diff --git "a/deduped/dedup_0951.jsonl" "b/deduped/dedup_0951.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0951.jsonl"
@@ -0,0 +1,100 @@
+{"text": "The pathogenesis of fibrosis in hepatic cirrhosis remains obscure. This study examines the eventual role of angiogenic factors in the fibrotic process. A series of 55 cirrhotic livers was studied for the proliferation state of fibroblasts, and the expression of vascular endothelial growth factor (VEGF), thymidine phosphorylase (TP) and the basic and acidic fibroblast growth factor  in both fibroblasts and hepatic cells. The angiogenic and/or fibrogenic factors VEGF, TP, bFGF, and aFGF were clearly expressed in regenerative hepatocytes, but not in fibroblasts of diffuse hepatic fibrosis. The immunohistochemical findings suggest that angiogenic factors and factors promoting oxidative stress  produced by hepatocytes may contribute to the development of fibrous bands in hepatic cirrhosis. Most cases of cirrhosis are attributable to alcoholicliver disease and chronic viral hepatitis, while less frequentcauses include autoimmune hepatitis, biliary disease, drugs,hemochromatosis, Wilson's disease, The molecular events leading to fibrotic process remain, by and large,obscure in hepatic cirrhosis. The highly vascularized fibrous tissue,surrounding the regenerative hepatic nodules, suggests that angiogenicfactors may be involved in the pathogenesis of the disease. Experimentaldata support such a hypothesis and angiogenic factors expressed byhepatocytes have been implicated as a key event in the development ofhepatic fibrosis \u20133.In the current study, we investigated the expression of angiogenicand fibrogenic growth factors in cirrhotic livers, providingevidence that the overproduction of these factors by hepatocytes,but not stromal cells, may play an important role in thepathogenesis of the disease.Formalin-fixed paraffin-embedded tissues from biopsies of 55patients with fully developed micronodular cirrhosis wereretrieved from the archives of the Department of Pathology,Democritus University of Thrace Medical School, Alexandroupolis,Greece. All cases were of a posthepatitic etiology for thepatients having a long-standing history of chronic viral hepatitisB with a histological activity index ranging from 11 to 18.Furthermore, the cirrhotic livers were characterized by thepresence of an ongoing necroinflammation, mainly in the form ofpiecemeal necrosis. There was, however, no evidence of large-cellor small-cell liver cell dysplasia and no indication ofhepatocellular carcinoma.A standard immunohistochemical technique, with the appropriateantibodies and controls, was applied (a) to assess theproliferation state of fibroblasts and (b) to detect theexpression of various angiogenic and fibrogenic factors\u2014thevascular endothelial growth factor (VEGF), the thymidinephosphorylase (TP), and the basic and acidic fibroblast growthfactors . Details of the immunohistochemicaltechniques , 5 and tImmunohistochemical evaluation was performed by two observers  over the conference microscope. The extent  and the intensity (strong versus weak versus absent) of thecytoplasmic and/or nuclear expression of the proteins analyzedwere recorded at \u00d7200 magnification.Basic fibroblast growth factor (bFGF), aFGF, and VEGFwere expressed diffusely and uniformly in the cytoplasmof hepatocytes throughout the entire cirrhotic liver. In all cases, the intensityof staining was weak, but definitely present (in 100% of casesexamined). In contrast, the adjacent stromal fibroblasts andhepatocytes from normal liver samples were persistently negative.Occasionally, small blood vessels were positively stained.Thymidine phosphorylase (TP), a marker of oxidative stress, wasexpressed strongly to a varying extent by hepatocytes. Nuclear andcytoplasmic expression was noted in 42 out of 55 cases, rangingbetween 5%\u201380% of cells examined. In 19 out of 55(34.5%) cases, the TP expression in hepatocytes was prominent(more than 50% of hepatocytes were stained). Again, the stromawas negative. Hepatocytes from normal liver showed a weak stainingfor TP.The MIB1 proliferation index was of a very low proliferationactivity in fibroblasts. Staining was noted in 14 out of 55cases, with a percentage of positivity not exceeding 2%.Similarly, proliferating activity of hepatocytes was low, rangingfrom 0% to 5%. MIB1 staining was noted in 22 out of 55cases (40%), where 6 out of 55 (11%) exhibited arelatively high expression .There was no association of patterns of expression among the molecularfeatures examined, nor with MIB1 proliferation index.\u03b1 protein accumulation [There is experimental evidence that VEGF plays an important rolein the development of hepatic cirrhosis. Rosmorduc et al., using rats as experimental models, indicated that biliary cirrhosis is associated with hepatocellular hypoxia . VEGF ismulation . Rats trmulation  Similarlmulation . AdminisThe above experimental evidence is confirmed in ourhistopathological study, as VEGF was overexpressed in cirrhotichepatocytes compared to normal liver cells. This finding is alsoin accordance with Shi's et al. recent report . In anotThe expression of both acidic and basic fibroblast growth factorswas also found increased in regenerative cirrhotichepatocytes. The importance of these factors in the development ofthe disease has been previously proposed in the study of Li etal., where high bFGF plasma levels paralleled high VEGF levels incirrhotic patients . bFGF haIn contrast to hepatocytes, fibroblasts were totallyunreactive to the above angiogenic factors. Moreover, theproliferation index, as assessed with the MIB1 monoclonalantibody, was very low. These findings show that the fibroticprocess, as it occurs in the context of cirrhosis, represents aslow fibroblastic response to external stimuli, that is, VEGF andFGF, produced by hepatocytes. Altered fibroblast biology, throughactivation of such genes, does not seem to contribute to theprocess. This suggestion is further supported by the absolute lackof expression of thymidine phosphorylase in fibroblasts, a markerof DNA synthesis and of oxidative stress . TP isfIt is concluded that growth factors such as VEGF, aFGF, and bFGFproduced by hepatocytes in patients with liver cirrhosis may havean important role in the development of hepatic fibrosis throughprogressive stimulation of fibroblasts."}
+{"text": "Hepatic fibrosis is a common outcome of hepatic injury in both man and dog. Activated fibroblasts which develop myofibroblastic characteristics play an essential role in hepatic fibrogenesis, and are comprised of three subpopulations: 1) portal or septal myofibroblasts, 2) interface myofibroblasts and 3) the perisinusoidally located hepatic stellate cells (HSC). The present study was performed to investigate the immunohistochemical characteristics of canine portal myofibroblasts (MF) and HSC in the normal unaffected liver as a basis for further studies on fibrogenesis in canine liver disease.In the formalin-fixed and paraffin embedded normal canine liver vimentin showed staining of hepatic fibroblasts, probably including MF in portal areas and around hepatic veins; however, HSC were in general negative. Desmin proved to react with both portal MF and HSC. A unique feature of these HSC was the positive immunostaining for alpha-smooth muscle actin (\u03b1-SMA) and muscle-specific actin clone HHF35 (HHF35), also portal MF stained positive with these antibodies. Synaptophysin and glial fibrillary acidic protein (GFAP) were consistently negative in the normal canine liver. In a frozen chronic hepatitis case (with expected activated hepatic MF and HSC), HSC were negative to synaptophysin, GFAP and NCAM. Transmission electron microscopy (TEM) immunogold labelling for \u03b1-SMA and HHF35 recognized the positive cells as HSC situated in the space of Disse.In the normal formalin-fixed and paraffin embedded canine liver hepatic portal MF and HSC can be identified by \u03b1-SMA, HHF35 and to a lesser extent desmin immunostaining. These antibodies can thus be used in further studies on hepatic fibrosis. Synaptophysin, GFAP and NCAM do not seem suitable for marking of canine HSC. The positivity of HSC for \u03b1-SMA and HHF35 in the normal canine liver may eventually reflect a more active regulation of hepatic sinusoidal flow by these HSC compared to other species. Hepatic fibrosis is a common outcome of hepatic injury in both man and dog. Depending on the primary site of injury the fibrosis may be restricted to the portal areas as in most biliary diseases or may be present in the hepatic parenchyma as seen in chronic hepatitis and cirrhosis. Chronic hepatitis is often diagnosed in pet-dogs. Treatment provides only limited results and the underlying mechanism of fibrosis is unclear. Activated fibroblasts which develop myofibroblasts (MF) characteristics play an essential role in hepatic fibrogenesis . Three dAlthough portal and interface MF have been considered to have fibrogenic potential ,8, most 4 intoxication model [HSC have species-specific immunohistochemical expression profiles. All HSC express vimentin (rat), desmin (rat) and actin (man and rat), but alpha-smooth muscle actin (\u03b1-SMA) is classically considered as an indicator of activation (man and rat) ,9,11. Hoon model .The purpose of this study was to investigate immunohistochemical characteristics of canine portal and interface MF and HSC in the normal unaffected liver, as a basis for further studies on fibrosis in canine liver disease.Routine haematoxylin and eosin (H&E) sections in all dogs revealed a normal liver. With large individual differences, presumptive vitamin A-storing HSC were regularly seen with a single large vacuole (vitamin A-storing lipid droplet) and a dislocated nucleus. HSC without a vitamin A-storing vacuole (\"empty HSC\") could not be identified on H&E sections. In immunostaining, negative controls were negative.There was strong variation between slides. In the portal area, vimentin showed positive staining cells in smooth muscle cells of portal vasculature, most spindle-shaped stromal cells and neural cells Fig. . Cells iThere was also marked variation between slides. In general, HSC were weakly positive in the perinuclear cytoplasm, but vitamin A-storing HSC were predominantly negative Fig. . In the Consistently in all slides, this marker showed a slightly irregular (1\u20133 \u03bcm wide) moderate staining in the perisinusoidal spaces throughout the hepatic parenchyma Figs. , and witStaining for this marker generally rendered similar results as \u03b1-SMA, consistently in all slides. In the portal areas, the terminal and sublobular hepatic veins, and in Glisson's capsule identical staining was observed. In the hepatic parenchyma moderate positive staining was seen in the HSC Figs. . In compIn formalin fixed normal canine liver tissue GFAP staining revealed few positive nerves located in larger portal areas  but no other positive staining was observed in any other location in these sections. Despite strong staining for synaptophysin in the adrenal medulla , no staining was observed in any of the formalin fixed normal liver sections. In the frozen chronic hepatitis case (with expected activated hepatic MF and HSC), only nerves in larger portal areas reacted positively to GFAP and NCAM, while synaptophysin did not provoke any signal at all.Transmission electron microscopy (TEM) for \u03b1-SMA and HHF35 revealed a strong granular cytoplasmic staining restricted to subendothelial cells with long cytoplasmic extensions located in Disse's space Figs. . These cNo antibody used in this study is species specific for the dog, but they still can be used due to interspecies cross-reactivity. All antibodies have been used previously in multiple other canine studies -26.Variation in vimentin and desmin staining pattern was widely present. This might be due to the varying epitope sensibility, caused by the intrinsic patient material variability regarding time of postmortal sampling and fixation, the age of the paraffin blocks, and age, sex and breed variation of the animals. However, the used material reflects similar variability in intended patient populations to be studied for spontaneously occurring hepatic fibrosis, and thus provides useful insight in normal baseline variation.In the formalin fixed paraffin embedded normal canine liver vimentin staining did not differentiate between fibroblasts and MF in the portal area and the perivenous stromal tissue. Moreover, HSC stained generally negative. Therefore, we conclude that vimentin antibody is not useful in paraffin sections as a marker for canine portal MF or HSC. Desmin stained MF in the portal area, around the sublobular hepatic vein and in Glisson's capsule. HSC stained inconsistently, with large variation between slides, so we conclude that desmin is not a sensitive marker for canine HSC. This is in contrast to man , but in In our laboratory, both \u03b1-SMA and HHF35 do identify myoepithelial cells in canine mammary gland. These monoclonal antibodies recognise different epitopes: a NH2 terminal decapeptide (\u03b1-SMA), and \u03b1 and \u03b3 muscle actin (HHF35). The chance of formalin-induced epitope masking was regarded smaller by use of two different monoclonal antibodies for the same peptide. Therefore, both markers were investigated in related (regarding possible contractility) cells in the liver, being HSC and portal MF. In formalin fixed paraffin sections these cells can be easily identified in the normal canine liver by immunohistochemical staining for both \u03b1-SMA and HHF35. Both antibodies produced almost identical results and stained both solitary MF in the portal areas as well as HSC in the hepatic parenchyma. The presence of small lipid vacuoles in positively staining perisinusoidal cells as well as the TEM immunohistochemical results confirms the nature of the latter cells as HSC. The vitamin A-storing HSC usually stained positive for \u03b1-SMA but reacted only rarely to HHF35, suggesting differentiation in staining characteristics between less contractile vitamin A-storing HSC and more contractile HSC. The present finding of \u03b1-SMA reactivity which was diffusely present throughout the hepatic parenchyma in the normal canine liver is in contrast with findings in normal human and rat liver, where the majority of hepatic lobules are devoid of \u03b1-SMA positive HSC, or only show weak positivity ,9,12. InDebate still exists regarding the contribution of non-activated quiescent HSC to sinusoidal blood flow and blood pressure in man and rat ,11. Our Despite positive staining of HSC for \u03b1-SMA in normal dogs reflecting contractility we feel it appropriate to regard these cells as \"quiescent\" HSC. This is in line with other species as HSC are most likely not activated in the sense of enhanced matrix- or TGF-\u03b2 production. In the dog discrimination between quiescent and activated HSC does not seem possible with antibodies directed against \u03b1-SMA and HHF35. However, morphological changes or functional changes such as increased cell size, loss of lipid vacuoles and enhanced production of TGF-\u03b2 and other substances may be helpful.The absence of reactivity of portal MF and HSC in the normal canine liver to synaptophysin and GFAP indicates that in contrast to man and rat ,3,6, canIn formalin fixed paraffin sections, canine portal MF and HSC can be identified by \u03b1-SMA, HHF35 and to a lesser extent desmin immunostaining. In contrast to man, these cells are consistently negative for synaptophysin, GFAP and NCAM, both in formalin-fixed paraffin embedded tissue, as well as in frozen sections. Alpha-SMA and HHF35 positivity of HSC in the normal canine liver may reflect a more active regulation of hepatic sinusoidal flow by these cells compared to other species. Alpha-SMA and HHF35 can be used for further studies on hepatic fibrosis in the dog.Normal liver tissue was obtained from ten dogs for immunohistochemistry: either patients with liver unrelated pathology (n = 8) or normal control animals euthanized for liver-unrelated research projects (n = 2). Laboratory exams regarding liver function were not performed. One frozen sample of a dog with chronic hepatitis was additionally used. Patients were submitted for their individual diagnostic purposes to the Department of Clinical Sciences of Companion Animals, or to the Department of Pathology, Faculty of Veterinary Medicine, Utrecht University. No tissue was taken purposely for the reported study. Projects were approved by the responsible ethical committees for the use of experimental animals and for use of client-owned animals according to Dutch legislation. After euthanasia as part of the research projects, we were allowed to take liver tissue of the two control animals. Included were six females and four males. Mean age was 13 months (\u00b1 15 months).2O2 in methanol for 30 min at RT. As the protocols for demonstration of desmin and synaptophysin required an antigen retrieval step [Liver specimens were taken within 1 hour post mortem (n = 9), or in a surgical biopsy procedure (n = 1). The normal liver samples were fixed in 10% neutral buffered formalin and routinely embedded in paraffin, while the chronic hepatitis sample was snap-frozen in liquid nitrogen cooled isopentane and stored at -70\u00b0C. Sections (3 \u03bcm) were stained with haematoxylin and eosin for routine histology. Immunohistochemistry was performed for \u03b1-SMA, HHF35, desmin, vimentin, GFAP and synaptophysin on all normal liver sections, the frozen sections (chronic hepatitis) were subjected to GFAP, NCAM and synaptophysin immunohistochemical staining. Antibody characteristics, manufacturer, source and dilution are given in Table val step ,21 sectiFor TEM, additional liver samples were taken from two female dogs, three and seven years old. Both were normal control animals euthanized for liver-unrelated research projects. Projects were approved by the responsible ethical committees for the use of experimental animals as required under Dutch legislation. After euthanasia as part of the projects, we were allowed to take liver tissue. Liver samples were taken immediately postmortem, fixed in 4% paraformaldehyde for 2 days, subsequently washed and transferred in methanol to an auto freezing device from Reichert. Freeze substitution was performed 36 h at -85\u00b0C in methanol, temperature was gradually raised in 5\u00b0C-steps to -45\u00b0C, followed by serial substitution from methanol to Lowicryl HM20 from methanol:HM20 = 2:1 (2 \u00d7 1 h) to methanol:HM20 = 1:2 (2 \u00d7 1 h) and pure HM20 2 h at -45\u00b0C. Polymerisation was performed for 36 h at -45\u00b0C, then temperature was raised in 5\u00b0C-steps for 13 h up to 20\u00b0C. Temperature stayed 20\u00b0C for 150 h all under UV-light. After ultrathin sectioning grids were labelled according to the procedure for single labelling. Free aldehyde groups were blocked in 50 mM glycine in PBS for 15 min, followed by 30 min aurion blocking solution for goat gold conjugates and washed in BSA-c buffer , 3 \u00d7 5 min. Overnight incubation of the primary antibodies \u03b1-SMA and HHF35 diluted in BSA-c buffer (1:1200 and 1:300 respectively) was followed by BSA-c buffer wash (6 \u00d7 5 min) and incubation of goat-anti-mouse IgG ultra small gold diluted 1:50 in BSA-c buffer (2 h). BSA-c buffer wash (6 \u00d7 5 min) and PBS wash (3 \u00d7 5 min) was done previous to postfixation in 2% glutaraldehyde in PBS (5 min), followed by wash in PBS (5 min) and distilled water (5 \u00d7 2 min). Signal enhancement was done using Aurion R-Gent SE-EM (30 min), and subsequent washing in distilled water (5 \u00d7 2 min). Grids were then stained with uranyl acetate and lead citrate. For sample evaluation a Philips CM 10 TEM was used.The author(s) declare that they have no competing interests.JY histochemically examined all slides and TEM findings, and wrote the manuscript. TR participated in study design and coordination and helped to draft the manuscript. RM stained all slides immunohistochemically. TU performed TEM studies. LP and JR conceived the study, participated in its design and helped to draft the manuscript. TI examined the slides and TEM findings, participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript."}
+{"text": "The messenger RNAs for the angiogenic acidic and basic fibroblast growth factors are expressed at a significantly higher level in samples of human benign neoplastic and hyperplastic tissue than in samples from breast cancers. However, approximately one in four malignant breast cancer samples contain basic fibroblast growth factor mRNA at the same level as in the benign lesions when basic fibroblast growth factor mRNA levels are corrected with respect to levels of expression of glyceraldehyde-3-phosphate dehydrogenase mRNA. A similar proportion of human malignant breast cancer cell lines express a high level of basic fibroblast growth factor mRNA. The results suggest that some malignant breast cancers and their constitutive carcinoma cells express abundant levels of basic fibroblast growth factor mRNA. The resultant production of basic fibroblast growth factor by breast cancer cells within some tumours may contribute to their development."}
+{"text": "Recent studies have cast doubt on the effectiveness and efficiency of school based dental screening programmes in improving dental attendance or improving dental health. In 2002 the National Dental Inspection Programme was introduced in Scotland which categorises children by their dental health and informs parents of the findings via a personalised letter home and encourages dental registration. In addition, epidemiological data for local and national planning purposes is collected. This replaced an earlier school screening system in Lothian where a generic letter urging registration was sent to children who were identified as not being registered with a dentist. The objective of this study is to compare dental registrations rates among unregistered children in these two school inspection systems with a system where letters were sent home but no dental inspection was carried out.The study was designed as a single blinded, cluster randomised, controlled trial involving 12,765 12\u201313-year-old children attending all 65 state Secondary schools in Lothian and Fife during the academic year 2003/4.After stratifying for school size and range of social deprivation, schools were randomly allocated to one of four groups:1. 'Traditional' inspection, letter to unregistered children only,2. Letter sent home to unregistered children only, no inspection,3. National Dental Inspection Programme, letter to all children,4. Control group in which the children were neither inspected nor sent a letter.Dental Registration status was compared at baseline and 3 months post inspection.The registration levels in both the 'Traditional' screening and the NDIP inspection groups rose 3 months post inspection (14% and 15.8% respectively) but were not significantly different from one another or the control group which rose by 15.8% (p > 0.05). The group who were sent a letter home but were not inspected also has a rise in registration levels of 18.1% which was not significantly different from either of the groups who were inspected or the control group (p > 0.05). The only significant predictors of registration were previous registration (p < 0.05) and within those who previously registered, the length of time since last registration (P < 0.001).Neither of the two dental inspection methods nor a letter home to unregistered children resulted in a significant rise in registration rates in 12\u201313-year-olds compared to a control group of children who received no intervention. The effectiveness of the school dental screening programme in increasing registration levels has previously been investigated in 3 RCTs -3. In thIn the academic year 2002/3 a uniform National Dental Inspection Programme (NDIP) was introduced across Scotland . The NDIPrior to this, each NHS Board Community Dental Service (CDS) had run differing screening programmes. The national guidance allowed for dental inspections up to three times in the child's school career. Between NHS Boards there were great variations in inspection frequencies, ages of children inspected, data collection protocols and information sent home. In Lothian and Fife, the CDS had developed links with the local education departments and the Scottish Dental Practice Board in order to electronically match school rolls with dental registration data and thus identify primary and secondary school children who were not registered with a GDP. This system is thought to be unusual in being able to identify named individuals and validate their \"official\" dental registration status rather than relying on anecdotal parental feedback or hand checking of records. After the clinical inspection these unregistered children were then sent a personalised letter urging them to register with a dentist and also a list of local NHS dentists.To evaluate the relative effect of this pre-existing Lothian and Fife system, which is referred to as 'Traditional' throughout the paper, in increasing registration rates in General Dental Practice and compare this with the newly introduced NDIP a study was designed to compare changes in registration rates in General Dental Practice in three groups of 12\u201313-year-old children  There is no difference between the two inspection methods  in terms of changing registration,b) The 'Traditional' school screening programme (inspection plus letter) confers no additional benefit on increasing dental registration to sending a letter alone,c) Sending home letters prompting registration to children confirmed as being unregistered, without conducting a dental inspection, has no effect on dental registration levels.The main outcome was whether or not children who were unregistered at baseline had become registered 3 months later. Unregistered children fall into two categories, those who have never been registered and those whose previous registration has lapsed. As by the age of 12 these two subgroups within the unregistered population may behave differently regarding registration a secondary analysis was conducted splitting the two groups.The study was designed as a cluster randomised, controlled trial in which the unit of randomisation was the school. In such a trial, the power to detect effects of the interventions depends on both the number of schools and the numbers of children per school, and is a complex function of these and the between- and within-school variation in effect sizes. However the relatively large number of children per school, (range 86\u2013275) meant that the power was likely to be dominated by the number of schools and the variation between schools in the magnitude of the intervention effects. A sample size of approximately 40 schools would be expected to have 80% statistical power to detect a mean difference between intervention and control groups of about one standard deviation in between-school variation. Good power to detect a true mean difference of 10% in take-up rates would require a variation of less than 10% between schools in mean take-up rates resulting from school-specific factors not explained by measurable factors such as deprivation.For the purpose of this study, first year students in all state secondary schools (n = 61) in Lothian and Fife were identified  in 2004. All the schools in the sample agreed to participate in the study and the study was approved by the local research ethics committee.After stratifying for size of school and range of social deprivation using the Scottish Index of Multiple Deprivation , the schFollowing accepted standards in Scotland, in both groups where the children were dentally inspected (1&3) pre-inspection letters were sent home to the parents explaining that their child was to be dentally inspected at school and offering the chance for them to request that their child be exempted from inspection. Children were also at liberty to refuse a dental inspection on the day. A team of 4 community dental officers conducted all inspections starting in February 2004 following protocols according to the allocated group for each school .Immediately prior to the interventions, the registration status of each child was identified by electronically matching the school lists obtained from the Lothian and Fife Education departments against the dental registration database  held by Dental Practitioner Services within the Common Services Agency of the NHS in Scotland.Each child was categorised as registered, lapsed or never registered. The time since registration had lapsed was also recorded. The relevant CDS treatment databases were searched and any children in the \"unregistered group\" found to be under treatment with the CDS in Lothian or Fife were excluded from further analysis.Only those originally identified as being unregistered (i.e. lapsed or never registered) were analysed. Three months following the interventions changes in registration status were investigated. A further analysis was included to investigate for differences in children who had never been listed as registered with an NHS GDP and those whose had been at one time registered (lapsed more than 9 months). This period was chosen to allow for those individuals whose lapse in registration was only \"temporary\" and who intended to maintain their registration with the GDS. Also those who had been lapsed for more than 9 months as 2 years would have passed since their last dental