching 20% in the upper concentration. Compared to a solution of equivalent NaCl concentration, seawater enhanced selectivity toward lactic acid which was raised by 10% for both monosaccharides, and sugars conversion, especially for D-glucose whose conversion was increased by 20%. 5-HMF molar yield around 30% were achieved from D-glucose in seawater at 211\u00b0C and 20 bars after 15 min.In biorefining, the conversion of carbohydrates under subcritical water conditions is a field of extensive studies. In particular, the hydrothermal decomposition of benchmark C6- and C5-monosaccharides, i.e., D-glucose and D-xylose, into furanics and/or organic acids is fully considered. Herein, we propose to establish the fundamentals of the decomposition of D-glucose and D-xylose under subcritical water conditions in the presence of specific salts  and in seawater. Our results demonstrated that the introduction of inorganic salts was found to modify sugars dehydration yields. Different NaCl concentrations from 0.21 to 1.63 mol L Upgrading of biomass is a field of extensive efforts. In particular, its hydrothermal conversion into valuable products has been extensively proposed in the state of the art  under subcritical water conditions (namely between 100 and 374\u00b0C at a pressure high enough to maintain the liquid state) is still under investigations as the mechanisms governing the monosaccharides decomposition are complex and numerous  and 2-furfural (2-F) together with variable amount of organic acids  together with variable amounts of humins  or bases (sodium hydroxide notably), and/or specific inorganics salts  enhance the conversion rate of C6-monosaccharides into 5-HMF O-H leads to a ring-opening of glucose and to a mutarotation from \u03b1-D-Glucose to \u03b2-D-Glucose. Nevertheless, in the NaCl reaction media, the ratio of \u03b2-D-glucose/\u03b1-D-glucose at mutarotation equilibrium is lower than that without NaCl. This affect glucose by decelerating its isomeration to fructose and suppressing its polymerization of humins. Actually, extensive R&D efforts are directed on the evaluation of biphasic or triphasic (organic) media as well as the selection of options as ionic liquids, deep eutectic solvents, etc. However, it appears that water plays a crucial role in the monosaccharide dehydration, catalyzing proton transfer and speeding up so the reaction  could be used as a processing medium at large scale especially for coastal cities while preserving drinkable water resources. Seawater is nowadays no longer limited to salts and seafood production. Due to its great potential, biorefinery concepts could benefit of it for aqueous-based processes as suggested in previous works. Lin et al.  seawater from different geographical origins without additional inorganic catalysts.In this study, pentose and hexose dehydration to furanic compounds and organic acids were investigated in the presence of inorganic salts in hydrothermal conditions at 211\u00b0C. The main salts found in biomass and seawater, i.e., NaCl and KI, were selected as benchmarks for this fundamental study. The objective is to assess the decomposition features of D-glucose and D-xylose in different mixtures of salts: (i) both aqueous solutions of sodium chloride and potassium iodide at increasing salts molarity from 0.21 to 1.63 mol LD-glucose (98%), D-xylose (98%), and D-fructose (99%) were supplied by Sigma Aldrich lactic acid (88%) from VWR, formic acid (99%) from Biosolv LTD, levulinic acid (98%), 5-hydroxymethylfurfural (5-HMF 98%) and 2-furfural from Alfa Aesar (98%), NaCl and KI were purchased from VWR and used as received.Seawater samples were collected from three different locations presented in The hydrothermal decomposition of monosaccharides (D-xylose and D-glucose) was performed in a Series 5,500 Parr reactor (600 mL) which is equipped with a temperature probe connected to a 4,848 Parr reactor controller and a mechanical stirring. The reactor was heated during 40 min to reach a target temperature of 211\u00b0C which was then maintained during 15 min. At the end of the treatment, the reactor was cooled down until 40\u00b0C . This prMonosaccharides  were determined using a high-performance liquid chromatography (HPLC) system Dionex 5,000 with acarbo Pac PA-100 (4 \u00d7 250 mm) anion exchange column and pulsed amperometric detection. Four different eluents were used: (A) 100 mM NaOH, (B) 100 mM NaOH + 600 mM NaCl, (C) 500 mM NaCl, and (D) ultra-deionized water. The decomposition products were analyzed using high performance liquid chromatography coupled with UV detection at 210 nm for organic acids and 284 nm for furanic compounds. 5 mM sulfuric acid was used as the elution solvent with a flow rate of 0.6 mL/min on a Aminex HPX-87H column (300 \u00d7 7.8 mm) at 45\u00b0C .Molecules were drawn using Chem Draw professional 15 (https://www.graphpad.com/scientific-software/prism/).Means were compared according to Tukey's multiple comparison test. The principal component analysis (PCA) was done using XLSTAT software (https://www.xlstat.com/fr/). Correlation matrix were realized using R Corrplot package. The geographic map was developed by integrating spatial data of sea zone map using ArcGIS .Results presented in Violin plot figures are the means of nine replicates. Scatter plot and Anova one-way analysis of variance as well as the Bartlett's test for equal variances were achieved using Graphpad Prism 7 (2)-OH group which leads to the production of furfuryl alcohol and formic acid. A series of reactions take place including a dehydration followed by the hydration to the aldehyde group. Then, a deprotonation gives a gem-diol which undergoes a C-C scission to release the formic acid and a thermodynamically stable intermediate (5-hydroxymethyl)tetrahydrofuran-2,4-diol. This reaction pathway leads to the production of furfuryl alcohol  and 5-hydroxymethylfurfural (5-HMF) in deionized water from respectively D-xylose and D-glucose . Classic alcohol . This la\u2212 ions promote 1,2-enediol formation and thus dehydration to furfural. Levulinic acid and formic acid were not detected. Surprisingly, KI showed a different effect on 2-F production, a higher KI concentration seemed to significantly decrease 2-F yield. Lactic acid was also monitored with a production ranging from 2 to 6%. Lactic acid yield was significantly reduced by increasing molar concentration for both salts, namely NaCl and KI.Experiments were conducted to probe the role of NaCl and KI in D-xylose dehydration into 2-furfural and lactic acid. \u22121 and NaCl at 0.60 mol L\u22121 . Concerning D-fructose, no significant effect was detected in salts treatment, under different concentrations, and deionized water. Its yield was low and did not exceed 0.7%. 5-HMF yield significantly increased in upper concentration 70 g/L of both KI and NaCl compared to their lower 35 g/L. Levulinic acid (LA) was not detected in KI processes, while it was detected in NaCl treatments and its yield was significantly higher in the upper concentration 70 g/L (1.19 mol L\u22121) than the lower 35 g/L (0.6 mol L\u22121). Lactic acid quantification through HPLC afforded values ranging from 7 to 11% as in terms of the inorganic salt used for the hydrothermal treatment. Variance analysis (ANOVA) showed that its yield was significantly lower than that in deionized water, while formic acid (FA) showed the opposite trend: significantly higher in both NaCl and KI processes whose yields were noticeable culminating at more than 15% and reaching up to 20% for the upper KI concentration. According to When the hydrothermal treatment of D-glucose was investigated in the presence of the same salts, we found that conversion was also significantly higher compared to deionized water. The results are demonstrated in To better understand the different effects of the previous salts on monosaccharides degradation, a combination of KI and NaCl was done, first with the lower concentration 35 g/L and second with the upper concentration of 70 g/L of each salts.\u22121 (the lower combination solution) and at 1.63 mol L\u22121 (the upper combination solution) compared to KI solution at 0.21 and 0.42 mol L\u22121, respectively. Besides, the higher the salt concentration, the lower the lactic acid detection. The variance analysis showed that lactic acid yield in combination solutions (0.81 and 1.63 mol) was significantly lower than that in KI solutions and which is not the case for NaCl, this can be explained maybe by the effect of sodium chloride on the appearance of some modifying functional groups to the intermediate molecule glycolaldehyde and pyruvaldehyde. Furfural yield was improved with increased salt concentration. Compared to KI solutions (0.2 and 0.42 mol L\u22121), 2-F increased significantly in the mixture salt at 0.81 and 1.63 mol L\u22121, which is not the case in NaCl solution and so this highlights that NaCl has a higher effect than KI salt on D-xylose dehydration to furfural production.According to \u22121. These results revealed that salts concentration had an antagonistic effect on lactic acid production for pentoses as well as hexoses. LA which was not detected in KI processes, was identified in the presence of salts mixture. Variance analysis showed that its yield was significantly increased in upper combination (1.19 mol L\u22121) compared to the lower combination (0.81 mol L\u22121). This result was in agreement with those previous results of NaCl processes. Formic acid yield was up to 20% in the upper combination (1.63 mol L\u22121) which gave the same yield in KI process in upper concentration (0.42 mol L\u22121). This yield was significantly higher than that in NaCl processes. This result stuck very well with previous results of KI.\u22121, respectively, while Kerkenah was 0.59 mol L\u22121. \u22121  but surprisingly comparable to the results obtained in combined solution . This observation suggests that other factors than salt concentration are responsible for sugar conversion in seawater. The yield of 2-F reached around 31% for Kerkenah which was significantly higher compared to Zeland, Salakta, and deionized water. This yield is consistent regarding the previous results achieved at different NaCl concentrations. Seawater also favored lactic acid production with yields reaching 14 to 17% for Zeland and Kerkenah, respectively. Variance analysis showed that these yields were significantly higher to lactic acid yield produced in deionized water and different salt concentrations. De Bruijn et al.  and with lactic acid appearance (R = 0.33), which could be explained by the pH shift during the treatment. Conversion of D-xylose to organic acids progressively decreases pH, favoring the generation of products by acid catalyzed pathways like the production of furfural. Lactic acid was positively correlated with seawater media with a correlation coefficient of 0.4 for Zealand and Salakta seawater and of 0.7 for Kerkenah seawater. This perfectly matches previous analysis. Seawater is a catalytic media to produce lactic acid from monosaccharides. 2-furfural showed a positive correlation with NaCl compared to KI. It presents a better correlation with the highest concentration of NaCl.Concerning D-xylose, PCA has been performed by considering three parameters and ten treatments. R = 0.61) and weakly correlated with levulinic acid (R = 0.24). On the other hand, negatively correlated with formic acid (R = \u22120.48). So, PCA analyses confirm clearly that HMF is positively correlated to fructose, which explains the increase of HMF production when fructose yield enhanced in seawater media. Fructose and HMF are highly negatively correlated to formic acid  and weakly to levulinic acid production . This negative correlation evinces HMF rehydration into formic acid and levulinic acid as shown in R = \u22120.895), and this may be explained by the different reactions types to form them from glucose based on Concerning D-glucose, results are depicted in This study was focused on the different products generated during hydrothermal treatment of D-xylose and D-glucose at 211\u00b0C in deionized water, NaCl and KI solutions at various concentrations and seawater. Typical reaction products were mixtures of lactic acid, formic acid, levulinic acid, 5-HMF and 2-F. 2-F yield from D-xylose is especially enhanced by the addition of NaCl and increases with salt concentration. The addition of NaCl to a D-glucose solution improves 5-HMF rehydration to levulinic and formic acid. KI favored other pathways toward formic acid production from D-glucose. 5-HMF production was improved in seawater as well as D-fructose concentration which indicates that this medium can promote isomerization. Seawater is consequently a cheap and suitable medium to perform C5- and C6-sugars conversion to furanic and acidic products especially to lactic acid production. The use of seawater in combination with dehydration catalysts or in biphasic systems could offer interesting performances while sparing drinkable water resources and should be investigated for developed costal countries.All experiments, data analysis, discussion, and the manuscript preparation were done by MK. AR carried out the development and discussion of this work. TI assisted with discussion. HA conducted statistical analyses and figures preparations. NR and TB realized the manuscript recension. All authors have approved the submitted manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Three dimensional (3D) co-cultures to mimic cellular dynamics have brought significant impacts in tissue engineering approaches for biomedical research. Herein, we present a novel sample holder combined with time-lapse fluorescence imaging technique, referred as 4D live cell imaging, allowing direct visualization of various cells up to 24\u2009hours. We further extended our approach to monitor kinetics and dynamics of particle uptake by cells and translocation across tissue membranes. In vitro 3D co-culture models have offered many great advantages in the field of tissue engineering especially in providing more physiological environments and predictive output towards conventional 2D cultures2. Indeed it has been shown that cells cultured in a 3D configuration differ morphologically and physiologically3, and they possess more similar cellular behaviors to in vivo systems in comparison to their 2D culture counterparts2, allowing more realistic and reliable studies in a setting that resembles the in vivo environment4. A few examples have demonstrated the potential of 3D cell models in drug discovery1 or biopharmacokinetics study of nanodevices in specific organs7, where, these models have comprised of a combination of different cell types in a 3D scaffold comprised of biological polymers, and/or the co-culture of various cell types. In particular, 3D models of the human lung epithelial tissue barrier have been established which has allowed for the accurate in vitro simulation of bacterial airway infection8 and particulate uptake/translocation as well as cellular responses mimicking inhalation pathways5. Difficulties lay in the spatial characterization of thick in vitro tissues composed of several cell layers (i.e. >60\u2009\u03bcm). Characterization of cell culture is normally performed by fluorescence light confocal microscopy, however, with 3D cell culture, the analytical challenge lies in the characterization of live co-culture/tissue in real time. Solving this will allow for the deeper understanding of the behavior of cells grown in a 3D co-culture configuration, as well as the study of the kinetics and dynamics of fluorescently-labelled drugs or nanocarriers over a longer period of time. In this brief communication, we report the design and fabrication of a sample holder by 3D printing technology optimized for 3D cell culture models cultured on widely used and commercially available permeable membrane inserts, combined with a simple time-lapse fluorescence confocal imaging technique, which we refer to as 4D live cell imaging. The system allows for the direct visualization of a live 3D cell model, without the need for the removal of membrane inserts and cell fixation. By using this method, the uptake and translocation of fluorescently-labelled silica particles across cellular tissue barriers has been followed in a 3D co-culture lung model consisting of three cell types namely, epithelial cells and macrophages on the apical and dendritic cells on the basolateral side of permeable inserts11 over several hours up to one day .The design of the imaging chamber consists of an insert holder fabricated by 3D printing with a \u201ctwist-fastener\u201d lock mechanism (see methods for details) and a commercially available and widely used glass bottom dish Fig.\u00a0. The sys12, where the system resembles human lung epithelial tissue. This barrier consists of three different types of cells, namely, human epithelial type-II cells (A549), MDM , and monocytes-derived dendritic cells . The fastest scanning rate for the three channels and 35\u201340 slices (slice thickness 2\u2009\u03bcm) was ca. 3\u20134\u2009min. To avoid any cell stress and possible light-induced cell killing due to extended light exposure, the time frame was increased to 20\u2009min and the imaging was performed for up to one day. The obtained raw data was processed and rendered using a 3D rendering software for the better visualization of cells.This technique was then applied to characterize systems that are more complex: 3D co-cultures. A 3D lung model was constructed according to a previously reported procedureca. two times faster than MDM\u2019s movement (i.e. 0.1\u2009\u00b1\u20090.08\u2009\u00b5m/min) cultured only on the insert. We hypothesized that this difference is twofold. Firstly, the phagocytotic nature of macrophages to clear debris from dead cells in the surrounding: the MDM are compelled to move and clean the cell debris from the apoptotic epithelial cells. The difference in velocity can be also attributed to substrate stiffness, i.e. insert vs. epithelial cell carpet. It is important to note that only a few cells underwent apoptosis, however, no significant reduction of the cell number was observed during the imaging experiment indicating the effect of long acquisition time can be well tolerated with higher time frame. In addition, we have performed cytotoxicity test based on lactate dehydrogenase (LDH) assay and we found out that cells were still viable even after the imaging experiment  in real time. During the image acquisition, no vertical movement of macrophages from apical to basolateral side nor of dendritic cells from basal to apical side was observed  and their distinction was only detected by their position . Figure\u00a03a). This result is in agreement with an earlier finding where polystyrene particles (1\u2009\u00b5m in size) were found more in MDM rather than in epithelial cells or MDDC in the same co-culture model12. The 3D lung model was further exposed to smaller size rhodamine B-labeled silica particles . To design the cap we used the open-source program FreeCAD, which was subsequently 3D printed on a UltiMaker 2+ . The material we used was polylactic acid polymer. Before the imaging experiment the holder was autoclaved for sterilization purpose. Second component is a commercially available and widely used glass bottom dish .The design of the live imaging chamber consists of two main components. First is a donut-shaped cap with a \u201ctwist-fastener\u201d lock mechanism  which is designed specifically for polyethylene terephthalate (PET) transparent BD Falcon permeable inserts  supplemented with 10% (v/v) fetal bovine serum , 1% (v/v) L-Glutamine (Life Technologies Europe) and 1% (v/v) penicillin/streptomycin (Gibco) and kept in a humidified incubator  until reaching 90% cell confluency of T-75 culture flask . The co-culture models were prepared as previously described10. Shortly, A549 cells  were seeded on a PET transparent BD Falcon permeable inserts  placed in a 12 well plates BD Falcon tissue culture plates (BD Biosciences) containing 1.5\u2009mL medium (lower chamber). Cells were cultured for 4 days and the medium was changed after the 2nd day. On day 5, medium was removed from the apical and basolateral chambers and the monolayer was stained with nuclei stained Hoechst 33342 (Invitrogen) or Vybrant\u00ae DiO  following the protocols provided by manufacturers for 30\u2009min. The layer was washed three times with PBS. The inserts were gently turned up-side down, placed in a petri dish and possible cells grown on the basolateral side of the membrane were gently removed with a cell scraper. MDDC  were priorly stained with Vybrant\u00ae DiI  for 15\u2009min and washed in PBS, were then pipetted onto the basolateral side of the inserts and incubated for 70\u2009min. The inserts containing A549 and MDDC were held in the 3D printed insert holder and the bottom part was placed in the glass bottom dish containing 1.5\u2009mL medium. MDM  which were pre-labeled with Vybrant\u00ae DiD  for 15\u2009min and washed in PBS, were added on the apical side (i.e. the top of A549) and the MDM were let to sediment for 30\u2009min before the imaging experiment.The 3D co-culture model consisted out of three different types of cells namely human alveolar epithelial type II cell line (A549) which was obtained from the American Type Culture Collection , human blood monocyte-derived macrophages (MDM) and dendritic cells (MDDC) which were isolated from buffy coats provided by the blood donation service SRK Bern and purified using CD14 Microbeads (Milteny Biotech) following the procedure reported previously18. For small size particles, shortly, 9\u2009mL of the silica precursor  was added to a preheated (60\u2009\u00b0C) mixture of 100\u2009mL of ethanol, 18\u2009mL of deionized water and 14\u2009mL of ammonium hydroxide . After 1\u2009min of core formation, 300\u2009\u00b5L of (3-aminopropyl) triethoxysilane  \u2013 rhodamine B conjugate, prepared the previous day by mixing 7.5\u2009\u00b5L of APTES with 528\u2009\u00b5L of rhodamine B isothiocyanate in ethanol (10\u2009mg/mL) and stirred overnight, was added to the mixture to form fluorescently-label layers around these initially formed cores. The reaction was further stirred overnight and purified by centrifugation at 5,000\u2009g and washed with ethanol three times followed by redispersion in autoclaved milliQ water 3 times. For larger particles, 2\u2009mL of TEOS was added dropwise (2\u2009mL/h) at room temperature to a mixture of 75\u2009mL of isopropanol, 25\u2009mL of methanol and 21\u2009mL of ammonium hydroxide. After 1\u2009hour of core formation, premixed solution of TEOS (6\u2009mL) and APTES rhodamine B isothiocyanate (300\u2009\u00b5L) was added dropwise (2\u2009mL/h) to the reaction mix. The reaction was further stirred overnight and purified by centrifugation at 100\u2009g and washed with ethanol two times followed by redispersion in autoclaved milliQ water 3 times. The synthesized particles were then visualized using a transmission electron microscope  and their corresponding size was determined using FIJI software . The hydrodynamic diameter and zeta potential were measured by dynamic light scattering and zeta potential analyzer , respectively. The particle concentration was determined by measuring the weight of 2\u2009mL of particle suspension after evaporating the water at 50\u2009\u00b0C.Two different sizes of silica particles were synthesized following the St\u00f6ber method previously described in literatureThe experiment was performed by incubating the 3D lung model with 260\u2009nm or 1.2\u2009\u00b5m rhodamine B-labeled silica particles at the initial concentration 20\u2009\u00b5g/mL or 50\u2009\u00b5g/mL in 500\u2009\u00b5L of cell culture media. After particle addition, the imaging experiment was immediately conducted.\u00ae DiI, rhodamine B, and Vybrant\u00ae DiD) were excited sequentially at 405, 541 and 633\u2009nm and their emissions were collected correspondingly by the detector with the frame size 512 pixel\u2009\u00d7\u2009512 pixel. The image was acquired in a z-stack and in time-lapse mode with the slice thickness 2\u2009\u03bcm and time between each frames 15\u201320\u2009min. Image processing (i.e. mean intensity projection) was carried out directly using Zen 2010 software (Zeiss GmbH). 3D rendering was performed using Imaris . False color images were adjusted to better distinguish different types of cells and nanoparticles.All of the fluorescence images were acquired using Zeiss LSM 710 confocal laser scanning inverted microscope set up with 20X magnification, numerical aperture, NA, 0.8 of Zeiss LCI Plan-NEOFLUAR objective lens . Different fluorophores . Using sum slice projection in Fiji the corresponding time-lapse z-stack images of particles was reconstructed. Particle surface area (in \u00b5m2) was calculated through measurement of pixel area in the entire single frame after intensity thresholding and binarization and it was plotted against the incubation time (different time frame).Single cell (surface) analysis was performed using self-written macro and 2D cell tracking was analysed by TrackMate plugin in Fiji software . 3D cell tracking was performed in Imaris. Semi quantitative image analysis of particle uptake (particle surface area measurement) in apical and basal side was performed using Fiji and Matlab . Shortly, the fluorescence channel of particles was classified depending on their position (basal Experimental data are available from the corresponding author upon reasonable request.Supplementary InformationSupplementary Video 1Supplementary Video 2Supplementary Video 3Supplementary Video 4"}
+{"text": "The objective of this study is to investigate the effects of humanistic care and psychological counseling (HCPC) on psychological disorders (PD) in medical students after coronavirus disease 2019 (COVID-19) outbreak.We will search randomized controlled trials or case-controlled studies of HCPC on PD in medical students after COVID-19 outbreak in the following electronic databases: PUBMED/MEDLINE, EMBASE, Cochrane Library, CINAHL, AMED, WANGFANG, and CNKI. The time is restricted from the construction of each database to the present. All process of study selection, data collection, and study quality evaluation will be carried out by two independent authors. Any different opinions will be solved by a third author through discussion. We will employ RevMan 5.3 software to conduct statistical analysis.This study will provide a better understanding of HCPC on PD in medical students after COVID-19 outbreak.This study may offer strong evidence for clinical practice to treat PD in medical students after COVID-19 outbreak.CRD42020193199. Studies suggested that humanistic care and psychological counseling (HCPC) can effectively treat PD in medical students after COVID-19 outbreak.\u201329 However, no systematic review has investigated this issue. Thus, this systematic review protocol will appraise the effects of HCPC on PD in medical students after COVID-19 outbreak.Outbreak of COVID-19 is associated with considerable psychological disorders (PD), such as depression, anxiety, and fear in general public, specific communities, or medical students, especially when the infection rate and deaths are considerable.22.1We registered this study protocol on CRD42020193199. We reported it based on the guideline of Preferred Reporting Items for Systematic Reviews and Meta-Analyses Protocols.2.22.2.1We will include randomized controlled trials (RCTs) or case-controlled studies (CCSs) of HCPC on PD in medical students after COVID-19 outbreak. We will not consider other studies, such as animal study, review, editorial comment, case report, and case series.2.2.2The target population is medical students with confirmed PD after COVID-19 outbreak irrespective of ethnicity, sex, and severity of PD.2.2.3The experimental interventions are any forms of HCPC combination.Besides any types of HCPC, no limitations will be made on comparators.2.2.4The primary outcomes are depression and anxiety, as reported by any scales in the trial, such as Hamilton Depression Rating Scale and Hamilton Anxiety Rating Scale.The secondary outcomes are mental disorder, panic disorder, health-related quality of life, and adverse events.2.32.3.1We will search the following electronic databases from the construction of each database to the present: PUBMED/MEDLINE, EMBASE, Cochrane Library, CINAHL, AMED, WANGFANG, and CNKI. We will build search strategy for Cochrane Library and will be presented in Table 2.3.2We will also check other resources, such as conference abstracts, dissertation/thesis, and reference lists of relevant review.2.42.4.1Two authors will independently carry out study selection. Any disagreements will be solved by a third author through consultation. All searched records will be imported to the citation management software (EndNote 7.0), and all duplications will be eliminated. Then, titles and abstracts of all potential studies will be scanned to remove unrelated studies. After that, we will carefully check full-text of all potential articles according to the eligibility criteria. We will present the process of study selection in a flowchart.2.4.2Two authors will independently undertake data extraction using a standard data extraction sheet. Any confusion will be resolved by a third author through discussion. The extracted information includes general information , study information , patient information , outcomes , and other information (such as funding and conflict of interest). If there is unclear or missing data, we will contact primary authors to obtain it by email or telephone or fax.2.4.3Two independent authors will carry out study quality assessment using Cochrane Risk of Bias Tool for RCTs, and Newcastle-Ottawa Quality Assessment for CCSs, respectively. Any discrepancies will be settled down by a third author through discussion or consultation.2.52.5.1I2 test. I2 \u226450% means reasonable heterogeneity, and we will employ a fixed-effect model. If sufficient data are extracted from eligible trials, we will conduct meta-analysis based on similarity in study information, patient information, interventions, controls, and outcomes. I2\u200a>\u200a50% exerts considerable heterogeneity, and we will place a random-effect model. In addition, we will carry out a subgroup analysis to explore its sources. If the meta-analysis is not possible, we will perform a narrative synthesis of study findings.This study will utilize RevMan 5.3 software to perform statistical analysis. We will estimate treatment effect of dichotomous outcomes as risk ratio and 95% confidence intervals (CIs), and that of continuous outcomes as mean difference (MD) or standardized MD and 95% CIs. We will identify statistical heterogeneity using 2.5.2We will only collect and analyze data from the first period of eligible study if cross-over study is included.2.5.3We will preside over a subgroup analysis in accordance with different study information, subject characteristics, specifics of interventions and controls, and study quality.2.5.4We will undertake a sensitivity analysis to check the robustness of study findings by removing low quality studies.2.5.5,32When more than 10 eligible studies on the same outcome are included, we will investigate reporting bias using Funnel plot and Egger's linear regression test.2.5.6 It will be further divided into five aspects of high, moderate, low or very low quality.Two authors will independently appraise the overall quality of evidence for each outcome using the Grading of Recommendations Assessment, Development and Evaluation approach.2.6We expect to publish this study on a peer-reviewed journal or a conference meeting. This study will not require ethic approval, because it will not collect individual patient data and privacy.3,2 It also brings tremendous PD for general population, doctors, nurses and medical students.\u201323 Previous studies reported that HCPC can benefit PD in medical students after COVID-19 outbreak.\u201329 However, there is no systematic review focusing on this topic, and evidence-based medicine literature is very necessary to explore its effects. Thus, in this study, we will summarize recent associated studies to appraise the effects of HCPC on PD in medical students after COVID-19 outbreak. The findings of this study may yield helpful evidence for both clinicians and health-related policy makers.The outbreak of COVID-19 pandemic creates challenges for clinicians and scientific researchers.Conceptualization: Hao Tian, Yu Xue, Rong-rong Yao, Da-yin Chen, Fan-bo Wang, Qing-hui Ji.Data curation: Hao Tian, Rong-rong Yao, Yu Yan, Yong Xue, Da-yin Chen, Fan-bo Wang, Chun-feng Li.Formal analysis: Hao Tian, Yu Xue, Yong Xue, Chun-feng Li.Investigation: Qing-hui Ji.Methodology: Hao Tian, Rong-rong Yao, Yong Xue, Da-yin Chen, Fan-bo Wang.Project administration: Qing-hui Ji.Resources: Hao Tian, Yu Xue, Rong-rong Yao, Yu Yan, Yong Xue, Da-yin Chen, Fan-bo Wang, Chun-feng Li.Software: Hao Tian, Yu Xue, Rong-rong Yao, Yu Yan, Yong Xue, Da-yin Chen, Fan-bo Wang, Chun-feng Li.Supervision: Qing-hui Ji.Validation: Hao Tian, Yu Xue, Yu Yan, Yong Xue, Da-yin Chen, Fan-bo Wang, Chun-feng Li, Qing-hui Ji.Visualization: Hao Tian, Rong-rong Yao, Yu Yan, Yong Xue, Qing-hui Ji.Writing \u2013 original draft: Hao Tian, Yu Xue, Rong-rong Yao, Yu Yan, Yong Xue, Da-yin Chen, Fan-bo Wang, Chun-feng Li, Qing-hui Ji.Writing \u2013 review & editing: Hao Tian, Yu Xue, Yong Xue, Fan-bo Wang, Chun-feng Li, Qing-hui Ji."}
+{"text": "Dental health in donkeys has long been neglected, even though it is quite common for them to have dental problems. Therefore, dental care, as basic as dental floating, can be a good start to improve their dental condition. Oral microbiome sequencing is a reliable way to reflect the oral health of animals. However, little is known on the effect of dental care on the oral microbiome of donkeys. Hence, a research project was undertaken to investigate the relationship between dental floating and oral microbial changes using a current sequencing technique. We found that the changes of the oral microbiome were not significant, probably due to the necessity of more specific and consistent treatment. However, the study provided an insight of the oral microbial composition and helped increase awareness of dental care in donkeys.The objective of this study was to investigate the oral microbial composition of the donkey and whether basic dental treatment, such as dental floating, would make a difference to the oral microbial environment in donkeys with dental diseases using high-throughput bacterial 16S rRNA gene sequencing. Oral swab samples were collected from 14 donkeys with various dental abnormalities on day 0 (before treatment) and day 20 (twenty days after treatment). It is the first report focusing on the oral microbiome in donkeys with dental diseases and the impact of common dental procedures thereon. Identified in group Day 0 and group Day 20, respectively, were 60,439.6 and 58,579.1 operational taxonomic units (OTUs). Several taxa in Day 0 differed significantly from Day 20 at the phylum and genus levels, but no statistically significant difference was observed in richness and diversity of Day 0 and Day 20. The results also indicated that a larger-scale study focusing on healthy donkey oral microbiome, as well as the correlation of dental diseases and oral microbiomes at different time frames following more specific and consistent dental treatment, are warranted. Dental disease is a large welfare concern in donkeys . The incThe donkeys involved in this study were of the Liaoxi breed from a donkey farm in Northeast China. Donkeys in this farm were mainly female, used for milk and reproduction. No dental care had been performed on any of these animals before this study, and no antimicrobial medications had been administered in the previous 8 weeks to any of them selected for this study. Fourteen donkeys were randomly selected from a group of approximately 100 donkeys on Day 0. All were female, aged between 2 to 10 years old (mean age was 6). They were fed with mainly crop residue  and supplemented with a small amount of homemade concentrate  three times a day for years. None of the donkeys wore halters daily, only for special procedures\u2014for example, the dental exam in this study. The examination started with a visual inspection of the skull symmetry and detection of ocular or nasal discharge. There was minimum-to-no obvious pain reactions such as head tossing noted while palpating and pressing the cheeks against the cheek teeth. Incisors were examined first to look for any abnormalities, such as brachygnathism, prognathism or occlusal surface abnormalities such as a slant, \u201cfrown\u201d or extreme \u201csmile\u201d. Whereafter, they were each sedated, and the oral cavity was flushed with tap water. An incisor speculum (Hausmann speculum) was then applied to facilitate examination. Other tools used to detect dental abnormalities of cheek teeth included a head light, a dental mirror, a dental explorer and a periodontal probe. Dental disorders were recorded, including severe sharp enamel points, periodontal pockets, hooks, diastemata, shear mouth, step mouth, wave mouth, accentuated transverse ridges and caries. Following the dental examination, sample procurement from the oral cavity was conducted in all 14 donkeys.On Day 0, after a thorough oral exam, samples were collected by using a sterile swab rubbed around the gingival margin and on top of the gingival sulcus on the buccal side bilaterally with sufficient pressure . Each swAll samples were maintained at \u201220 \u00b0C before DNA extraction. Sample DNA was obtained from the oral swabs using a Hi-Swab DNA Kit  in accordance with the manufacturer\u2019s instructions. The DNA concentration and purity were monitored by 1% agarose gel electrophoresis. According to the concentration, DNA was diluted to 1 ng/\u00b5L using sterile water.\u00ae High-Fidelity PCR Master Mix ; 0.2 \u00b5m of forward and reverse primers, 10-ng template DNA and ultrapure water. Thermal cycling consisted of initial denaturation at 98 \u00b0C for 60 s, 30 cycles of denaturation at 98 \u00b0C for 10 s, 50 \u00b0C for 30 s, 72 \u00b0C for 30 s and one final cycle of 72 \u00b0C for 300 s.The V4 hyper-variable regions of the 16S rRNA genes were amplified by Novogene using the specific primers 515F (5\u2032-3\u2032 GTGCCAGCMGCCGCGGTAA) and 806R (5\u2032-3\u2032 GGACTACHVGGGTWTCTAAT), which target the V4 region of the bacterial 16S rRNA gene. Each PCR reaction was carried out in total volume of 30 \u00b5L with 15 \u00b5L of PhusionFor \u03b1-diversity, the richness of samples representing the number of different bacterial taxa in each group was assessed using the number of observed operational taxonomic units (OTUs) and the Shannon index. In addition, the Simpson index was used for assessing evenness. The Illumina-sequenced paired-end reads were merged by using FLASH (V1.2.7). Sequences were processed by using the QIIME  software package for quality filtering and construction of the OTUs . SequencT-test for paired samples was applied for the comparisons of the Shannon index. \u03b2-diversity analysis was performed to compare samples. Principal component analysis (PCA) was used to evaluate the general distribution of the resulting bacterial community composition. The linear discriminant analysis effect size (LEfSe) pipeline was also applied.The Kolmogorov-Smirnov test and the Shapiro-Wilk test were used to assess continuous data for normal distribution. t-test  and Mann-Whitney U test  were used for the statistical evaluation of continuous variables.Paired On Day 0, all 14 donkeys in this study had mild-to-severe sharp enamel points and a varied degree of periodontal pockets . AccordiP = 0.401) from samples collected on Day 0 and Day 20, respectively. The microbial richness and diversity were evaluated with \u03b1-diversity indexes, including the Chao1 index, observed OTUs, Shannon index and Simpson index. The richer bacterial microbiomes are indicated by a higher Chao1 index or observed OTUs, while more diverse bacterial microbiomes are indicated by a higher Shannon index or lower Simpson index. There was no significant difference of the mean number of OTUs , Chao1 index (P = 0.291), Shannon index (P = 0.779) and observed OTUs (P = 0.306)   between Firmicutes, Proteobacteria, Actinobacteria, Bacteriodetes, Fusobacteria, Cyanobacteria, Acidobacteria, Gemmatimonadetes, Chloroflexi and Spirochaetes. Among these phyla, each of the first five phyla  accounted for >1% of the total sequences amongst both groups. Firmicutes and Proteobacteria were the most common bacterial phyla in the Day 0 group and Day 20 group, which accounted for 81.1\u201381.9% . Actinobacteria had significantly lower relative abundance (3.3%) on Day 20 after dental treatment compared to the data (8.8%) on Day 0 (P = 0.035).When the taxonomic abundance of the two groups of sequences was compared at the phylum level, the microbial community of the two groups featured a similar profile. The relative abundance of the top nine phyla in both groups are displayed in .1\u201381.9% a. CyanobGemella and Streptococcus were the most common bacterial genera in both groups. Higher levels of Pseudoclavibacter (2.97%), Lautropia (9.74%), Moraxella (2.17%), Leptotrichia (1.64%) and Rothia (1.35%) were found in the Day 0 group.There were also some differences of the taxonomic abundance at the genus level b. Eight P < 0.05). The genera found most associated with the Day 0 group were Lautropia and Pseudoclavibacter, while Fusobacterium was the genus most associated with the Day 20 group. Burkholderiaceae and Bacteoidales yielded the highest LDA scores among the periodontal biomarkers in the Day 0 group and Day 20 group, respectively.\u0392-diversity was accessed by a principal coordinate analysis (PCoA), which did not show statistic difference at the phylum level, while there was a greater overall variance in the Day 20 group than in the Day 0 group . The linThis is the first report investigating the oral microbiome in donkeys and comparing the microbial changes before and after dental floating. All donkeys in this study were female due to the production purpose of this farm. There has been no report of the correlation of sex and oral microbial composition, while gut microbiota variance has exhibited an association with sex in other species , includiThe feeding pattern of donkeys in this farm only allowed them to chew for short periods of time during the day, which may cause the teeth wearing down inadequately and unevenly . TherefoThe environment is another popular variable input while studying a microbiome, yet no report regarding the association of environmental changes and oral microbiota composition in animals has been published. However, environmental factors such as husbandry conditions in terms of stable types and grazing periods have been proven to have a great influence on the richness and diversity of gut microbiota in horses . DerivedOral microbiome changes have been associated with dental disease, especially periodontal diseases in humans and many animal species, including horses ,11 dogs The donkeys selected in our study had severe sharp enamel points prevalently, which are especially common in younger donkeys , and perActinobacteria, Bacteriodetes, Firmicutes, Proteobacterio and Spirochaetes, which were found predominant in both groups at the phylum level in this study, were also commonly found in the mouths of healthy humans [Firmicutes, the most common bacteria phyla in this study, was also a common inhabitant of the oral cavity, especially in the subgingival area. However, some studies focusing on oral microbiomes in dogs and cats with periodontitis showed that it was one of the predominant phyla in the periodontitis group. Firmicutes was also abundant in horse subgingival plaque, likely acting as an opportunistic pathogen and contributing to periodontitis [Proteobacteria, the second-highest bacterial phylum in this study, was also abundant in horse subgingival plaques [In the current study, 16S rRNA sequencing revealed that the composition of the oral microbiome of the two groups (Day 0 and Day 20) were not significantly different in richness and diversity, indicating that dental floating did not render many changes at the microbial level. However, the relative differences indicated a shift in relative abundance, indicating a reassortment in dominance. Hence, more specific and consistent dental treatments on dental disorders may yield more optimal outcomes, and more studies focusing on these topics are worthwhile for the better control and improvement of donkey dental conditions. In previous research using the same 16S rRNA sequencing technique, y humans , equinesy humans  and caniy humans , with sldontitis . Proteob plaques . FurtherGemella spp. and Streptococcus spp. were the most common bacterial genera in this study, as well as in many animals in other studies [Gemella was slightly more predominant in the Day 20 group, while Streptococcus was slightly lower in the Day 20 group. Gemella has been shown more prominent in healthy horses [Streptococcus has been reported to be the most common genera of Firmicutes in the healthy human oral microbiome [Gemella in the Day 20 group but not enough for notable changes. studies . Gemellay horses , and Strcrobiome , but indcrobiome . Dental Fusobacterium, an obligate, anaerobic bacterium, is considered as a common oral niche inhabitant in humans and some other animals, including horses [Lautropia and Pseudoclavibacter were the genera most associated with Day 0 in LEfSe. These changes were likely an indication of an expansion of the lesser phyla allowed by suppression of the more dominant microflora present in Day 0. Its population can increase significantly as an opportunistic pathogen in oral disease and has been cultured from a horse and a donkey with dental abscesses [Fusobacterium, such as F. nucleatum, have been associated with periodontal diseases in many animals, including dogs, cats and horses [Pseudoclavibacter, belonging to the Actinobacteria phylum. So far, nothing has been reported about this bacterial genus in oral microbiome studies either in humans or in animals. It was not identified in the Day 20 group and only associated with the Day 0 group according to the LDA score, which may indicate some associations between this bacteria genus and donkey dental diseases. Further studies involving more individuals will be helpful to decide whether Pseudoclavibacter is specific in donkeys and associated with dental diseases or merely an environmental contaminant.g horses . In thisbscesses . Some spd horses ,34,35. HIn conclusion, this is the first report of the donkey oral microbiome in association with basic dental treatment. Our results did not reveal significant differences of the oral microbial composition in selected donkeys; however, there were bacterial genera showing significant differences between the Day 0 and Day 20 groups, as well as a strong association to each group. These shifts of relative diversity and dominance indicated a reassortment relative to the dental treatment. Furthermore, our study revealed that the donkeys shared many similarities with other animals at the phylum and genus levels. Additional studies to investigate the donkey oral microbiome in healthy conditions, as well as its associations with specific types of oral diseases, such as periodontitis and diastema, by selecting samples specifically will promote an understanding of the impact of these diseases on donkey dental health. It will also build up a basis for studying the influences of other potential factors, including diet, feeding pattern and farm environment on the donkeys\u2019 dental condition, so that more scientific raising methods can be established to improve their quality of life."}
+{"text": "Coronavirus Disease 2019 (COVID-19), emerged in Wuhan, China, in December 2019. As of 10 March 2020, COVID-19 cases have been reported in 114 countries from all Continents except Antarctica, with accumulative 80\u2009932 cases in China and 29\u2009432 in other countries . TherefoReverse Transcription-Polymerase Chain Reaction (RT-PCR) testing was recommended to confirm COVID-19 cases by China medical authority , howeverConsidering that asymptomatic cases are also of higher transmission potential, sensitivity should be first considered for the screening purpose of COVID-19 infection. When confirmation for intensive treatment, specificity should be first considered to avoid false treatment. Parallel tests and serial test are needed to increase both sensitivity and specificity. Parallel tests perform RT-PCR and CT imaging at the same time and the results are cross-referenced to make the diagnosis ["}
