diff --git "a/deduped/dedup_0282.jsonl" "b/deduped/dedup_0282.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0282.jsonl"
@@ -0,0 +1,44 @@
+{"text": "The ribosome is a two-subunit enzyme known to exhibit structural dynamism during protein synthesis. The intersubunit bridges have been proposed to play important roles in decoding, translocation, and the peptidyl transferase reaction; yet the physical nature of their contributions is ill understood. An intriguing intersubunit bridge, B2a, which contains 23S rRNA helix 69 as a major component, has been implicated by proximity in a number of catalytically important regions. In addition to contacting the small ribosomal subunit, helix 69 contacts both the A and P site tRNAs and several translation factors.in vitro protein synthesis, and under-represented in the polysomes. Mutation \u03a81917C has a very strong growth phenotype and leads to a general depletion of the cellular polysome pool. Mutation A1916G, having a modest growth phenotype, is apparently defective in the assembly of the 70S ribosome.We scanned the loop of helix 69 by mutagenesis and analyzed the mutant ribosomes using a plasmid-borne IPTG-inducible expression system. We assayed the effects of 23S rRNA mutations on cell growth, contribution of mutant ribosomes to cellular polysome pools and the ability of mutant ribosomes to function in cell-free translation. Mutations A1912G, and A1919G have very strong growth phenotypes, are inactive during Mutations A1912G, A1919G, and \u03a81917C of 23S rRNA strongly inhibit translation. Mutation A1916G causes a defect in the 50S subunit or 70S formation. Mutations \u03a81911C, A1913G, C1914A, \u03a81915C, and A1918G lack clear phenotypes. Thermus thermophilus ribosome Phe  and 0.2 mg S-100 enzymes. After 30 min incubation at 37\u00b0C, reactions were stopped by addition of 1 ml 5% trichloroacetic acid (TCA) and heated for 20 min at 95\u00b0 C. Precipitates were collected onto GF/A filters (Whatman) and counted for radioactivity. Thiostrepton resistance of the ribosomes was calculated by dividing TCA-insoluble radioactivity obtained in the presence of thiostrepton to that obtained in the absence of the drug.Poly(U) translation was performed essentially as described in Saarma and Remme . ThiostrAL and DK did most of the experimental work and participated in planning and design of the experiments. \u00dcM participated in the analysis of mutant ribosomes and writing of the manuscript. JR conceived the study, participated in its design, and helped to write the manuscript."}
+{"text": "Drosophila melanogaster. This review is dedicated to Drosophila as a genetic and cellular model to study axonal growth and demonstrates how it can and has been used for this research. We describe the various cellular systems of Drosophila used for such studies, insights into axonal growth cones and their cytoskeletal dynamics, and summarise identified molecular signalling pathways required for growth cone navigation, with particular focus on pathfinding decisions in the ventral nerve cord of Drosophila embryos. These Drosophila-specific aspects are viewed in the general context of our current knowledge about neuronal growth.One of the most fascinating processes during nervous system development is the establishment of stereotypic neuronal networks. An essential step in this process is the outgrowth and precise navigation (pathfinding) of axons and dendrites towards their synaptic partner cells. This phenomenon was first described more than a century ago and, over the past decades, increasing insights have been gained into the cellular and molecular mechanisms regulating neuronal growth and navigation. Progress in this area has been greatly assisted by the use of simple and genetically tractable invertebrate model systems, such as the fruit fly  The function of a nervous system depends on the proper arrangement of its cellular elements, that is, neurons and glia cells. Amongst these, neurons bear axonal processes that establish synaptic contacts with other cells  that can be a significant distance away. The transfer of information between these cells is the key feature of nervous system function and is usually mediated by action potentials that propagate along axons and are passed on to other cells at synapses. The wiring of such a system has to be precise and reproducible from individual to individual, as was first highlighted by Ram\u00f3n y Cajal for the nervous systems of humans, other vertebrates, and also invertebrates . Such prCaenorhabditis elegans or the fruit fly Drosophila melanogaster. The strength of these species lies in their amenability to genetic manipulation (see below) and the fact that their nervous systems are composed of relatively low numbers of cellular elements. Whereas specific neuronal connections in vertebrates are usually formed by larger groups of neurons that develop and act in parallel, these connections are mostly represented by unique, individually recognisable neurons in invertebrates. Studies capitalising on such identifiable neurons, for example in insects, have helped to unravel principles of neuronal circuit formation. For example, the initial observation of guidepost cells as stepping stones for axonal growth came from studies of the grasshopper limb bud ,,23], molOne obvious feature of axonal growth behaviour in the CNS is that projections of motor-, inter- and sensory neurons aggregate into a cell body-free region, the neuropile, in which synaptic contacts will be established Figure . This beDrosophila CNS midline'; most interneurons and some motorneurons). Those axons that cross the midline are faced with the first and third choices again on the contralateral side. Those axons that do not leave the neuropile terminate their growth in stereotypic positions, presumably at points of future synapse formation [Within the (prospective) neuropile, growth cones are faced with a number of decisions Figures  and 4c,dormation .Drosophila CNS midline' below. In contrast, virtually nothing is known about the mechanisms underlying axonal growth termination in the neuropile. In the context of the navigational capability of motorneuronal growth cones to exit the CNS, the involvement of only two signalling pathways has been suggested so far: the diffusible ligands Netrin A+B and their receptors Unc5 and Frazzled, and the receptor tyrosine kinase Eph and its ligand Ephrin. Targeted expression of Unc5 or of double stranded Eph or Ephrin RNA in interneurons causes their aberrant exit from the CNS , their growth cones will carry out the normal growth regime, however, in mirror image fashion on the ipsilateral side, demonstrating that midline crossing is not an essential prerequisite for their capability to exit the CNS [The third and fourth growth decisions outlined above  have been studied extensively during the past two decades, and insights gained from these studies will be reviewed in detail in the sections 'The formation of longitudinal fascicles in the embryonic ventral nerve cord' and 'Growth cone guidance at the S Figure , xxx [21o debate ,214. At o debate ,82,215.  the CNS ,217. ObvDetailed analyses of the developing ventral nerve cord have revealed the time course of initial antero-posterior axonal growth within the longitudinal connectives ,218,219.During their initial advance, growth cones of MP1, dMP2, vMP2 and pCC establish intimate contacts with longitudinal/interface glia cells, which line up in the area of the future connectives prior to the axonal growth phase Figure  8,206,2,221. Theneurotactin mutant phenotypes emerge in combination with mutations in other neuronal growth-related genes [neurotactin and neuroglian display fasciculation defects of dMP2 and MP1 axons and disrupted connectives at high frequency  [In addition to responding to external cues such as glial surfaces and Netrins, the axons of the four pioneer neurons interact with each other in a stereotypical way, involving sequential steps of fasciculation, defasciculation and refasciculation  ,242.neurotactin's genetic interactions, the range of molecules involved in longitudinal guidance of central axons in Drosophila clearly goes beyond adhesion factors, and this is supported by a number of further mutant phenotypes. For example, lack of the transmembrane protein Semaphorin-1A and its receptor PlexinA causes disruption of a lateral Fasciclin 2 tract  show severe disruption of connectives and strong defasciculation phenotypes [As illustrated by t Figure , xxxiii,ehaviour . Embryosenotypes ,248. Alsenotypes ,250.Lola encodes a variety of isoforms that are expressed within subsets of neurons and these are likely to regulate the expression of many guidance molecules [The expression of these various neuronal receptors, adhesion molecules and their associated molecules involved in the neuronal response to environmental cues must be precisely regulated by pioneer neuron-intrinsic gene regulatory programmes. One candidate regulator is the neuronal transcription factor Longitudinals lacking (Lola). In the absence of Lola, longitudinal glia cells form normally, but pCC, vMP2 and MP1 growth cones stall dramatically and connectives fail to form ,251. Lololecules .As discussed above, all these genetic pathways implicated in longitudinal fascicle formation eventually have to act on the cytoskeletal machinery of the growing neurons Table . In agreIndividual longitudinally projecting axons are positioned at particular locations within the connectives. This is mediated both by selective fasciculation behaviour and the use of protein gradients that establish positional information within the connectives to dictate where individual axons project. As explained above, longitudinal pioneer axons are initially grouped into one fascicle, but they subsequently separate into distinct fascicles in characteristic dorso-ventral and medio-lateral positions Figure  219,223223. ThisN-cadherin mutant embryos display aberrations of longitudinal fascicle patterns , growth cones alter their medio-lateral pathfinding and longitudinal fasciculation behaviour in stereotypical ways  , suggesting further parallels to the vertebrate system.Another major factor guiding axons at the CNS midline and opposing the effects of Netrins is the secreted repellent factor Slit, which is also expressed by the glia cells at the midline of the ventral nerve cord Figure , vi 258258,270. e Figure , xiv [23e Figure , xi [205ptor DCC . The mos) Figure . SubsequIn vivo observations in normal and mutant Drosophila embryos have revealed that growth cones of the ipsilateral motorneuron RP2 form longer and more persistent filopodia in robo mutant animals, and that filopodia reaching across the midline have the unusual tendency to persist and develop into contralateral branches [robo interacts genetically with mutations of the actin-plasmamembrane linker molecules beta-Spectrin/Karrussell in the context of midline crossing [2+-binding molecule Calmodulin [branches . This clcrossing ,283 and crossing . Furthercrossing ,285-287.crossing ,153. In crossing . Thus, Acrossing ,288-291.lmodulin .Drosophila CNS, DPTP69D, DPTP99A, and DPTP10D [robo-like midline-crossing phenotype [kra mutations interact genetically with short stop, slit and robo [kekkon and neurotactin, both of which encode adhesion factors [Apart from the three ligand receptor systems discussed above, a number of other genes have been implicated in the process of midline crossing and need to be incorporated into any model that seeks to explain how midline crossing is regulated. Thus, Amalgam, a secreted protein with three immunoglobulin domains, and its binding partner Neurotactin, a transmembrane protein with a catalytically inactive cholinesterase domain, interact with Abelson in the context of midline crossing . Another DPTP10D ,294. Of henotype . Robo sihenotype , while Shenotype . The traand robo . Also, iand robo . Finally factors . WhetherDrosophila, and there is hardly a cellular system of axonal growth for which there is more molecular and genetic information available. Axons must make a decision whether to cross the midline and, those that do cross, must select a commissure, and be shepherded towards, across and then away from the midline. This clearly requires a significant amount of cellular processing for which the principal mechanisms are quite well understood . Third, with respect to pathfinding mechanisms in the ventral nerve cord, virtually nothing is known about growth regulation in the dorso-ventral axis, which may be due to the fact that the read-outs used in most genetic screens would not easily reveal growth aberrations within the vertical axis. Improved cellular systems and closer attention to this aspect of axon growth should ensure that mechanisms will be found in due course [Drosophila' above), and many of them are still awaiting their detailed analysis. Consequent work in these directions will ensure that Drosophila will continue to contribute essential new insights to the field of neuronal growth.First, more analyses need to be carried forward to the identified cell level using cell-specific markers  declare that they have no competing interests.The first draft of this review was written by NSS together with AP, which was then refined, corrected and complemented by GT and PW. All figures were composed by AP with image contributions by NSS Figures  and 4a a"}
+{"text": "Comprehensive information about national spending on prevention is crucial for health policy development and evaluation. This study provides a comprehensive overview of prevention spending in the Netherlands, including those activities beyond the national health accounts.National spending on health-related primary and secondary preventive activities was examined by funding source with the use of national statistics, government reports, sector reports, and data from individual health associations and corporations, public services, occupational health services, and personal prevention. Costs were broken down by diseases, age groups and gender using population-attributable risks and other key variables.Total expenditures on prevention were \u20ac12.5 billion or \u20ac769 per capita in the Netherlands in 2003, of which 20% was included in the national health accounts. 82% was spent on health protection, 16% on disease prevention, and 2% on health promotion activities. Most of the spending was aimed at the prevention of infectious diseases (34%) and acute physical injuries (29%). Per capita spending on prevention increased steeply by age.Total expenditure on health-related prevention is much higher than normally reported due to the inclusion of health protection activities beyond the national health accounts. The allocative efficiency of prevention spending, particularly the high costs of health protection and the low costs of health promotion activities, should be addressed with information on their relative cost effectiveness. Among tIn contrast to their public health impact, the share of prevention in total health expenditures is often claimed to be small . In the New preventive and curative health technologies are being developed continuously, and health authorities are faced with decisions about allocating resources towards these technologies, in addition to (or as substitute for) existing interventions. This requires knowledge on the effectiveness, resource use, and costs of new and existing technologies. Differences in cost effectiveness indicate that we could save lives more effectively and efficiently . RegardiAccordingly, comprehensive information about national spending on prevention is crucial for health policy development and evaluation. We present here an overview of the costs of health-related preventive activities in the Netherlands in 2003, both inside and outside the health care sector, as a framework for more detailed (cost-effectiveness) analyses. Costs are broken down by different categories, disease groups, age and gender, and will also be discussed from the perspective of expenditure on curative services and long-term care.We considered preventive activities conducted by (semi-)government, trade and industry, and consumers . We identified these preventive activities as follows. First, we consulted overview articles or (policy) reports -12, thatWe included primary and secondary preventive activities . Tertiary preventive activities were excluded because these are difficult to separate from usual patient care.Preventive activities performed by actors integrated in the NHA  were all seen as relevant and included. Preventive activities considered outside the NHA  all aim to protect or promote health. However, some interventions are not exclusively aimed at promoting health, but also serve other sources of welfare, such as a clean , comfortable (e.g. noise barriers), and safe (e.g. prevention of violence) environment, either physical or social. We included those interventions for which the promotion of health is the principal policy objective or has been the dominant motive by the time of introduction, even though these interventions were not exclusively aimed at promoting health. For this, we relied to a great extent on expert opinions. Although the existence of multiple policy objectives is evident for specific interventions, valid criteria are lacking to break down the expenditures of these interventions by separate policy objectives.Preventive activities aimed at sports were partly included (e.g. promoting sport as a public initiative) due to a dominant public health aim, whereas this was not the case for sports in general . Education was not labeled as prevention, although schools can play an important role in promoting healthy lifestyles regarding nutrition and sexual behavior.Although excise duties  are important public health instruments, they were not included since from a societal perspective they must be regarded as transfer payments rather than real (opportunity) costs.Various sources were used to quantify the expenditures on selected preventive measures: national statistics , governmOn aggregate level we analyzed the distribution of preventive expenditure from a societal perspective as well as from a more restricted health care perspective as used in NHA and in the System of Health Accounts (SHA) developed by the OECD. Then, all identified preventive measures were classified as either health promotion, health protection, or disease prevention. Health promotion is aimed at promoting healthy behavior through information and education; health protection is aimed at reducing exposure to environmental health risks by legislation, control, and interventions; disease prevention includes preventive medication, vaccination, and screening. Health promotion and health protection are both aimed at a specific determinant and not directly at a specific disease. Disease prevention is disease specific, and includes primary preventive activities (i.e. aimed at a determinant of a specific disease) as well as secondary preventive activities (i.e. aimed at a specific disease). Although most preventive activities could be uniquely classified , some preventive measures overlapped multiple categories. For instance, expenditure on youth health care by municipal health services was divided into disease prevention  and health promotion (15%) based on contact guidelines and expert consultation. Preventive activities of occupational health services were entirely allocated to health protection, although a minority of activities can be regarded as disease prevention  or health promotion ; this was guided by expert opinion since registration data were unavailable. Similarly, preventive activities by fire departments were classified as health protection because they are predominantly directed as risk assessment and enforcement of fire safety regulations, whereas no specific information was available on information and education activities undertaken by fire brigades.Preventive expenditures were allocated to age groups , gender, and disease groups using key variables. For example, we used figures on screening participation to allocate expenditures on the national breast cancer screening program to women in the different age groups. Similarly, expenditures of cholesterol-lowering therapy were allocated to age and gender by drugs-dispensing data from the 2003 national registry on pharmaceutical care . PrenataDisease groups were in line with the cost-of-illness approach defined according to the 17 chapters of the ICD-9 .Most preventive measures could uniquely be related to disease groups . Preventive measures aimed at addiction and gambling dependence were consistently allocated to mental disorders.Some other preventive measures, however, relate to risk factors for multiple diseases, such as smoking and obesity. The costs of these preventive measures were allocated to each disease group using the population attributable