inspection which is the maximum recommended period between routine dental check-ups.Significance tests and confidence intervals for effect sizes were calculated by multilevel modelling using MlwinN software, which allowed the inclusion of predictors of registration rates at both the individual subject level and the school level, and also took appropriate account of the different numbers of children in each school.At baseline, of the total S1 population in Lothian and Fife  two thirds were registered (n = 8448) and, of the remaining third, 394 were receiving treatment from the CDS. Excluding these children left 3923 in the primary analysis.Table The registration levels in both the 'Traditional' screening and the NDIP inspection groups rose 3 months post inspection (14% and 15.8% respectively) but were not significantly different from one another or the control group which rose by 15.8% (p > 0.05). The group who were sent a letter home but were not inspected also has a rise in registration levels of 18.1% which was not significantly different from either of the groups who were inspected or the control group (p > 0.05).In the multi-level modelling, among the children who were unregistered at baseline, but who had previously been registered, the most significant predictor of registration at 3 months was the length of time they had been lapsed (P < 0.001), while other predictors tested at pupil level (deprivation score) or school level  were not significant. Figure In the 3,923 children who were not registered at the start of the study, 1,323 had previously registered and had lapsed for less than 9 months; these were treated as registered as previously described. Therefore, the analysis in this study was completed on a total of 2,600 children within 61 clusters (schools). Of these, 882 had been lapsed for more than 9 months and 1,718 had never been registered.The final multilevel model included length of time lapsed as a pupil-level predictor together with study group as the school-level predictor, and the following null hypotheses were tested by comparing study groups:1. There is no difference between the two inspection methods  in terms of changing registration (Group 1 compared with Group 3),2. The 'Traditional' school screening programme (inspection plus letter) results in no more dental registration than sending a letter alone (Group 1 compared with Group 2),3. Simply sending home personalised letters prompting registration  has no effect on dental registration levels (Group 2 compared with Group 4).No statistically significant differences were found to reject the null hypotheses.The secondary analysis looked at differences in the responses to the interventions between those who were once registered (lapsed) and those who were never registered Table . Among tThis study found that there was no significant increase in registration among children who were not registered with a GDP at baseline in any of the four groups. Neither of the two inspection methods  nor a letter sent home to unregistered children prompted statistically significant increases in registration. The findings of our study are in line with the recent large scale study in England who also found that none of their similar interventions were successful in increasing registration rates . The preNeither of these studies discussed any difference between \"lapsed\" and \"never registered\" in the unregistered group. When the two groups were compared in this study there was a significant difference in these two groups of children, with a higher level of re-registration in the group who had lapsed in all 4 groups. In these lapsed children, the time since they lapsed was the strongest predictor of re-registration Figure  however One of the unique features of this study is that the use of the MiDAS database allowed follow-up of children's registration status not only within Lothian and Fife but across the whole of Scotland. Since migration out of Scotland is very low in the 0\u201315 age group  it is unIt should be noted that this study was conducted using a cohort of 12\u201313-year-old children and the findings may not be found within other age groups. This age group however has been identified as exhibiting an increase in the proportion of untreated dental decay  and it hAccuracy in determining registration status has been reported to be problematic. Early studies in this area relied either on parental feedback via a questionnaire to determine registration status ,3, involIt is not only difficult to increase dental registration in this age group, but it has also been suggested that registration with a GDP does not equate with a healthy attendance pattern . More imRecent guidance from the National Screening Committee (NSC) states that three questions need to be answered in relation to school-based dental screening programmes . First, In conclusion, neither of the two dental inspection methods nor a letter home to unregistered children resulted in a significant rise in registration rates in 12\u201313-year-olds compared to a control group of children who received no intervention. Registration with the GDS was more likely in the sub-group of children who had previously registered with a dentist and subsequently lapsed than in those who had never registered. Further study is needed to monitor the effectiveness of other methods of improving treatment rates following referral such as the Scottish CHILDSMILE programme.The authors declare that they have no competing interests.CJC conceived of the study, participated in its design and coordination and drafted the manuscript with GVAT. RE participated in the design of the study and carried out the statistical analysis and commented on the draft manuscript. GVAT participated in the design of the study and drafted the manuscript with CJC. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Increased amino acid availability stimulates muscle protein synthesis, however, aged muscle appears less responsive to the anabolic effects of amino acids when compared to the young. We aimed to compare changes in myofibrillar protein synthesis (MPS) in elderly men at rest and after resistance exercise following ingestion of different doses of soy protein and compare the responses to those we previously observed with ingestion of whey protein isolate.13\u2009C]leucine and L-[ring-13\u2009C6]phenylalanine and skeletal muscle biopsies were used to measure whole-body leucine oxidation and MPS over 4\u2009h post-protein consumption in both exercised and non-exercised legs.Thirty elderly men (age 71\u2009\u00b1\u20095 y) completed a bout of unilateral knee-extensor resistance exercise prior to ingesting no protein (0\u2009g), or either 20\u2009g or 40\u2009g of soy protein isolate . We compared these responses to previous responses from similar aged men who had ingested 20\u2009g and 40\u2009g of whey protein isolate (W20 and W40). A primed constant infusion of L-[1-P\u2009=\u20090.003). Rates of MPS for S20 were less than W20 (P\u2009=\u20090.02) and not different from 0\u2009g (P\u2009=\u20090.41) in both exercised and non-exercised leg muscles. For S40, MPS was also reduced compared with W40 under both rested and post-exercise conditions (both P\u2009<\u20090.005); however S40 increased MPS greater than 0\u2009g under post-exercise conditions (P\u2009=\u20090.04).Whole-body leucine oxidation increased with protein ingestion and was significantly greater for S20 vs. W20 (The relationship between protein intake and MPS is both dose and protein source-dependent, with isolated soy showing a reduced ability, as compared to isolated whey protein, to stimulate MPS under both rested and post-exercise conditions. These differences may relate to the lower postprandial leucinemia and greater rates of amino acid oxidation following ingestion of soy versus whey protein. Ageing is associated with sarcopenia  that ultThe mechanisms underpinning the differential capacity of proteins from different sources to support increased rates of protein synthesis are not fully understood . Whey prKnowledge of the capacity of proteins from different sources to stimulate MPS in the elderly is warranted in view of the importance of preserving skeletal muscle mass in ageing. Therefore, the aim of the current study was to examine the effects of different doses (20\u2009g and 40\u2009g) of soy protein isolate on MPS at rest and following the potent anabolic condition of resistance exercise in elderly men, and compare these findings to our previous work examining the effects of graded intakes of whey protein isolate on MPS in the elderly .2) were recruited to participate in the study and were randomly assigned to one of three treatment groups that were counterbalanced for body mass, age, and self-reported physical activity levels. Participants were light-to-moderately active, non-smokers, non-diabetic, and considered generally healthy based on responses to a routine health screening questionnaire. Participants taking medications controlling blood pressure were allowed into the study. The characteristics of the whey protein treatment groups  have been reported previously  leucine (7.6\u2009\u03bcmol\u00b7kg-1) and L-ring-13\u2009C6 phenylalanine  were introduced, before a continuous infusion of L-[1-13\u2009C] leucine (7.6\u2009\u03bcmol\u00b7kg-1\u00b7h-1) and L-ring-13\u2009C6 phenylalanine was initiated (0.05\u2009\u03bcmol\u00b7kg-1\u00b7min-1). Arterialized blood samples were obtained by wrapping the forearm in a heating blanket (45\u00b0C) for the duration of the infusion; a procedure we have found completely arterializes venous blood sampled from a hand vein. Blood samples were processed as previously described [13\u2009C] leucine and 8% with 13\u2009C6 phenylalanine to minimize disturbances in isotopic steady state; an approach that we have validated [t\u2009=\u20090\u2009min and the isotopic infusion was continued until t\u2009=\u2009240\u2009min. During the remainder of the infusion, arterialized blood and breath samples were obtained to confirm steady state and measure leucine oxidation and MPS as previously described [t\u2009=\u2009240\u2009min) muscle biopsies were obtained (described below).Participants reported to the laboratory at ~0700 in a 10\u2009h post-absorptive state. Upon arriving at the laboratory, a baseline breath sample was collected to measure alidated . Completvastus lateralis muscle from both exercise and non-exercised legs using a 5-mm Bergstrm needle , under 2% local anaesthesia by xylocaine. Muscle biopsies were freed from any visible blood, fat, and connective tissue and rapidly frozen in liquid nitrogen until further analysis.Muscle biopsy samples were obtained from the ring13\u2009C6 phenylalanine enrichments were determined as previously described [Plasma L-escribed . Blood aescribed . Plasma Myofibrillar enriched protein fractions were isolated from ~30\u2009mg of wet muscle as described previously . IntraceThe fractional synthetic rates (FSR) of myofibrillar proteins were calculated using the standard precursor-product method:p2 and Ep1 are the protein bound enrichments from muscle biopsies at 240\u2009min and baseline plasma proteins, respectively. The difference represents the change in bound protein enrichment between two time points; Eic is the mean intracellular phenylalanine enrichment from the biopsies; and t is the tracer incorporation time. The utilization of \u2018tracer naive\u2019 subjects allowed us to use the pre-infusion blood sample  as a surrogate baseline enrichment of muscle protein; an approach we have previously validated [where Ealidated  and thatalidated . Previoualidated  to be va13\u2009C-label in expired CO2 using the reciprocal pool model with fractional bicarbonate retention factors of 0.7 and 0.83 for fasted (0\u2009g protein) and fed (S20 and S40) states, respectively [Leucine oxidation was calculated as described in our previous publications ,8 from tectively . The areectively ,8.F ratio by ANOVA, a Tukey\u2019s honestly significantly different test, with adjustment for multiple comparisons, was used for post hoc analyses. Significance was set at P\u2009\u2264\u20090.05. All statistical analyses were performed using SPSS 17 for Windows.A 3-way ANOVA with both between (protein dose and protein source), and within (condition) subject factors was used. When a 3-way interaction was found ) analyses of variance was used to examine individual time and dose effects and isolate significant pairwise differences by calculating critical differences and by comparisons of means accounting for differences in the means by time. Following observation of a significant There were no between-group differences in age, body weight, body composition, SPBB or other subject characteristics Table . DietaryPlasma insulin concentration was similar for all groups at 0, 3 and 4\u2009h post-drink. At 1\u2009h post-drink, insulin concentration had increased by ~2.6- and 4-fold for W20 and W40, and ~2.2 fold for both S20 and S40 . There were no differences in leucine oxidation between S40 and W40 . In the exercised condition, myofibrillar FSR was no different for S20, but increased for S40 when compared to the 0\u2009g group. However, the response of MPS to soy was less than that of whey at both protein doses in the exercised condition  was unchanged in response to ingestion of soy protein in both the S20 and S40 group, but increased in response to whey in both the W20 and W40 group Figure . As suchIn the present study, we show that ingestion of 20\u2009g (S20) and 40\u2009g (S40) of soy protein isolate does not stimulate increased rates of MPS under resting conditions in the elderly. However, when combined with the potent anabolic stimulus of resistance exercise, 40\u2009g but not 20\u2009g, of soy protein isolate has a modest effect on increasing post-exercise rates of MPS when compared to a group who performed resistance exercise without subsequent protein intake Figure . These dWe have previously reported that soy protein is less effective than whey  and boviIn the present study, we observed protein source-dependent differences in rates of leucine oxidation Figure . When exThe mechanisms underpinning the \u2018anabolic resistance\u2019 of elderly muscle to nutrient provision are not entirely clear. Given the results of the current study, and previous studies demonstrating that MPS responds favorably to higher doses of protein in the elderly ,12 as coIn summary, we report that soy protein isolate is relatively ineffective in its capacity to stimulate MPS in the elderly when compared to whey protein. The mechanisms underpinning the reduced anabolic effect of soy as compared to whey likely relate to its relatively lower leucine content (~12% in whey and ~8% in soy)  and reduMPS, myofibrillar protein synthesis; S20, 20\u2009g soy protein isolate; S40, 40\u2009g soy protein isolate; SPPB, short physical-performance battery; W20, 20\u2009g whey protein isolate; W40, 40\u2009g whey protein isolate.YY, TACV, NAB, LB, MAT, and SMP declare that they have no competing interests.YY and SMP designed the research; YY, TACV, NAB, MAT and SMP conducted the research; YY and SMP analyzed the data; YY, TACV, LB, and SMP wrote and edited the manuscript; SMP had primary responsibility for the final content. All authors read and approved the final content.Table S1. Participants\u2019 dietary intake. (PDF 129 kb)Click here for fileTable S2. Amino acid profiles of the whey  and soy  protein drinks .Click here for file"}
+{"text": "In resolving the vertebrate tree of life, two fundamental questions remain: 1) what is the phylogenetic position of turtles within amniotes, and 2) what are the relationships between the three major lissamphibian (extant amphibian) groups? These relationships have historically been difficult to resolve, with five different hypotheses proposed for turtle placement, and four proposed branching patterns within Lissamphibia. We compiled a large cDNA/EST dataset for vertebrates (75 genes for 129 taxa) to address these outstanding questions. Gene-specific phylogenetic analyses revealed a great deal of variation in preferred topology, resulting in topologically ambiguous conclusions from the combined dataset. Due to consistent preferences for the same divergent topologies across genes, we suspected systematic phylogenetic error as a cause of some variation. Accordingly, we developed and tested a novel statistical method that identifies sites that have a high probability of containing biased signal for a specific phylogenetic relationship. After removing putatively biased sites, support emerged for a sister relationship between turtles and either crocodilians or archosaurs, as well as for a caecilian-salamander sister relationship within Lissamphibia, with Lissamphibia potentially paraphyletic. EarFor amphibians, several morphological and physiological characters, including pedicellate teeth and cutaneous respiration, suggest frogs, salamanders, and caecilians share a common origin Both turtles and lissamphibians have ancient divergences within vertebrates  In this study, we address two difficult phylogenetic questions in the vertebrate phylogeny: the placement of turtles among amniotes and the relationships among frogs, salamanders, and caecilians. Minimizing stochastic error requires acquiring a sizeable dataset suitable for testing the hypotheses of interest. We do this in our study by compiling one of the largest datasets for vertebrate phylogenetics to date (75 genes for 129 taxa). Systematic error is more difficult to address and not solvable by acquiring additional data http://dx.doi.org/10.5061/dryad.25j6h.We obtained DNA sequences of 75 protein-coding genes for 129 taxa from 1) online genomic resources and 2) targeted sequencing of new samples We inferred gene trees for each gene using maximum likelihood (RAxML); each hypothesis for both the turtle placement and lissamphibian relationships was supported by subsets of these individual gene trees . For theFor the phylogenetic placement of turtles, results from concatenated datasets were generally consistent within, but differed between, each data transformation , Table 1For the lissamphibian question, phylogenetic analyses for N12, DEGEN1, and AA often recovered different relationships, but most AU tests did not exclude any of the four major hypotheses. The NUCL data-type was unique in that the recovered topology had no two lissamphibian groups monophyletic , but of Results from phylogenetic analyses and AU tests performed on the \u2018slow genes\u2019 dataset are summarized in Unstable (rogue) taxa in a phylogeny can affect phylogenetic inference. Removal of these taxa can improve phylogenetic results by increasing resolution and/or support values Initial phylogenetic results were inconclusive, possibly due to conflicts between phylogenetic and non-phylogenetic signal. Features of the data that may be correlated with biases in phylogenetic reconstruction include site-specific rates of evolution (site-rates), as well as heterogeneities between clades in GC content (%GC) and amount of missing data (%missing) We validated our approach on simulated data and a previously published biological dataset To further validate our approach, we used a dataset of eight gene concatenates addressing the Ecdysozoa-Coelomata controversy We computed site-wise descriptive statistics and most likely topologies for the NUCL dataset. As our method focuses on specific phylogenetic questions, we performed filtering of biased sites twice, once for the turtle question and once for the Lissamphibia question, producing two different sets of alignments.We find that DFA accurately predicts the most likely topology for 47% of the sites for Lissamphibia, and 36% of the sites for turtles. DFA is able to predict the topology with the highest site likelihood more accurately than the control  . The preInterestingly, the ability of DFA to predict the preferred topology at a site varies by topology. In lissamphibians, DFA is most able to predict the Procera topology (1.98\u00d7 more accurately than the control predictor) and least able to predict the Batrachia topology (1.43\u00d7). In turtles, DFA is most able to predict the Lepidosaur topology (3.62\u00d7) and least able to predict the Archosaur topology (0.66\u00d7) . For eacBased on the performance of DFA-filtering when analyzing simulated as well as empirical data, we performed two DFA analyses: three types of descriptive statistics  or two types (excluding %GC). We generated several alignments by removing the 10%, 20%, 30%, 40%, or 50% most confidently predicted (i.e. most suspect) sites from the alignment for the turtle and Lissamphibia analyses, and generated phylogenies from these sub-sampled alignments as well as alignments of the discarded sites. For turtles, all phylogenetic analyses and topology tests based on DFA-filtering using all three descriptive statistics support turtles as the sister group to crocodilians . FiltereFrom the four alignments with the 10% most suspect data removed, one for each combination of taxonomic question and number of DFA predictor types (2 or 3), we can exclude all but four possible topologies relating major vertebrate groups. We combine these trees to produce a consensus phylogeny, with relationships within amniotes from the turtle datasets and deeper vertebrate relationships from the lissamphibian datasets. The consensus phylogeny of higher-level vertebrate relationships from our study is in Previous studies of the vertebrate phylogeny have resulted in ambiguity regarding the phylogenetic placement of turtles within amniotes and the interrelationships within Lissamphibia , in partPast studies have hypothesized five different phylogenetic positions for turtles in the amniote phylogeny, with the most recent molecular studies debating between the turtle-lepidosaur Recent results An important question in turtle biology is how and when its unique, shelled body plan evolved. Previous work suggested parareptilian (Anapsida) groups as the extinct ancestor of turtles Ancestral amphibians appear in the fossil record starting in the late Devonian and are extremely diverse in the Palaeozoic. However, a large gap in the fossil record exists between Palaeozoic amphibians and lissamphibians, with the exception of Stereospondyls extending into the Mesozoic The most recent molecular study based on mitochondrial genomes and eight nuclear genes A common notion in molecular systematics is that the solution to resolving difficult relationships is to include ever increasing amounts of data. This belief is based on the idea that true phylogenetic signal will eventually dominate and drive the results of an analysis, circumventing any methodological problems. However, our results suggest that inclusion of more data can introduce biased signal into a dataset, resulting in a lack of resolution or even misleading inferences, a possibility also raised by others Proper modeling of molecular evolution and evaluation of the fit between data and model seem to be just as important as the amount of data present in a study. With the advent of new technologies that produce sequence data faster and more cheaply than ever before, datasets will only become larger, and issues relating to signal quality will become even more important in molecular systematics. We view our DFA approach as an important step towards the goal of objectively identifying non-phylogenetic signal in large datasets.With increasingly large datasets being gathered for phylogenetics, many relationships have been confidently resolved. What remains are controversial, difficult to resolve phylogenetic questions, probably arising from conflicting and biased phylogenetic signal in the data. We developed a method for identifying and minimizing biases from molecular data to tackle two persistent yet fundamental problems in vertebrate phylogenetics: the placement of turtles within amniotes and the interrelationships within Lissamphibia. Based on tests of our filtering method on simulated and empirical datasets, we believe that we are able to reduce the amount of conflicting signal in datasets. For the vertebrate phylogeny, the application of this filtering method results in analyses that support turtles being closely related to archosaurs, as either the sister group to crocodilians or archosaurs, and a caecilian-salamander sister relationship, with the possible paraphyly of Lissamphibia. Because of our use of a new statistical approach, we view our results to be tentative and encourage more work from paleontologists and molecular biologists alike to further evaluate these hypotheses and methodology. Given the importance of the historical framework provided by phylogenetic systematics in fields as diverse as developmental biology, genomics, conservation biology and paleontology, we believe approaches like ours will be useful to resolve major phylogenetic questions and advance modern biological thought.This research was conducted under and approved by UC Berkeley's Animal Care and Use Committee (protocol #R279-0211). Tissue samples used in this study were obtained from the Museum of Vertebrate Zoology (MVZ), an institution that serves as a specimen and tissue repository for researchers. The MVZ has a strict policy for researchers when depositing specimens and tissues into the museum, requiring local collecting permits and import permits when necessary.Sphenodon). Omission of the Tuatara is inconsequential to our investigation due to its uncontroversial affinity with Squamata (\u200a=\u200aLepidosauria) Our study included sampling for all major vertebrate groups except Tuatara . We combined the data from both individuals to minimize missing data; this approach is justified, as when there were data from both individuals for a marker, data were identical. The dataset of reduced loci for all taxa was used when evaluating the specific phylogenetic questions (turtle and Lissamphibia). Loci without representatives of all the focal groups were removed, leaving 31 genes for the turtle analysis and 26 genes for the lissamphibian analysis.Sequences were combined into two main categories of datasets: individual genes and concatenations. Individual datasets for the 75 genes consisted of orthologous sequences from online genomes and the new samples. Combining individual genes using a Perl script (available upon request) produced the concatenated datasets. We compiled seven different concatenated datasets: 1) All taxa-75 genes, 2) 16 taxa-75 genes, 3) All taxa-31 genes (turtle), 4) All taxa-26 genes (Lissamphibia), 5) 16 taxa-31 genes (turtle), 6) 16 taxa-26 genes (Lissamphibia), 7) slow genes . For the 16-taxon datasets, the vertebrate group Crocodilia is represented by two individuals of the species rd codon positions were removed for N12 using MacClade v4.08 The standard nucleotide (NUCL) dataset was transformed to three data-types using the following methods. AA was translated in Geneious 5 (Biomatters Ltd.), 3The rate of evolution for each of the 75 genes was calculated by computing tree length and averaging branch lengths using an R script All datasets were subject to maximum likelihood analyses using RAxML st+2nd and 3rd codon position (150 partitions), and by gene and codon position (225 partitions). Likelihood ratio tests selected the 150 partitions as the best partitioning strategy.Since this study deals with a complex, multi-gene dataset, we explored heterogeneous processes of molecular evolution through partitioning the data. Tests of alternative partitioning strategies were performed on the NUCL dataset only, as the N12 dataset is a subset of the NUCL dataset, and the DEGEN1 and AA datasets have information on codon position integrated into gene partitions. For RAxML analyses of the NUCL dataset, three different partitioning strategies were tested: by gene (75 partitions), by gene and 1RAxML nucleotide analyses used the GTRGAMMA model of evolution for tree inference and bootstrapping . RAxML amino acid analyses employed the protein gamma model of evolution and the appropriate model of protein evolution selected using ProtTest v2.4 For individual gene analyses, the support values of clades are generally very low, since these relatively short genes (average length is \u223c450bp) were used to infer the entire vertebrate phylogeny. However, to understand and summarize the phylogenetic signal for each gene, we classified them based on preferred topology see  irrespecBioHPC@CBSU resource at Cornell University (http://cbsuapps.tc.cornell.edu). All analyses were run with four chains for 10 million generations. Appropriate models of DNA substitution for each partition were selected using MrModeltest v2.3 Bayesian analyses were only run on individual genes and 16-taxon datasets, as the computational burden for the larger datasets would require extremely long analysis times to achieve stationarity (i.e. >2000 hours). When both RAxML and MrBayes analyses were run, preferred topologies were almost identical, so results should not be compromised by reporting only inferences from RAxML. MrBayes v3.1.2 and v3.2 Rogue taxa analyses were performed using RAxML (Stamatakis 2006) and an algorithm described in Pattengale et al. (2010) Approximately unbiased topology tests (AU tests) Scripts for DFA analyses of the NUCL dataset were written using the R language DFA (from the MASS library) was run with preferred topology as the predicted category, and %GC (for relevant clades), %missing (for relevant clades), and site-rates as predictor variables in one case, and without %GC in another case. Posterior probabilities from the DFA were calculated using leave-one-out cross-validation and normalized with prior probabilities (posterior/prior ratio). The prior probability of assignment to any particular topology was simply the proportion of sites in the alignment preferring that topology. Two different types of DFA were tested to maximize the predictive power of our analysis: linear discriminant analysis (LDA), and quadratic discriminant analysis (QDA). Comparisons of average posterior/prior ratios show that QDA performed best .We validate this new methodology by evaluating its performance in two situations: (1) when analyzing DNA data simulated under conditions known to cause phylogenetic inference problems, and (2) when analyzing empirical amino acid data for a challenging phylogenetic question For the simulation study, we simulated two 8-taxon datasets under conditions that cause standard phylogenetic methods to recover the incorrect phylogeny. Tree topologies were balanced and included four groups of two sister species. On each side of the short innermost branch are two sister groups, one of which has a short subtending branch and one of which has a long subtending branch. Equilibrium GC content was set to 80% for long branches and the sister groups that they subtend, while it was set to 50% for all other branches. Other parameters of the substitution matrices were equal among branches. Each simulated dataset was 1,500 bp in length and consisted of one 1000-bp subset, and one 500-bp subset. The 500-bp partition  showed larger differences in branch lengths than the other one . Simulations were performed using bppseqgen The simulated dataset was filtered for biased sites with DFA comparing the true topology used in simulations and the biased topology in which clades with long branches are clustered together. We used either two descriptive statistics (%GC and site-rates) or one descriptive statistic (site-rate), removing 10%, 20%, 30%, 40% and 50% of the sites. These alignments were compared to the random removal of a comparable number of sites. Phylogenetic analyses of the datasets were performed using RAxML with the same parameters as above. Results of these analyses are found in For an empirical test of our methodology, we focus on the Coelomata-Ecdysozoa debate regarding metazoan phylogeny While we endeavored to include those predictor variables that we felt were most likely to be correlated with biased signal in the data, we note that these decisions were subjective and we may have left out stronger correlates. Similarly, interactions among predictors were ignored for the sake of tractability. The potential also exists for true phylogenetic signal to manifest itself in %GC in some cases, leading to the exclusion of sites with unbiased signal. However, for both analyses we repeated the QDA procedure after excluding all %GC variables as predictors and report those results as well. Examining the sensitivity of phylogenetic conclusions to these considerations will be an interesting avenue for future work.Figure S1Maximum Likelihood phylogenies of the different data transformations. Phylogenies have been simplified to only show higher-level relationships within vertebrates. A) All taxa-NUCL dataset, B) 16 taxa-NUCL dataset, C) All taxa-N12 dataset, D) 16 taxa-N12 dataset , E) All taxa-DEGEN1 dataset, F) 16 taxa-DEGEN1 dataset, G) All taxa-AA dataset, H)16 taxa-AA dataset. Support values for phylogenies with all taxa  show RAxML bootstrap values only if \u226550. Support values for phylogenies with 16 taxa show support values in the form of RAxML bootstrap/Bayesian posterior probability. An * indicates full support.