+{"text": "In the majority of EU Member States, agricultural land is expected to decrease not only due to land-use changes in favour of urban expansion and afforestation but also to land abandonment processes. The knowledge on location and extent of agricultural land abandonment is relevant for estimating local external effects and adapting policy interventions. Currently, multi-level land-use models are able to capture determined processes of demand-driven redevelopment. However, land abandonment is much more difficult to capture because of its more ambiguous definition and the lack of data on its spatial distribution. This paper presents a method to explicitly model agricultural abandonment as a choice of disinvestment, which in turn is embedded in a utility-based land-use modelling framework that projects land-use changes for the EU and the UK. Validation exercises using observed spatial distribution of abandoned farmland show that the proposed method allows to model abandonment with acceptable accuracy. \u2022LUISA is a modelling platform able to dynamically project agricultural land abandonment.\u2022Biophysical, agricultural socio-economic and regional factors are key drivers to estimate abandonment risk.\u2022The model outcomes project more than 5.6 M ha of abandoned land by 2030 in the EU and the UK.\u2022Risk areas for land abandonment are widespread in the EU countries and not limited to mountain regions.\u2022We present a long-term territorial assessment that might guide different strategies for preventing land abandonment.\u2022Data availability and resolution are key elements for modelling and validating farmland abandonment. It stilThe abandonment of agricultural land can cause undesirable environmental, socio-economic and landscape impacts; for instance, biodiversity loss, landscape homogenization, increased fire risk, soil erosion and soil degradation, as well as increase of the area of agriculture intensification . HoweverOn the other hand, where agricultural abandonment coincides with favourable climate and soil conditions it can lead to environmentally valuable natural succession. This re-vegetation process may entail important positive benefits such as improving soil organic matter content, stabilisation of soils, carbon sequestration, regulation of water flow, and habitat restoration with an improvement in species number and biodiversity . All in In many countries in Europe, the potentially negative impacts of agricultural abandonment have been addressed via a broader set of policy instruments that aim to alleviate the negative consequences or even reverse abandonment trends in its early stages. For decades the European Union (EU) has been intervening in agricultural markets with specific payment schemes dedicated to marginal farming areas . The \u201cLeDuring the last decades, considerable effort has been put in mapping, quantifying and assessing the major impacts and drivers that entail abandonment land processes. Some studies on land abandonment focused on concepts and drivers, highlighting the importance of environmental, socio-economic and farm management factors , while oGiven the political relevance of agricultural abandonment in Europe, an estimate of where and how much abandonment will happen in the future would be useful. Unfortunately, so far less attention has been given to modelling techniques to obtain estimates of future abandonment locations, typically developed in existing spatially dynamic modelling systems. Previous studies built different scenarios in order to explore possible future developments and impacts, and were based mostly on econometric techniques . These eA more refined method to model locations of farmland abandonment is called for. The paper at hand presents a method to explicitly model future local agricultural abandonment processes as a result of economic decisions on the use of land, within an integrative, spatially dynamic land-use modelling framework. The implementation of the method is illustrated with the LUISA Territorial Modelling Platform, a model that dynamically simulates population, land-use and accessibility changes across the EU and the UK (The United Kingdom) at a 100\u00a0m resolution in order to assess local and cross-policy externalities. Future land-use trends and major drivers of land abandonment are simulated under the EU Territorial Reference Scenario 2017 . The terThe rest of this paper is structured as follows. Firstly, we briefly introduce the general land-use modelling framework of LUISA Section . Then, w2Within the LUISA modelling framework, land abandonment is thus conceptualised as a temporary phenomenon that may happening even without demand reduction, as a consequence of a transition of the agricultural production system towards an optimal spatial distribution section , 2.2. A 2.1LUISA is a pan-European modelling platformDiscrete land-use changes in LUISA are modelled by optimizing the expected local utility values for land uses. Optimization is constrained by the available land in a region and by input expectations on total land area in the region that is needed by the modelled land uses. A key input thus considers projected regional demand for agricultural land. These demand projections are obtained from the 2016 CAPRI baselineGiven regional demand for agricultural land and other land uses, a dedicated discrete allocation mechanism available in the open-source GeoDMS software  iterativLand-based functions require investments with a long-term time horizon. Utility is, therefore, computed as the net present value (NPV)The time horizon, annual costs and discount rates are held fixed in the model regardless of location and modelling time. Initial investment costs do depend on the existing land cover in a specific location, as the existing physical make up of a location may call for clearing or demolition operations. Revenues are highly dependent on location, being calculated as follows:The computed NPVs are implemented in the allocation algorithm, by employing a logit-type approach derived from discrete-choice theory . Discret2.2In LUISA, the extent, location and timing of farmland abandonment is modelled in three separate classes, namely through abandoned arable crops, permanent crops and fields used for livestock. To do so, both local likeliness and regional expectations of abandonment need to be provided for every 5-years model step. Expectations on future regional agricultural abandonment are dynamically quantified for each modelled country separately, based on expected shares of land abandonment. Those were quantified based on per-annum percentual losses of Utilized Agricultural Area (UAA) as observed in Corine Land Cover between 2000 and 2012, and are further supported by the reference values taken from the modelling exercises presented in At the local level, abandonment is simulated in LUISA's utility optimization approach as an alternative choice available to all grid cells that are currently used as agricultural land. This approach, thus, considers abandonment a separate disinvestment decision that may be the highest utility outcome in specific locations and contexts. So-called allow rules govern which transitions between land uses are permitted within the simulation. They are imputed in the model by imposing that the NPV values for a non-allowed transition are below the minimum threshold of the discrete allocation method, so that, effectively, disallowed transitions are not considered. Through such allow rules, only agricultural land types can become abandoned agricultural land while previously abandoned agricultural land can be converted into any land-use type , save other abandoned land classes, in a subsequent time step.Agricultural revenue and cost estimates were obtained from 2.3The risk map2.3.1A set of nine factors, dealing with soil, climate and terrain criteriaThe selection of these criteria is supported by many studies. As described in 2.3.2Economic and farm-structure agricultural data is used to represent the stability, viability and performance of regional agricultural systems, indicating resilience against farmland abandonment. These datasets are mainly gathered from FADN2.3.32 are considered very low-density areas . Pastoral land  and permanent crops  make up smaller portions of total abandoned land. Almost a quarter (1.38\u00a0Mha) of all agricultural abandonment will most likely occur in mountainous areasLandscapes and agricultural production systems vary considerably among EU MSs, and as a consequence, so are national compositions of abandonment . AbandonAt the regional level, The modelling exercise allows us to analyse agriculture land abandonment at the local scale for the whole EU territory . For illThe Karditsa region b, is cha3.3Analysing land-use/cover flows illustrate the main land-use trajectories that are projected to occur within the simulation period. Comparing differences in shares  from 2015 to 2030 provides important findings at the country level . Some co3.4As described in section Second, we compare local abandonment hotspots compiled by Lasanta et al. 2016)1620, VauFinally, a logit expression see Eq.  is used 4Even though agricultural land abandonment is a sizeable process in Europe, a wide overview and future outlook of abandonment are missing for the continent. Previous contributions covered case studies and partial aspects of the process , which dThe way to model agricultural abandonment by the LUISA model differs substantially from previous abandonment modelling exercises in terms of assumptions, spatial and thematic resolution, and reference land-use data. To estimate the extent and locations of future abandonment, LUISA attempts to endogenously model agricultural land abandonment as a choice of disinvestment, using a map of induced abandonment risk to capture the most likely locations of abandonment while taking into account the spatial heterogeneity of Europe's farming conditions. The most recent available data and information were used to compose that risk map. However, a set of uncertainties are intrinsically part of this type of modelling, coming into play through choices such as thematic, spatial and temporal resolution, data availability, geographical coverage, assumptions and aggregation methods . For insAn extensive exercise has been executed to validate the inclusion of the agricultural abandonment model. We find that the introduced agricultural risk map coincides with abandonment observed in the LUCAS database. Modelled abandonment coincides with the abandonment shares reported by Despite the many differences between prior modelling approaches, LUISA's abandonment results corroborate many of the findings of previous works. The total abandonment share expected here is very similar to the 3.7% from the most moderate scenario reported by Lasanta et al. (2016)When an abandonment process occurs, it affects not only the abandoned area itself but also its local population and the whole society in terms of production of goods  as well as other services provided by the multifunctionality of the agricultural land . One of 5Agricultural land abandonment is the largest land-use change process in Europe and it is expected to continue during the next decades. Land abandonment has been analysed in European mountainous and remote areas since the earlier decades of the 20th century, but less effort has focused on other vulnerable areas. This study, therefore, presents a comprehensive European, spatially explicit exercise to model agricultural land abandonment. This was done within the LUISA Territorial platform from the period 2015\u20132030\u00a0at a high spatial resolution for all EU countries and the UK. Abandonment is considered a (dis)investment decision, and the location of abandonment is defined by an abandonment risk map deduced from previous findings in the literature. That risk map was composed by combining a set of factors that presumably drive agricultural abandonment, highlighting the importance of biophysical conditions, agricultural socio-economics, farm structure, demographics and geography.By 2030, results reveals that the total abandonment is projected to reach more than 3% (5.6 million ha) of the total agricultural land while, at the same time, the decrease of agricultural land over the same period of time is an evident fact in most EU countries and the UK. Spain and Poland are likely to account for one third of the EU total land abandonment, whereas France, Germany and Italy complement the leading group . This abandonment share is not equally spread across EU countries, ranging from less than 2% to more than 50% at the regional level. Areas that are hot-spots of undesirable abandonment might be particularly aimed at by policymakers in order to prevent or minimize present and future negative consequences, and our results can be a valuable spatial and quantitative source of information to this end.Modelling dynamic indicators require a set of geospatial and statistical data whose availability, accessibility and resolution are often limited, potentially affecting the reliability of the data produced. Multiple strategies were followed in order to validate the implemented approach. We need to emphasize the challenge of direct comparison with other sources because for instance temporal coverage, data, assumptions, abandonment definitions and spatial location vary among all those studies. Despite differences in location and extent, we stress the considerable spatial overlapping between LUISA and other datasets and model results. Definitively, LUISA projections of abandonment, however, seems to be conservative but in line with European average figures when compared to case studies based on policy scenarios and modelling.The views expressed are purely those of the author and may not in any circumstances be regarded as stating an official position of the European Commission.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
+{"text": "The chronic complications of Type 2 Diabetes (T2D) such as macrovascular disease is amplified with the increase in the number of metabolic syndrome (MetS) risk factors. This research aims to study the relationship of MetS, diagnosed by the International Diabetes Federation (IDF) or revised National Cholesterol Education Programs Adult Treatment Panel III (NCEP ATP III) criteria, with glycemic control, fasting blood glucose (FBG), glycated hemoglobin (HbA1c), C-peptide, and insulin resistance in T2D patients.The study is a cross-sectional observational study which, involved 485 T2D patients who are receiving treatment at the University Kebangsaan Malaysia Medical Center (UKMMC), Kuala Lumpur, Malaysia. The MetS among the T2D patients was diagnosed based on IDF and revised NCEP ATP III criteria. C-peptide and HbA1c levels were determined by an automated quantitative immunoassay analyzer and high-performance liquid chromatography, respectively. The MetS factors; FBG, triglyceride, and high-density lipoprotein cholesterol were measured by spectrophotometer.P\u2009<\u20090.001). Both IDF and revised NCEP ATP III criteria indicated that T2D patients with 5 MetS factors had higher insulin resistance , C-peptide , FBG , and HbA1c  than those T2D patients without MetS, respectively.Application of the IDF and revised NCEP ATP III criteria respectively resulted in 73% and 85% of the T2D subjects being diagnosed with MetS. The concordance of these criteria in diagnosing MetS among T2D patients was low (\u03ba\u2009=\u20090.33, Although there is a low concordance between IDF and revised NCEP ATP III criteria in the diagnosis of MetS among T2D patients, both criteria showed that T2D patients with 5 MetS factors had higher insulin resistance, C-peptide, FBG, and HbA1c. The burden of non-communicable diseases in developing countries is increasing and leading to high mortality rates . NowadayIt is estimated that 20\u201325% of the world\u2019s adult population suffers from MetS. People\u00a0with MetS have a threefold\u00a0increase\u00a0in the risk of coronary\u00a0heart\u00a0disease and stroke and a twofold increased risk of mortality from cardio- and cerebrovascular disease compared with people without the MetS . This glThe National Cholesterol Education Programs Adult Treatment Panel III (NCEP ATP III) proposed a simple set of diagnostic criteria for MetS based on WC, TG, HDL-C, BP, and FBG levels . In 2005In 2009, a meeting between several organizations: International Diabetes Federation Task Force on Epidemiology and Prevention; National Heart, Lung, and Blood Institute; American Heart Association; World Heart Federation; International Atherosclerosis Society; and International Association for the Study of Obesity attempted to unify criteria , 22.Several studies have assessed the MetS among normal individuals in different populations, while few studies evaluated the MetS among T2D patients. Taking into consideration, T2D patients who had MetS also have cardiovascular risk factors. Therefore, the diagnosis of MetS in those T2D patients is very important for the detection, prevention, and treatment of the underlying risk factors , 24. ThiThe current study was a cross-sectional observational study. Four hundred and eighty-five previously diagnosed T2D patients aged between 30 and 70\u00a0years attending the University Kebangsaan Malaysia Medical Center, Kuala Lumpur, Malaysia, were randomly recruited into the study after obtaining their informed consent. Ethical approval was obtained from the National University of Malaysia Research and Ethics Committee.g within 30\u00a0min of blood collection, and the serum from each sample was separated into 2 Eppendorf tubes and immediately kept at \u2212\u200920\u00a0\u00b0C until analysis. The treatment for each participant was collected from the patient data record at the University Kebangsaan Malaysia Medical Center.The WC was measured midway between the lower rib margin and the superior iliac spine at the end of gentle expiration in a standing position. The PB were taken from each patient\u2019s right arm in the seated position by using an Omron IntelliSense Automatic BP Monitor after 10\u00a0min rest in a quiet room. Two to three successive BP readings were obtained at 5\u00a0min intervals and averaged. Fasting blood (5\u00a0ml) was collected from each subject and divided into an EDTA tube for HbA1c measurement, and a plain tube for biochemical investigations. The plain tube was centrifuged for 10\u00a0min at 3000\u00d7Kits for the measurement of glucose, TG, and HDL-C  were purchased from Human Company . The Human company elevated control sera (Humatrol P Reference number 13512) was used as quality control for these parameters. C-peptide was measured in an automated quantitative immunoassay analyzer  using the IMMULITE C-peptide kit . HbA1c levels were determined by high-performance liquid chromatography  with lyphochek diabetes Bi-level controls  as quality control. Insulin resistance was calculated using the Homeostasis Model Assessment (HOMA2) Calculator v2.2 available from Oxford Center for Diabetes, Endocrinology, and Metabolism. This program used fasting C-peptide or insulin and FBG levels to calculate insulin resistance.Central obesity: WC\u2009\u2265\u2009102\u00a0cm for men, or\u2009\u2265\u200988\u00a0cm for womenRaised BP: systolic blood pressure\u2009\u2265\u2009130\u00a0mmHg, diastolic blood pressure\u2009\u2265\u200985\u00a0mmHg, or treatment of previously diagnosed hypertensionRaised TG levels:\u2009\u2265\u20091.7\u00a0mmol/l or specific treatment for this lipid abnormalityReduced HDL-C: men\u2009<\u20091.03\u00a0mmol/l, women\u2009<\u20091.29\u00a0mmol/l, or HDL-C treatment.The MetS was diagnosed based on the IDF and revised NCEP ATP III. All subjects included in this study were previously diagnosed with T2D, and therefore FBG was excluded from the five MetS criteria. The MetS in T2D patients was diagnosed according to revised NCEP ATP III that included two or more of the following abnormalities:While according to the IDF criteria, the MetS was defined by the presence of central obesity  together with one of the other MetS factors  with the same cut off point as revised NCEP ATP III.The analyses were assessed by SPSS version 11.5 software . The FBG, HbA1c, C-peptide, and insulin resistance were log-transformed as they were not normally distributed. Therefore these parameters mean and 95% confidence intervals were transformed back and reported. Cohen\u2019s Kappa (\u03ba) test was used to evaluate the concordance between the IDF and revised NCEP ATP III criteria. The general linear model  was used to study the correlation of MetS with glycemic control parameters  as a set of dependent variables.The T2D patients were on insulin and or oral antidiabetic medications (98%), antihyperlipidemic agents (65%), and antihypertensive medications (64.5%). Three hundred fifty-six (73%) and 415 (85%) out of the 485 T2D patients had MetS when defined by the IDF and revised NCEP ATP III criteria, respectively (Table\u00a0The IDF and revised NCEP ATP III criteria concurred the diagnosis of MetS in 331 (68%) T2D patients, while 25 (5%) were diagnosed as MetS by the IDF but not by revised NCEP ATP III and 84 (17%) by revised NCEP ATP III criteria but not by IDF . The revised NCEP ATP III criteria showed that not much difference in the prevalence of MetS between women with T2D (87%) and men with T2D (84%), while the IDF criteria showed that the prevalence of MetS was higher in women with T2D (82%) than in men with T2D (62%). The revised NCEP ATP III criteria showed that the highest prevalence of MetS was found in Malay patients with T2D (88%) followed by Malaysian Indian (85%) and Malaysian Chinese patients with T2D (81%). While the IDF criteria showed that the highest prevalence of MetS was found among Malaysian Indian patients with T2D (83%) followed by Malay (74%) and the lowest was among Malaysian Chinese patients with T2D (67%). Both criteria showed a higher prevalence of MetS among women with T2D than men with T2D within the three races with low concordance, particularly among Malaysian Indian women  Table\u00a02.\u221210; 4.7\u2009\u00d7\u200910\u221211 with powers to detect the relationships were at 0.99998 and 0.99997, respectively. The T2D patients with 5 MetS factors defined by the IDF or revised NCEP ATP III criteria had a significantly higher FBG  than T2D patients without MetS  in both IDF and revised NCEP ATP III criteria. The IDF criteria showed that T2D patients with 5 MetS factors had a significantly higher HbA1c than T2D patients with 4 or 3 MetS factors .Multivariate analysis of covariance in both IDF and revised NCEP ATP III criteria revealed significant relationships of MetS with glycemic control parameters, \u039b\u2019\u2009=\u20090.865; 0.855, P\u2009=\u20094.8\u2009\u00d7\u200910S Tables\u00a0 and 4. BP\u2009=\u20091.21\u2009\u00d7\u200910\u221213; 4.1\u2009\u00d7\u200910\u221211) or 4 MetS factors  than those T2D patients without MetS using both IDF and revised NCEP ATP III criteria, respectively (Tables\u00a0P\u2009=\u20090.004), whereas the IDF criteria showed no difference (P\u2009=\u20090.096). Both IDF and revised NCEP ATP III criteria showed a significantly higher C-peptide in T2D patients who had 5 MetS factors than those who had 4  or 3 MetS factors .C-peptide was significantly higher in T2D patients having 5 MetS factors , and those who had 3 MetS factors  or 4 MetS factors  when IDF or revised NCEP ATP III criteria were applied, respectively. Both IDF and revised NCEP ATP III criteria showed that insulin resistance was significantly higher in T2D patients with 4 MetS factors  than T2D patients without MetS, respectively. The revised NCEP ATP III criteria showed that T2D patients with 3 MetS factors had a higher insulin resistance than T2D patients without MetS (P\u2009=\u20090.01), while IDF criteria did not show a significant association (P\u2009=\u20090.110).The T2D patients with 5 MetS factors had a higher insulin resistance than T2D patients without MetS (2 used instead\u00a0of WC) showed a higher prevalence than IDF with 0.60 concordance between these criteria [In the present study, the prevalence of MetS among T2D patients was higher according to revised NCEP ATP III criteria compared to IDF, and the concordance between these two criteria was low. However, in German patients with T2D, the IDF criteria showed more MetS than revised NCEP ATP III with a higher concordance (0.69) . In the criteria . A recencriteria . The lowThe prevalence of MetS in our Malaysian patients with T2D as defined by revised NCEP ATP III criteria was higher than that reported in Ethiopians , NepalesThe increased WC was more frequent in women with T2D (89% and 59%) than men with T2D (68% and 23%) when defined by IDF and revised NCEP ATP III, respectively resulting in a higher prevalence of MetS in women with T2D than men with T2D, which is in agreement with previous studies , 35\u201338. In general, the IDF and revised NCEP ATP III criteria are the most applicable criteria for epidemiological studies and clinical diagnosis of MetS. However, the concordance between these two criteria was low for the diagnosis of MetS among Malaysian patients with T2D. The revised NCEP ATP III criteria utilized American data while the IDF criteria based on accumulated international data. Moreover, there is an ethnic difference in WC, which was considered by IDF. Although the IDF and revised NCEP ATP III criteria were in low concordance for the diagnosis of MetS among Malaysian patients with T2D, there was a similar relationship of MetS with glycemic parameters . The T2D patients with MetS have higher central obesity, which is associated with higher insulin resistance . AccumulThe relationships of MetS, as defined by either IDF or revised NCEP ATP III criteria, with insulin resistance and poor glycemic control were similar with a low concordance between IDF and revised NCEP ATP III criteria in the diagnosis of MetS among T2D patients. Based on the finding of our study as well as many other studies, it is clear that different definitions of MetS give rise to different prevalence. The difference in the definition of MetS between the two criteria requires more consideration as chronic complications of T2D is amplified with MetS."}
+{"text": "Drosophila and vertebrates have demonstrated that polyploid cells arise in adult tissues, at least in part, to promote tissue repair and restore tissue mass. However, the signals that cause polyploid cells to form in response to injury remain poorly understood. In the adult Drosophila epithelium, wound-induced polyploid cells are generated by both cell fusion and endoreplication, resulting in a giant polyploid syncytium. Here, we identify the integrin focal adhesion complex as an activator of wound-induced polyploidization. Both integrin and focal adhesion kinase are upregulated in the wound-induced polyploid cells and are required for Yorkie-induced endoreplication and cell fusion. As a result, wound healing is perturbed when focal adhesion genes are knocked down. These findings show that conserved focal adhesion signaling is required to initiate wound-induced polyploid cell growth.A key step in tissue repair is to replace lost or damaged cells. This occurs via two strategies: restoring cell number through proliferation or increasing cell size through polyploidization. Studies in  Summary: Conserved focal adhesion genes, mys and Fak, enable efficient wound repair by inducing polyploid cell growth via cell fusion and Yki-dependent endoreplication. Drosophila tissues also induce polyploid cell growth in response to tissue damage in the abdominal epithelium, follicular epithelium, pyloric hindgut, and intestinal epithelium  occurs in the l fusion . The endl fusion , 2016. Tl fusion . In WIP,is model . In mammis model .in vivo. Here, we find that conserved focal adhesion proteins, including integrin and focal adhesion kinase, are upregulated in wound-induced polyploid cells and are required to activate Yki to induce WIP.The Hippo pathway regulates Yki/Yap activation by responding to biological and biophysical cues, including adhesion, polarity, extracellular matrix (ECM) stiffness, and cytoskeleton rearrangement . Cell-ECDrosophila abdomen triggers WIP ], Fak, and talin. We found that Mys is strongly expressed in the lateral muscle fibers that overlay the abdominal epithelium prior to injury and expressed at a low level in the underlying epithelium, as measured in gaps between muscle fibers .We first examined the expression and localization of three conserved focal adhesion proteins in e fibers B, arrowse fibers C,D. Thise fibers . The talmys and Fak by comparing expression in control (no RNAi) with two UAS-mysRNAi and UAS-FakRNAi lines expressed with the epithelial specific Gal4  driver . We assayed for endocycle entry using the thymidine analog EdU as an S phase marker, as cells undergo successive S phases with each endocycle during WIP  and 40 (RNAi#3mys) .Next, we used the Gal4/UAS-RNAi system to knockdown focal adhesion genes in the fly epithelium and determine their role in WIP. First, the knockdown efficiency was confirmed for both ) driver  , 14% (RNAi#2Fak), 10% , and 7%  polyploid at 3\u2005dpi  and 3\u2005dpi (+) epithelia. Our previous studies have shown that the uninjured epithelial nuclei are diploid (2C) and therefore can be used as an internal control to measure changes in the fly epithelial cell ploidy . As expeectively F,I. We aat 3\u2005dpi G\u2013I. TherMyc and bantam (ban) whose expression can be detected with the lacZ reporters, Myc-lacZ and ban-lacZ, respectively. We found that knockdown of mys resulted in \u223c4-fold reduction in Myc-lacZ and up to 4-fold reduction in ban-lacZ expression comparable to RNAiyki at 2\u2005dpi  or 3\u2005dpi (+) epithelia in comparison to control  and RNAi#3mys alone. We previously observed that Yki overexpression induces hyper-polyploidization post injury , even though the focal adhesion gene knockdowns significantly reduced cell fusion . There were no significant changes in nuclear number or cell size with genetic loss of mys or Fak . Instead, mys and Fak are required post injury in the adult fly epithelium for optimal cell fusion during wound repair.Another key process for WIP is cell fusion, which enables formation of the giant multinucleated cells required to reseal the epithelium under the wound scab A,D. We iithelium A\u2013D. At 3ectively E,F. The l fusion D. This reostasis . Howevermys and Fak resulted in breaches in FASIII labeled cell-cell junctions in the epithelial sheet overlaying the wound scar, suggesting a role for integrin in this wound closure model as well (1118) with less than 7% of epithelial area open at 3\u2005dpi, whereas a WIP mutant , which fails to heal due to inhibition of both mechanisms of WIP has 80% of the epithelial area open at the wound site as previously reported , unlike the WIP mutant , which remains permanently open. The RNAimys delayed wound closure may be due to the reduced, but not permanent block in cell fusion. We previously showed that endoreplication or cell fusion alone is sufficient for epithelial wound closure, but inhibition of both simultaneously inhibits wound healing in adult fly epithelium  at 25\u00b0C. Drosophila strains for this study were from Bloomington Stock Center (b), and VDRC (v) stock numbers are noted. GMR51F10-GAL4 (b38793) called epi-Gal4 (1118 (b3605), UAS-ykiRNAi (v104523), UAS-mysRNAi#2 (b33642), UAS-mysRNAi#3 (v29619), UAS-FakRNAi#1 (b33617), UAS-FakRNAi#2 (b44075), UAS-talinRNAi#1 (b28950), UAS-talinRNAi#2 (b32999), UAS-E2F1RNAi (v108837); UAS-RacDN (b6292) .The epi-Gal4 , w1118 ( (b6292) , UAS-yki292)   . Full Z-stack images taken at 0.5\u2005\u00b5m per slice and flattened into SUM of stacks projections for all analysis. Fluorescent intensities were measured for anti-Mys, anti-Fak, and anti-\u03b2gal in at least three representative areas of the fly epithelium. The integrated density per area was measured between the overlaying muscle fibers in uninjured flies and around the wound site where the muscle fibers had retracted in the injured flies. The integrated density was then divided by the area of the measurement to normalize the staining intensity. The Yki reporters, ban-lacZ and Myc-lacZ, are expressed in epithelial nuclei and were measured by creating an ROI map of at least 30 GrhDrosophila epithelial nuclear ploidy was performed as recently reported  epithelium providing the percent open area, area=open epithelial area/ wound scar size.Cell fusion was quantified by outlining the FasIII cell-cell junctions of central syncytia and counting the number of Grht-test (Excel software) or ANOVA (Prism). Statistical significance indicated as follows: *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001.All experiments were performed in duplicate with at least three biological fly replicates measured and analyzed per condition. Statistical analysis was performed as indicated using unpaired"}
+{"text": "Fibrinogen incubated with human leukocytes activated by TNF\u03b1 was similarly oxidized, and later proteolyzed after 3\u00a0hours in vitro. TNF\u03b1 induced mitochondrial superoxide generation from neutrophils and monocytes, myeloperoxidase (MPO)-derived reactive oxygen species (ROS) from neutrophils, and nitric oxide from lymphocytes and monocytes. Inhibition of mitochondrial superoxide prevented oxidative modification and proteolysis of fibrinogen, whereas inhibition of MPO attenuated only fibrinogen proteolysis. Quenching of both mitochondrial superoxide and MPO-derived ROS prevented coagulopathy better than tranexamic acid. Collectively, these findings indicate that neutrophil and monocyte mitochondrial superoxide generation can rapidly oxidize fibrinogen as a priming step for fibrinogen proteolysis and coagulopathy during inflammation.Critical illness leads to rapid fibrinogen consumption, hyperfibrinolysis, and coagulopathy that exacerbates bleeding and increases mortality. Immune cell activation and inflammation are associated with coagulopathy after injury but play an undetermined role. We performed high dimensional immunophenotyping and single-cell imaging flow cytometry to investigate for a pathophysiological mechanism governing the effects of leukocyte-associated inflammation on fibrinogen function. Fibrinogen was oxidized early, followed by its degradation after 3\u00a0hours of lipopolysaccharides (LPS)-induced sterile inflammation in a rat model   \u2022Leukocyte-induced inflammation first oxidizes, then degrades fibrinogen.\u2022Fibrinogen is primed for proteolysis by\u00a0a process that involves mitochondrial and myeloperoxidase-derived oxidative stress.\u2022Inhibition of oxidative stress by antioxidants can prevent both fibrinogen oxidation and degradation. Severin vitro and that oxidative modifications are increased in trauma patients with TIC [Fibrinogen is a glycoprotein complex, made by the liver, that normally circulates in the range of 2\u20134\u00a0mg/mL in blood ,12. It iwith TIC ,17. ThisLeukocytes, consisting of monocytes, lymphocytes and neutrophils, can influence blood coagulation and fibrinolysis in many ways. Leukocytes can activate thrombosis by releasing tissue factor ,19, and in vitro and used single cell flow cytometry to measure ROS generation. We found that ROS were primarily generated by neutrophils and monocytes, sequentially generating mitochondrial superoxide, followed by MPO-derived ROS, and NO/NOX-derived ROS. The ROS generated could oxidize fibrinogen, were associated with its proteolytic degradation, and could induce coagulopathy. Mitochondrial superoxide and MPO-derived ROS also mediated NF\u03baB trans-activation and leukocyte TNF\u03b1 secretion. Only antioxidants inhibiting mitochondrial superoxide and MPO could block fibrinogen oxidation and prevent its degradation. Collectively, these data suggest that mitochondrial superoxide and MPO-derived ROS from neutrophils and monocytes can directly oxidatively modify fibrinogen, priming it for enzymatic degradation during inflammation.In this study, we investigated the direct effects of leukocyte-derived inflammation and ROS on fibrinogen form and function. We first demonstrated that fibrinogen oxidation, proteolysis, and coagulopathy were present and associated with increased TNF\u03b1 levels in a rat model of sterile inflammation induced by lipopolysaccharides (LPS) infusion. To further investigate potential mechanisms, we then exposed human fibrinogen to human leukocytes activated by TNF\u03b1 22.1in vivo during early inflammation, male Sprague-Dawley rats weighing about 300\u00a0g  were intravenously (i.v.) injected with LPS  for indicated time periods. All experimental procedures were undertaken with approval from the Institutional Animal Care and Use Committee of the University of Washington (Protocol #4329-05).To investigate the alteration of fibrinogen and hemostasis 2.2The extent of oxidative modification of fibrinogen was analyzed using the OxyBlot protein oxidation detection kit (Millipore) according to manufacturer's instruction. Carbonyl groups induced by oxidative modification are derivatized to 2,4-dinitrophenylhydrazone (DNP-hydrazone) by reaction with 2,4-dinitrophenylhydrazine (DNPH) and the DNP-derivatized proteins detected by western blot analysis. Briefly, isolated plasma from LPS-injected rats or culture conditioned media from human leukocytes were reduced and electrophoresed on a 4\u201312% gradient SDS-PAGE gel. Proteins were then transferred to nitrocellulose membranes. The membranes were incubated with a rabbit anti-DNP antibody, and then with a horseradish peroxidase-conjugated goat anti-rabbit secondary antibody.Plasma from LPS-injected rats or culture conditioned media from human leukocytes were also analyzed by western blot using anti-fibrinogen A\u03b1, B\u03b2 and \u03b3 antibodies. The samples were electrophoresed on a 4\u201312% gradient SDS-PAGE gel and then transferred to nitrocellulose membranes using a Bio-Rad Mini-Transfer Cell. After incubation with the blocking buffer  for 2\u00a0h at room temperature, membranes were incubated with a mouse monoclonal antibody against fibrinogen A\u03b1 , a rabbit monoclonal antibody against fibrinogen B\u03b2 , and a rabbit monoclonal antibody against fibrinogen \u03b3 , respectively, overnight at 4\u00a0\u00b0C in blocking buffer. PBS-T was used for all washing steps. After incubation with the horseradish peroxidase-conjugated secondary antibody for 1\u00a0h at room temperature, membranes were washed and scanned by using a GE ImageQuant 350 and software (GE). After western blot, each band corresponding to the apparent fibrinogen A\u03b1, B\u03b2 and \u03b3 was excised and subjected to in-blot trypsin digestion in order to confirm whether anti-DNP and anti-fibrinogen antibodies detect the exactly matched proteins. Tryptic peptides were then extracted and analyzed by matrix-assisted-laser desorption (MALDI) time-of-flight (TOF) tandem mass spectrometry as described previously .2.3Cytokines and chemokines  from LPS-injected rat plasma were measured using the multiplex immunoassay LEGENDplex rat Inflammation Panel (BioLegend) following the manufacturer's instructions. Samples were read using an LSRII (BD) flow cytometer and FlowJo. v10 (Treestar). Data analysis was performed with the LEGENDplex Data Analysis Software v.8 (BioLegend).2.4Citrated whole rat blood was recalcified to 10 mmol/L with 0.2 mol/L of calcium chloride and then transferred to 37 \u00b0C ROTEM minicups (Werfern) for assessment via ROTEM using EXTEM and FIBTEM assays as described previously . EXTEM  at the Bloodworks Northwest Research Institute, Seattle, Washington. All donors provided written informed consent and authorization for blood draws and release of medical information (Protocol # BT001).2.6+, CD3/CD19\u2212, CD16b+, CD14\u2212), lymphocytes  and monocytes . Analysis was performed using an LSRII (BD) flow cytometer and FlowJo. v10 (Treestar).Whole human blood was incubated in ACK RBC lysis buffer (Thermo Fisher Scientific) for 4\u00a0min at 37\u00a0\u00b0C to remove red blood cells. Cells were incubated with NIR Zombie  in PBS for live/dead staining for 15\u00a0min at room temperature, followed by BV421 CD45 , APC CD14 , BV605 CD16b , PE/Cy7 CD19 , PE/Cy7 CD3  and Fc blocker  at 4\u00a0\u00b0C in the dark for 20\u00a0min, and washed in PBS/0.5% BSA. Neutrophils, lymphocytes, and monocytes were identified from peripheral blood cells of normal healthy donors with the following high dimensional immunophenotyping; Neutrophils  w2DCFDA  and NO was measured using 4-amino-5-methylamino-2\u2032,7\u2032-difluorofluorescein  as described previously [1-(4-hydroxy-3-methoxyphenyl)-ethanone, apocynin; antioxidant for NOX, 10\u00a0\u03bcmol/L, all reagents from Cayman Chemical) for 3\u00a0h. Total ROS generation in TNF\u03b1-activated leukocytes was assessed as CM-Heviously . Mitochoeviously . After w2.8Human neutrophil-, lymphocyte-, monocyte-enriched cells were purified (>90% purity) from fresh peripheral whole blood using magnetic immunoaffinity isolation with negative-selection by antibodies conjugated to magnetic beads  according to the manufacturer's instruction.2.9MPO activity was measured using MPO chlorination fluorometric assay kit  from whole lysate of leukocytes, neutrophils, lymphocytes or monocytes according to the manufacturer's instruction. MPO activity was calculated as the amount of enzyme that caused the formation of 1\u00a0pmol of fluorophore per minute at 25\u00a0\u00b0C. NOX activity was measured from membrane fraction of isolated leukocytes, neutrophils, lymphocytes or monocytes by superoxide dismutase (SOD)-inhibitable chemiluminescence as described previously .2.10To evaluate the extent of inflammation of TNF\u03b1-activated leukocytes treated with various antioxidants, single-cell flow imaging was performed on leukocytes stained with Alexa Fluor 488 NF\u03baB p65  and PE TNF\u03b1  using the Amins ImageStreamX Mark II flow cytometer (Luminex). Compensation and analysis were performed using Amnis IDEAS software 6.2 (Luminex). Focused cells were chosen based on a bright field intensity gradient of >40, followed by elimination of debris and doublets by the bright field aspect ratio vs area dot plot.2.11To determine whether TNF\u03b1-activated leukocytes disturb the clottability of fibrinogen, human leukocytes were incubated with 4\u00a0mg/mL of fibrinogen (Sigma) and/or various antioxidants for the indicated time points. The extent of fibrin polymerization in conditioned media from TNF\u03b1-activated leukocytes was measured as using thrombin and reptilase time using the START-4 steel ball coagulation analyzer  as described previously . Prolong2.12Statistical testing was chosen based upon data distribution as appropriate. Statistical tests were performed with SPSS (Windows version 19) or OriginPro software . All data are shown as means\u00a0\u00b1\u00a0SEM. One-way ANOVA (ANOVA) was used to compare differences between groups with Bonferroni post-hoc adjustment for multiple comparisons. Pearson coefficient was used for linear regression analysis. An overall p value\u00a0<\u00a00.05 was considered statistically significant.33.1in vivo, we induced sterile inflammation by injecting endotoxin i.v. into rats, and sequentially measured cytokines and fibrinogen oxidative modification and degradation. We found that fibrinogen was rapidly oxidized as measured by carbonyl band-staining using OxyBlot  on fibrinogen oxidation and proteolysis fter 3\u00a0h . TXA did4in vivo, with oxidation occurring before, and proteolysis occurring after 3\u00a0h of LPS exposure. Further in vitro investigations revealed that fibrinogen oxidation was induced primarily by mitochondrial superoxide generated from neutrophils and monocytes and was confined to its A\u03b1 and B\u03b2 chains, as was later proteolysis. We found that NO generated from lymphocytes had little or no effect on oxidation of fibrinogen. Furthermore, mitochondrial superoxide and MPO-derived oxidants played an important role in priming fibrinogen for proteolysis. Finally, only antioxidants targeting mitochondrial superoxide, rather than the commonly used antifibrinolytic drug TXA, could fully inhibit fibrinogen proteolysis and prevent coagulopathy.We found that fibrinogen is directly affected by leukocyte-associated inflammation in two ways. Fibrinogen is first oxidized, then becomes proteolyzed. These events were present in a rat model of sterile inflammation in vivo are currently underway and will be published separately.Increased pro-inflammatory cytokines, leukocyte activation, and inflammation are common responses to both sepsis and trauma and have been reported to play an important role in associated coagulopathies ,32. In tOur findings support the existence of a \u201cdual hit\u201d process of altered fibrinogen form and function in response to leukocyte inflammation. First, oxidants generated by activated leukocytes directly oxidize fibrinogen A\u03b1 and B\u03b2 chains. This oxidative stress may directly prime fibrinogen for proteolysis by oxidative modification and/or induce intracellular signaling events leading to expression of fibrinolytic proteases by leukocytes. Since antioxidants inhibiting mitochondrial superoxide inhibited both oxidation and proteolysis, it appears that superoxide is a key initiator of the first hit and that the second proteolytic hit is dependent upon its generation. \u201cTwo hit\u201d models have been proposed for many different disease processes that include inflammation, including sepsis and trauma-induced multiorgan failure. After severe trauma as well as sepsis, the inflammatory response is \u201cprimed\u201d so that any additional minor inflammatory stimulus triggers an exaggerated response . Neutropin vitro that adding oxidized fibrinogen to plasma changed the behavior of the bulk solution, altered fibrin clot structure, and induced coagulopathy [It is curious that significant proteolytic breakdown of fibrinogen due to inflammation was delayed until >3\u00a0h after the onset of inflammation. This timing matches the time interval for which TXA has been found to be beneficial for reducing mortality in trauma patients . This coulopathy . Linear ulopathy ,37.These findings suggests that new approaches that include alternative antifibrinolytic drugs, antioxidants, and anti-inflammatory agents may be needed to fully preserve fibrinogen function during acute systemic inflammation. Studies antioxidant drug cocktails for inflammatory conditions have met with mixed results. Two observational studies reported remarkable efficacy with high-dose vitamin C, thiamine, and hydrocortisone therapy in critically ill septic patients ,39. HoweRegarding the specific source of oxidants generated during leukocyte inflammation, MPO has been reported to need NOX-derived superoxide to produce hypochlorous acid ,47. HoweWe showed that fibrinogen A\u03b1 and B\u03b2 are very susceptible and labile for oxidative modification and proteolysis and fibrinogen \u03b3 is very resistant to these two events by activated leukocytes. Their preference for oxidation and degradation may be due to the composition of amino acids of these fibrinogen isomers and their solvency. Fibrinogen \u03b1 and \u03b2 subunits are enriched with basic amino acids like histidine, lysine and arginine which are easily oxidized and target for many proteases while fibrinogen \u03b3 is composed of more acidic amino acids like aspartate and glutamate which are relatively more resistant to oxidation and proteolysis. Solvation may also contribute to the relative resistance to oxidation and proteolysis of the individual fibrinogen chains. Alpha-C domains are unordered, having increased flexibility due to a series of repeat sequences . Thus, ttrans-activation were activated in leukocytes that corresponded with timing of fibrinogen proteolysis. Partial efficacy of TXA to prevent fibrinogen B\u03b2-chain proteolysis suggests that plasmin was the proteolytic enzyme generated. However, further investigation is required to positively identify the culprit protease(s). Our results also support the need for additional clinical trials investigating potential benefit of early and aggressive fibrinogen replacement to prevent and treat coagulopathy in diseases associated with significant inflammation, including trauma and sepsis.Our study is limited in several ways. First, further work is required to determine what specific oxidative modifications are taking place on fibrinogen in response to leukocyte-induced inflammation. We have demonstrated increased methionine sulfoxide formation on the fibrinogen A\u03b1-C domain in trauma patients with coagulopathy . Howeverin vivo and in vitro. These events are governed by generation of mitochondrial superoxide and MPO-associated oxidants by leukocytes and can induce significant changes in fibrinogen coagulability and contribute to coagulopathy.In conclusion, fibrinogen is sequentially oxidized and degraded during exposure to leukocyte activation and inflammation, both C.Y.H., T.J.P., X.W., K.M.R. and A.E.J. conducted the experiments. All authors interpreted the data and assisted with editing the manuscript. C.Y.H., S.A.S. and N.J.W. designed the experiments, supervised the work, interpreted the data, and wrote the manuscript.N.J.W. has received funding from U.S. NIH, DoD, and is shareholder in Stasys Medical Corp, and consultant to Velico Medical Corp. All other authors declare no conflict of interest."}