risk (PAR) for mortality, which is the proportion of cause-specific deaths that is attributable to a risk factor  is the proportion of the general population exposed to a particular agent, and the RR is the relative risk ) of disease or death for the exposed versus nonexposed. For more information, see also the study of Steenland et al.  who estiNot all preventive activities could be allocated to relevant disease groups mainly because available data lacked sufficient detail, e.g. use of vitamins, general medical examinations, youth health care (excluding vaccination), housing quality inspectorate, general health promotion, and occupational prevention. These were classified as \"not disease specific\".In the Netherlands, total expenditures on prevention were estimated at \u20ac12.5 billion in 2003, equal to \u20ac769 per inhabitant capita  was made within the health care system and accounted for 4.3% of total health expenditure. This part of preventive expenditure was dominated by disease-prevention activities such as cholesterol-lowering therapy, antihypertensive treatment, cancer screening, and vaccination (82%). A much smaller part was spent on health protection activities  and on health promotion (8%).From a societal perspective expenditure on prevention exceeds the investments on prevention undertaken by health providers within the scope of the health care system. Table Most of the spending on preventive measures was aimed at prevention of infectious diseases (34%), followed by injury (29%), respiratory diseases 13%), cardiovascular diseases (8%) and mental disorders (5%) , which is much higher than usually reported. This is due to the inclusion of health protection activities beyond the NHA , that are fourfold the prevention expenditures within the NHA . Most expenditures of preventive measures were aimed at infectious diseases  and acute physical injuries . The expenditures on disease prevention were lowest in children and adolescents, and increased steeply with age. Amounts spent on prevention were slightly higher for women. Only for infectious diseases and injuries were expenditures on prevention higher than expenditures on curative services and care services.Although we aimed for a complete overview of spending on preventive measures, data were unavailable for specific police expenditures , prevention by general practitioners , and industrial spending on food safety. Data for specific consumer expenditures were also lacking due to (many) different providers supplying one specific preventive product in combination with no access to the financial data concerning the product. Therefore, it was not possible to collect (reliable) financial data on preventive products such as fire alarms, sunscreen, car safety seats, prescription-free vitamins, and bicycle helmets. Expenditures on sports products  were ignored, because in this study these products were not labelled as preventive activities. As a result, our figures are still an underestimate. On the other hand, we included interventions that were not exclusively aimed at promoting health, but also serve other policy objectives . The rationale for their inclusion was that, in these instances, health objectives are considered to dominate other policy objectives, and valid criteria are lacking to break down the expenditures of these interventions by separate policy objectives. If interventions directed at multiple policy objectives would be excluded, the total prevention expenditures would then be \u20ac160 per capita (\u20ac2.6 billion for the Dutch society) instead of \u20ac769 per capita (\u20ac12.5 billion for the Dutch society). Although the inclusion of health protection measures beyond the NHA is questionable, in our opinion the inclusion of these measures is justified based on their positive contribution to public health ,37.A second limitation of our study is that we assumed that data from financial reports and literature (i.e. not peer reviewed) were true, because we could not control these data. Per definition, data taken from expert opinions are estimations, and subdivision of expenditures in terms of personnel, material and overhead was lacking. For this reason, assessing face validity was not possible. However, for the validity and to prevent double counting of spending on prevention we collected data from executive organizations, and as much as possible used published annual reports and formal balance sheets.A third limitation of our study is the use of PARs as a methodology to allocate costs of preventive activities to disease groups. Two important limitations of the PAR methodology are that 1) some causes of disease can be synergistic so that PARs sum to more than 100%, and 2) PARs vary in the scientific literature .It is difficult to judge whether our findings are generalizable to other countries due to the lack of comparable studies. Total prevention expenditures in the USA were estimated at $188 per capita in 1988 (adjusted to price level 2003) , which iThe proportion of health promotion in total prevention expenditures  is small compared to the health burden that can be attributed to harmful health behavior. In the Netherlands 13% of the total burden of disease can be attributed to smoking, 10% to overweight and obesity, 8% to hypertension, and 4% to physical inactivity . AlthougA significant relationship is expected between the high expenditures on prevention of infectious diseases and injuries, and the respectively low expenditures on curative services and long-term care. Strategies to combat these health problems by regulation and preventive technologies have been successful, and provide a clear motive to investigate whether the potential of preventive strategies in other public health areas  has been sufficiently reached . Particuth and early 20th century, with very favorable cost effectiveness ($500 per life year saved in 2003 dollars) [Relatively high amounts are spent on health protection measures such as air quality, drinking water systems, domestic waste disposal and traffic safety measures. Some of these have provided considerable value for money. For instance, the implementation of clean water systems in American cities substantially reduced mortality in the 19dollars) , whereasdollars) . Given tWe conclude that the total expenditures on health-related prevention in the Netherlands is much higher than usually reported due to the inclusion of health protection activities beyond the NHA and SHA. The low share of health promotion activities in total expenditures is noteworthy. Because the health effects of many costly health protection activities are unknown or uncertain, this can only partly be due to the lack of available evidence on effectiveness and cost effectiveness. A systematic assessment of available evidence on the cost effectiveness of preventive and curative interventions could lead to more investments in prevention directed at health behavior.The author(s) declare that they have no competing interests.EWB carried out the research and drafted the manuscript. WJM conceived the idea of the paper and supervised the research. All authors contributed substantially to the study design, data collection, and the manuscript. JPM acted as guarantor. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:An overview of prevention measures, data sources, and types of cost calculation method.Click here for fileAn example of allocating costs of anti-smoking medication to different disease groups.Click here for file"}
+{"text": "Although, American Academy of Pediatrics updated the guidelines for lipid in childhood, Asian study is rare.Dyslipidemia is one of the important modifiable risk factors for cardiovascular disease. Thus, to know the prevalence of dyslipidemia is the 1The authors aimed to make a reference of each serum lipid level of Korean children and adolescents  from the data of Korea National Health and Nutrition Examination Survey IV (2007\u20132009).The mean serum concentrations for total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), triglycerides (TG), and high-density lipoprotein cholesterol (HDL-C) were 158 mg/dL, 90 mg/dL, 90 mg/dL, and 49 mg/dL, respectively. The 95th percentile values for TC, LDL-C, and TG were 203 mg/dL, 129 mg/dL, and 185 mg/dL, respectively. The 5th percentile value for HDL-C was 36 mg/dL. The prevalence of hypercholesterolemia, high LDL-C, high TG, and low HDL-C was 6.5%, 4.7%, 10.1%, and 7.1%, respectively. Considering the risk factors such as obesity, hypertension, smoking, and diabetes, approximately 0.41% of the subjects were potentially eligible for pharmacological treatment.This information may be useful in not only Korean but also Asian planning programs for the prevention of cardiovascular disease through lipid control from childhood. Cardiovascular disease (CVD) is a major cause of morbidity and mortality worldwide, including Korea Historically, the prevalence of CVD in Korea has been much lower than that in Western countries. However, recently, the CVD-associated mortality rate in Korea increased up to 27.6%, comparable to that in the United States The objectives of this study were as follows: (1) to determine the serum lipid concentrations of Korean children and adolescents aged 10 to 18 years; (2) to estimate the national prevalence of pediatric dyslipidemia; and (3) to estimate the number of children and adolescents eligible for pharmacological treatment using the approach presented in the AAP report.This study was performed using data acquired in the Fourth Korea National Health and Nutrition Examination Survey . These surveys have been conducted periodically since 1998 to assess the health and nutritional status of the non-institutionalized civilian population of Korea. KNHANES IV was a cross-sectional and nationally representative survey with a multistage and stratified sampling design conducted by the Division of Chronic Disease Surveillance, Korea Centers for Disease Control and Prevention. Total 31,705 individuals  were included in KNHANES IV; among them, 74.5% families participated in health surveillance and blood sampling. A total of 2753 subjects aged 10 to 18 years  were identified as potential subjects for this study. All subjects and their parents were interviewed at home after informed consent and undergo various examinations including blood sampling. Those with incomplete data for a standardized physical examination, blood pressure (BP) assessments, and laboratory tests, including whole lipid profile, and anthropometric measures and those who were currently taking blood cholesterol-lowering medications were excluded. Thus, the final analytical sample consisted of 2,363 subjects  who were at least 8 h of fasting state.The blood samples were taken by skilled nurse in mobile vehicle and transported daily to the Central Laboratory . In 2007, serum TC, HDL-C, and TG concentrations were measured enzymatically by using ADIVIA1650 (Siemens/USA) with commercial reagents . In 2008\u20132009, TC, HDL-C, and TG concentrations were enzymatically measured using Hitachi Automatic Analyzer 7600 (Hitachi/Japan) with reagents  by NEODIN Medical Institute.The LDL-C were calculated with the Friedewald equation (LDL-C\u200a=\u200aTC\u2212[HDL-C+(TG\u00f75)]) The prevalence of dyslipidemia was assessed according to the NECP and AHA report All data were analyzed using SPSS 17.0 for Windows . The prevalence of each type of dyslipidemia was estimated by incorporating weights to avoid bias. Weights were created to account for the complex survey design, non-response, and post-stratification. The data are presented as the mean \u00b1 SD (or SE). The authors calculated mean and percentile values for TC, LDL-C, TG, and HDL-C concentrations. To compare the means between the sex and among age groups, Student's t test and ANOVA were used. Differences in the prevalence of dyslipidemia as a function of obesity and hypertension status were assessed using chi-square tests. Odds ratios (OR) were used to estimate the relative risk for abnormal lipid concentrations. P-values of <0.05 were considered significant.Among the 2,363 subjects, 450 (19.2%) had hypertension, 341 (14.4%) were obese, 26 (1.1%) were current smokers, and 2 girls (0.09%) were newly identified diabetes. Obese subjects were significantly more likely to have at least one abnormal lipid concentration  and subjects with hypertension were more likely to have at least one abnormal lipid concentration .P<0.001). Children aged 10\u201311 years had a mean TC concentration of 166 mg/dL, which was significantly higher than that for 12\u201318 years (P<0.001). Furthermore, there was a significant decrease in mean TC from ages 11\u201312 years to 13\u201314 years only in boys (P<0.001) (P<0.001), and the mean LDL-C decreased from 12 years of age and then stabilized subsequently only in boys. Girls showed relatively stable LDL-C (P<0.001) (P<0.05). Mean TG values ranged from 81 to 101 mg/dL for boys and 80 to 105 mg/dL for girls according to the age group. The peak TG concentration was noted in the 15\u201316-year age group in boys and the 11\u201312-year age group in girls  . Age- anle LDL-C . Age- anP<0.001) . In addiin girls .P<0.001) but lower low HDL-C prevalence .Among all subjects, 19.7% had at least one abnormal lipid concentration according to the cutoff points of the NCEP and AHA . The estAmong the 2,363 subjects, 2 subjects (1 boys and 1 girl) had an LDL-C >190 mg/dL. Nine subjects (3 boys and 6 girls) with other risk factors  had an LDL-C >160 mg/dL. No subject who newly diagnosed diabetes showed elevated LDL-C (\u2265130 mg/dL). Weighted prevalence of each criterion was 0.09%, 0.34%, and 0.00% respectively. Thus, almost 0.41% of Korean adolescents were eligible for pharmacological treatment.This is the first Asian study to estimate the percentage of children and adolescents, including those with hypertension and diabetes, eligible for pharmacological treatment according to AAP guidelines. The prevalence of hypercholesterolemia, high LDL-C, high TG, and low HDL-C concentrations among Korean children and adolescent is 6.5%, 4.7%, 10.1%, and 7.1%, respectively. Twenty percent had at least one type of dyslipidemia. Furthermore, almost 0.41% of children and adolescents would qualify for lipid-lowering pharmacological treatment according to the AAP guidelines.Several major studies such as Lipid Research Clinics Prevalence Study and NHANES have provided age- and sex-specific references for concentrations of lipids in children and adolescents in the United States The 50th, 75th, 90th, and 95th percentile values for cholesterol concentrations from the KNHANES IV adolescents aged 10 to 18 years were 152, 171, 191, and 200 mg/dL, respectively, for boys and 160, 176, 194, and 205 mg/dL, respectively, for girls. In comparison, the percentile values calculated from the United States NHANES 1999 to 2006 data for white boys aged 6 to 17 years were 157, 177, 195, and 212 mg/dL, respectively, and those for white girls were 162, 182, 201, and 219 mg/dL, respectively The TG profile also showed a similar pattern. The 50th and 95th percentiles for TG concentrations were 73 and 189 mg/dL for Korean boys and 80 and 181 mg/dL for girls. In comparison, the percentiles calculated from the United States NHANES data from 1988 to 1994 for white boys 12 to 19 years of age were 76 and 205 mg/dL, respectively, and those for white girls were 80 and 218 mg/dL, respectively. The 5th and 50th percentiles for HDL-C concentrations were 35 and 48 mg/dL for Korean boys and 37 and 50 mg/dL for girls. In comparison, the percentiles calculated from the NHANES 1988 to 1994 data for white boys aged 4 to 19 years were 37 and 53 mg/dL, respectively, and those for white girls were 36 and 54 mg/dL, respectively Gender differences in lipid concentrations also existed in Korean children and adolescents, as reported in other previous studies In Korea, like in other Asian countries, the prevalence of CVD was much lower than that in Western countries 50 years ago Dyslipidemia is one of the most important modifiable risk factors for cardiovascular diseases There were some limitations in the present study. First, we were unable to estimate precisely the number of children and adolescents who were potentially eligible for pharmacological treatment because information regarding family history of CVD was not collected in KNHANES-IV. Second, the subject who was suspected diabetes with high LDL-C and high HbA1c was not included as they were not fasting state. If they were included the adolescent potentially eligible for pharmacological treatment would further increase.We made the references of each lipid and lipoprotein concentrations in Korean children and adolescents aged 10\u201318 years. The estimated national prevalence of any type of pediatric dyslipidemia by using the NECP and AHA guidelines was 19.7%. Furthermore, at least 0.41% of Korean children and adolescents are eligible for pharmacological treatment according to the AAP guidelines. These findings provide useful information not only for Korean but also for Asian ethnicity in planning programs targeting the prevention of CVD through lipid control from childhood."}
+{"text": "Orientia tsutsugamushi in colonies of Leptotrombidium palpale was studied in the parent and F1 and F2 generations. Both transovarial transmission and filial infection rates were 100% in the parent and F1 generations of Leptotrombidium palpale. The filial infection rate in the F1 generation was 100%, but it declined to 94.3% in the F2 progeny. The sex ratio of the F1 generation from infected L. palpale was 1\u22360.8  and the proportion of males was relatively high. This study is the first to report on the transovarial transmission of O. tsutsugamushi in L. palpale. High transovarial transmission rates in L. palpale suggest that this species might be one of the major vectors of tsutsugamushi disease in Korea.Transovarial transmission of  Orientia tsutsugamushi infection. This disease, which is transmitted by the bite of infected chiggers was first reported in Korea in 1951 http://stat.cdc.go.kr). Seven species\u2014Euschoengastia koreaensis, Leptotrombidium orientale, L. scutellare, L. pallidum, L. palpale, L. zetum and Neotrombicula japonica\u2014are considered to be the major vector species in Korea Scrub typhus, better known as tsutsugamushi disease, is an acute and febrile disease caused by O. tsutsugamushi, to maintain disease transmission, it is necessary for O. tsutsugamush to be transmitted transstadially through the nymph and adult stages and transovarially transmitted through the eggs to the progenies Orientia by infected chiggers is important in determining how the disease is maintained in nature. Previous studies on transovarial transmission occurred in L. pallidumL. scutellareO. tsutsugamushi was transmitted transovarially through eggs in the infected colonies of L. fletcheri, L. arenicola, L. deliense, L. imphalum, and L. chiangraiensisBecause the larval stage is the only parasitic stage of O. tsutsugamushiL. pallidumL. imphalumO. tsutsugamushi in two generations (Parent and F1) of naturally-infected L. palpale colonies. Two parameters, transovarial transmission rate and filial infection rate, were studied. Oviposition and hatching rates in naturally infected and uninfected L. palpale were also compared.It is known that males are aberrant hosts of 1 generations of trombiculid mites were used in this study.The animal protocol used in this study was reviewed and approved based on ethical procedures and scientific care by the KCDC-Institutional Animal Care and Use Committee . Engorged larval chiggers were collected from wild rodents, which were captured in March 2010 from Jangan-myeon, Hwaseong-si Gyeonggi Province, Korea. There was no need for specific permission for using these collecting sites, because these sites were not located at national parks or protected areas and installation of traps was supported by Public Health Center in Hwaseong-si. A total of 50 Sherman live folding traps (3\u00d73\u00d79 inch), baited with a peanut butter spread paper, set up at five points in the collection site with 5 m intervals and collected at next day morning. A total of 20 wild rodents were captured. The captured wild rodents were transferred individually into small cages made of stainless steel and each cage was placed on a petri dish containing water. The fully engorged larvae were collected from the water surface every day. These parent and FSinella curviseta). When chiggers developed into adults, their sexuality was determined by observing the presence of genital setae located in the genital pore by using a stereomicroscope The collected engorged larvae were reared in plastic containers  containing plaster of calcium sulfate hemihydrate with charcoal powder (9\u22361) to maintain the humidity level in the incubator. Deutonymphs and adults were fed with the eggs