(PDF)Click here for additional data file.Figure S2Frequency histogram of the rate of evolution for the 75 molecular markers. Rate of evolution of the 75 markers was estimated by computing average branch length. The red, vertical line indicates the top 25% fastest genes, which were removed for subsequent phylogenetic analyses.(PDF)Click here for additional data file.Figure S3Permutation test results for the predictive ability of discriminant function analysis (DFA). Permutation results are compared to random expectations regarding A) lissamphibian relationships and B) the phylogenetic position of turtles. Preferred lissamphibian relationships were permuted among sites . Values on the x-axis are the posterior/prior ratio for the preferred topology averaged across all sites for each replicate. The arrow indicates the empirical value, which falls far outside the null distribution.(PDF)Click here for additional data file.Table S1Test of discriminant function analysis (DFA) filtering method on simulated data.(DOCX)Click here for additional data file.Table S2Test of discriminant function analysis filtering method on empirical example.(DOCX)Click here for additional data file.Table S3Predictive power of discriminant function analyses (DFA) for alternative hypotheses.(DOCX)Click here for additional data file.Table S4Phylogenetic results from filtered datasets.(DOCX)Click here for additional data file.Table S5List of Taxa and Genbank numbers.(XLS)Click here for additional data file."}
+{"text": "Dicistroviridae, has a positive-sense single strand RNA genome that contains two internal ribosome entry sites (IRES), a 5\u2032untranslated region (5\u2032UTR) and intergenic region (IGR) IRES, that direct translation of open reading frames (ORF) encoding the viral non-structural and structural proteins, respectively. The regulation of and the significance of the CrPV IRESs during infection are not fully understood. In this study, using a series of biochemical assays including radioactive-pulse labelling, reporter RNA assays and ribosome profiling, we demonstrate that while 5\u2032UTR IRES translational activity is constant throughout infection, IGR IRES translation is delayed and then stimulated two to three hours post infection. The delay in IGR IRES translation is not affected by inhibiting global translation prematurely via treatment with Pateamine A. Using a CrPV replicon that uncouples viral translation and replication, we show that the increase in IGR IRES translation is dependent on expression of non-structural proteins and is greatly stimulated when replication is active. Temporal regulation by distinct IRESs within the CrPV genome is an effective viral strategy to ensure optimal timing and expression of viral proteins to facilitate infection.Internal ribosome entry is a key mechanism for viral protein synthesis in a subset of RNA viruses. Cricket paralysis virus (CrPV), a member of  Viral protein synthesis is an essential process in all viral life cycles. As such, viruses have adapted diverse strategies to recruit the host ribosome and the translational machinery. Numerous positive strand RNA viruses use a strategy whereby infection leads to an inhibition of host translation concomitant with an increase in viral protein synthesis . One of Dicistroviridae family uses an interesting strategy for viral protein synthesis: the monopartite plus strand ~9 kb RNA genome contains two IRESs, the 5\u2032untranslated region (5\u2032UTR) and the intergenic (IGR) IRES that direct translation of two open reading frames (ORFs) encoding the non-structural and structural proteins, respectively  results in the rapid shut off of host protein synthesis concomitant with preferential viral protein synthesis involving supramolar expression of the structural proteins compared to the non-structural proteins [The ectively A 6]. In. InDicisproteins ,8,9. Thein vitro and in vivo, including in yeast, insect and mammalian extracts and cells -uridine (Perkin Elmer) for fifteen minutes. Total RNA was extracted . Equal amounts of RNA were separated in a denaturing agarose gel and transferred to nylon membrane. Levels of radioactivity were detected by phosphorimaging and quantified using ImageQuant software.S2 cells  The increase in structural protein synthesis can be described by some form of passive regulation during infection\u2014a combination of ribosome availability upon host translational repression, different intrinsic affinities for ribosomes and requirements for translation initiation factors between the 5\u2032IRES and the IGR IRES and/or an increase in viral RNAs; (2) alternatively, the increase in viral structural protein synthesis may be driven by some active form of regulation during infection; in other words, IGR IRES translation may be activated or inhibited, possibly by protein factors binding to the IGR IRES and/or by changes in the structure of IGR IRES during infection. To address these two broad hypotheses, we examined IRES activities indirectly by ribosome profiling. Ribosome profiling is a next-generation sequencing-based approach that identifies ribosome occupancy across mRNAs at high nucleotide resolution . RNAseq The ribosome profiling and pulse-labelling experimental results suggest that translation of the CrPV ORFs is regulated. However, it is possible that the increase in ORF2 expression at 3\u20134 h.p.i. may be reflected in the rapid increase in viral RNA levels due to replication . To uncoIn vitro transcribed minigenome RNA was transfected into S2 cells, which were then infected with CrPV an hour later. Previously, we showed that this approach resulted in luciferase activity that increases linearly in the first six hours, indicating that the reporter RNA is engaged in translation during this time -uridine for 15 min at specific time points after infection , which deregulates eIF4A activity, results in a rapid decrease in cap-dependent translation and stimulates IGR IRES-mediated translation ,45. We tstop), which contains two stop codons within the most N-terminal protein of ORF1, CrPV1A, and thus prevents ORF1 expression (in vitro transcribed replicons (stop) RNA transfections led to relatively low luciferase activity, CrPV2(Fluc) RNA transfections resulted in a significant increase in luciferase activity, especially between 12 and 20 h after transfection ) by replacing the ORF2 structural proteins of the CrPV-2 infectious clone with firefly luciferase . Thus, fpression A. The ineplicons B were trsfection C. These stop) transfections (stop) transfections, indicating that IGR IRES activity is stimulated similar to that observed with the reporter construct assays and ribosome profiling (The increase in luciferase activity observed from CrPV2(Fluc) transfections is likely due to contributions to an increase in IGR IRES translation and replication. To uncouple these effects, we mutated two conserved residues (D1620A and D1621A) within the RdRp that have been shown to be important for replicase activity (CrPV2(Fluc)-mutRdRp) . Transfefections D showed rofiling D. These Dicistroviruses utilize a strategy whereby distinct IRESs regulate translation of non-structural and structural protein ORFs. While it has been well established that the viral structural proteins are produced in supramolar excess over non-structural viral proteins ,8,9, theRegulation of IRES translation is key for some virus infections. For instance, poliovirus uses a strategy via temporal cleavage of host factors such as the translation factors eIF4G and poly (A) binding protein and IRES-trans-acting factors, Poly(rC) binding protein 2 and polypyrimidine tract binding protein 1, to regulate the switch from host translation to IRES-mediated protein synthesis as well as the switch from viral translation to replication ,47,48,49stop) (One possible explanation is that there may be a more direct effect on IGR IRES translation during infection: (i) IGR IRES translation may be inhibited at early time points during infection or (ii) IGR IRES translation may be activated at later times. Our data suggest that besides RdRp, one or more non-structural proteins contribute to the increased structural protein synthesis during CrPV infection . Specifistop) . These rstop) . A possiAs described earlier, a number of viruses, including poliovirus, recruit ITAFs to facilitate viral translation ,55. It iA key finding from our studies is that replication of the CrPV genome is necessary for the dramatic increase in firefly luciferase, which monitors IGR IRES translation in the replicon system . In contet al. (2014) demonstrated that Pelo is required for enhanced structural protein synthesis during dicistrovirus infection but does not affect IGR IRES translation [Drosophila homolog for Dom34, which is responsible for the recycling of stalled 80S ribosomes on mRNAs [et al. (2014) speculated that the action of Pelo during infection provides dicistrovirus genomes greater access to ribosomes for high level synthesis of viral structural proteins [In a recent report, Wu nslation . Pelo ison mRNAs . Wu et aproteins . Neverthproteins , thus riDicistroviridae family.Many viruses use a strategy to coordinate temporal expression of non-structural and structural proteins . We prop"}
+{"text": "We aimed to use the pairwise and network meta-analysis to estimate the effects of different meditation exercises on the control of systolic blood pressure (SBP) and diastolic blood pressure (DBP). Randomized controlled trials (RCTs) were retrieved from PubMed and Embase up to June 2016, which are published in English and reported on meditation exercise for hypertensive patients. Risks of bias assessment of the included studies were assessed by Cochrane Collaboration Recommendations and network meta-analysis was performed by ADDIS. Mean difference (MD) and its 95% confidence interval (CI) were used as the effect size. A number of 19 RCTs were included in this study. Results of pairwise comparisons indicated that meditation exercise could significantly decrease the SBP and DBP, compared with other interventions . With good consistence and convergence, network meta-analysis showed that there were no significant differences between meditation and other interventions on SBP. For DBP, Qigong was significantly lower than \u201cno intervention\u201d . Qigong may be the optimal exercise way in lowering SBP and DBP of hypertensive patients, but a detailed long-term clinical research should be needed in the future.  Hypertension is one of the most common cardiovascular diseases worldwide with an increasing incidence among adolescents and adults. Increased systemic artery pressure is the major clinical manifestation of this disease. Hypertension is a risk factor for stroke, coronary heart disease, heart failure, renal insufficiency, and failure . It is eQigong is an ancient Chinese movement for people to improve their mind status. Qigong consists of series of exercises, such as meditation, breathing, rhythmical movements, and focus of intention. As its definition depicted, Qi is an important energy of the body and gong is the exercise that will promote Qi through the body so that the body can heal itself . PreviouSimilarly as Qigong, Tai Chi  is another traditional Chinese exercise, which is performed dominantly by the elders to enhance body balance and awareness . Since tYoga is a part of India traditional spiritual practice for individual to achieve the union of spirit, mind, and body. Despite its origins, Yoga has become a prevalent movement for mental and physical relaxing and a complementary method for chronic diseases control . As a coAlthough many articles have reported that meditation exercises, such as Qigong, Yoga, and Tai Chi, could effectively reduce the blood pressure and the effectiveness of them has been estimated by meta-analysis or summarized in a systematic review, the comparisons only focused on two of the interventions such as Yoga and care and Yoga and no active intervention , 12; thehttp://www.ncbi.nlm.nih.gov/pubmed/) and Embase (http://www.embase.com/) from their inception to June 2016 with English publications reported on the association between exercise and hypertension. The search strategy was set as the combinations of the following terms: hypertension (OR \u201chigh blood pressure\u201d OR \u201cBlood pressure\u201d) AND Qigong (OR \u201cQi-gong\u201d OR \u201cchi-gong\u201d OR \u201cchi kung\u201d) AND Yoga (OR \u201cYogic\u201d) AND Tai Chi (OR \u201cTaijiquan\u201d OR \u201cShadow Boxing\u201d).Literatures were searched from electronic databases of PubMed (Studies were included if they met the following criteria: (1) the articles investigated influence of meditation exercises such as Qigong, Yoga, and Tai Chi on the administrations of SBP and DBP in patients with hypertension; (2) the studies were randomized controlled trials (RCTs) and the treatment group were hypertensive patients intervened by meditation exercises such as Qigong, Yoga, or Tai Chi, while control group were hypertensive patients underwent walking, jogging, routine nursing, education, or \u201cno intervention\u201d; (3) articles could provide sufficient data to calculate the indexes of SBP and DBP after exercising by Qigong, Yoga, Tai Chi, or other interventions. However, studies were excluded if they were reviews, reports, comments, or negotiation letters.Data included in each eligible article was extracted by two independent authors. The extracted information included first authors' name, publication year, research country, and basic characteristics of participants such as gender, age, the interventions, and follow-up status. Risks of bias assessment were evaluated by the Cochrane Collaboration Recommendations assessment tools, which was recommended by the Cochrane Handbook . Once an\u03c72-based Q test [I2 statistics, by which p value < 0.05 or I2 > 50% was considered to be heterogeneous and the random-effects model was chosen; otherwise , the fixed-effects model was selected [R 3.12 software  was selected to perform the pairwise meta-analysis. Mean difference (MD) and its 95% confidence interval (CI) were used to present the effect size of the blood effect. Heterogeneity across trials was estimated by the d Q test  and I2 sselected . Publicaselected .p value > 0.05, the consistency model was utilized; otherwise, the inconsistency model was selected [Aggregate data drug information system  was used for the network meta-analysis. This software was a nonprogramming software, which was based on Bayesian Framework and Markov Chain Monte Carlo (MCMC) theory and had a priori evaluation and processing for the research data , 18. Simselected . Convergselected .n = 8), case/series reports (n = 9), literature reviews (n = 26), and irrelevant studies (n = 68). Subsequently, the full-text of the remaining 32 articles was reviewed and 5 of them were duplicated and 8 were non-RCTs. Finally, a total of 19 eligible studies were included in this network meta-analysis [A flowchart of literature searching and selection procedure was showed in analysis , 21\u201338.The baseline characteristics of the included articles were summarized in p < 0.05, I2 > 50%) estimated in systolic blood pressure (SBP) and diastolic blood pressure (DBP), random-effects model was selected to calculate the pooled results. As a result, medication exercises, including Qigong, Yoga, and Tai Chi, remarkably lowered the SBP and DBP of hypertensive patients compared with controls . Based on Egger's test results, there was no significant publication bias among studies regarding SBP  and DBP , and these results reflected that results of our study had a relatively high reliability. Furthermore, subgroup analysis indicated that Tai Chi, Qigong, and Yoga also significantly decreased the SBPs and DBPs compared with other interventions, such as care and education .The rank probability of hypertension was presented in The effect of meditation on blood pressure control had been reported in many RCTs. However, the previous studies did not have a simultaneous systematic review of the relationships for all relevant evidences. For this article, 19 papers with 1459 patients were enrolled to illustrate the effects of different medication exercises on hypertension control. The pairwise meta-analysis in this study showed that Qigong, Yoga, and Tai Chi could significantly reduce the SBP and DBP of hypertensive patients, compared with no intervention, education, or exercise. However, results of network meta-analysis showed that only Qigong had a remarkable effect on lowering DBP, compared with \u201cno intervention.\u201dSlow-breathing contributes to the decrease of heart rate by decreasing activities of both sympathetic and parasympathetic nervous systems, so that it can affect blood pressure . Qigong,An important advantage of this study over previous researches is the ability to compare the different meditation exercises simultaneously and combine them into a comprehensive network; thus it can provide us with the best solution for hypertension control. Compared to the pairwise meta-analysis, this method not only can perform comparisons between each two of the included interventions, but also can simulate the real condition of pathogenesis. This means influence of the inventions could be estimated by series of comparisons. Based on this method, ADDIS were selected as the analytical tool to evaluate the influence of different inventions. Despite the good consistence and convergence of the test model, no significant differences of SBP and DBP were observed between different interventions, except the comparison between Qigong and \u201cno intervention\u201d on DBP according to network meta-analysis. Both SBP and DBP are the indicators of hypertension; why only DBP had the significant lower effect than \u201cno intervention\u201d is not clear. The same phenomenon is also identified in Veronique A's  researchSeveral limitations of this network meta-analysis should be taken into consideration. First, due to the incomplete extracted data, several related criteria were not included, such as essential and primary hypertension, elders and adolescents, diabetes, and renal disease and cardiovascular disease, and the subgroup analysis was not allowed. Second, as we suggested in the context, Qigong, Yoga, and Tai Chi are most prevalent in Asian countries; therefore, several articles were published in Chinese or other non-English languages; but in order to improve quality of the included papers, published in English was used as a criterion in this study; hence, there may exist selection bias and some unknown impact on the final result. Third, the lowering ability of interventions may be exaggerated due to the unclosed circle data and fewer included papers. Last but not least, despite the fact that ADDIS has a simple operation, the constraint programming property may have a conservative effect on the final result.In conclusion, results of the network meta-analysis suggest that Qigong may be a potential exercise pattern for hypertension control. Because Qigong is a chronic exercise and the outcome of it also comes slowly, therefore, this result still needed to be further verified by more eligible RCTs with large sample size and long-term clinical researches, as well as detailed subgroup analyses."}
+{"text": "Coregonus maraena) were exposed for 9\u2009days to different stocking densities: ~10\u2009kg/m3 (low density), ~33\u2009kg/m3 (moderate), ~60\u2009kg/m3 (elevated), and ~100\u2009kg/m3 (high). Transcriptome profiling in the liver and kidney of individuals from each group suggested that crowding conditions activate stress-related signaling and effector pathways. Remarkably, about one-quarter of the genes differentially expressed under crowding conditions were involved in the activation of immune pathways such as acute-phase response and interleukin/TNF signaling attended by the simultaneous reduction of antiviral potency. Network analysis confirmed the complex interdigitation of immune- and stress-relevant pathways with interleukin-1 playing a central role. Antibody-based techniques revealed remarkable changes in the blood composition of whitefish and demonstrated the correlation between increasing stocking densities and elevated number of myeloid cells together with the increased phagocytic activity of peripheral blood leukocytes. In line with current studies in mammals, we conclude that crowding stress triggers in whitefish hallmarks of a CTRA, indicating that the stress-induced molecular mechanisms regulating the immune responses not only are conserved within mammals but were established earlier in evolution.Adverse life circumstances evoke a common \u201cconserved transcriptional response to adversity\u201d (CTRA) in mammalian leukocytes. To investigate whether this pattern is preserved in lower vertebrates, maraena whitefish ( Fish farming preserves natural resources. However, adverse housing conditions including practice activities, such as selection, handling, transport, nutrition, and/or inadequate stocking densities, threaten fish well-being \u20138. In faCoregonus maraena L.), making this salmonid fish an excellent model for the investigation of sensitivity to crowding stress and its impact on whitefish physiology.In mammals, adverse life circumstances have been shown to induce a \u201cconserved transcriptional response to adversity\u201d (CTRA), which typically leads to an increased expression of proinflammatory genes and a decreased expression of genes involved in innate antiviral responses , 27. Thein vitro experiment with inactivated and viable Aeromonas salmonicida, a major threat in whitefish farming , moderate density , elevated density , and high density . Fish were randomly assigned to identical 300-l glass tanks (0.74\u2009m length\u2009\u00d7\u20090.58\u2009m width\u2009\u00d7\u20090.72\u2009m height) at a 12\u2009h day/night light period. Tanks received brackish water from the Darss-Zingst Bodden Chain  to the recirculating aquaculture system with an exchange rate of about 0.5 times/h. Water was pretreated with gravel-packed filters and moving bed biofilm reactors in complement with UV radiation. To ensure that water parameters were consistently in optimal ranges, water quality  experiments were performed in water recirculation tanks at the Institute for Fisheries in Born, Germany. Maraena whitefish were aged 205\u2009days post-hatch at the start of the experiments. These were performed in duplicate at four different stocking densities: low density ] of the commercially available Troutlodge strain . Trout were kept in 1,000-l tanks at 15\u00b0C in partially recirculating water systems and fed with commercial dry pellets.For the comparison of Ab-staining patterns among salmonid fishes, we used rainbow trout . The entire liver, spleen and head and trunk kidney were isolated from seven animals from each group, sliced, and immediately frozen at \u221280\u00b0C until RNA isolation. Blood was collected from the caudal vein of four individuals per group using a heparinized syringe and immediately diluted in cold medium mixed with Iscove\u2019s DMEM/Ham\u2019s F12  at a ratio of 1:1. Head kidneys were homogenized to prepare single-cell suspensions. The cell suspensions were layered onto an isotonic Percoll gradient  (The spleno-somatic index (SSI) was calculated by the formula SSI\u2009=\u2009spleen weight (grams)/body weight (grams)\u2009\u00d7\u2009100.Blood samples were centrifuged , and the supernatant was kept on ice until analysis of blood plasma parameters was performed. Plasma glucose concentrations were quantified using a colorimetric assay  at the Beckman Coulter DTX 800/880 Series Multimode Detector .5 cells/ml leukocytes were stained with a set of monoclonal antibodies (MAb) with known specificity for distinct subpopulations of rainbow trout leukocytes. The population of thrombocytes was stained by MAb 42 . Then, the cell suspension was applied to the MACS column, and the population of labeled cells was collected. The purity of enriched populations was estimated using BD FACSCanto II, and those exceeding 95% of labeled cells were used for the RNA isolation by the RNeasy Mini Kit .2. Following the incubation, the cells were washed twice with PBS/EDTA. After the final washing, the cells were measured on BD FACSCanto II (BD Biosciences) and gated by forward and size scatter. Only FITC-positive cells were considered phagocytic cells, and their proportion was calculated relative to the total number of acquired leukocytes.To evaluate the phagocytic potential of the blood leukocytes, 100\u2009\u00b5l blood was mixed with 5\u2009\u00b5l latex beads  labeled with fluorescein isothiocyanate (FITC). Blood cells were incubated for 2\u2009h at 15\u00b0C in 2.5% COAeromonas salmonicida ssp. salmonicida wild-type strain JF 2267 was used for stimulation trials. Bacteria were prepared according to the protocol described previously  for 1\u2009h. Prior to usage, the bacteria were diluted to a final concentration of 5\u2009\u00d7\u2009107 cells/ml in sterile PBS.The eviously . A. salm6 viable or PFA-inactivated A. salmonicida ssp. salmonicida. An amount of 100\u2009\u00b5l PBS was added to the control sample. After inoculation, the samples were incubated in a CO2 incubator at 15\u00b0C. The stimulated samples were collected after 12\u2009h and stored in a 700\u2009\u00b5l RLT buffer until RNA preparation.Head kidney leukocytes from each individual were stimulated with 1\u2009\u00d7\u200910For RNA isolation, tissue samples were homogenized individually in 1\u2009ml TRIzol Reagent (Invitrogen/Thermo Fisher Scientific) and purified using the RNeasy Mini Kit  with 30\u2009min on-column DNase treatment. The concentration and quality of RNA were proven using NanoDrop ND-1000 (NanoDrop Technologies/Thermo Fisher Scientific) and the Agilent 2100 Bioanalyzer (Agilent Technologies): only RNA samples with RIN values >9 were used for subsequent analyses. RNA was stored at \u221280\u00b0C.Microarray experiments were conducted in duplicate; two biological replicates were performed for each tissue (liver or kidney) and stocking density . To this end, seven individual RNA samples from the same tissue and SD were pooled. These RNA pools were individually used as template to produce Cy3-labeled cRNA according to the Low Input Quick Amp Labeling Kit (Agilent Technologies). Yields of the cRNA and the dye-incorporation rate were measured using the ND-1000 Spectrophotometer. The hybridization procedure was performed according to the One-Color Microarray-Based Gene Expression Analysis protocol  using the Agilent Gene Expression Hybridization Kit (Agilent Technologies). In brief, 600\u2009ng Cy3-labeled fragmented cRNA in a hybridization buffer was hybridized overnight  to 8\u2009\u00d7\u200960K Agilent-049158 Salmon Oligo Microarrays  using Agilent\u2019s recommended hybridization chamber and oven. After hybridization, the microarrays were washed once with the Agilent Gene Expression Wash Buffer 1 , followed by a second wash with the preheated Agilent Gene Expression Wash Buffer 2 .t-test. Data were then imported into a Rosetta Resolver gene expression data analysis system  for quality control and analysis.The fluorescence signals of the hybridized Agilent microarrays were detected using Agilent\u2019s Microarray Scanner System G2505C (Agilent Technologies). The Agilent Feature Extraction software (version 10.7.3.1) quantified the intensity of the fluorescent images and normalized the results by subtracting the local background fluorescence based on a two-sided Student\u2019s p-values were adjusted according to Benjamini and Hochberg  and an absolute fold change (FC\u2009>\u20091.5) met the criteria. Comparisons of gene expressions across different stocking densities were performed using Venn diagrams (\u20134) were included, and redundant probes representing identical transcripts were joined.The limma package of the R version 3.1.1/Bioconductor suite  was usedHochberg . Genes wdiagrams . Sets ofin vivo and in vitro systems. Enriched pathways were hence carefully reviewed and are indicated in the following by italic face; pathways of mammalian diseases were excluded from the analysis. The significance values were calculated using Fisher\u2019s exact test right-tailed. Standard scores (z-scores) were used as a basis to assess whether certain pathways were activated (z\u2009>\u20091) or inhibited (z\u2009<\u20091); for pathways with z-scores around 0, no prediction could be made.Gene lists were assigned to functional pathways using the Ingenuity program , well minding that this program extracts global functional networks and canonical pathways of the differentially expressed genes according to investigations into mammalian, not teleostean, The concentration of total RNA was accurately determined in repeated measurements using the NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies) and the Agilent 2100 Bioanalyzer (Agilent Technologies). Subsequently, cDNA was synthesized from total RNA using the SuperScript II Reverse Transcriptase Kit (Invitrogen/Thermo Fisher Scientific) according to the supplier\u2019s instructions.CKM2, FDPS, GAMTb, IGF1, SAA5, STEAP4, TLR8a1), 20\u2009ng total RNA (IL1B), 10\u2009ng total RNA , or 8\u2009ng total RNA . The temperature profile was as follows: initial denaturation step at 95\u00b0C for 10\u2009min followed by 40 cycles with 15\u2009s denaturation at 95\u00b0C, 10\u2009s annealing at 60\u00b0C, and 20\u2009s extension time at 72\u00b0C. The relative transcript amounts of the target genes were calculated and normalized against the reference gene RPL9  and SensiFAST SYBR No-ROX One-Step Kit . The reaction mix contained 6\u2009\u00b5l of 2\u2009\u00d7\u2009SensiFAST SYBR No-ROX Mix (Bioline GmbH), 10\u2009\u00b5M of each primer  with an absolute FC\u2009>\u20091.5 and corrected In the liver, 357 genes were affected by HD conditions (168 up- and 189 downregulated genes relative to MD), while only 6 and 3 genes were differentially expressed under ED and LD conditions, respectively  for all selected genes, except for IGF1 (p\u2009=\u20090.07). Accordingly, profiles across all target genes revealed a high concordance .The full complement of microarray data is available in the Gene Expression Omnibus database (GEO accession: GSE76543). Quantitative RT-PCR was used to validate the array-predicted expression differences of a select panel of whitefish genes publicly available at GenBank, that is, ERK/MAPK, mTOR, glucocorticoid receptor, SAPK/JNK, and JAK/Stat signaling, as well as p38 and p53 signaling. Moreover, several stress-relevant effector pathways were found to be overexpressed, including glycolysis, gluconeogenesis, glycogen degradation, and ascorbate recycling. The induction of a glycolytic pathway is, however, not supported by the measured plasma glucose levels, showing no significant differences in the four sets of fish exposed to the different SD conditions (data not shown).Assigning differentially expressed genes to functional groups revealed that numerous stress-related signaling pathways were activated in the liver and kidney under ED and HD conditions Table , such asLECT2) in the liver (23.6-fold), an acute-phase gene encoding serum amyloid protein A-5 (SAA5) in the in liver (8.8-fold) and kidney (13.3-fold), a lysozyme-encoding gene (LYZ) the liver (3.5-fold) and kidney (8.6-fold), the complement factor-encoding genes C7 (7.6-fold) and C1Q-like (4.0-fold) in the liver, a cytokine-encoding gene (CCL19) in the liver (4.9-fold), and a transcription factor-encoding gene (CEBPB) in the liver (2.4-fold) and kidney (3.9-fold). On the other hand, genes encoding antiviral effectors such as the myxovirus resistance factor (MX1) and the influenza virus-binding protein IVNS1ABP were about two-fold downregulated in the kidney. The IPA program was again used to infer which pathways may have been influenced by the regulation of the immune genes regulated in the expression . Eight immune pathways were identified as activated at HD in the liver; 4 and 13 immune pathways were activated at ED and HD in the kidney, respectively  and 80 out of 396 upregulated genes in the kidney (~20%) from fish kept at HD (compared with MD fish) were related to immunological processes. Particularly worth mentioning here is the strong upregulation of a chemotaxin-encoding gene  in myeloid cells, and IRGA2B  in thrombocytes. As expected, the highest level of transcripts encoding IRGA2B was detected in the population of MAb 42+ cells (thrombocytes), the large granular MAb 30+ leukocytes (myeloid cells) expressed the highest levels of CSF3R-encoding mRNA, and the highest transcript level of IGM was found in the population of MAb N2+ cells (B cells) , regulation of actin-based motility by Rho (z\u2009=\u20090.78), and phagosome formation (z\u2009=\u20090), indicating enhanced cell locomotion combined with the internalization of foreign material. Isolated PBLs were thus subjected to a phagocytic assay with fluorescent-labeled latex beads mimicking host\u2013pathogen interaction during infectious diseases to study the leukocytes\u2019 potential to internalize infectious agents and trigger proinflammatory processes  in the kidney and the overall dramatic changes in the expression of surface molecules involved in cell adhesion and migration  together with the elevated level of myeloid cells in HD individuals may indicate accompanying cell migration into the SP as a main secondary lymphoid organ of salmonid fish. We investigated, thus, whether fish from MD and HD groups exhibited a difference in SP size. Although we found a slightly increased spleno-somatic index (SSI) in the HD group, the difference was not statistically significant , interleukin-8 (CXCL8), and tumor necrosis factor alpha (TNF). These cytokines have been predicted to control the expression of 12 genes, which have been identified as differentially regulated under MD compared with HD conditions  10.5-fold induced. Remarkably, TNF transcripts reached after stimulation  a higher level in the MD group, which was approximately twice as high as measured in the HD group  and the alternative complement pathway , which are both also present in salmonid fish  and kidney (128%) compared with the number of upregulated genes. Although stress conditions had a negative impact on a number of pathways, crowding activated several signal transduction pathways, including signaling through the stress-activated protein kinase or the \u201cstress kinase\u201d p38, which are all well-known to be switched on by cellular stress [reviewed in Ref. \u201353]. Connid fish . In thisAcute-phase and interleukin signaling as well as complement pathways are among the most frequently observed immune pathways overrepresented upon stress exposure in salmonid fish  after exposure to short-term stress , (ii) increased T-lymphocyte activation , and (iii) an increased activity of NF-\u03baB transcription factors (upregulated genes coding for NF-\u03baB p50 and \u2212p65), concomitant with (vi) a reduced antiviral response (downregulated genes encoding myxovirus resistance factor MX1 and influenza virus\u2013binding protein IVNS1ABP) as evaluated for the hematopoietic, immune-, and stress-relevant kidney of whitefish exposed to crowding. These observations are essentially in accordance with the abovementioned reports about stress in mammals (cf. Table complement system and production of NO and ROS in macrophages), which is broadly consistent with both the increased proinflammatory signaling noted above and previous measures of antimicrobial response in socially stressed mice  recorded in stressed whitefish in the present study and generally characterizing fish under stress conditions (Our data indicate not only an increased number of myeloid cells in whitefish exposed to crowding stress but also expression profiles equating to the CTRA , 27, incsed mice . Howevernditions , 66\u201368.IL1B may play a prominent role in the regulation of stress-induced immune responses fitting well with previous observations recorded for mammals (IL1B, CXCL8, and TNF may plausibly be responsible for the expression of several further genes in whitefish under HD compared with MD conditions. As in salmonid fish, IL1B (CXCL8 (TNF (in vitro stimulation of head kidney leukocytes with A. salmonicida to study the influence of crowding on the induction of cytokine expression. Unexpectedly, SD manipulations had different effects on these genes. No differences were observed in the expression of CXCL8 between cells from whitefish kept at MD or HD. In contrast, the expression of IL1B and TNF was obviously biased by SD conditions, though not unidirectionally: while the mRNA level of TNF was lower in stimulated cells from HD fish, the IL1B mRNA level was higher in challenged cells from HD fish compared with cells from MD fish. A similar effect on the expression of IL1B has been observed after long-term stress in salmon (cf (Moreover, our data set confirmed that  mammals  and fish mammals . On the sh, IL1B , 72, CXCB (CXCL8 , 74, andCL8 (TNF  serve asCL8 (TNF \u201379 and sCL8 (TNF , 80, 81.n salmon , may havlmon (cf ].In conclusion, the present study describes the physiological features of maraena whitefish exposed to increased stocking densities, revealing similar observations as in mammalian models: first, the increased mobilization of myeloid cells in the bloodstream, and second, CTRA-like profiles of several immune pathways significantly overexpressed in the liver and kidney of density-stressed whitefish Table . These fTG, BK, AR, and TK designed research; TK and BK performed immunological assays; AR, TG, SA, and MN performed gene profiling assays; TK, AR, MN, and SA, analyzed data; and TK and AR wrote the paper.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer AT and handling Editor declared their shared affiliation, and the handling Editor states that the process nevertheless met the standards of a fair and objective review."}
+{"text": "An author name was incorrectly spelled as Roland F. Friedel. The correct spelling is Roland H. Friedel. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.In the published article, there was an error in affiliation . Instead of \u201cThe original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the title of the original article, the name \u201cdel R\u00edo-Hortega\u201d was incorrectly misspelled as \u201cdel R\u00edo Ortega\u201d.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, we neglected to include the funder the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT & Future Planning, 2017R1D1A1B03035373 to Shruti Shukla. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The correct spelling is [Sunderesan]. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.An author name was incorrectly spelled as The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, we missed an affiliation for Yufeng Lin. The new affiliations have been added and reordered accordingly.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, the details for reference  were incThe original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "CUHK-Faculty of Arts, The Publication Subvention Fund to Gladys W. L. Tang. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.In the original article, we neglected to include the funder The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was a mistake in Figures The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "There is an error in the Funding statement. The correct number for the Cooperative Research Program for Agriculture Science and Technology Development  by Rural Development Administration is PJ013985032018.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, the order of the affiliations was incorrect. The correct order appears above. In addition, the city for affiliation 2 should be Saint-Maurice instead of Paris. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the Author Contributions statement, the individual contribution of SK was inadvertently missed. SK designed and supervised all the work.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, we neglected to include the following funding information:This study was supported by a grant from the Deutsche Jose Carreras Leuk\u00e4mie-Stiftung to ES (DJCLS R 1408).The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was a typographic error in Equation 2.MATERIALS AND METHODS, sub-section Model Based Analysis, paragraph 2, Equation 2:A correction has been made to the section The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "This clarification does not change the scientific conclusions of the article in any way.The final sentence in the legend of Figure 3 has been reworded to explicitly state the significance of the symbols. The original version of the article has been updated following the highlighting of issues by a third party.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was an error. It was stated that \u201cChinese word frequency was estimated from a database with a corpus of over 973,338 Chinese dissyllable words  in phonological structure and y KAIST, . A diffey KAIST, . Given ty KAIST, , a numbeThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the published article, there was an error regarding the affiliation(s) for Sabira Mohammed. Dr Mohammed should also have an additional affiliation:Manipal Academy of Higher Education, Manipal, India.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, due to the authors' oversight, there were several mistakes in The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Raquel Sabino was not included as an author in the published article. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the published article, there was an error in affiliation 2. Instead of \u201cProgram in Animal Healthcare, Hungkuang University, Taichung, Taiwan\u201d, it should be \u201cBachelor Degree Program in Animal Healthcare, Hungkuang University, Taichung, Taiwan\u201d. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the published article, Pia Knoeferle was not included as a corresponding author. This has now been rectified. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "An author name was incorrectly spelled as Andrea Di (first name) Cataldo (last name). The correct spelling is Andrea (first name) Di Cataldo (last name). The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Kenneth Chiou. The attribution of the image has now been inserted in Figure 3 and Figure 4, and reads:In the original article, http://kennychiou.com/dissertation/#species.Baboon image created by \u00a9 Kenneth Chiou, in \u201cPopulation genomics of a baboon hybrid zone in Zambia\u201d, The authors apologize for the omission and state that the current version does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Materials and Methods section, subsection 3D Microfluidic Co-Culture and Blocking Experiments, where it was written that 100\u2009\u00b5g/mL of anti-PD-L1-blocking or anti-PD-1-blocking antibody or their respective isotype control was used. The correct concentration is 10\u2009\u00b5g/mL. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.In our original research article, there was an error in the The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Pythium aphanidermatum was misspelled as aphanideratum. Corrections have been made throughout the article, as well as in keywords, Figures 2, 3, and in Supplementary Table S1.In the original article, there was an error. The species name The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was an error in the Funding statement. The correct Name for the Funder is Bei Shan Tang Foundation. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was an error in the title.Vibrio cholerae.\u201dThe title has been corrected to: \u201cRevisiting the Global Epidemiology of Cholera in Conjunction With the Genomics of The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the original article, there were mistakes in Table In all mentioned tables and figures, quantity of amino acids was described in mM instead of \u03bcM. The corrected tables and figures appear below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was an error. The letter \u201cC\u201d was incorrectly provided and should instead be \u201cB.\u201dIntroduction, paragraph seven:A correction has been made to the \u201cThe present study is focused on the relationship between reinforcement contingencies and the formation of TI. More specifically, our aim is to explore the effect of extended training of all premise pairs and overtraining in a single premise pair. Previous studies have analyzed the effect of overtraining on TI. For example, Lazareva et al.  and LazaThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was an error. The diabetes app \u201cmySugr\u201d was misspelled as \u201cmySugar\u201d throughout the original article.A correction has been made throughout the article to correct this spelling error.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the original article, Francesca Maria Alvino was not included as an author in the published article. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Funding statement. The correct number for \u201cU01-DR116317\u201d is \u201cU01-DK116317.\u201dThere is an error in the The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "VTTact\u2014reverse contained a false nucleobase. The corrected In the original article, there was a mistake in The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Sci. Rep. 7:1597. doi: 10.1038/s41598-017-01716-1.In the original article, the reference for (Leinonen et al., J. Alzheimers Dis. 51, 21\u201326. doi: 10.3233/JAD-150798.It should be Leinonen, H., Lipponen, A., Gurevicius, K., and Tanila, H. . Normal The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "One of the author's name was incorrect in the Funding Statement. \u201cCecilia Demargasso\u201d should be \u201cCecilia Demergasso.\u201dThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the original article, there was a mistake in the third last patient in table 1 is listed to have the onconeuronal antibody \u201cAm\u201d, which is corrected as \u201cAmphiphysin\u201d. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.In addition, there was an error in the conclusion of the abstract, caused by a misunderstanding during the language translation. The original text is:By contrast, cerebrospinal fluid analysis showed that serum autoantibodies and tumor markers, the function of crucial organs, electrophysiology, and radiological findings were not associated with a poor outcome.A correction has been made to the corresponding text in the conclusion of the abstract:By contrast, the results showed that cerebrospinal fluid analysis, serum autoantibodies and tumor markers, the function of crucial organs, electrophysiology, and radiological findings were not associated with a poor outcome.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "A mistake was made in the authorship. Heiko Adler, who contributed to the unpublished murine experiments, which are indicated in the last chapter, was unintentionally omitted from the author's list. Therefore, he should be included in the authorship. The authors apologize for the mistake. This error does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "There is an error in the Funding statement. The first funding number is incorrect and should be AICO/2018/123. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the original article, a mistake was found in affiliation 1. The state should be CO (Colorado) instead of IL (Illinois). The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was an error. We neglected to disclose a conflict of interest.Conflict of Interest statement:A correction has been made to the \u201cPatents associated with CAR design, T cell manufacturing, and delivery have been licensed by Mustang Bio., Inc., for which CB and BB receive licensing and consulting payments.\u201dThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Unfortunately there was a production error in three of the illustrations of the published work that distorted several graphical elements. The correct versions of Figures The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, due to an unfortunate miswording, it is possible for readers to think that the PVQ5X was translated by Abessolo and colleagues, which is not the case. Therefore, and at the request of Mrs. Pulfrey, we would like to replace the citation of Abessolo et al., 2017b with a citation of a personal communication between Abessolo and Mrs. Pulfrey in September 2014. A correction has been made to Materials and Methods, sub-section Measures, sub-subsection Portrait Values Questionnaire, and the reference above has been removed.We used a validated French translation  of Schwartz's portrait values questionnaire (PVQ5X, Schwartz et al., The authors apologize for this error and state that it does not affect the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The manuscript will be updated and the original will remain online on the article webpage. The authors apologize for these errors and state that this does not change the scientific conclusions of the article in any way.The authors would like to make the following corrections to the published paper :(1)In t"}
+{"text": "In the original article, the reference for the \u201cEuropean Biostimulant Industry Council\u201d was incorrectly written as \u201c\u201d. It should be \u201c\u201d. It shThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "The following source of funding was not reported in the original publication: National Research, Development and Innovation Office \u2013 NKFIH, Grant Number K 109009. The authors apologize for this error and declare that the amendment does not affect the scientific conclusions of the published studies in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "SPTA1 mutation of Allele 2 in Patient 1, is stated as \u201cc.4294T>A (p.L1432*).\u201d The correct mutation should read \u201cc.4295del (p.L1432*).\u201d The corrected In the original article, there was a mistake in The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the original article, there was an error. In all mentions of hydroxybutyrate should be gamma (\u03b3), not beta (\u03b2): \u03b3-hydroxybutyrate.This correction refers to the main text, to the legend of Figure The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was an error in Acknowledgements section. We need to add an acknowledgement of Dr. Robert X. Smith for his contributions towards Figure 1.A correction has been made to the Acknowledgements section.This work was partially supported by the Intramural Research Program of the National Institute on Drug Abuse, the National Institutes of Health (NIH). Data from the Human Connectome Project, WU-Minn Consortium  were funded by the 16 NIH Institutes and Centers that support the NIH Blueprint for Neuroscience Research; This work was also supported by NIH grant (UH2-NS100614). The authors are grateful to Drs. Michael Breakspear and Stewart Heitmann for their help with the Brain Dynamic Toolbox. The authors are also grateful to Dr. Robert X. Smith for his contribution of Figure 1.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The original Appendix 3, which contained the four reading texts, was removed due to copyright concerns.The enumeration of the appendices has been updated accordingly. The author apologizes for this error and states that this does not change the scientific conclusions of the article in any way. The original article has been updated.The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, we neglected to include a conflict of interest statement of Prof. John D. Lambris.JL is the founder of Amyndas Pharmaceuticals, which is developing complement inhibitors  and is the inventor of patents or patent applications that describe the use of complement inhibitors for therapeutic purposes, some of which are developed by Amyndas Pharmaceuticals. JL is also the inventor of the compstatin technology licensed to Apellis Pharmaceuticals .The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "The citation has now been inserted in section Immunomodulators, Paragraph 3 and should read:In the original article \u201cRecently the clinical potential of six plant-derived anti-inflammatory compounds: curcumin, colchicine, resveratrol, capsaicin, epigallocatechin-3-gallate (EGCG), and quercetin has been highlighted F\u00fcrst and Z\u00fcndoft . The preThe citation has now been inserted in section Curcumin, Paragraph 2 and should read:\u201cHowever, F\u00fcrst and Z\u00fcndoft  suggesteThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Funding statement outlined below has now been added to the original article.In the original article, we neglected to include the funder \u201cFAPESP, 2018/13456-6\u201d to Eliane Florencio Gama. The \u201cWe appreciate the support received from FAPESP, which provided funds for the publication of this article .\u201dThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the original article, there was an error: Incorrect presentation of bacteriocin classification schemes.A correction has been made to the Introduction, paragraph one:Bacteriocins are ribosomally synthesized peptides with antibacterial activity (Cavera et al., Classification schemes for bacteriocins are constantly evolving to accommodate the increase in complexity and diversity of these peptides. Furthermore, with increased understanding of how bacteriocins function and identification of novel bacteriocins the systems in place to group them will need to adapt and change accordingly.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Aspergillus nidulans . Specifically, in A. nidulans, AlcR (Lockington et al., N. crassa. These autoregulations might enhance or attenuate the regulatory outputs of TFs in response to environmental changes. In addition, VosA and CpcA in A. nidulans and PACC, CYS-3, SRE in N. crassa can bind to their own promoters, while the consequent regulatory effects have not been clarified through low-throughput experiments to our knowledge.Twelve and eight TFs were identified as autoregulating TFs in The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The correct affiliation is \u201c1Dipartimento di Biologia e Biotecnologie \u201cC. Darwin\u201d, Istituto Pasteur-Fondazione Cenci Bolognetti, Sapienza Universit\u00e0 di Roma, Rome, Italy\u201d. \u201cVIB Department of Plant Systems Biology, Ghent University, Ghent, Belgium\u201d is the present address for Daniel V. Savatin. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.In the published article, there was an error regarding the affiliation for Daniel V. Savatin. The affiliation \u201cThe original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, there was an error. Throughout the manuscript, all instances of\u201cPlectranthoic acid A (PA-A)\u201d have been replaced with \u201cPlectranthoic acid(PA)\u201d.The authors apologize for this error and state that this does not change the scientificconclusions of the article in any way. The original article has been updated."}