+{"text": "In this work, the metabolomics approach based on UPLC-Q-TOF/MS was employed to investigate serum metabolic changes in HUA patients, 138 potential differential metabolites related to HUA were identified, which provided associations of lipids, amino acids, fatty acids, organic acids, and nucleosides profiles of HUA individuals. Metabolic pathways involved in glycerophospholipid metabolism, sphingolipid metabolism, arachidonic acid metabolism, linoleic acid metabolism, phenylalanine metabolism, phenylalanine, tyrosine and tryptophan biosynthesis, and a-linolenic acid metabolism shed light on the understanding of the etiology and pathogenesis process of HUA.Hyperuricemia (HUA) as a metabolic disease is closely associated with metabolic disorders. The etiology and pathogenesis of HUA are not fully understood, so there is no radical cure so far. Metabolomics, a specialized study of endogenous small molecule substances, has become a powerful tool for metabolic pathway analysis of selected differential metabolites, which is helpful for initially revealing possible development mechanisms of various human diseases. Twenty HUA patients and 20 healthy individuals participated in the experiment, and ultrahigh performance liquid chromatography coupled with quadrupole time-of-flight tandem mass spectrometry (UPLC-Q-TOF/MS) was employed to investigate serum samples to find differential metabolites. The statistical techniques used were principal component analysis and orthogonal partial least-squares discriminant analysis. The differences in metabolomics results of samples after pretreatment with different solvents were compared, 38, 20, 26, 28, 33, 50, and 40 potential differential metabolites were found, respectively, in HUA patient samples, and each group involved different metabolic pathways. Repetitive metabolites were removed, 138 differential metabolites in HUA serum were integrated for analysis, and the human body was affected by 7 metabolic pathways of glycerophospholipid metabolism, sphingolipid metabolism, arachidonic acid metabolism, linoleic acid metabolism, phenylalanine metabolism, phenylalanine, tyrosine and tryptophan biosynthesis, and  Hyperuricemia (HUA) as a metabolic disease is closely associated with metabolic disorders and is an important risk factor for gout, cardiovascular disease, metabolic syndrome, and so on \u20136. In reMetabolomics analysis explores the dynamic changes of endogenous small molecule substances  at a certain stage of the disease . MetabolThe integrity of the extraction of endogenous small molecular substances from biological samples is tremendously important for the analysis results. The loss of biological information caused by improper extract methods has considerably affected the elucidation of disease mechanisms \u201328. OrgaIn this study, high-sensitivity and high-resolution ultrahigh performance liquid chromatography coupled with quadrupole time-of-flight tandem mass spectrometry (UPLC-Q-TOF/MS) combined with multivariate statistical analysis was applied; the metabolome of HUA patients was investigated to identify serum differential metabolites and analyze metabolic pathways affected by HUA, exploring its mechanisms.Liquid chromatography-mass spectrometry (LC-MS) grade MeOH and MeCN were purchased from Merck . Ultrapure water was purified by a Milli-Q water system . LC-MS grade formic acid was obtained from Fisher Scientific Corporation .Instruments used in this study include vortex mixer , cryogenic supercentrifuge , nitrogen evaporator , and UPLC-Q-TOF/MS .n\u2009=\u200920) and healthy volunteers (n\u2009=\u200920) were enrolled in this study. The related clinical information, including gender, age, and biochemical indexes of serum, was collected. Inclusion criteria were as follows: (1) serum uric acid level was \u2265420\u2009\u03bcmol/L in males and \u2265360\u2009\u03bcmol/L in females and (2) aged between 20 and 65 years. Exclusion criteria were as follows: (1) pregnant or lactating women; (2) suffering from cardiovascular disease, kidney disease, or other diseases that will affect the clinical observations and biological indicators or having metabolic diseases, tumors, and mental disease; (3) patients with HUA caused by the following drugs: thiazide diuretics, furosemide, pyrazinamide, aspirin, and other drugs. These participants did not take medicines or supplements before they collected serum samples. Verbal informed consent from all subjects was obtained, and the project was approved by the Ethics Committee of Beijing University of Chinese Medicine Affiliated Dongzhimen Hospital and was conducted according to the Declaration of Helsinki Principles. All serum samples were stored at \u221280\u00b0C before analysis.Participants were collected from the Rheumatology Clinic and Physical Examination Center of Beijing University of Chinese Medicine Affiliated Dongzhimen Hospital . HUA patients , MeOH-MeCN , MeOH-MeCN , MeOH-MeCN , MeOH-MeCN , and MeCN) labelled as groups A, B, C, D, E, F, and G, respectively. Frozen serum samples, including 20 HUA samples (HUA group) and 20 healthy samples (control group), were thawed at 4\u00b0C; then, each sample was divided into seven aliquots of 100\u2009ul. Then, 300\u2009TM System coupled to a Xevo G2 Q-TOF/MS with a Waters UPLC BEH C18 column  at a column temperature of 45\u2009\u00b0C. The mobile phase was composed of 0.2% formic acid aqueous solution (A) and MeOH (B) with the gradient set as follows: 0\u20131.0\u2009min, 95\u201395% B; 1.0\u20132.0\u2009min, 95\u20132% B; 2.0\u201313.0\u2009min, 2\u20132% B; 13\u201313.5\u2009min, 2\u201395% B; 13.5\u201315\u2009min, 95\u201395% B. The flow rate was 0.40\u2009mL/min, and the injection volume was 2\u2009\u03bcL. The autosampler temperature was conditioned at 4\u00b0C.The chromatographic separation was achieved on an Acquity UPLCz 50\u20131200\u2009Da. The optimized operating parameters were set as follows: ion spray voltage of 3.0\u2009kV, cone voltage of 25\u2009V, cone gas flow of 50\u2009L/h, source temperature of 120 \u00b0C, dry gas (N2) flow of 10\u2009mL/min, atomization temperature of 450 \u00b0C, and 400 \u00b0C for ESI+ and ESI\u2212. MS data were recorded in MSE mode. The accurate mass and composition of the relative target ions were calculated with MassLynx V 4.0 software .Electrospray ionization (ESI) in positive ion (ESI+) mode and negative ion (ESI\u2212) mode was applied for high-resolution MS detection. The mass range was set at m/z value, retention times, and normalized peak area, were generated. These two-dimensional data matrices were, respectively, imported into SIMCA-P 14.1 software  for pattern recognition. Principal component analysis (PCA) revealed the distribution of metabolites in human serum samples. Orthogonal partial least-squares discriminant analysis (OPLS-DA) models were constructed to distinguish sample differences and mine differential metabolites in massive data. Permutation tests were used to verify the validity of the OPLS-DA model. The contribution rate of a variable is often described by the variable importance of the projection (VIP) value. The greater the contribution rate is, the larger the VIP value is. The VIP values were generated by the OPLS-DA model. Metabolites with VIP greater than 1, p values of t-test (p) less than 0.05, and a fold change (FC) of greater than 2.0 or FC less than 0.5 were selected as differential metabolites.Raw data from the seven protocols were processed by Progenesis QI software  for peak detection, peak alignment, normalization, and other operations. Finally, two-dimensional data matrices, including the m/http://www.hmdb.ca/) and METLIN (http://metlin.Scripps.edu). Input the precise molecular mass, ionization method, and addition ion information of differential metabolites into HMDB and METLIN, in accordance with the rule that the deviation of the m/z value does not exceed 0.02. The identification results are proved by combining the exact number of charges and the ionization method that meets the experimental conditions. Compare the primary and secondary mass spectra information of the differential metabolites with the theoretical fragments of the HMDB search results, then infer the structure of the compound and the attribution of the fragments to obtain the HUA differential metabolites.The chemical information of differential metabolites was searched through the human metabolome database . All metabolic pathways found displayed their impact values and p values in the form of bubbles. The metabolic pathways with a pathway impact of >0.2 and p\u2009<\u20090.05 were considered the most significant.Moreover, for exploring how the major metabolic pathways related to the differential metabolites were affected, metabolic pathway analysis was performed by MetaboAnalyst 5.0  platformp\u2009>\u20090.05) between age and gender. Compared with the control group, fasting serum glucose (FSG), uric acid (UA), triglyceride (TG), alanine aminotransferase (ALT), aspartic aminotransferase (AST), high-density lipoprotein cholesterol (HDL), low-density lipoprotein cholesterol (LDL), and creatinine (CR) of the patients in the HUA group all increased significantly (p\u2009<\u20090.05).Basic characteristics and serum biochemistry results of participants in the control group and HUA group are presented in Base peak ion chromatograms in ESI\u2009+ mode and ESI\u2212 mode from seven HUA groups and corresponding control groups were compared as shown in Figures Based on LC-MS results of seven groups' serum samples, PCA was used to study the distribution of metabolites. Figures 3(a)3(d)R2Y and Q2 of the OPLS-DA model listed in n\u2009=\u2009200) was further used to validate the model, and Figures 3(c)3(f)R2 and Q2 values were smaller than the values in the actual model, indicating that there was no overfitting in the OPLS-DA model.The OPLS-DA model showed the differences between the HUA group and control group more clearly compared with the results of PCA. Seven groups' OPLS-DA score plots of the control group and HUA group in ESI\u2009+ mode were shown in Figures 3(b)3(e)Furthermore, the metabolic patterns of human behaved differently in different groups according to the PCA and OPLS-DA score plots. It revealed that the pretreatment solvent would affect the results revealing the disorder of the metabolic pathway in human.p\u2009<\u20090.05, and FC\u2009>\u20092.0 or FC\u2009<\u20090.5. According to the online database, 38 (Group A), 20 (Group B), 26 (Group C), 28 (Group D), 33 (Group E), 50 (Group F), and 40 (Group G) characteristic metabolites in patient serum metabolic profiles of seven groups were finally identified, and the results are listed in Tables There were, respectively, 296 (Group A), 260 (Group B), 150 (Group C), 203 (Group D), 393 (Group E), 461 (Group F), and 382 (Group G) differential metabolites between the control group and HUA group satisfying VIP\u2009>\u20091.0, a-linolenic acid metabolism. A schematic diagram of the relevant metabolic pathways was summarized in The significant 35 metabolic pathways of serum differential metabolites from the seven groups are shown in Figures HUA is a complex metabolic syndrome, which is the result of a combination of multiple factors \u201339, inclThe pretreatment solvents, MeOH, MeOH-MeCN , MeOH-MeCN , MeOH-MeCN , MeOH-MeCN , and MeOH-MeCN , and pathogenesis MeCN were compared; except for the solvents used, the subsequent operations were the same. LC-MS/MS is one of the most commonly used methods for metabolite analysis of biological samples in metabolomics analysis. In this study, a UPLC-Q-TOF/MS-based serum metabolomics approach coupled with multivariate statistical analysis provided a convincing method to clearly differentiate patients with HUA from matched control subjects and identify the potential differential metabolites. Results indicate that OPLS-DA revealed an evident separation between the HUA and control samples. The number and types of differential metabolites in the seven groups are not the same, and the metabolic pathways involved are also different, which will have an impact on the reference direction for exploring the HUA mechanism. If a serum precipitation solvent suitable for HUA metabolomics analysis must be recommended, then MeOH\u2013MeCN  can be used for subsequent analysis.a-linolenic acid metabolism related to the 138 HUA differential metabolites were discovered.In this study, combining repeated compounds, a total of 138 differential metabolites were identified in seven groups. These identified differential metabolites belong to five families of compounds: lipids, amino acids, fatty acids, organic acids, and nucleosides. Lipids were detected in seven groups covering 20 lipid classes, namely, phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidylglycerol (PG), phosphatidylinositol (PI), phosphatidylglycerol phosphate (PGP), lysophosphatidylcholine (LysoPC), lysophosphatidylethanolamine (LysoPE), lysophosphatidylinositol (LysoPI), lysophosphatidic acid (LysoPA), sphingomyelin (SM), lysosphingomyelin (LysoSM), TG, monoacylglyceride (MG), diglyceride (DG), ceramide (Cer), lactosylceramide (LacCer), glucosylceramide (GlcCer), cholesteryl ester (CE), and sphinganine 1-phosphate (S1P). A total of 138 differential metabolites were imported into the MetPA website at one time for metabolic pathway analysis; the results are shown in The metabolites involved in glycerophospholipid metabolism and sphingolipid metabolism account for a large proportion of all metabolites, prompting attention to the correlation between abnormal lipid metabolism and HUA. In the previous study of HUA rat model by potassium oxonate or fructose in our laboratory , 40, glya-linolenic acid metabolism. In the previous study of the HUA rat model by fructose in our laboratory [\u03b3-linolenic acid by 6-acyl-coenzyme A dehydrogenase in humans and mammals and further converted to arachidonic acid [Fatty acid metabolism is also involved in abnormal lipid metabolism; in this study, there are three pathways, namely, arachidonic acid metabolism, linoleic acid metabolism, and boratory , arachidboratory . Linoleinic acid . Arachidnic acid , 44. In nic acid .In this study, phenylalanine, tyrosine, and tryptophan were decreased in the serum of the HUA patient. Phenylalanine is an essential amino acid for the human body. Phenylalanine is converted into tyrosine by phenylalanine 4-hydroxylase, which together synthesize important neurotransmitters and hormones involved in the metabolism of glucose and fat , 47. Phea-linolenic acid metabolism shed light on the understanding of the etiology and pathogenesis process of HUA.In conclusion, in this work, the metabolomics approach based on UPLC-Q-TOF/MS was employed to investigate serum metabolic changes in the HUA patients; 138 potential differential metabolites related to HUA were identified, which provided associations of lipids, amino acids, fatty acids, organic acids, and nucleosides profiles with HUA individuals. Metabolic pathways involved in glycerophospholipid metabolism, sphingolipid metabolism, arachidonic acid metabolism, linoleic acid metabolism, phenylalanine metabolism, phenylalanine, tyrosine and tryptophan biosynthesis, and"}
+{"text": "The knowledge, attitude, and practice of emergency neonatal resuscitation are critical requirements in any facility that offers obstetric and neonatal services. This study aims to conduct a needs assessment survey and obtain individual and facility-level data on expertise and readiness for neonatal resuscitation. We hypothesize that neonatal emergency preparedness among healthcare providers in Kano, Nigeria is associated with the level of knowledge, attitudinal disposition, practice and equipment availability at the facility level.A semi-structured, self-administered questionnaire was administered to a cross-section of health providers directly involved with neonatal care (n = 112) and attending a neonatal resuscitation workshop in Kano state. Information regarding knowledge, attitude, practice and facility preparedness for neonatal resuscitation was obtained. Bloom\u2019s cut-off score and a validated basic emergency obstetric and neonatal care assessment tool were adopted to categorize outcomes. Multivariable logistic regression was employed to determine independent predictors of knowledge and practice.Almost half (48% and 42% respectively) of the respondents reported average level of self-assessed knowledge and comfort during resuscitation. Only 7% (95% CI:3.2\u201313.7) and 5% (95% CI:2.0\u201311.4) of health providers demonstrated good knowledge and practice scores respectively, with an overall facility preparedness of 46%. Respondents\u2019 profession as a physician compared to nurses and midwives predicted good knowledge , but not practice.Healthcare provider\u2019s knowledge and practice including facility preparedness for emergency neonatal resuscitation were suboptimal, despite the respondents\u2019 relatively high self-assessed attitudinal perception. Physicians demonstrated higher knowledge compared to other health professionals. The low level of respondents\u2019 awareness, practice, and facility readiness suggest the current weak state of secondary health systems in Kano. Each year, approximately 136 million babies are born, with an estimated 10% requiring some form of basic support at birth, and 3\u20136% needing active resuscitation . Over 90The intrapartum transition of the new-born requires meticulous proficiency in the immediate and emergent care provided at birth and is key to a favorable neonatal outcome. A recent meta-analysis reported a 37% reduction in intrapartum asphyxia-related deaths with neonatal resuscitation training (NRT) . To averWe hypothesize that neonatal emergency preparedness among healthcare providers in Kano, Nigeria may be associated with the level of knowledge, attitudinal disposition, practice and equipment availability at the facility level. To our knowledge, there is no published research on the status of emergency preparedness for neonatal resuscitation in the most populous state in Africa\u2019s most populated country. We, therefore, conducted a needs assessment survey to obtain individual and facility-level data on the level of expertise and readiness for neonatal resuscitation. Our multi-center findings will help inform policy to delineate areas that need support and enhance service delivery.This survey was conducted in secondary health facilities in Kano, the capital of Kano state in northwest Nigeria (estimated population: 13 million) . The StaA descriptive cross-sectional survey was conducted during a two-day NRT workshop in November 2020.The State Ministry of Health organized a two-day neonatal resuscitation workshop for healthcare providers in secondary health centers of the state. The training was conducted in two batches. A master health facility list was used to identify the centers that offer obstetric and newborn services and invitations were sent to participants through the state ministry of health and management board. Two participants were invited from each of the 33 secondary facilities that conduct deliveries. The remaining participants were drawn from the two Pediatric secondary health centers within Kano metropolis . Using each center\u2019s work rota, a convenience sample was used for the selection process, inviting only staff that were off duty to eliminate the risk of staff shortage on active duty during the training period. The diversity of the participants including doctors, nurses, and midwives added strength to the sample and reduced selection bias. Only healthcare providers who were directly involved in neonatal care were invited and participation in the survey was voluntary.With a power of 80%, 95% confidence level, a desired level of precision of 0.05 and 3% prevalence of healthcare workers with good knowledge of neonatal resuscitation obtained from a similar study in North-eastern Nigeria , and a nThe study population was comprised of medical officers, nurses and midwives working in the operating room, delivery, newborn, and Pediatric wards of government-owned secondary health centers in Kano, Nigeria. We excluded any healthcare provider who was not directly involved in labor/delivery and newborn care, and those who did not provide consent, a pre-requisite for inclusion.Participants were informed about the survey at the beginning of the workshop before the commencement of the training, and written consent was obtained from each participant before inclusion in the survey.A literature review of methods and data collection instruments used for NRT needs assessment was conducted. A semi-structured questionnaire was developed from core components of the neonatal resuscitation algorithm ,15 and sThe outcome variables considered were four, namely: knowledge; self-reported preparedness and attitude; practice; and facility preparedness for neonatal resuscitation. The knowledge on neonatal resuscitation was assessed using 12 elements on the questionnaire, eliciting information on the appropriate sequence of resuscitation, initial steps and airway management, indications for ventilation and chest compression, rate of ventilation, indications for oxygen use and targeted oxygen saturation, when to use drugs, and the indicators of adequate resuscitation. Self-reported preparedness and attitude were evaluated using four questions. Two questions elicited self-assessed knowledge and opinion regarding facility preparedness for neonatal resuscitation with a 6-level Likert-type scale. Other questions enquired about the participants\u2019 attitude during resuscitation, specifically the need to call for help and how soon the request was made, and their comfort level during resuscitation.The practice of the respondents was assessed using 15 items on resuscitation technique and everyday practice, e.g., partograph use to predict the need for resuscitation, the number of staff that participate during resuscitation, neonatal temperature regulation, routine umbilical cord care practice, expertise in umbilical catheterization, etc. Facility level preparedness was audited with 8 questions in three domains: availability of essential and priority resuscitation equipment, and on-the-job staff training. The first two domains had questions on available equipment for neonatal resuscitation and the third domain covered the presence of neonatal resuscitation guidelines and equipment checklist.Demographic information included age, sex, the profession of the participant , unit/ward of practice, years of experience in the specified ward, number of deliveries conducted, and neonatal resuscitation events performed by the respondents during the preceding year; and whether the respondent had received NRT in the past. Other information captured the availability of advanced equipment and certain emergency medical facilities/services, the total number of deliveries and deaths within 24 hours and the number of staff dedicated to neonatal care.One point was allocated for each correct response and zero was allocated to a wrong or \u2018don\u2019t know\u2019 response. For each section, the mean score was calculated as a percentage of the total for that section . Bloom\u2019s cut-off  of 80% wThe WHO method of assessing facility service availability and readiness for basic emergency obstetric and neonatal care (BEmONC)  was usedPaper forms were used to collect data anonymously, and these were distributed at the beginning of the training before didactic sessions began. All questionnaires were checked for completeness, correctness, clarity, and consistency by the investigators immediately after collection from participants. The completed forms were kept in a secured institutional unit accessible only to other investigators on request.All analyses were conducted using STATA 15.0 . Proper coding and categorization of data were done, and these were rechecked for completeness and accuracy. Frequencies and percentages were described for categorical variables, mean  was reported for age and median with interquartile range (IQR) for years of experience. Univariate analysis was conducted to identify variables associated with knowledge and practice of neonatal resuscitation. All variables were considered a priori confounding variables for both knowledge and practice of neonatal resuscitation as identified by previous literature ,22\u201325. IEthical approval was obtained from the Kano State Ministry of Health research ethics committee (Ref: MOH/Off/797/T.I/2111). Signed consent was obtained from all the respondents and participation was voluntary. All provisions of the Helsinki declaration were respected.A total of 112 participants responded to the survey and 111 were included for analysis Almost half of the respondents  reported an average level of self-assessed knowledge towards neonatal resuscitation, while only 9 (9%) and 3 (3%) believed they had poor and excellent knowledge respectively. However, when knowledge was measured objectively, only 8 participants  had good knowledge. Respondents\u2019 profession was the only factor identified as a predictor of good knowledge; nurses and midwives were 92% less knowledgeable than physicians . Age, gender, ward, years of work experience, previous NRT, number of deliveries attended, and neonates resuscitated were not predictive of knowledge Only 5% (95% CI:2.0\u201311.4) of the respondents (n = 6) had good neonatal resuscitation practices. After adjusting for the effect of previous NRT, no factor was found to be independently associated with good practice On the self-assessed level of facility readiness, slightly over a third of respondents  believed their facilities to be averagely ready, while 28 (28%) felt their facilities were poorly prepared. The overall neonatal resuscitation preparedness index was 45.8%, with each of the three domains assessed having less than 50% average score for the measured indicators. The facility readiness based on a 33.3% proportionate contribution of each domain for staff and training was 13.2%, for essential equipment and drugs were 17.5% and for priority equipment was 15.1%.None of the facilities had 100% availability of any indicator  of readiness, including advanced equipment and emergency services, We found that the level of knowledge and practice of neonatal resuscitation among healthcare providers in secondary health facilities in Kano to be poor, with only 7% and 5% of respondents demonstrating good knowledge and practice, respectively. Similarly, the overall facility-level preparedness for neonatal resuscitation was inadequate at 18%. These findings imply that the quality of neonatal resuscitation provided at secondary health centers in the state requires significant improvement. Both long-term neurobehavioral and cognitive development of children are associated with the quality of immediate care provided in the first few hours of life. The low utilization of delivery services including lack of antenatal care, delayed hospital presentation during labor, preference for unorthodox obstetric care and home deliveries hinders timely obstetric service demand  and worsThe finding of low level of knowledge and practice among respondents despite almost half (46%) of them having had prior NRT was unexpected. This finding could be due to the lack of regular facility audits to ensure an up-to-date level of comprehension and practice  of the hp = 0.01). This finding likely affected the general quality of service offered, as the majority (62%) of the workforce are nurses and midwives. The prevalence of good knowledge and practice of neonatal resuscitation is similar to reports from Gombe in northern Nigeria Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0NoReviewer #2:\u00a0YesReviewer #3:\u00a0No**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0NoReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0\u2022 Facility and care provider emergency preparedness for neonatal resuscitation in Kano, Nigeria.\u2022 Abstract\u2022 Abstract should be written in sections of introduction, method, result and conclusion.\u2022 Under abstract it better to define first what mean by emergency preparedness for neonatal resuscitation rather than neonatal resuscitation.\u2022 On line 23, why you proposed an hypothesis \u201cWe hypothesize that the high prevalence of asphyxia-related morbidity\u2026\u201d? While your title was preparedness for neonatal resuscitation? This is the same comment for introduction section.\u2022 On line 33, include the confidence interval for the result of Healthcare provider\u2019s knowledge, skills and facility preparedness.\u2022 On line 37, what do you mean by weak state and what is your base line to say this?\u2022 On line 55 to 57, you stated that \u201cEven among health workers, the knowledge of neonatal resuscitation is poor, ranging between 2%\u201312%.[1] In addition, only 8%-22% of surveyed facilities have appropriate resuscitation equipment.[1]\u201d, if these are known, why you study again?\u2022 On line 77, you stated as your study will help for policy maker. Do you think that a single site cross sectional study can be influence policy makers?\u2022 On line 105 to 109, why you used prevalence of knowledge only for sample calculation, while there are also practices and facility preparedness? Again your sample is different with abstract section (111 Vs 98 and 112 under result section), why this difference?\u2022 On lone 108, you said that, \u201cTo increase precision, all healthcare workers who were\u2022 109 present at the training were included in the study.\u201d, so why sample calculation is necessary in this case if you were collect data from all them?\u2022 On line 114, you excluded those who did not provide consent. Do you think that unable to give consent is exclusion criteria? If yes, who were none respondents?\u2022 On line 117, you used a semi-structured, self-administered questionnaire. Do you think that it is appropriate method self-administrated questionnaire for knowledge and practice? Why not you used interview administered?\u2022 You are using skill, practice and proficiency exchangeable. Therefore, try to use one of it throughout the document.\u2022 Under your analysis section include the p-value you used to select variable for multivariate analysis.\u2022 Under table 1, check male sex is 405%?\u2022 On line 209, you included attitude. But, there were not stated in the introduction or in method section about attitude. Why this happened/from where attitude came? Even no under operational definition and under measurement.\u2022 On line 227, you said that level of practices\u2026, is it a level? If yes, how much level is there?\u2022 In discussion section, try to limit your discussion to your main objectives only.\u2022 Try to copy edit for punctuation (most of your full stop is before your citation bracket in throughout the document).Reviewer #2:\u00a0The manuscript presents an analysis of provider and facility readiness for neonatal resuscitation in Kano state, Nigeria. The issue examined is very pertinent to address the variable and often slow progress toward global neonatal mortality targets. Limitations in the design of the research restrict its validity and generalizability, though the findings are illustrative of barriers encountered widely.Abstract: The abstract accurately describes the study. The degree of precision in the percentages reported for adequate knowledge, practice, and facility preparedness could be reduced to whole numbers.Introduction: It is very pertinent to highlight that Kano State has the highest NMR and thus the highest burden, as the most populous state. It might be useful to characterize the area further .Reference 9 presents a Delphi review that estimated the mortality reduction with neonatal resuscitation to be around 30%. More recent systematic reviews and meta-analyses provide information from actual trials (e.g. Dol J 2018).While the hypothesis that poor neonatal emergency preparedness contributes to the high prevalence of asphyxia-specific mortality is valid, later discussion of the very low rate of in-facility delivery in the state reveals another major factor contributing to the burden. Addressing this aspect would give a more complete picture of the needs.Methods: In the description of participants, it should be made clear that this was a convenience sample. Did the selection criteria for attending the workshop skew the participants toward those with low knowledge and skills, or perhaps did it skew toward more experienced clinical leadership?In the sample size estimation, it is not clear what difference (of 10%) was being measured.The data collection instrument regarding essential equipment and drugs inquired about several medications that are no longer recommended by ILCOR  for acute neonatal resuscitation .The reliability of data on total number of deliveries and deaths within 24 hours and staff numbers would seem low if based on report from non-supervisory personnel.What was the basis for considering a facility readiness score of 50% as sufficient to qualify a facility as well-equipped and prepared?Results: The percentages of respondents could be rounded to whole numbers.Discussion: When comparing the results to findings of other studies, there is frequent speculation on cause of differences \u2013 e.g. \u201cIn Ghana\u2026.mainly because all respondents were midwives\u2026\u201d. The demographic differences can be highlighted, but causation should not be implied. On page 19, \u201cWestern Nigeria reported\u2026..probably because the score criterion\u2026.\u201d and \u201c\u2026.in Tanzania\u2026.probably because the latter study\u2026.\u201d should be similarly revised.The first paragraph of page 20 regarding strengths of the study over-estimates the strength of the design, as it was not a representative sample, nor was self-report validated by observation or triangulation. This paragraph should be revised or omitted.The role of low utilization of health facilities for delivery should also be highlighted in the discussion. This may be linked to the inadequate knowledge, skills, and equipment in the facilities.Conclusion: The conclusion appropriately highlights the value of information gained in the study.Figures and Tables: Figure 2 adds little to the results as presented in the text, and it could be omitted.References: References are current and complete.Reviewer #3:\u00a0PLOS ONE REVIEW COMMENTSMany thanks for the opportunity to review this manuscript addressing an important topic that is key to improving newborn outcomes in a developing country. Neonatal resuscitation is key to the achievement of maternal and newborn health SDG targets on neonatal mortality globally. Overall, the manuscript is well written, paying attention to the existing literature and relating to the current findings. A few specifics comments to be addressed or clarified are as belowAbstract \u2013 nicely written and succinctIntroduction- Line 47 \u201c\u2026\u2026one-fourth of these deaths\u2026..\u201d revise to \u2026..a quarter of these deaths \u2026.- Line 55 \u2013 57 \u201cEven among health workers, the knowledge of neonatal resuscitation is poor, ranging between 2%\u201312%.[1] In addition, only 8%-22% of surveyed facilities have appropriate resuscitation equipment\u201d\u2026\u2026.please clarify whether these are global or Nigerian statisticsMethodsStudy sitehttps://www.shopsplusproject.org/sites/default/files/resources/SHOPS%20Nigeria%20Private%20Sector%20Health%20Census_6.15.2014%20FINAL.pdf- Private hospitals were not included as part of the study. Does this mean they do not conduct any births since they were not included in the study? Refer to this related survey about Nigerian health care system at - Any information on the proportion of births conducted in the three levels of health facilities would be useful to provide the contextData collection- How were study participants recruited/informed about the study?- When and how were the study participants consented to participate in the study?- When was the structured interview questionnaire administered?- Who collected the data/administered the structured questionnaire?Results- Line 193: Age of participants is better presented by median given the age ranges and distribution- Line 194 \u201cThe majority of the respondents \u2026..\u201d this is just half the population and not the majority- It would be useful to know if there were any differences in knowledge/skills scores between participants - Table 3: Bicarbonate\u2026.write the chemical name in full e.g. sodium bicarbonateDiscussion- Well written and relates to other studies in the field to explain any similarities, variations and meanings of the findings- Page 19, line 307 \u2013 312: \u201cOn self-assessed reports of knowledge and facility preparedness, few respondents (8.5% and 32.4%) believed they had a below-average level of knowledge and preparedness, with 90% of the respondents reporting an above-average comfort level during resuscitation. This confirms that the majority of the healthcare providers lack insight into their deficient preparedness both at the individual and facility level, which is a significant barrier for self-motivated learning, improvement and capacity building.\u201d This statement is confusing and unclear. Authors to review and clarify for ease of understanding**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0AttachmentPLoS ONE preparedness for neo resus Nigeria.docxSubmitted filename: Click here for additional data file. 4 Oct 2021Responses to reviewers\u2019 commentsThank you for considering our manuscript for publication in PLOS One. We have addressed the concerns raised by the reviewers in the table below.Reviewer #1 comments Abstract should be written in sections of introduction, method, result and conclusion. Response: DoneUnder abstract it better to define first what mean by emergency preparedness for neonatal resuscitation rather than neonatal resuscitation Response: Done. The sentence has been modified to fit the context.On line 23, why you proposed an hypothesis \u201cWe hypothesize that the high prevalence of asphyxia-related morbidity\u2026\u201d? While your title was preparedness for neonatal resuscitation? This is the same comment for introduction section. Response: This has been changed to \u201cWe hypothesize that poor neonatal emergency preparedness among healthcare providers in Kano, Nigeria may be associated with the dearth of knowledge, poor attitudinal disposition, lack of good practice and equipment shortage at the facility level.\u201dOn line 33, include the confidence interval for the result of healthcare provider\u2019s knowledge, skills and facility preparedness Response: Confidence intervals added.On line 37, what do you mean by weak state and what is your base line to say this? Response: The basis for this conclusion is from the low level of knowledge, skills and facility preparedness found in our study, which were below the pre-specified reference cut-off values used.On line 55 to 57, you stated that \u201cEven among health workers, the knowledge of neonatal resuscitation is poor, ranging between 2%\u201312%.[1] In addition, only 8%-22% of surveyed facilities have appropriate resuscitation equipment.[1]\u201d, if these are known, why you study again?Response:The cited study was done in 6 African countries . It is unclear if findings will be similar in Nigeria, a country with similar demographics that was not included in the cited study.On line 77, you stated as your study will help for policy maker. Do you think that a single site cross sectional study can be influence policy makers?Response:The study participants were drawn from all the secondary health centres in the state, hence can be described as a multi-centre survey with the potential to inform policy decisions. On line 105 to 109, why you used prevalence of knowledge only for sample calculation, while there are also practices and facility preparedness? Again your sample is different with abstract section (111 Vs 98 and 112 under result section), why this difference?Response: Two other sample sizes were computed using prevalence of healthcare workers with good resuscitation practices and prevalence of facility preparedness from a similar setting, however, a lower sample size was obtained in both cases. Therefore, the power analysis for prevalence of knowledge was used for this study. The sample size has been corrected in the abstract to 112. One participant had incomplete records and was excluded from the final analysis, hence, 111 were finally included. In the methods, 98 was the minimum sample calculated. However, all participants that provided consent were included in analysis, which will improve the precision of the findingsOn line 108, you said that \u201cTo increase precision, all healthcare workers who were 109 present at the training were included in the study.\u201d, so why sample calculation is necessary in this case if you were collect data from all them?Response: Sample calculation was necessary to obtain the minimum sample required to avoid a type II error and for objective extrapolation of results. Including all the 112 survey participants may improve the precision of results and is unlikely to impact negatively on the findings.On line 114, you excluded those who did not provide consent. Do you think that unable to give consent is exclusion criteria? If yes, who were none respondents?Response: Voluntary participation is an ethical pre-requisite for inclusion. Only one participant declined to take part in the survey.On line 117, you used a semi-structured, self-administered questionnaire. Do you think that it is appropriate method self-administrated questionnaire for knowledge and practice? Why not you used interview administered?Response: The questionnaire was self-administered to ensure anonymity and reduce response bias. Further, all the participants were literate and could respond to the survey appropriately based on instructions provided. The interviewer to participants ratio was also low, making interviewer administration less efficient and timely.You are using skill, practice and proficiency exchangeable. Therefore, try to use one of it throughout the document Response:Thank you. Done.Under your analysis section include the p-value you used to select variable for multivariate analysisResponse: P-value used to include independent variables in the multivariate analysis now includedUnder table 1, check male sex is 405%?Response: We apologise for the typo. The correct number is 40.5% (now corrected).On line 209, you included attitude. But, there were not stated in the introduction or in method section about attitude. Why this happened/from where attitude came? Even no under operational definition and under measurement.Response: This information has been added to the abstract, introduction and methods section (outcome variables) to reflect the findings.On line 227, you said that level of practices\u2026, is it a level? If yes, how much level is there?Response:This phrase has been modified to practice during neonatal resuscitation.In discussion section, try to limit your discussion to your main objectives only.Response: Thank you. DoneTry to copy edit for punctuation (most of your full stop is before your citation bracket in throughout the document).Response: Thank you. DoneReviewer #2 comments The abstract accurately describes the study. The degree of precision in the percentages reported for adequate knowledge, practice, and facility preparedness could be reduced to whole numbers.Response:DoneIntroduction: It is very pertinent to highlight that Kano State has the highest NMR and thus the highest burden, as the most populous state. It might be useful to characterize the area further .Response:More detail has been added characterizing neonatal mortality in the state based on urban/rural, geographic, or political/social challenges.Reference 9 presents a Delphi review that estimated the mortality reduction with neonatal resuscitation to be around 30%. More recent systematic reviews and meta-analyses provide information from actual trials (e.g. Dol J 2018).https://doi.org/10.1136/bmjpo-2017-000183)Response:This has been changed to a more recent systematic review.  was being measured.Response: Sample size parameters corrected. \u201cdifference (of 10%)\u201d was a typographical errorThe data collection instrument regarding essential equipment and drugs inquired about several medications that are no longer recommended by ILCOR  for acute neonatal resuscitation .Response:Calcium and naloxone have been removed. Sodium bicarbonate, however, although discouraged during brief CPR may be useful during prolonged arrest after adequate ventilation is established and there is no response to other therapies. Information regarding its availability in the surveyed facilities to assess level of preparedness may still be useful (DOI: 10.1111/apa.15754 )The reliability of data on total number of deliveries and deaths within 24 hours and staff numbers would seem low if based on report from non-supervisory personnel.Response: We agree, but this is a survey looking at participants\u2019 self-reported knowledge, among other things. The findings therefore reflect the perception of the respondents. In the results section, this detail has been revised to reflect self-reported monthly deaths and deliveriesWhat was the basis for considering a facility readiness score of 50% as sufficient to qualify a facility as well-equipped and prepared?https://apps.who.int/iris/bitstream/handle/10665/149025/WHO_HIS_HSI_2014.5_eng.pdf?sequence=1isAllowed=y)Response:The score was determined using the WHO approach, and facility preparedness indicators identified according to the WHO Service Availability and Readiness Assessment (SARA) Manual \u2026..\u201d this is just half the population and not the majorityResponse:This has been changed to \u201capproximately half of the respondents\u2026.\u201dIt would be useful to know if there were any differences in knowledge/skills scores between participants  Response:Differences in knowledge and skills scores by type of hospital added.Table 3: Bicarbonate\u2026.write the chemical name in full e.g. sodium bicarbonate Response:DonePage 19, line 307 \u2013 312: \u201cOn self-assessed reports of knowledge and facility preparedness, few respondents (8.5% and 32.4%) believed they had a below-average level of knowledge and preparedness, with 90% of the respondents reporting an above-average comfort level during resuscitation. This confirms that the majority of the healthcare providers lack insight into their deficient preparedness both at the individual and facility level, which is a significant barrier for self-motivated learning, improvement and capacity building.\u201d This statement is confusing and unclear. Authors to review and clarify for ease of understanding Response:This has been reviewed to \u201cFew respondents  believed they had a below-average level of knowledge and preparedness. Ninety percent of the participants, however, reported above-average comfort level during resuscitation. This finding, compared with the low participants\u2019 scores on objective assessment of knowledge and practice of NRT confirms that most of the healthcare providers lack insight into their level of individual and facility preparedness for neonatal resuscitation. This is a significant barrier for self-motivated learning, improvement, and capacity building\u201dAdditional remarks Authors are encouraged to further clarify outcome variables and provide the questionnaire used in this study as supplementary file.Response:DoneAuthors should explain whether this questionnaire was anonymous or not? Response:The questionnaire was self-administered and completed anonymously (Lines 243-244 and 328 of the revised manuscript with track changes)Authors should provide unidentified raw data of the study. PLOS journals require that authors make all data underlying the findings described in their manuscript fully available, with exception when ethical or legal restrictions prohibit public sharing of data. Authors may upload their data to a public repository or include their data as a Supporting Information file. If data cannot be made public, all restrictions and information necessary for submitting data requests should be outlined in the Data Availability statement, which will be published at the top of the article. Response:Our data contain potentially identifying and sensitive participant information and therefore cannot be made publicly accessible without permission from the Ethics Review Committee of Kano State Ministry of Health. All data requests should be directed to Mr. Nasir Tafida, Secretary, Research Ethics Review Board, Kano State Ministry of Health, Post office road, Kano Nigerianasirtafida438@gmail.comEmail: Phone: +234 (0)8022759125 https://doi.org/10.11604/pamj.2020.36.68.22164\".Authors are encouraged to include and discuss the following relevant and recent publication \"Briggs, D. C., Eneh, A. U. (2020). Preparedness of primary health care workers and audit of primary health centres for newborn resuscitation in Port Harcourt, Rivers State, Southern Nigeria. The Pan African Medical Journal, 36, 68. Response:Done, see line 543-545Please state whether you validated the questionnaire prior to testing on study participants. Please provide details regarding the validation group within the methods section.Response:Lines 257-259: The final questions used were consensually reviewed, edited, and validated, and were pretested among 12 neonatal health care providers consisting of nurses and doctors in a tertiary institution.http://journals.plos.org/plosone/s/data-availability.In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see Response:Our data contain potentially identifying and sensitive participant information and therefore cannot be made publicly accessible without permission from the Ethics Review Committee of Kano State Ministry of Health. All data requests should be directed to Mr. Nasir Tafida, Secretary, Research Ethics Review Board, Kano State Ministry of Health, Post office road, Kano Nigerianasirtafida438@gmail.comEmail: Phone: +234 (0)8022759125AttachmentResponse to reviewers.docxSubmitted filename: Click here for additional data file. 29 Nov 2021PONE-D-21-11467R1Facility and care provider emergency preparedness for neonatal resuscitation in Kano, Nigeria.PLOS ONEDear Dr. Usman,In the conclusion: \u201cThe low level of respondents\u2019 awareness, practice, and facility readiness demonstrates the current weak state of secondary health systems in Kano\u201d. Conclusion has to be based on study findings. Since this study didn\u2019t investigate the \u201cstate of secondary health systems in Kano\u201d, authors are encouraged to revise this sentence (reducing its strength/certainty) .In the abstract: \u201cRespondents\u2019 designation predicted good knowledge , but not practice\u201d. Authors should better define/specify \u201cdesignation\u201d .Please submit your revised manuscript by Jan 13 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.\u00a0Authors have adequately addressed most reviewers' and editorial comments. Just minor comments remain.A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.Please include the following items when submitting your revised manuscript:If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-emailutm_source=authorlettersutm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Elsayed Abdelkreem, MD, PhDAcademic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0No**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0(No Response)**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 11 Dec 2021Thank you for considering our manuscript for publication in PLOS One. We have addressed the concerns raised by the reviewers below.1) In the conclusion: \u201cThe low level of respondents\u2019 awareness, practice, and facility readiness demonstrates the current weak state of secondary health systems in Kano\u201d. Conclusion has to be based on study findings. Since this study didn\u2019t investigate the \u201cstate of secondary health systems in Kano\u201d, authors are encouraged to revise this sentence (reducing its strength/certainty) .Response:The conclusion has been revised to reflect the study findings and the word demonstrates has been changed to suggest and indicates in the abstract conclusion and main conclusion respectively.2) In the abstract: \u201cRespondents\u2019 designation predicted good knowledge , but not practice\u201d. Authors should better define/specify \u201cdesignation\u201d .Response:The designation has been better specified by including physicians versus nurses/midwives to describe it.AttachmentResponse to reviewers.docxSubmitted filename: Click here for additional data file. 17 Dec 2021PONE-D-21-11467R2Facility and care provider emergency preparedness for neonatal resuscitation in Kano, Nigeria.PLOS ONEDear Dr. Usman,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.\u00a0Specifically, in the conclusion/results \"Respondents\u2019 designation predicted good knowledge . In order to provide the readers with meaningful information, authors should specify \"designation\" .plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Jan 31 2022 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.Please include the following items when submitting your revised manuscript:https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-emailutm_source=authorlettersutm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Elsayed Abdelkreem, MD, PhDAcademic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 20 Dec 2021Specifically, in the conclusion/results \"Respondents\u2019 designation predicted good knowledge . In order to provide the readers with meaningful information, authors should specify \"designation\" .Response:The word designation has been changed to profession for clarity and further specified by including physicians versus nurses/midwives to describe it in the abstract, methods, results and conclusion.AttachmentResponse to reviewers copy.docxSubmitted filename: Click here for additional data file. 26 Dec 2021Facility and care provider emergency preparedness for neonatal resuscitation in Kano, Nigeria.PONE-D-21-11467R3Dear Dr. Usman,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Elsayed Abdelkreem, MD, PhDAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments: 30 Dec 2021PONE-D-21-11467R3 Facility and care provider emergency preparedness for neonatal resuscitation in Kano, Nigeria. Dear Dr. Usman:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Elsayed Abdelkreem Academic EditorPLOS ONE"}