of Collembola (O. tsutsugamushi were detected using a nested PCR assay performed as described in 5\u2032-TCA AGC TTA TTG CTA GTG CAA TGT CTGC-3\u2032) and 55 (5\u2032-AGG GAT CCC TGC TGC TGT GCT TGC TGC G-3\u2032) were used for the first PCR, and second PCR primers 10 (5\u2032-GAT CAA GCT TCC TCA GCC TAC TAT AAT GCC-3\u2032) and 11 (5\u2032-CTA GGG ATC CCG ACA GAT GCA CTA TTA GGC-3\u2032) were used to amplify a 483-bp fragment. In the first PCR, 5 \u00b5L of template DNA of chigger mites was added to the PCR premix . The cycling conditions used were as follows: 94\u00b0C for 5 min followed by 30 cycles of 94\u00b0C for 30 sec, 60\u00b0C for 2 min, and 72\u00b0C for 2 min, and a final extension of 72\u00b0C for 10 min. For the second PCR, 2 \u00b5L of the first PCR product was amplified by the same procedure as described above, except the use of the second PCR primer pairs as follows. The second PCR products were analyzed by electrophoresis on a 1.5% agarose gel. The second PCR products size was 483 bp. The nucleotide sequence of the nested PCR products was analyzed using the BLAST program of NCBI (http://blast ncbi.nlm. nih.gov) to confirm whether the gene is from O. tsutsugamushi.DNA was extracted from chigger mites using the G-spin total DNA extraction kit . The 56-kDa genes of Apodemus agrarius Thomas were captured in Jangan-myeon, Hwaseong-si . The positive female mites (P1 and P2) produced 25 and 24 eggs and 18 and 16 larvae were hatched from these, respectively. The transovarial infection rate in L. palpale is summarized in L. palpale parents (2/2) and F1 adults (8/8) were 100%. The filial infection rate in the F1 generation was 100% (34/34), but this rate slightly declined to 94.3% in the F2 larvae (160/169).We collected 1,138 engorged larvae from twenty wild rodents, seong-si . Two O. L. palpale females produced eggs for 16 weeks. Infected females laid 32.6\u00b16.7 eggs per female and uninfected ones laid 31.5\u00b17.7 eggs per female. The hatching rate of the eggs from infected females was 64.8\u00b114.4% and that in uninfected females was 74.5\u00b18.3%. The number of eggs from infected and uninfected females were not significantly different (P>0.05), while the hatching rate in the infected cohort was lower than that in the uninfected cohort (P<0.05) (Both infected and uninfected (P<0.05) .L. pallidumL. scutellareL. palpale, which is a vector species of scrub typhus in Korea.Successful transovarial transmission in chiggers is important in the epidemiology of scrub typhus L. palpale are similar to those in L. pallidumL. pallidum were 100% 1 generation, but these rates declined to 97% in the F2 and 90% in the F3. The fillial infection rate rapidly decreased in the succeeding generations. Electron microscopic observations revealed that O. tsutsugamushi did not always invade the oocytes in the ovaries of infected females 1 of L. imphalum was 100%, which declined to 62.3% in the F2.Transovarial and filial infection rates in L. fletcheriL. arenicolaL. pallidumL. imphalumL. fletcheri (1\u2236107.8), L. arenicola (1\u2236905), and L. imphalum (1\u223664.5). In our study, the male to female sex ratio in L. palpale F1 generation was 1\u22360.8. This result is similar to the sex ratio (1\u22361.09) in L. pallidumInfected male chiggers were reported in L. palpale females laid eggs for 16 weeks, but it was for 28 weeks and longer in L. imphalumIn this study, Euschoengastia koreaensis, L. orientale, L. scutellare, L. pallidum, L. palpale, L. zetum, and Neotrombicula japonica\u2014have been considered as vectors in Korea O. tsutsugamushi infection using an indirect immunofluorescent antibody (IFA) test and polymerase chain reaction (PCR) methods. In this case, chiggers were a possibly temporarily infected through feeding on the fluids of infected wild rodents. In order to determine the vector species more clearly, it is important to investigate whether the unfed larvae collected from the soil were infected by the pathogens or not, or their transovarial transmission should be confirmed through successive rearing.To date, seven species\u2014O. tsutsugamushi in L. palpale in Korea. Further studies are needed to confirm transovarial transmission of other species for vector determination and to investigate the distribution of tsutsugamushi disease associated with the vector species.This is the first study describing transovarial transmission of"}
+{"text": "In the past few decades many countries have worked to increase the number of women delivering in facilities, with the goal of improving maternal and neonatal health outcomes. The purpose of this study is to explore the current situation of facility deliveries in Africa and Asia to understand where and with whom women deliver. Furthermore, we aim to test potential drivers of facility delivery at the individual, household, and community-level.Demographic and Health Survey data collected since 2003 from 43 countries in Africa and Asia is explored to understand the patterns of where women are delivering. We look at patterns by region and wealth quintile and urban/rural status. We then run a series of multi-level models looking at relationships between individual, household and community-level factors and the odds of a woman delivering in a facility. We explore this for Asia and Africa separately. We also look at correlates of delivery with a trained provider, in a public facility, in a private facility, with a doctor and in a hospital.The majority of women deliver in a facility and with a provider; however, about 20% of deliveries are still with no one or a friend/relative or alone. Rates of facility delivery are lower in Asia overall, and a greater proportion of deliveries take place in private facilities in Asia compared to Africa. Most of the individual level factors that have been found in past studies to be associated with delivering in a facility hold true for the multi-country-level analyses, and small differences exist between Asia and Africa. Women who deliver in private facilities differ from women who deliver in public facilities or at home.Most women in Africa and Asia are delivering in a facility, and drivers of facility delivery identified in smaller level or country specific studies hold true in multi-country national level data. More data and research is needed on other drivers, especially at the country-level and relating to the quality of care and maternal health complications. Developing countries account for 99% of global maternal deaths, the majority in sub-Saharan Africa and Asia. It is gUnderstanding why women decide to deliver in a facility is important for program and policy planning. A recent systematic review conducted by Moyer & Mustafa 2013) identified a number of drivers of facility deliveries in Sub-Saharan Africa, including maternal, social, facility, and macro-level factors[ identifiWe conducted a review of the literature in Asian countries and found that, similar to Moyer and Mustafa\u2019s findings from Sub-Saharan Africa, most studies focus on individual drivers. There is strong evidence that factors such as maternal education are associated with facility deliveries\u201311. OtheMoreover, most studies focus on country-specific cases, rather than looking at drivers across regions, including smaller scale studies in Africa and Asia\u201329. TherThis study builds upon existing literature and takes advantage of nationally representative data using the DHS to assess drivers of facility deliveries across multiple countries and regions. To our knowledge, an analysis of drivers of facility deliveries across Asia and Africa has not been undertaken with this dataset. The DHS allows us to go beyond individual factors and also examine, family, community, and facility-level factors associated with facility deliveries using more advanced multi-level modeling. A benefit of using this rich dataset is the common definition of facility delivery and providers across countries, and the ability to examine a multitude of individual and community-level factors across different contexts using more complex analytical tools. Whereas previous studies have looked at a single country, or a small handful of countries, and focused on a limited number of potential drivers, this study compiles data from over 40 DHSs and combines drivers of facility delivery at the individual, household and community level. Hence, we are able to test if the findings from a sub-set of countries are applicable across Asia and Africa, and if certain relationships hold after controlling for other potentially confounding drivers of facility delivery. Additionally, this study examines where deliveries are occurring across Africa and Asia, and highlights the types of facilities and providers in each region. The objective of the study was to describe the current landscape of facility deliveries, and to identify drivers of facility deliveries in Africa and Asia.http://www.measuredhs.com). Data on the most recent birth was included, thereby limiting the analysis to one birth per woman, and only births occurring since 1993 are included in the analysis . Regions are classified based on the UN standards for sub-regions.We used data from 43 Demographic and Health Surveys (DHS) collected in the last 10\u00a0years (since 2003) to look at the current status of facility deliveries and related outcomes , and private facilities include any type of private institution , maternity home, NGO or religious facility.The DHS also asked women who attended their delivery. There are a large number of missing responses for this indictor, with about 29% of women not answering this question . The indicator of \u201cdelivery with a doctor or nurse\u201d includes respondents who answered that they delivered with a doctor, nurse, nurse mid-wife, or auxiliary nurse mid-wife. \u201cTraditional provider\u201d includes traditional healers, traditional birth attendants, and homeopathic providers. \u201cNo provider\u201d includes respondents who said no one, a friend, or a relative attended the birth. \u201cOther health provider\u201d includes anyone who was not in the previous three categories.We conducted a series of analyses using Stata 12MP. Demographic, household, and community drivers were modeled using logistic regressions on the outcome of facility- deliveries. Covariates were chosen based on the recently published systematic review of drivers of facility deliveries in Africa . The maternal, social and antenatal care-related factors that they identified were used to select variables from the DHS to include in our analysis; however, facility-level factors identified in the review were not included because these questions were not asked in the DHS  compared to delivering at home. In the second set of models, the main correlate of interest is an individual\u2019s probability of delivering with a provider . Demographic, household and community drivers are modeled separately, and then combined. All models are clustered at the stratum level, and weighted using information on the primary sampling unit and stratum. These models are then run separately for Asia and Africa. Finally, we re-run the global models on a series of more specific outcomes: delivery at a hospital compared to another facility or home; delivery in a public facility compared to another facility or home; delivery in a private facility compared to another facility or home; and delivery with a doctor specifically, compared to other health professional, no one, friend/relative or traditional provider.Below we describe the pattern of where women deliver by region, and by wealth quintile and urban/rural status. We then describe the statistical analyses testing various drivers of facility delivery, and other outcomes including delivery with any trained provider, delivery at a hospital, in a public facility, in a private facility and with a doctor.The majority (53.4%) of women in Africa deliver in a facility. The rates are lower in Southern Asia (roughly 45%) and Southeast Asia (just over 40%) Figure\u00a0. The majIn Africa and Asia, over 65% of deliveries are attended by some type of health provider  Figure\u00a0. In AfriIn most countries, delivering at a facility means that women are delivering with a trained provider Figure\u00a0. Middle As can be seen in Figure\u00a0Over 400,000 women were included in the analysis which combined all 43 of the DHS\u2019s Table\u00a0. O f thoThirty-four percent of the sample lived in urban areas, and the average wealth quintile was 3   area, having a higher score on the wealth index, having a non-male household head, and having a husband who is not employed were significantly and robustly associated with increased odds of delivering in a facility (p\u2009<\u20090.01). Having a husband with more education was significantly associated with increased odds of delivering in a facility when only household factors were included in the model (Model 1.3), but it was no longer significant when other demographic factors were included. When only household factors were included (Model 1.3), husband\u2019s age was not significantly associated with delivering in a facility, however, in the full model having an older husband was significantly associated with delivering in a facility. When only community level factors were included in the model (Model 1.4), a higher percent of the stratum who had 4 or more ANC visits was associated with an extremely high odds of delivering in a facility , and a higher mean stratum level acceptability of wife beating was associated with lower odds of delivering in a facility. In the full model (Model 1.1) a higher percent of the stratum that had 4 or more ANC visits was associated with higher odds of delivering in a facility, and this value was of a reasonable magnitude . The mean stratum acceptability of wife beating was not associated in the full model. Country of data collection was significantly associated in all models.In Model 2 we explored correlates of delivering with a provider. These were very similar to the relationships found in Model 1 (delivering in a facility). Being older, having more years of education, having fewer children, not being married, the most recent baby being born more recently, not desiring the most recent pregnancy at this time, having any or 4 or more ANC visits, seeing a doctor for ANC, and having a lower acceptability of wife beating score were all significantly and robustly associated with increased odds of delivering with a provider Table\u00a0. Again, In terms of household level factors, living in a urban  area, having a higher score on the wealth index, having a non-male household head, having a husband who is not employed and a husband with more education were significantly and robustly associated with increased odds of delivering with a provider (p\u2009<\u20090.01). When only household factors were included (Model 2.3), a younger husband was significantly associated with delivering with a provider, however, in the full model husband\u2019s age was only marginally associated, and in the reverse direction. When only community level factors were included in the model (Model 2.4) and in the full model (Model 2.1), a higher percent of the stratum who had 4 or more ANC visits was again associated with an extremely high odds of delivering in a facility and a higher mean stratum level acceptability of wife beating was associated with a lower odds of delivering with a provider. Country of data collection was significant in all models.When only the countries in Africa are included in the model, being older, having more education, having fewer children, being married, not being employed, not desiring the most recent pregnancy at that time, having any or 4 or more ANC visits and a lower acceptability of wife beating were all significantly and robustly associated with increased odds of delivering in a facility (p\u2009<\u20090.01) Table\u00a0. The mosWhen only the southeast and southern Asian countries were included in the model, being older, having more education, fewer children ever born, the most recent baby being born more recently, not being employed, having any or 4 plus ANC visits and seeing a doctor for ANC were significantly and robustly associated with increased odds of delivering in a facility Table\u00a0. MaritalTable\u00a0Our results confirm many of the findings from the systematic review by Moyer and Mustafa 2013), but are in conflict with other findings[, but arePast literature suggests that younger maternal age is associated with increased odds of delivering in a facility. Literature in Asia also paint a mixed picture, with some studies predicting that higher maternal age was associated with delivering in a facility, 32\u201334, We find that, where significant, maternal employment was negatively associated with the odds of facility delivery, which is the opposite of what Moyer and Mustafa 2013) found[ found[3When modeled separately there are few differences in correlates of delivering with a provider and delivering at a facility between Africa and Asia. Interestingly, year of most recent birth is not significant in Africa, although it is in Asia and in the full models. This suggests that perhaps time trends are more important in Asia than in Africa, which supports the trends seen in the graphs. Living in a household with a non-male head is not associated in the full model in Africa, although it is in all other models. Perhaps male permission or the role of male decision making is less important in Africa compared to Asia. In Asia, being married, whether the pregnancy was desired, and the acceptability of wife beating score are not associated with facility delivery. Since these factors are associated in the full country model, it is clear that this is dominated by the African experience.When we look at more specific outcomes , a few small differences emerged. Particularly, women who delivered in a private facility seemed to stand out: they are more likely to be younger, married, have more children, have not had ANC and are rural.Across the board, having any ANC (and 4 or more ANC visits) was consistently, positively, and strongly (high odds ratios) correlated with facility delivery. The percent of women in a stratum that had ANC was also very strongly correlated with facility delivery in all of the models. With such a large sample size, odds ratios that are just above or below 1, yet statistically significant, might not be that meaningful. That those variables related to ANC use at both an individual and community level have odds ratios over 2 consistently across models therefore warrants further attention. Past literature has noted that the same type of women who deliver in a facility will seek ANC, therefore attributing causation from ANC to facility delivery is not appropriate. However, even after controlling for other individual, household and community level factors, we see such a strong correlation between ANC and facility delivery, that this relationship appears to be the strongest of those explored in this analysis.Cross-sectional data, such as the DHS surveys, preclude the ability to draw causal conclusions, limiting our analysis to look at correlates, rather than predictors or determinants of facility delivery. In order to analyze the current situation for facility delivery, we limited the sample to surveys collected since 2003 . Within that, we limit the sample to births since 1993. However, some of the data is more recent than others and therefore we are seeing a relatively wide window on the current status of rates and trends in facility delivery. Ideally, we would have data from all countries in the same year so as to make a better comparison.Another set of limitations revolves around the fact that this is individual, self-reported, and for some indicators relating to past births, retrospective data. This type of survey data can therefore suffer from recall bias, or other errors due to lack of knowledge on the part of the respondent . These biases are unavoidable in these types of surveys.Many of the variables that past literature found to be associated with facility delivery are not in, or could not be modeled within the DHS. Particularly relevant is that there were only a limited number of community level and facility related factors that we could include. Additionally, we were unable to include any of the macro-level factors that other scholars have found to be associated with facility delivery. There are a number of indicators that are only in some DHS\u2019s , and we therefore had to exclude these issues because they would have dramatically reduced the sample size.We were also limited because there may be other factors that are related to a woman\u2019s odds of delivering in a facility that are not in the DHS, especially those relating to maternal complications, quality of care and perceptions of quality, and access to facilities . It is possible that some of