+{"text": "E. coli overexpressing wild type CooA-2 acquired a red color similar to the color of CooA-1 expressing E. coli as described in Youn et al. (2004) due to the accumulation of the heme containing protein \u201d in Results section, subsection \u201cExpression and Characterization of CooA-2\u201d. The corrected Figure In the original article, there was a mistake in Figure Additionally, there was a mistake in Figure The authors apologize for these oversights and state that these errors do not change the scientific conclusions of the article in any way.The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Similarly, the vaginal swab compositions for H2O2 and 15H2O2 were also mistakenly swapped. The corrected In the original article, there was a mistake in The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Streptococcus pyogenes. Sci. Rep. 7:1129. doi: 10.1038/s41598-017-01267-5. The correct reference appears in the Reference List below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.In the original article, the reference for Sugimoto et al.  was incoThe original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "OPPK CZ.2.16/3.1.00/ is OPPK Microscopic System CZ.2.16/3.1.00/28034. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.There is an error in the Funding statement. The correct number for The original article has been updated.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "This study has been funded by Red SAMID. RETICS, ISCIII \u2013 Sub-DirectorateGeneral for Research Assessment and Promotion, and the European Regional Development Fund (ERDF), ref. RD 12/0026/0006.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Conflict of Interest: \u201cRR is an investigator for Aytu Biosciences, the manufacturer of Natesto.\u201d The corrected Conflict of Interest statement appears below. The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.In the original article, we neglected to state a commercial relationship. A correction has been made to RR is an investigator for Aytu Biosciences, the manufacturer of Natesto. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The standard deviations in column 1 are incorrect due to a copy/paste error. The corrected In the original article, there was a mistake in The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "The Thailand Research Fund, RSA6080009 to author Sirilak Disatian Surachetpong.In the original article, we neglected to include the funder The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the original article, there was a mistake in the legend for Adcyap1r1. During production, PACAP peptide column was erroneously positioned under the PACAP receptor. The corrected In the original article, there was a mistake in The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the published article, author Kok Soon Phua had a wrong affiliation. Instead of affiliation 4, they should have affiliation 5.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "As Frontiers does not apply Fair Use, the image has been removed from the figure, and a link has been inserted for readers to view the image on a public website. The corrected In the original article, there was a mistake in Additionally, in the original article, Uhrig  was not The authors apologize for these errors and state that they do not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Instead of \u201c5\u201d, it should be \u201c6\u201d.In the published article, there was an error in affiliation 6. Instead of \u201c6\u201d, it should be \u201c5\u201d.In the published article, there was an error in affiliation The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Tianxin Ye. The correct spelling is Tianxing Ye.An author name was incorrectly spelled as The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the original article, we neglected to acknowledge the HRSM project NANOBILD for infrastructure support. The corrected acknowledgment statement appears below:The authors thank Dietmar Pum  for technical advice and acknowledge the HRSM project NANOBILD for infrastructure support.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the original article, the reference for \u201cGeorge and Panagiotis, 2008 is incorrect\u201d. It should be \u201cGiatsis and Zahariadis, 2008\u201d. Citations of George and Panagiotis, 2008 have been replaced and it has been removed from the reference list. \u201cGiatsis and Zahariadis, 2008\u201d is already in the reference list.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "VIROPLANT project which has received funding from the European Union's Horizon 2020 Research and Innovation Program is 773567.There is an error in the Funding statement. The correct number for The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "RA: conception, write, and review. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In the original article, all authors were indicated as corresponding authors. This is incorrect and only Mingguo Qiu and Chen Liu are corresponding authors.The authors apologize for this error and state that this does not change the scientific conclusions. The original article has been updated."}
+{"text": "The authors wish to make the following corrections to this paper : in the We apologize for the original error. To correct this oversight, Schirmann et al., 2009 [The authors apologize for any inconvenience caused and state that the scientific conclusions are unaffected. The original article has been updated."}
+{"text": "Sarwal1* for the Kidney Precision Medicine Project (KPMP) Consortium.\u201dThe Kidney Precision Medicine Project (KPMP) Consortium was incorrectly included as an author in the published article, as indicated by the phrase \u201cMinnie M. SarwalThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Materials and Methods, Methodological Theoretical Framework, Paragraph 2. The corrected paragraph is shown below.In the original article, there was an error. A citation was not formulated in the correct way. A correction has been made to Secondly, we conducted a thematic analysis of qualitative data based on focus groups with nurses from two elderly health care organizations in the Netherlands to explore the different roles double duty care givers describe. Earlier research has shown that different caring roles can be found (Ward-Griffin et al., The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "In the published article, there was an error in the Conflict of Interest statement. We neglected to include that the author Paul Dent, is a paid consultant and a Key Advisor for Genzada Pharmaceuticals. The correct statement appears below.\u201cPD has received funding support from Genzada Pharmaceuticals Inc. for these studies. CW is a paid officer of the company. DH is a paid consultant and a Key Scientific advisor to the company. PD is a paid consultant and a Key Advisor for Genzada Pharmaceuticals. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u201dThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Conflict of Interest statement was inadvertently incomplete. The statement should include:In the original article, the \u201cSQ is a founder and shareholder of Mirvie, and Stanford University and the Chan Zuckerberg Biohub have filed patents based on the work of SQ and MM on the use of cfRNA in maternal and fetal health.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u201dThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "There is an error in the Funding statement. The new statement should be: \u201cSupported by the national social science fund project Research on Path Design and Policy Support for Rural Tourism in Ethnic Areas to Consolidate the Achievements of Poverty Alleviation (20BSH062), the Fundamental Research Funds for the Central Universities (SWU2109207).\u201dThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Conflict of interest statement was incorrect. The correct Conflict of interest statement appears below:In the published article, the Conflict of interest\u201cThe author FS has received research support from Mastelli for work on polydeoxyribonucleotide. Authors FS, AB and DA are co-inventors on a patent describing therapeutic polydeoxyribonucleotide activity in chronic intestinal disease. Author LM, FS and AB are co-inventor on a patent describing therapeutic polydeoxyribonucleotide activity in testicular injury by torsion.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest\u201d.The authors apologize for this error and state that this does not change the scientific conclusion of the article in any way. The original article has been updated."}
+{"text": "In the published article, there was an error.Abstract, \u201cConclusions:\u201dA correction has been made to This sentence previously stated:\u201cHowever, the initial combination group was non-inferior compared with the delayed combination group in terms of the improvement of BCVA.\u201dThe corrected sentence appears below:\u201cHowever, the delayed combination group was non-inferior compared with the initial combination group in terms of the improvement of BCVA.\u201dIn the original article, there was an error.Conflict of Interest:A correction has been made to This sentence previously stated:\u201cThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u201dThe statement should read:\u201cJZ was employed by the company Bothwin Clinical Study Consultant Inc.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u201dThe authors apologize for these errors and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Conflict of Interest statement.In the published article, there was an error in the This sentence previously stated:\u201cThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u201dThe corrected sentence appears below:\u201cThe authors LL, BA, L-FH, ZS, KB, and LO declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. ES holds patents for optical treatment strategies for myopia and is a consultant for SightGlass Vision Inc., Treehouse Eyes Inc., and Vision CRC USA on issues related to myopia management.\u201dThe authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated."}
+{"text": "Commercial escape rooms have grown in popularity as an enjoyable experience that also doubles as an exercise in communication and collaboration. Educators can take advantage of these natural qualities to engage and support students in a low-stress learning environment. The primary goal of this study is to share the development and application of an educational escape room as a tool to provide biomedical engineering (BME) students with an immersive and practical experience. A BME laboratory course-specific escape room was developed and beta-tested on an initial group of BME students. The first set of feedback enabled improvements to the design and difficulty of the escape room, which was followed by the final release of the activity for the intended undergraduate BME course. Across an academic year, 74 participants agreed to provide survey feedback for this study. Despite a moderate escape rate (29%), students reported high satisfaction and enthusiasm for the activity. Student survey responses indicated that participants were engaged and empowered to successfully escape even without external motivators. Responses supported the effectiveness of the escape room as a BME learning environment, allowing students to practice and retain course-related knowledge in a challenging but low-risk activity. The foundational structure of escape rooms offers a beneficial environment for experiential knowledge application. We conclude that educational escape rooms show promise as a pedagogical tool in promoting enhanced knowledge retention through immersive, game-based learning.The online version contains supplementary material available at 10.1007/s43683-022-00089-w. Escape rooms are a narrative-based challenge that requires completing a series of puzzles or tasks with a small group of people in a limited amount of time. Successful completion of escape rooms results in either escaping from a physical room or completing a final objective such as breaking into a vault. Escape rooms have been touted as excellent team building exercises and reward creativity, leadership, communication, and critical thinking.33Escape rooms have been growing in popularity since the early versions established in Japan in 2007; prior to the COVID-19 pandemic, their popularity had peaked to over 2,250 escape rooms in the United States.11 In higher education, most escape rooms tend to be in either healthcare professions or STEM related disciplines.40 Escape rooms have been implemented in a variety of fields including medicine,44 engineering,35 and others.43 Due to the versatility of its structure, different formats of escape room have been used to target specific learning outcomes. Table-top breakout boxes consisting of a series of puzzles in a box was designed to teach genetics concepts to undergraduates8 or digital electronics skills to second-year students.35 Aspects of gamification combined with the escape room format have been used to create a virtual escape room through MATLAB to prepare students to address bioimaging course outcomes in biomedical engineering (BME).22 Virtual and table-top escape rooms are valuable in that they may be easier to scale for large courses. However, physical escape rooms are more immersive, may be more motivating for students, and seem to better facilitate communication and collaboration.2 In this innovation article, we describe the first, to our knowledge, physical BME focused educational escape room.With the opportunity to practice these skills, it is not surprising that some educators have adopted escape rooms themed to also teach domain-specific knowledge. Escape rooms for K-12 classrooms may cover a wide array of subjects. One such virtual escape room game was developed to allow the educator to select from subjects ranging from history and English to chemistry and mathematics.38 In BME, game-based learning has been used to create a low-stress environment in midterms and exam review sessions to decrease test anxiety in an undergraduate Biofluid Mechanics course.6 Incorporated into the design of an educational escape room, students are required to apply domain-specific knowledge in response to problems presented throughout the activity. Furthermore, a physical escape room lends itself well to testing students\u2019 abilities to use equipment or perform technical tasks like those that might be learned in a laboratory course. Several educational escape rooms have seen successful implementation in clinical fields. For instance, an escape room was used to measure whether nursing students retained information from didactic lectures to complete different skill tasks, where progression was not allowed until a moderator observed the skills completed successfully.1 Another escape room, designed for medical school students, demonstrated that the experience helped motivate students to prepare in advance and retain knowledge necessary to complete tasks related to vascular surgery.24 In each case, the escape room activity required real-time application of background knowledge and execution of physical skills.An escape room can be a low-stress alternative for practical laboratory examinations where students are expected to successfully demonstrate technical skills. Gamification has been identified as a potential method to reduce testing anxiety.27 point systems related to the fastest clear times,21 or grading schemes related to specific learning objectives.43 However, only about one third of escape rooms report assessing students or teams during the escape room.43 Whether or not students are graded in the escape room, several other study authors have pointed out the necessity to provide feedback to students about the experience through a debrief.19 That is, feedback to the students about their learning does not necessarily need to happen in the form of a grade.A variety of techniques have been explored to grade escape room activities including through attendance and participation,14 Educational escape rooms take advantage of this concept to gamify and strengthen student learning outcomes.7 In one study, chemical and industrial engineering students were more motivated to study heat transfer course concepts in preparation for an escape room experience.12 Similarly, in another study, computer science students also reported increased motivation to study with accompanying increase in learning gains measured by pre-tests and post-tests given outside of the escape room.28 That study also linked increased learning gains with an increase in the number of puzzles solved by the student during the escape room.28 One key aspect of gamified learning is promoting education through intrinsic motivators  as opposed to reliance on extrinsic motivators, such as a grade.9 Self-determination theory (SDT) identifies areas of intrinsic motivation such as the needs for competency and autonomy that are essential to human social and personal well-being.36 SDT provides compelling evidence linking intrinsic motivators, such as autonomy and competence, to both increased academic achievement41 and enjoyment of gaming.37A grade may not be necessary to motivate student participation in escape room activities. Gamification, using aspects of a game to increase engagement, has been a method to increase student engagement and motivation in various aspects of education.16 In the field of positive psychology, this optimal state of focused concentration resulting from proper matching of challenge and skill is referred to as flow theory.31 Flow theory has been studied under the scope of education, revealing strong correlations between the state of flow and heightened motivation, self-efficacy, and satisfaction.23 For an escape room, one way to modulate the difficulty of an experience in real-time would be through intervention in the form of hints or feedback. Commercial escape rooms utilize a \u201cGame Master\u201d (GM), who initially introduces the narrative and then serves as a resource for hints if necessary.32 In educational escape rooms, the GM may be an instructor or teaching assistant who facilitates learning through game design or through clues and hints to guide the learner. The GM may intervene when appropriate to help students navigate a particularly difficult obstacle but must also keep in mind the potential of providing excessive assistance resulting in reduced student ownership of success. As with any other learning experience, optimization of the challenge level of an escape room is crucial to enable the potential benefits it may provide as an educational tool.One challenge for both gaming and education lies in finding the right balance between an activity\u2019s difficulty and the skill of the participants. An easy task may result in lowered participant satisfaction and boredom; in contrast, an overly difficult task may lead to frustration and anxiety. Proper challenge-skill balance has been shown to enable a motivating state of \u201cflow\u201d when there is an appropriate level of challenge to match a person\u2019s skill.Here we describe the design, implementation, difficulty adjustment, and results from an in-person, physical biomedical engineering laboratory escape room. The learning objectives of this escape room were: (1) to evaluate the retention of course material, (2) provide a practical setting to apply and reinforce newly acquired laboratory techniques, and (3) to encourage teamwork and communication skills in advance of a group project.The escape room was designed for a semester-long upper-level BME laboratory course . The laboratory course teaches a variety of BME lab skills across broad topics. In the first 6 weeks of the lab, students build technical and laboratory skills such as micropipetting, aseptic technique, and cell culture skills. They learn to use and analyze data from equipment such as microscopes, spectrophotometer plate readers, uniaxial mechanical test frames, and ultrasounds. The escape room is situated in the 7th week of the semester, preceding an open-ended final project where students design experiments to address a hypothesis of their own. The escape room provides an opportunity for the students to review laboratory skills and practice with equipment before they work on final projects in small groups of 2\u20134 students. In the beginning of the semester, students were made aware that the escape room would occur in the 7th week and that skills from the entire semester would be needed to complete it successfully.43The room was designed to be completed in groups of 8 or fewer participants and within 45 min. A time limit of 45 min was originally selected to facilitate scalability and to allow multiple groups to move through the escape room within a 130-min course timeframe scheduled for each laboratory section. This provides enough time to allow two groups to move through the escape room, including a short reminder about rules and presentation of the objective/narrative before the experience, and a short debrief for each group after the experience. It also allows for the instructors to turn over the room  in between the two groups. This setup permitted up to 64 students to participate in a single escape room across 4 different lab sections all within one week of the semester. Group sizes were targeted to be between 6 and 8 people because this size is small enough that all students will be able to actively participate on at least one puzzle or task at almost all times during the 45-min window. In addition, it is still within range of what has been described as acceptable by other educational escape room designers.32 Often a sequential path for an escape room is selected because it is simpler to monitor, and easier for students to identify how to progress.43 However, a sequential path escape room  using a spectrophotometer and analyzing standard curves, (2) micropipetting, (3) cell counting and cell density calculations, (4) dynamic mechanical testing, and (5) ultrasound imaging. Additionally, other biomedical engineering-related background was included as appropriate to the plotline. Each of these techniques were integrated into a puzzle and organized into four pathways of the escape room  and mounted on a microscope slide. Another puzzle is to match solution density based on absorbance readings using a spectrophotometer after pipetting standards and unknowns into a 96-well plate. Entering all four numbers in the right sequence into a bottle labeled as \u201cThe Cure\u201d before the 45-min timer runs out dictates a successful escape. Importantly, the four paths enable students to miss the mark on one set of puzzles and still successfully guess the last digit of the escape code.25 Each puzzle was created and tested independent of one another, and the connection between puzzles can be established with the resulting codes or keys at the end. This provided the freedom for the puzzles to be shifted in sequence if needed. During this process, a few puzzles were simplified or altered for clarity. For example, one puzzle required participants to calculate the concentration of an unknown sample using absorbance. The concentration result was a code entered into a lock, but this required participants to find the exact concentration. For the simplified version, we printed a table with sample IDs and concentrations then attached it to the wall. Instead of entering the concentration, students would enter the sample ID as the code. This allowed some room for variability or error in measuring concentration, so if they were in range of the true value, they could identify the correct sample ID as the code for the lock. In another case, we simplified puzzle elements such as the design of the circuit-board to reduce the complexity and speed up the solve-time.We employed an iterative process during the escape room prototyping phase to continually assess the robustness and difficulty of the puzzles. The goal was to create a set of challenging puzzles that were appropriate in difficulty to match student skill level, targeting the optimal state of flow to maximize engagement.3 Upon arrival, testers were given the expositional narrative as described above and provided with the general rules prior to entering the escape room. An instructor was also present in the area to moderate the activity. The instructor kept the time, documented observations, and would provide free clues when requested by the entire group. For the beta tests, participants were allowed to continue past the allotted 45 min if necessary to experience and provide feedback for all components of the escape room. After completion of the activity, an anonymous survey was sent electronically to the beta testers.The primary goals of the prototype (or beta-test) were to assess the difficulty of the tasks and effectiveness of the escape room for collaboration. Testers consisting of both graduate and upper-level undergraduate students were recruited to participate in the prototype escape room in groups of 4-6 participants. Before attempting the activity, participants were instructed to view an informational video about tips for escape rooms.39 The leaderboard did not affect their grade but served primarily as social feedback with group names and corresponding scores displayed during class. An instructor was present to keep the time and document observations. From the prototype feedback, it was decided that students would be allowed to explore the space for 15 min first, at which point the instructor would provide a free clue every 5 min until the timer ends . The students were encouraged to ask for more clues as a group, however any additional clues will factor into the group score.After making several adjustments to the escape room in response to the results from the prototype escape room tests, the improved activity was incorporated into the BME laboratory course curriculum. This activity was scheduled after six weeks of laboratory course instruction but before the final group research projects. Students were assigned to groups of 2 to 4 for their final group projects, which were combined into teams of 6 to 8 participants for the escape room activity. This provided students with the opportunity to work with potentially unfamiliar classmates and/or further develop their teamwork and communication skills with their project groups. Keeping the format of the beta test, students were given the expositional narrative and provided the general rules prior to entering the escape room. Students were also informed that their efforts will be quantified into a group score at the end of the activity, and this will be displayed on a class leaderboard Eq. . The gro34 Student rating of the difficulty of various escape room puzzles were converted to a 3-point Likert scale  for relative quantitative comparison of difficulty between beta testers and students in the course. Student responses to other survey questions were tabulated to describe the level of agreement expressed for each statement. Students\u2019 responses to open-ended questions were reviewed for relevant themes including satisfaction, motivation, teamwork, and learning. The survey questionnaire and methodology for this study was approved by the Institutional Review Board of the The Ohio State University and determined as exempt (study ID 2022E0178). Informed consent was obtained from all individual participants included in the study. A total of n=64 undergraduate students  who were enrolled in the upper-level course (mostly juniors) agreed to participate in the survey. An additional n\u00a0=\u00a010 responses were collected from beta testers who were a mix of graduate and undergraduate students who had previously taken the course, but not participated in the escape room before or graduate students in the department. All participants were confirmed to be at least 18 years old. While demographic data was not collected as part of the study, the students are expected to be representative of the Biomedical Engineering department as a whole since this the escape room was placed in a required course and all undergraduate and graduate students were from the BME department. Between 2019 and 2022, 46% of BME students identify as female, and 8% of students identify as Black, African American, Hispanic, American Indian, Native Hawaiian, or Pacific Islander.Instructors observed students during the completion of the activity and recorded observations about number of clues needed, which puzzles were solved, and timing of completing certain achievements. After completion of the activity, an anonymous survey was sent electronically to participants (Supplementary Information 1). The survey questions were adapted from four other studies on educational escape rooms.n = 12 total) participated in the prototype (\u201cbeta-test\u201d) escape room and 10 participants agreed to provide survey feedback. All prototype testing participants were teaching assistants at the graduate or undergraduate level. Only 40% of the beta-test participants had participated in an escape room experience prior to this one and 50% of the participants viewed the instructional video. Between the two groups, it took an average of 54 min to successfully escape, and neither beta-test group successfully completed the activity within the allotted time of 45 min. Between the two groups, participants asked for an average of 5 clues to complete the activity.Two groups . The fastest time was one group that completed the room in less than 36 min. When asked to rate their enjoyment of this activity, 95% of students answered agree/strongly agree  experienced the escape room, of which 64 students agreed to participate in the survey. Four groups were able to successfully escape within the allotted time, yielding a success rate of 29% Below is the link to the electronic supplementary material."}