+{"text": "Do mental health and sexual function differ between women with or without polycystic ovary syndrome (PCOS) with comparable BMI and fertility characteristics?Women with PCOS have a poorer mental quality of life than women without PCOS, but there were no differences in symptoms of depression, anxiety, physical quality of life or sexual function.Various studies suggest that women with PCOS have poorer mental health, such as higher symptoms of anxiety and depression with a lower quality of life, and have an impaired sexual function compared to women without PCOS. However, in most studies, BMI and infertility status differ between women with and without PCOS, which may hamper comparability.This study is a cross-sectional analysis of a 5-year follow-up of a randomized controlled trial (RCT) among women with obesity and a history of infertility.Participants in this follow-up study of an RCT were women with obesity and infertility randomized to a lifestyle intervention followed by infertility treatment or prompt infertility treatment (control), stratified by ovulatory status and trial centre. In total, 173 (30.0%) women of the 577 women randomized in the initial trial participated in this follow-up study, with a mean follow-up of 5.5 years (range 3.7\u20137.0 years); of these women 73 had been diagnosed with PCOS and 100 did not have PCOS. Participants completed questionnaires on symptoms of anxiety and depression ), quality of life ) and sexual function ). We also compared quality of life subscale scores in women with and without PCOS and compared them to an age-matched Dutch reference population with average BMI. Effect sizes were calculated to assess the differences.Symptoms of anxiety and depression, physical quality of life and sexual function did not differ significantly between obese women with and without PCOS. However, women with PCOS had a worse mental quality of life summary component score (\u22123.60 [95% CI \u22126.72 to \u22120.56]), mainly due to a lower score on the subscale \u2018role limitations due to emotional problems\u2019 (\u221212.41 [95% CI \u221222.78 to \u22122.28]), compared to women without PCOS. However, compared to an age-matched Dutch reference population, the obese infertile women with and without PCOS both scored lower on almost all physical and mental quality of life subscales.These are secondary analyses of the follow-up study of the RCT. No power analysis was performed for the outcomes included in this analysis and, as our study had a relatively small sample size, the null findings could be based on insufficient power to detect small differences between the groups. Our study population had a high mean BMI ; therefore, our results may only be generalizable to women with obesity.Our results indicate that PCOS status is associated with impaired mental quality of life. Anxiety and depression, physical quality of life and sexual function in obese infertile women with PCOS seem more related to the obesity than the PCOS status.The initial study and follow-up were supported by grants from: ZonMw (50-50110-96-518), the Dutch Heart Foundation (2013T085) and the European Commission (633595). The Department of Obstetrics and Gynaecology of the UMCG received an unrestricted educational grant from Ferring pharmaceuticals BV, The Netherlands, outside the submitted work. A.H. reports consultancy for Ferring pharmaceuticals. B.W.J.M. is supported by an NHMRC Practitioner Fellowship (GNT1082548). B.W.J.M. reports consultancy for ObsEva, Merck Merck KGaA, iGenomix and Guerbet. All other authors declare no competing interests.The initial trial was registered on 16 November 2008 in the Dutch trial register; clinical trial registry number NTR1530. WHAT DOES THIS MEAN FOR PATIENTS?Various studies suggest that women with polycystic ovary syndrome (PCOS) have poorer mental health, with more anxiety and depression, and lower quality of life. Studies also suggest that women with PCOS have more sexual problems, due to reduced levels of sexual arousal or lubrication, compared to women without PCOS. Previous studies looking into the effect of PCOS on mental health and sexuality have included women who varied in BMI and were either fertile or infertile. Since BMI and infertility have their own effect on mental health and sexuality, it is difficult to study the effects of PCOS alone in such studies. The advantage of our study is that we asked women with and without PCOS, with a similar BMI and history of infertility, to participate in our study. Women with PCOS experienced a poorer mental quality of life compared to the women without PCOS. Based on our findings, PCOS does not seem to affect sexuality, symptoms of depression or anxiety, or physical quality of life. We also compared all women who participated in our study, regardless of their PCOS status, to women of similar age from the general population, and found that the women who participated in our study reported more symptoms of anxiety and depression, poorer quality of life and more sexual problems. Therefore, obesity or infertility might have a bigger impact on mental health and sexuality than PCOS.Polycystic ovary syndrome (PCOS) affects 5\u201320% of all women of reproductive age worldwide. It is a heterogeneous disorder characterized by three key features: anovulation, hyperandrogenism and the presence of polycystic ovaries. PCOS is a chronic disorder during the reproductive lifespan, commonly associated with acne, excessive growth of body hair (hirsutism), menstrual disturbance, infertility, obesity, insulin resistance, diabetes, dyslipidaemia, hypertension and metabolic syndrome, which is associated with long-term sequelae such as a higher risk of endometrial cancer, type II diabetes mellitus and cardiovascular disease later in life  allocated to the intervention or control group.The current study is a cross-sectional analysis of data from a follow-up study after a multicentre randomized controlled trial (RCT) in the Netherlands. The study protocols of the initial RCT and the current follow-up study have been published previously , encouragement to increase in physical activity up to 10\u200a000 steps a day, 30 min of moderate to vigorous exercise twice to three times a week, and individualized behavioural counselling. The main goal was a weight reduction of at least 5% of their initial bodyweight, or a reduction in BMI below 29 kg/mFive years (range 3.7\u20137.0 years) after randomization in the preconception lifestyle intervention trial (LIFEstyle study) , women p2 participated in this follow-up study. PCOS was diagnosed by clinicians at entry within the initial trial, based on the Rotterdam 2003 criteria (Women with infertility and a BMI \u226529 kg/mcriteria . The womcriteria  or PCOS criteria  or unsuccriteria . A detaicriteria  and foll\u03b1 = 0.82) and anxiety (\u03b1 = 0.83) in a large validation study  . Scores \u03b1 = 0.71 to 0.92  .Sexual function was assessed using the validated Dutch version of the McCoy Female Sexuality Questionnaire (MFSQ) . The MFST-test or Mann\u2013Whitney U test and categorical and binary outcomes were analysed with the Chi-square, Fisher\u2019s exact test or Fisher\u2013Freeman\u2013Halton exact test.Demographic characteristics are reported as means and SD for continuous variables. For categorical variables, frequencies are reported as number of participants (n) and percentage. Continuous variables were analysed with the independent sample The Kolmogorov\u2013Smirnov test was used to test whether the outcomes were normally distributed. In case the normality assumption was violated, results are presented as mean difference with bias-corrected and accelerated 95% CI\u2019s, based on 5000 bootstrap re-samples . CIs notA sensitivity analysis was performed comparing PCOS women to ovulatory women as controls, excluding 16 women classified as WHO class II anovulation but without PCOS from this control group, as different WHO II anovulation status may influence mental health and sexual function outcomes. A second sensitivity analysis was performed to rule out the influence of Selective Serotonin Reuptake Inhibitors (SSRIs) and Serotonin Noradrenalin Reuptake Inhibitors (SNRIs) (n = 8) on the MFSQ, HADS and SF-36 outcomes. We excluded women who used these medications from this analysis, as these medications are known to influence mental health and sexual function. A third sensitivity analysis was performed by calculating an adapted MFSQ total score from items 1 to 11. These items could be answered by all women, irrespective of whether they were sexually active or not. As a result, we could include those women who reported that they did not engage in vaginal intercourse in the past 4 weeks (n = 30) and were excluded from the main analyses in accordance with the correct use of the MFSQ questionnaire. We calculated MFSQ total scores and domain scores for these comparisons.P-values <0.05 were considered as statistically significant. Statistical analyses were performed using SPSS version 24 for Windows .The LIFEstyle RCT as well as the WOMB project follow-up study were approved by the institutional medical ethics review committee of the University Medical Center Groningen (METc code: 2008/284). The LIFEstyle study was registered on 16 November 2008 in the Dutch trial register . Written informed consent was given by all participants at both the beginning of the LIFEstyle RCT and the WOMB project follow-up. Both the initial study and follow-up were conducted according to the principles of the Declaration of Helsinki.In total, 190 women of the 577 women returned questionnaires (32.9%) during this follow-up study with a mean follow-up of 5.5 years (range 3.7\u20137.0 years). Women who participated in our follow-up study had a better mental quality of life, were more often of Caucasian origin and had been trying to conceive for less time see .2.Symptoms of anxiety and depression measured by the HADS did not differ between women diagnosed with PCOS and women without PCOS . Using tWith regard to quality of life measured by the SF-36, the summary- and separate subscales for physical quality of life were not different in women with and without PCOS. However, women with PCOS had a significantly lower MCS score compared to women without PCOS  (P = 0.001) compared to women in lower BMI categories  to an age- and sex-matched representative German population in which data were collected in 1998 (subsample 1) and 2009 (subsample 2) , 47.9% oWith respect to quality of life among women with PCOS, our findings are in line with the only other study that addressed quality of life among women with and without PCOS with a similar high BMI (Compared to the age-matched Dutch reference population . Women w2) than in our study group. Findings of these five individual studies suggest that BMI rather than PCOS is associated with lower sexual function scores, with increasing degrees of obesity being associated with worse sexual function  feel limited in their roles in life, which hampers their wellbeing. We cannot rule out that PCOS as a diagnosis and main factor of infertility in a couple, gives an additional burden to the mental quality of life in these women. Clinicians therefore may want to pay attention to the psychosocial dimension of PCOS. Future studies should validate our findings in a group of women with and without PCOS with matched BMIs and infertility histories.Human Reproduction Open online.The data underlying this article will be shared on reasonable request to the corresponding author.hoab038_Supplementary_DataClick here for additional data file."}
+{"text": "In this study we have developed a method based on Flux Balance Analysis to identify human metabolic enzymes which can be targeted for therapeutic intervention against COVID-19. A literature search was carried out in order to identify suitable inhibitors of these enzymes, which were confirmed by docking calculations. In total, 10 targets and 12 bioactive molecules have been predicted. Among the most promising molecules we identified Triacsin C, which inhibits ACSL3, and which has been shown to be very effective against different viruses, including positive-sense single-stranded RNA viruses. Similarly, we also identified the drug Celgosivir, which has been successfully tested in cells infected with different types of viruses such as Dengue, Zika, Hepatitis C and Influenza. Finally, other drugs targeting enzymes of lipid metabolism, carbohydrate metabolism or protein palmitoylation  are also proposed. In this context, the rapid identification of therapeutic molecules against SARS-CoV-2 is essential. To this aim an extensive collaboration and teamwork among researchers of all academic disciplines is required2. Computational methods and systems biology approaches, as the one presented here, can play a significant role in this process of identification of suitable drugs.The COVID-19 pandemic, caused by the virus SARS-CoV-2, has resulted in a substantial increase in mortality and serious economic and social disruption worldwide3: a first pulmonary phase in which the virus infects the host\u2019s lung cells leading to pneumonia and acute respiratory distress syndrome, a second pro-inflammatory phase in which infected cells and lymphocytes respond by overproducing cytokines (cytokine storm), and a third prothrombic phase. In order to reduce the number of necessary hospitalizations and decrease the large pressure on healthcare systems caused by the COVID-19 pandemic, drugs searching to inhibit specifically viral proliferation during the pulmonary phase are necessary.Infection by SARS-CoV-2 has three distinct phases4; the second is based on the fact that many native enzymes of the host are necessary to produce the constitutive biomolecules of viral particles, which makes them potential drug targets. Some of the ways in which viruses reprogram the host metabolism and support viral replication are, among others, activation of glycolysis, fatty acid biosynthesis and elongation, protein glycosylation and inhibition of mitochondrial function5. It is reasonable to expect that drugs targeting key human metabolic enzymes can be used to inhibit viral replication. Indeed, nucleoside and nucleotide analogs such as Tenofovir, Sofosbuvir or Ribavirin are already being used as antiviral drugs8. Pharmacological inhibition of either acetyl-CoA carboxylase (ACC) or fatty acid synthase (FASN) has also been shown to result in a strong reduction of viral titers in vaccinia infection9.In order to inhibit the replication and assembly of viral particles, two main approaches can be attempted: the first one consists in targeting viral proteins involved in replication; 4. SARS-CoV-2, in the same manner as other coronaviruses, also replicates within ER derived vesicles10. Therefore, it is reasonable to expect that host enzymes key for viral replication are recruited to RTCs via their interaction with viral proteins. A human-SARS-CoV-2 interactome has been recently published11, which contains 332 high-quality human-SARS-CoV-2 protein\u2013protein interactions, of which 90 involve metabolic enzymes. The goal of this work is to identify metabolic enzymes that are suitable drug targets against viral replication. In previous articles13 we developed the python library pyTARG, with the object of finding metabolic drug targets against cancer cell lines. This method makes use of a generic human Genome Scale Metabolic Model (GSMM), which is constrained using RNA-seq data in order to generate a context-specific model. This allows computing metabolic flux distributions and evaluating the outcomes of restricting enzymatic reaction rates. In order to use this methodology for the evaluation of the metabolic fluxes in lung cells infected by SARS-CoV-2, a literature based stoichiometric equation for the formation of virions has been added to a context-specific GSMM based on RNA-seq data of lung tissue13.In many cases, the metabolic resources of the host cell are diverted to the formation of virions via the recruitment of metabolic enzymes and their localization in \u201creplication and transcription complexes\u201d (RTCs), which are vesicles formed from endoplasmic reticulum (ER) membranes, in which the virus replicates. This recruitment takes place via the interaction of host enzymes with viral proteins, such as NSP3 of rotavirus, which recruits FASN, or NS5A of hepatitis C virus, which recruits phosphatidylinositol 4-kinase alpha (PI4KA)This approach provides an efficient method to identify putative drug targets against infection by SARS-CoV-2 and could be used by pharmaceutical companies in order to save considerable resources and time when developing new drugs.14, has been used to estimate the stoichiometric relations between the main structural proteins. Image analysis revealed a relation of 8\u00a0M protein dimers per S protein trimer in the virion surface, with an estimated number of 90 spikes per viral particle. N proteins are found both at the surface and within the virion, with M:N ratios between 1 and 3 depending on the authors15. The M:S ratio determined by crio-electron microscopy is equal to 5.3 and corresponds to the inverse of the ratio between the two protein lengths, which could be consistent with viral proteins being translated at the same rate per amino acid. This would lead to a M:N ratio of 1.9, which is within the previously mentioned rank and has been chosen for modeling purposes. No other proteins have been included in the structure of the virion. E protein seems to play a key role in virion assembly, but it is not present in significant quantities in viral particles. The S protein of SARS-CoV-2 has 16\u00a0N-glycosylation residues14 and one palmitoyl residue, while the M protein has one N-glycosylation residue and one palmitoyl residue. The lipid quantity of phospholipids per virion was estimated by considering an average virion diameter of 125\u00a0nm and assuming that the surface proteins are packed as circles touching each other forming a hexagonal pattern15. This geometry leaves 10% of the surface for a lipid bilayer, whose composition has been assumed to be equal to that of the human endoplasmic reticulum16. In a previous work18 the authors evaluated the conductance of the SARS-CoV viroporin 3a purified protein in planar lipid bilayers with a biologically relevant mix with a composition to that of intracellular organelle membranes, such as the endoplasmic reticulum (ER)-Golgi intermediate compartment (ERGIC). Thus, this assumption appears to be widely accepted.The SARS-CoV-2 genome is similar to SARS-CoV, each has an Orf1ab encoding 16 predicted non-structural proteins (Nsp1-16) and each has the 4 typical coronavirus structural proteins, including: Spike (S), Envelope (E), Membrane (M) and Nucleocapsid (N). Thus, the structural information from SARS-CoV, obtained by crio-electron microscopyNot only the structural proteins forming the virions are being translated, but also all the viral proteins, however only the structural proteins are being drained away from the cells when virions are secreted, the rest of the proteins are assumed to be degraded within the cell at the same rate as they are produced, and their amino acids are constantly recycled. This fact does not result in a drain of amino acids from the cells, but it has energetic costs in form of ATP and GTP. In order to have an approximate estimation of these costs, we assume that all the viral proteins are translated at a rate inversely proportional to its length. Equally, genomic RNA and sub-genomic mRNAs require methylation, which consumes SAM units. This has been modeled by assuming that the genomic and sub-genomic mRNAs are all produced in the same proportions. This choice does not have any impact on the conclusions of the article. The detailed virion composition is reported in Table fullconstrain function from pyTARG (https://github.com/SergioBordel/pyTARG), as described in reference13, in this way a context-specific model for lung cells has been obtained. The library pyTARG was previously developed to identify metabolic enzymes whose inhibition would inhibit the growth of cancer cells while having weaker effects on healthy cells. Here we follow an analogous approach in which virion production in infected cells is selectively targeted. Infection by SARS-CoV-2 has been modeled by making use of the interactions between viral proteins and human enzymes10, which contains 332 high-quality human-SARS-CoV-2 protein\u2013protein interactions, of which 90 involve metabolic enzymes .For the rest of metabolic enzymes expressed in the lung and interacting with viral proteins, the constraints on their rates have been removed . Possible changes in gene expression were modeled by identifying the transcription factors that interact with viral proteins. Only TCF12 was identified. This regulator is known to be a transcriptional repressor. Thus, the genes regulated by TCF12 are assumed to be upregulated and the constraints on their reactions were also removed in the model. The model predicts a maximal rate of virion formation of 0.0084\u00a0nmol-virions per hour and gram of dry weight of infected cells. The rate estimated by our model is consistent with data from literaturehttps://github.com/SergioBordel/COVID-19.The metabolic model of SARS-CoV-2 infected cells and the model of non-infected lung cells are available at 19, leading to the identification of guanylate kinase as a potential target. The mentioned work relied on a method previously published by Aller and co-workers20. This approach is based on the comparison of the metabolic flux distributions under the scenarios of cell biomass and viral biomass optimization, respectively. In this approach no extra constraints are modified in the metabolic model between non-infection and infection conditions. In the approach presented here, high quality interaction data between viral and human proteins have been used to modify the constraints of the model, as it has been previously discussed. Also, our choice of putative targets has been restricted to proteins that have been confirmed to interact with viral proteins, so as to restrict the proposed drug targets to enzymes more likely involved in the infection cycle of SARS-CoV-2.Flux Balance Analysis has also been used recently to suggest putative drug targets against SARS-CoV-2block of pyTARG. This function restricts the rate of reactions catalyzed by the tested enzymes to 0.1 times its original value and computes the ratio by which the objective function  decreases. This ratio takes values from 1 (indicating no effect) and 0.1 (indicating that the objective function decreases in the same proportion as the flux in the targeted reaction). The model of non-infected lung cells was used as a way of quantifying potential secondary effects. In order to select suitable targets, a difference between both ratios (non-infected and infected) of 0.3 was used as cutoff value. The analysis was restricted to human enzymes interacting with viral proteins. Using this method, 10 human enzymes were identified . The AGPS protein is inhibited, at least, by Benzyl Isothiocyanate (BITC)21, the anti-fungal agent Antimycin A22 and the investigational new drug, ZINC-69435460 [3-(2-fluorophenyl)-N-ethyl)butanamide]22. Antimycin A can be discarded due to its cytotoxicity, as it is also an inhibitor of cytochrome C reductase, essential for the viability of eukaryotic cells23. The two other inhibitors could be promising alternatives to treat SARS-CoV-2 infections. On one hand, BITC inhibits the proliferation of human glioma U87MG and hepatic carcinoma HepG2 cells, as well as aggressive human breast tumors, by interfering with the enzymatic function of AGPS21. On the other hand, ZINC-69435460 makes multiple specific interactions with residues in the AGPS active site and inhibits its activity22. Therefore, these two compounds could be used to reduce the enzymatic function of the AGPS enzyme in the SARS-CoV-2 infected lung cells (in a similar manner as in the cancer cells), which would result in a hamper of the viral replication, while allowing the viability of the non-infected cells. The second enzyme, SLC27A2 , is a transmembrane transporter coenzyme that participates in the long-chain fatty acid beta-oxidation and peroxidase lipid metabolism24. In a recent publication it has been shown that the selective pharmacological inhibition of FATP2 with Lipofermata -thiadiazol]-2(1H)-one) suppresses the activity of pathologically activated neutrophils and substantially reduces melanoma growth and invasion, while maintaining the viability of healthy cells25. Therefore, inhibition of this target with Lipofermata could be also a therapeutic option to treat SARS-CoV-2 infected cells. The third enzyme, ACSL3, is one of the five members of the long chain acyl-CoA synthetase (ACSL) family26. Specifically, ACSL3 has been identified as a host factor required for Poliovirus replication, which, as SARS-CoV-2, is a positive-sense single-stranded RNA virus that replicates its genome in association with membranes27. Inhibition of ACSL3 with inhibitors such as Triacsin C28 has been shown to reduce virion formation in human cells infected with different viruses, including Cytomegalovirus, Rotavirus and Hepatitis C31. For these reasons, and according to our metabolic modelling results, this drug constitutes a very promising therapeutic option to treat SARS-CoV-2 infection.Some of the 10 putative targets are known oncogenes for which drugs are already in clinical trials , is inhibited by the approved drug, Propylthiouracil (PTU), is inhi14. The importance of protein glycosylation is evidenced by the use of Celgosivir (an inhibitor of N-glycan synthesis) in treating cells that harbor Dengue virus, which prevents proper protein glycosylation, leading to protein misfolding and impaired replicative efficiency38. Celgosivir  has been shown to be a very promising drug, not only for the treatment of Dengue virus or members of the same family (like for example ZIKV), but also for other viruses belonging to different families, such as the Hepatitis C or Influenza viruses41. As 3 of our 10 selected enzyme targets are involved in the N-Glycan biosynthesis pathway , we propose treating SARS-CoV-2 with inhibitors of glycoprotein biosynthesis, such as the previous mentioned iminosugars or the nucleoside antibiotic Tunicamycin, which also inhibits N-linked protein glycosylation42. Interestingly, this last compound has been shown to display strong antiviral activity against certain viruses, like for example the Epstein-Barr virus43, and has been recently proposed as a promising therapeutic option to treat SARS-CoV-244. Similarly, drugs that disrupt the integrity of the Golgi apparatus  also alter glycoprotein synthesis45 and, for this reason, could be also effective therapeutic molecules to treat COVID-19 patients. The complete list of drugs and the most relevant information regarding them, is contained in Table The rest of the identified targets are involved in N-glycan biosynthesis and glycosylation  and sIL-6R (soluble receptor for IL-6), inhibiting its signaling pathway and stopping the cytokine storm syndrome47. In addition to the current developed vaccines and the humanized monoclonal antibodies, we still need more therapeutic molecules to tackle the severity and mortality of the COVID-19 disease. In this sense, the toll\u2010like receptor 5 (TLR\u20105), which plays a vital role in various host immune defense mechanisms, can stimulate innate immune responses against common symptoms associated with COVID\u201019, such as respiratory infection48. Another example of promising strategies to tackle the COVID\u201019 outbreak is provided by an immunoinformatic analysis, which highlighted 13 Major Histocompatibility Complex\u2010(MHC) I and 3 MHC\u2010II epitopes within the spike glycoprotein of SARS\u2010COV\u20102 that could be ideal candidates to formulate an immunogenic multi\u2010epitopic peptide vaccine against SARS\u2010COV\u2010249.The scientific response to the COVID-19 pandemic has been unprecedented, with a huge number of studies developed in an attempt to rapidly unravel the pathogenesis of the disease and to propose potential therapeutic strategies, such as the recently approved COVID-19 vaccines or the promising treatments based on humanized monoclonal antibodies that can be used to treat the cytokine storm syndromeHowever, if we want to decrease significantly the pressure on healthcare systems, it would be desirable to focus our efforts in finding antiviral drugs able to stop the infection by SARS-CoV-2 in its early pulmonary phase and avoid hospitalization.50. Unfortunately, one of the few antivirals that has been approved for the treatment of COVID-19, Remdesivir, has resulted not very effective for many patients50. These findings open a window of opportunity for antivirals that might be able to act before the fulminant inflammation caused by SARS-CoV-2.The screening of other therapeutic molecules  has also received substantial attention. However, finding antivirals that reduce mortality from severe respiratory viral infections has proven challenging. For example, Lopinavir-ritonavir and hydroxychloroquine are not efficient in treating COVID-1951. The most targeted protein in these in silico approaches is the main protease (Mpro), for which 150 drugs have been suggested (50 of which approved by the FDA), followed by the spike protein (S), with 47 suggested drugs. The most suggested drug against Mpro is Lopinavir and ritonavir52, while gazoprevir is the most suggested drug targeting the spike protein53.In silico approaches, including molecular docking (one of the methods we use in this article) and molecular dynamics, have been broadly used to identify putative drugs targeting the replication cycle of SARS-CoV-2. These studies have been extensively reviewed by Sumon and co-workersIn this study, we have developed a metabolic modeling approach to identify human metabolic enzymes that can be targeted for therapeutic intervention against COVID-19. The model is constrained using RNA-seq data and completed with a literature based stoichiometric equation for the formation of virions. This model is used to identify metabolic reactions that, when inhibited, are expected to result in lower rates of virion production while perturbing minimally the production of cellular biomass. For example, the reactions involved in glycosylation of viral proteins, even if they carry relatively low metabolic fluxes (compared to other reactions such as those in glycolysis) are good targets because they are essential for protein activity.31. Similarly, we have also identified the drug Celgosivir, in clinical trials54, what was proven against cells infected with different types of viruses, such as Dengue, Zika, Hepatitis C and Influenza41. Other drugs targeting proteins of lipid metabolism, carbohydrate metabolism or protein palmitoylation  are also proposed in this study. The work also provides a systematic schema for target/drug screenings that allows investigators to seek them directly. The testing of some of those compounds may encourage others to do the same with other investigational molecules, expanding the options to find drugs with therapeutic value for the treatment of different types of coronaviruses infections.Along with the predictions of metabolic enzymes of the host, that could serve as targets for therapeutic intervention against COVID-19, we have utilized docking analysis and an in depth revision of the scientific literature to propose a list of drug candidates. In total, we have proposed 12 bioactive molecules that could be promising drugs to treat COVID-19 patients. Among the proposed therapeutic molecules, those in clinical trials or approved, such as Tunicamycin and PTU, constitute the best options to investigate. We have also identified Triacsin C as very promising drug to tackle SARS-CoV-2. This compound has been shown to be very effective against different viruses, including some positive-sense single-stranded RNA viruses, such as the PicornavirusIn conclusion, the optimism surrounding the word wide COVID-19 vaccination program should not deflect from the search for an effective therapeutic option against the virus. Systematic validation of different approved drugs, compounds in clinical trials or in a preclinical stage, including the ones proposed in this study, will be key to find important COVID-19 treatment options in selected patient groups.fullconstrain function from pyTARG (https://github.com/SergioBordel/pyTARG), creating a context-specific metabolic model for lung cells. The way in which pyTARG uses RNA-seq data to constrain GSMMs is described in reference13. The library pyTARG requires the installation of the library COBRApy and is compatible with the version 0.9.0 of COBRApy (solver glpk).A human genome scale metabolic model has been constrained using the \u22121\u00a0h-\u22121 per unit of RPMK. The accuracy of the metabolic flux predictions obtained by pyTARG has proven to be much higher than that of previously proposed methods such as PRIME55. This is mostly due to the fact that pyTARG imposes constraints in almost all the metabolic reactions of the model.A maximal value is given to the rates of each of the reactions in the model, this maximal rate is set based on the expression level of the genes encoding the associated enzymes measured in Reads Per Million and Kilo-base (RPMK). Reactions not associated to any gene are left unconstrained. The proportionality constant between gene expression and maximal rate is purely phenomenological and has been chosen to reproduce the experimental growth rate of the cancer cell line A549. The chosen proportionality constant was 0.0027\u00a0mmol\u00a0g-DW56. This model can also be downloaded in SBML format together with the pyTARG library. The lung RNA-seq data necessary to constrain the model were obtained from the Human Protein Atlas (www.proteinatlas.org)57. In order to model infection by SARS-CoV-2, oxidative phosphorylation has been constrained to have a zero rate. Attenuation of respiration is known to be a general feature of viral infection5. In our case, this is further supported by the fact that 5 genes involved in oxidative phosphorylation  are part of the human-SARS-CoV-2 interactome11. These interactions are interpreted as inhibitory or as relocating the involved proteins to RTCs instead of mitochondria, which would suppress their function. For the rest of metabolic enzymes expressed in lung and interacting with viral proteins, the constraints on their rates have been removed . The list of human transcription factors and the genes regulated by them were obtained from the TRANSFAC database58. The metabolic model of SARS-CoV-2 infected cells and the model of non-infected lung cells are available at https://github.com/SergioBordel/COVID-19. Both models are in SBML format and can be used to compute distributions of metabolic fluxes using the function flux from pyTARG.The GSMM utilized is an updated version of the HMR human metabolic modelblock from pyTARG. This function reduces the flux in the selected metabolic reaction to 0.1 times its original value and computes the ratio by which virion production is reduced as a result of this restriction. In order to evaluate the effects on non-infected cells, a lung metabolic model was used and production of cellular biomass was chosen as an objective function.The effects of blocking metabolic enzymes were modeled by selecting virion production as objective function and using the function 59 in the cases of: O00116 (template PDB ID 4BC7), O95573 (template PDB ID 5MSS), Q2TAA5 (template PDB ID Q2TAA5), Q8WUY8 (template PDB ID 5L7J), Q9Y673 (template PDB ID 5MLZ), O14975 (template PDB ID 3A9V) and Q9C0B5 (template PDB ID 6BMS). Q9BVK2 was modelled with I-TASSER60. Q96K12 was modelled with Rosetta61. QMEAN was used to assess homology model quality62.Three dimensional structures of the target proteins were generated using the SWISS-MODEL cloud based modeling toolhttps://www.rcsb.org)63. As other human structures were not available, homology models were used instead. Protein model structures were prepared initially with UCSF Chimera64 and then converted to pdbqt file format with Open Babel65. Cofactor biding sites on PDB structures and templates were used as potential docking locations to set up cubic docking calculations. The calculations were performed in boxes of 20 \u00c53. The conformer models of the ligands were acquired from PubChem66 or ZINC67 databases and then converted to pdbqt file format with Open Babel65. QuickVina-W was used to carry out docking task with all prepared structural data68. Docking results were visualized, analyzed and imaged with UCSF Chimera64.Q8IVS2 (PDB ID 2C2N) and P00387 (PDB ID 1UMK) structures were acquired directly from RCSB PDB (Thermodynamic affinities for the natural substrates of the enzymes and the tested ligands can be found in supplementary file Supplementary Information 1.Supplementary Information 2.Supplementary Information 3.Supplementary Information 4."}
+{"text": "Ser473, p-GSK-3\u03b2Ser9, and Snail were analyzed using Western blotting and real-time polymerase chain reaction (PCR). The effect of COL11A1 on cell stemness was tested using flow cytometry and clone formation assays. Results: These results demonstrated that COL11A1 significantly promoted the invasion and migration abilities of PDAC cells. Furthermore, COL11A1 facilitated the occurrence of epithelial\u2013mesenchymal transition (EMT) and cell stemness by upregulating the expression levels of p-AKTSer473, p-GSK-3\u03b2Ser9, and Snail. Conclusions: This study suggests that the activation of the AKT/GSK-3\u03b2/Snail signaling pathway induced by COL11A1 plays a major role in the progression of PDAC. Therefore, COL11A1 could serve as a potential target for PDAC treatment.Background: Collagen type XI \u03b11 (COL11A1) is associated with tumorigenesis and development in many human malignancies. Previous reports indicate that COL11A1 may be a significant diagnostic marker for pancreatic ductal adenocarcinoma (PDAC); however, its biological role in PDAC progression remains unclear. In this study, we investigated the influence of COL11A1 on the invasion and migration abilities of pancreatic cancer cells and explored its potential molecular mechanisms. Methods: Cell migration and invasion were assessed using Transwell assays in pancreatic cancer cells transfected with siCOL11A1 and pCNV3-COL11A1 plasmids. The protein and mRNA expression levels of N-cadherin, E-cadherin, Vimentin, cluster of differentiation (CD)-24, CD44, serine\u2013threonine kinase (AKT), glycogen synthase kinase (GSK)-3\u03b2, phospho (p)-AKT Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal solid tumors due to its propensity for early metastasis and local invasion ,2. Most A histological hallmark characteristic of PDAC is the abundant extracellular matrix that constitutes its tumor microenvironment (TME). The TME is composed of a complex network of molecules with distinct biochemical properties that regulate tumor progression and metastasis. Among these components, collagen serves as a module of diverse signaling and is involved in the regulation of the physiological state in tumor cells .Recent eEpithelial\u2013mesenchymal transition (EMT) is considered to be a vital process for inducing cancer cell metastasis . During Accumulated evidence has indicated that COL11A1 modulates serine\u2013threonine kinase (AKT) signaling pathways in various cellular events ,17, inclIn the present study, we elucidated the function of COL11A1 in promoting EMT and cell stemness via the AKT/GSK-3\u03b2/Snail signaling pathway, which facilitates the invasion and migration of pancreatic cancer cells. We focused on EMT and cell stemness programs to better understand the intricate molecular mechanisms by which COL11A1 regulates cancer development. This study provides valuable information that may aid in developing personalized therapeutic strategies for patients with pancreatic cancer.2) at 37 \u00b0C.PANC-1,BxPC-3, and Capan-2 cells were purchased from the American Type Culture Collection (ATCC). Capan-2 and BxPC-3 cells were cultured in the Roswell Park Memorial Institute (RPMI)-1640 medium, and PANC-1 cells were incubated in Dulbecco\u2019s modified Eagle medium (DMEM) containing 10% fetal bovine serum  and 1% penicillin\u2013streptomycin. All the cells were cultured in an incubator with 5% carbon dioxide  against COL11A1, GSK-3\u03b2, and Snail were purchased from Gene Pharma . The pCMV3-COL11A1 plasmid was purchased from Sino Biological . The pCMV3-COL11A1 plasmid and siRNAs were transfected into cells using Lipofectamine 2000 . LY294002, an inhibitor of phosphatidylinositol 3-kinase (PI3K), was purchased from Beyotime. The cells were pretreated with LY294002 (50 \u03bcM) for 1 h. The siRNA sequences for target genes are listed in The treated-cell suspension (200 \u03bcL) in a serum-free medium was added to a Transwell chamber , with or without Matrigel coating. Then, 500 \u03bcL of medium containing 10% FBS was added to the lower chamber. After 24 or 48 h, cotton swabs were used to remove cells from the upper chamber. Cells were fixed with 4% paraformaldehyde and incubated with crystal violet. Stained cells were counted at 40\u00d7 magnification in five randomly selected files.Total cell extracts were harvested and solubilized in the radioimmunoprecipitation assay (RIPA) lysis buffer . Nuclear proteins were collected using a Nucleoprotein Extraction Kit . The concentration of the lysate was detected using a bicinchoninic acid (BCA) kit . Then, proteins (30 \u03bcg) were separated by 10% sodium dodecyl sulfate\u2013polyacrylamide gel electrophoresis (SDS\u2013PAGE) and transferred onto a 0.2 \u03bcm polyvinylidene fluoride (PVDF)membrane (Millipore). After blocking with 5% nonfat milk, the membranes were incubated with the corresponding antibodies at 4 \u00b0C overnight. The antibodies used are listed in ChIP assay was performed according to a previous report . BrieflyPANC-1 cells were seeded on coverslips in a 24-well plate. Aftertreatment, the coverslips were fixed, permeabilized, blocked for 1 h with 10% goat serum, and incubated with anti-E-cad, anti-VIM, anti-N-cad, and anti-Snail (1:200) antibodies overnight at 4 \u00b0C. Next, the coverslips were stained with fluorescein isothiocyanate (FITC)-labeled secondary antibodies at room temperature for 1 h. Nuclei were marked with 4\u2032,6-diamidino-2-phenylindole dihydrochloride . The coverslips were washed three times with phosphate-buffered saline containing 0.05% Tween 20 and photographed using a laser scanning microscope.2 at 37 \u00b0C. Images were captured under a 40x inverted microscope at 0, 24, and 48 h to calculate the scratch-healing rate.Treated cells were seeded in a 6-well plate. When the cell confluence was close to 100%, two straight lines were drawn in the 6-well plate with a 10 \u03bcL pipette tip and washed with PBS to remove floating cells. They were then incubated with a serum-free medium with 5% CO\u2212\u0394\u0394Ct method. The primer sequences used in this study are listed in Total RNA was extracted using the Total RNA Extraction Kit  according to the manufacturer\u2019s instructions. Then, it was reverse-transcribed into cDNA using a HiFiScript first-strand cDNA synthesis kit .Real-time PCR was performed using ChamQTM Universal SYBR qPCR Master Mix  and detected using an Applied Biosystems7500 Fast Dx Real-time PCR Instrument .The relative mRNA expression was calculated using the 26 cells; Abcam, Cambridge, UK), and anti-CD44-FITC  at 37 \u00b0C for 30 min in the dark. Analysis was performed using a FACS Calibur cytometer . The CD24+/CD44+-PANC-1 cells were sorted using a BD FACSAria II cell sorter  and lysed with the RIPA lysis buffer for Western blotting analysis.Treated cells were harvested in centrifuge tubes, washed with PBS, and blocked for 1 h with 5% FBS. Then, the cells were culturedwithanti-CD24-PE  \u00d7 100%.3 cells/well and cultured in an incubator with 5% CO2 at 37 \u00b0C for 7\u201314 d. PANC-1 cells were fixed in anhydrous methanol for 15 min and stained with Giemsa solution  at room temperature for 20 min. Then, the Giemsa solution was discarded, and the cells were washed with PBS. The colony formation rate was calculated as follows: (number of cells with clone spheres/number of inoculated cells) \u00d7 100% [PANC-1 cells were inoculated into a 6-well plate at 10) \u00d7 100% .t-test and analysis of variance. Statistical significance was set at * p < 0.05.Statistical analyses were conducted with software SPSS version 16.0. Data obtained from three independent experiments are expressed as the mean \u00b1 standard deviation (SD). Experimental and control groups were compared using a Student\u2019s Several reports have indicated thatCOL11A1 is overexpressed in pancreatic cancer tissues ,35. Our To examine the underlying mechanism by which COL11A1 promotes the invasion and migration of pancreatic cancer cells, we measured the expression levels of EMT markers and MMP-2/9 using Western blotting and immunofluorescence. Western blotting results revealed that pCMV3-COL11A1-transfection upregulated the expression levels of N-cad, VIM, and MMP-2/9 but reduced the expression of E-cad, in BxPC-3, Capan-2, andPANC-1 cells. In addition, the knockdown of COL11A1 caused the opposite result A,B. To fSer473 and GSK-3\u03b2Ser9 and simultaneously enhanced the expression and nuclear localization of Snail  components. Studies have shown that collagen  in the ECM component is closely associated with the metastatic process . Many elSer473 activation via integrin \u03b11\u03b21 and discoid in domain receptor 2 to implement signal transduction in a variety of biological events, including migration and invasion [Ser473 inactivates GSK-3\u03b2by phosphorylating the ser-9 site, while p-GSK-3\u03b2Ser9 increases the nucleation of Snail, an inhibitor of E-cad. In sequence, p-GSK-3\u03b2Ser9/Snail manages the EMT process by regulating the epithelial and mesenchymal genes in epithelial tumors [Ser473 and GSK-3\u03b2Ser9 and then enhanced both the expression and nuclear localization of Snail. GSK-3\u03b2 acts as the main kinase that phosphorylates Snail, thereby facilitating its degradation via the ubiquitin\u2013proteasome pathway [Previous studies have shown that COL11A1 mediates Aktinvasion ,16,19. pl tumors ,45. In t pathway . We prop+/CD44+ and CD133+CXCR4+ cells have been proposed to represent CSCs in PDAC, based on their self-renewal ability [+/CD44+ cell surface phenotype [The association between cell stemness and EMT has attracted the attention of many researchers due to the similar roles that these two processes play in cancer cell metastasis. Evidence suggests that epithelial CSCs express many mesenchymal markers that are related to advanced malignant features, including relapse, invasiveness, and metastatic dissemination . Recent  ability . PANC-1 henotype , so we c+/CD44+ cells with high COL11A1 expression may undergo EMT.COL11A1 is absent in normal pancreatic tissues, which may be a crucial factor for distinguishing between cancer initiation and development. Therefore, we propose that COL11A1 inhibitors have high therapeutic potential in simultaneously affecting EMT/CSC properties in pancreatic cancer, thereby suppressing the migration and invasion of cells, which provides an additional means for implementing conventional therapy. Additionally, COL11A1 plays a pivotal role in manipulating the cell stemness and EMT, essentially serving as a link between the two processes. Therefore, the molecular mechanisms underlying the effect of COL11A1 on EMT require further elucidation.We elucidated the mechanism by whichCOL11A1regulated the expression levels of both mRNAs and proteins involved in EMT and stem cell-like properties, such as enhanced colony formation. The CD24In summary, our study demonstrated that COL11A1 effectively induced EMT progression and cell stemness by activating the AKT/GSK-3\u03b2/Snail signaling pathway to enhance the migration and invasion abilities of pancreatic cancer cells. The present study revealed a novel signal transduction cascade, in which COL11A induced EMT and cell stemness, and highlighted a potential therapeutic target for the metastasis of PDAC."}