the associations that we have identified are actually related to other factors such as pregnancy complications, distance to facility, etc., rather than to facility delivery itself.This study is a multi-country analysis of the drivers of facility deliveries across regions.. It examines the individual, family, community, and facility level factors that lead to facility deliveries. The study finds that the majority of women surveyed in the 43 DHSs explored in this study are delivering in some type of facility with a health care provider. Rates are lower in Asia than in Africa, and private facilities make up a larger proportion of delivery facilities in Asia than in Africa. Disparities exist between rich and poor, and urban and rural populations. There is still a need to increase accessibility to facilities for delivery for poorer and more rural women in all regions of the globe.A vast number of previous studies have looked at drivers of facility deliveries in certain regions or countries, often using small datasets. This analysis combines information about potential drivers of facility delivery from these studies into one multi-level analysis of countries in Africa and Asia. We find support for the majority of previous findings on a multi-country level, and few differences between African and Asian regions. Demographic, household and community level factors all contribute to a woman\u2019s odds of delivering in a facility. The most powerful correlation in this analysis was between a woman having ANC or a larger percent of women in a community having ANC, and facility delivery. Even after controlling for other variables, this was the strongest and most consistent relationship. Understanding how ANC and facility delivery are linked is key. Do the same type of women who go to ANC go to a facility to deliver? Or does the very act of getting women into ANC set her on a \u201cfacility\u201d track? Or is there something that happens in ANC that convinces women to deliver in a facility? Further longitudinal study is needed to explore this.More research is also needed to understand other drivers of facility delivery, so as to be better able to target women who do not currently deliver in facilities so they can have access to the care they need at the time of delivery. As discussed above, some of the drivers may be related to maternal complications which would make it more likely for a woman to deliver at a facility. Other factors such as cost, distance, transportation, and policy-related factors like bans on home delivery and cash incentive programs also might be influencing decision making. We were unable to include factors such as these in our analysis. More research is needed to pinpoint which other factors are the most important \u201cmissing\u201d drivers in women\u2019s decision-making, so we can understand what barriers remain and what incentivizes women to deliver in facilities. It is time to move beyond individual, demographic factors and focus on the community, facility and policy levels. These findings clearly show that more and more women are delivering in facilities in Africa and Asia, suggesting that perhaps policy makers should begin to focus more on the quality of care that women receive in facilities and ensuring that facilities are not overburdened."}
+{"text": "Health professionals and public health experts in maternal and newborn health encourage women to deliver at health facilities in an effort to reduce maternal and newborn mortality. In the existing literature, there is scant information on how migration, family members and community influence facility delivery. This study addresses this knowledge gap using 10\u00a0years of longitudinal surveillance data from a rural district of Tanzania.Multilevel logistic regression was used to quantify the influence of hypothesized migration, family and community-level factors on facility delivery while adjusting for known confounders identified in the literature. We report adjusted odds ratios (AOR).Overall, there has been an increase of 14% in facility delivery over the ten years, from 63% in 2001 to 77% in 2010 (p\u2009<\u2009.001). Women residing in households with female migrants from outside their community were more likely to give birth in a facility AOR\u2009=\u20091.2 (95% CI 1.11-1.29). Furthermore, the previous facility delivery of sisters and sisters-in-law has a significant influence on women\u2019s facility delivery; AOR\u2009=\u20091.29, 95% CI 1.15-1.45 and AOR\u2009=\u20091.7, 95% CI 1.35-2.13 respectively. Community level characteristics play a role as well; women in communities with higher socioeconomic status and older women of reproductive age had increased odds of facility delivery; AOR\u2009=\u20092.37, 95% CI 1.88-2.98 and AOR\u2009=\u20091.17, 95% CI 1.03-1.32 respectively.Although there has been an increase in facility delivery over the last decade in Rufiji, this study underscores the importance of female migrants, family members and community in influencing women\u2019s place of delivery. The findings of this study suggest that future interventions designed to increase facility delivery must integrate person-to-person facility delivery promotion, especially through women of the community and within families. Furthermore, the results suggest that investment in formal education of the community and increased community socio-economic status may increase facility delivery.The online version of this article (doi:10.1186/1471-2393-14-329) contains supplementary material, which is available to authorized users. Health facility delivery plays an important role in improving maternal and newborn health worldwide. Health professionals and public health experts recommend that women deliver at health facilities due to the availability of skilled birth attendants, a clean environment, emergency obstetric services in case of complications, and affordable lifesaving technologies , 2. Yet The determinants of facility delivery can be organized into three categories: individual, institutional and community. First, in Tanzania and other resource poor countries, individual demographic characteristics of the mother are associated with increased facility delivery. Mothers who are less than 20\u00a0years or older than 30\u00a0years are more likely to deliver at a facility, as well as mothers at low (1\u20132 births) or high parity >5 births) . Further births .Second, in addition to individual level factors, institutional characteristics of the health facilities where women would attend for delivery have a significant impact on current and future use. The presence of a skilled attendant at a facility has been shown to reduce maternal mortality and morbidity compared to unskilled birth delivery in some developing country settings \u201316. HoweThird, whereas individual and health facility factors affecting facility delivery are well-established in the literature, research on community level determinants is limited. One study conducted in six African countries including Tanzania examined community-level factors associated with the decision to deliver in health facilities using the Demographic and Health Surveys (DHS) . In the Although some studies have tried to incorporate community-level factors, the evidence is limited. Our study contributes to this literature by quantifying the previously unexamined influence of in-migrants, sisters, sisters-in-law and community factors on facility-based delivery in rural Tanzania.We examine the influence of migrants and family member on women\u2019s likelihood of facility delivery in two ways. First, we estimate the odds of facility delivery in households with female migrants who have moved in from outside the study site. Second, we examine the influence of having sisters or sisters-in-law who previously delivered in health facilities. In this study, sisters and sisters-in-law are referred to as family members.Literature from Guatemala showed the co-residence of in-migrants was positively associated with women\u2019s contraceptive knowledge and utilization . AnotherWe examine the influence of family members by considering sisters\u2019 and sisters\u2019-in-law experience with facility delivery. Prior research has shown that village communities and family members play an integral role in shaping individual behavior. Village communities are close knit and strongly enforce social norms , 22. A sIn addition to these two new variables, we also examine the influence of three community level factors: 1) average educational attainment for women in the community, 2) average household wealth in the community derived from an asset index, and 3) average age of women of reproductive age in the community. We hypothesize that women living in communities with greater levels of female education will be more likely to deliver in the facility due to the combined effect of education, community accessibility to public health knowledge, and autonomy to seek health services. We hypothesize that women in communities of greater wealth will be more likely to deliver in facilities because of their greater ease of accessing health care services. Furthermore, we predict, that women in communities with an older mean age of women of reproductive age will be more likely to deliver in the facility as a result of their greater collective experience of the benefits of skilled birth attendants.Finally, this paper also tests the hypothesis that, in addition to the observed influence of migration, family member and community factors, there are residual unmeasured community and maternal factors that influence a woman\u2019s decision to give birth in a facility.This study utilizes delivery records of women who gave birth from 2001 to 2010 in the Rufiji Health and Demographic Surveillance System (RHDSS). The surveillance area was established in 1998 with an initial census conducted by enumerating the entire population. The surveillance system covers an area of 1,813 square kilometers with 33 communities (villages). The surveillance area, and lies about 178\u00a0km south of Dar es Salaam (the largest city in the country), and covers approximately 50% of the population of Rufiji District. The study area is geographically formed by 33 administrative villages which will be referred to as communities and serve as a unit of analysis in this study. Dominant ethnic groups are Ndengereko, Makonde and Sukuma. The surveillance system is managed by Ifakara Health Institute (IHI).Rufiji district was the site of two projects aimed at increasing facility delivery. From 1998 \u2013 2003, the Ministry of Health implemented the Tanzania Essential Health Intervention Project (TEHIP). The goal of TEHIP was to increase district capacity to provide expectant mothers with access to basic obstetric and reproductive care. The project provided management tools such as training in management skills, team building, planning, and introduced management systems to help the district focus resources on areas in greatest need . FollowiThe population under surveillance in Rufiji is a dynamic cohort that enrolls individuals through birth and in-migration and who exit through death or out-migration. Each enumerated individual is given a unique identification number that is used to longitudinally track demographic events. Field teams visit each registered household three times annually to record dates of births, deaths, in and out -migrations and marital status changes that have occurred to each individual since the previous visit. Birth registration includes detailed information about mother\u2019s place of delivery and assistance during delivery. More details about the surveillance system can be found elsewhere .This paper uses data on all deliveries to women aged 15\u201349 between 2001 and 2010. A total of 20,049 deliveries were included in the analysis. Although the RHDSS started in 1998, data collection on place of delivery began in 2001. The dichotomous outcome variable compares delivery in a facility to delivery at home. The annual percent of facility deliveries was calculated by the ratio of facility deliveries with all deliveries recorded in the surveillance area. The change in the percent of facility delivery was calculated as difference in proportion in 2001 and 2010 at 5% significance level.The predictor variables of interest were constructed as follows. Presence of an in-migrant in a household was captured from the dataset documenting in and out-migration in the surveillance area. We construct a binary measure indicating presence of an adult female in-migrant in a household two years prior to delivery. Sisters\u2019 place of delivery was constructed by first identifying sisters through matching parent identification numbers, and then determining place of delivery for sisters\u2019 previous births using the birth registry data. We then construct a count variable for how many times she has given birth in a facility. The measure of sisters-in-law\u2019s place of delivery is similarly constructed; women are linked to their husbands, and we then use husband\u2019s identification number to link him to his sisters through matching parent identification numbers. We included sisters-in-law\u2019s experience with facility delivery because Rufiji is a patrilineal society, and women are likely to reside in their husbands\u2019 home village. To capture the influence of the community, we calculate the mean age of women of reproductive age, mean household wealth, and mean years of education of women of reproductive age by village using all residents in the village at the time of birth.Control measures were constructed as follows. Wealth measures were constructed using an asset index constructed through principal components analysis, based on asset ownership  and structural characteristics of the home  . Asset dMapping of geographic boundaries was conducted to locate all 33 communities and main roads. Proportion of facility delivery for each community was added to the surveillance map to geographically explore the facility delivery in relation to village main road connections.Exploratory analysis was conducted by plotting annual proportions of facility delivery  by socio-economic status, education, previous birth outcome and previous place of delivery.Multilevel logistic regression was used to estimate the hypothesized influence of in-migrants, family and community-level factors on facility delivery while adjusting for known confounders including mother\u2019s age, birth order, season of birth, place of delivery of previous pregnancy, and marital status. Multilevel models were specified where children are nested within their mothers and mothers within communities. Mother and community level random effects were included because many individual and community-level factors that may influence facility delivery are not collected or are unobserved, such as husband\u2019s approval of facility delivery and tribe. Maximum likelihood was used to estimate regression model coefficients and results are presented as odds ratios with 95% confidence interval.The study protocol was approved by Ifakara Health Institution Internal Review Board, National Institute of Health Research and Commission of Science and Technology, Tanzania. All participants were explained the demographic surveillance system study protocol and were enrolled through informed consent.Our research had adhered to the STROBE guidelines for observational cohort studies . However, this increase has not been uniform across communities. Over the study period there has been substantial variation in the trend and proportion of facility based deliveries across communities. In Figure\u00a0To explore potential reasons for this variation, Figure\u00a0Figure\u00a0In Table\u00a0Community level factors identified in Model 2 were high community asset index , and high average age of females in the community . Increased female education in the community was weakly associated with decreased odds of family delivery .Models 1 and 2 identified individual level factors associated with facility delivery that are well supported and established in the literature. This includes younger age of women, lower parity, higher education (primary and above), high income job (compared to agriculture), high economic status, multiple birth, dry season, previous health facility delivery and previous poor birth outcome (stillbirth/miscarriage/abortion). The random effect is significant for the community but insignificant for the mother, suggesting that there are unobserved community characteristics that influence facility deliveryIn Table\u00a0In Model 3, odds of delivering in a facility significantly increased by 29%  for every increase in number of facility deliveries experienced by her sister. Model 4 shows the odds of facility delivery significantly increased for a unit increase in number of sister\u2019s-in-law facility delivery .With respect to average community wealth, in Model 3 we find that, women in communities with higher socio-economic status have increased odds of facility delivery . Results are consistent in Model 4, .In Model 4 we also find that higher mean age of women in the community is positively associated with the odds of facility delivery . Similar to Model 2, Model 3 also shows a negative influence of community levels of female education . Despite controlling for individual and community level variables, the random effect for the community is still significant, which suggests that there are unobserved characteristics that influence facility delivery.Facility delivery in the RHDSS has been consistently above 70% since 2007, well above the national average of 50% . An overThe lower odds of facility delivery at older ages observed in this study at individual and community level analysis are inconsistent with findings from previous analysis of DHS surveys in Tanzania . These fHigher levels of female education in the community are associated with lower odds of facility delivery, which is opposite from the association with individual levels of schooling. This may be due to the fact that the majority of women in the surveillance area are either illiterate or have incomplete primary education.This study finds a positive association between the presence of a female in-migrant in the household and the odds of facility delivery. Female in-migrants who enter households from outside the study area may influence or challenge local knowledge with respect to health seeking behavior, hence changing their attitudes toward facility delivery.Sisters\u2019 and sisters-in-law\u2019s experience with facility delivery positively influences women\u2019s odds of their own facility delivery, demonstrating the importance of family members in communicating information about the health system. Indeed, family members have been previously shown to be a factor in health facility utilization . HoweverPrevious studies have assessed community level variables through qualitative and quantitative studies. Our study has quantified the influence of community wealth, level of education and maternal age on facility based delivery.This study contributes to our knowledge about unexplained community level variation in women\u2019s choice of facility delivery. Some studies have added a random effect for the village/cluster, family and the individuals whereas others have assessed specific factors theorized to influence facility delivery , 28\u201330. The findings of this study suggest that future interventions designed to increase facility delivery must integrate person-to-person facility delivery promotion, especially through women of the community. Furthermore, the results suggest that investment in formal education of the community and increased community wealth may increase facility delivery.Although this study attempted to quantify the influence of community level variables without losing power, we are limited by the available data. This is most evident with the stark drop in observations when including sisters and sisters-in-law in the model. Due to missing data on sisters and sisters-in-law for the majority of women, it was difficult to assess these factors with such a small sample size. Although the sample size decreased significantly, the remaining sample was sufficiently large (>900 mothers) due to the long individual follow-up. Furthermore, different settings may have differing determinants of facility delivery, limiting the generalizability of our findings. Nevertheless, because this is a longitudinal study in a remote setting, the results of this study may be applicable to similar settings.There is a need for further qualitative research within urban and rural areas to determine which factors influence facility delivery. Although the supply side of providing quality reproductive healthcare at facilities is progressing, utilization and demand require a better understanding of the family and community contexts in which women live.Overall, there has been an increase in facility delivery over the decade, from 63% in 2001 to 77% in 2010. However, this increase has not been consistent across all communities in Rufiji. This study underscores the importance of female migrants, family members and community level factors in influencing women\u2019s place of delivery. The findings of this study suggest that future interventions designed to increase facility delivery must integrate person-to-person facility delivery promotion, especially through women of the community. Furthermore, the results suggest that investment in formal education of women in the community and increased community wealth may increase facility delivery.STROBE checklist for cohort studies.(DOC 80 KB)Additional file 1:"}