+{"text": "Recent progress of the calcium-based nanomaterials-mediated cancer diagnosis and therapy were summarized.Main challenges and clinical translation prospects of calcium-based nanomaterials were discussed. 2+) makes its \u201cJanus nature\u201d strictly regulated by its concentration. Abnormal regulation of calcium signals may cause some diseases; however, artificial regulation of calcium homeostasis in local lesions may also play a therapeutic role. \u201cCalcium overload,\u201d for example, is characterized by excessive enrichment of intracellular Ca2+, which irreversibly switches calcium signaling from \u201cpositive regulation\u201d to \u201creverse destruction,\u201d leading to cell death. However, this undesirable death could be defined as \u201ccalcicoptosis\u201d to offer a novel approach for cancer treatment. Indeed, Ca2+ is involved in various cancer diagnostic and therapeutic events, including calcium overload-induced calcium homeostasis disorder, calcium channels dysregulation, mitochondrial dysfunction, calcium-associated immunoregulation, cell/vascular/tumor calcification, and calcification-mediated CT imaging. In parallel, the development of multifunctional calcium-based nanomaterials  is becoming abundantly available. This review will highlight the latest insights of the calcium-based nanomaterials, explain their application, and provide novel perspective. Identifying and characterizing new patterns of calcium-dependent signaling and exploiting the disease element linkage offer additional translational opportunities for cancer theranostics.As the indispensable second cellular messenger, calcium signaling is involved in the regulation of almost all physiological processes by activating specific target proteins. The importance of calcium ions (Ca T. T2+ hasER lumen . Dai andICD Fig.\u00a0d 153]. . 2+ has cellular . The immcellular , 156.Fig2+ plays an indispensable role in the autophagy process . . 2 NPs) Calcification is clinically important and has been proved as a positive prognostic factor for treatment response . HoweverComputed tomography (CT) scanning is sensitive to the mineralized deposits but less sensitive to cancer assessment than magnetic resonance imaging (MRI) and is therefore often overlooked in cancer monitoring . Due to 2 NPs presented a good example. In addition to playing a good therapeutic role, it can also accelerate the formation of tumor calcification, providing visualization. As shown in Fig.\u00a02-based nanoparticles to disturb Ca2+ signal and enhance PDT [2S gas, enzyme dynamic therapy (EDT), and Ca2+-interference therapy [. prepared nano-CaH2, which can react with H2O to produce Ca2+, hydrogen (H2), and hydroxyl ions (OH\u2212), accelerating tumor calcification . Focus on the clinical guidance of drugs, promote drugs regression clinical value, and reinterpreting the principles and mechanisms in disease evolution should be the direction of efforts.Although promising advances have been made in calcium-related tumor therapy, further research is needed in this field, where there is room for improvement. More consummate calcium tumor therapy should also consider the following points thoroughly.Overall, developing calcium-based materials for specific cancer therapy is a recognized trend. This system involves many disciplines, including materials science, chemistry, molecular biology, medicine, and imageological; a more in-depth interdisciplinary study addressing calcium-based materials for specific cancer therapy is now necessary. With the development of the calcium-cancer relationship and the further understanding of cancer, we believe that more efficient and multifunctional calcium-based delivery systems will be designed to enhance therapy efficiency and facilitate clinical transformation. Furthermore, we believe that calcium-based materials will continue to be responsible for breakthroughs in cancer treatment and expect it to become a paragon of a new generation of anticancer agents."}
+{"text": "Malignant peripheral nerve sheath tumor (MPNST) is a soft tissue sarcoma with limited therapeutic interventions and a poor prognosis. This review summarized the current understanding of the pathogenic mechanisms behind MPNST and the latest concepts in clinical management from diagnosis to therapeutic intervention. Additionally, the developments in molecular diagnosis and targeted therapies for MPNST are highlighted. It concluded with the challenges and prospects of MPNST management.Malignant peripheral nerve sheath tumor (MPNST) is an aggressive soft tissue sarcoma with limited therapeutic options and a poor prognosis. Although neurofibromatosis type 1 (NF1) and radiation exposure have been identified as risk factors for MPNST, the genetic and molecular mechanisms underlying MPNST pathogenesis have only lately been roughly elucidated. Plexiform neurofibroma (PN) and atypical neurofibromatous neoplasm of unknown biological potential (ANNUBP) are novel concepts of MPNST precancerous lesions, which revealed sequential mutations in MPNST development. This review summarized the current understanding of MPNST and the latest consensus from its diagnosis to treatment, with highlights on molecular biomarkers and targeted therapies. Additionally, we discussed the current challenges and prospects for MPNST management. Malignant peripheral nerve sheath tumor (MPNST) is a relatively rare tumor, accounting for 5\u201310% of all soft-tissue sarcomas . It refeNF1 is located at 17q11 and has 14 protein-coding genes. It primarily encodes neurofibromin, an analog of the negative regulator of the RAS proto-oncogene expressed in a variety of tissues. It inactivates RAS by accelerating the conversion of active guanosine triphosphate (GTP) bound RAS to the inactive guanosine diphosphate (GDP) bound RAS [NF1 mutation can lead to abnormal cell growth mediated by MEK, AKT, and other downstream pathways [NF1 and flanking loci affect 5\u201310% of NF1 patients [SUZ12 gene loss in NF1 microdeletion is also involved in tumor formation [NF1 genotype\u2013phenotype correlation is being highly elucidated due to the development of new analysis techniques, such as multiplex ligation-dependent probe amplification (MLPA), comparative genomic hybridization (CGH) array, and next-generation sequencing (NGS). MLPA, in particular, is an efficient method for diagnosing and classifying NF1 microdeletions [Neurofibromatosis type 1 (NF1) is a complex autosomal dominant disorder characterized by various germline mutations and clinical manifestations in multiple organs . The glopathways . A germlpatients . SUZ12 gormation . MPNST iormation . Clinicaeletions .The risk of post-radiation sarcoma in patients who undergo radiation therapy has been reported to be about 0.06% . ApproxiSeveral studies over the last decade have indicated that NF1-associated MPNSTs typically begin as plexiform neurofibroma (PN) and atypical neurofibromatous neoplasm of unknown biological potential (ANNUBP). As PN and ANNUBP are considered precancerous lesions, they can help illustrate the pathogenesis of MPNST. PN is a benign precursor lesion in about 50% of NF1 patients . The proIn summary, previous studies have found numerous risk factors associated with the onset of MPNST . NF1 is NF1 from the cell (flox/floxNF1 embryos) and mouse  models has been found to cause PNs similar to those seen in humans [NF1 mutation duplicates are significantly associated with the development of lesions [NF1 cannot result in the malignant transformation of PN to MPNST, suggesting that other genes are involved in developing MPNST [CDKN2A/B deficiency [NF1 and CDKN2A in the Schwann cell lineage results in ANNUBP and can progress to MPNST in the flox/flox Arfflox/floxPostn-Cre Nf1 mouse model [Significant breakthroughs have been made in understanding the genetic mechanisms of MPNST in the previous decade. Researchers now have access to more genetic data related to MPNST because of the application of genetic sequencing in clinical diagnosis. In the case of NF1-associated MPNST, sequential, multiple-hit genetic changes may eventually lead to the transformation of Schwann cells into precancerous lesions and MPNST. Knocking out the n humans . Simulta lesions . Howeverng MPNST . Loss ofng MPNST ,37. The ficiency . A haploficiency . Conditise model . Functiose model . EED andse model . Almost se model . Researcse model . Ma et ase model . The preNF1 and TP53 can lead to MPNST in mouse models (flox/floxGfap-Cre Nf1) without developing the PN phase [TP53 is an independent prognostic factor for MPNST. Holtkamp et al. found increased EGFR expression, decreased ERBB2 expression, and decreased expression of the tumor suppressor gene PTEN in MPNST cells [PTEN deletion in the presence of NF1 mutations results in 100% MPNST manifestation [Several other genetic targets have been investigated concerning MPNST. Hirbe et al. illustrated that co-mutations of PN phase . This maST cells . Animal estation .NF1 mutation of sporadic MPNST is similar to NF1-associated MPNST [CDKN2A or PRC2 mutations have also been seen in sporadic MPNST [BRAF V600E and NRAS Q61, are detected in sporadic MPNST. However, none of these mutations have been found in patients with NF1-associated MPNST or post-radiation MPNST [NF1-wild type MPSNTs harbored BRAF mutations compared to 2.9% of NF1-altered MPNSTs. CDKN2A is significantly altered in both NF1- and BRAF-altered MPNSTs [However, only a few studies have revealed a possible pathogenesis for sporadic de novo MPNST. Some evidence suggests that sporadic MPNST has the same mutant genes, but in a different order, which may lead to atypical pathological changes and various prognoses. For example, the somatic ed MPNST . CDKN2A ic MPNST . Howeveron MPNST . Anotherd MPNSTs . The gend MPNSTs .NF1 gene can result in abnormal activation of the RAS pathway, which can promote cell proliferation via the downstream RAF-MEK-ERK (MAPK) and PI3K-AKT-mTOR pathways. MEK is significantly activated in MPNST [The cellular signaling pathways of MPNST and the tumor microenvironment are important areas of future research. Particularly, alterations in the in MPNST , and cliin MPNST  and MPNSin MPNST . The mTOin MPNST . Biplab in MPNST . Johanssin MPNST ; howeverin MPNST . Wnt/\u03b2-cin MPNST . A studyin MPNST . Howeverin MPNST  and EGFRin MPNST , which hin MPNST . It is pin MPNST . NF1-hetin MPNST , which lin MPNST . Others,in MPNST . TogetheThere are currently no highly accurate diagnostic criteria for MPNST. Due to its strong similarity in symptoms and radiological imaging with PN and other soft tissue tumors, it is difficult to distinguish MPNST from other soft tissue tumors. Therefore, effective clinical diagnostic criteria are urgently needed. The latest 2022 National Comprehensive Cancer Network (NCCN) clinical guidelines summarized the primary modalities of MPNST diagnosis. In addition to conventional imaging and pathological means, gene mutation analysis and molecular detection during the pathogenesis of MPNST are the latest methods for diagnosing MPNST. Applying new molecular targets will help to diagnose and grade MPNST in a better way.Magnetic resonance imaging (MRI) is one of the most commonly utilized imaging techniques for soft tissue sarcomas. With the advancement of MRI technology, its sensitivity and specificity in tumor diagnosis are constantly improving . MRI imaThe NCCN guidelines recommend using PET/CT for MPNST diagnosis, as MPNST usually results in a significant increase in 18F-FDG uptake. PET/CT is a well studied technique that is thought to be more sensitive than conventional MRI; however, its diagnostic cutoff value is debatable . It is mA biopsy is strongly recommended for diagnosing and grading soft tissue sarcomas. However, performing a biopsy for suspected MPNST remains debatable. Core needle biopsy is a method using a hollow-bored needle  to obtain tissue from a suspected tumor. Image-guided core-needle biopsy (IGCNBx) is a standard procedure for most soft tissue sarcomas, with a 90% accuracy rate and minimal risk of tumor seeding . HoweverFurthermore, it is debatable to pursue a biopsy versus upfront resection of a suspected MPNST. A biopsy, rather than an upfront resection, may only focus on a confined tumor area, but MPNST tends to be mixed with precursory lesions or benign changes. Therefore, a biopsy may be less sensitive than upfront resection .There is no defined subset of MPNST markers for pathological analysis. A specific pathological criterion for MPNST, particularly sporadic MPNST, is lacking due to the heterogeneity of gene mutation loci and immunohistochemical manifestations. Therefore, distinguishing it from other soft tissue sarcomas is challenging. Currently, MPNST diagnosis is primarily based on exclusion. MPNST is a tumor of nerve origin, usually attached to a nerve trunk, is white, solid, fleshy, and sometimes has myxoid changes. The main distinction is to rule out other nerve tumors. Microscopically, the MPNST can have a variety of morphologies, and as a result it is often classified into distinct subtypes . MPNST hMPNST lacks distinct molecular markers. As previously stated, the immunohistochemistry analysis is also based on the diagnosis of exclusion. Some important markers are listed in In recent years, several new MPNST markers have been used as a step forward in the study of MPNST mechanisms. As mentioned earlier, CDKN2A mutation is considered an early-stage mutation for MPNST. Thus, complete loss of the CDKN2A-encoded cell cycle regulator p16 is a common finding in MPNST . HoweverThe most recently discovered MPNST marker is H3K27me3. PRC2 has recently been identified as the decisive mutation in the transition from ANNUBP to MPNST. The complete loss of H3K27me3 in immunohistochemical staining is observed in MPNST, with a frequency of 30\u201390%. It is more common in sporadic and radiation-associated MPNSTs than in NF1-associated MPNSTs ,91. The There are limited treatment options for MPNST, and the only effective treatment is complete surgical resection to achieve negative margins . AccordiChemotherapy is an alternative option for those with unresectable or metastatic MPNST. According to the SARC006 prospective study, chemotherapy with adriamycin and ifosfamide resulted in a minimal response, whereas sporadic MPNST responded better than NF1-associated MPNST . DoxorubRadiation therapy is often recommended for high-grade lesions or tumors larger than 5 cm . The lonTargeted therapy is the way forward for patients with unresectable or metastatic MPNST. Several clinical trials for targeted therapies have been conducted as our understanding of the molecular pathogenesis of MPNST has increased . EGFR inNf1/p53 model) [As mentioned above, mTOR is an important signaling pathway in MPNST development. In vitro studies shows that mTOR inhibition by everolimus has anti-tumor activity in MPNST cell lines . Johanss3 model) .Nf1flox/ko;lox-stop-loxMETtg/+;Plp-creERTtg/+) [MEK inhibitors are effective in preclinical studies. Trametinib treatment has been shown to reduce tumor growth in MPNST murine models (ERTtg/+) . MirdameERTtg/+) . HoweverERTtg/+) . HoweverERTtg/+) . TrametiERTtg/+) . Given tBRAF V600 is a novel target for MPNST therapy. Vemurafenib is a selective kinase inhibitor for BRAF V600 [RAF V600 . Kaplan RAF V600 . AlthougMPNST has a poor prognosis on average. Previous studies have shown that the five-year overall survival rate is 50\u201460% ,122,123,In addition to grading systems, some independent predictive factors of prognosis have been reported in various series. NF1 mutation is associated with worse survival than sporadic MPNST ,123,127.Many questions remain to be investigated in the future. Firstly, as the mechanism of sporadic MPNST is not fully characterized, the differences and relationships between NF1-related MPNST and sporadic MPNST are not well explained. Further exploration is needed to assess the risk of both types of MPNST in a better way and select appropriate treatment strategies. Secondly, the specific diagnostic criteria for MPNST must be defined. Although MPNSTs can be roughly assessed by imaging and immunohistochemistry in clinical practice, more precise criteria are still needed for more detailed classification and grading of MPNSTs. Detection techniques using genetic and molecular probes could be a future direction.Complete surgical resection remains the most effective treatment for MPNST. A combination regimen of chemotherapy, radiation, and targeted therapy may achieve better survival, but more consensus is needed and toxicity should also be carefully assessed. Additionally, research on MPNST-targeted drugs is an important development goal. Currently most of drugs in clinical trials are based on the\u00a0RAS and tyrosine kinase receptor pathways. However, the majority of them have failed clinical trials. Recent MPNST research has revealed that complex PRC2 mutations and H3K27me3 loss play a critical role in MPNST development. Using gene therapy to target CDKN2A or NF1 could be a novel breakthrough . HoweverSignificant breakthroughs have recently been made in the study of MPNST. On the one hand, risk factors of NF1 and radiation exposure are further explained in MPNST development. The precancerous lesions of PN and ANNUBP have revealed the genetic and molecular mechanism of MPNST. On the other hand, there has been a greater focus on diagnosing and treating MPNST, particularly novel molecular biomarkers and combined therapy regimens."}
+{"text": "The correlation between personality traits and health outcomes of primary prevention has been examined. However, there is a lack of evidence on the association between the assessment of personality traits and medication adherence for secondary prevention of cardiovascular disease. Thus, this study aimed to explore the association between personality traits and medication adherence, including compliance to prescribed medications and attitudes toward taking medications among patients with cardiovascular disease. This cross-sectional study included patients hospitalized for cardiovascular disease. We assessed the Big Five personality traits  of each patient at discharge using the Ten-Item Personality Inventory. In addition, we evaluated four aspects of medication adherence using a 12-item version of the medication adherence scale: medication compliance, collaboration with health care providers, willingness to access and use information on medication, and acceptance to take medication. Logistic regression analysis was performed to assess the correlation between the level of each medication adherence domain and each personality trait. The data of 128 patients with cardiovascular disease were analyzed. Higher conscientiousness score was significantly associated with a high compliance score , high collaboration score , and high willingness score  after adjustment for potential confounders. Other combinations of personality traits and medication adherence showed no statistically significant correlations in multivariate analyses. The findings of this study suggest that assessment of personality traits, especially conscientiousness, may facilitate patient\u2013medical staff communication for the improvement of medication adherence in patients with cardiovascular disease. Medication adherence is a key factor in the secondary prevention of cardiovascular disease (CVD) . SeveralPersonality traits have been proposed as fundamental constructs of health-related behavior, and communication with health care providers  may alsoThe correlation between personality traits and health outcomes of primary prevention has been examined. However, there is a lack of evidence on the association between assessment of personality traits and medication adherence for secondary CVD prevention. Therefore, this study aimed to explore the association between the Big Five personality traits and medication adherence in patients with CVD.In this cross-sectional study, we retrospectively retrieved and analyzed the data of patients with CVD admitted at Nagoya Ekisaikai Hospital in Nagoya City, Japan, between April 2021 and March 2022. The inclusion criteria were participation in an inpatient cardiac rehabilitation program and completion of a routine clinical assessment questionnaire during hospitalization. Patients with one or more of the following conditions were excluded: not receiving prescribed medications for chronic disease before admission, inability to walk, unable to fill in the questionnaire owing to visual or hearing impairment, presence of severe psychiatric or neurological disorders, presence of physician-diagnosed dementia or taking anti-dementia drugs  before admission.In Japan, inpatient cardiac rehabilitation has become standard care for patients hospitalized for CVD. In 2017, the implementation rates for inpatient cardiac rehabilitation were 76.5%, 65.6%, and 46.9% for patients hospitalized for cardiac surgery, acute coronary syndrome, and heart failure, respectively , which cThe personality traits of each patient were assessed during routine clinical practice using the Japanese version of the Ten-Item Personality Inventory (TIPI-J) . The oriThe World Health Organization has highlighted the need for patient consent to and participation in treatment , suggestPatients\u2019 medical records were reviewed to extract data on age, sex, body mass index, principal etiology, comorbidities, left ventricular ejection fraction, biochemical parameters, medications prescribed at discharge, need for a walking device, or need for walking assistance during hospital stay. Comorbidities were evaluated using the Charlson Comorbidity Index .Continuous variables are expressed as mean and standard deviation (SD) for normally distributed variables and as median with interquartile range for non-normally distributed data. Categorical data are expressed as numbers and percentages.Some subscale scores of medication adherence showed skewed distributions. Therefore, each subscale was categorized into binary variables of high and low levels using median values. Thereafter, logistic regression analysis was performed to evaluate the relationship between medication adherence (high/low) and the Big Five personality traits. To explore their potential correlations, logistic regression analysis adjusted for age was first performed, with medication adherence as a dependent variable and personality trait as an independent variable. Thereafter, multivariate analyses were further performed adjusted for the potential confounders if the relationships were significant in the age-adjusted analyses. The number of independent variables was based on the concept of one variable per 10 outcome events in the logistic regression analysis . To follAll statistical analyses were performed using Stata/SE software version 15.1 (StataCorp LP). A p-value of <0.05 was considered statistically significant. This study was an exploratory analysis of the association between personality traits and multidimensional medication adherence; thus, no adjustment for multiple testing was performed. Considering the potential for type I error, this study should be considered a hypothesis-generating study.This study was performed according to the principles of the Declaration of Helsinki and was approved by the ethics committee of Nagoya Ekisaikai Hospital . The requirement to obtain informed consent from the patients was waived because of the retrospective nature of the study. Instead, all patients were informed about their participation in this study and each patient was offered the opportunity to opt out of the study. Information regarding this study, such as the inclusion criteria and opportunity to opt out, was provided on the hospital\u2019s website. The ethics committees approved this consent procedure. No patient opted out of the study at the time of analysis.2 , and 41.4% patients were hospitalized due to acute coronary syndrome Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S1 Dataset(XLSX)Click here for additional data file."}
+{"text": "Helicobacter pylori infection is still the main risk factor for the development of gastric cancer (GC). We explore the scientific evidence for the role of the gastric microbiome beyond Helicobacter pylori (H. pylori) in gastric carcinogenesis. The composition of the gastric microbiome in healthy individuals, in presence and absence of H. pylori infection, in proton pump inhibitor (PPI)-users, obese individuals, and GC patients was investigated. Possible mechanisms for microbial involvement, limitations of available research and options for future studies are provided.Streptococcus, Prevotella, Neisseria, and Actinomyces in healthy individuals or those with H. pylori-negative gastritis. In PPI-users the risk for GC increases with the treatment duration, and the gastric microbiome shifts, with the most consistent increase in the genus Streptococcus. Similarly, in obese individuals, Streptococcus was the most abundant genus, with an increased risk for cardia GC. The genera Streptococcus, Lactobacillus and Prevotella were found to be more prominent in GC patients in multiple studies. Potential mechanisms of non-H. pylori microbiota contributing to GC are linked to lipopolysaccharide production, contribution to inflammatory pathways, and the formation of N-nitroso compounds and reactive oxygen species.A common finding amongst studies was increased levels of In conclusion, the knowledge of the gastric microbiome in GC is mainly descriptive and based on sequencing of gastric mucosal samples. For a better mechanistic understanding of microbes in GC development, longitudinal cohorts including precancerous lesions, different regions in the stomach, and subtypes of GC, and gastric organoid models for diffuse and intestinal type GC should be employed. However, the gastric environment is particularly harsh and difficult to colonize, mainly because of its low pH value. As a result, the gastric microbial load is much lower compared to the small intestine or the colon The human gastrointestinal (GI) microbiome constitutes a complex ecosystem and is an integral aspect of human biology H. pylori may lead to the development of gastric abnormalities H. pylori eradication, proton-pump inhibitor (PPI)), bacterial infection (H. pylori and non- H. pylori bacteria), low socio-economic status, geographical differences and inherited gene alterations. GC development and progression is a multiannual and multistage process\u00a0Helicobacter pylori and the gastric micro-environment hold a significant position in the development of GC  can greatly alter the state of H. pylori and the microenvironment in the stomach. H. pylori, belonging to the \u03b3-Proteobacteria, is a major risk factor for the development of GC and has been associated with the precancerous steps of chronic gastritis, atrophy, intestinal metaplasia and finally the intestinal type of GC H. pylori might also participate in gastric diseases and carcinogenesis H. pylori significantly contributes to the risk of GC, H. pylori eradication doesn't fully remove the potential for GC development. Studies indicate that eradication of H. pylori decreases the risk of GC by 33%\u2212\u200947% H. pylori eradication therapy and increases bacterial abundance. We therefore explored the relationship between eradication therapy, PPI use, and the mucosal microbiome in relation to GC  and vacuolating cytotoxin A\u00a0(VacA). The CagA protein, transported from H. pylori into host cells through the Cag IV secretion system\u00a0(T4SS), perturbs multiple downstream signaling pathways, resulting in cytopathic effects and subsequent cell transformation. VacA constitutes one of the most crucial virulence factors that enable bacterial colonization and survival in the gastric epithelium; the VacA gene is present in all the H. pylori strains. The VacA-s1m1 genotype is commonly found in H. pylori-infected patients with chronic gastritis, whereas in H. pylori-induced GC, usually vacA-s1 and vacA-m1 allelic variants strongly increased susceptibility to GC H. pylori infection of gastric epithelial cells can activate nuclear factor \u03baB (NF-\u03baB), extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK), cytokine-stimulated transduction (JAK-STAT) signaling pathway, and be involved in processes that impair gastric epithelial cells such as methylation, apoptosis and necrosis, which can control the expression of a number of host proteins and influence the growth of gastric epithelial cells\u00a0H. pylori infection causes mucosal inflammation and induces histological changes and is considered a major risk factor for GC. Nevertheless, only 3% of people with H. pylori infections will progress to GC, suggesting the importance of other factors in gastric carcinogenesis\u00a0H. pylori induces chronic active gastritis, and may lead to atrophic gastritis, intestinal metaplasia, gastric precancerous lesions (i.e. low- and high-grade dysplasia) and finally progression to GC and/or gastric mucosa-associated lymphoid tissue (MALT) lymphomas H. pylori penetrates the mucus layer by its motility and survives in a niche between the gastric epithelial cells and the mucus H. pylori colonization is limited to the antrum. In corpus-predominant gastritis there is low or absent acid secretion which may lead to severe atrophic gastritis, intestinal metaplasia, and GC. H. pylori infection typically starts in the distal stomach (i.e. antropyloric region) and without treatment may move upwards to the gastric corpus. H. pylori produces ammonia and bicarbonate from urea, elevating the gastric pH, which may allow growth of other bacteria H. pylori can reduce gastric motility, reducing clearance of toxins or bacteria from the gastric mucosa H. pylori with other gastric microbiota may also