+{"text": "Extramammary Paget disease (EMPD) is a rare form of cutaneous, intraepithelial adenocarcinoma, which typically presents itself as an erythematous plaque originating from apocrine-gland rich regions, such as the vulva, the perianal region, the scrotum, the penis, or the axilla. EMPD patients typically have a good prognosis, with expected 5-year survival of 60%\u201392%, but it is estimated that about one-third of EMPD patients will develop lymph node or distant metastases. Treatment approaches for EMPD include locoregional therapies such as broad surgical resection, radiotherapy, or topical imiquimod, when the disease is localized, and chemotherapy and biological agents for advanced EMPD. We report the case of a 58-year-old man diagnosed with locally advanced, symptomatic HER2-overexpressing, AR-positive EMPD, who achieved long-term tumor control with a sequence of several trastuzumab-based treatments . Even if it is reported that AR expression occurs concomitantly with HER2 overexpression in more than half of the cases of EMPD, to the best of our knowledge, this is the first case report describing androgen receptor blockade therapy in combination with an anti-HER2 agent. Our patient did not benefit from androgen receptor blockade in combination with trastuzumab, thus suggesting that AR expression may simply reflect an intrinsic characteristic of the EMPD cell of origin, rather than tumor dependence upon AR signaling. Given the reported sensibility to anti-HER2 therapy, also new antibody drug conjugates targeting HER2 are worth exploring in the management of advanced EMPD. Clinical features of EMPD resemble inflammatory, non-malignant conditions, thus frequently resulting in misdiagnoses or delayed recognition of the cancerous nature of this disease. EMPD more frequently affects female individuals, with a male-to-female ratio of 1:2.8 in Europe (Extramammary Paget disease (EMPD) is a rare form of cutaneous, slowly growing intraepithelial adenocarcinoma originating from apocrine-gland rich regions, such as the vulva, the perianal region, the scrotum, the penis, or the axilla . Similarn Europe , 4. The n Europe .EMPD patients typically have a good prognosis, with expected 5-year survival of 60%\u201392% . It is eTreatment approaches for localized EMPD include broad surgical resection, radiotherapy, topical imiquimod, and photodynamic therapy; for patients with advanced  EMPD, several chemotherapeutic agents, including 5-fluorouracil, taxanes, platinum salts, and vinca alkaloids, have shown moderate antitumor activity in published case series \u201317. MoreHere, we report the case of a 58-year-old man diagnosed with locally advanced, symptomatic HER2-overexpressing, AR-positive EMPD, who experienced prolonged disease control when treated with subsequent lines of trastuzumab plus different cytotoxic agents.in situ hybridization (ISH) analysis revealed ERBB2 gene amplification  of 5 every 3 weeks] plus paclitaxel (150 mg/mq every 3 weeks) in combination with trastuzumab (provided with an off-label procedure) was initiated. Trastuzumab was administered at a loading dose of 8 mg/kg i.v., followed by 6 mg/kg i.v. maintenance dose every 3 weeks, as for the treatment of HER2-positive breast cancer . EchocarHER2 (IHC/FISH) , as assessed by means of targeted next-generation sequencing (NGS) through the Ion Torrent Personal Genome platform \u201cHot-spot Cancer Panel\u201d (Thermo Fisher Scientific). While confirming the overexpression/amplification of Based on both AR expression and HER2 overexpression, in June 2019, fourth-line treatment with bicalutamide 50 mg p.o. daily, plus leuprorelin 11.25 mg i.m. every 3 months (according to the schedule commonly used in prostate cancer) was started, together with i.v. trastuzumab maintenance; however, the disease rapidly progressed  achieved long-term tumor control with a sequence of several trastuzumab-based treatments .Inoperable EMPD is typically associated with dismal prognosis, and systemic medical treatment is the only therapeutic choice. In the clinical case that we reported here, a patient with inoperable, loco-regionally advanced EMPD bearing HER2 overexpression . PD-L1 expression is typically low in most EMPDs . NonetheThe study of Liegl et\u00a0al. reported that AR expression frequently occurs concomitantly with HER2 overexpression, both in MPD and EMPD (88% of MPD cases and 52% of EMPD cases) . Two casDissimilarly to other EMPD case reports described in the literature, our patient never developed distant metastases. He presented with cutaneous involvement and bilateral inguinal lymphadenopathies and underwent several subsequent locoregional progression events responsible for a slow but progressive deterioration of clinical conditions. The absence of metastatic spread could be the result of intrinsic molecular characteristics of the tumor and/or of the antitumor and immunomodulatory effects of trastuzumab, which might explain the long-term disease control.To the best of our knowledge, this is the first case reporting a prolonged clinical benefit and long-term survival after treatment with several trastuzumab-based regimens , including a trastuzumab\u2013anti-androgen therapy combination, which has never been used in previous published EMPD case reports or case series. In patients with HER2-positive EMPD, the use of ADCs targeting HER2 should be further explored. In the context of a very rare disease, we suggest that sharing cases of patients achieving prolonged tumor control and long-term survival holds great value and might help clinicians in making decisions when managing these neoplasms.The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding author.EZ: conceptualization, manuscript preparing, editing. FN: conceptualization, manuscript preparing, editing. FL: manuscript preparing. LM: draft preparing. RL: manuscript preparing. GF: editing. GP: editing. AV: data collection. GB: conceptualization. GC: editing. FB: conceptualization. CV: conceptualization, manuscript preparing, editing, supervising. All authors contributed to the article and approved the submitted version.We would like to thank AIRC, the Associazione Italiana per la Ricerca sul Cancro, for funding our research (MFAG 22977: PI Claudio Vernieri).FB reports an advisory role at Roche, EMD Serono, NMS Nerviano Medical Science, Sanofi, MSD, Novartis, Incyte, BMS, Menarini; speaker role for BMS, Healthcare Research and Pharmacoepidemiology, Merck Group, ACCMED, Nadirex, MSD, Pfizer, Servier, Sanofi, Roche, AMGEN, Incyte, Dephaforum; Principal Investigator for Novartis, F.Hoffmann-LaRoche Ltd, BMS, Ignyta Operating INC, Merck Sharp and Dohme Spa, Kymab, Pfizer, Tesaro, MSD, MedImmune LCC, Exelixis Inc., LOXO Oncology Incorporated, DAICHI SANKIO Dev. Limited, Basilea Pharmaceutica International AG, Janssen-Cilag International NV, Merck KGAA. CV reports an advisory role for Novartis; travel grants: Lilly, Novartis, Istituto Gentili, Roche, Pfizer; research grants: Roche.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "DNA clearance was assessed, and the risk of persistent HPV DNA was 23.2% . Regarding immunological parameters, immune responses by specific T-HPV cells were more likely in vaccinated women . In short, these studies favored the vaccine group over the placebo group. This work indicated that therapeutic vaccines are efficient in the treatment of CIN 3, even after accounting for publication bias.Cervical cancer (CC) is a disease that affects many women worldwide, especially in low-income countries. The human papilloma virus (HPV) is the main causative agent of this disease, with the E6 and E7 oncoproteins being responsible for the development and maintenance of transformed status. In addition, HPV is also responsible for the appearance of cervical intraepithelial neoplasia (CIN), a pre-neoplastic condition burdened by very high costs for its screening and therapy. So far, only prophylactic vaccines have been approved by regulatory agencies as a means of CC prevention. However, these vaccines cannot treat HPV-positive women. A search was conducted in several databases  to systematically identify clinical trials involving therapeutic vaccines against CIN 3. Histopathological regression data, immunological parameters, safety, DNA clearance, and vaccine efficacy were considered from each selected study, and from the 102 articles found, 8 were selected based on the defined inclusion criteria. Histopathological regression from CIN 3 to CIN < 1 was 22.1% (95% CI: 0.627\u20130.967;  Cancer is a devastating disease, being associated with a burden on affected individuals and their families as well as health care systems . The incPapillomaviridae family, a group of small, non-enveloped, double-stranded DNA viruses [HPV belongs to the  viruses . The gen viruses , are enc viruses ,9: HPV 1 viruses . Of all  viruses , account viruses .After the virus entrance in the epithelial cells, the viral DNA starts the replication, and a small amount of E1, E2, E6, and E7 proteins is produced before the infection even happens. Then, E2 invokes E1 to promote an increase in the number of viral episome copies ,13. E6 aWhen a HPV infection becomes persistent, a progression to pre-malignant glandular or squamous intraepithelial lesions can emerge. From a histopathological perspective, these lesions can be classified as cervical intraepithelial neoplasia (CIN), which is subdivided into CIN 1\u2014mild dysplasia; CIN 2\u2014moderate to severe dysplasia; CIN 3\u2014severe dysplasia and carcinoma in situ, and can progress to cancer stage . DespiteThere are three marketed prophylactic vaccines (i) Cervarix , a bivalent vaccine against HPV 16 and 18; (ii) Gardasil , a quadrivalent vaccine against HPV 6, 11, 16, and 18, and (iii) Gardasil 9 (Merck Inc.), a nonavalent vaccine against HPV 6, 11, 16, 18, 31, 33, 45, 52, and 58 . The priProphylactic vaccines are generally given to healthy individuals and have little potential when the disease is already present. Therapeutic cancer vaccines, however, are given to cancer patients and are designed to eradicate cancer cells. This technology can induce immune responses to HPV proteins with the aim of removing HPV infection by killing HPV + cells in a lesion or tumor ,23. E6 aThis systematic review with a meta-analysis of randomized controlled trials (RCTs) aims to evaluate the efficacy of therapeutic vaccines against CIN 3.This systematic review was conducted according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) statement . The seaTwo reviewers independently reviewed the selected studies for inclusion eligibility using standardized data collection forms. The following data were retrieved from each study: (i) author, (ii) year of publication, (iii) number of study participants, (iv) type of the vaccine and placebo administered, (v) study duration/location (vi) CIN, (vii) main outcomes . In the face of disagreement between the authors, a third author was called to discuss and find a consensus to include or exclude the study in question.To validate the articles, they had to meet the following eligibility criteria: (i) RCT, (ii) include participants with CIN 3, and (iii) include the assessment of CIN 3 regression in both control and experimental groups. Titles and abstracts that did not fit the criteria were eliminated without further review.The main outcomes of this meta-analysis were clinical efficacy based on the lesion regression, viral load reduction, and immunogenicity, in particular HPV-T cell response.https://training.cochrane.org/online-learning/core-software-cochrane-reviews/revman/revman-5-download/download-and-installation) (accessed on 15 September 2022).We assessed internal validity using Cochrane Collaboration\u2019s Risk of Bias Tool. This tool classifies the risk of bias in RCTs included in meta-analysis as high risk, unclear, or low risk in seven domains: random sequence generation, allocation concealment, blinding of participants and personnel, blinding of outcome assessment, incomplete outcome, data selective reporting, and other sources of bias . This clhttps://www.metaanalysis.com/) (accessed on 31 January 2022). Forest plots were generated to illustrate the study-specific effect sizes (risk ratio\u2014RR or odds ratio\u2014OR) along with a 95% confidence interval (CI). In general, the random-effects model was used; however, when a fixed-effects model would be more useful, i.e., when there was little variance in effect sizes, the software automatically converted the random-effects into a fixed-effects model [Q-statistic . Under the hypothesis that homogeneity exists (null hypothesis), Q will follow a \u03c72 distribution. A p-value of less than 0.05 leads to the rejection of the null hypothesis and therefore indicates that some (undetermined) degree of heterogeneity exists. Higgins et al. [2 was used as a measure of inconsistency across the findings of the included studies. I2 has a range of 0 to 100%, and values of 25%, 50%, and 75% are considered to indicate low, moderate, and high heterogeneity, respectively [2 reflects the proportion of observed dispersion which was due to the heterogeneity.Data statistical analyses were performed using Comprehensive Meta-Analysis, version 2.0 . In the absence of publication bias, the studies would have been symmetrically distributed about the pooled effect size ,31. SincThe sensitivity analysis was also performed by removing each study one at a time to evaluate the stability of the results.Our search retrieved 102 records, of which 37 were duplicates and were then excluded. The titles and abstracts of the remaining 65 published articles were screened, and 8 articles were found to meet the inclusion criteria and were assessed for eligibility via full-text evaluation . AnotherThe selected studies focused on vaccines developed for the regression of CIN 3 , in whicThe risk of bias of each included RCT was assessed with the Cochrane Library tool. The results found in the assessment of the risk of publication bias from the included studies are summarized in The effect sizes were summarized as RR or OR and associated with 95% CI. A RR less than one or an OR great than one suggested vaccine protection against a clinical endpoint. Consistent with definitions used in vaccine RCTs, efficacy was estimated as (1-RR) and expressed as a percentage.The histological complete resolution or partial response (CIN 1) was obtained by measuring the lesion before and after vaccination in women who were confirmed to have CIN 2 or 3 at baseline. After this regression, the vaccine efficacy (VE) for complete resolution was calculated.Eight studies assessed the histopathological regression to CIN \u2264 1 and VE for complete resolution.p-value = 0.024) .Vaccines showed a statistically significant reduction of 22.1% in CIN 2/3 incidence compared with placebo  . Howeverp-value < 0.001) .The pooled RR for confirmed cases of CIN 1/2/3 in the vaccinated group compared with the unvaccinated group was 0.764  , correspp-value < 0.001) equivalent to a 23.2% lower risk of persistent HPV DNA for vaccine recipients compared with control recipients. There was a non-significant heterogeneity .Viral load was measured using PCR amplification to assess the clearance of HPV DNA from the cervical biopsy after vaccination. Four studies reported on DNA clearance. Viral DNA clearance of CIN 2/3 was significantly greater in the vaccine-treated group than in the placebo group. In addition, Immunogenicity is one of the key features of therapeutic vaccines as it represents the potential of the vaccine to induce virus-specific T cell response, in particular HPV-T cell immune response.p-value = 0.017) .Vaccinated women were more likely to develop HPV-T cell immune response than were unvaccinated women  . There wOverall, all vaccines were well tolerated without vaccine-related serious adverse events. No serious adverse events (Grade 3/4) related to the vaccination were reported. No dose-limiting toxicities were observed.p-value = 0.01) when compared with the conclusions obtained for the global analysis .The sensitivity analysis was performed by excluding one or more studies from the analysis to see how this affected the results. Special attention was also given to studies identified as outliers. The sensitivity analysis showed that the pooled effects of the effectiveness of DNA therapeutic vaccines endpoints, efficacy for complete resolution, histopathological regression to CIN \u2264 1, and DNA clearance, did not change substantially if a single or a few studies were omitted . RegardiOverall, the sensitivity analysis demonstrated that the findings of the meta-analysis of the effectiveness of DNA therapeutic vaccines for cervical intraepithelial neoplasia 2/3 on the defined outcomes of this work are robust.p-value > 0.05, indicating no evidence of publication bias . The present work evaluated the therapeutic efficacy of these vaccine technologies by considering and comparing the following outcomes: (i) histopathological regression, (ii) VE, (iii) DNA clearance, (iv) immunogenicity, and (v) safety.Virus-like particles are multi-protein supra-molecular structures and present varied virus characteristics that can be applied in vaccine development strategies. VLP-based vaccines exclude the virus ability to replicate, since it lacks the viral genome, making it a safe model for vaccine development . GardasiLactobacillus casei (L. casei) to present specific antigens to APCs [L. casei expressing mutant HPV16 E7 [L. casei by electroporation. Subsequently, L. casei expressed E7 HPV 16 on its surface [L. casei was purified and dried into a powder and stored in a capsule designed to degrade in the gut containing 250 mg of the vaccine. GLBL101c was therefore administered orally. This vaccine allowed the development of Th1 cells, leading to a significant regression of the CIN presenting a VE of 100% [A vaccine based on recombinant E6/E7 fusion proteins, and an adjuvant was explored by Frazer and coworkers and revealed an improved specific antibody response, and also developed E6 or E7 specific T cells . However to APCs . Thus, GHPV16 E7 . A plasm surface . The att of 100% .DNA vaccines are considered the third generation of vaccines since they stimulate both humoral and cellular pathways of the immune system, have low production cost, are thermostable, and are easy to deliver compared with conventional vaccines . These vZYC101a consists of an encoded HPV 16 E7 protein via pDNA encapsulated in polylactide co-glycolide (PLG) microparticles. Francisco Garcia and collaborators conducted a study involving 161 volunteers. Histopathological regression was higher in the ZYC101a groups compared to placebo (43% versus 27%). In addition, in women younger than 25 years, regression was higher in the experimental group (70%) compared with the control group (23%). The immune response showed a 2-fold increase of HPV 16-specific CD8 + T-cell production. Thus, the VE of this vaccine was 37.21% . MatijevAnother vaccine exploiting DNA technology is the VGX-3100 (33). This vaccine consists in the administration of a final dose of 6 mg (3 mg of the plasmid expressing the E6 and E7 protein of HPV 16 and 3 mg of the plasmid expressing the E6 and E7 protein of HPV 18) through intramuscular route followed by electroporation. Involving 154 patients, this vaccine was well tolerated, manifesting common adverse effects at the administration site. The histopathological regression parameter was evaluated, and the result was 48.2% in the experimental group and 30.0% in the control group. The immunological component was improved, namely the specific T-cell response, which was increased 9.5-fold compared to baseline. The clearance of HPV DNA was also checked, showing an elimination of HPV-positive cells of 39.5% in the experimental group and only 15.40% in the placebo group. This vaccine had a VE of 37.76% .Overall, the present study shows that the use of therapeutic vaccines against HPV-related CC can provide effective immune responses that lead to the histopathological regression of CINs and the elimination of HPV DNA from infected cells. The results observed with DNA vaccines can be related to the fact that some vaccines are applied without delivery systems and other make use of DNA delivery systems with different performance in the process of cellular internalization. Undoubtedly, the use of delivery systems can bring several advantages for DNA vaccines, not only to efficiently condense, protect, and carry the DNA but also to target deliver these vaccines into APCs, being considered strong adjuvants in the intended immune responses activation ,53. For The sensitivity analysis results showed that the efficacy of therapeutic vaccines in histopathological regression for CIN < 1 did not change when removing either study, implying that the results found are robust. The risk of publication bias cannot be excluded, showing that there are factors that may influence the results of this meta-analysis. However, this systematic review with meta-analysis demonstrated that those therapeutic vaccines could efficiently reduce CIN and were excellent approaches to treating women with HPV-related CC.Previous systematic reviews have also demonstrated the therapeutic potential of DNA vaccines against CIN 3. Indeed, therapeutic vaccines have the potential to be a novel therapy for cancer. Despite currently available treatments, such as chemotherapy or radiotherapy, the recurrence rate remains high (50% of cases) and the 5-year survival rate is low. However, one DNA vaccine, MEDI0457 (plasmid VGX-3100 associated with a plasmid expressing IL-12), gave an estimated disease progression-free survival (PFS) of 88.9% . AlthougCervical cancer remains a very prevalent disease worldwide, for which only prophylactic vaccines are available until now. This systematic review and meta-analysis provided an overview of the therapeutic vaccines under clinical assays. Among the most varied technologies evaluated and for the chosen parameters, the vaccine group was always the favored one. These results reflect the importance of investigating therapeutic vaccines against CC in order to treat HPV-positive patients, especially in the initial stages of cancer such as CIN, also reducing the use of invasive surgical procedures for their treatment."}
+{"text": "Cerebral vasospasm (CVS) continues to account for high morbidity and mortality in patients surviving the initial aneurysmal subarachnoid hemorrhage (SAH). Nimodipine is the only drug known to reduce delayed cerebral ischemia (DCI), but it is believed not to affect large vessel CVS. Milrinone has emerged as a promising option. Our retrospective study focused on the effectiveness of the intra-arterial application of both drugs in monotherapy and combined therapy.We searched for patients with aneurysmal SAH, angiographically confirmed CVS, and at least one intra-arterial pharmacological angioplasty. Ten defined vessel sections on angiograms were assessed before and after vasodilator infusion. The improvement in vessel diameters was compared to the frequency of DCI-related cerebral infarction before hospital discharge and functional outcome reported as the modified Rankin Scale (mRS) score after 6 months.p = 0.217). Only nimodipine or the combined approach could prevent DCI-related infarction (both 57.1%), not milrinone alone (87.5%). Both drugs induced a doubled vasopressor demand due to blood pressure decrease, but milrinone alone induced tachycardia.Between 2014 and 2021, 132 intra-arterial interventions  in 30 patients were analyzed for this study. The vasodilating effect of nimodipine was superior to milrinone in all intradural segments. There was no significant intergroup difference concerning outcome in mRS (The monotherapy with intra-arterial nimodipine was superior to milrinone. Nimodipine and milrinone may be used complementary in an escalation scheme with the administration of nimodipine first, complemented by milrinone in cases of severe CVS. Milrinone monotherapy is not recommended. Subarachnoid hemorrhage (SAH) is in about 85% of cases caused by cerebral aneurysm rupture . A distiDysregulation of the cerebral vasculature, mainly at the larger extraparenchymal vessels, remains a target for endovascular treatment and improves the outcome of patients with severe, refractory vasospasms . VasospaNimodipine and milrinone are the most applied drugs for intra-arterial spasmolysis. Retrospective studies have found large variability in dosing, route, and cointerventions \u20137. Both In this retrospective study, the aim was to analyze the effects of nimodipine, milrinone, and the combined use of both agents on different vessel segments to define the criteria for their application. We hypothesized that milrinone could be as effective as nimodipine for improving arterial vessel diameters and that a multiple-vasodilator regimen may provide a greater benefit in angiographic and clinical outcomes than monotherapy.We screened our hospital records for patients admitted to our clinic after SAH between January 2014 and July 2021 with aneurysmal SAH, angiographically confirmed CVS, and at least one intra-arterial pharmacological angioplasty. The local Ethics Committee of our Medical Faculty approved this study (reference number: 412/19-ek). Inclusion criteria were: (1) an aneurysmatic SAH verified by computer tomography (CT), magnetic resonance imaging (MRI), or lumbar puncture, and (2) pharmacological intra-arterial spasmolysis. Patients with mycotic or traumatic-induced pseudoaneurysms and aneurysms associated with arteriovenous malformations were excluded.Delayed cerebral ischemia (DCI) is the recommended term to describe the post-SAH delayed clinical deterioration after other potential identifiable causes have been ruled out. DCI can lead to infarction. To identify DCI-related infarction, available non-contrast CT at hospitalization, after aneurysm treatment, at the onset of vasospasm before endovascular treatment, and after the vasospasm phase before discharge were analyzed for signs of infarction. Infarctions within 48 h after aneurysm treatment and up to 3 days after initial SAH were assessed as SAH-related or treatment-associated complications. New infarctions up to 21 days after SAH due to other potential causes  have been ruled out.After 6 months, all neurosurgical patients were routinely summoned to our clinic to evaluate the functional outcome. The modified Ranking Scale (mRS) was subsequently assessed based on the medical report.via gastric tube (60 mg every 4 h) from admission until day 21 after SAH. The standard of care compromised normovolemia and normoglycemia. The mean arterial blood pressure was always sustained above 75 to 85 mmHg to support a cerebral perfusion pressure (CPP) over 65 mmHg. The blood pressure target depended additionally on patient age, pre-existing hypertension, and cardiac function. The intravenous administration of the vasopressor norepinephrine or the vasodilator urapidil was used for blood pressure management. To prevent thrombosis and/or pulmonary embolism, all patients received low molecular weight heparin in a prophylactic dosage . Corticosteroids or statins were not given routinely.All patients were monitored in our neurointensive care unit . NimodipMonitoring included daily transcranial Doppler (TCD) investigation of cerebral arteries for 2 weeks following SAH. If cerebral vasospasm was suspected based on new neurological impairment or increased flow velocity in TCD above 120 cm/s in MCA or doubling within 24 h, CT was performed to detect new territorial infarctions. Intubated and sedated patients without a sufficient window for ultrasound assessment received a control CT after 7 days. CT perfusion analysis was additionally performed in cases with new infarctions to determine if further treatment is needed. Before indicating rescue therapy, there was always an interdisciplinary discussion between intensivists, neurosurgeons, and neuroradiologists. The potential patient's benefit had to exceed the risk of blood pressure drops and physical stress during transport. Lacunar or small territorial infarctions were not considered a contraindication for intra-arterial spasmolysis, as long as there was still a large vessel territory at risk. The initial DSA on admission served as a reference image to assess the severity of CVS.Diagnostic DSA was performed using either a biplane Siemens system , a biplane Philips system , or a monoplane GE system . Iopromide  was used as the contrast medium.We regularly performed intra-arterial spasmolysis over the entire period, using nimodipine , milrinone , or a combination of both agents. In this retrospective study, patients were not randomized for one treatment. There was a staff turnover causing a serial use of nimodipine from 2014 to 2017 and milrinone from 2018 to 2021. The latter interventionalists also used a combination of both agents (2018\u20132021), especially in more severe cases.via 4-F or 5-F angiography catheters  with the same inner diameter. The femoral sheath and the catheter were continuously flushed with an infusion of heparin  and saline solution (0.9%) to prevent periprocedural thromboembolism. The patients' hemisphere most affected by vasospasm was defined as the main side. Vessel diameters were analyzed at the time when the dilating agent was directly admitted to the corresponding hemisphere. Nimodipine was applied with a dosage of 1.5 mg per vascular territory and a maximum of 3 mg per treatment session. As a rare exception, 6 mg in a single treatment was administered. When used separately, milrinone was applied with a dosage of 10 mg per vascular territory and a maximum of 20 mg per treatment. In rare cases, a maximum of 40 mg was used. Different agents were administered consecutively, typically over 30 \u2212120 min. According to the criteria mentioned above, the treatment was repeated after 12 to 24 h or intermittently on demand when recurrence of vasospasm was suspected by TCD in unconscious patients or worsening of clinical symptoms. Continuous spasmolysis with indwelling microcatheters was not performed.Vasodilators were administered intra-arterial Since nimodipine and milrinone are vasodilative, norepinephrine , and the heart rate (HR) were assessed from the digital patient records 1 h before intra-arterial spasmolysis and during spasmolysis. The minimum MAP during spasmolysis was evaluated. Milrinone is known to increase the HR ; therefoOnly angiographic procedures with a direct intra-arterial infusion of vasodilating agents in the internal carotid artery were evaluated.Vessel diameters before infusion (pre-infusion diameter = PrID) and after completion of pharmacological treatment (post-infusion diameter = PoID) were measured at ten defined vessel segments: segment C5 of the extradural internal carotid artery (ICA), segment C6 and C7 of the intradural ICA, the narrowest point of C7 (nC7), the proximal M1 segment (pM1) the distal M1 segment (dM1) and the proximal M2 segment (M2) of the middle cerebral artery, the proximal A1 segment (pA1), the distal A1 segment (dA1) and the proximal A2 segment (A2) of the anterior cerebral artery. The drug-specific spasmolytic effect was defined by calculating the difference of PrID and PoID for each measured point. The degree of angiographic response was defined by the improvement percentage ratio (IPR) calculated as IPR = (PoID/PrID\u22121) x 100%. All values were measured on a diagnostic workstation  according to a defined protocol .The investigator was blinded to the patients' treatment and retrospectively decided whether vessel narrowing was presumably due to a spasm or a pre-existing condition, such as developmental hypoplasia or atherosclerosis. The proximal ACA was considered hypoplastic if the contralateral A1-segment and the AComA were large and the A2-segments were well filled. Confidence in identifying A1 hypoplasia was increased if no spasm was present in the ipsilateral A2 segment. In the case of the proximal bifurcation variant of the MCA, the most prominent branch of the M1 segment was evaluated. The two most prominent M2 branches were measured if there was a trifurcation or quattrofurcation.The values were not measured at the site of aneurysms or implanted materials e.g., coils. Vessel segments with stents of any kind were excluded.t-test and chi-square test were used as appropriate. A two-tailed value of p < 0.05 was considered indicative of statistical significance.Statistical analyses were performed with SPSS version 27.0  and R version 4.0.1 . Data were first analyzed by the Shapiro-Wilk test for normal distribution. Subsequently, the We identified 30 patients with 129 intra-arterial spasmolysis in 144 vascular territories  due to cerebral vasospasm . Twenty-n = 4), leading to a higher proportion of clipped aneurysms in these patients (n = 4). This is partly caused by a profound selection bias that has to be kept in mind when interpreting outcome data. Therefore, a prospective design is needed to refer valuable clinical outcome data to pharmacological intra-arterial CVS treatment. Intubation and external ventricular drainage (EVD) were less frequent in patients treated with nimodipine only compared to the other patients.Regarding clinical scores, patients who received monotherapy with nimodipine or milrinone did not relevant differ in Fisher score, Hunt & Hess score, or WFNS score on admission . Patientn = 4, WFNS score: 3, HH score: 3, Fisher score: 3.75). After clipping, three patients developed post-therapeutic infarctions . Two patients with multiple aneurysms and combined treatment revealed an infarction or an intracranial hemorrhage (ICH) due to aneurysm rupture during clipping .After endovascular aneurysm treatment, post-therapeutic infarctions occurred in three instances, and intracranial hemorrhage was observed once , milrinone , or a combination of both  summarized in P-values of the calculated difference of PrID and PoID for each drug group are shown in p-value for the pM1 between nimodipine and milrinone. The extradural C5 segment responded higher to the milrinone application. The combined approach augmented the IPR in the C5, pA1, A2, and M2 segments compared to monotherapy with nimodipine, but significant differences were only detected for C5 and A2 segments.The IPR for each measured point is depicted in boxblots for each group of drugs in There were no major periprocedural complications of intra-arterial spasmolysis, e.g., hemorrhage transformation of infarction, vessel occlusion, or dissection. Minor complications were femoral sheath dislocations or occlusions between the several endovascular treatments.Circulatory data for MAP and HR 1 h before intra-arterial spasmolysis and during spasmolysis are specified in One patient was susceptible to small dosages of milrinone (1 mg), resulting in a short-lasting tachyarrhythmia (<1 h). The spasmolytic treatment was escalated to nimodipine. Another patient showed rapid blood pressure drops to small milrinone dosages (<5 mg).Six patients (20%) already suffered from DCI-related infarctions before intra-arterial spasmolysis . One patp = 0.216).The outcome in mRS after 6 months is displayed in detail for each drug group in n = 2) or general brain edema (n = 1). These patients had an initial Fisher score of 3 (n = 1) or 4 (n = 2). Patients who received the combination of nimodipine and milrinone had a worse clinical starting condition (p = 0.145), WFNS (p = 0.261), or Hunt and Hess score (p =0.186) did not predict a significantly worse outcome in this study group.Three patients died of multi-infarct syndrome  then leading to further imaging . Patients with clinical worsening, vessel territories at risk, and/or angiographical detectable vasospasm received an intra-arterial spasmolysis.We compared three different intra-arterial treatment strategies for preventing vasospasm-caused infarctions. The application of nimodipine only and the combination of nimodipine and milrinone were superior to milrinone alone. The proven superiority refers in particular to angiographically detectable changes and the frequency of DCI-related infarctions detected by CT.n = 18), of whom 53% developed new infarcts. These findings align with our results. Other investigators reported 21\u201362% of infarction rates despite intra-arterial spasmolysis with nimodipine  and cyclic guanosine 3'5'-monophosphate (cGMP) with maximum velocity for cAMP higher than that for cGMP . PDE3 inn = 34), on average, the distal ICA segment dilated by 12% (p < 0.001), the A1 segment by 35% (p < 0.001) and the M1 segment by 40% (p < 0.001) after milrinone or nimodipine administration. Shankar et al. (n = 14) reported a mean percentage angiographic improvement after intra-arterial Milrinone application in supraclinoid ICA of 11.32%, M1 and M2 segment of MCA of 37.5%, and A1 and A2 segment of ACA 38.69%. These results match our IPR. The discordant value of Milrinone with an IPR of 112% in the M2 segment is most probably caused by anatomical variations, rendering this measuring point especially difficult, e.g., caused by unequal distribution of M2 branches.In retrospective clinical studies , 24, ther et al.  (n = 14)The delay of 5 to 7 days between SAH and the onset of CVS is not entirely consistent with the appearance of most putative spasmogens in cerebrospinal fluid after SAH , 26. MulIt has to be noted that our retrospective study is focused on imaging results and does not allow a reliable conclusion from the considered intervention on the clinical outcome. Randomized controlled trials are challenging to realize due to the disease pattern's severity and infrequency. The inhomogeneous sample size per drug in our analysis does not allow for a robust statistical assessment of the effect of treatment on vessel diameter. Furthermore, unequal distribution of the Fisher score put the patients treated with the nimodipine/milrinone combination in a worse position. A prospective design is needed to refer valuable clinical outcome data to pharmacological intra-arterial CVS treatment.Twenty-two angiograms were analyzed for monotherapy with nimodipine or milrinone even though the respective patients received the other drug in another endovascular intervention for the same reason, which nevertheless may justify this consideration since both drugs have a short half-life, being eliminated after 12 h. Nevertheless, there may result a confounder regarding possible cumulative effects.For intra-arterial pharmacological spasmolysis after SAH, nimodipine seems superior to milrinone with regard to the local effect on cerebral vessels. The combined therapy with nimodipine and milrinone prevented DCI-related infarctions equal to nimodipine monotherapy in severe CVS in our cohort. Nimodipine and milrinone may be used complementary in an escalation scheme with the administration of nimodipine first, complemented by milrinone in cases of severe CVS. Following former studies, our results question the monotherapy with milrinone for intra-arterial spasmolysis.https://zenodo.org/, href=https://zenodo.org/record/6374148.The datasets presented in this study can be found in online repositories. The name of the repository and accession number can be found at: Zenodo, The studies involving human participants were reviewed and approved by Ethical Committee of the Leipzig University. The patients/participants provided their written informed consent to participate in this study.UQ and SS performed the endovascular interventions. JJ was responsible for data acquisition and drafting the article. HM performed image analysis. SZ was responsible for patient monitoring. DL and KG performed neurosurgical interventions. K-TH wrote and reviewed the paper. RW revised the article critically for important intellectual content. DH performed the statistical review. SM performed vascular analysis. CR designed the study, wrote the paper, and performed interventions. All authors contributed to the article and approved the submitted version.The work was supported by the Open Access Publishing Fund of Leipzig University, supported by the German Research Foundation within the Open Access Publication Funding program.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Dominant theoretical accounts of developmental language disorder (DLD) commonly invoke working memory capacity limitations. In the current report, we present an alternative view: That working memory in DLD is not under-resourced but overloaded due to operating on speech representations with low discriminability. This account is developed through computational simulations involving deep convolutional neural networks trained on spoken word spectrograms in which information is either retained to mimic typical development or degraded to mimic the auditory processing deficits identified among some children with DLD. We assess not only spoken word recognition accuracy and predictive probability and entropy , but also use mean-field-theory based manifold analysis to assess; (a) internal speech representation dimensionality and (b) classification capacity, a measure of the networks\u2019 ability to isolate any given internal speech representation that is used as a proxy for attentional control. We show that instantiating a low-level auditory processing deficit results in the formation of internal speech representations with atypically high dimensionality, and that classification capacity is exhausted due to low representation separability. These representation and control deficits underpin not only lower performance accuracy but also greater uncertainty even when making accurate predictions in a simulated spoken word recognition task , which replicates the response delays and word finding difficulties often seen in DLD. Overall, these simulations demonstrate a theoretical account of speech representation and processing deficits in DLD in which working memory capacity limitations play no causal role. Learning language is a central aspect of child development and is often mastered with astonishing ease despite the complexity of language and a lack of direct instruction. Nevertheless, not all children succeed equally in acquiring language. In developmental language disorder (DLD), deficits in spoken language comprehension and production severe enough to affect the child\u2019s wellbeing are observed despite no obvious biomedical cause . AlthougA dominant feature of existing causal accounts of DLD is an emphasis on the role of working memory. Apparently uniformly, research in this area has taken lead from doppelate, hampent, or glistering, a task commonly held to tap phonological loop capacity This view of working memory capacity limitations as the consequence rather than cause of language difficulties aligns well with contemporary working memory frameworks that seek to de-emphasize the role of functionally discrete, modality-specific buffers, such as the phonological loop, in favor of a relatively parsimonious characterization of working memory in terms of activated long-term memory plus attention . The so-For some, the state-based working memory framework represents simply a difference in terminology and research focus , rather than a clear theoretical break with the earlier multicomponent model that continues to dominate DLD research . Yet, inThe challenge for mechanistic accounts arguing that apparent working memory capacity limitations are the consequence of shortfalls in long-term language knowledge is, of course, to explain how and why speech encoding is deficient without appealing to a primary working memory capacity bottleneck. Along these lines, computational modeling of variance in nonword repetition and span task performance among typically developing individuals has appealed to the notions of input frequency and regularity . Here, tThe long-term encoding benefits of high frequency and regularity of exposure clearly boost performance for certain stimuli in working memory tasks, and may more broadly explain why working memory capacity appears to increase during infancy and childhood . Simply,Auditory processing deficits commonly reported among children with DLD provide a credible starting point for this form of inquiry. While initially cast as a temporal processing issue, that is, that some children affected by DLD have difficulty discriminating rapidly occurring changes in pure tone\u2014a view developed through the work of Paula Tallal and colleagues e.g., \u2014subsequeIt may appear reasonable to assume a causal association between low-level frequency discrimination deficits and the deficits in higher-order speech representation and retrieval that characterize DLD. Children affected by DLD commonly require more exposures to a spoken word than control children in order to encode similar levels of phonological detail , for insfuzziness, imprecision, or indistinctiveness of underlying long-term speech representations , a precise account of the form that such deficits take remains elusive, with existing research restricted to verbal descriptions of task performance being impeded due to the ntations . In the Method section.The theoretical account presented in this report is informed by the manifold untangling framework developed in visual neuroscience  and receThe manifold untangling framework has at its heart the notion that acoustic speech signals stimulate patterns of firing in populations of neurons that may be understood as a response vector in high dimensional space; a principle illustrated in form dependent or noise sensitive. Transformations instantiated across the typical auditory processing hierarchy result, however, in input-invariant neural responses that are reduced in dimensionality, that is, which are substantiated in patterns of activation across relatively small subspaces of a given neural population, and which are therefore more easily separated from the neural response patterns underpinning competitor classes  and the belt, for instance, with increasing speech selectivity, or, by the same token, reduced sensitivity to low-level acoustic features including noise, then observed in the parabelt and more distal substrates  is, to our knowledge, as yet unstudied. However, it might be assumed that such auditory\u2013perceptual deficits, which demonstrably characterize the profiles of some children affected by DLD , would pMethod section , recent computational realizations of the manifold geometry view of neural responses provide the tools required to formally quantify both speech representation dimensionality and associated demands on attentional capacity . State-of-the-art deep learning systems have reached human-level accuracy in speech recognition tasks, and work in computational auditory neuroscience has shown that despite the many substantial differences between biological and artificial neural networks, deep learning can provide valuable insight into human auditory processing and speech representation . The untangling of neural response manifolds is achieved in part as a result of these architectural features, in conjunction with the constraint of response sparseness, that is, top-down pressure on the system to align on a single target representation. As a result of these constraints, the relative size of the subspace in which manifolds reside decreases at each level of transformation, facilitating manifold separability  and pooling functions .This report is associated with a Jupyter notebook  that canhttps://www.deeplearningbook.org). In essence, in convolutional layers, these networks pass learned filters over the input, here acoustic spectrograms, in order to identify and summarize through pooling functions invariant features that help solve the task at hand, or, more precisely, that help to reduce output and target discrepancy. For instance, the network might learn that identifying a specific formant pattern captured in a certain distribution of pixels facilitates the discrimination of two phonological competitor words , reducing classification error for these items. We trained and tested two populations of networks (n = 3) on clean and degraded speech data in a spoken word recognition task. Training lasted for ten epochs , determined as the point at which networks exposed to clean input approximated 100% accuracy in initial trial simulations involving a restricted dataset.Simulations involved the ResNet-18 convolutional neural network , implemeCrucially, there was no difference in any architectural parameter affecting processing capacity between network populations . As previously described, the current prevailing view is that fundamental working memory capacity limitations cause speech representation and processing deficits among many children affected by DLD. To reflect this position, a prominent approach in the computational modeling of DLD to date has been to reduce network size, particularly the number of nodes in a network\u2019s hidden layer, explicitly to mimic group differences in working memory capacity e.g., . In contbackward, up, down, digits 0\u20139, and a selection of nouns including bird, cat, and dog: see Networks were trained and tested on a random sample of 5,000 instances of spoken words  from the Speech Commands dataset, which comprises .wav files of different articulations of 35 spoken word types used in the development of keyword recognition systems  throughout the present study.As we noted in our introduction, the existing evidence suggests that the auditory\u2013perceptual deficits seen among some children with DLD are spectral  as a function input type  we were able to analyze both potential variance in performance in a simulated spoken word recognition task and the representation and attentional control factors that underpin that variance. All statistical analyses were conducted in R (SD = 2.21) in the clean spectrogram condition, compared to 55.2% (SD = 1.59) in the degraded spectrogram condition. Networks exposed to spectrograms that had been degraded by the addition of Gaussian noise not only made fewer accurate predictions, but also showed substantially greater uncertainty in the accurate predictions they made (SD = .34), with a mean, maximum predictive probability of .94 (SD = .13). In contrast, networks exposed to degraded input generated accurate predictive distributions with entropy of .53 bits (SD = .59), with a mean maximum predictive probability of .84 (SD = .20).hey made  and 3C. These training and test-phase performance profiles relate directly to the networks\u2019 ability to represent and efficiently retrieve speech information. In In fuzziness, imprecision, or indistinctiveness of these children\u2019s speech representations, and provides a vital counterpart to such accounts . We posit no such functionally discrete system, and instead attribute a substantial proportion of the variance in working memory task performance to the quality of activated long-term speech encodings. Like prior computational work in this general area  directly undermined the networks\u2019 ability to discriminate any given speech representation within an activated cohort, which is a central function of attentional control. This illustrates how irregularities in long-term speech representation may be the cause of ea e.g., , the simnet) but subsequently gazes more regularly at competitor images  than age-matched, typically developing control children  in which the discrepant phoneme is a sound that the child has particular difficulties with  by improving sublexical speech segment representation. Ultimately, given the complex causal basis of DLD emphasized earlier, comprehensive programs of intervention that target multiple aspects of the language system appear essential . This factor may explain the limited success of targeted commercial packages of auditory processing intervention such as  ForWord  in rando ForWord . RelatedIn this report we have presented an alternative to dominant theoretical accounts of DLD centered on deficits in working memory capacity. Our account aims to reposition the proximal origin of many of the behavioral deficits seen in DLD from a shortfall in working memory capacity, to working memory being itself functionally unimpaired but overloaded due to operating on speech representations characterized by atypically high dimensionality and low separability."}