+{"text": "When extending the life of Wireless Rechargeable Sensor Networks (WRSN), one challenge is charging networks as they grow larger. Overcoming this limitation will render a WRSN more practical and highly adaptable to growth in the real world. Most charging algorithms require a priori full knowledge of sensor nodes\u2019 power levels in order to determine the nodes that require charging. In this work, we present a probabilistic algorithm that extends the life of scalable WRSN without a priori power knowledge and without full network exploration. We develop a probability bound on the power level of the sensor nodes and utilize this bound to make decisions while exploring a WRSN. We verify the algorithm by simulating a wireless power transfer unmanned aerial vehicle, and charging a WRSN to extend its life. Our results show that, without knowledge, our proposed algorithm extends the life of a WRSN on average 90% of what an optimal full knowledge algorithm can achieve. This means that the charging robot does not need to explore the whole network, which enables the scaling of WRSN. We analyze the impact of network parameters on our algorithm and show that it is insensitive to a large range of parameter values. With the increase in popularity of Wireless Sensor Networks (WSN), the need for sustainable networks becomes more and more prominent. Low cost sensors may make it appealing to replace sensor nodes when their power level is depleted. Simply replacing sensor nodes is not only costly but also harmful to the environment . In addiThere are many approaches to increasing the life of a WSN ranging from improving communication protocols , smarterOur work decouples the charging problem from path planning, resulting in a computationally tractable solution. Our charging solution also requires no a priori knowledge of the current nodes\u2019 power levels, enabling it to scale with large WRSN. Reducing data collection in WRSN not only reduces the transmission power consumption at each sensor node, but also the overall computational cost across the network. Reducing the data flow requirements on a WRSN enables it to scale better.Large-scale WSNs are defined as either networks covering large areas or networks of high density . While hWe consider without the loss of generality a line graph network topology shown in k nodes reach zero residual power. There is no knowledge of the exact power level of any node prior to the UAV visiting the node, making it only possible to identify the nodes that need to be charged after they are visited. On the other hand, we assume the nodes have a known discharge rate and a known power level at a previous time instance. The network size is such that if the UAV visits the whole network, it will only be able to charge a single node. The UAV can charge one node at a time, but may still charge several nodes in a single round-trip. It needs to identify the furthest beneficiary point of exploration that helps in determining the best set of nodes to charge. Charging this set extends the network life close to what an optimal algorithm with full knowledge can achieve.The general problem that we consider in this paper is the stopping point in an exploration path, and the amount of power to charge each node. The problem is as follows: given a set of sensor nodes on a line graph as demonstrated in One of the key challenges associated with charging WRSN is determining which node to charge if not all nodes can be charged. We use a probabilistic approach to address the charging of large scale WRSN. Our algorithm utilizes probability to make stopping decisions. We also use a charging algorithm that charges a subset of nodes only considering power levels observed during flight. Determining the power level of nodes in a WRSN is very important to optimally charge the network. Charging and exploring a WRSN based on the actual collected power information, at the time of exploration, enables the conservation of power and scalability of efficient WRSN charging.Presenting ANLPP, a novel algorithm that increases the life of a WRSN with no knowledge of sensor nodes\u2019 power levels and without the need to fully explore the network. Simulation results showing that ANLPP performs on average at 90% of what an optimal full knowledge algorithm could achieve.Analysis of WRSN parameters that impact the performance of ANLPP, and show that ANLPP is tolerant to a wide range of WRSN parameters.The main contributions of this paper are:The rest of this paper is organized as follows. Previous efforts related to wireless rechargeable sensor networks can be divided into several categories. Some address the power replenishment using different techniques; other work addresses different network types. While some authors address scalability of WRSN, others address the levels of power knowledge needed by the charging algorithm. We now discuss these efforts and how they relate to our work.There are a variety of methods to replenish the power level of sensor nodes in WRSN. For\u00a0instance, energy harvesting is adopted to recharge the sensors in WRSN using solar cells . Other sMobile sensor based networks can also benefit from wireless power transfer. Using stationary charging stations with partial coverage, the WRSN life can be extended . One or We focus on WRSN scalability as a network expanding over a large area , as defined in . An\u00a0optiWith the increase in WRSN scale, the cost of data propagation significantly increases. In an effort to reduce sensors\u2019 energy on reporting data to the sink, studies have been conducted to investigate efficient algorithms to both replenish energy levels of sensors and collect data from them simultaneously , or in tAs WRSNs scale, the cost of collecting energy information becomes impractical. An efficient energy monitoring protocol was designed to address this problem ; howeverMost of the solutions for WRSN require full knowledge of power levels. In a partial knowledge adaptive approach, power level information from representatives of a subset of nodes was used to increase the life of a WRSN . They deZero knowledge based algorithms using several MCR units were presented for charging WRSN . The autsIn this section, we give the formal definition of our general problem. Suppose that there is a base station The set l, total localization and charge power as C, total number of sensor nodes to charge as uA single MCR with total power We define M as the total moving power consumed by the MCR, and this includes the power needed to reach the furthest node to visit and return to Charging r or zero, based on a discharge function g and a discharge probability p, we use a fixed discharge probability for each run similar to [Each sensor node discharges power at either rate milar to g(n)=r,ik nodes reach zero residual energy:Finally, we define the network life as the time until The best point to stop exploring and return to The best possible set of nodes to charge, The objective is to maximize the increase in network life. With no prior knowledge of Stopping at point r, the nodes\u2019 power level are always decreasing. We also assume node discharge independently of each other and randomly, i.e.,\u00a0random events trigger the discharge. Define T as the time interval elapsed since node was at power W.In this section, we define the parameters involved in modelling our sensor nodes from the power perspective. Considering the discharge function Sensors have the same maximum power capacity W.Without loss of generality, we can assume that all nodes start at the same power level. The last known power level of a sensor node is p.The probability of a sensor node discharging at each time unit is r.Without loss of generality, we can assume that all nodes have the same discharge rate Y.The power level of the currently explored sensor node is Other properties and definitions of sensor nodes are:Given the sensor node model and the discrete nature of the discharge function, we can compute the probability of a node to exist at each power level. We start by computing the exact probability of a certain power level, and later compute the expected power level of a node and identify probability\u00a0bounds. Y, what is the probability of such a node, or one with less power, to exist in the network? We assume the following:T time units have elapsed,W before T time units,the node was at power level p at each time unit.discharge probability is In this section, we compute the exact probability of a single node to be at a certain power level, by\u00a0answering the following question: given a node with power level t are needed for a node to reach power level Y. Due to the discrete nature of discharge and knowing the discharge rate r, we can define t asWe start by identifying how many discrete steps t or more discharges to occur in T steps. We treat this as Bernoulli trials with success= p and failure= t discharges to occur will beY will beOur problem is now simplified to finding the probability of j . When using the parameters needed to simulate a large scale WRSN, the precision exceeds our computer\u2019s computational precision. Each computed probability component becomes zero. Even with an increase in computational power, we still face another problem. This calculated probabilistic value does not give us an exact prediction, increasing the chances of making mistakes if these values are used. Due to these limitations, we need to find a better and more scalable solution. We turn to utilizing an upper bound on our desired probability estimations instead of computing the exact probability. An upper bound will be more helpful in identifying highest possible values without having to consider exact probability and variance.While the above formula can be used to find the total probability, we face two main problems when dealing with it. First, the numbers become significantly small with the increase of P, the expected charge level of each node is defined as We develop an upper probabilistic bound on the sensor node\u2019s power level based on the node model described in p, For unbiased values of Y. Several tail probability estimation methods exists [Our interest is to be able to identify the probability of a node being at or below a certain power level, s exists . While Ms exists ,52 condiY or less, where\u00a0Y is always less than Let us assume we wish to identify the probability of a node being at power level The probability becomesp of a node discharging at any time instance, the average discharge rate r, the time elapsed T since the moment the sensor node power level was W, and the node maximum power level W.This probability is a function of four parameters, the probability Y or less. Equation\u00a0 gives usIn this section, we discuss our algorithm, with three stopping methods. Our objective is to identify, without full knowledge of network power levels, the shortest distance the MCR should travel, xplore algorithm (Algorithm\u00a01) successively explores the WRSN nodes sequentially, and\u00a0performs three steps after visiting each new sensor node in the network:determine the subset of visited nodes to charge decide whether to move forward and visit more nodes or terminate exploration, define when no more nodes are to be visited, return home and charge nodes in Our EAlgorithm 1 Find exploration termination point.Require:\u00a0\u25b9 The traversing UAVRequire:\u00a0N\u25b9 List of network nodesprocedure Explore(N)\u00a01: \u00a02: \u00a0\u00a0\u00a0\u00a0\u25b9 List of visited nodes\u00a03: \u00a0\u00a0\u00a0\u00a0\u25b9 List of nodes to charge\u00a04: \u00a0\u00a0\u00a0\u00a0\u25b9 Charge powerfordo\u00a05: \u00a0\u00a0\u00a0\u00a0\u00a06: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a07: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a08: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Get the charging list, power needed to charge, and new power level\u00a09: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Power left, after charging and returning home reservesifcanVisitMoreNodesthen10: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Based on location and power level decide to continue or terminate11: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0visit next 12: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0add else13: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a014: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Breakend if15: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0end for16: \u00a0\u00a0\u00a0\u00a017: \u00a0\u00a0\u00a0\u00a0return to base and charge nodes in end procedure18: xplore algorithm (Algorithm\u00a01) is an online algorithm, which starts when the MCR leaves The Eharge algorithm (Algorithm\u00a02) is similar to the Greedy Plus algorithm from [harge, knowledge builds up as the charging unit traverses the network. The Charge algorithm assumes a fast moving MCR, leading to a round trip from harge algorithm will sort the nodes based on their power level (line\u00a02), and adds the low power nodes to the charging list sequentially (lines\u00a013\u201315), until\u00a0the MCR has no more power to bring the list of nodes proposed to be charged, Determining thm from , but it harge algorithm is canVisitMoreNodes algorithm is The time complexity of Algorithm\u00a01 is canVisitMoreNodes is The time complexity of Algorithm\u00a02 is Algorithm 2 Find subset to charge.Require:\u00a0\u25b9 Localization cost in terms of powerprocedure Charge is based on the amount of power left on the MCR. The power left is the power available after subtracting both the power needed to charge, C, and the power needed to return to canVisitMoreNodes, we show how power is the main factor. This movement decision-making is what we will describe in more detail based on different parameters. The canVisitMoreNodes procedure implementation can be done in several ways, and, in the next subsections, we will address our three methods addressing making this decision.Our implementation of the movement or termination decision function canVisitMoreNodes (Algorithm\u00a03) is based only on travel power cost. That is, the algorithm will calculate how much power is needed to visit the next node, Our first implementation of Algorithm 3 Naive approach for canVisitMoreNodes.Require:\u00a0\u25b9 Set of distances between nodes Require:\u00a0\u25b9 MCR moving power consumption per move unitprocedurecanVisitMoreNodes  canVisitAlgorithm 4 Minimum Only approach for canVisitMoreNodes.Require:\u00a0N\u25b9 Set of network sensor nodesRequire:\u00a0\u25b9 Localization cost in terms of powerRequire:\u00a0\u25b9 Set of distances between nodes Require:\u00a0minThreshold\u25b9 Minimum probability threshold, tuning parameterprocedurecanVisitMoreNodes1: \u25b9 l: node target power levelifthen2: \u00a0\u00a0\u00a0\u00a0return3: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0else4: \u00a0\u00a0\u00a0\u00a05: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Power needed to charge lowest power node in ifthen6: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Proceed if charging power is greater than power needed to charge lowest node7: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Probability of lower power nodes to exist, less than the lowest in ifthen8: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0return9: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0else10: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0return11: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0end if12: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0end if13: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0end if14: \u00a0\u00a0\u00a0\u00a0end procedure15: The time complexity of Minimum Only (Algorithm\u00a01) is Equation\u00a0 , our final implementation of Algorithm 5 ANLPP approach for canVisitMoreNodes.Require:\u00a0N\u25b9 Set of network sensor nodesRequire:\u00a0\u25b9 Localization cost in terms of powerRequire:\u00a0\u25b9 Set of distances between nodes Require:\u00a0minThreshold\u25b9 Minimum node probability threshold, tuning parameterRequire:\u00a0maxThreshold\u25b9 Maximum node probability threshold, tuning parameterprocedurecanVisitMoreNodes1: ifthen2: \u00a0\u00a0\u00a0\u00a0return3: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0else4: \u00a0\u00a0\u00a0\u00a05: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0ifthen6: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Proceed if charging power is greater than power needed to charge lowest node7: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Probability of lower power nodes to exist, less than the lowest in ifthen8: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0return9: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0else10: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a011: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Probability of lower power nodes to exist, less than the highest in ifthen12: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0return13: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0else14: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0return15: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0end if16: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0end if17: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0else18: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0return19: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0end if20: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0end if21: \u00a0\u00a0\u00a0\u00a0end procedure22: canVisitMoreNodes (Algorithm\u00a05) extends the MCR exploration limit under three conditions:sufficient power exists in the MCR to explore further,there is a high probability of finding nodes with power level less than the minimum power level node in there is a high probability of finding nodes with power level less than the maximum power level node in ANLPP implementation of The algorithm applies all the steps from the Minimum Only approach (Algorithm\u00a04). The\u00a0algorithm calculates the probability of finding a node with power less than the highest power node in In this section, we describe the optimal full knowledge algorithm used as a baseline for comparing the performance of our algorithms. This algorithm requires full knowledge of all the power levels of all the sensor nodes in the WRSN.Given the full knowledge of the power levels of the WRSN, it is possible to identify the set of lowest power nodes in the network. Charging a node involves three main factors: the cost to localize , the cost to reach it, and finally the cost to bring its power level to the target level. When the charging list is determined, the total cost can be computed, and,\u00a0then, comparing the available power to the total cost identifies the feasibility of charging. Using the Charging Algorithm\u00a02, the target node is the next node after the set of charged nodes, u, ignoring all other factors (line\u00a03). Since\u00a0it is only after k nodes deplete their power that the network dies, we can skip charging We take a top-down approach in our realization of an optimal solution, presented in Algorithm\u00a06. Assume the highest possible life increase, while highly improbable, and gradually reduce the life increase until we hit the highest possible one. We start by considering localization cost; knowing the localization power cost, we can identify the highest possible number of nodes to charge, Algorithm 6 Find Optimal Time Increase.Require:\u00a0\u25b9 Maximum MCR powerRequire:\u00a0\u25b9 Localization cost in terms of powerRequire:\u00a0k\u25b9 Number of possible nodes to dropRequire:\u00a0N\u25b9 List of network nodesprocedure FindOptimalTimeIncrease(N)1: 2: \u00a0\u00a0\u00a0\u00a0\u25b9 Sort the nodes based on power3: \u00a0\u00a0\u00a0\u00a0\u25b9 Number of nodes in charge list4: \u00a0\u00a0\u00a0\u00a0\u25b9 Index of target node5: \u00a0\u00a0\u00a0\u00a0\u25b9 Highest possible target6: \u00a0\u00a0\u00a0\u00a0\u25b9 Power needed to charge and movewhile7: \u00a0\u00a0\u00a0\u00a08: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 If not enough power exists then