play a role in gastric carcinogenesis H. pylori bacteria. In the next paragraph, we will discuss the current knowledge about the human gastric microbiota beyond H. pylori.Chronic 3.2H. pyloriH. pylori positive and negative individuals. The specifics for each study are given in H. pylori positive and negative individuals. For the subject of this study, we extracted information from each article on gastric microbiome composition in three conditions, which were healthy individuals, and gastritis patients that were either H. pylori positive or negative.Culture-independent technological advancements have given us a first view of the composition of the gastric microbiota in the absence and presence of H. pylori negative healthy individuals without gastritis) the gastric microbiome is predominant of the phyla Proteobacteria, Bacteroidetes, Firmicutes, Fusobacteria and ActinobacteriaStreptococcus followed by Prevotella, Veillonella, Rothia, and HaemophilusStreptococcus and Prevotella represented 40.6% and 41.5% of all clones respectively in two studies In healthy individuals , an increased microbial richness and higher Shannon diversity was found in H. pylori negative individuals [41]. Besides a reduced \u03b1\u2010diversity of the gastric community, the overall composition of the gastric microbiota in H. pylori\u2010infected individuals was distinctly different from the negative controls. In contrast, an earlier study by Bik et al. was unable to show difference in microbial abundance and \u03b1\u2010diversity in the presence of H. pyloriH. pylori positive group, H. pylori dominated the gastric microbiome and presence of H. pylori was significantly associated with presence of other Proteobacteria, Acidobacteria and Spirochetes in corpus biopsy samples Proteobacteria, Actinobacteria, and Acidobacteria were significantly increased in the H. pylori positive group compared to the H. pylori negative controls et al. investigated gastric swabs of Chinese patients with gastritis receiving gastric endoscopy and found Proteobacteria, Bacteroidetes, Firmicutes, and Actinobacteria together accounted for 99.82% of the gastric microbiota H. pylori positive individuals with an enrichment in fifty-five gastric microbial pathways. In H. pylori negative individuals, co-abundance networks between species were negatively associated with Stenotrophomonas maltophilia, while in H. pylori positive individuals this relationship turned positive. Miftahussurur et al. identified the families Streptococcaceae (25.9%), Prevotellaceae (13.5%), and Veillonellaceae (10.8%) predominated in the H. pylori-negative group in the gastric mucosa of Indonesian individuals with gastritis or intestinal metaplasia H. pylori negative individuals with gastritis gastric microbiota were Rothia, FusobacteriumGemella[43], Haemophilus and PorphyromonasH. pylori, indicating restructuring of the gastric microbiome in H. pylori positive cases. One study showed that the bacterial load in patients with gastritis is higher than in controls without an elevated pH Streptococcus was detected in a less acid milieu, which may be linked to the development of peptic ulcer disease H. pylori species in the pathogenic process of gastritis still requires further investigation in larger cohorts.In 4 studies comparing H. pylori negative individuals  et al. investigated both gastric mucosa and gastric fluid samples in Chinese individuals of healthy and chronic gastritis patients combined. Streptococcus, Helicobacter, Neisseria, Alloprevotella, Prevotella, and Actinomyces were the most dominant taxa in gastric mucosal samples in H. pylori negative individuals et al. have analyzed the gastric microbiome by using temporal temperature gradient gel electrophoresis (TTGE) and a small-scale 16\u2009S rDNA sequence showed that in addition to H. pylori, other microbes such as Enterococcus, Pseudomonas, Streptococcus, Staphylococcus, and Stomatococcus were present in the gastric mucosa samples Helicobacter sequences were detected in all H. pylori-negative gastric biopsies suggesting asymptomatic colonization, which might be another feature of this younger age cohort.Two studies included 56 and 5 et al. and Delgado et al. focused on H. pylori negative gastritis and found that the abundance of Streptococcus was significantly higher in this group et al. cultivated bacteria from the biopsies and washed biopsies with phosphate buffered saline (PBS) to verify the bacteria of Streptococcus phylotypes are indeed resident instead of passersby in the stomach Two studies from Li H. pylori positive gastritis individuals belongs to the phyla Firmicutes, Actinobacteria, Bacteroidetes, Fusobacteria, and Proteobacteria and the most prevalent genera in H. pylori negative gastritis are Prevotella, Streptococcus, Veillonella, Rothia, and Haemophilus  and clarithromycin triple  therapy has been recommended as a first-line treatment for H. pylori, resulting in restoration of the gastric microbiome, PPIs are also commonly used in the treatment of non-erosive reflux disease (NERD), gastroesophageal reflux disease (GERD) and as a stomach protector when patients use NSAIDS/ASCAL. Commonly prescribed PPIs include omeprazole, esomeprazole, pantoprazole, and lansoprazole, amongst others, that are indicated as first-line therapy in NSAID-related ulcers and GERD +/K+ adenosine triphosphatase pump, resulting in increased gastrin secretion and elevated systemic gastrin levels. It is important to note that H. pylori may change its location after long-term PPI therapy. There is a transition from antral-dominant gastritis to corpus-dominant gastritis, which inhibits gastric acid secretion and stimulates increased gastrin secretion by G cells. Gastrin increases gastric motility but also enhances mucosal growth via stimulation of gastric mucosal endocrine cells (ECLs), which may be related to the development of ECL cell hyperplasia and neuroendocrine tumors (NETs) Although PPIs are included in eradication treatment of 3.3.2et al. used a national database, which included medical information on more than one million individuals H. pylori eradication. Likewise. Segna et al. performed a systematic literature review with meta-analysis and concluded that PPI use was associated with a two-fold increase in GC incidence et al. reported in their meta-analysis  there was a significant positive correlation between the use of PPI and the risk of non-cardia GC and a trend between the duration dependent effect of PPI use and the risk of GC  H. pylori infection, showed a near 3-fold increase in GC risk. However, the exact mechanism how PPI use might directly or indirectly via microbiota or hypergastrinemia lead to GC is currently unknown. One suggestion is that use of PPIs or H. pylori eradication might create an environment for N-nitrosamine formation via non-H. pylori microbiota. However, the current results only showed a possible association between PPI use and GC, however, a direct causative link has not been reported so far Multiple studies suggest that long-term use of PPIs (\u226512 months) is associated with a higher risk of GC, and long-term prescription of PPIs should be avoided 3.3.3PPIs are frequently prescribed and long-term use of PPIs is a growing concern as it may disrupt one of the important barriers of the body against pathogens, with a potential increased risk of enteral infections et al. and Mowat et al. found an increase in the diversity and abundance of gastric microbiota in individuals treated with PPI et al. indicated that Cyanobacteria, and Streptococcus were significantly increased in the PPI-treated samples, whereas Prevotella, Porphyromonas, Treponema, Leptotrichiaceae, Haemophilus, and Fusobacterium were significantly decreased compared to normal stomachs et al. indicated that Streptococcus was significantly increase in PPI-treated patients, and this increase seemed to occur independently of H. pyloriStreptococcus was confirmed in patients taking PPIs by Rosen et al.StreptococcusStreptococcus, Neisseria and Haemophilus influenzae upon culturing compared to individuals not on PPIs et al. showed that there was no significant difference between PPI users and non-PPI users in gastric juice samples, however, PPI users usually had a lower gut microbial diversity PPIs can affect gastric microbiome diversity by directly targeting bacterial and fungal proton pumps or disrupting the normal gastric microenvironment by increasing gastric pH; changes in the gastric microbial composition occur principally in the number of bacteria that can increase by a factor of 200 due to the more favorable pH Streptococcus was most consistently found to be increased in abundance in PPI users -levels, or an imbalance in adipokines. It is known that insulin can stimulate gastric adenocarcinoma cell PI3-kinase/Akt signal transduction, proliferation, and survival Obesity (BMI>30) affects hormonal levels, including insulin and estradiol, which are thought to contribute to the onset of several cancers 3.4.2Firmicutes and Bacteroidetes, followed by Actinobacteria, Proteobacteria, and Verrucomicrobia. Alterations in gastric microbiota in patients with obesity is not fully understood yet. The only study published so far by Carolina Guti\u00e9rrez-Repiso et al. included 41 morbid obese individuals (BMI\u2009>\u200940\u2009kg/m2 or BMI >35\u2009kg/m2 with comorbidities) who underwent sleeve gastrectomy. The gastric mucosal samples obtained during the operation were analyzed by high-throughput-sequencing and showed Streptococcaceae, Bacteroidaceae, Prevotellaceae, Carnobacteriaceae, Enterobacteriaceae, Micrococcaceae, Neisseriaceae, and Lachnospiraceae were the predominant bacteria at family level. At the genus level, Streptococcus was the genus most represented, followed by Bacteroides, Prevotella, Alkalibacterium, Rothia, Neisseria, Shewanella, Pseudomonas, and Actinomyces. Finally, at the species level, Bacteroides species were the most predominant species, followed by Rothia mucilaginosa, Alkalibacterium olivapovliticus, Faecalibacterium prausnitzii, Prevotella copri, and Actinomyces odontolyticus[77]. However, the effect of obesity on the human gastric mucosa microbiome have not yet been studied by others and no comparative studies between obese and healthy individuals have been performed yet.The gut microbiome has been identified as an important factor associated with obesity. In non-obese individuals, about 90% of the bacterial taxa belong to the phyla 3.4.3et al. showed that the gastric microbiome changes in 24 weeks high fed diet (HFD) fed mice with especially a decrease in Akkermansia muciniphila, a beneficial bacterium with probiotic properties. Some interventional studies have even shown that daily administration with A. muciniphila can counteract the negative effects on metabolism of a HFD diet in mice A. muciniphila, the 24 weeks-HFD mice had higher abundance of Lachnospiraceae, Rikenellaceae, and Desulfovibrio, which have been reported to be positively correlated with obesity et al. tested several HFDs, including those based on lard, coconut, linseed oil, corn oil and cocoa butter. All HFDs increased microbial numbers in the stomach and led to a higher abundance of Lactobacillus, although this varied by HFD-type. Bifidobacteriales was less abundant in the gastric microbiota and this reduction sustained at 12 and 24 weeks HFD Bifidobacterium has been associated with diet induced obesity in another study. Supplementing Bifidobacterium to obese mice resulted in a significant reduction of body and organ weights et al. showed that intestinal metaplasia, a precursor of GC, shaped the microbial community, and its occurrence was independent of BMI and composition of the microbial community, but depended on HFD-induced gastric leptin signaling. These results suggest that microbiota changes may follow the early steps in carcinogenesis in this obesity model and that intestinal metaplasia may be driven by changes in leptin signaling Although there are few studies of human gastric mucosa in obese individuals, several animal studies were conducted. He 3.5H. pylori infection or the use of drugs like PPIs can cause hypochlorhydria (pH between 4 and 7), which results in a more favorable environment for certain non-H. pylori bacteria A chronic Proteobacteria, Bacteroidetes, Fusobacteria, Actinobacteria, and FirmicutesStreptococcusLactobacillusPrevotellaNeisseriaHaemophilusVeillonellaAt the phylum level, the composition of the microbial community in GC is similar to chronic gastritis. Thus, regardless of mucosal state, the most prominent phyla are et al. found that the relative abundance of Helicobacter decreases and Prevotella increases with more advanced tumor stage in gastric cardia adenocarcinomas (GCA) compared to non-tumor tissue. Also Dicksved et al.H. pylori and a domination of the GC microbiome by different species of the genera Streptococcus, Lactobacillus, Veillonella and Prevotella. In contrast, Gunathilake et al. found Helicobacter to be the dominant taxa in GC patients, followed by Propionibacterium, and Prevotella, and a relatively high abundance of the species Lactococcus lactis was found in the control groups. Propionibacterium lactis was verified to be increased in GC patients and was shown to have an anti-proliferative activity in human colorectal cancer cells. The lowered relative abundance of P. lactis in the GC group suggests it may serve as a protective factor against the development of GC Lactococcus lactis ssp. lactis, which can induce apoptosis and cell cycle arrest\u00a0et al. performed a separate analysis in the patients with Helicobacter dominance status and found that the composition of microbiota in this Helicobacter-dominant group was significantly different between GC patients and controls with a relative increase in Streptococcus family Recently, Shao et al. including the IMPACT cohort with 234 GC and 40 tumor adjacent non-malignant samples and the TCGA cohort revealing 286 samples with microbial sequencing information. There were five bacterial taxa significantly enriched in both cohorts compared to non-malignant tissue, including Bacteroides, Helicobacter, Lactobacillus, Prevotella and Streptococcus. There were no significant differences in enrichment between intestinal and diffuse type GC. However, Lactobacillus, Streptococcus, Prevotella, Fusobacterium, Selenomonas, and Porphyromonas, were enriched in microsatellite instability-high GC The largest GC population to date was investigated by Abate Lactobacillus was reported in 11 of 18 studies\u00a0Streptococcus in 8 of 18 studies\u00a0et al. investigated the patients with H. pylori-negative GC, and identified Lactobacillus, Bifidobacterium and Streptococcus as the most relevant taxa for GC et al. found that Lacticaseibacillus, which belongs to the lactic acid bacteria (LAB), was significantly enriched in the GC group, while Haemophilus and Campylobacter were depleted and together were able to distinguish GC patients from controls. Interestingly, these discriminating bacterial taxa were significantly correlated with increased expression of mucosal IL1B mRNA expression. Previously, Korean researchers suggested that the presence of IL1B\u201331\u2009T/IL1B\u2013511\u2009C polymorphism increased the production of IL1B by the gastric mucosa in H. pylori infection, and consequently, could promote the development of the intestinal type GC\u00a0Several studies found an increased abundance of lactic acid bacteria in GC patients. An increase in Prevotella was also enriched in gastric adenocarcinoma. The LPS-producing bacteria Prevotella melaninogenica, Neisseria sicca, and Veillonella parvula were significantly increased in bile reflux gastritis (BRG) and GC, with Prevotella melaninogenica having the highest relative abundance in both groups\u00a0H. pylori gastric microbiota was isolated with culturing methods using selective media and subsequently cocultured with gastric epithelial cell lines. In these cell models, LPS from Neisseria subflava interacted with toll-like receptor 4 (TLR4), resulting in potent stimulation of IL-8 expression, and may thus contribute to gastric inflammation. N. subflava colonized in the gastric mucosa may perpetuate gastric inflammation and accelerate neoplastic progression in the hypochlorhydric stomach H. pylori to INS-GAS mice infected with H. pylori and other complex gastric microbiota resulted in a worse outcome in the combined model in the development of gastric carcinogenesis H. pylori bacteria played a positive role in the development of GC by synergizing with H. pylori. Bacteria-host interactions and H. pylori-other bacteria microbial symbioses  are important causes of the development and progression of GC in this model. Based on these results we cannot directly conclude whether GC-enriched microbiota are a bystander or drivers of gastric carcinogenesis. However, we learned that the gastric mucosal microbiota changed significantly in the presence or absence of H. pylori, and this may contribute to the initiation of gastric carcinogenesis. Even in precancerous stages, because H. pylori and non-H. pylori bacteria are an integral part of the gastric micro-environment in gastric carcinogenesis. Exemplified by a recent study investigating the progression of precancerous lesions with network analysis, where they showed that microbial diversity decreases across precancerous stages from atrophic gastritis, intestinal metaplasia and intraepithelial neoplasia and that the gastric mucosal genera Gemella, Veillonella, Streptococcus, Actinobacillus, and Hemophilus had the higher degree of centrality and strong co-occurrence interaction in gastric biopsies across these precancerous stages in H. pylori negative individuals An animal study which compared INS-GAS mice mono-infected with Helicobacter presence. Especially the genera Streptococcus and Lactobacillus were found to be more prominent in GC patients in multiple studies. Further research with larger sample sizes is necessary to get more representative results of the GC population and assess its clinical relevance. Furthermore, the changes in microbiome composition in precancerous versus cancerous stages and subtypes of GC needs to be further investigated. Bacterial genera that showed a trend toward statistical enrichment in MSI-High GC subtype, such as Fusobacterium, Bacteroides, Prevotella and Streptococcuss, were also found to be enriched in MSI-High type colorectal cancer\u00a0In conclusion, GC patients have an altered microbial composition at the genus level, which may be different between patients with high and low 3.6H. pylori positive and negative healthy controls, and GC patients. Especially lactic acid bacteria (LAB), including Lactobacillus and Streptococcus, are increased in GC patients in multiple studies. Interestingly, the increase in Streptococcus is also observed in patients using PPIs and Streptococcus was the predominant bacterial genus in obese gastric microbiome in the only study performed so far. Therefore, there is a great need to explore the potential mechanisms of this group of bacteria  with restricted microbiota consisting of Lactobacillus murinus ASF361, Clostridium ASF356, and Bacteroides ASF519, was sufficient to promote gastrointestinal intraepithelial neoplasia, which associated with robust expression of gastric inflammatory and cancer-associated genes, including TNF-\u03b1, Ptger4 and Tgf-\u03b2. The study suggested individuals presenting with gastric atrophy may be more susceptible to the detrimental effects of colonization by opportunistic microbiota\u00a0In previous studies, Lertpiriyapong Streptococcus salivarius and H. pylori were co-cultured and subsequently inoculated into mice. Compared to H. pylori mono-infection, the co-infection resulted in a robust pathological outcome. At the same time, the expression levels of IL-1\u03b2, IL-17A, and IL-22 were found to be significantly elevated in mice co-infected with H. pylori and S. salivarius, and Ki67 staining detected a significant increase in the number of proliferating epithelial cells in the stomach et al. observed mucosal IL-1\u03b2 mRNA overexpression had a positive correlation between the relative abundance of Lacticaseibacillus and it contributes to the development of GC by inducing chronic inflammation in H. pylori-negative group. Another study demonstrated that IL-17A can inhibit apoptosis and promote ROS production, sphere formation ability of cancer stem cells, and expression of stemness-related genes in gastric cancer AGS cells through the regulation of the IL-17RC/NF-\u1d0bB/NOX1 pathway In a recent study, H. pylori chronic infection plays an important role in chronic gastritis and atrophic gastritis and increases the risk for GC, however, its colonization in intestinal metaplasia and GC is scarce H. pylori with GC development increasing the recognition of the role of non-H. pylori factors in GC progression. Once LAB colonizes in GC, it can potentially promote GC via 4 mechanisms: 1) via impact the release of interleukin-1\u03b2/17\u2009A/22, 2) via IL-17RC/NF-\u1d0bB/NOX1 pathway, 3) via gastric inflammatory and cancer-associated genes TNF-\u03b1/Ptger4/Tgf-\u03b2, 4) via N-nitroso compounds and 5) ROS (d 5) ROS c. Whethe3.7Several studies have shown differences in the composition of the gastric microbiome between patients with GC, gastritis and healthy individuals, and PPI users with their paired controls. The composition and diversity of the gastric microbiome has been described in detail and in recent years the sizes of the cohorts are increasing with reduced sequencing costs. However, different samples sources  will result in significant different composition and diversity of bacteria. At the same time, differences in patient population, ethnicity, socioeconomic status, age, lifestyle, and genetic variation also play an important role in the composition and changes of the gastric microbiome throughout life.Most of the studies reviewed in this study belong to cross-sectional studies, therefore, should be interpreted with caution particularly with regards to causation relationships. To assess potential causal relationships bacterial colonization in the gastrointestinal tract and its fluctuations in relationship to precancerous gastric lesions and GC development would have to be studied longitudinally in different populations across the world, including eating habits, living environment, medication and other variables influencing GC risk. These studies could reflect the gradual development of microbial dysbiosis before GC develops. Current developments in collection of longitudinal cohorts to study health effects could help shed light on these more complex health questions.Technological differences are also an important factor in the inconsistent results of microbiome studies4H. pylori inflammation worldwide. Nowadays, analysis of other gastric microbiota than H. pylori is possible through the innovation of 16\u2009S rRNA sequence analysis.Overall, most studies detected a comparable abundance of the most prominent phyla in the gastric microbiota. Differences in individual composition at the bacterial genus level may be due to geographical differences, technological differences, and the distribution of H. pylori remains the strongest risk factor for GC development. Besides H. pylori, GC patients may have a shift in the non-H. pylori gastric microbiome before the premalignant and malignant transformation of gastric mucosa occurs. Research has shown that despite the eradication of the main risk factor H. pylori, GC could not be prevented, which suggests a contribution of non-H. pylori factors to the development of GC. Eradication of H. pylori leads to restoration of the gastric microbiome, potentially faster when using probiotics, the GC microbiome differs from controls and between patients with and without H. pylori dominance.So far, H. pylori eradication treatment regimens and are frequently used to treat GERD or as stomach protector. An increase in pH induced by PPI use can lead to changes in the composition of the microbiome favoring towards a dysbiotic state characterized by decreased diversity and increased (opportunistic) pathogenic bacteria, especially increasing Streptococcus spp., and is associated with inflammation, and accumulation of nitrogenous products PPIs are a common ingredient of Next to that, obese individuals have an increased risk for GC, potentially via a multitude of factors including low grade inflammation, leptin increase and influence on hormonal balance. This corroborates the findings in post-menopausal women treated with hormonal therapy reducing the risk for GC, especially through estrogen supplementation. However, how these factors influence the gastric microbiome of obese patients is not studied in detail so far.Lactobacillus and Streptococcus, were increased in GC patients in multiple studies. These LAB may play an important role in the development of GC, because they are able to convert nitrogen to potentially carcinogenic N-nitroso compounds, promote ROS, regulate specific molecules to promote tumor development, or contribute to chronic inflammation as shown in mice models, which could explain an increased risk for GC.Reviewing the literature, we found some studies showing that specific microbes had a strong relationship with GC, for example LAB, including et al., showing an increased diversity after H. pylori eradication across cohorts as well as a consistent shift in mucosal microbiome in GC H. pylori in GC development, longitudinal studies including precancerous lesions, different regions in the stomach, and both intestinal and diffuse type GC should be performed. One of the current shortcomings is actual visual evidence of a gastric microbiome in mucosal samples. In our experience the bacterial abundance in gastric mucosal samples is low and this crucial information is relevant for our understanding of the impact on GC development. Importantly, the potential mechanisms of microbiota and influence of medication could be studied in gastric organoid models for diffuse and intestinal type GC H. pylori microbiota in the pathogenesis of the development of different types of GC remains to be determined soon to get new insights in prevention strategies, management, and treatment of GC.There are still questions that remain unanswered. Studies that have analyzed the composition and the changes of the microbiome in GC patients are scarce, cross-sectional, and partially controversial. A powerful method of combining information from these different datasets across cohorts is the use of meta-analysis and statistical methods as recently performed in the study by Li 10.13039/501100004543China Scholarship Council (CSC) to Chengliang Zhou (Funding number: 202206180009).This study was supported by Chengliang Zhou (First Author): Methodology;Investigation; Writing - Original Draft; Tanya M. Bisseling (Author 2): Data Curation; Writing - Review & Editing; Rachel S. van der Post (Author 3): Visualization; Investigation; Supervision\uff1bWriting - Review & Editing; Annemarie Boleij (Corresponding Author): Conceptualization; Resources; Investigation; Supervision; Writing - Review & Editing.The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Cheng-Liang Zhou reports financial support was provided by CSC."}