+{"text": "There is growing evidence that the appearance and texture of the skin that is altered during the aging process are considerably enhanced by the accumulation of senescent dermal fibroblasts. These senescent cells magnify aging via an inflammatory, histolytic, and senescence-associated secretory phenotype (SASP). Secreted frizzled-related protein 4 (SFRP4) was previously determined to be expressed in dermal fibroblasts of aging skin, and its increased expression has been shown to promote cellular senescence. However, its role in the SASP remains unknown. We found that SFRP4 was significantly expressed in p16ink4a-positive human skin fibroblasts and that treatment with recombinant SFRP4 promoted SASP and senescence, whereas siRNA knockdown of SFRP4 suppressed SASP. Furthermore, we found that knockdown of SFRP4 in mouse skin ameliorates age-related reduction of subcutaneous adipose tissue, panniculus carnosus muscle layer, and thinning and dispersion of collagen fibers. These findings suggest a potential candidate for the development of new skin rejuvenation therapies that suppress SASP. The skin is the outermost protective barrier of an organism and is composed of two main layers: the epidermis and dermis. The dermis lies beneath the epidermis and plays an important role in the structure and function of the skin . It primThe SASP induces chronic inflammation via chemokines and proinflammatory factors, inhibits proliferation by impairing the release of essential growth factors, and promotes ECM degradation by enhancing the activation of proteolytic enzymes, including matrix-degrading metalloproteinases . Human fink4a functions as a specific marker of senescent cells [in vivo depletion of p16ink4a-positive senescent cells significantly improves organ function in aging organisms by suppressing the SASP, extending both healthy and overall life span [Furthermore, it has been previously shown that SASP-induced fibroblasts can spread to neighboring non-aging fibroblasts . This hant cells , and in ife span , 22. HowPrevious studies have shown through RNA sequencing that secreted frizzled-related protein 4 (SFRP4) mRNA and protein expression levels are significantly upregulated with age in human fibroblasts and that external supplementation of SFRP4 promotes fibroblast senescence . SFRP4 iWe investigated the classical model of skin fibroblasts based on Hayflick\u2019s mitotic limit , the obsink4a-positive senescent cells  . RT-PCR We further tested whether SFRP4 contributes to the induction of senescence by silencing SFRP4 in aging skin fibroblasts and by evaluating senescence markers. Following strong silencing of SFRP4 at 72 h after transfection with SFRP4 siRNA, RT-qPCR analysis revealed that gene expression levels of the SASP factors IL1A (P = 0.0086), IL6 (P = 0.0028), IL8 (P = 0.006), MMP3 (P = 0.0084), TNF-\u03b1 (P = 0.0078) and SFRP4 (P = 0.0000034) were significantly reduced in the SFRP4 siRNA group . ELISA sin vivo inhibition of SFRP4 might inhibit SASP-induced skin aging in mice ). All experiments were performed in accordance with the institutional guidelines on animal experimentation.Normal human dermal fibroblasts (C-12300) were obtained from PromoCell GmbH . The cells were grown in low-glucose Dulbecco\u2019s Modified Eagle Medium  supplemented with 10% fetal bovine serum  and 1% penicillin/streptomycin (Thermo Fisher Scientific). Fibroblasts with proliferative senescence or more than 2 weeks were defined as the absence of cell proliferation. Intracellular SA-\u03b2-gal activity was assessed using the Senescence \u03b2-Galactosidase Staining Kit from Cell Signaling Technology .The cells were incubated with BrdU for 24 h at 37\u00b0 C, then collected, and incubated with BrdU-FITC antibody  for 30 min. A flow cytometer  was used for the analysis, and FlowJo (Ver. 10.2) was used to count the number of positive cells.ink4a antibody  diluted at 1:100 in phosphate-buffered saline (PBS). After washing thrice with PBS, the slides were incubated with Alexa Fluor 488 conjugated goat anti-rabbit antibody and AlexaFluor555 conjugated donkey anti-goat antibody (Thermo Fisher Scientific) diluted at 1:2000 in PBS for 1 h at room temperature. After incubation, the slides were washed thrice with PBS and counterstained for nuclear visualization using ProLong Gold Anti-fade Mountant (Thermo Fisher Scientific) containing 4\u02b9,6-diamidino-2-phenylindole.The cells were placed on glass slides, fixed in acetone for 5 min at room temperature (15\u201325\u00b0 C), and dried completely before staining. Cells were incubated overnight at 4\u00b0 C with an anti-SFRP4 antibody (Thermo Fisher Scientific) and anti-p16Aged human skin fibroblasts (PD55-60) were maintained in acclimated DMEM containing 15 \u03bcg/ml recombinant SFRP4 . The rSFRP4-containing medium was supplemented every 2 days. Samples were analyzed for the induction of senescence after 10 days using the SA-\u03b2-galactosidase assay  and typical senescence markers in a real-time PCR.Lipofectamine 2000  was used to inject SFRP4 siRNA . RNA was collected from the cells after 72 h, and specific gene knockdown was assessed using real-time PCR.Total protein was extracted from the cells and tissues. Tissues were pre-shredded and treated with collagenase. Samples were extracted in lysate buffer: 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.5% Nonidet P40, 0.5% sodium deoxycholate, and phenylmethylsulfonyl fluoride . Western blotting was performed as previously indicated . BrieflyAfter blocking with 3% nonfat milk for 2 h at room temperature, primary antibodies against SFRP4 , p21 , SIRT1 , collagen III , and GAPDH  diluted in blocking solution were incubated overnight at 4\u00b0 C. The next day, the sections were incubated with the following secondary antibodies: donkey anti-goat IgG H&L (HRP) , goat anti-rabbit IgG H&L (HRP) , and goat anti-mouse IgG H&L (HRP)  at 1:1000 dilution for 2 h at 37\u00b0 C. After washing, the immunoreactive protein bands were visualized using an electrochemiluminescence detection kit . Images of the bands were obtained using a chemiluminescence imager . Image analysis was performed using ImageJ software (version 1.53p). Each experiment was repeated thrice.Replicative senescent cell models were prepared as described above, and the medium was changed to serum-free medium containing antibiotics. After 24 h, the conditioned medium was collected and IL-6 and IL-8 expression was quantified using ELISA (Human IL-6 Quantikine ELISA Kit (D6050), Human IL-8 Quantikine ELISA Kit (D8000C), ), according to the manufacturer\u2019s protocol.Male C57BL/6 mice were purchased from the Sankyo Labo Service Corporation, Inc. . Young (15 weeks old) and old (90 weeks old) mice were both used in this study. The complexes were prepared by combining invivofectamine 2.0  and SFRP4 siRNA , according to the manufacturer\u2019s instructions. The SFRP4 siRNA complex, negative siRNA  complex, or control (PBS) were injected at 4 mg/kg into old mice by intravenous injection weekly (1.5 mg/kg in week 1 and 1 mg/kg in weeks 2 and 3). Experiments were performed with n = 5 for each group. One week later, the skin was collected in whole layers, and tissue specimens were fixed by immersion in 4% paraformaldehyde, embedded in paraffin, sectioned, and stained with hematoxylin-eosin and Masson\u2019s trichrome staining. Tissues for RNA recovery were later immersed in RNA  and stored at \u221220\u00b0 C until use.Total RNA was extracted from cells or skin tissue using a monophasic solution of phenol and guanidine isothiocyanate , according to the manufacturer\u2019s instructions. Total RNA was mixed with random primers, reverse transcriptase, and dNTP mixture . The mixture was incubated in a T100TM thermal cycler  at 25\u00b0 C for 5 min, 55\u00b0 C for 10 min, and 80\u00b0 C for 10 min for heat inactivation of reverse transcriptase to generate cDNA.SFRP4 , Il-6 , Il-1a , Il-8 , MMP3  and TNF-\u03b1  (Thermo Fisher Scientific). PCR master mix  was used, according to the manufacturer\u2019s instructions; GAPDH (Hs02786624_g1) and ACTB (Mm02619580_g1) were used as control genes for normalization, according to the manufacturer\u2019s instructions. Gene expression levels in the proliferating cell population were used as the baseline, and fold-change values were determined using the 2\u2212\u0394\u0394Ct method [RT-qPCR was performed using the Applied Biosystems 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). A total of 40 cycles were performed and the fluorescence of each sample was measured at the end of each cycle. The PCR reaction was performed in two major steps: holding the reagents at 95\u00b0 C for 3 s (denaturation) and at 60\u00b0 C for 30 s . In the subsequent melting curve analysis stage, the temperature was increased from 60\u00b0 C to 95\u00b0 C, and fluorescence was measured continuously. Gene expression was analyzed for Statistical analyses were performed using GraphPad Prism  or SPSS 22.0 . Mann\u2013Whitney U test was used to analyze differences between two groups. One-way ANOVA and Tukey\u2019s post hoc test were used to compare differences between three or more groups. Statistical significance was set at P < 0.05.The data that support the findings of this study are available from the corresponding author, K.T., upon reasonable request."}
+{"text": "Fermented wine refers to alcoholic beverages with complex flavor substances directly produced by raw materials (fruit or rice) through microbial fermentation (yeast and bacteria). Its production steps usually include saccharification, fermentation, filtration, sterilization, aging, etc., which is a complicated and time-consuming process. Pulsed electric field (PEF) is a promising non-thermal food processing technology. Researchers have made tremendous progress in the potential application of PEF in the fermented wine industry over the past few years. The objective of this paper is to systematically review the achievements of PEF technology applied to the winemaking and aging process of fermented wine. Research on the application of PEF in fermented wine suggests that PEF treatment has the following advantages: (1) shortening the maceration time of brewing materials; (2) promoting the extraction of main functional components; (3) enhancing the color of fermented wine; (4) inactivating spoilage microorganisms; and (5) accelerating the formation of aroma substances. These are mainly related to PEF-induced electroporation of biomembranes, changes in molecular structure and the occurrence of chemical reactions. In addition, the key points of PEF treatments for fermented wine are discussed and some negative impacts and research directions are proposed. Fermented wine, known as original juice wine, is made of raw materials containing starch and sugar (fruit or rice) through the fermentation of yeast and bacteria to produce complex flavor substances and alcohol, such as red wine, white wine, and rice wine. The production of fermented wine is a complex and time-consuming process, including saccharification, fermentation, filtration, sterilization, and a series of continuous technological procedures. Any operation introduced in the brewing process can affect the physicochemical properties and sensory characteristics of the finished wine , 2. SomePulsed electric field (PEF) is a promising non-thermal food processing technology, which can effectively ensure the good quality of products \u20139. Recent = pulse duration \u00d7 pulse number) are the main processing factors, and increasing the intensity of these two parameters generally improves the processing efficiency of PEF  to food or raw material between two electrodes \u201319. The y of PEF .When an external electric field is applied, the charge accumulation on the membrane surface causes an increase in the transmembrane potential on both sides of the membrane. After the critical value of transmembrane potential is exceeded, the electroporation (reversible or irreversible) will be produced in cell membranes, resulting in a sharp increase in membrane permeability , 22. AniThe efficient extraction of functional components from target tissues or cells is a major problem prior to fermentation. The raw materials are usually pressed and macerated for a long time to extract their active ingredients such as sugar and polyphenols in traditional brewing, thus improving the yield and quality of fermented wine , 33. PEFThe yield of fruit juice is an important index to measure the effect of maceration, and it obviously increases by PEF treatment in the brewing process. After applying 11 kJ/kg  and 22 kJ/kg  of PEF treatments, the yield of grape juice increased by 8.9 and 4.3% compared with 78.0% (w/w) of the untreated sample, respectively . SimilarPhenolic compounds are important components in determining the quality of fermented wine, which influence the color, mouthfeel, and aging ability of wines. The phenolic compounds in winemaking can be divided into flavonoids  and non-flavonoids (mainly hydroxyl cinnamic acid derivatives) . The appThe variation trend of phenolic content was not consistent with different PEF treatment conditions, which is closely related to the variety of raw materials. El Darra et al.  applied In general, according to published research results, it is not difficult to find that PEF treatment increases the content of total phenolic compounds and effectively promotes the dissolution of components, and the main influencing factors are electric field intensity, treatment time, and raw material type. Due to the electroporation effect, there are three main trends in the pretreatment of raw materials by PEF. Firstly, the yield of juice during the maceration stage was increased. Secondly, the extraction efficiency of compounds from the skins and the seed of raw materials was improved, which was manifested by the increase of phenolic substances such as hydroxycinnamic acids, malvidin-3-O-glucoside and (+)-catechin. Finally, the higher applied electric field strength may lead to a decrease in the extraction rate of polyphenols, and there is an optimal value of PEF treatment conditions.The extraction of pigment compounds from the cells of the skin during the maceration step is controlled by diffusion through the cell membranes in the winemaking process . The extThe color of fermented wine is usually an important index to measure its quality. For red wine, its color is generally determined by a mixture of pigment compounds , influenced by various factors such as variety, harvest year, grape ripeness, health, winemaking techniques, age, and storage conditions , 51. TheThe color of the Garnacha must after maceration significantly enhanced with the increase of PEF treatment conditions  . With PEThe purplish tones of young red wine typically develop into more stable brick-like colors of matured wines during storage \u201358. Duri2 is generally used in the traditional winemaking process as an antioxidant and selective antibacterial additive to inhibit the growth of molds in the must during the early stage of wine production and the growth of undesirable bacteria and yeast during the fermentation process, to avoid microbial spoilage in the wine production and storage process  and 3.56 log reductions (Acetobacter pasteurianus) at PEF treatment of 62 kJ/kg , (Acetobacter aceti) and 2.44 log reductions (Metschnikowia pulcherrima). The 95 kJ/kg PEF treatment  managed inactivations between 1.96 log reductions (O. oeni strain O46) and 4.94 log reductions (A. pasteurianus).The inactivation effect is closely related to the species of microorganisms, due to the different sensitivity of microorganisms to PEF treatment. rendilek  found th at 24\u00b0C . The opta et al.  treated 154 \u03bcs), . The inaSaccharomyces cerevisiae were inactivated when PEF treatment with moderate conditions  was applied to Chinese rice wine. Further, Huang et al.  of the cell membrane to occur , 73. NotBrettanomyces bruxellensis is mainly found in barrel-aged red wines with low SO2 content and high pH  after PEF treatment . However, the yeast concentration had returned to the same level as the untreated wine after 2 months. Therefore, moderate PEF treatment conditions which could have induced a sublethal state instead of cell death, are not sufficient to inactivate B. bruxellensis to produce microbiologically stable wines  achieved the expected level of B. bruxellensis inactivation in Cabernet Sauvignon red wine (>6 log reductions)  cultivated with 9% ethanol by PEF treatment  could reach 5.17 log reductions, which was significantly higher than that cultivated without ethanol (3.22 log). According to the report, the combination of eugenol and PEF has a strong synergistic bactericidal effect. The inactivation level of Escherichia coli was increased from 0.39 to 0.96 log when the added eugenol concentration was increased from 0 to 0.64 mg/ml and PEF treatment intensity was 20.0 kV/cm  factors such as alcohol and temperature. For example, u et al. . The ina.0 kV/cm . Besides.0 kV/cm .In summary, PEF used for microbial inactivation can maximize the sterilization effect, inactivate enzymes, protect the nutritional components in wine, and require low processing temperature, a short processing time of several decades microsecond to sterilize. However, it was very difficult to summarize and systematically classify resistance to PEF based on size, shape or membrane structure due to the high number of different microorganisms. The inactivation of microorganisms associated with fermented wine depends on the PEF conditions applied and the characteristics of the microorganisms . The divFreshly fermented wines usually have some disadvantages such as sourness, thin taste, stimulating taste, and many other negative impacts due to the high content of fusel oil, acetal, and free alcohol. Hence, aging is needed to stabilize the wine quality, while various biological and chemical reactions occur during the aging process, resulting in complex aromas and full-bodied mouthfeel . It is rModerate PEF markedly increased the fatty acid content of fermented wine because it enhanced the oxidation of ethanol to aldehydes and further to acids . DiffereIt is noteworthy that the variation trend of different fatty acids after PEF treatment was significantly different. For example, PEF was able to decline the content of tartaric acid in white wine and then decreased more steeply with a further increment of PEF strength. This trend is consistent with the change in bottle storage and may be related to chemical reactions between tartaric acid and other components. High levels of PEF allow the rapid evolution of tartaric acids, forming caffeoyltartaric acid, and \u03c1-coumaroyl tartaric acid . FurtherThe taste characteristics of free amino acids can be divided into several categories, which were MSG-like (Asp and Glu), sweet , and bitter , based on the study of Azevedo et al. . The sweThe content of polyphenols in fermented wine after PEF treatment was increased, such as flavan-3-ols, flavonols, hydroxycinnamic acids, and their derivatives, which is due to the high concentration of precursors in PEF-wine . For exaEsters are the main source of aroma in wine  and PEF Pulsed electric field treatment can reduce the concentration of some irritant volatile substances below the reported odor threshold, potentially having a positive effect on overall wine perception. The fatty acids such as octanoic acid, capric acid, butyric acid, and 3-methylbutyric acid significantly decreased in the presence of PEF  . The conIn previous studies, the potential of PEF in the raw material extraction, sterilization and aging of fermented wine has been extensively explored in laboratory studies, and gradually applied in pilot-scale and semi-industrial production. Nevertheless, further investigations should be carried out for some controversial results about the application of PEF in fermented wine.For commercial application, PEF needs to achieve breakthroughs in the core components of equipment such as high-power supply and intelligent control systems. The focus should be on the applicability of PEF for broad-spectrum processing of different materials such as high conductivity or high viscosity, the uniformity under the action of the physical field, and the controllability of the processing temperature. At the same time, the stability, processing capacity and production efficiency of PEF system should be greatly improved to realize the large-scale application, continuous processing and intelligent control of PEF in the fermented wine industry. Moreover, since the electrode is in direct contact with the wine, the electrochemical reaction at the interface may cause corrosion and migration of the electrode material, resulting in the flavor of the PEF-treated wine being affected. Some researchers even tasted metallic in some PEF-treated samples . TherefoOn the other hand, the principle of accelerated aging of fermented wine after PEF treatment and the optimal application parameters of PEF are still unclear. The complex reactions of multiple compounds occur under the action of PEF, and flavor in wine is affected by the combination of all the compounds, which means that some trace substances may have a unique effect on flavor. It is difficult to capture the effects of trace substances in conventional analysis methods, making it difficult for researchers to detect subtle changes caused by PEF. More importantly, for specific compounds, such as phenols, alcohols, acids, esters, and other aroma components, the effect of PEF is not all positive. The effects of PEF on some desired substances have disparate trends for different fermented wines. However, most current research on PEF mainly focus on the application of pre-maceration and the evolution of phenolic components during red wine aging while other kinds of fermented wine are rarely reported. Furthermore, various aging conditions such as container material and aging temperature, give the wine a kaleidoscope of styles during aging. PEF treatment alone cannot completely achieve the complex aroma and taste of the natural aging process. Therefore, combining PEF technology with other processing technologies such as ultrasound, microwave, and micro-oxygenation to obtain fermented wines that are closer to natural aging may be a direction worth exploring.Research on the applicability of PEF in the fermented wine industry suggests that PEF can not only shorten the maceration time of brewing raw materials and promote the extraction of main functional components, but also enhance the color of fermented wines, inactivate spoilage microorganisms, and accelerate the formation of aroma substances during the aging process. Additionally, appropriate PEF treatment can reduce the levels of some unpleasant substances, especially fusel oil in freshly fermented wines. Furthermore, some laboratory and semi-industrial studies on the application of PEF technology have achieved the expected results. However, it is worth noting that there are still some bottlenecks that need to be solved urgently, such as the development of corrosion-resistant electrodes, high-power supplies, and intelligent control systems, which hinder the large-scale industrial application of PEF technology in the fermented wine industry.YF: writing\u2014original draft, software, formal analysis, and visualization. TY: writing\u2014review and editing and validation. YZ: conceptualization and data curation. AZ: investigation and resources. LG: writing\u2014review and editing and investigation. DN: funding acquisition, supervision, writing\u2014review and editing, resources, and project administration. All authors contributed to the article and approved the submitted version."}
+{"text": "Given that the consequences of treatment decisions for end-stage renal disease (ESRD) patients are long-term and significant, good communication skills are indispensable for health care personnel (HCP) working in nephrology. However, HCP have busy schedules that make participation in face-to-face courses difficult. Thus, online curricula are a rising trend in medical education. This study aims to examine the effectiveness of online ESRD communication skills training (CST) concerning the truth-telling confidence and shared decision-making (SDM) ability of HCP.n\u00a0=\u200945) or the control group (CG) (n\u00a0=\u200946), with the IG participating in ESRD CST and the CG receiving regular in-service training. Truth-telling confidence and SDM ability were measured before (T0), 2\u2009weeks after (T1), and 4\u2009weeks after (T2) the intervention. Group differences over the study period were analyzed by generalized estimating equations.For this single-center, single-blind study, 91 participants (nephrologists and nephrology nurses) were randomly assigned to two groups, the intervention group (IG) , while there were no significant intergroup differences in the confidence levels of participants in the two groups at T0 and T2. Concerning SDM ability, there were no significant intergroup differences at any of the three time points. However, IG participants had high levels of satisfaction  and were willing to recommend ESRD CST to others .IG participants exhibited significantly higher truth-telling confidence at T1 than did CG participants (t\u2009=\u20092.833, ESRD CST enhanced short-term truth-telling confidence, though it is unclear whether this was due to CST content or the online delivery. However, during pandemics, when face-to-face training is unsuitable, online CST is an indispensable tool. Future CST intervention studies should carefully design interactive modules and control for method of instruction.The online version contains supplementary material available at 10.1186/s12909-022-03458-9. According to the United States Renal Data System, the prevalence of end-stage renal disease (ESRD) in Taiwan has been the highest worldwide since 2001 [Because 85% of medical-related lawsuits in the US and numerous patient safety reports are caused by miscommunications , as showUnfortunately, curricula addressing these aspects are not emphasized either in higher education or in-service training , 10. ThuIn the past, CST programs in Taiwan have predominantly been conducted via face-to-face (F2F) lectures, which often discouraged HCP with busy schedules from attending such programs. Participants in past programs were often confronted with suddenly scheduling changes at work and had to leave mid-training, while others complained about a lack of time to attend training sessions. Therefore, incorporating technology to provide online training courses has been a rising trend in medical education . This stThis single-center, single-blind, randomized study employing repeated measures tested the online ESRD CST. The outcomes were the truth-telling confidence and SDM ability of HCP.This study was approved by the Institutional Review Board of the study site (No. 201701611B0). Participants were recruited between December 2017 and November 2018 from the nephrology department of a medical center and teaching hospital in northern Taiwan. Inclusion criteria were HCP who were nephrologists or senior nephrology nurses. Nurses were included in this study because they are a communication bridge between physicians and patients and are the best candidate for the decision coach , 14. TheThe IG participated in both regular in-service training and the ESRD CST, while the CG was only required to participate in the former. The regular in-service training only included basic communication skills training, while the ESRD CST, which was an advanced form of communication training, consisted of 2 units: truth-telling and SDM for ESRD. Each unit contained two parts: an explanation of the theoretical frameworks for truth-telling and SDM  and video demonstrations of communication with patients with ESRD employing the frameworks mentioned above Table\u00a0. The ESRStructured questionnaires were used to measure the truth-telling confidence and SDM ability of HCP participants before the intervention (T0), 2 weeks after the intervention (T1), and 4 weeks after the intervention (T2). In addition, we investigated the satisfaction and ESRD CST recommendation intention of the IG participants. To maintain a single-blind design, participants were unaware of the group assignment, and the PI also asked participants not to discuss the intervention they received during the study process to prevent bias, as all participants worked in the same nephrology department. However, trained research assistants provided IG participants with online links to the ESRD CST via mobile device immediately after they had completed the baseline questionnaires (T0); as such, these research assistants had to be aware of the group assignments of the HCP involved. IG participants were required to complete the ESRD CST individually within 2 weeks of receiving the video links on YouTube. A gift certificate was given as an incentive to increase participants\u2019 willingness to complete the study.Confidence in communication with patients is a 21-item self-reported scale that was used to test the truth-telling confidence of HCP concerning ESRD patients and their family members [ members . Item re members \u201318. In tCombined Outcome Measure for Risk Communication and Treatment Decision-Making Effectiveness (COMRADE) is a 20-item self-reported scale, including two subscales, risk communication and confidence in decisions, that aims to measure patients\u2019 thoughts concerning risk communication and confidence concerning treatment decisions. The PI was authorized by the author of the questionnaire (Dr. Edward) to shift the target population to HCP to measure their ability to apply SDM skills. Item responses are rated on a 5-point Likert scale ranging from 1 (strongly disagree) to 5 (strongly agree) [The y agree) . Higher y agree) . COMRADEy agree) , 20, 23.Satisfaction with and recommendation intention for ESRD CST was a single-item indicator that asked IG participants about their satisfaction and intent to recommend the intervention. Item responses are rated on a 5-point Likert scale ranging from 1 (strongly dissatisfied/would not recommend) to 5 (strongly satisfied/would recommend).P\u00a0<\u2009.05 was considered to be statistically significant; data were analyzed individually. Group differences in baseline data and important outcome variables at each time point were compared by independent t-test and chi-squared test. In addition, to compare group differences in outcome variables over the study period, we used generalized estimating equations (GEEs) to account for within-subject dependency due to repeated measurements and to allow for within-group variation at each time point [IBM SPSS Statistics V24.0  was used for the analysis; p\u00a0<\u2009.05, and effect size\u2009=\u20090.72, the estimated total sample size was 96 (48 per group). We ultimately enrolled 100 HCP (50 per group) in this study.To date, no studies have examined the effectiveness of ESRD CST in improving the abilities of HCP concerning truth-telling and SDM with ESRD patients. By relying on the results of past CST studies regarding cancer truth-telling, the PI was aware that F2F CST has a moderate effect size (Cohen\u2019s d\u2009=\u20090.72) . TherefoParticipants were randomized to the IG and the CG. However, five IG participants were unable to complete the ESRD CST in time, and four CG participants did not complete the posttest questionnaire. Therefore, these nine participants were withdrawn from this study (a 9% attrition rate) and excluded from the analysis Fig.\u00a0. There wThe mean age of participants was 41.6\u2009years (SD\u2009=\u20097.6), and most participants were female 80.2%). The largest proportion comprised registered nurses (64.8%) with bachelor\u2019s degrees (47.3%). Half of the participants had prior experience participating in truth-telling (51.6%) or SDM-related courses (49.5%). No significant group differences were found in participants\u2019 characteristics at baseline    or at any subscale   , which was consistent with the result of this study concerning the short-term (2 weeks) effectiveness of the truth-telling confidence of HCP. However, since Fujimori et al. did not assess the long-term effectiveness of CST in increasing participants\u2019 communication confidence [This study found that the ESRD CST had a significant short-term effectiveness in enhancing the truth-telling confidence of HCP. Fujimori et al. conducted a study of 30 oncologists to test the effectiveness of a two-day CST program in improving participants\u2019 communication confidence 2 weeks after the CST workshop. Their results showed that IG participants increased their level of confidence significantly more than did CG participants  CST workshop concerning increasing physicians\u2019 and nurses\u2019 truth-telling ability and found that participants\u2019 confidence levels 3 months after the CST workshop were significantly higher than the levels recorded before and immediately after the CST workshop, which demonstrated the long-term effectiveness of CST , 18. HowEven though the ESRD CST showed short-term effectiveness concerning truth-telling confidence, the study design cannot distinguish between the impact of additional CST content and the impact of online delivery. However, our previous studies which delivered CST F2F revealed a moderate to high positive effect size of CST (Cohen\u2019s d\u2009=\u20090.8\u20130.99) on confidence in communication or perceptions of truth-telling among physicians , 27, nurIn addition, the limited training time (30\u2009minutes) might also be a reason for such short-term effectiveness. Scholars have suggested that CST should be followed by posttraining consolidation workshops to maximize effectiveness and to encourage participants to apply what they have learned to daily clinical practice \u201341. HoweThere were no significant group differences in the COMRADE scores of participants 2 weeks and 4 weeks after the intervention. In contrast to past studies that utilized the COMRADE questionnaire based on patients\u2019 self-reports , 42\u201344, Several limitations must be considered when interpreting the study results. First, using self-report measures as our main outcome was a major limitation. This approach may entail the risk of self-recall bias. In addition, self-reported measures cannot assess behavioral changes, which may limit the generalizability of this study. Although direct observation in a real-life clinical setting is an objective method for evaluating the effectiveness of the CST concerning behavioral change, this approach may also face certain limitations . A revieThis study did not verify the effectiveness of CST on SDM ability among HCPs. Still, because present law in Taiwan does not prevent HCPs from exploring patients\u2019 concerns about and preferences for treatments, all HCPs need SDM education. As a guide for SDM CST, we recommend both the three-talk model and, especially with nurse participants, the Ottawa Decision Support Framework (ODSF). The ODSF emphasizes team effort and recommends a decision coach during the SDM deliberation process , 14. NurThe test of this ESRD CST led to a merely preliminary result. ESRD CST enhanced short-term truth-telling confidence, though it is unclear whether this was due to CST content or the online learning method. Therefore, future studies verifying the effectiveness of online CST must carefully design interactive modules, control for delivery method, and incorporate both subjective and objective evaluations.Additional file 1. IRB Approval."}
+{"text": "Health and mental health interventions, such as psychotherapy and exercise programs, delivered via information and communication technology (ICT) may improve service access. However, adjustment among older people and in synchronous group interventions is more challenging. Technology affordance concerns the possibilities engendered by technology for various users and purposes and can help understand challenges in ICT-delivered groups and identify possible solutions.Adopting a multiple triangulation approach, we observed ICT-delivered groups of acceptance and commitment therapy and exercise for older people with depressive symptoms, conducted focus groups with older people who had received group psychotherapy with or without an exercise component, and obtained clinical notes from interventionists. We conducted a thematic analysis of the observation notes, focus group transcriptions, and clinical notes.Four focus groups were conducted with 22 participants . We identified 3 challenges: (1) seeing\u2013be seen dilemma, (2) speaking\u2013hearing dilemma, and (3) blurred therapy\u2013home boundary, and 2 solutions: (1) maneuvering layouts and collaborative tools, and (2) cross-platform mediated strategies. Participants struggled to observe the interventionist while simultaneously demonstrating their posture in front of a camera. Remaining silent and moderated turn-taking allowed for clearer hearing but limited interactions. Interruptions from the background environment and intersections of family living spaces disrupted audio-visual communication and jeopardized the sense of security. As a solution, interventionists maneuvered layouts and collaborative tools on teleconferencing applications to achieve intervention goals and provided support through different media.The identified challenges and potential solutions can be understood from interactivity, portability, temporality, persistence, and multimediality. Technology affordance can guide ICT-delivered group design by matching the affordance of various technologies and communication media with the characteristics of the intervention and users to enhance efficacy and avoid an unnecessary digital divide. Translational Significance: Delivering health and mental health interventions via information and communication technology is challenging among older people and in synchronous group format. By focusing on the functional and relational elements of the user-technology system, we identified unique and common challenges across intervention modalities, such as seeing\u2013be seen dilemma and speaking\u2013hearing dilemma, and potential solutions, such as cross-platform strategies. Interventionists can match the affordances of various information and communication technologies with intervention and participants\u2019 characteristics to improve intervention efficacy and group cohesion while avoiding an unnecessary digital divide.Information and communication technology (ICT) has been employed in delivering health and mental health interventions, such as psychotherapy and exercise programs, to mitigate barriers and improve access to services . During With roots in perceptual psychology, Gibson theorized \u201caffordance\u201d as the potential options of action or purpose made available to or easier for a subject by another item. This initial conceptualization emphasized that affordances are both functional  and relational  . ObjectsResearch on ICT-delivered groups is limited, particularly those that aimed at older people who are likely affected by the digital divide . ICT-delRecently, Yeshua-Katz and colleagues identified 4 technology affordances relevant to digital interventions: temporality, interactivity, multimediality, and portability, and recommended combining and matching affordances of different media to address intervention goals . These aOlder people participating in a videoconferencing-delivered exercise group felt a sense of belonging and familiarity with the group . They alThis study explored the role of technology affordance in therapeutic interactions in ICT-delivered group psychotherapy with and without a physical exercise component. Particularly, it examined how ICTs afford and constrain group cohesion and therapeutic interactions. It would deepen our understanding of technology affordance in the relational process in digital group among other tasks related to intervention performance, such as logistic management and technical support. This study adopted a multiple triangulation approach to data sources, investigators, and methods, to provide a holistic picture and enhance the findings\u2019 credibility and validity .We adopted multiple sites, multiple investigators, and multiple methods design. Qualitative methods employed in the study included on-site observation, focus groups, and clinical notes. All voice recordings and qualitative data were stored in computers accessible only to the research team. This study was approved by the Human Research Ethics Committee of the University of Hong Kong (references: EA2003001A and EA200132).In response to the suspension of face-to-face social services for older people during the COVID-19 pandemic , partnerF.H.C.W. conducted on-site observations at 2 ACTs with exercise groups, attended the Zoom sessions and took research notes while observing the interactions in the session. F.H.C.W. was introduced to the participants but did not interact with them.Purposive sampling was applied to identify focus group participants. We asked social workers to invite older people who participated in online groups to join our focus groups to share their experiences. We included older people who joined but could not complete the group entirely online to account for the diverse experience in the population. They were service users of a community-based holistic mental health care program for older people at risk of or with mild-to-moderate depressive symptoms (JC JoyAge) . InclusiWith participants\u2019 consent, we obtained their demographic information from social workers, including age, gender , marital status, education level, living arrangements, housing conditions, and physical impairment. An interview guide was developed to ascertain participants\u2019 experiences of attending these ICT-enhanced intervention groups see . D.K.Y.LTwo clinical psychologists and one physiologist who provided the ACT with exercise, and one clinical psychologist who provided the CBT-I were invited to share their anonymized clinical notes.Thematic analysis was used to analyze the data . D.K.Y.LD.K.Y.L., E.L.Y.W., L.S., and M.C. have psychology training backgrounds, and F.H.C.W. is trained in journalism and communications. L.S. and M.S. also have experience delivering teleconference training programs and interventions to older people. We noted our a priori assumptions about ICT-delivered interventions to aid reflexibility in analysis . We assun = 11) and 2 CBT-I groups (n = 11) conducted between March and August 2020. Four focus groups were conducted with 22 older people who participated in 2 ACT with exercise groups  the seeing\u2013be seen dilemma, (2) the speaking\u2013hearing dilemma, and (3) blurred therapy\u2013home boundary, and 2 solutions: (1) maneuvering layouts and collaborative tools, and (2) cross-platform mediated strategies .The seeing\u2013be seen dilemma occurred in the exercise groups and depicted participants\u2019 struggle between observing the interventionist\u2019s on-screen instructions and presenting their full-body movements to the interventionist for guidance in front of the camera. The narrower field of view and uncontrollable camera from the interventionist created a different communication experience for participants. Unlike in-person interactions, the camera\u2019s field of view was narrower and fixed, excluding anything outside the camera\u2019s field of view from participants.When the interventionist demonstrated full-body exercises and parts of her body were not in view of the camera, some participants tilted their heads trying to peek at what was outside the camera\u2019s field of view as if they were in an in-person session. Some participants constantly adjusted their position, switching between sitting closer and further away from the device. One participant reflected that the display on his phone was too small to see the interventionist when he moved away from the camera to show the interventionist his movements. (Observation notes)When participants needed to use the same technology to present themselves to others with such a novel experience in mind, they tended to move further away from the camera so that the camera could capture their whole body. However, some struggled to capture their entire body because of environmental limitations, such as being in a small room. Some who sat further from the camera found it challenging to observe what the interventionist was doing because her image on the screen appeared very tiny.To be honest, I think she [the interventionist] could only see my upper body, but not the movement in my lower body. The device can only capture certain parts of the [visual] field\u2014like if I put it here, it captures my upper body, so I moved further and further away from the camera, but she still couldn\u2019t see my lower body. The camera\u2019s limited field of view made it difficult for the interventionist to determine whether the participants were doing the exercise correctly because some body parts were out of sight. The interventionist used more oral instructions to ensure participants carried out the exercise as correctly as possible.The angle of the camera depends on the participant\u2019s surroundings, and they may not be able to show their whole body or the exercise . This can be resolved by explicitly telling the participants which muscles they\u2019re supposed to be feeling or working on and asking them to let me know if they felt more pain or have any questions. Since we\u2019re also sitting further back to demonstrate the exercise better, we must look tiny on their screen. To ensure we\u2019re all doing the same exercise at the same time, we need to describe the exercise and clearly explain each step. (Interventionist C)In both psychological and exercise groups, simultaneously hearing others clearly and being heard also posed a dilemma. While participants are usually encouraged to share in a therapeutic group, overlapping voices could disrupt participants\u2019 ability to hear the interventionists or other group members. The technology affords a key solution to avoiding overlapping sounds through the \u201cMute all\u201d function and the interventionist\u2019s ability to moderate the interaction.When two or more people were speaking simultaneously, Zoom spontaneously suppressed all but one voice. This interrupted the flow of conversation. Participants were then all muted and the interventionist invited them to speak in turn. The interactions were usually limited to between the interventionist and a certain participant at a time. Fewer interactions among the participants were observed. (Observation notes)Although participants agreed that being put on mute allowed them to listen to the interventionist or a particular group member clearly, they found it difficult to get to know other participants because of insufficient opportunities or time to talk to each other. Also, the interventionist might not be able to notice and address their concerns immediately. Some participants preferred face-to-face sessions because they allowed more flexibility in communicating with each other.I think [the interventionists] can mute us all when they are talking. Then we can listen to them clearly without disruption from other people\u2019s voices. If we have something to say, we can raise our hands. This will be the best. Sometimes when we couldn\u2019t see or hear [the interventionist], we raised our hand for help\u2026 but sometimes she couldn\u2019t see me since there were many of us\u2026 I could only keep raising my hand until she noticed me. It\u2019s not easy for her to pay attention to so many of us. It will be better face-to-face. At least we can interact with each other, and if you don\u2019t know how to do something, the person sitting next to you can tell you... This can\u2019t happen online... The interventionist spoke to us in turn, she invited someone to answer or speak. Despite greater control over interactions with participants, the \u201cmute all\u201d function was believed to have affected the sense of engagement in the group because of the lack of interaction between participants.Because participants could not provide immediate feedback, the interventionists needed to check their status constantly to provide any information about adjusting the intervention.Although the whole group cheered and clapped for a particular member, he or she could only hear the sounds from me since everyone else was muted. This has somewhat affected the sense of group cohesion. (Interventionist A)Apart from proactively checking with the participants, the regular breaks scheduled throughout the session allowed them to give feedback and raise questions about the movements. It was helpful to know each participant\u2019s sensation as they were performing the exercise so that I could provide specific instructions or modify the movements to ensure that they would not injure themselves. (Interventionist C)An ICT-delivered intervention joined 2 venues with different natures\u2014the therapy room and participants\u2019 homes. A therapy group can be considered a \u201cprivate sphere\u201d in which participation is restricted to permitted persons. However, study participants tended to join the intervention group in living spaces shared with other family members because they lacked sufficient privacy, a very common phenomenon in Hong Kong. Therefore, the home setting introduced a \u201cpublic sphere\u201d in the therapy. The camera transmitted the picture and sound of the public sphere into the private sphere and, at the same time, conversely, broadcast the sight and sound from the private sphere to the public sphere. The activities undertaken in the 2 spheres are usually different, but the online session encouraged the blurring of this boundary. The challenge then occurs when participants undertake activities at home that are normally considered out of place, for example, when interruptions from the background environment disrupted audio-visual communication.When participants unmuted themselves to speak, there were noises from the background, such as television and conversations among other family members. It was difficult for other people to hear what the participant said. (Observation notes)Intersections of family living spaces affected participants\u2019 ability to concentrate on the interventions. Against the background of studying and working from home during the COVID-19 pandemic, family members were more likely to stay at home all day. The presence of family members may also jeopardize participants\u2019 sense of security, particularly when the discussion was related to family issues.There were three of us at home. I was in my room and they were in the living room. We sat separately from each other. Since my grandchildren attended online classes from home, all three of us were in teleconferencing and it can be noisy sometimes. When someone at home asks you for help to get something, you will walk away to do so and miss out on what the interventionist was saying. You\u2019re less engaged. Sometimes you just walk away to grab a cup of coffee during the session. I would whisper; I don\u2019t want them [family members] to hear me. My son was at home, and I kept my voice down so that he wouldn\u2019t hear me. Nonetheless, one participant expressed that the familiarity of her surroundings allowed her to speak her mind more easily and remain engaged in the group, given that no other people were around. Another participant was a carer for his wife with dementia and appreciated the chance to join the intervention online, enabling him to care for his wife and his own mental well-being simultaneously.It\u2019s probably because when you\u2019re at home, and sometimes family members are not around, you feel more relaxed and can open up. On the contrary, the face-to-face environment [in the community center] is unfamiliar to you. Staying at home seems to be better since you will be less affected [by the relative unfamiliarity of the surroundings]. Interventionists noticed that some participants did not or were unable to use earphones, which raised concerns about being overheard by participants\u2019 family members and reduced their sense of security. In a group setting, this also risks exposing other participants\u2019 privacy.Family members could overhear the discussion in the group and sometimes interrupted participants\u2019 sharing. They attempted to clarify or explain the issues the participants raised. This affected participants\u2019 willingness and comfort to share their thoughts. Participants were encouraged to join the group from somewhere where they could speak freely. We may arrange for them to join the group at the community center. (Interventionist B)The interventionists changed the layout in Zoom according to the intervention activities. The share screen, spotlight video, and gallery view are some features in Zoom that interventionists commonly employed in their sessions. During screen sharing and video spotlighting, the shared content and the spotlighted video are on the larger display for all participants, respectively. On the other hand, the gallery view feature allows participants to see thumbnail displays of all participants in a grid pattern.The interventionists used the share screen function to show the PowerPoint slides and worksheets to the participants. They also spotlighted themselves when demonstrating in-class or homework exercises, such as progressive muscle relaxation and physical activity, to make sure participants could see them in a larger display. They stopped sharing the screen or removed the spotlight after the demonstration and reminded participants to switch to gallery view if they had not done so so that they could all see each other. (Observation notes)Participants appreciated being able to see each others\u2019 faces without masks during the pandemic, which helped them form connectedness with each other. They also found the display name on Zoom helpful in getting to know each other.Every time the interventionist asked a question, she invited one of us to answer first and then asked that person to invite the next person to answer by his or her name. You had to look at their [display] names to choose the next person, and gradually you could remember their names. The interventionists also reduced activities that required physical interactions, such as chair sculpture in ACT, which requires participants to put their chairs on top of other participants\u2019 chairs. They introduced activities through Zoom that encouraged instantaneous interactions. For example, by enabling the annotation functions, such as the screen sharing whiteboard, participants could draw on the screen together simultaneously, which all participants could see.We tried different activities with the screen sharing to keep participants engaged, such as matching the questions and answers shown in two columns, or showing a photo in PowerPoint and asking participants to circle the wrong food items to eat before sleeping, etc. (Interventionist D)Interventionists also adopted cross-platform mediated strategies to resolve the challenges by communicating and delivering supplementary materials through different media, including video streaming and printed materials.The interventionists sent video links and audio files to the WhatsApp group during the session. They demonstrated how to access the videos and recordings on Zoom by holding the mobile phone closer to the camera. They encouraged participants to follow the instructions in the videos and recordings at home. (Observation notes)Participants appreciated these supplementary materials so they could revisit and familiarize themselves with the exercise movements outside class. Therefore, they could sit further away from the camera and focus on demonstrating their movements to the interventionist for feedback. They also suggested using printed supplementary materials so they were more familiar with printed forms of materials, and print copies would not be affected by access to the internet.We were given a link [that shows a video of the exercises taught in class], so we can watch it over and over again to make sure we did the movement correctly. The interventionist demonstrated how the relaxation exercise is done in the video, guiding us on how to breathe and relax. Printed instructions would help\u2026 like a book that includes pictures of a person demonstrating the movements with labels of \u201cleft leg\u201d and \u201cright leg\u201d on the side pointing to the person. Participants also found printed guidelines and in-person training on teleconferencing technology provided by social workers ahead of the online groups helpful in navigating the devices and software.