pick a lower target9: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a010: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u25b9 Reduce number of charged nodes by one11: \u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0end while12: \u00a0\u00a0\u00a0\u00a013: \u00a0\u00a0\u00a0\u00a0\u25b9 Time is how long the extra power can be consumedreturn14: \u00a0\u00a0\u00a0\u00a0end procedure15: k lowest power sensor nodes. This time increase is the lowest possible time increase. A more accurate value will involve the probability of a sensor node discharge. The lowest possible time increase is sufficient for algorithms\u2019 performance comparison when similarly applied to all algorithms.To compute the time increase, we simply compare the amount of added power to the The power computing algorithm (Algorithm\u00a07) computes the power needed to charge and reach the nodes in the charging list. Travel cost is the cost to reach the furthest node in the charging list (lines\u00a014 and 15). A cost is assigned to each node, defined as the amount of power needed to bring the node to the target power level and the cost to reach it (in terms of power). Based on the cost, the\u00a0algorithm identifies the lowest cost nodes to charge, and accumulates the costs (lines\u00a09\u201313).Algorithm 7 Compute Needed Power to Charge and Move Given Nodes.Require:\u00a0d\u25b9 Distance between two consecrative nodesRequire:\u00a0\u25b9 Localization cost in terms of powerprocedurecomputeNeededPower on an Intel core processor  2.3 GHz 16 cores machine , and 16 GB RAM. We set-up the WRSN using real world parameters obtained from our previous work , shown iOur simulations show that it takes two minutes to run ANLPP over ten thousand networks of over 200 nodes each. This execution time combined with the low memory requirements of ANLPP, for a single iteration .We will show the performance of our algorithms on more than one hundred thousand networks with no knowledge, and how our algorithms compare to a full knowledge algorithm. Using the parameters in It can be seen from k low power nodes, dropped for optimal performance,high power nodes, need not be charged.While ANLPP most of the time outperforms the other two algorithms, we wish to observe its exact behaviour to identify when and where it performs well and poorly. To understand how ANLPP behaves, we need to identify the types of nodes in a WRSN, from a charging algorithm perspective. ANLPP divides nodes into two categories. Based on the action it takes regarding a node, ANLPP either adds the node to the charging list Given the above descriptions, No change in performance, seen as horizontal short lines of consistent performance in k nodes that may be dropped, but ANLPP adds it to Decrease in performance, noticed as a sharp or staircase decaying performance in k nodes that may be dropped, and the addition of this node to the k nodes modifies Increase in performance, observed as a sharp or staircase increases in When the network size increases, three possible outcomes could occur:Next, we will look into the impact of network parameters on the performance of ANLPP.In this section, we show the results of changing the algorithm tuning parameters. In the ANLPP algorithm, we used two parameters, which are probability limit values. The minThreshold parameter makes sure the lowest node to charge is within a certain range. The maxThreshold parameter makes sure the highest node in the charging list is within a certain range. For all simulated WSN created, we used the parameters in T on the performance of ANLPP. Some parameters show little to no effect on the algorithm performance. Changes in W and r almost have no impact on the algorithm performance. This is because these parameters only impact the value of We explored the impact of varying d, impacts the performance of ANLPP. d on ANLPP, when it is tuned for d. However, with a small range of change , a novel algorithm to charge a WRSN without a priori knowledge using a single MCR (Mobile Charging Robot). By disjointing the charing problem from the path planning problem, the charging problem is no longer NP-Hard. This reduction in complexity and no prior knowledge of power levels enable the scalability of the charging algorithm. The proposed algorithm is tunable and agnostic to the underlaying WRSN protocols. Through simulations, we showed that ANLPP on average, and with a low variance, extends a WRSN life by up to 90% of what an optimal full knowledge algorithm can achieve. Our analyses and simulation results reveal the existence of a range for each network parameter that has little to no impact on our algorithm\u2019s performance. On the other hand, we report how ANLPP can accommodate, in a single run, larger value-changes for some parameters. For example, large changes in localization time and discharge rate have almost no impact on performance, while, for distance, it can accommodate a smaller change. The proposed approach is flexible to operate under different network parameters and can be applied to large-scale WRSN using a single MCR.In the future, our proposed algorithm could be extended to incorporate a richer set of sensor nodes\u2019 power consumption models, while keeping it agnostic to the WRSN underlying protocols. We also plan to explore the potential benefit of online tuning with respect to several parameters changing simultaneously. We wish to evaluate the performance of ANLPP on a physical UAV based charging system. In another direction, we would like to investigate integrating ANLPP with the path planning process of an MCR, and then comparing it to other charging algorithms. We wish to extend ANLPP as a distributed algorithm using multiple MCRs to charge a single WRSN. We are also interested in leveraging a data prediction algorithm like  for our"}
+{"text": "The search was restricted to English language. Literature search was performed using the PubMed/MEDLINE database and \u201c99mTc-sestamibi guided biopsy methods; to our knowledge, no full studies have yet been reported on clinical validation of this new biopsy procedure. This review describes technical aspects of 99mTc-sestamibi guided biopsy and discusses the advantages and limitations of this procedure in comparison with MG, US and MRI-guided biopsy. There are few studies on MBI-guided biopsy appears to be a complementary modality and is principally indicated in the case of occult or unclear breast lesions on MG/US, that are suspicious on MBI. The future indication is in targeted biopsies in patients with large heterogeneous tumours. Further studies are needed to define the accuracy of this biopsy procedure. The search was restricted to English language. The references of the retrieved articles were examined to identify additional articles. The aim of this review is to discuss the methodological aspects of this novel radioguided-biopsy method, including its advantages, limitations and future clinical applications.Breast cancer (BC) is the most common cancer type in women with an estimated 246.660 new cases and 40.450 deaths in the United States, in 2016 . Ultrasor tracer . Recentlon MG/US . We perf99mTc-sestamibi in breast cancer cells is based on increased vascularity and cytoplasmic mitochondrial density and activity [99mTc-sestamibi in tumour cells [99mTc-sestamibi-MBI refers to functional imaging of the breast using a breast-dedicated high-resolution, small field of view (FOV) gamma camera; the images, based on the detection of increased uptake of 99mTc-sestamibi in the tumour in comparison to normal tissue, are independent of breast density. The original MBI system still employs a single detector with a 20\u00a0\u00d7\u00a015\u00a0cm FOV, containing an array of sodium iodide (NaI) crystals (3\u00a0\u00d7\u00a03\u00a0mm pixel size) coupled to position sensitive photomultiplier tubes (PSPMTs). Most literature reports have been based on the use of a single-head system . In recent years, dual-head detection became available following the introduction of the MBI devices Discovery NM750b  and LumaGem 3200\u00a0s  which employ two opposite cadmium-zinc-telluride (CZT) detectors with small FOV (24\u00a0\u00d7\u00a016 resp. 20\u00a0\u00d7\u00a016\u00a0cm) and 2.5 resp. 1.6\u00a0mm pixel size; these devices are aimed to provide better energy resolution [Increased uptake of activity , 15. Howur cells . In 2002ur cells . Since tur cells . In screur cells , 20. A rur cells . 99mTc-ssolution . A summa99mTc-sestamibi for single-head MBI or 300\u00a0MBq for dual-head MBI-systems) in an antecubital vein contralateral to the breast lesion. Approximately 5\u201310\u00a0min after the injection of the radiotracer, standard planar images are performed for each breast in the craniocaudal (CC) and mediolateral oblique (MLO) projections. The acquisition time for each image is 8\u201310\u00a0min with a total acquisition time of approximately 40\u00a0min per study. If needed, additional images may be acquired  or axillary craniocaudal view). These projections correspond to the standard projections used in MG  with light compression to limit patient motion. Patients receive an intravenous injection of the radiotracer  have been described [99mTc-sestamibi. For this latter modality, slant-hole collimator technology  is used to calculate the lesion depth using a single-head system [139Ce) is imbedded into the compression paddle as spatial reference point for determining the position of the lesion. The patient is administered with approximately 600\u00a0MBq of 99mTc-sestamibi into an arm vein contralateral to the breast lesion. Approximately 5\u00a0min after the injection, a scout image is performed using a parallel-hole collimator for positioning of the lesion. The breast lesion is in the exact position when it is assumed to be visible in the FOV of both the left and right stereotactic views. Subsequently, left and right stereotactic images are performed using a sliding slant-hole collimator  for determining the grid localization  and the depth (Z) of the lesion. Using this slant-hole collimator, 20 degree angle stereo views are required from both the left and right side  calculates the X, Y, Z coordinates indicating the X and Y coordinates in the grid and the depth of the trocar needle in the guidance block  using the energy window of 139Ce. Both pre- and post-verification images are acquired using both slant-hole collimators located under the lesion to verify the correct position of the needle  with dense breasts and at high risk of breast cancer; biopsy revealed carcinoma in 3 out of 5 of these patients [57Co was mounted inside the top of the breast compression paddle as spatial reference point. An algorithm for determining the spatial location of the breast lesion was implemented in the software of the dedicated breast camera [99mTc-sestamibi for subsequent stereotactic localization and biopsy  and occult after second-look US. Other possible indications include: (i) unclear lesions on MG/US but suspicious on MBI (BI-RADS criteria 4\u20135); (ii) failure of other biopsy methods. A potential future indication concerns optimization of primary tumour tissue sampling in patients with locally advanced breast cancer (LABC) by means of 99mTc-sestamibi-guided targeted biopsy. In the literature non-correspondence between the core biopsy location and the area with highest metabolic activity in the tumour has been described for stage II/III breast cancer patients scheduled for neoadjuvant chemotherapy [99mTc-sestamibi in breast carcinomas is associated with high proliferation rate, indicating more aggressive tumour behaviour [99mTc-sestamibi in large heterogeneous tumours could result in more optimal therapy planning in patients with LABC. The advantages and disadvantages of the different biopsy methods are summarized in Table\u00a0In recent years, percutaneous image-guided breast biopsy has gained importance as an alternative to surgical biopsy, mainly using sonographic, stereotactic, or MRI guidance. US-guided biopsy is the first technique of choice for sampling breast lesions. The sampling probe is placed behind the lesion to be biopsied and the verification of the correct needle placement is real-time. The main advantages of US-guided biopsy are its wide availability, lack of ionizing radiation and low costs . Stereotpatients . In 2006t camera . To our psy Fig.\u00a0. Howeverotherapy . Since eehaviour , the samIn conclusion, MBI-guided biopsy represents an adjuvant tool to MG/US-guided biopsy and a promising alternative to MRI-guided biopsy. The principal application of this new biopsy method is in patients with occult or unclear lesions on MG and US that are suspicious on MBI (BI-RADS criteria 4 and 5). The future indication is in targeted biopsies in patients with large heterogeneous tumours. Further studies are needed to define the accuracy of this biopsy procedure."}
+{"text": "Anopheles gambiae s.s. mosquitoes from two sites in Uganda.To combat malaria transmission, the Ugandan government has embarked upon an ambitious programme of indoor residual spraying (IRS) with a carbamate class insecticide, bendiocarb. In preparation for this campaign, we characterized bendiocarb resistance and associated transcriptional variation among An. gambiae s.l. WHO tube bioassay mortality in Nagongera and Kihihi, respectively) was investigated using whole-genome microarrays. Significant overexpression of several genes encoding salivary gland proteins, including D7r2 and D7r4, was detected in mosquitoes from Nagongera. In Kihihi, D7r4, two detoxification-associated genes (Cyp6m2 and Gstd3) and an epithelial serine protease were among the genes most highly overexpressed in resistant mosquitoes. Following the first round of IRS in Nagongera, bendiocarb-resistant mosquitoes were collected, and real-time quantitative PCR analyses detected significant overexpression of D7r2 and D7r4 in resistant mosquitoes. A single nucleotide polymorphism located in a non-coding transcript downstream of the D7 genes was found at a significantly higher frequency in resistant individuals. In silico modelling of the interaction between D7r4 and bendiocarb demonstrated similarity between the insecticide and serotonin, a known ligand of D7 proteins. A meta-analysis of published microarray studies revealed a recurring association between D7 expression and insecticide resistance across Anopheles species and locations.Gene expression in two mosquito populations displaying some resistance to bendiocarb  contains supplementary material, which is available to authorized users. Plasmodium falciparum infection in endemic regions [Malaria interventions deployed across sub-Saharan Africa over the past 15\u00a0years have had an extraordinary impact upon disease transmission, halving the prevalence of  regions . Further regions , 4.An. gambiae s.s. remaining the primary vector in these communities. Insecticide resistance testing in both Kihihi and Nagongera revealed high levels of pyrethroid resistance in this species , and lower levels of bendiocarb resistance  in 2014. This high level of pyrethroid resistance may partially explain why only modest declines in malaria metrics were observed following the universal LLIN distribution campaign.Malaria is a critical public health challenge in Uganda, with the estimated number of annual cases ranking fourth highest in the world . The invAn. gambiae s.l. WHO tube bioassay mortality in Nagongera and Kihihi, respectively) and identify associated mechanisms present in An. gambiae s.s. We then collected samples in the months following the first round of IRS to detect whether these insecticide resistance expression phenotypes persisted. Bendiocarb-resistant An. gambiae s.s. in Nagongera did not display any of the commonly observed resistance mechanisms, such as mutations in the insecticide target site (Ace1-119S) or overexpression of detoxification enzymes. Instead, a significant association between bendiocarb resistance and overexpression of two salivary gland genes, D7r2 and D7r4, was observed both before and after IRS deployment. Further research is needed to elucidate the role of D7 proteins in bendiocarb resistance, however in silico models support the hypothesis that these proteins are capable of binding insecticide, suggesting that they may play a role in transport or sequestration.To combat high levels of malaria transmission in Nagongera, an IRS campaign using the carbamate class insecticide bendiocarb was initiated in December 2014. We collected mosquito specimens prior to IRS deployment to measure pre-existing bendiocarb resistance  were identified as An. gambiae s.s. and 32% were identified as Anopheles arabiensis, while those from Kihihi were exclusively An. gambiae s.s (n\u2009=\u2009556). All survivors of bendiocarb exposure whose species could be identified were An. gambiae s.s.WHO tube bioassays were performed between January and May 2014 using reported . SpeciesAn. gambiae s.s [n\u2009=\u200940), however one heterozygous 119G:119S female from Nagongera was detected among unexposed samples (n\u2009=\u200940). Its genotype was confirmed by Sanger sequencing.To investigate the observed bendiocarb resistance phenotype, resistant and unexposed individuals were tested for a mutation in the target of the insecticide, acetylcholinesterase-1. This G119S mutation is widespread in West African biae s.s , 9. A TaAn. gambiae s.s. mosquitoes from Nagongera and Kihihi as well as the Kisumu laboratory strain of insecticide-susceptible mosquito originating from western Kenya .Several genes met these criteria in addition to displaying greater than 1.2-fold overexpression in resistant vs. unexposed control mosquitoes and an ANOVA F-test gSG1a, apyrase, GSG7). Additional resistant mosquitoes from the Kihihi collections were also included: one additional unexposed control pool and either 3 additional resistant pools  or 4 additional resistant pools . Among the Kihihi candidates, overexpression of all four genes was confirmed . Resistant mosquitoes from Nagongera displayed overexpression of D7r2, D7r4, gSG1a, and CPLCX2 relative to unexposed controls (Two-tailed Mann-Whitney p\u2009<\u20090.05). Overexpression of apyrase and GSG7 was not validated by qPCR .To validate these findings, real-time quantitative PCR (qPCR) was used to measure expression of nine resistance candidates in the same pooled RNA samples that were assayed by whole-genome microarray Fig.\u00a0. For eacAn. gambiae s.s. mosquitoes, with only 27% identified as An. gambiae s.s. (n\u2009=\u200989) . Surprisingly, bioassay mortality observed in May 2015 (98%) was significantly higher than that observed in May 2014 (95%) . A TaqMan assay detected no instance of the G119S target-site mutation in either resistant or unexposed control mosquitoes (n\u2009=\u200927). Real-time quantitative PCR analyses performed on individual mosquitoes detected overexpression of both D7r2 and D7r4 in resistant individuals  , which supports the hypothesis that these genes are co-regulated. Real-time quantitative PCR analyses did not detect overexpression of gSG1a, apyrase, GSG7, or CPLCX2 in resistant mosquitoes ,Additional bendiocarb WHO tube bioassays were performed following the bendiocarb IRS campaign implemented between December 2014 and February 2015 in Nagongera. Species identification PCR revealed a decrease in the proportion of 05) Fig.