+{"text": "Brain stores new information by modifying connections between neurons. When new information is learnt, a group of neurons gets activated and they are connected to each other via synapses. Dendritic spines are protrusions along neuronal dendrites where excitatory synapses are located. Dendritic spines are the first structures to protrude out from the dendrite to reach out to other neurons and establish a new connection. Thus, it is expected that neuronal activity enhances spine initiation. However, the molecular mechanisms linking neuronal activity to spine initiation are poorly known. Membrane binding BAR domain proteins are involved in spine initiation, but it is not known whether neuronal activity affects BAR domain proteins. Here, we used bicuculline treatment to activate excitatory neurons in organotypic hippocampal slices. With this experimental setup, we identified F-BAR domain containing growth arrest-specific protein (Gas7) as a novel spine initiation factor responding to neuron activity. Upon bicuculline addition, Gas7 clustered to create spine initiation hotspots, thus increasing the probability to form new spines in activated neurons. Gas7 clustering and localization was dependent on PI3-kinase (PI3K) activity and intact F-BAR domain. Gas7 overexpression enhanced N-WASP localization to clusters as well as it increased the clustering of actin. Arp2/3 complex was required for normal Gas7-induced actin clustering. Gas7 overexpression increased and knock-down decreased spine density in hippocampal pyramidal neurons. Taken together, we suggest that Gas7 creates platforms under the dendritic plasma membrane which facilitate spine initiation. These platforms grow on neuronal activation, increasing the probability of making new spines and new connections between active neurons. As such, we identified a novel molecular mechanism to link neuronal activity to the formation of new connections between neurons. When we learn something new, neurons change their connections to other neurons. We know that active neurons connect to each other, but we have poor understanding on the cellular or molecular mechanisms which link neuronal activity to the formation of new connections. Here we show how neuronal activation can facilitate formation of new connections to wire the firing neurons together.Recent findings indicate that memory storage processes operate conjointly at the level of neurons, dendrites, and dendritic spines. The group of neurons that store a specific information together is called an engram . NeuronaDendritic spines are small, dynamic, actin-rich protrusions along the neuronal dendrites where most of the excitatory synapses are located. Size, morphology, and density of dendritic spines directly affect synaptic function and plasticity . The appIn our previous study, we identified a protein called missing-in-metastasis (MIM/Mtss1) as a novel spine initiation factor . Spine iGCTGCAGAAGCAACTGAAAGG, for shRNA #2, clone name: RSH088545-24-mH1 and target sequence: GGTAGAGATGATCCGACAACA, and for the control shRNA, clone name: CSHCTR001-2-mH1, and the target sequence: TGGCTGCATGCTATGTTGA.The plasmids pmCherry-C1 and pEGFP-C1 were purchased from the Clontech Laboratories Inc. shRNA constructs against rat Gas7 (NM_053484.2) were purchased from GeneCopoeia. For shRNA #1, clone name: RSH088545-23-mH1 and target sequence: GGACTCAGATCTCGAAACGGCACCGTGGCTGGG and reverse: TAGATCCGGTGGATCCTACTGATCCACGGGCTCG.The GFP and mCherry-tagged wild-type (WT) growth arrest-specific 7 (Gas7) were generated using the Genome Biology Unit core facility cloning service . Briefly, entry clone (clone-ID: 100005432) from the human ORFeome collaboration library was transferred into the pcDNA6.2/N-emGFP-DEST and N-mCherry, respectively, using the standard LR reaction protocol. The FBAR domain of Gas7 was PCR amplified from Gas7-pcDNA6.2/N-emGFP-DEST and cloned into the XhoI and BamHI of pEGFP-C1 and pmCherry-C1 using the following primers: forward: The RFP-LifeAct and Ruby-LifeAct constructs were kind gifts from Roland Wedlich-S\u00f6ldner . Each well was treated with anti-mitotics  at 3\u2009d in vitro (DIV) to inhibit glial growth. Net wells containing slices were then transferred to fresh plates and medium at 4 DIV to end treatment. Following this, medium changes were undertaken every 2\u20133\u2009d by replacement of 500-\u00b5l medium from each well.All experimental procedures were conducted in compliance with the institutional guidelines of The University of Queensland Animal Ethics Committee. Wistar rat pups were provided by UQBR at postnatal day (P)4. Pups were euthanized by decapitation, and the hippocampus was removed. 400-\u00b5m slices were then taken of the hippocampus and placed onto sections of nitrocellulose membrane \u223c5 mmAt 5 DIV for GFP and 8 DIV for Gas7 experiments, hippocampal slices were biolistically transfected with plasmids. This involved the coating of 1.5\u2009\u00b5m Au particles with spermidine and 25\u2009\u00b5g plasmid DNA. These particles were then deposited onto silicone tubing, which was cut and inserted into a Bio-Rad Gene Gun. Particles were then propelled into each well of hippocampal slices by He pressurized at 180 PSI.Transfection success was assessed by fluorescence microscopy (Zeiss Discovery V8 Stereoscope) at 10 DIV for GFP and at 12\u201313 DIV for Gas7 experiments. Neurons showing visible expression of fluorescent proteins were selected for two-photon imaging.At 10\u201313 DIV, neurons were imaged with a two-photon laser-scanning microscope (Bruker Ultima Investigator) using a 60\u00d7, 0.9 numerical aperture objective (Olympus) using a Ti:Sapphire laser  at 920\u2009nm with a imaging intensity of 20mW, measured in objective back aperture. Green and red fluorescence were captured with dual close-proximity photomultiplier GaAsP detectors (Hamamatsu Model H10770) using emission filters (et525/70m-2p and et595/50m-2p) and a t565lpxr dichroic beam splitter for simultaneous viewing and acquisition from both detectors. Scan control and image acquisition was performed by Prairie View software. Either apical or basal dendritic segments were imaged. Image stacks consisted of sections  taken in 0.5-\u00b5m steps. The resolution of the imaging system (point spread function) was of x/y \u223c0.6\u2009\u00b5m and z \u223c3.5\u2009\u00b5m.m NaCl, 2.5 mm KCl, 25 mm NaHCO3, 1.25 mm NaH2PO4, H2O, 2 mm CaCl2, 1 mm MgCl2, 25 mm d-glucose), circulated by a peristaltic pump. Following a baseline image at t\u2009=\u20090, the slices was perfused with aCSF containing 30 \u03bcm bicuculline  or continued in unadulterated aCSF (controls) and a second image was taken at t\u2009=\u20091 h for experiments shown in During imaging, hippocampal slices were maintained in artificial CSF  was manually defined for the neural image with a specific separate mask image. To define the ROI for a neural image, one-pixel-wide white curves on black background were manually drawn along the desired dendrite\u2019s branches in Gimp software. These white curves were saved as a \u201cskeleton curve image.\u201d The width of these skeleton curves was then widened 95 pixels (5\u2009\u00b5m) to the both sides from the curve [using the option \u201cSelect -> Grow\u2026 (Grow selection)\u201d in Gimp software], thus getting 191-pixel-wide \u201cobservation paths\u201d that were saved as a black-and-white mask image . The length of the region of interest (ROI) for the desired dendrite was computed from the \u201cskeleton curve image\u201d by using in Fiji software the option \u201cAnalyze -> Skeleton -> Analyze Skeleton (2D/3D).\u201dMotivated by the previous research and open source algorithm components , we devehttps://github.com/laurilahti/neural-image-brightness-cluster-analysis-script). This script can be used on the public online computing environment of the Binder Project that is a nonprofit project built, led and supported by an open community (https://mybinder.org). To start the running of this script online you can access the following web address: https://mybinder.org/v2/gh/laurilahti/neural-image-brightness-cluster-analysis-script/HEAD?urlpath=rstudio. When running the script \u201cneural-image-brightness-cluster-analysis-script-developed-by-lauri-lahti.R\u201d for the first time, the initialization and installation phases may take a long time  before the actual analysis results become generated. However, after that the subsequent new running of the script generates the actual analysis results much more quickly. Usage guidance for the script can be found at the GitHub repository web site . The Binder Project online environment is designed to address carefully data privacy and security when running a script online in this environment (https://mybinder.readthedocs.io/en/latest/about/user-guidelines.html#security-and-privacy). Anyway, if the user wants to analyze sensitive data with the script, it is recommended to be done so that the script is running only in the user\u2019s own local computer.\u201cNeural image brightness cluster analysis script\u201d is also openly available at the following GitHub repository , the correct brightness threshold value needs to be set manually based on the shown visualizations. In an optimal situation, with this brightness threshold value the script identifies a similar selection of clusters as a person would identify independently without the script. However, achieving this was sometimes difficult, especially when analyzing input images captured from time-lapse videos in which the cluster intensity, total brightness, or cluster/diffuse protein ratio changed after drug treatment.Setting the correct brightness threshold value depended largely on the brightness distribution of the image so that a wide dynamic range could be exploited well but in some cases the brightness threshold value had to be set so that only a narrow dynamic range could be exploited to prevent the script to identify incorrectly bright diffuse stainings as clusters. When analyzing images of fixed cells in different experiments, the same brightness threshold value was set for all images that belonged to the same experiment. As an exception, in 2+ and Mg2+-free HBBS medium with DNase I , sodium pyruvate (1 mm) and HEPES . The cells were then plated on 13 mm diameter glass coverslips coated with poly-L-lysine . A total of 100,000 to 150,000 cells per 24-well plate well were cultured on 13-mm coverslips in Neurobasal medium (Invitrogen) supplemented with L-glutamine (Invitrogen), B-27 (Invitrogen), and primocin (InvivoGen). The neurons were cultured in humidified incubators at 37\u00b0C and 5% carbon dioxide (CO2), and the media was refreshed at regular intervals twice a week. Transient transfection was performed on DIV14 neurons using Lipofectamine 2000 (Invitrogen) as described previously  for 20\u2009min at room temperature and then washed three times with PBS. The neurons were then permeabilized using 0.2% Triton X-100 in PBS. Blocking was done for 30\u2009min using 3% normal donkey serum and 0.5% bovine serum albumin (BSA) in PBS. Antibodies were diluted in blocking solution and coverslips were stained setting them upside down over a drop of antibody solution. The neurons were incubated in primary antibody for 1 h at room temperature and washed three times for 10\u2009min with 0.2% BSA in PBS. The neurons were then incubated in the secondary antibody for 1 h and then washed three times for 10\u2009min in a similar way. Subsequently, the coverslips with neurons were mounted on glass slides by using Shandon Immu-Mount (Thermo Fisher Scientific).The mouse monoclonal anti-Gas7 antibody (sc-365385) was purchased from Santa Cruz Biotechnology and the mouse anti-myc (9E10) antibody was purchased from Thermo Fisher Scientific. The dilution of 1:200 was used for both primary antibodies. The anti-mouse Alexa-647 was purchased from Thermo Fisher Scientific and the dilution of 1:400 was used.m Tris\u2013HCl pH 7.4, 150 mm NaCl, 1 mm EDTA, 0.25% sodium deoxycholate and 1% NP-40, 1% SDS and phosphatase and protease inhibitor cocktail (Roche)]. Bicinchoninic acid (BCA) protein assay (Thermo Fisher Scientific) was used to estimate the protein concentration. For each sample, 35\u2009\u00b5g protein was run on 10% SDS-PAGE gel. The manufacturer\u2019s protocol was followed to transfer the protein from the gel to the polyvinylidene difluoride (PVDF) membrane; 5% milk in TBS-0.1% Tween 20 (TBS-T) was used for blocking the membrane for 1 h at the room temperature. The membrane was then incubated overnight at 4\u00b0C in primary antibody against Gas7  diluted in 5% milk in TBS-T. Next, the membrane was washed 3 times 10\u2009min with TBS-T and incubated in secondary antibody  at the room temperature for 1 h. After three times 10-min wash with TBS-T, enhanced chemiluminescence (ECL) reagent (Thermo Fisher Scientific) was used to develop the membrane and detect the specific protein bands. The membrane was stripped using stripping buffer (2% glycine) and the same protocol was repeated with mouse anti-actin AC-15 antibody  to detect the total actin. Gas7 levels were quantified against total protein using Image Lab software.C57Bl6 mice were anesthetized and transcardially perfused using 50-ml cold PBS. Cortex, hippocampus, and cerebellum from the right hemisphere were fast frozen in liquid nitrogen and stored at \u221280\u00b0C for western blotting. Tissue was then homogenized and lysed in the mixture of radio immunoprecipitation assay (RIPA) buffer [50 m2 levels can be adjusted. The live cells were imaged in culture media at 37\u00b0C and 5% CO2. The 63\u00d7\u20091.4\u2009NA oil immersion objective was used for imaging. Z-stack of 20\u201330 optical sections was obtained for each neuron. The step size was set to 0.2\u2009\u03bcm. The laser power and gain settings were adjusted to maximize the signal-to-noise ratio. The Fiji software was used to process the image files obtained from the imaging , length between 0.1 and 5\u2009\u03bcm, and a maximal width of 3\u2009\u03bcm were retained as spines. Following the default settings of the program and the empirical classification rule defined by 3) were classified as stubby spines. All other spines were considered thin. The spines detected and modeled by the software were carefully verified and corrected manually. The structures wrongly labeled as spines were removed and the spines that were not detected by the software were added and classified. Measurements obtained by NeuronStudio were transferred to a spreadsheet application (MS Excel) for analysis.After modeling of the dendrite surface, protrusions with a minimum volume of five voxels . The EzColocalization Plugin in the Fiji software was used for the colocalization analysis . Statistical significance was determined using The datasets generated during and/or analyzed during the current study are not yet publicly available but are available from the corresponding author on reasonable request.in vitro (DIV)7\u2013DIV12. We first confirmed these results using DIV10 organotypic slices  and tdTomato (red). Time frames of GFP-Gas7 channel are shown in 10.1523/ENEURO.0344-22.2023.video.1Movie 2.Time-lapse video showing a segment of GFP-Gas7 and Ruby-LifeAct transfected pyramidal neuron in DIV12 organotypic slice after 30 \u03bcM bicuculline treatment. Left upper panel shows GFP-Gas7 channel in inverse color. Panel below shows Ruby-LifeAct in inverse color. Right upper panel shows Gas7 in inverse Fire and below right is merged GFP-Gas7 (green) and Ruby-LifeAct (red). Arrows point to site where new filopodium appears. Time frames of video are shown in 10.1523/ENEURO.0344-22.2023.video.2Movie 3.Time-lapse video showing a segment of RFP-LifeAct and GFP-Gas7 transfected pyramidal neuron in DIV14 primary hippocampal culture. Upper panel shows segment before treatment and lower panel shows same dendrite after 5 \u03bcM Latrunculin B treatment. Left panel shows RFP-LifeAct channel in inverse color. Panel on right shows GFP-Gas7 in inverse color. Time frames of video are shown in Figure 5D. Frames are imaged every 3 minutes. Both before and after have 10 frames = 30 minutes. Frame rate in video is 8 frames / second.10.1523/ENEURO.0344-22.2023.video.3Movie 4.Time-lapse video showing a segment of Akt PH domain-mRFP and GFP-Gas7 transfected pyramidal neuron in DIV21 primary hippocampal culture. One frame is shown in 10.1523/ENEURO.0344-22.2023.video.4c slices A,B. At Dendrites A,B. Withendrites A. We nexendrites B. It seeendrites  to analyendrites C. To havendrites D. As theendrites . As the endrites . Bicuculendrites F. On aveendrites C\u2013F.Moviin vitro  seems to be the main neuronal isoform .To examine the expression of Gas7 in the developing and adult brain, we performed Western blot analysis in the brain tissues obtained from P7, P26, and P117 mice A\u2013C. WestTo analyze the localization of endogenous protein in primary hippocampal neurons, we immunostained mCherry-transfected cells with anti-Gas7 antibodies. These experiments revealed that endogenous Gas7 localization is comparable to GFP-Gas7 localization shown in We next tested whether knock-down of Gas7 affects dendritic spine density. For that, we used two different shRNA constructs targeting the Gas7 mRNA. We transfected the primary hippocampal neurons with GFP and either scrambled shRNA or one of the two anti-Gas7 shRNAs A. Figure10.1523/ENEURO.0344-22.2023.f4-1Extended Data Figure 4-1A, Representative dendritic segments of hippocampal neurons expressing mCherry together with scrambled shRNA (ctrl), Gas7 shRNA #1 (#1 and R #1), or Gas7 shRNA #2 (#2 and R #2). ctrl, #1 and #2 are also transfected with GFP. In R #1 and R #2, knock-down of endogenous Gas7 is rescued by overexpressing human GFP-Gas7, which is resistant to used shRNAs. All cells are stained with anti-Gas7 antibody. mCherry channel was used for analyzing dendritic spine density and morphology (B). mCherry on right is shown as intensity-based pseudocoloring (Fire). All scale bars, 10 \u00b5m. On left, is shown anti-Gas7 antibody staining in magenta and either GFP or GFP-Gas7 in green. In the middle, anti-Gas7 antibody staining is shown in black and white to see different expression levels in transfected cell somas compared to neighboring nontransfected cells. In control cells transfected with scrambled shRNA, Gas7 staining is at similar level compared to nontransfected cells. In Gas7 shRNA-transfected, but not rescued, cells (#1 and #2), Gas7 expression is lower than in neighboring cells. In cells rescued with GFP-Gas7 expression (R #1 and R #2), Gas7 level is higher than in neighboring cells and transfected cells are easy to distinguish from nontransfected cells. White arrows point to somas of transfected cell somas. mCherry images on right (higher zoom in of cells shown on left) show that Gas7 shRNA-transfected cells have less spines compared to controls or rescued cells. B, Quantification of total dendritic spine density for neurons expressing scrambled shRNA (ctrl), Gas7 shRNA #1 (#1), and Rescued shRNA #1 (R #1). The total spine density was ctrl\u2009=\u20090.68\u2009\u00b1\u20090.071, #1\u2009=\u20090.38\u2009\u00b1\u20090.036, R #1\u2009=\u20091.02\u2009\u00b1\u20090.062. Ctrl: n\u2009= 16 neurons; #1: n\u2009=\u200915 neurons; R #1 16 neurons. Data is pooled from three experiments and represented as mean \u00b1 SEM. **p\u2009<\u20090.01 and ***p\u2009<\u20090.001 as determined by one-way ANOVA with Bonferroni\u2019s post hoc test. Violin plots present the median and interquartile range (25th and 75th percentiles). C, Quantification of dendritic spine density of different types of spines for neurons expressing scrambled shRNA (ctrl), Gas7 shRNA #1 (#1), and Rescued shRNA #1 (R #1). Stubby spine densities were ctrl 0.16\u2009\u00b1\u20090.016, #1\u2009=\u20090.089\u2009\u00b1\u20090.010, R #1\u2009=\u20090.24\u2009\u00b1\u20090.019. Thin spine densities were ctrl 0.29\u2009\u00b1\u20090.032, #1\u2009=\u20090.16\u2009\u00b1\u20090.017, R #1\u2009=\u20090.46\u2009\u00b1\u20090.033. Mushroom spine densities were ctrl 0.23\u2009\u00b1\u20090.036, #1\u2009=\u20090.14\u2009\u00b1\u20090.027, R #1\u2009=\u20090.32\u2009\u00b1\u20090.027. Data is pooled from three experiments and represented as mean \u00b1 SEM. *p\u2009<\u20090.05 and **p\u2009<\u20090.01 as determined by one-way ANOVA or Kruskal\u2013Wallis test. Violin plots present the median and interquartile range (25th and 75th percentiles). D, Quantification of total dendritic spine density for neurons expressing scrambled shRNA (ctrl), Gas7 shRNA #2 (#2), and Rescued shRNA #2 (R #2). The total spine density was ctrl\u2009=\u20090.68\u2009\u00b1\u20090.071, #2\u2009=\u20090.38\u2009\u00b1\u20090.033, R #2\u2009=\u20091.07\u2009\u00b1\u20090.066. Ctrl: n\u2009= 16 neurons; #2: n\u2009=\u200915 neurons; R #2 16 neurons. Data is pooled from three experiments and represented as mean \u00b1 SEM. **p\u2009<\u20090.01 and ***p\u2009<\u20090.001 as determined by one-way ANOVA with Games\u2013Howell post hoc test. Violin plots present the median and interquartile range (25th and 75th percentiles). E, Quantification of dendritic spine density of different types of spines for neurons expressing scrambled shRNA (ctrl), Gas7 shRNA #2 (#2), and Rescued shRNA #2 (R #2). Stubby spine densities were ctrl 0.16\u2009\u00b1\u20090.016, #2\u2009=\u20090.092\u2009\u00b1\u20090.0081, R #2\u2009=\u20090.25\u2009\u00b1\u20090.014. Thin spine densities were ctrl 0.29\u2009\u00b1\u20090.032, #2\u2009=\u20090.13\u2009\u00b1\u20090.014, R #2\u2009=\u20090.50\u2009\u00b1\u20090.044. Mushroom spine densities were ctrl 0.23\u2009\u00b1\u20090.036, #2\u2009=\u20090.16\u2009\u00b1\u20090.023, R #2\u2009=\u20090.32\u2009\u00b1\u20090.026. Data is pooled from three experiments and represented as mean \u00b1 SEM. *p\u2009<\u20090.05, **p\u2009<\u20090.01, and ***p\u2009<\u20090.001 as determined by one-way ANOVA or Kruskal\u2013Wallis test. Violin plots present the median and interquartile range (25th and 75th percentiles). Download Figure 4-1, TIF file.Extended data supporting We showed earlier that actin polymerization was required for filopodia growth after initial formation of a proto-protrusion by MIM/Mtss1 . Also, tThe interaction between Gas7 and N-WASP through the WW domain in Gas7 has been previously reported . N-WASP N-WASP binds and activates the Arp2/3 complex, a key actin nucleator . Thus, win vitro P3 in vitro . To examin vitro A,B. We fin vitro A. As expin vitro B. Moreovin vitro  exhibitein vitro .10.1523/ENEURO.0344-22.2023.f7-1Extended Data Figure 7-1A, Quantification of the rate of formation of new protrusions 10\u201315 min before and 10\u201315 min after 100 \u00b5m PI3K inhibitor (LY294002) treatment in GFP-Gas7-expressing neurons. The average number of new protrusions/10 \u00b5m/1 min before LY294002 treatment was 0.212\u2009\u00b1\u20090.029 compared to that after LY294002 treatment, 0.088\u2009\u00b1\u20090.017. *p\u2009<\u20090.05 as determined by Wilcoxon matched-pairs signed-rank test n\u2009=\u20097 videos). B, Quantification of the percentage of new protrusions initiating from GFP-Gas7 clusters before and after 100 \u00b5m PI3K inhibitor (LY294002) treatment in GFP-Gas7-expressing neurons. The average percentage of new protrusions initiating from GFP-Gas7 clusters before LY294002 treatment was 73.106\u2009\u00b1\u20094.572 compared to that after LY294002 treatment, 37.800\u2009\u00b1\u20094.374. *p\u2009<\u20090.05 as determined by Wilcoxon matched-pairs signed-rank test (n\u2009=\u20097 videos). P3  and we dWe also analyzed the localization of F-BAR domain alone. MIM/Mtss1 I-BAR domain localized strongly to the plasma membrane and it induced finger-like filopodia all over the dendrites . SrGAP3 Earlier results have indicated that the activity-induced spine outgrowth is dependent on NMDA receptor signaling . NMDA rein vivo prevented the exercise-induced increase in spine density and EPSCs. In our current study, we showed that Gas7 localization to spine initiation sites can be enhanced by neuron activation (Expression of ABBA/Mtss1l has been shown to increase in a mouse brain in response to physical exercise . shRNA-mtivation . This evGas7, SrGAP3 and ABBA/Mtss1l have relatively broad expression throughout the mouse life . In cont"}
+{"text": "Fatigue tests were carried out with a load ratio of 0.1 and at least four load levels for each material, and the peak value of the load levels was reduced accordingly in subsequent levels. The results showed that the static and fatigue strengths of Type A and Type B materials were better than those of Type C and Type D. Moreover, the fiber-reinforced polymer material, Type C, showed marked material\u2013geometry coupling. The study revealed that the final properties of the restoration depended on manufacturing techniques and the operator\u2019s experience. The findings of this study can be used to inform clinicians\u2019 choice of restorative materials for implant-supported rehabilitation, considering factors such as esthetics, mechanical properties, and cost.The choice of the proper restorative material is essential for the long-term success of implant-supported rehabilitations. This study aimed to analyze and compare the mechanical properties of four different types of commercial abutment materials for implant-supported restorations. These materials included: lithium disilicate (A), translucent zirconia (B), fiber-reinforced polymethyl methacrylate (PMMA) (C), and ceramic-reinforced polyether ether ketone (PEEK) (D). Tests were carried out under combined bending\u2013compression conditions, which involved applying a compressive force tilted with respect to the abutment axis. Static and fatigue tests were performed on two different geometries for each material, and the results were analyzed according to ISO standard 14801:2016. Monotonic loads were applied to measure static strength, whereas alternating loads with a frequency of 10 Hz and a runout of 5 \u00d7 10 The choice of the proper restorative material is fundamental for the long-term success of implant-supported rehabilitation . Severalt-test was applied to the static strength results, revealed the significant influence of specimen shape on the mechanical resistance of the abutment. The results attained in the static tests guided the fatigue characterization campaign that was carried out with the aim of simulating five years of clinical service, corresponding to 5 \u00d7 106 loading cycles [Within this context, in the present study, we aimed to analyze the mechanical performance of four different types of commercial abutment materials, both ceramics and polymer composites. In particular, the static and fatigue strength of abutments obtained from the selected materials were analyzed and systematically compared according to the ISO standard 14801:2016 [g cycles ,21. The The experimental tests were carried out according to ISO standard 14801:2016 [\u00ae E10000 [The testing machine used to perform the fatigue tests was the Instron Electropuls\u00ae E10000 , which cThe standard defines two possible loading geometries for systems with or without angulated abutments. In the present work, a system with no angulated abutment was adopted, the schematic of which is shown see in a. Load FThe loading setup was configured according to this load geometry. Autodesk Inventor 2022 (education version) CAD software was used to model the system b in ordeAs static and dynamic tests necessitated only a small load, there was no need to conduct numerical simulations in order to verify the stiffness or capacity of the loading setup. In the present study, four types of material were analyzed in monotonic static and fatigue tests: lithium disilicate, translucent zirconia, fiber-reinforced PMMA, and ceramic-reinforced PEEK material, namely Type A, Type B, Type C, and Type D see , respectThe geometry of the implant body is not that of a typical threaded rod used to tighten an implant to a patient\u2019s jawbone. Instead, the implant body was shaped as a rod, with a small conical angle see a that alTo investigate whether the mechanical behavior of the abutment was affected by its shape, two different geometries were tested for all four materials. The specimens made out of the four materials are shown below with symmetrical (S) and asymmetrical (A) geometries, in The first mechanical test performed on the specimens was a monotonic static test, which defined the static strength of every combination of material and geometry. The tests were carried out under the displacement control mode at a crosshead speed of 0.1 mm/min, and five different samples were tested for each sample type. Due to considerable statistical dispersion in the experimental results caused by variations in material properties and manufacturing processes (such as non-standardized cementation), the static strength was determined as the average of five valid tests. A single test was considered valid when a failure occurred: (i) in the implant abutment; (ii) at a significant load; (iii) without a clear variation in the load setup geometry due to abnormal deformation of the specimen before failure.min/Fmax) equal to 0.1, as prescribed by the ISO standard. The load frequency was set to 10 Hz, which is less than 15 Hz, as specified in the standard in case of dry tests, and with a runout reference value equal to 5 \u00d7 106 cycles, corresponding to five years of clinical service [Following the identification of static strength and the potential influence of the specimen\u2019s geometry, static strength was used as reference value for subsequent fatigue tests. More specifically, every material was subjected to fatigue tests using at least four load levels, with the test being repeated at each of the load levels at least three times. Load controlled tests were carried out with a load ratio R , fN being the number of cycles to failure, and coefficient a and exponent b being the two constants evaluated in the aforementioned fitting procedure.Log\u2013log diagrams in a and b) of Equation (1) were calculated by performing least square fitting on the fatigue strength values.According to the usual procedure applied to determine the fatigue strength of a material, at least three valid tests per load level and at least four load levels per sample type were carried out. The evaluation of the power law parameters  regime, with a fatigue strength at Nf = 103, namely p = 90%) at the runout (5 \u00d7 106 cycles). In particular, the two materials show nearly the same fatigue strength, namely, p = 90% with respect to that of Type A, which is a direct consequence of the higher slope of the fitting curve and larger data scatter.3 and 5 \u00d7 106 cycles , ceramics (disilicate and zirconia) demonstrated significantly more static strength, with mean values exceeding 500 N for disilicate and 750 N for zirconia.\u22126 cycles, with mean values of around 280 N for both materials.The results of the fatigue tests confirmed the trend observed for static strength, with disilicate and zirconia exhibiting the highest endurance limit values at 5 \u00d7 10\u2212The power law fatigue parameters obtained for all materials provided the fatigue strength for a wide range of life cycles and highlighted the sensitivity of each material to fatigue loading conditions.\u2212For nominally isotropic materials, such as ceramics and PEEK, no geometric effects were observed. However, significant material\u2013geometry coupling was noted for fiber-reinforced PMMA in terms of both static and fatigue strength.The mechanical performance of four different types of commercial abutment materials, including ceramics and polymer composites, was investigated for both static and fatigue behaviors in accordance with ISO standard 14801:2016. Two different material geometries were also analyzed. The main results are summarized as follows:"}
+{"text": 
\ No newline at end of file