[The printed guidelines] allow us to follow paper instructions for reading certain pages at home...The social worker was great and photocopied [the printed guidelines], which included first steps like the pages to look at and which [application] button to press. There was a small book with a few pages photocopied for us, and she would tell us to turn to a specific page or press here and there [on the application] to turn on the device.The interventionists acknowledged the need to provide technical training before the ICT-delivered interventions and considered it an opportunity to build rapport with participants individually. They also noticed that some participants were empowered through learning how to use ICT so they could become skilled at technology or acquire a novel skill.For Zoom groups where participants don\u2019t know the therapist before the group, it\u2019s a good idea to arrange a \u2018pre-group phone call or Zoom call\u2019 individually to get to know each participant better first. It\u2019s also an opportunity for them to try and sort out any technical difficulties in advance. (Interventionist A)In the first Zoom session, some participants were visibly anxious and explicitly expressed their worries about managing the hardware  or software . However, with more practice, some participants were able to master the new skill which may have helped them de-stigmatize their prior beliefs that \u201cI can\u2019t learn anything new when I\u2019m old\u201d. (Interventionist D)This study explored the challenges of using ICT in delivering group psychotherapy with and without exercise components using a multiple triangulation research approach and solutions to them. From a technology affordance perspective, we identified 3 challenges and 2 potential solutions that were synthesized across different modalities in complex intervention settings and for older users. Five technology affordances\u2014interactivity, portability, temporality, persistence, and multimediality appear to be relevant to therapeutic interactions in digital intervention, largely echoing the findings from Yeshua et al. . Table 3While the screen-camera dilemma, the dilemma in hearing, and the blurred therapy\u2013home boundary arose from innate characteristics of relaying interventions on a virtual platform, the particular intervention content of the psychotherapy and exercise program meant that they have a unique relational affordance. Portability is a related technology affordance, referring to the ability to transport device and use it regardless of the user\u2019s location . The scr2 and the median per capita floor area was 16 m2 (On the other hand, the blurred therapy\u2013home boundary appeared to be more disruptive in psychological interventions. Restricted living space in Hong Kong meant that participants\u2019 therapy-home setting was more likely to intersect with family members\u2019 private space. The median floor area of accommodation of domestic households was 40 mas 16 m2 . Particias 16 m2 . If partSynchronous and asynchronous technologies constitute dissimilar affordances, which should be utilized by therapists to facilitate interventions. Findings suggest that, while Zoom and WhatsApp both allow multiple users to communicate, their differences in functional features shape distinct power relationships and engagement mechanisms on the platforms. Videoconferencing apps\u2019 functionality affords synchronous interactions, rapport building, and the introduction of information using different layouts. According to theories of social presence, live visual and audio cues in videoconferencing enhance feelings of connectedness and support in a group setting ,23. FurtNonetheless, technologies for asynchronous communication may compensate by sustaining uninterrupted conversations with more equal power between interventionists and participants. Two related technology affordances are temporality and persistence. Temporality refers to how digital interaction over time is experienced by individual users , and perOnline interventions have emerged as a solution to the challenges brought by the COVID-19 pandemic, encouraging therapists to develop knowledge that can fundamentally change the mode of future intervention delivery. ICT-delivered intervention can provide greater accessibility to social care for individuals who cannot attend in-person sessions. Bearing in mind the blurred therapy\u2013home boundary, therapists could work with participants to optimize their physical environment to reduce distractions and preserve privacy for themselves and other participants. Interventionists could set platform-specific rules to avoid overlapping voices and encourage smoother interactions among participants, such as raising hands to speak and asking participants to invite the next person to speak. Before the interventions, interventionists could arrange individual ICT-based or in-person meetings with participants to build rapport and get to know their digital literacy, thus ensuring adequate support for operating ICT, such as printed materials or in-person training. Interventionists should familiarize themselves with the affordance of different ICTs so that they can modify intervention activities accordingly. For example, screen sharing and whiteboard functions in Zoom enabling participants to add annotations may be useful to engage multiple participants and enhance group cohesion. Interventionists could also consider employing multiple platforms to achieve intervention goals. In exercise interventions, for instance, sharing supplementary material such as videos of exercise via instant messaging apps or print material may be particularly helpful for participants to revisit the exercise without time restriction and the camera\u2019s limited view of the field.This study has several limitations. Participants included in this study might have higher digital literacy and motivation given their willingness to join in psychosocial interventions using a delivery mode different from usual practice. Recent census survey revealed that 68% of older people in Hong Kong own a smartphone and 49% of them know how to use a personal computer. They reported mainly using the Internet for communication, information searching, and online entertainment . While dMoreover, the study focused on group therapy, Zoom, and WhatsApp. Although some challenges and strategies identified in the study may be applicable across intervention modalities and ICTs, technology affordance is relational and functional-related. Future studies can explore the unique technology affordances of other applications and intervention modalities, such as psychoeducation that involves more information provision but less personal sharing, to identify how applications can be best adapted to improve older people\u2019s experience of different types of interventions.The challenges and possibilities synthesized across group psychotherapy and exercise programs in complex intervention settings for older users can be understood from technology affordance perspective: interactivity, portability, temporality, persistence, and multimediality. The dilemmas of seeing\u2013be seen and blurred therapy\u2013home boundary were more prominent in the exercise program and psychotherapy, respectively, whereas the speaking\u2013hearing dilemma affected both intervention modalities. These challenges originated in the inherent qualities of conveying group interventions on a virtual platform, influencing therapeutic interactions and group cohesion. Interventionists maneuvered layouts and collaborative tools in teleconferencing media according to intervention goals and used cross-platform strategies to address these. Technology affordance can be used to guide intervention development. Matching the affordances of various ICTs with the characteristics of the intervention and participants can improve intervention efficacy and avoid an unnecessary digital divide.igad063_suppl_Supplementary_MaterialClick here for additional data file."}
+{"text": "Medication nonadherence is a major public health problem. Identification of patients who are likely to be and not be adherent can guide targeted interventions and improve the design of comparative-effectiveness studies.To evaluate multiple measures of patient previous medication adherence in light of predicting future statin adherence in a large U.S. administrative claims database.We identified a cohort of patients newly initiating statins and measured their previous adherence to other chronic preventive medications during a 365-day baseline period, using metrics such as proportion of days covered (PDC), lack of second fills, and number of dispensations. We measured adherence to statins during the year after initiation, defining high adherence as PDC \u2265 80%. We built logistic regression models from different combinations of baseline variables and previous adherence measures to predict high adherence in a random 50% sample and tested their discrimination using concordance statistics (c-statistics) in the other 50%. We also assessed the association between previous adherence and subsequent statin high adherence by fitting a modified Poisson model from all relevant covariates plus previous mean PDC categorized as < 25%, 25%-79%, and \u2265 80%.Among 89,490 statin initiators identified, a prediction model including only demographic variables had a c-statistic of 0.578 (95% CI = 0.573-0.584). A model combining information on patient comorbidities, health care services utilization, and medication use resulted in a c-statistic of 0.665 (95% CI = 0.659-0.670). Models with each of the previous medication adherence measures as the only explanatory variable yielded c-statistics ranging between 0.533 (95% CI = 0.529-0.537) for lack of second fill and 0.666 (95% CI = 0.661-0.671) for maximum PDC. Adding mean PDC to the combined model yielded a c-statistic of 0.695 (95% CI = 0.690-0.700). Given a sensitivity of 75%, the predictor improved the specificity from 47.7% to 53.6%. Patients with previous mean PDC < 25% were half as likely to show high adherence to statins compared with those with previous mean PDC \u2265 80% .Including measures of previous medication adherence yields better prediction of future statin adherence than usual baseline clinical measures that are typically used in claims-based studies. What is already known about this subjectVarious effective medication adherence interventions exist; however, it is critical to identify patients who are at risk of nonadherence to maximize the efficiency of the interventions.Many attempts to predict medication adherence using routinely collected electronic health care data have had limited predictive performance.What this study addsMeasures of previous adherence to chronic medications were relatively strong predictors of future adherence to newly initiated statins compared with other claims-based measures.Addition of previous adherence measures to usual claims-based adherence predictors modestly improved the performance of the models for predicting future adherence.1 On average, up to 50% of patients do not adhere to their prescribed therapies.3 Less than half of patients persist with cardiovascular drugs for a year following a heart attack,4 despite compelling evidence of the clinical benefits of these life-saving treatments.5 Poor adherence has substantial clinical and economic consequences.6 In the United States, suboptimal adherence accounts for 33%-69% of medication-related hospital admissions and $100 billion of potentially avoidable health spending each year.1Medication nonadherence is a major public health problem.9 Even small improvements in adherence to evidence-based treatment at the population level can improve clinical outcomes for patients.11 A key challenge in maximizing the benefit and value of certain interventions is identifying populations of patients who are expected to have low adherence. Although technologic advances have enabled real-time adherence monitoring, identification of patients who are likely to adhere or not adhere to treatment at the time of treatment initiation would enable early intervention at the first encounter.Various effective medication adherence interventions exist.13 Although previously developed medication adherence algorithms have had limited predictive performance, some evidence suggests that using measures of previous adherence to other chronically used medications may be a strong predictor of future adherence to newly initiated medication.17 However, it is not known how best to measure and use previous medication adherence to predict adherence to a newly initiated drug.Many attempts have been made to predict medication adherence using routinely collected health care data.By focusing on statins, one of the most frequently prescribed drug classes in the United States, we sought to systematically evaluate different metrics and chronic medication classes for measuring previous adherence and to assess the added value of these measures of previous adherence to adherence prediction using administrative claims data.18 The data undergo quality checks by OptumInsight and Sentinel. The use of the data was approved by the institutional review board of Brigham and Women's Hospital, Boston, Massachusetts.We used data from Optum Clinformatics Data Mart, which includes medical and pharmacy claims data ; demographic data; and plan information for patients with commercial insurance plans across the United States administered by a large national insurer. The database has been used extensively for observational research and is part of the U.S. Food and Drug Administration\u2019s Sentinel System.We identified patients aged 18 years or older who initiated a statin between July 1, 2010, and December 31, 2011. Initiation of a statin was defined as a new statin dispensation following a 365-day baseline period in which patients were required to have continuous enrollment in the health plan and no statin dispensation. The day of the first statin dispensation was defined as the cohort entry date. For patients with multiple eligible cohort entries, only the first was included.The primary analysis focused on patients who were continuously enrolled in the plan for the 365 days following statin initiation and who had at least 1 dispensation for a medication used for measuring previous adherence in the 365-day baseline period .21 We chose PDC as the measure for adherence as it is 1 of the most frequently used adherence measure in administrative claims data.The outcome of interest was adherence to statins in the 365 days following the first dispensation. We measured adherence using proportion of days covered (PDC), defined as the total number of days covered by the dispensed medication supplies in the 365-day follow-up divided by 365.Demographic variables included age and sex. We used claims with services dates occurring during each patient\u2019s 365-day baseline period before cohort entry to define an extensive list of variables as potential predictors. These included comorbidities, medication use, and health service utilization measures .22We also assessed measures of patient medication burden by counting the number of dispensations of all drugs and the number of unique drug types dispensed during the baseline period; evidence for medication refill synchronization, which indicates patients filling multiple prescriptions on the same day; and the number of concurrently used medications on the cohort entry date.Finally, we assessed proxies of patient medication cost burden, including plan benefit type, total copayment for all drugs during baseline period, and index statin copayment. These variables formed the set of basic potential predictors.We measured patient adherence to the following types of medications using dispensations in the 365-day baseline period: angiotensin-converting enzyme (ACE) inhibitors or angiotensin II receptor blockers (ARBs), renin inhibitors, beta blockers, calcium channel blockers, thiazide diuretics, loop diuretics, potassium-sparing diuretics, other antihypertensives, oral anticoagulants, digoxin, antianginal agents, selective serotonin reuptake inhibitors (SSRIs), conventional antipsychotics, atypical antipsychotics, other lipid-lowering agents, antidiabetics, osteoporosis drugs, thyroid hormone, nonbiologic disease-modifying antirheumatic drugs, antiparkinson agents, anti-convulsants, and antiglaucoma agents. We aimed to include a broad range of medications to balance including as many patients as possible in the analysis cohort while focusing on drugs that are intended to treat chronic conditions.We assessed previous adherence using 7 measures of prescription coverage, drug discontinuation, and dispensation counts identified from the literature . MeasureWe tabulated the characteristics of the cohort based on its demographics, previous medication use, comorbidities, health services utilizations, medication burden, and financial burden.We first divided the cohort into a training cohort and a testing cohort in a 1:1 ratio. We selected predictors of future statin PDCs in the training cohort from among the list of covariates other than measures of previous adherence using the least absolute shrinkage and selection operator (lasso). We fit lasso logistic regression models with a binary outcome of good adherence defined as PDC \u2265 80%, with a shrinkage parameter lambda chosen to minimize the models\u2019 Bayesian information criterion. Variables with nonzero beta coefficients were selected as predictors of the statin adherence for subsequent models. Appendix B contains the full list of variables selected via the lasso procedure (available in online article).We then developed multivariable logistic regression models predicting PDC \u2265 80% in the training cohort by including various groups of the lasso-selected variables. For example, we built a model including only demographic characteristics and another model including only comorbidities. Next, we built a model that included all variables selected by lasso from the set of basic predictors. We also built separate univariable logistic regression models in which each of the previous medication measures was included as the only explanatory variable. We then developed models that included all of the variables selected by lasso from the basic set of predictors plus the best-performing measures of previous adherence.Finally, we developed a separate model using only data available at the pharmacy at the time of prescription dispensation  to examine the performance of adherence prediction if medical data are not available.Each model created in the training cohort was applied to the testing cohort to predict each patient\u2019s probability of having a 1-year PDC \u2265 80% for the newly initiated statin. The predicted probabilities were used to calculate c-statistics to compare discrimination across models. We assessed the calibration of the models using calibration plots.23 with a binary dependent variable of high adherence (PDC \u2265 80%). We categorized patients into 3 previous adherence groups based on their mean PDC during the baseline period: high previous adherence (mean PDC \u2265 80%), moderate previous adherence (25% \u2264 mean PDC < 80%), and low previous adherence (mean PDC < 25%). We compared the probability of having high adherence to statins across previous adherence groups, adjusting for all previously selected predictors via lasso regression.To assess the strength of association between previous adherence and subsequent statin adherence, we fit a modified Poisson regression model using sandwich variance estimators,To assess the performance of the prediction models in a typical patient population, we conducted an expanded cohort analysis that added patients excluded from the primary study cohort because they had no dispensation of drugs used for previous adherence measurement in the baseline period. Because measures of previous adherence could not be calculated for these patients, we expected that model performance would be lower but that the analysis population would better reflect real-world patient cohorts. In this cohort, we applied the model that included all lasso-selected baseline predictors + mean PDC, since this was 1 of the best performing models in the primary analysis and required only 1 measure of previous adherence. We replaced the missing previous adherence values with the median observed previous adherence measurement from patients in the training cohort. We estimated c-statistics to assess the performance of the model in this expanded cohort.To examine the performance of individual drug classes for previous adherence measurement, we conducted 4 subgroup analyses in which we restricted the training cohort to patients who used specific classes of medications in the baseline period: (1) antihypertensives, (2) antidiabetics, (3) lipid-lowering agents other than statins, and (4) SSRIs. These medication classes were selected because they are commonly used and are intended to be used chronically.We then assessed the performance of each of the 4 models in the following 3 cohorts: (1) those in the primary analysis cohort who had nonmissing previous adherence values for the drug class of interest; (2) the entire primary cohort ; and (3) the expanded cohort described earlier in this article.As a separate sensitivity analysis, we developed and assessed the performance of the adherence prediction models in a cohort including the patients originally excluded for having less than 365 days of follow-up after statin initiation. Statin adherence during follow-up was measured by PDC, accounting for variable length of follow-up. Patients were followed until they were censored or until 365 days, whichever came first, and PDC was calculated using a denominator defined as the length of the varying follow-up period and a numerator defined as the number of denominator days on which drugs were available during that period. We repeated the modeling process as described for the primary cohort in the 50% randomly selected training cohort and assessed the discrimination of the model in the other 50%.We identified 243,051 statin initiators in the database between July 1, 2010, and December 31, 2011; 165,620 had complete follow-up during the 365 days after cohort entry. The primary analysis cohort comprised 89,490 patients  who had at least 1 dispensation for a medication used for previous adherence measurement. The average age of patients in the analysis cohort was 54.6 years (standard deviation [SD] 10.2), and 54.5% were female. The most common comorbidities were hypertension (56.1%), diabetes (26.0%), depression (14.6%), and cancer (13.4%). Frequently dispensed medications during the baseline period included ACE inhibitors (34.7%), beta blockers (25.3%), antidiabetics (25.2%), nonsteroidal anti-inflammatory drugs (22.8%), SSRIs (21.6%), and calcium channel blockers (20.7%). Mean medication synchronization metric was 0.26 (SD 0.21), indicating that many of the patients did not consolidate their medication dispensations. The median PDC for statins was 57.5%, and the 25th and 75th percentiles were 24.7% and 89.6%, respectively; 11.8% of patients had PDCs less than 10%, approximately reflecting the proportion of patients who filled only a single statin prescription.Using the basic set of predictors selected by lasso models including medication burden as the only explanatory variables yielded the highest c-statistic in the testing cohort ; history of mammography exams ; past medical events, including myocardial infarction and stroke; past or current use of oral anticoagulants and nonstatin lipid-lowering drugs; and the use of high-dose statins were strong predictors of good adherence. Information for the model without medical data is also shown in the same table.A strong association was observed between previous adherence and future adherence after adjusting for all of the predefined clinical variables, despite the modest incremental improvement in predictive accuracy. For patients with mean previous PDC of < 25%, and for those with mean previous PDC 25%-79%, the likelihood of having high adherence to newly initiated statins was 51% lower , and 36% lower , respectively, as compared with those with mean previous PDC of 80% and above.When we applied the prediction model with baseline variables + mean PDC from the primary analysis to the expanded cohort that included patients with no previous medication adherence measurement, the c-statistic was slightly lower .Subgroup analyses restricting to specific classes of medications for previous adherence measurement substantially reduced the number of patients included in the cohort  but led In the sensitivity analysis in which we included patients with less than 365 days of follow-up, the pattern of results was similar to that from the primary analysis (full data not shown), although the c-statistics were consistently slightly lower for the models with previous adherence measures. The model including the basic set of predictors selected by lasso and mean PDC yielded a c-statistic of 0.680 (95% CI = 0.676-0.685).17 we found that previous adherence as a predictor of future adherence was best measured using the PDC. Adding multiple previous adherence measures to the prediction model did not lead to substantive improvement in discriminatory ability over a model with mean PDC as a single previous adherence measure.Our large, systematic evaluation found that previous adherence to chronically used medications was associated with future adherence to newly initiated statin treatment. Addition of measures of previous adherence to prediction models led to models capable of identifying whether patients would have high adherence to the newly started statins with improved accuracy. Building on previous work,16 Muntner et al. (2014) reported a strong association between past adherence to anti-hypertensive medication and the risk of statin discontinuation and low adherence among patients discharged from hospitals for acute myocardial infarction or coronary revascularization.14 Neither study specifically assessed the extent to which measures of previous adherence improve the performance of models to predict future medication adherence. Our study is the first study to systematically compare the predictive performance of a large number of previous adherence metrics across a large set of drugs used to measure previous adherence.Few studies have examined previous medication adherence as a predictor of future adherence. Solomon et al. (2011) described the strength of association between previous nonadherence to medications for chronic medical conditions, defined as having less than 2 prescriptions of the drugs despite having diagnoses for the conditions and very-low future adherence to osteoporosis medication in women.15 An obvious and important difference between this study and ours is the inclusion of adherence measured for medications dispensed both before and concurrent to the bisphosphonates. This is also an important difference between our study and that by Franklin et al.24 where patient adherence to newly initiated statins for the first 3 months was used to predict future adherence, achieving a model with c-statistics as high as 0.83. Estimating patient adherence before the start of a new medication is useful to determine whether patients are likely to be nonadherent at the time of the initial dispensation because it would enable pharmacists to intervene at a critical time for patients initiating therapy. At the same time, it is important to point out that these prediction methods can be used to achieve improved prediction and intervention in combination and need not be used separately.Curtis et al. (2009) previously evaluated improvements in c-statistics for models predicting bisphosphonate adherence in administrative claims data using adherence to other medications. They found that the use of adherence to previous and concurrently used chronic medications such as statins, ACE inhibitors/ARBs, and SSRIs improved the c-statistics of the prediction model up to 0.70 from the base model\u2019s 0.62.We observed good discrimination when we used previous adherence measures from only antidiabetics or only lipid-lowering agents other than statins. It is possible that previous adherence behaviors with these drugs are better indicators of future statin adherence. However, because only a small subset of patients used these drugs, models based on only these drugs performed less well when applied to the expanded cohort of all statin initiators as compared with models in which all previous adherence drugs were considered. Future work should focus on identifying the optimal set of previous adherence drugs to predict adherence to statins as well as to other drugs of interest.24 We built this model with the idea that adherence prediction could happen at the point of a pharmacy visit when only prescription data may be available. For example, the pharmacy or pharmacy benefits manager could identify patients at risk of nonadherence in real time at the point of initial prescription dispensation and use the pharmacy encounter to provide adherence improvement interventions.26The c-statistics of the prediction model without medical data were slightly reduced compared with the full model but still had good discrimination, which is consistent with the findings from previous studies.27 dispensation patterns may not exactly correspond to patient medication-taking behavior.Several important limitations of this study should be acknowledged. First, we measured statin adherence in claims data using PDC to define high adherence. Although this has been shown to correlate well with other adherence measures, including drug presence measured by serum levels, and is a widely used measure of adherence,Second, we selected a lookback period of 365 days for the assessment of baseline covariates and of previous adherence. Requiring longer lookback periods may lead to more complete capture of chronic conditions but would reduce the number of eligible patients, which would potentially limit the generalizability of the prediction models. Future work should examine the effect of different lookback periods on adherence prediction.28 we believe our results should be largely generalizable to adherence behavior in the longer term.Third, we focused the statin adherence outcome on the first year following statin initiation, whereas some patients continued to use the drugs for much longer. However, because monthly PDC for chronic cardiovascular medications tends to stabilize after the first 10 months of treatment,Fourth, patients needed to have baseline use of the selected chronic medications to estimate their previous medication adherence, which was available for 54% of all identified statin initiators. By definition, measures of previous adherence were not applicable to those patients with no use of drugs used to assess previous adherence.Fifth, the generalizability of our findings may in part be compromised by the introduction of the Centers for Medicare & Medicaid Services Medicare Health Plan Quality and Performance Ratings program, which includes medication adherence programs and which may have led to heightened attention to adherence by the health care providers and insurers or by an introduction of new treatment guidelines and generics that occurred since the study period set in 2010-2011.Sixth, because our study relied on a claims database as the data source, we were unable to capture primary nonadherence as an outcome. Finally, the study was conducted using a U.S. claims database consisting mostly of commercial insurance beneficiaries, and we evaluated adherence among patients initiating a single chronic medication. We chose statins as our target medication because of their widespread and chronic use for asymptomatic conditions, which are features common to other cardiovascular medications. Future studies should evaluate the generalizability of the study\u2019s results to older patients and those with different insurance providers and to other medication classes.Previous adherence to chronic medications was a strong predictor of future adherence to newly initiated statins and was a stronger determinant than demographic variables, clinical variables, and other medication-based measures. When predicting medication adherence in administrative claims data, whether for targeted adherence improvement interventions or to better design comparative effectiveness research studies, models should include measures of previous medication adherence, such as mean PDC."}
+{"text": "Ehlers\u2013Danlos syndrome is a rare, heritable connective tissue disorder characterized by soft, hyperextensible skin, joint hypermobility, and tissue fragility, the severity of which can range from mild to severe. A 9-month-old male entire miniature Dachshund was presented following peracute tetraparesis. Neurological examination was suggestive of intracranial vestibular disease or high cervical myelopathy. MRI revealed atlantoaxial instability and subluxation, resulting in marked spinal cord compression at C1\u2013C2, which was surgically stabilized. On discharge from the hospital, skin fragility was noted as the result of skin tearing during tape removal. A piece of full-thickness antebrachial skin was submitted for histopathology which showed changes consistent with Ehlers\u2013Danlos syndrome. This case report describes the first case of atlantoaxial instability and subluxation in a dog as the result of a confirmed underlying collagenopathy. In rpossible . An autopossible . Previoupossible \u201317.Atlantoaxial instability and subluxation (AAIS) secondary to ligamentous laxity has been reported to be a potential complication for humans with EDS, and the development of spinal instability has been increasingly appreciated among clinicians , 18. CurA 9-month-old male entire miniature Dachshund presented to the emergency department following peracute tetraparesis after being groomed. Neurological examination revealed normal mentation with non-ambulatory tetraparesis, right-sided head turn, and positional ventrolateral strabismus of the left eye. An intracranial lesion involving the central vestibular system or high cervical myelopathy was suspected. Magnetic resonance imaging (MRI) of the brain and cervical spine was performed using 3.0T Siemens MAGNETOM Skyra . Sequences of the brain included sagittal and transverse T2-weighted (T2W) images in 2 mm slices, diffusion-weighted imaging (DWI) in 3 mm slices, apparent diffusion coefficient (ADC) in 3 mm slices, and T1-weighted (T1W) pre- and post-contrast images in 1 mm slices. Cervical spine  sequences included sagittal and transverse T2W (2 mm slices), sagittal T1W pre- and post-contrast in 2 mm slices, and transverse T1W sequences (2 mm slices) from C1 to C3. Images were interpreted by a specialist in diagnostic imaging. MRI of the brain was within normal limits with no structural abnormalities identified. In the cervical spine, the dens had a normal shape with abnormal position, demonstrated by left and dorsal displacement of the dens in relation to C1. There was marked compression of the spinal cord at this site with heterogeneous increased T2W intensity of the cord at C1\u2013C2 .MRI findings were consistent with atlantoaxial instability/subluxation causing marked spinal cord compression. A conforming ventral fiberglass cast was fabricated and placed to provide external coaptation of the cervical spine.In-house hematology and biochemistry (IDEXX laboratories) had revealed increased alanine transaminase 212 IU/L (range 13\u201398), and subsequent investigation via paired bile acid tolerance testing revealed elevated pre-  and post-prandial  bile acids. Computed tomography scan  of the thorax, abdomen, and pelvic limbs were performed using 0.8 mm transverse slices, and pre- and post-contrast images were available, which were reviewed by a specialist in diagnostic imaging. No visible portal-systemic vessel communication was identified. All vessels were identified, appeared normal, and the liver was normal in size.The patient subsequently underwent surgical stabilization and a ventral approach to the cervical spine was made. The sternohyoideus muscle was identified and divided on midline via blunt dissection with preservation of the thyroid vein. The sternothyroid muscle was transected close to the larynx and trachea retracted to the left side. Blunt dissection to the ventral paraspinal muscles was performed, which were divided on the midline to expose the ventral aspect of C1\u2013C2. The muscles were elevated from these bones and the joint capsule was incised and removed to expose the synovial cartilage. The cartilage on the ventrocaudal and ventrocranial aspects of C1 and C2, respectively, was removed with high-speed burr. C2 was noted to be significantly unstable in relation to C1 and was held in place with a towel clamp placed across the vertebral body. A 1.5-mm hole was drilled from the cranioventral aspect of the left side of C2 across the joint and into C1 with an approximately 40\u00b0 angle from the midline and with a 20\u00b0 angle relative to the floor of the spinal canal. A 2.0-mm lag hole was drilled into C2 and an 18-mm self-tapping cortical screw was fastened from C2 to C1. A 1.5-mm hole was then drilled into the right side with the same angles, and the procedure was repeated with a 16-mm 2.0 mm cortical screw on that side. Routine closure was performed with 3/0 PDS simple continuous sutures in the paraspinal, sternothyroideus, and sternohyoideus muscles. The subcutaneous tissue was closed with 3/0 PDS simple continuous sutures, and the skin was closed with 5/0 PDS intradermal sutures. Postoperative ventrodorsal and lateral radiographs were performed, which confirmed that the screws were located appropriately.A dermal slow-release fentanyl patch  was placed on one hindlimb, and the patient recovered uneventfully. Postoperative analgesia was achieved with a constant rate infusion of fentanyl (3 \u03bcg/kg) for the first 12 h together with meloxicam (0.5 mg/kg PO q24h) and gabapentin (10 mg/kg PO q8h). Repeated neurological examination following surgery revealed slight improvement in the voluntary motor function, but the patient remained non-ambulatory.On the day of discharge, the adhesive tape covering the cephalic vein catheter on the left antebrachium was removed and a piece of full-thickness skin, approximately 1 cm square, unexpectedly became detached and adhered to the adhesive tape. This occurred under normal handling without the use of excessive force. On further re-examination of the patient, excessive joint laxity, particularly involving flexion and extension in the carpal, stifle, and tarsal joints, was noted together with hyperelasticity of the skin along the dorsal trunk.The fragment of antebrachial skin that became detached was submitted for histopathology due to the suspicion of abnormal skin fragility and extensibility beyond normal limits. This sample was compared with the samples of antebrachial skin from two control dogs that had no history of dermatological diseases. On routine light microscopic examination of H&E-stained sections, the dermal collagen fibers from this patient were strikingly different from the controls, being irregularly and often loosely oriented, with increased variation in size and shape and increased numbers of dermal fibroblasts . In conjFollow-up examination at 3 months post-operatively revealed improved neurological function, but the patient remained weakly ambulatory tetraparetic. 13 months postoperatively the patient was readily ambulatory with generalized proprioceptive quality ataxia, and 20 months postoperatively, the patient was ambulatory paraparetic with normal postural reactions in thoracic limbs and delayed in both pelvic limbs. The patient was subsequently lost to follow-up.de novo mutations of COL5A1, and a COL5A2 variant was found in the heterozygous state in Chihuahua  and \u201cdermatosparaxis\u201d (fragile skin). It is mainly characterized by skin fragility, skin hyperextensibility, vascular fragility, and joint hypermobility . In humahihuahua , 22. A hwith EDS , 24. Detwith EDS . A genomThe nervous system is not described as a primary target of EDS, and underlying molecular defects and structural anomalies involving the brain and spinal cord are not common findings in these patients. However, there is an emerging focus in humans with EDS on the wide spectrum of neurological manifestations that have been described and are unexpectedly common and potentially disabling. A recent review discussed the etiology and clinical findings related to neurological and spinal manifestations commonly observed but poorly recognized in people with EDS. The described neurological manifestations included atlantoaxial instability, craniocervical joint instability, segmental kyphosis and instability, and early disc degeneration along with weakness of the epineurium and perineurium surrounding peripheral nerves , 22.Although rare, EDS has been reported to be a cause of atlantoaxial subluxation in people , 18, andIn canines, the majority of atlantoaxial joint stability arises from a series of ligaments that can be divided into two groups: peripheral ligaments which cover the intervertebral space and separate the atlas from the axis and the deep ligaments which are located on the floor of the vertebral canal and connect the dens of the axis to the atlas and the occipital bone. The dorsal atlantoaxial membrane, dorsal atlantoaxial ligament, and ventral atlantoaxial ligament comprise the peripheral ligaments which join the ventral tubercle of the atlas to the ventral crest of the axis. The deep ligaments include the apical ligament of the dens axis, the paired alar ligaments, and the transverse ligament . HistoloCanine AAIS occurs most frequently due to congenital abnormalities and most commonly occurs in young and small toy breeds. Aplasia or hypoplasia of the dens, absence or weakness of supporting ligaments, incomplete ossification of the atlas, block vertebrae, and dorsal angulation of the dens are the most common congenital abnormalities associated with atlantoaxial subluxation. Subluxation can occur in these affected dogs spontaneously or with very mild trauma , 27, 28.MRI in this patient did not reveal evidence of absence or tearing of the atlantoaxial ligaments, which further supports excessive laxity as the cause of the atlantoaxial instability and subluxation. The dog in this case report presented following a sudden inability to walk whilst being at the groomers. Dogs with congenital anomalies that predispose them to atlantoaxial subluxation and spinal cord injury may have trauma-related onset of clinical signs. This is likely due to an inability to compensate for the pre-existing instability . Minor tThe prevalence of AAIS resulting from primary ligamentous disease in dogs is unknown. This is partly due to the lack of preoperative imaging as traditional diagnosis has historically been based on the criteria deduced from CT or survey radiographic studies, which indirectly assess the likelihood of ligamentous rupture . PrimaryReported microscopic changes in animals with EDS include reduced normal dermal thickness and abnormal dermal \u00b1 hypodermal collagen fibers . Some cases also have increased numbers of fibroblasts or increased ground substance , 31. HisBloodwork in this patient also demonstrated elevations in ALT and paired bile acid stimulation testing, and CT did not reveal aberrant portal-systemic vessels to account for these biochemical abnormalities. The possibility of other hepatic abnormalities, including portal vein hypoplasia (microvascular dysplasia), cannot be excluded. Human EDS patients with a clinical phenotype involving tissue fragility not only manifest signs externally, such as easy bruising of the skin and impaired wound healing with dystrophic scarring, but can also show fragility within internal organs such as the arteries, lungs, intestines, liver, and spleen. In such cases, a vascular type of EDS is predominantly suspected . In the To the best of our knowledge, we describe the first report of a suspected neurological manifestation of Ehlers\u2013Danlos syndrome in a dog. It is postulated that abnormalities in collagen assembly and/or synthesis likely affected the integrity of ligamentous structures surrounding the atlantoaxial joint, subsequently predisposing to atlantoaxial instability and subluxation either spontaneously and/or in the face of minor trauma.The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.Written informed consent was obtained from the participant/patient(s) for the publication of this case report.SC and SL were neurology clinicians involved in the clinical patient assessment, imaging work-up, and surgery performed. LS performed the histopathology of the skin that was submitted. SC wrote the first draft of the manuscript. SL and LS wrote sections of the manuscript. All authors contributed to manuscript revision, read, and approved the submitted version."}