\u00a0. CompariAn. gambiae, and aid in blood feeding by scavenging host amines that induce vasoconstriction, platelet aggregation, and pain [An. gambiae, three long (D7L1\u20133) and five short D7 (D7r1\u20135) have been identified, and their expression is limited to female mosquitoes [D7r2 and D7r4 expression via intrathoracic injection was performed to test whether these transcripts could be silenced. Kisumu strain mosquitoes were injected with either double-stranded RNA (dsRNA) targeting the D7r2 transcript (dsD7r2), the D7r4 transcript (dsD7r4) or control dsRNA containing green fluorescent protein sequence (dsGFP). Attempts to silence these genes yielded highly variable results (32\u201389% reduction in transcript abundance) as well as off-target silencing of other D7 genes, and thus were not pursued further.Members of the D7 family are among the most highly-expressed salivary proteins in and pain , 11. In squitoes , 12. RNAAn. gambiae reference genome were detected . First, the D7r2/D7r4 intergenic regions from resistant and unexposed mosquitoes displaying a wide range of expression levels were amplified and sequenced. This D7r2/D7r4 intergenic region has previously been tested for its promoter activity in transgenic fruit flies, where it reproduced the tissue-specificity of D7r4 expression [D7r4 expression (fold change 1\u20132 relative to unexposed controls) were compared to twenty-three sequences derived from twelve individuals displaying high levels of D7r4 expression (fold change 4\u2013216 relative to unexposed controls). The amplified sequences varied widely in size, ranging from 1.2 to 1.8 kilobase pairs  tool [p\u2009>\u20090.05).To identify nucleic acid variants responsible for the elevated pression . Seven sME) tool . A searcAn. gambiae s.s. (n\u2009=\u200928) from the 2015 Nagongera collections whose expression had been measured. Thirteen individuals displaying low levels of D7r4 expression (fold change 0\u20132 relative to unexposed controls) were compared to fifteen individuals displaying high levels of D7r4 expression (fold change 3\u2013216 relative to unexposed controls). Following molecular cloning, one sequence per individual was included in the comparison. A cytosine/thymine SNP at genomic location 3R:8564156 displayed an association with both D7 expression level and bendiocarb resistance . In contrast, this SNP was less prevalent in mosquitoes from the 2014 Kihihi collections, appearing in only 2/24 resistant and 2/25 unexposed individuals (n\u2009=\u200949). No mosquito homozygous for the non-reference nucleotide was identified.Next, a region downstream of the short D7 cassette that encodes an apparently non-coding transcript was examined for expression-associated SNPs. It has been previously speculated that this transcript may have a role in regulation of D7 expression . For thiThe crystal structure of D7r4 protein and a modelled structure of D7r2 were used to assess the possibility of direct binding of bendiocarb to these proteins. Having noted a strong chemical structural similarity between bendiocarb and serotonin, as visualised in complex with D7r4 , we confAlthough D7r2 and D7r4 are relatively distantly related, sharing only 32% sequence identity, they align with only a single one residue insertion in the former vs the latter. This, along with the conservation of most cavity-lining residues, ensures a comparatively reliable prediction of the cavity shape and size in D7r2, although not of the quality desirable for automated docking methods. Interestingly, D7r2 is predicted to have a distinctly larger cavity, the difference arising principally from the replacement of two residues, Phe 110 and Leu 43 in D7r4, with the smaller Val in both cases , and pyrethroids  in four mosquito species   Table\u00a0. All fivm Zambia . The hypsistance . In thisAn. gambiae s.s. persists [An. gambiae s.s. mosquitoes following IRS, suggesting that this species was disproportionately affected, perhaps due to it being more anthrophophilic than An. arabiensis [.Recent campaigns to control malaria transmission in Uganda through a combination of LLIN distribution and IRS have been highly effective in decreasing malaria metrics, however our sampling of mosquito larval populations indicates that a reservoir of bendiocarb-resistant persists . Measurepersists . Furtherabiensis .An. gambiae s.s. and collectively confer bendiocarb resistance, however one resistance-associated phenotype that was observed both before and after IRS deployment is overexpression of genes encoding the D7r2 and D7r4 salivary gland proteins. The overexpression of apyrase, GSG7, gSG1a, and CPLCX2, detected in Nagongera in 2014 but not in 2015, may have associated fitness costs that caused these phenotypes to be eliminated from the local mosquito population, or may have been false positives. Our results demonstrate an association between D7 overexpression and bendiocarb resistance in An. gambiae s.s. mosquitoes, however further studies are needed to confirm whether D7 overexpression is a causative factor in resistance, or instead closely associated with a resistance-conferring variant.It is likely that several different mutations circulate within this population of The hypothesis that D7 family proteins are directly involved in bendiocarb resistance is supported by four key observations: (1) Overexpression of D7r4 in resistant mosquitoes from both Nagongera and Kihihi (2) Overexpression of D7 genes in mosquitoes collected from Nagongera both pre- and post-IRS intervention (3) Association between a D7-adjacent SNP and both D7 overexpression and bendiocarb resistance (4) The ability of the D7r4 protein structure (and probably D7r2 too) to accommodate bendiocarb in the central binding pocket, in a fashion that resembles that observed experimentally for the chemically similar serotonin.We hypothesize that D7 overexpression is symptomatic of a disruption in the tissue-specificity of D7 expression which allows these proteins to interact with insecticides in tissues other than the salivary glands. While expression of D7 genes has primarily been associated with the salivary glands, lower expression levels have been detected in tissues such as the malpighian tubules . Our seqAnopheles gambiae 1000 genomes dataset available for this region [Importantly, the identification of a D7 overexpression-associated SNP provides evidence that the high level of D7 expression observed in resistant mosquitoes is not simply a reaction to insecticide exposure, but is associated with an identifiable genotype. Further studies will be needed to determine whether the apparently non-coding transcript downstream of the short D7 cassette regulates expression of these genes. Our ability to test for an association between this SNP and bendiocarb resistance was limited by the fact that unexposed controls contain a mixture of resistant and susceptible individuals. However, the increase in SNP frequency among resistant mosquitoes following implementation of bendiocarb IRS supports our hypothesis that this SNP is associated with both D7 overexpression and bendiocarb resistance. The 3R:8564156 SNP was found in approximately half of the D7-overexpressing individuals tested, indicating that other SNPs conferring this phenotype remain to be discovered. Additional putative candidate resistance polymorphisms within this locus are being investigated using the s region . PrelimiAedes aegypti mosquito was observed to bind dengue virions and envelope protein, suggesting that this family of proteins may have a broader range of associated phenotypes than previously thought [Despite repeated appearances among the top microarray hits for genes overexpressed in resistant mosquitoes, the D7 protein family has never been functionally validated as an insecticide resistance candidate. The crystal structure of D7r4 revealed that the short form D7 proteins are structurally related to arthropod odorant-binding proteins, and exhibit a single binding site . In a re thought . We hypo thought , 26. Fur thought . The cry thought . Isother thought .D7r2 and D7r4 from a transgene will provide a more robust tool for investigating the role of these proteins in insecticide resistance. In particular, this method would allow us to test the promoter activity of putative D7 regulatory sequences, and test whether the tissue-specificity of D7 expression impacts insecticide resistance.Silencing the expression of D7 proteins yielded only moderate decreases in D7 transcript, which could be due to both transcript abundance and the previously-documented inefficiency of RNAi in mosquito salivary glands , 29. OveD7r2 and D7r4 expression. D7 proteins are estimated to compose at least 5\u201320% of salivary protein [D7L2, was shown to decrease blood feeding capacity and increase probing time in An. gambiae mosquitoes [Aedes aegypti mosquito was significantly less susceptible to an avian malaria parasite, Plasmodium gallinaceum [Whether D7 proteins are directly responsible for insecticide resistance or simply closely-associated markers, their role in mosquito blood-feeding makes this overexpression phenotype relevant to malaria transmission. Real-time quantitative PCR analyses of mosquitoes collected post-IRS detected instances of extremely high levels of  protein , thus resquitoes . Furtherlinaceum . ExploraD7 genes and bendiocarb resistance across multiple geographic locations and multiple collection years supports the hypothesis that D7 proteins confer insecticide resistance. Further study of the function of these proteins in insecticide resistance, and the impact of their overexpression on mosquito blood-feeding behaviour is needed. This study demonstrates the value of a whole-genome approach to detecting insecticide resistance, as it identified genes that have no known detoxification function and have never before been studied for their role in insecticide resistance. Screening for novel insecticide resistance candidates is necessary, as even the most well-characterized resistance mutations explain only a small fraction of a resistance phenotype [The replicated association between expression of henotype .Continued surveillance of insecticide resistance and investigation of the underlying mechanisms are a key component of vector control in malaria-endemic countries. The recent success of the IRS campaign in Nagongera underscores the value of insecticides in malaria control and the importance of preserving their efficacy.An. gambiae species complex using morphological keys. Female mosquitoes were exposed to 0.1% bendiocarb or control papers according to standard WHO tube bioassay protocols [WHO tube bioassays were performed in January, March, and May 2015, as described previously . Brieflyrotocols .An. gambiae s.s. females using an RNAqueous\u00ae-4PCR Total RNA Isolation Kit (Ambion) according to the manufacturer\u2019s protocol. For each sample type , four RNA pools were extracted. A Nanodrop spectrophotometer (Nanodrop Technologies) and an Agilent 2100 Bioanalyser (Agilent Technologies) were used to measure the quality and quantity of RNA samples. RNA labelling, as well as array hybridization, washing, scanning, and feature extraction were performed as previously described [An. gambiae microarray chips (A-MEXP-2196) were used in an interwoven loop design to compare four biological replicates each of resistant, unexposed, and laboratory mosquitoes with maximal statistical power  in an ANOVA F-test of the resistant vs. unexposed individuals comparison; 2. Displayed a log2 fold change greater than 0.3 in the resistant vs. unexposed individuals comparison; 3. Displayed the greatest fold change in the resistant vs. Kisumu individuals comparison (relative to resistant vs. unexposed and unexposed vs. Kisumu comparisons). All microarray data have been deposited in ArrayExpress (accession no. E-MTAB-6280).For all bendiocarb-resistant and unexposed mosquito samples, chelex-extracted DNA from individual legs was used as template for a species identification PCR . Mosquitescribed . Five 8\u2009DNA extracted from individual legs was used as template for a TaqMan assay to detect the G119S mutation in the Ace1 gene . Each 10The expression of nine genes was evaluated using qPCR. Following species identification, RNA was extracted from individual females collected in January, March, and May 2015 using a Zymo Quick-RNA MiniPrep kit (Zymo Research) according to the manufacturer\u2019s protocol.http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and evaluated for their efficiency over a ten-fold serial dilution. Primer efficiencies ranged between 89 and 110%, and were included in calculations of fold change. Amplification was performed and analysed using an Agilent Mx3005P QPCR System. The thermal profile was as follows: 1\u00a0cycle 95C for 3\u00a0min, 40\u00a0cycles of 95C for 10\u00a0s followed by 60C for 10\u00a0s. Gene expression relative to two housekeeping genes (rpS7 and GDPH) was calculated using the REST 2009 software tool [Invitrogen SuperScript III Reverse Transcriptase (Invitrogen) and 200 nanograms of template RNA were used to perform cDNA synthesis reactions. Following cDNA purification with a QIAquick PCR Purification Kit (QIAGEN), triplicate qPCR reactions were prepared using SYBR Brilliant III (Agilent Technologies) and 300\u00a0nM each primer  and reverse (5\u2019 CGGATCTCGCACAGTCTACT 3\u2032) primers were designed to bind within the D7r2 and D7r4 coding sequences, respectively. A high-fidelity Taq polymerase, either Thermo Scientific Phusion Hot Start II High-Fidelity DNA polymerase or NEB Q5 High-Fidelity DNA polymerase, was used according to the manufacturer\u2019s protocol. A Promega Wizard SV gel and PCR clean-up system was used to purify individual PCR amplification products. A Thermo Scientific CloneJET PCR cloning kit was used to clone select PCR amplification products prior to sequencing. Assembled sequences of PCR amplification products are presented in Additional\u00a0file\u00a0Leg DNA from individual females collected in March and May 2015 was used as template for amplification of the Leg DNA from individual females collected from Nagongera in 2015 was used as template for amplification of a region downstream of the short D7 cassette. The genomic region encoding a non-coding transcript, identified by Arca et al. as \u201cContig 709\u201d, was amplified using the following primers: 709F (5\u2019 ACCTATCCATCAGTTCCACCAC 3\u2032) and 709R (5\u2019 CAGGCCTAATCTGTGGCAGT 3\u2032) . PCR proLeg DNA from individual females collected from Nagongera in 2014 was used as template for amplification of the D7r2 and D7r4 coding sequences. The D7r4 coding region of four resistant and four unexposed females was amplified using the following primers: D7r4seqF (5\u2019 GTAATTCTGAAGATCAAGGTGTG 3\u2032) and D7r4seqR (5\u2019 CGTGCCTTTGAACGCTACAT 3\u2032) or D7r4seqF2 (5\u2019 AGGTAATGGATCATGAAGTAAGTCT 3\u2032) and D7r4seqR2 (5\u2019 TGAACGCTACATCTGTTTTCA 3\u2032). Additional sequences the D7r2/D7r4 intergenic region (described above) was used to assemble partial or full coding sequences. The D7r2 coding region of three resistant females was amplified using the following primers: D7r2seqF (5\u2019 TCGCAGTATAAAAGGCAGTATCT 3\u2032) and D7r2seqR (5\u2019 TGCATCATTGTTCCTTTTGCT 3\u2032). PCR products were amplified and cloned as described as above. Assembled sequences of PCR amplification products are presented in Additional\u00a0file\u00a0A real-time quantitative PCR using a locked nucleic acid probe was designed for genotyping individuals for the 3R:8564156 C/T SNP located in Contig 709. The PCR primers TM709F (5\u2019 GCCCGCGTAATAGGGATTATGT 3\u2032) and TM709R (5\u2019 TTTTTCGCTGGGAAGTTGGTC 3\u2032) were used in combination with the following probes: 709Alt (5\u2019 CGCC+A\u2009+\u2009T\u2009+\u2009GGAGA 3\u2032) labelled with FAM, 709Ref (5\u2019 CGCC+A\u2009+\u2009C\u2009+\u2009GGAGA) labelled with HEX. Each 10\u00a0\u03bcl reaction contained 1\u00d7 Sensimix (Bioline), 0.5\u00a0\u03bcM each primer, 0.5\u00a0\u03bcM each probe, and 1\u00a0\u03bcl template DNA. An Agilent MX3005p real-time PCR machine was used to run the following program: 95\u00a0\u00b0C for 10\u00a0min followed by 40\u00a0cycles of 92\u00a0\u00b0C for 15\u00a0s and 57\u00a0\u00b0C for 1\u00a0min. Genotypes were called from endpoint HEX and FAM fluorescence using MxPro software.Structure modelling of the D7r2 protein was carried out using the crystal structure of D7r4 protein bound to serotonin  as a tepymol.org) was used for manual positioning of bendiocarb into D7 protein structures. Automated small molecule docking was then done at the ROSIE/Rosetta [PyMOL  with the following search terms: Anopheles AND insecticide resistance AND microarray. These 32 results were filtered to select publications in which genome-wide microarrays were performed on whole female mosquitoes that had been selected with insecticides. Three microarrays were used in these publications: the 4\u2009\u00d7\u200944\u00a0k (ArrayExpress accession number A-MEXP-2245) and the 8\u2009\u00d7\u200960\u00a0k (A-MEXP-2374) microarrays were used to assay An. funestus mosquitoes, and the 8\u2009\u00d7\u200915\u00a0k (A-MEXP-2196) microarray was used to assay An. gambiae s.s. and An. arabiensis mosquitoes [To identify publications containing microarray data collected from insecticide-resistant squitoes , 46, 47.www.vassarstats.net).GraphPad Prism version 5.04 for Windows statistical software (GraphPad Software) was used to perform Fisher\u2019s exact, Mann-Whitney and Spearman tests for statistical significance. The lower and limits of the 95% confidence interval for a proportion were calculated using VassarStats Additional file 2:D7r2/D7r4 intergenic regions, from Nagongera mosquitoes. (DOCX 22\u00a0kb)FASTA sequences of amplified Additional file 3:FASTA sequences of region encoding Contig 709 transcript, from Nagongera mosquitoes. (DOCX 20\u00a0kb)Additional file 4:pymol.org). (PNG 1766\u00a0kb)Comparison of the cavity binding serotonin in the D7r4 crystal structure  and theAdditional file 5:Diagram of hybridizations performed in the microarray analysis. (PDF 117\u00a0kb)Additional file 6:Complete microarray results. (XLSX 7082\u00a0kb)Additional file 7:Sequences of primers used in qPCR analyses and dsRNA synthesis. (XLSX 11\u00a0kb)Additional file 8:Anopheles insecticide resistance microarrays. (DOCX 20\u00a0kb)Articles considered in the meta-analysis of"}
+{"text": "The aim of this work was to analyse the distribution of causal and candidate mutations associated to relevant productive traits in twenty local European pig breeds. Also, the potential of the SNP panel employed for elucidating the genetic structure and relationships among breeds was evaluated. Most relevant genes and mutations associated with pig morphological, productive, meat quality, reproductive and disease resistance traits were prioritized and analyzed in a maximum of 47 blood samples from each of the breeds , Casertana, Cinta Senese, Gascon, Iberian, Kr\u0161kopolje (Kr\u0161kopoljski), Lithuanian indigenous wattle, Lithuanian White Old Type, Mora Romagnola, Moravka, Nero Siciliano, Sarda, Schw\u00e4bisch-H\u00e4llisches Schwein , Swallow-Bellied Mangalitsa and Turopolje). We successfully analyzed allelic variation in 39 polymorphisms, located in 33 candidate genes. Results provide relevant information regarding genetic diversity and segregation of SNPs associated to production and quality traits. Coat color and morphological trait-genes that show low level of segregation, and fixed SNPs may be useful for traceability. On the other hand, we detected SNPs which may be useful for association studies as well as breeding programs. For instance, we observed predominance of alleles that might be unfavorable for disease resistance and boar taint in most breeds and segregation of many alleles involved in meat quality, fatness and growth traits. Overall, these findings provide a detailed catalogue of segregating candidate SNPs in 20 European local pig breeds that may be useful for traceability purposes, for association studies and for breeding schemes. Population genetic analyses based on these candidate genes are able to uncover some clues regarding the hidden genetic substructure of these populations, as the extreme genetic closeness between Iberian and Alentejana breeds and an uneven admixture of the breeds studied. The results are in agreement with available knowledge regarding breed history and management, although largest panels of neutral markers should be employed to get a deeper understanding of the population\u2019s structure and relationships. Modern pig production is mostly based on highly-selected genotypes from lean breeds, farmed in intensive production systems for provisioning the market with fresh pork. On the other hand, the use of local examples of pig breeds is usually associated with local forms of pig husbandry and processing of their meat into high-quality products, often dry-cured. The most representative local pig breed is the Iberian raised in the southwest of the Iberian Peninsula, but there are many other breeds reared in European countries. These breeds are in general characterized by a good adaptation to specific environments, high potential for fat deposition and characteristic meat quality, mostly related to high intramuscular or intermuscular fat content, which are associated with high quality pork productions.Conservation of animal genetic resources depends on current and future economic relevance of autochthonous breeds but also on scientific importance, the cultural and historical value, adaptation to environment and contribution to the development of local communities and marginal areas. Local breeds, although showing economic and social relevance, may be threatened by inefficient utilization  and the Neutral markers like microsatellites have been recommended by FAO for genetic characterization of animal breeds . Howeverhttps://treasure.kis.si), a multidisciplinary European Union funded project pointing toward development of sustainable pork chains in several European local pig breeds.In this study, we have investigated, in 20 local breeds, allele frequency distribution of causative polymorphisms and polymorphisms associated with relevant traits in a total of 33 genes selected from previous studies carried out in cosmopolitan breeds. The analysis was focused on variants in candidate genes known to affect the regulation of growth and