+{"text": "Aedes aegypti, is lacking. In the current study, we utilized solid-state nuclear magnetic resonance spectroscopy, gas chromatography/mass spectrometry, and transmission electron microscopy to gain insights into the cuticle composition of congenic cytochrome P450 monooxygenase insecticide resistant and susceptible Ae. aegypti. No differences in cuticular hydrocarbon content or phenolic biopolymer deposition were found. In contrast, we observed cuticle thickness of insecticide resistant Ae. aegypti increased over time and exhibited higher polysaccharide abundance. Moreover, we found these local cuticular changes correlated with global metabolic differences in the whole mosquito, suggesting the existence of novel cuticular resistance mechanisms in this major disease vector.Insecticides have made great strides in reducing the global burden of vector-borne disease. Nonetheless, serious public health concerns remain because insecticide-resistant vector populations continue to spread globally. To circumvent insecticide resistance, it is essential to understand all contributing mechanisms. Contact-based insecticides are absorbed through the insect cuticle, which is comprised mainly of chitin polysaccharides, cuticular proteins, hydrocarbons, and phenolic biopolymers sclerotin and melanin. Cuticle interface alterations can slow or prevent insecticide penetration in a phenomenon referred to as cuticular resistance. Cuticular resistance characterization of the yellow fever mosquito,  Aedes aegypti is the primary vector of four arboviruses: yellow fever virus (YFV), dengue virus (DENV), chikungunya virus (CHIKV), and Zika virus (ZIKV)1. Of these arboviruses, dengue virus has the most significant public health burden with an estimated 50\u2013100 million symptomatic infections per year3. Moreover, Ae. aegypti has an encroaching geographic range that renders half of the world\u2019s population at risk for dengue infection4. Vector control in dengue endemic areas relies heavily on pyrethroid insecticides used on adult Ae. aegypti8. Over time, the selection pressure imposed by the extensive use of pyrethroids in these regions has resulted in increasingly widespread populations of highly insecticide resistant Ae. aegypti7. Consequently, insecticide resistance threatens to undermine Ae. aegypti control efforts in regions where vector-borne diseases are most prevalent.Worldwide, vector control programs rely on insecticides to prevent vector-borne diseases. Mosquitoes are responsible for the most significant burden of vector-borne disease and consequently are a primary focus of public health interventions. 12. Physiological resistance occurs via two primary mechanisms: target-site mutations and metabolic resistance. Contact-dependent pyrethroid insecticides target the voltage-sensitive sodium channels (Vssc), which are essential to the insect nervous system13. Insects with mutations in Vssc that prevent pyrethroid activity are phenotypically knockdown resistant (kdr)15. Metabolically resistant insects exhibit increased expression and detoxifying activity of cytochrome P450 monooxygenases (CYPs) allowing for metabolization and excretion of insecticides17. A large body of work has demonstrated the physiological adaptations associated with CYP and KDR play a significant role in insecticide resistance16. In contrast, however, comparatively little is known about other physiological mechanisms that contribute to resistance, such as modifications to the insect exoskeleton18. The exoskeleton, also referred to as insect cuticle, is essential for structural integrity, barrier protection, sensation, hydration, and chemical communication20. Furthermore, the cuticle is an arthropod's first line of defense against contact insecticides18. Modifications to the cuticle including thickening have been shown to slow, or even prevent the penetration of contact insecticides\u2014a phenomenon first documented in the 1960s\u2014yet the structural modifications and mechanisms contributing to cuticular thickening remain largely uncharacterized22. Although cuticular resistance alone is insufficient to confer complete resistance, it acts synergistically with other resistance mechanisms to promote efficient insecticide elimination and limit internal damage18.Insecticide resistance is complex and often involves physiological resistance and behavioral responses23. The exocuticle is deposited before eclosion, whereas the soft endocuticle is deposited during and after eclosion, depending on the insect24. The distinct lamellar structure of the exocuticle is hard and rigid due to the deposition of tyrosine-derived sclerotin soon after eclosion, in a process known as sclerotization. During sclerotization, chitin is cross-linked to key residues of cuticular proteins via the oxidative conjugation of tyrosine-derived catechols, resulting in cuticular hardening conferring structural stability and resiliency25. The pigmented phenolic-derived biopolymer melanin, another tyrosine-derived component of the exocuticle, is responsible for cuticular darkening30. Like sclerotin, melanin is highly recalcitrant and crosslinked to other cuticular moieties, albeit to a lesser degree31.Mosquito cuticle is a formidable barrier to external assault; it is composed of three distinct layers, each with their own unique properties. The epicuticle is a thin, waxy, hydrocarbon-rich layer deposited on the outermost surface of the cuticle. Beneath the epicuticle lies the exocuticle, followed by the endocuticle. Both the exo- and endocuticular layers consist of macromolecular frameworks composed of the polysaccharide chitin, with proteins and a small amount of lipids interwoven throughout29. Phenoloxidases, including cuticular laccases35 and immune tyrosinases36, produce phenolic biopolymers for these various processes under tight regulation to limit internal damage37. Due to their compatibility with a range of substrates, phenoloxidases have a proposed role in detoxification in many invertebrates40. For example, prior studies have demonstrated a potential link between increased tyrosinase activity and insecticide resistant lab strains of the common house mosquito, Culex pipiens42. Thus, we were interested in exploring whether the tyrosinase activity would similarly differ between the ROCK and CR strains.Melanin has several outsized roles in other physiological processes such as wound healing and the insect immune responseAnopheles gambiae and An. funestus possess distinct structural and biochemical alterations41. In contrast, very few studies have directly characterized cuticular alterations in the major arboviral vectors of the genus Aedes in the context of insecticide resistance43. One notable feature of this resistant phenotype is leg cuticular thickening. Mosquitoes are often exposed to insecticides while resting on treated surfaces, rendering the leg cuticle an important interface for contact-dependent insecticide absorption45. In comparisons of mosquito leg cross-sections using electron microscopy (EM), insecticide resistant An. gambiae and An. funestus were found to have thicker cuticles49. While EM is well-suited to characterize the exo- and endocuticular layers, the thin, waxy hydrocarbon-rich epicuticle is not commonly visible45. However, the long-chain (\u223c\u2009C21\u2013C37+) alkane or alkene cuticular constituents are readily extractable from the epicuticle and can be profiled using gas chromatography/mass spectrometry (GC\u2013MS)50. These aliphatic lipids have been shown to serve as a barrier to desiccation, and their increased cuticular abundance has been correlated with insecticide resistance52.Recent work has demonstrated that cuticles of insecticide resistant populations in malaria vectors Ae. aegypti. To address these shortcomings, we profiled cuticular differences between two characterized congenic strains: susceptible Rockefeller (ROCK) and CYP-mediated metabolically resistant strain herein referred to as CR53. The CR strain used in this work is primarily resistant to pyrethroid insecticides, with some cross-resistance to several organophosphate insecticides due to overexpression of several identified CYP genes53. The possibility that the CR strain possessed cuticular morphology and compositional changes associated with the isolation of CYP-mediated resistance was unknown.No investigations of the potential contribution of sclerotin and melanin to cuticular resistance have appeared in the literature. More broadly, the phenomenon of cuticular resistance is understudied in Ae. aegypti females54. Because insects produce sclerotin in addition to melanin, we utilized Drosophila melanogaster pigmentation mutants to validate the ability of this method to consistently recover phenolic compounds as well as their associated lipid and polysaccharides. Due to the structurally complex, insoluble nature of insect cuticle, we utilized solid-state nuclear magnetic resonance (ssNMR) spectroscopy to compare the sclerotin and melanin-rich acid-resistant material as well as whole intact mosquitoes from insecticide resistant and susceptible Ae. aegypti females. Because the relationship between insecticide resistance mechanisms and phenoloxidase activity has not been fully elucidated56, we compared phenoloxidase activity in the two strains. Additionally, we monitored cuticular thickening and changes in cuticle ultrastructure over time using TEM at 3\u20135\u00a0days and 7\u201310\u00a0days post-eclosion. Finally, we analyzed the cuticular hydrocarbon content from both males and females using gas chromatography/mass spectrometry (GC\u2013MS). Our analyses finds that neither cuticular hydrocarbons nor phenolic biopolymer deposition differed between insecticide resistant and susceptible mosquito strains. However, the increased endocuticle deposition observed in resistant mosquitoes of this globally important disease vector suggests the possibility of a potentially novel mechanism of cuticular resistance that requires further characterization.In this work we have utilized complementary biophysical, biochemical, and imaging methodologies to characterize the cuticle of the congenic ROCK and CR strains. Our studies focused primarily on female mosquitoes of this strain in light of the male\u2019s inability to transmit vector-borne diseases. We adapted a methodology used to enrich for deposited fungal melanin to compare insecticide resistant and susceptible 36. Constitutively active phenoloxidase, a measurement of baseline immune activation57, was estimated by incubating individual female mosquito homogenates with 2\u00a0mM of the melanin precursor L-DOPA. There was no difference in constitutively active phenoloxidase between the two strains, indicating a similar level of baseline immune activation . These findings indicate that both sclerotin and melanin contribute to the acid resistance of insect cuticle. To confirm that prolonged HCl digestion was a suitable means to prepare insect cuticle samples that are enriched in both polymers, the acid-resistant material from each D. melanogaster strain was analyzed using Carbon-13 (13C) ssNMR spectra .In addition to immunity, insect melanin, along with sclerotin, plays a vital role in maintaining the structural integrity of the cuticleAe. aegypti strains  and ROCK (black trace) mosquitoes are shown in Fig.\u00a013C NMR spectra were also collected  experiment  with a concurrent decrease in lipid content (52% vs. 59%). The lipid content of the material was further validated with a ent Fig. . Due to Ae. aegypti occurs with a trade-off in body size56. In agreement with previous findings, the CR female mosquitoes had significantly smaller body mass compared to ROCK females  male and female, 3\u20135-days old mosquitoes from the CR and ROCK strains. Hexane extractions were performed on groups of 20 pooled mosquitoes per extraction with an internal pentadecane standard. Samples were collected from three separate rearing cohorts. Total mosquitoes were as follows: ROCK females n\u2009=\u2009180, ROCK males n\u2009=\u2009140, CR females n\u2009=\u2009140, CR males\u2009=\u2009180. To estimate cuticular hydrocarbon (CHC) abundance, samples were referenced to the internal pentadecane standard. Total abundances were estimated from the sum of peak areas and divided by sample mass. GC\u2013MS analysis of the extractions found that males and females of the ROCK and CR strains had similar alkane composition  in the exterior epicuticle, have been correlated with insecticide resistance in the lab and field18. Compared to internal physiological mechanisms, cuticular resistance is much less well understood. Insect cuticle is essential for structural integrity, barrier protection, sensation, hydration, and chemical communication20. Therefore, cuticular alterations may have unanticipated consequences in other aspects of insect physiology that require further study.Cuticular insecticide resistance refers to insect cuticle alterations that reduce insecticide penetration, simultaneously limiting internal damage and increasing efficacy of internal physiological resistance mechanisms such as CYP enzyme detoxification and insecticide target-site mutations conferring KDR phenotypic resistance17. By comparing congenic strains, our findings are more likely to be related to defined CYP-overexpression, either directly or indirectly, and not purely a result of the genetic background53. The CR strain\u2019s resistance loci originate from the well-characterized SP strain16. The SP strain contains dual KDR and CYP resistance loci but did not possess cuticular penetration resistance16. However, they did not characterize cuticle ultrastructure, composition, or compare penetration resistance over time16. Our findings may be explained by KDR and CYP resistance loci interactions. It is well-established that CYP and KDR loci interact in nonadditive ways, influencing physiology and fitness-costs67. This is the case in the strain used in this study; isolation of the CR strain\u2019s resistance loci from the KDR resistance loci resulted in greater fitness costs associated with CYP-resistance, including a reduced lifespan56. Therefore, we hypothesize the cuticular differences we observed may be related to the isolation of the CYP resistance locus from KDR. Future work comparing the cuticles of congenic strains with dual and isolated resistance loci would begin to answer these questions.In this work we provide data showing an association between increased cuticle thickness and insecticide resistance in context of global metabolic differences. Future work is necessary to measure penetration of insecticides in the CR strain at several time intervals to establish whether cuticular penetration resistance correlates with the observed changes in thickness and polysaccharide content observed. Notably, past studies examining cuticular resistance have compared unrelated strains or strains with undefined resistance mechanisms. The CR strain is congenic to ROCK, meaning that they differ only in the resistance locus conferring CYP-overexpression68. In fungi, analysis of acid resistant material makes it possible to characterize not only fungal melanin, but components protected by melanin71. Adapting acid-digestion protocols used for fungal melanin enrichment allowed us to characterize the abundance and composition of associated material in the resistant cuticle72. While ssNMR comparison of ROCK and CR acid-resistant material showed no differences in melanin and sclerotin content at baseline, the strains were not pre-exposed to insecticides. Therefore, the possibility that melanin or other phenolic compounds play a role in detoxification during direct exposure cannot be excluded.As noted previously, the cuticle is comprised of cuticular hydrocarbon-based waxes, chitin polysaccharides, cuticular proteins, and the phenolic biopolymers sclerotin and melanin. In contrast to other cuticular constituents, the contributions of sclerotin and melanin to cuticular resistance have been unexplored. This is primarily due to their relatively low abundance in the cuticle and amorphous structure. Within the cuticle, moreover, sclerotin and melanin are attached to other moieties via strong covalent bonds and are resistant to acid digestion30. Tyrosinase-derived melanin is especially important in the insect immune response36. Phenoloxidases exhibit broad substrate specificity and are able to metabolize a wide variety of phenolic-containing compounds, such as those secondary metabolites produced by plants, which are in turn toxic to insects if ingested in sufficient quantities39. As such, these enzymes have a proposed role in detoxification in addition to immunity. In contrast with previous findings that insecticide resistant C. pipiens lab strains had higher tyrosinase activity57, we observed a significant decrease in total tyrosinase activity (estimated by a-chymotrypsin activation) in the CR strain. This finding does not support the notion that tyrosinases are playing a major role in detoxification of this strain. However, the biological relevance of this decrease during immune challenge is unknown. Additionally, we did not measure the activity of cuticular laccases, which would require harsh extraction procedures to remove from the cuticle35. Consequently, it is possible that the CR strain may have differences in cuticular laccase activity. Future work is required to investigate the role of cuticular laccases in penetration resistance and insecticide detoxification73.Sclerotin and melanin play vital roles in several essential physiological processes including coloration, cuticular structural integrity, immunity, and wound healing65 and characteristic 55-ppm NMR resonance from the C2 ring carbon of chitin, which carries an amino group which is acetylated. This signal was clearly observed to display greater intensity in the CR sample spectrum  via the hydroxylation of key sites, which increases their polarity and in turn promotes their excretion. Metabolically resistant mosquitoes exhibit constitutive overexpression of CYPs; thus, when reared in a lab setting in the absence of any xenobiotics, increased CYP activity could result in the hydroxylation of structurally similar non-toxic moieties. Although not fully understood, CYPs and other downstream detoxifying enzymes are thought to preferentially hydroxylate the arene and aliphatic carbons of pyrethroids84: the signal at 180\u00a0ppm is unambiguously attributable to the carbon within a carboxylic acid group of an unesterified fatty acid85, whereas the signal at 130\u00a0ppm is attributable to the olefinic carbons of fatty acids containing at least one point of unsaturation85, which are predominant in fat bodies86 and preferentially liberated from triacylglycerols as compared with saturated fatty acids87.\u00a0Taken together, our data suggest that ROCK mosquitoes have a greater content of free fatty acids in comparison to the CYP strain. Notably, these differences in free fatty acid peak intensities were not observed in the spectra of the acid-resistant material, which suggests they reflect a change in global metabolism rather than a change in cuticular molecular architecture. Free fatty acids are an important energy source in insect metabolism69; they are stored in fat bodies in the form of triacylglycerols and are liberated immediately prior to utilization for energy production. Thus, the comparatively lower content of fatty acids observed in CR mosquitoes offers evidence of the high energetic cost of maintaining CYP resistance89. The high energy demands of the CYP strain and overexpression of detoxification mechanisms are likely to require mobilization of carbohydrate reserves, resulting in chitin production and therefore causing cuticle thickening to correlate with metabolic resistance. We hypothesize that global metabolic changes impacting carbohydrate metabolism contribute indirectly to the cuticular alterations often observed in resistant strains, rather than a distinct selected phenomenon. While our observation of endocuticle thickening over time supports this notion, connections between the global metabolic state of the vector to cuticular modifications require further exploration.Further comparison of the CR and ROCK whole-mosquito data revealed additional spectral differences which could potentially reflect a difference in metabolic state between the two strains. Namely, there are two sharp signals at ~\u2009180 and 130\u00a0ppm that are of greater intensity in the ROCK spectrum.\u00a0The peaks at 180 and 130\u00a0ppm are characteristic of rapidly-tumbling unsaturated free fatty acids found in fat bodiesAe. aegypti and related vectors that jeopardize human health.Our work profiling the contributions of polysaccharide, lipid, and phenolic biopolymers to cuticular resistance revealed cuticular changes in the CR strain. While TEM allowed us to monitor the cuticle ultrastructure for differences, a combination of solid-state Nuclear Magnetic Resonance (ssNMR) and Gas Chromatography Mass Spectrometry (GC\u2013MS) yielded insights into cuticular composition . CYP resistance alleles originating from the resistant Singapore (SP) strain were introgressed into the ROCK background to produce a strain with only CYP-mediated resistance that was congenic to the well characterized insecticide susceptible Rockefeller (ROCK) strain91.The congenic Ae. aegypti CR and ROCK strains were maintained with a 12\u00a0h light:dark photoperiod at 27\u00a0\u00b0C and 80% relative humidity. Larvae were fed 1 pellet of Cichlid Gold\u00ae Fish Food  per 50 larvae69. Eggs were vacuum hatched in a 1\u00a0L flask in diH2O for 30\u00a0min to maximize synchronized development. After 24\u00a0h, larvae were sorted to a density of 200 larvae/1\u00a0L of diH2O. After eclosion, mosquitoes were maintained on 10% sucrose using cotton wicks.The D. melanogaster strains used in this study, WT- CantonS (BDSC 64349), ebonyS (BDSC 498), and yw (BDSC 1495) were obtained from the Bloomington Drosophila Stock Center . All D. melanogaster strains were maintained on our standard fly food92 on a 12\u00a0h light:dark photoperiod at 25\u00a0\u00b0C and 80% relative humidity. Adult flies (4\u20137\u00a0days old) were collected and sexed for further processing. Acid-resistant material was collected from groups of 25 homogenized female flies. Samples were homogenized in 500\u00a0\u03bcL diH2O using an electric pellet pestle cordless motor (Kimble). After homogenization, 500\u00a0\u03bcL of 12\u00a0M HCl was added to the homogenate . Samples were digested for 24\u00a0h on an Eppendorf ThermoMixer C shaker at 85\u00a0\u00b0C with 700 RPM shaking. After digestion, samples were spun down for 30\u00a0min at room temperature at 15,000 RCF. Samples were washed three times, first with 1\u00a0mL 1\u00d7 PBS, then 1\u00a0mL 10% PBS, and finally 1\u00a0mL diH2O. Washed melanin samples were lyophilized, weighed, and combined for ssNMR analysis.The l-phenylalanine, Sigma Catalogue # D9628-25G), and 140\u00a0\u03bcL diH2O with or without 0.07\u00a0mg/mL a-chymotrypsin . Melanization activity was determined through SpectraMax iD5 spectrophotometer readings at 492\u00a0nm 30\u00a0\u00b0C for 45\u00a0min with 1 reading/minute57.To measure phenoloxidase activity, single mosquitoes were crushed in 35\u00a0\u03bcL of cold PBS using an electric pellet pestle cordless motor (Kimble) with ScienceWare Disposable Polypropylene Pestles . After a 2-min 3000 RPM spin at 4\u00a0\u00b0C, 15\u00a0\u03bcL of hemolymph homogenate was recovered and frozen on dry ice for 2\u00a0min for hemocyte lysis. Samples were stored at -80\u00a0\u00b0C until analysis. Hemolymph homogenate samples were thawed on ice. In a transparent, flat bottom 96-well plate 5\u00a0\u03bcL of hemolymph homogenate was mixed with 20 \u03bcL PBS, 20 \u03bcL 20\u00a0mM L-DOPA (4\u00a0mg/mL) . After homogenization, 500\u00a0\u03bcL of 12\u00a0M HCl was added to the homogenate . Samples were digested for 24\u00a0h on an Eppendorf ThermoMixer C shaker at 85\u00a0\u00b0C with 700 RPM shaking. After digestion, samples were spun down for 30\u00a0min at room temperature at 15,000 RCF. Samples were washed three times, first with 1\u00a0mL 1\u00d7 PBS, then 1\u00a0mL 10% PBS, and finally 1\u00a0mL diH2O. Washed melanin samples were lyophilized, weighed, and combined for ssNMR analysis.Female mosquitoes were collected 5\u20137\u00a0days post-eclosion and weighed in groups of 25 in 1.5\u00a0mL microcentrifuge tubes. The weight of single mosquitoes was estimated from these measurements to reduce error. To obtain acid resistant material, 25 female mosquitoes were homogenized in 500\u00a0\u03bcL diH13C direct-polarization (DPMAS) experiments conducted with 90\u00b0 pulse lengths of 1.2 and 1.4\u00a0\u03bcs for 1H and 13C, respectively; 104-kHz heteronuclear decoupling using the small phase incremental alternation pulse sequence (SPINAL) was applied during signal acquisition. The DPMAS experiments used a long recycle delay (50-s) to generate spectra with quantitatively reliable signal intensities. Thus, the relative amounts of carbon-containing constituents present in the samples could be estimated using the GNU image manipulation program (GIMP) by measuring the integrated signal intensity within the spectral region corresponding to each moiety and comparing it to the total integrated signal intensity of the spectrum. 4096 scans/sample were collected over 56\u00a0h.Solid-state NMR experiments were conducted on a Varian (Agilent) DirectDrive2 (DD2) spectrometer operating at a 1H frequency of 600\u00a0MHz and equipped with a 1.6-mm T3 HXY fastMAS probe ; all measurements were carried out using a magic-angle spinning (MAS) rate of 15.00\u2009\u00b1\u20090.02\u00a0kHz at a spectrometer-set temperature of 25\u00a0\u00b0C. Data were obtained on ~\u20097.8\u00a0mg of lyophilized sample mass yielded by HCl hydrolysis of each CR and ROCK female mosquitoes to analyze the acid-resistant material. To analyze the whole mosquitos, data were obtained on 20 intact lyophilized female mosquitoes from either the CR or ROCK strain, equivalent to ~\u20098\u00a0mg. Acid digested and whole mosquitoes used for ssNMR analysis were obtained at 5\u20137\u00a0days post-eclosion. Both sets of samples were examined using 2, and 0.1\u00a0M sodium cacodylate (pH 7.2) overnight at 4\u00a0\u00b0C.Groups of 10 midlegs were removed from ROCK and CR females of the same rearing cohort at 3\u20135\u00a0days post-eclosion and 7\u201310\u00a0days post-eclosion . Midlegs were severed at the tibia just after the femur with a razor blade and were fixed in 2.5% glutaraldehyde, 3\u00a0mM MgCl71. After buffer rinse, samples were postfixed in 1% osmium tetroxide, 1.25% potassium ferrocyanide in 0.1\u00a0M sodium cacodylate for at least 1\u00a0h (no more than two) on ice in the dark. After the fixing step, samples were rinsed in dH2O, followed by uranyl acetate  , dehydrated in a graded series of ethanol and embedded in Spurrs (Electron Microscopy Sciences) resin. Samples were polymerized at 60\u00a0\u00b0C overnight. Thin sections, 60\u201390\u00a0nm, were cut with a diamond knife on a Leica UCT ultramicrotome and picked up with 2\u2009\u00d7\u20091\u00a0mm Formvar copper slot grids. To obtain consistent comparable segments across samples, femur cross-sections were obtained 200\u00a0nm into the femur from the direction of the tibia. Grids were stained with 2% aqueous uranyl acetate followed by lead citrate and observed with a Hitachi 7600 TEM at 80\u00a0kV. Images were captured at 10,000\u00d7 magnification using an AMT CCD XR80 .TEM protocols were adapted from:Ten representative images were chosen per femur. Each image captured\u2009~\u200918\u00a0\u03bcm of total cuticle length \u2264\u200910 measurements were taken per image using ImageJ2 version 2.30/1.53f. Measurements of total cuticle and endocuticle were taken at the same point and exocuticle was calculated by subtracting these values. Areas of the cuticle containing structural modifications were excluded from measurements.2 gas. After evaporation, samples were frozen at \u221220\u00a0\u00b0C until further analysis.Pools of 20 mosquitoes were collected at 3\u20135\u00a0days post-eclosion, weighed, and stored in glass vials at \u2212\u200920\u00a0\u00b0C until sample processing. Samples were collected from three separate rearing cohorts. The pools of 20 mosquitoes were submerged for 30\u00a0min in 400\u00a0\u03bcL GC\u2013MS quality hexane and 16\u00a0\u00b5g/sample pentadecane internal standard. Each extraction was purified through a column chromatography quality Silica gel (Pore Size 60\u00a0\u212b 0.063\u20130.200\u00a0mm) to final a volume of 1.5\u00a0mL of hexane and evaporated with N51. Samples were analyzed by gas chromatography/mass spectrometry . Concentrated hydrocarbons were resuspended in 30\u00a0\u03bcL of hexane and 1\u00a0\u03bcL of each sample was injected onto a HP-5MS capillary column (30\u00a0m length\u2009\u00d7\u200925\u00a0mm diameter\u2009\u00d7\u20090.25\u00a0\u00b5m film thickness). The GC oven was programmed with an initial temperature of 50\u00a0\u00b0C with a 2\u00a0min hold followed by an increase of 20\u00a0\u00b0C/min to 300\u00a0\u00b0C with a 6\u00a0min hold. A helium carrier gas with a flow rate of 1.2\u00a0mL/min\u22121 was used. The MS analyzer was set to acquire over a range of m/z 35\u2013500 and was operated in EI mode. The ion source and transfer line were set to 230\u00a0\u00b0C and 300\u00a0\u00b0C respectively. Analyte peak areas were normalized to the internal standard and by sample weights. Compound identification was achieved by comparison of mass spectra with the NIST Mass Spectral Library version 2.2 and retention time matching with analytical reference standards.GC\u2013MS were adapted fromData were analyzed with Prism Version 9.3.1. Figure\u00a0Supplementary Figures."}
+{"text": "Matrix metalloproteinases (MMPs) are zinc-dependent metalloproteinases that play important roles in a variety of diseases, including cancer, cardiovascular disease, diabetes, obesity, and brain diseases. Dietary polyphenols are thought to have a variety of beneficial effects on these diseases characterized by inflammation. Clinical studies have demonstrated that MMPs are in most cases upregulated in various inflammatory diseases, including osteoarthritis, rheumatoid arthritis, inflammatory bowel disease, and Alzheimer\u2019s disease. Studies using patient-derived human samples, animal studies, and cellular experiments have suggested that polyphenols may be beneficial against inflammatory diseases by suppressing MMP gene expression and enzyme activity. One important mechanism by which polyphenols exert their activity is the downregulation of reactive oxygen species that promote MMP expression. Another important mechanism is the direct binding of polyphenols to MMPs and their inhibition of enzyme activity. Molecular docking analyses have provided a structural basis for the interaction between polyphenols and MMPs and will help to explore new polyphenol-based drugs with anti-inflammatory properties. Dietary polyphenols have been demonstrated to have a variety of beneficial effects on human diseases such as cancer, obesity, diabetes, cardiovascular disease, and neurodegenerative disorders ,2,3,4,5.Matrix metalloproteinases (MMPs), which degrade extracellular matrix proteins, are zinc-dependent metalloproteinases that play an important role in inflammation . At leasIn our previous review, we discussed the anticancer property of epigallocatechin-3-O-gallate (EGCG) in terms of its inhibitory activity against MMPs . Recent This review provides updated information on effects of these dietary polyphenols on MMPs in relation to their anti-inflammatory effects with mechanistic aspects including evidence from molecular docking studies.This review provides updated information on important dietary polyphenols, chlorogenic acid (CGA), curcumin (CUR), EGCG, genistein (GEN), quercetin (QUE), and resveratrol (RES)  on MMPs Clinical studies have demonstrated that in most cases, MMPs are upregulated in various inflammatory diseases. Example studies for 13 MMPs  are discussed below. In 115 patients with rheumatoid arthritis (RA), 20 with osteoarthritis (OA), 28 with psoriasis arthritis, 24 with ankylosing spondylitis, 3 groups with systemic autoimmune diseases, and 30 healthy controls were examined; MMP1 levels were elevated in RA, OA, psoriasis arthritis, systemic lupus erythematosus, and mixed connective tissue disease . MMP3 leA study by Mahmoud et al. , in whicWhen synovial biopsy samples were examined according to Kellgren\u2013Lawrence grading from grade I (doubtful OA) to grade IV (severe OA), the levels of MMP1, MMP2, and MMP9 were higher in grades II to IV than that in grade I and that of MMP13 was higher in grades II to III than that in grade I  Table 1Table 1. Chronic inflammation is a hallmark of Alzheimer\u2019s disease (AD)-related neuropathological events, leading to neuronal dysfunction and death .Based on a study with 31 patients with AD and 15 normal controls, Gu et al.  concludeA clinical study determining MMP2, MMP9, and MMP10 levels in cerebrospinal fluid (CSF) and plasma in 52 AD patients, 26 matched controls, and 24 vascular dementia patients led Duits et al.  to impliA prospective, cross-sectional, multicenter study found that serum concentrations of MMP2, MMP7, and MMP9 were higher in chronic hepatitis C patients than in healthy subjects . MMP7 waIn blood samples from patients with Buerger\u2019s disease, an inflammatory occlusive disorder, the blood levels of MMP9, and intercellular adhesion molecule-1 (ICAM-1), and high mobility group box-1 were significantly higher than those from controls, and no differences were detected in MMP2 and MMP11 levels .In hidradenitis suppurativa, a chronic inflammatory disease, higher expression of granulocyte colony-stimulating factor was observed in the skin samples from of patients . The incCrohn\u2019s disease (CD) is one of the immune-mediated inflammatory bowel diseases . ImmunohAdditional examples of studies on human subjects and clinical samples related to MMPs in inflammatory diseases are listed in V 1.Arthritis, an inflammatory joint disease, occurs through dysregulation of pro-inflammatory cytokines such as IL1\u03b2 and TNF\u03b1, pro-inflammatory enzymes such as cyclooxygenase 2 (Cox-2) and lipoxygenase, expression of adhesion molecules and MMPs, and proliferation of synovial fibroblasts (SFBs) . Agents The pathology of OA involves cartilage degradation by MMPs . In an eWIN-34B is the n-butanol fraction prepared from the two kinds of herbs for arthritis treatment in East Asian countries and contains CGA as one of the main components . CGA andIn an OA-like chondrocyte model in which human SW1353 chondrocytes were stimulated with IL 1\u03b2, CGA restored IL 1\u03b2-induced increases in inducible nitric oxide synthase (i-NOS)/NO, IL-6, MMP13, COX-2/PGE2, and type 2 collagen protein expression . CGA inhMicroarray analysis using tips containing tissue samples of OA patients and healthy controls demonstrated that the gene expression of MMP3 in OA patients was higher compared to the controls . CompariLiacini et al.  reportedStimulation with macrophage migration inhibitory factor (MIF) in SFB derived from RA patients resulted in an increase in MMP1 and MMP3 mRNA levels, along with those of c-jun, c-fos, and IL-1\u03b2 . SimilarWhen SW982 cells stimulated with IL1\u03b2, IL6, or TNF\u03b1 were used as the RA model synoviocytes, CUR was found to reduce the viability of these cells, restore the levels of MMP1 gene expression increased by stimulation with IL1\u03b2 or TNF\u03b1, and decrease TNF\u03b1 protein production . CUR decIn a collagen-induced RA model in rats, administration of CUR (200 mg/kg) daily for 3 weeks reduced the inflammatory features including synovial hyperplasia . CUR inhIn human OA chondrocytes derived from OA cartilage, stimulation with advanced glycation end-products (AGE)-modified bovine serum albumin induced gene expression and production of TNF\u03b1 and MMP13, both of which were attenuated by EGCG . The AGEIn human OA chondrocyte CHON-001 cells, stimulation with IL1\u03b2 decreased cell viability and upregulated mRNA and protein levels of miR-29b-3p and MMP13 . ProteinIn a mouse OA model that received a tissue incision, the articular cartilage of EGCG-treated mice developed less erosion and exhibited reduced staining for MMP13 and a disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts-5) compared to vehicle-treated controls . EGCG caExcessive osteoclast activation is one of the common features in many bone-loss diseases such as osteoporosis and RA . In cultJoint cartilage and bone destruction in RA patients is caused by MMPs produced by RA SFBs and TNF\u03b1 contributes significantly to their production. In these cells, EGCG suppressed TNF\u03b1-induced production of MMP1 and MMP3 at the protein and mRNA levels with concomitant downregulation of ERK1/2, p38, and JNK . EGCG inIn RA, plasma levels of IL1\u03b2 are elevated compared to those of normal subjects , IL1\u03b2-stIn RA synovium-derived fibroblasts, EGCG at 10-20 \u03bcM inhibited the production of IL1\u03b2-induced epithelial neutrophil activating peptide-78, RANTES, and CXCL1, but monocyte chemotactic protein 1 (MCP1) production was inhibited at much higher concentrations . EGCG inEGCG inhibited IL1\u03b2-induced IL6 production and trans-signaling in RA SFBs by enhancing soluble gp130 production . In a raUpregulation of IL1\u03b2 was reported in the synovial fluid and cartilage of patients with OA . In chonIn rheumatoid synoviocytes derived from patients, IL1\u03b2 or TNF\u03b1 upregulated expression of MMP9 and MMP2 . EpidermIn a model of knee osteoarthritis in rats, intra-articular injections of iodoacetate increased the expression of MMP8, MMP13, and Indian hedgehog but decreased the expression of type 2 collagen, Sox5, and Sox6 . GEN parOA is characterized by features such as cartilage matrix degradation, the production of inflammatory cytokines, apoptosis of chondrocyte and activation of macrophages in the synovial fluid . In an OQUE inhibited unstimulated and IL1\u03b2-stimulated cell proliferation of rheumatoid SFBs, and also the mRNA and protein expression of MMP1, MMP3, and COX-2 . QUE inhIL1\u03b2 stimulation of chondrocytes from mouse condylar cartilage induced apoptosis and upregulated the mRNA expression of COX-2, p65, MMP1, and MMP13 . RES attIL1\u03b2 stimulation of chondrocytes from OA patients increased the mRNA levels of MMP1, MMP3, and MMP13 and protein expression levels of enzymes including COX-2, i-NOS, MMP1, MMP3, and MMP13 compared to the unstimulated cells . These eStimulation with TNF\u03b1 in chondrocytes from OA patients resulted in upregulation of COX-2, MMP1, MMP3, MMP13, and PGE2 production and MMP2 and MMP9 activity . RES attElayyan et al.  demonstrRES inhibited spontaneous PGE2 production in cultured cartilage explants from OA patients and abrogated PGE2 upregulation in IL1\u03b2-stimulated chondrocytes . The resThe Sirt1 protein and mRNA levels in fibroblast-like synoviocytes isolated from RA synovial tissues were lower compared to normal fibroblast-like synoviocytes . RES decIn IL1\u03b2-stimulated human chondrocytes derived from healthy femoral head articular cartilage, CUR and RES synergistically downregulated NF-\u03baB-regulated gene products related to inflammation such as COX-2, MMP3, and MMP9 and apoptosis such as Bcl-2 and Bcl-xL along with suppression of IL1\u03b2-mediated NF-\u03baB activation . These tIn chondrocytes isolated from pig joints, RES inhibited AGE-induced expression of i-NOS and COX-2 and production of NO and PGE2 via inhibition of the IKK-I\u03baB\u03b1-NF-\u03baB and JNK/ERK/AP1 signaling pathways upregulated by AGE . RES alsIn a mouse model of chronic asthma, sensitization with ovalbumin (OVA) induced inflammation dominated by eosinophils, leading to fibrosis and airway remodeling . CUR admBronchoalveolar lavage fluid of OVA-induced asthmatic mice exhibited enhanced activities of MMP2 and MMP9 . IntranaIn the lungs of asthmatic model mice exposed to OVA as an antigen and the endotoxin lipopolysaccharide (LPS) simultaneously, airway inflammation, enhanced production of ROS, increased mRNA expression of MMP9, TIMP1, TGF\u03b21, IL13, type 1 collagen and TLR-4, and activation of MAPK pathway enzymes were observed . The expIn lung tissues from the asthma model mice, mucus production and gene expression of mucin 5B, p38, and MMP9 were elevated, compared to the non-asthmatic mice . EGCG atIn a mouse asthma model that received intranasal administration of toluene diisocyanate, EGCG reduced the total cell number and cell counts of inflammatory cells such as neutrophils, eosinophils, and macrophages as well as ROS and TNF\u03b1 levels in bronchoalveolar lavage fluid, compared to vehicle-treated control mice . In the Studies have demonstrated that CGA, CUR, and EGCG may have beneficial effects on neuroprotection and cognitive function in AD ,86,87,88A 105-amino-acid carboxyl-terminal fragment (CT105) of amyloid precursor protein increased TNF\u03b1 and MMP9 production in interferon-\u03b3-treated human monocytic THP-1 cells . The inhMIF stimulation of synovial RA fibroblasts upregulated gene expression of MMP1 and MMP3  and GEN Cholesterol oxidation products, oxysterols, have been implicated in the pathology of AD . In humaA retrospective study on mild-to-moderate AD patients found that encapsulated RES administered orally for 52 weeks reduced the CSF levels of MMP9, but not those of MMP2, MMP3, and MMP10, compared to the placebo group . The RESIn an animal model of AD, RES reduced A\u03b242 in the hippocampus compared to the control rats; downregulated AGE receptor, MMP9, and NF-\u03baB; and upregulated Claudin-5 . These fSome selected studies on other inflammatory diseases in relation to the polyphenol\u2019s action are as follows. Gastric ulcer is characterized by inflammation, irritation, or erosion in the mucosal lining of the stomach . In indoIn rat IBD induced by 2,4,6-trinitrobenzene sulfonic acid, Motawi et al.  found anIn CUR-treated mucosal biopsies from children and adults with IBD, p38 activation and IL1\u03b2 were downregulated, while IL10 was upregulated . In the Previous data showed that intestinal subepithelial myofibroblasts in patients with CD had an increased oxidative status . In cultLPS promotes the inflammatory reaction of hepatitis. LPS-stimulation of L02 hepatocytes upregulated inflammation-related proteins including MCP1, TNF\u03b1, ICAM-1, VEGF, and MMP2 . EGCG atHuman retinal pigment epithelial cells play a critical role in various retinal inflammatory diseases. TNF\u03b1 increased the mRNA and protein expression of ICAM-1 along with elevation of mRNA and enzyme activity of MMP9 in these cells . QUE attIL1\u03b2 stimulation decreased the content of proteoglycans in cultured adult human articular cartilage, suggesting the elevated degradation of extracellular matrix, and RES reversed the effect. IL1\u03b2 stimulation of human articular chondrocytes resulted in upregulation of gene and protein expression of MMP13 and RES attenuated these effects . RES inhOne important mechanism by which polyphenols exert their anti-MMP activities is likely to be via the downregulation of ROS that promote MMP expression. Another is their direct binding to MMPs, leading to inhibition of enzyme activity.In our previous discussion on the molecular mechanisms of EGCG for its anti-MMPs, the effects on ROS-mediated signaling were highlighted. Since CGA, CUR, GEN, QUE, and RES have similar effects on this signaling as discussed previously, the EGCG-mechanism can be applied to these polyphenols  and FiguAnother important mechanism for MMP inhibition is likely to involve the direct binding of these polyphenols to MMP proteins. In an early stage of polyphenol\u2019s binding to MMPs, affinity chromatography using EGCG immobilized on agarose was used . The resComputational molecular docking analysis (MDA) has provided the structural basis for the interactions between polyphenols and MMPs. Recently, MDA has been applied to reveal the molecular interaction between MMPs and polyphenols.The MDA conducted by Priya et al.  showed tOther studies found similar interactions for QUE\u2013MMP1 binding. An MDA conducted by Xiao et al.  showed tThe binding energy was calculated to be \u22127.15/mol. These findings indicate that these dietary polyphenols have similar binding mode with MMP1 as exemplified by the interaction of CUR, GEN, QUE, and RES with Glu 219, and that of EGCG, QUE, and RES with Asn180.MDA studied by D\u2019Abadia et al.  revealedBased on the crystallographic structure of MMP2, Hosseini et al.  assumed MDA conducted by Ahmad et al.  showed tMDA of the active MMP2-EGCG complex revealed binding cavity of 10 A\u02da around the active site residue Glu404 and that Ala192, Leu399, His403, Glu404, and Met421 are located close to the EGCG binding site . The 15 Comparison of epigallocatechin (EGC) without galloyl group and EGCG showed that EGC has no discernible inhibitory activity against MMP2 . MDA shoFor the interaction between QUE and MMP2, Li et al.  reportedXu et al.  reportedThe results found by Pandey et al.  were som\u22128 M. The two phenyl rings of CUR show \u03c0\u2013\u03c0 interaction with His201 on one side and with His224 and Tyr223 on the other side of the active site pocket. One enol-OH of the CUR midsection interacts with the backbone O of Leu218 by hydrogen bonding. Hydrogen bonds are also formed between phenolic-OH of CUR and backbone N of Leu164 and N of Ala165.Docking analysis revealed that the free energy of binding of the CUR with MMP3 was \u221210.2 kcal/mol  Figure . The estZhang et al.  found thMDA performed by Zhong et al.  showed tIn the MMP9\u2013EGCG complex, amino acid residues with an interaction energy of >5 kcal/mol are Leu187, Leu188, His401, Glu402, and Pro421, and those with an interaction energy > 2 kcal/mol are Ala189, His190, Ala191, Phe192, Val398, Ala399, His405, His411, and Met422 . Among tIn contrast to EGCG, EGC showed no significant inhibitory activity against MMP9 . MDA revMDA showed that the binding energy between QUE and MMP9 is \u22128.82 kcal/mol with a Ki value of 343.46 nM . The catYu et al.  found thMDA and a molecular dynamics simulation lead Saragusti et al.  to preseHuynh et al.  found thMDA showed that EGCG binds to MMP14 with binding free energy of \u221257.61 kcal/mol . The amiIn contrast to EGCG, EGC did not show noticeable inhibitory activity against MMP14 . MDA shoAs shown above, several clinical studies have demonstrated that MMPs are useful as biomarkers for disease severity in serum and other tissue specimens. However, there are some reports that require further studies for confirmation. For example, in psoriatic arthritis patients, the serum MMP1 levels were significantly lower than the control levels . MMP7 mRMost of the basic studies have demonstrated the inhibitory activity of polyphenols against MMPs in inflammatory diseases. However, it is not clear whether polyphenols are useful for prevention and/or therapy and this issue awaits future interventional studies.As for mechanistic aspects, the anti-inflammatory activity of polyphenols can be explained by the antioxidant property. In the ROS-mediated signaling pathways, various transcription factors are downregulated by the action of polyphenols as antioxidants, which leads to the downregulation of gene expressions of MMPs. However, in some cases, the downregulation of transcription factors by polyphenols is not necessarily related to the downregulation of MMP expression. For example, Vicentini et al.  reportedAs mentioned above, miR-145-5p regulates MMP expression in RA, impacting the NF-\u03baB pathway and suggesting its potential role in targeted RA therapies . Our preMDA has provided the structural basis for the interactions between polyphenols and MMPs to understand their MMP inhibitory activity and would be useful in exploring new polyphenol-based drugs with anti-inflammatory property. An example is the finding that MDA showed that in DenCUR, a CUR derivative, oleoyl, and polyethylene glycol moieties can contribute to the increase in two hydrogen bonds to interact with the enzyme, explaining the higher biological activity of DenCUR than CUR  136]. A. A136]. Further advances in technology and research are expected to continue to unravel the detailed interaction between polyphenols and MMPs. The use of emerging computational technologies including quantum mechanical/molecular mechanical simulations ,153, may"
\ No newline at end of file