appetite, meat quality, coat color, reproduction and disease resistance. Moreover, the genotyping information was employed to assess population genetics and structure measures. This work was framed in the TREASURE project , Basque and Gascon (France), Schw\u00e4bisch-H\u00e4llisches Schwein (Germany), Apulo-Calabrese, Casertana, Cinta Senese, Mora Romagnola, Nero Siciliano and Sarda , Lithuanian indigenous wattle and Lithuanian White old type (Lithuania), Alentejana and B\u00edsara , Moravka and Swallow-Bellied Mangalitsa (Serbia), Kr\u0161kopolje (Slovenia) and Iberian and Majorcan Black (Spain). Selection of individuals for sampling was performed avoiding highly related animals , balancing between sexes and prioritizing adult individuals or at least animals with adult morphology. Specialized professionals from each institution that provided animal material obtained all blood samples following standard routine monitoring procedures and guidelines, at farm or at slaughter. No animal experiment was performed within this research and blood samples were obtained as a general breeding procedure and only reused here.The genomic DNA was extracted from leukocytes present in 8\u201315 mL of peripheral blood, collected in Vacutainer tubes containing 10% 0.5 M EDTA  at pH 8.0. The extraction was performed using either a standardized phenol-chloroform, high-salt method or a commercial kit .Most intMC1R) haplotypes were constructed from the data on individual SNPs located at the following positions on SSC6 according to Ss11.1: g.181461 \u2013 g.181697 \u2013 g.181818 \u2013 g.181825 g.181825 \u2013 g.181905 \u2013 g.182126 (CC>*), with the following definition of haplotypes: MC1R*1: GCGTG**; MC1R*2: GCGCA**; MC1R*3: GCATG**; MC1R*4: ATGTG**; MC1R*6: GCATGCC; MC1R*7: GCGTGCCMelanocortin receptor 1 (O) and expected (HE) heterozygosity and FST [IS statistic. DS and FST distance measures were estimated according to Takezaki and Nei [hierfstat library in R environment [S and FST distances with the nj function belonging to the ape library in R [Genetic variability at the different loci in each population was measured with observed  through  v.2.0.2  in R env v.2.0.2 . The optet al. [The most likely number of partitions in the dataset, irrespective of breed of origin, was also determined using the algorithm implemented in STRUCTURE . We carret al.  recommenet al. ; the mosThe analyzed SNP panel includes polymorphisms related to coat color and morphological traits, growth, fatness and carcass traits, meat quality traits, reproduction and disease resistance.TaqMan allelic discrimination qPCR assays have been shown to be accurate and reliable ,56. The MC1R and v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gene (KIT) genes are supposed to play major roles in determining coat color variation in Mediterranean pig breeds or populations [A picture showing the characteristic phenotype and country of origin for each breed is shown in ulations .MC1R gene codes for a G protein-coupled receptor that is primarily expressed in melanocytes and plays a key role in melanogenesis. It is involved in regulation of eumelanin (black/brown) and phaeomelanin (yellow/red) synthesis in the melanocyte and is encoded by the Extension (E) coat color locus. Several SNPs were genotyped for MC1R locus, which were used for the construction of haplotypes [E+), which in many species involves synthesis of both melanin types and is present in wild boars, was present in Mora Romagnola (0.52) and fixed in Swallow-Bellied Mangalitsa. The fixation of MC1R*1 in Swallow-Bellied Mangalitsa breed has already been reported [D1), characterized by a p.L102P aminoacid change is associated with dominant black coat. This allele has Asian origin and has been previously detected in Chinese and Large Black breeds. According to our results MC1R*2 is observed at high frequency in Black Slavonian (0.89) and with moderate presence in Moravka and Schw\u00e4bisch-H\u00e4llisches. The Black Slavonian pig comes from eastern Croatia and was created at the end of the 19th century by the crossbreeding of Swallow-Bellied Mangalitsa, Berkshire, Large Black and Poland China breeds [MC1R allele. Interestingly, MC1R*1 allele probably provided by Swallow-Bellied Mangalitsa has not persisted, possibly due to selection of the black coat color. Since the Black Slavonian pig is the only Croatian breed with MC1R*2 genotype, the genotyping of this locus has been already proposed to determine the purity of the Black Slavonian pigs [plotypes ,59. Fivea breeds ,62, whicED2) and MC1R*6 (EP), are widely observed in European breeds. Allele MC1R*3 is associated with a p.D124N substitution involving black coat color. Allele MC1R*6 causes black spotting on a red or white background and possesses, in addition to the p.D124N substitution for dominant black coloring, a two base pair insertion at codon 22. These two alleles are predominant in most of the analyzed breeds, which is in agreement with the dark coat color of most of them. MC1R*3 mutation is the most frequent in Mediterranean and Pyrenean pig breeds whereas this variant is practically absent in Iberian Peninsula breeds. MC1R*6 allele showed the highest frequency in Lithuanian indigenous wattle and Turopolje breeds in agreement with its characteristic patched phenotype. This allele was also fixed in Lithuanian White Old Type, in which the white coat color must be consequence of variation in the KIT locus.Haplotypes MC1R*3 , associated with the recessive red coat color and characteristic of the Duroc breed was present in Mora Romagnola and detected at very low frequency in several other breeds. This allele was previously indicated to be fixed in the Mora Romagnola breed , which sWe previously detected a new allele, MC1R*7 , which wKIT gene plays key roles in melanogenesis, erythropoiesis, spermatogenesis and T-cell differentiation. Jointly with MC1R, they are the major determinants of the across-breed differences in coat color patterns in different mammals. Mutations in the porcine KIT gene (dominant white locus) have been shown to affect coat color and color distribution [KIT alleles was beyond the scope of this work. Nevertheless, the KIT g. 43597545C>T (g.41488472 in Sscrofa11.1) SNP was included in the panel, since it had been previously associated to the belted phenotype [et al. (2017) [et al. [ribution . A largeribution ,34 but thenotype . This SN. (2017)  in eleve [et al.  suggestiMC1R and KIT genes on coat color, other genes have been associated to specific coat patterns. For example, several polymorphisms in the porcine Tyrosinase-related protein 1 (TYRP1) gene have been recently associated with the blond coat color in Liangshan pigs [TYRP1 gene even if the blond phenotype was not present in these breeds. These two breeds have known introgression of different commercial breeds. In the case of Kr\u0161kopolje, German Landrace, Pietrain and Duroc breeds were commonly used as terminal sires for many years. Regarding Moravka, the creation of this breed is known to be the result of unsystematic crossing of the ancient and extinct local breed, \u0160umadinka, with Berkshire [th century. These influences could explain the presence of unexpected alleles.Besides the main roles of han pigs . One of han pigs , only Krerkshire , and alsNR6A1) gene has been shown to affect vertebrae number in the pig. While wild boars show a fixed vertebrae number (19), most domesticated pig breeds show a vertebrae number varying between 21 and 23 [The orphan nuclear receptor, germ cell nuclear factor (1 and 23 . Previou1 and 23 . In our 1 and 23 . Also AlPPARD) gene was shown to be a Quantitative Trait Nucleotide (QTN) affecting the ear size in pigs [PPARD gene has roles in skin and cartilage development besides affecting fat metabolism. The Chinese allele A, which increases ear size, is supposed to be absent in European breeds, but it has been detected in Large Black [A missense mutation (p.G32E) of Chinese origin in the gene encoding the peroxisome proliferator-activated receptor delta , upon exposure to halogenated anaesthetics [RYR1 gene codes for the skeletal ryanodine receptor, a protein structurally involved in calcium channels controlling movements of Ca2+ from the sarcoplasmic reticulum to the cytosol. PSS is of concern to the worldwide swine industry from both welfare and an economic perspective as it results in losses during transport and very fast post-mortem pH decline causing denaturation of muscle proteins, water loss and formation of pale, soft, exudative meats (PSE) with reduced meat quality and commercial value [Porcine stress syndrome (PSS) or Malignant hyperthermia is a condition that develops in homozygous animals carrying a single coding nucleotide substitution in the sthetics . The RYRal value . Among lal value , the c.1al value ,77.IGF2) intron 3 g.3072G>A (g.1483832G>A in Sscrofa11.1) substitution has been identified as a QTN for a paternally-expressed QTL affecting muscle growth, fat deposition, and heart size [\u00aesoftware [The insulin-like growth factor 2  gene is also most likely involved in the regulation of energy balance and feed intake [LEPR gene mutation has been related to several productive, fatness and meat quality traits in different genetic backgrounds [LEPR favorable T allele is completely absent in Basque, Mora Romagnola and Turopolje breeds; and at very low frequency in many other breeds, also characterized by a fat phenotype. Nevertheless, this results agrees with the polygenic nature of fatness and meat quality traits. Regarding the MC4R gene, different SNPs have been previously evaluated. Among them, the c.892G>A (p.D298N) is usually considered the most relevant one, being associated with variation in growth and fatness traits in most breeds and crosses, but with some discrepancies among studies [LEP and FTO genes [Several genes encoding proteins with key roles in energy homeostasis were included in the SNP panel. These functionally related genes are involved in the melanocortin pathway that regulates feed intake and energy expenditure at hypothalamic level. The leptin (LEP) is the signaling molecule, produced in adipocytes, which informs the central nervous system about the increase in energy stores, unchaining an anorexigenic signal through its hypothalamic receptor (LEPR). The melanocortin receptor 4 (MC4R) is a downstream molecule involved in transmitting the LEP signal. The fat mass and obesity-associated protein  is a member of transforming growth factor-\u03b2 (TGF-\u03b2) superfamily. It is a negative regulator for both embryonic development and adult muscle homeostasis. Previous works have detected and analyzed three SNPs , located in the r region , concludr region . We seler region \u201392. AccoTAS2R) gene family encodes for receptors involved in taste perception and bitter sensing. Among them, TAS2R39 and TAS2R4 genes have been recently reported to be related to backfat thickness, probably as a consequence of different feed intake, due to different feed taste perception [TAS2R39 gene, the missense mutation, p.N71T, was included in our panel. Allele G was predominant or fixed in most breeds although some others showed moderate to intermediate frequency of T allele (0.21 to 0.29), such as Majorcan Black, Cinta Senese, Black Slavonian, Kr\u0161kopolje or Sarda, in which the SNP may be used in association studies. Such studies could deepen in the effects and causality of the marker and the potential mechanism for affecting fat deposition (voluntary feed intake). Finally, the marker in TAS2R4 gene showed the A allele fixed in all breeds.Taste 2 Receptors (rception . For TASFASN), acetyl CoA carboxilase alpha (ACACA) and microsomal triglyceride transfer protein (MTTP) genes, included in our panel. The ACACA and FASN genes are involved in de novo lipogenesis, and mutations in these genes have been associated to MUFA and SFA content [MTTP gene is highly associated with the fatty acid composition in the pig [The fatty acid profile is one of the main determinants of animal product quality and is one of the distinguishing characteristics of high-valued Iberian meat products. Fatty acid profile has profound effects on the nutritional, sensorial and technological properties of meat . Differe content . The mis the pig , influenSCD) and long-chain acyl-CoA synthetase (ACSL4) genes may be considered causal mutations of effects on meat fatty acid profile, specifically regarding MUFA content. The SCD is a very relevant enzyme because it catalyzes the desaturation of palmitic and stearic to palmitoleic and oleic acids. For this gene a mutation g.2228T>C (g.111461751C>T in Sscrofa11.1), positioned in the core sequence of several putative transcription factor binding sites, has been repeatedly associated to MUFA content in different genetic backgrounds [ACSL4 mRNA expression levels in liver than the A allele [SCD mutation, the favorable allele is already at high frequencies in most populations, in agreement with the high desaturation potential and favorable fatty acid profile and meat quality parameters observed in these breeds [ACSL4, in contrast, high level of segregation is observed in most breeds.Mutations in the stearoyl CoA desaturase  gene encodes an enzyme involved in the degradation of skatole in the liver, being negatively correlated with its accumulation; the g.2412C>T (g. 141690107C>T in Sscrofa11.1) polymorphism located in the promoter of CYP2E1 gene accounts for more than a 10% of total phenotypic variance of skatole content in backfat, the C allele being associated to higher skatole levels [CYB5A) gene codify for a protein involved in androstenone biosynthesis. A c.-8T>G polymorphism was found located 8bp upstream the start codon [Boar taint is an unpleasant odor that influences the smell and taste of cooked pork from non-castrated male pigs. This defect leads to losses in carcass value resulting in economic cost to the industry. Its main cause is the accumulation of androstenone and skatole in fat tissues. Alternatives to surgical castration for the control of this problem include selective breeding and in consequence many studies have addressed the genetic variation underlying androstenone and skatole levels. Many QTLs have been found  and a fee levels ,23. Thisrt codon  and c.-8rt codon ,21. Accort codon  and boarrt codon .postmortem proteolysis are determinant factors in meat tenderization thus affecting eating quality. The calpastatin (CAST) gene codes for an inhibitor of proteases whose activity is highly related to meat tenderness in different species. More than 900 polymorphisms have been identified in this gene [post-mortem meat processes. Among them the calpain S1 (CAPNS1) polymorphism c.429A>C has been associated with pH, conductivity and meat color in different experimental and commercial pig populations [CAST and CAPNS1 genes, respectively, in which the favorable alleles are already at high frequency or even fixed.Proteolytic enzymes participating in his gene , the SNPhis gene . Calpainulations . Allele PPARGC1A) gene codes for a transcription coactivator involved in adipogenesis, energy metabolism and muscle fiber determination, favoring oxidative type fibers. The PPARGC1A c.1288T>A polymorphism was associated with pH and cooking loss in Duroc\u00d7Pietrain experimental cross and in Italian Large White and Landrace [ADIPOQ) gene encodes an adipokine involved in glucose and lipid metabolism. The non-synonymous polymorphism c.1735G>A had been previously associated with fat deposition [Some genes involved in fat metabolism and deposition may also influence meat quality parameters. The peroxisome proliferator activated receptor gamma coactivator 1A . This mutant A allele was absent in all local porcine breeds, in agreement with the main phenotypic characteristics of our local breeds and with previous works [Glycogen content is determinant of multiple meat quality traits, such as pH, meat color, drip loss or tenderness. One of the first genes identified affecting these meat quality traits in pigs was PRKAG3 . The prous works . The p.Vus works . The A aus works . AccordiPHKG1) gene has been shown to be a causal mutation leading to high glycogen content and low meat quality in pig muscle [More recently, a splice mutation in the phosphorylase kinase catalytic subunit gamma 1 (g muscle . This geg muscle . AccordiPCK1) gene codes for a regulatory molecule involved in gluconeogenesis. A polymorphism in this gene  has been recently reported [PCK1 c.2456A allele, the one that encodes methionine and is associated to both less water losses and more favorable fat distribution, seems to be overrepresented in breeds or crosses not subjected to strong artificial selection [The phosphoenolpiruvate carboxykinase (GBP5) gene is known to play a role in host immune response and inflammation based on studies in the knockout mouse. The rs340943904 mutation in the pig gene is a strong candidate causal mutation for a QTL on SSC4 that controls variation in host response to Porcine Respiratory and Reproductive Syndrome (PRRS) virus [Three genes involved in disease resistance traits were explored . The guaS) virus . This inS) virus  thus leaS) virus . With thS) virus . BesidesEscherichia coli (ETEC), that expresses the F4ab and F4ac fimbriae is a major cause of diarrhea outbreaks and mortality in the pig breeding industry, infecting both newborn and weaned piglets. The mucin 4 gene (MUC4) SNP located in intron 7  is the most extensively studied polymorphism in relation to ETEC F4ab/ac susceptibility in pigs [Enterotoxigenic  in pigs . This SN in pigs . The C a in pigs . AccordiFUT1) gene, considered the candidate gene controlling the adhesion to F18 receptor. In this gene a G/A transition resulting in an p.A103T amino acid substitution has been discovered which is involved in susceptibility, AA individuals are resistant to ETECF18 while GG or AG are sensitive. This mutation of FUT1 gene has been also associated to resistance to natural infection by PRRS and Haemophilus parasuis virus [Weaned piglets are also susceptible to F18-positive Escherichia coli (ETECF18) infections leading to post-weaning diarrhea or edema disease. The F18 receptor (F18R) plays a crucial role in this disease by mediating the binding of F18 fimbriated bacteria to the intestinal epithelium with F18R positive animals being susceptible to infection. Susceptibility to this infection appears to be dependent on the activity of the alpha-fucosyltransferase-1  gene polymorphism, previously associated to litter size [The estrogen receptor 1  gene polymorphism shows segregation at intermediate frequencies in most of tested populations. Iberian and Alentejana breeds showed the wild allele almost fixed. For this Asian-derived non-synonymous mutation the mutant G allele has been associated with a substantial increase in litter size in multiple European commercial lines [The aryl hydrocarbon receptor  and expected heterozygosity (HS) values per locus ranged from 0.024 to 0.414 and from 0.025 to 0.415, respectively, with overall values of 0.24 for both parameters. FST is a measure of population structure due to genetic structure and its values range from 0 to 1. While a zero value indicates there is no genetic structures and the populations are in complete panmixia, a value of one implies there are not gene flux between the populations. The overall FST value from all tested loci was 0.25, pointing out that a 25% of genetic differences are due to differences between breeds and a 75% is caused by differences among individuals, therefore, the breeds studied share some genetic diversity. A similar value (FST = 0.27) [ST values were obtained for MC1R and KIT loci, meaning that these markers show the highest degree of differentiation among populations, whereas the lowest values were observed for FASN, PPARD and RYR1 polymorphisms.The results of diversity parameters obtained for each tested and segregating marker are shown in  = 0.27)  was alsoIS values for each breed are shown in IS estimates the departure from panmixia at the subpopulation level, and is a measure of inbreeding; negative values indicate there are less related individuals than expected by random mating and positive values indicate there are more related individuals than expected by random mating. According to this statistic, Casertana and Apulo Calabrese are the breeds displaying the highest inbreeding, in agreement with their endangered situation and small census [The global Ho, Hs and Fl census ,118,119.ST pairwise estimates ranged from 0.039 between Alentejana and Iberian breeds to 0.524 between Mora Romagnola and Turopolje , meat quality  or disease resistance  are segregating in many breeds, in some cases with intermediate frequencies, opening selection possibilities. Results provide an extended catalogue of fixed and segregating candidate SNPs associated with complex traits with potential usefulness for traceability purposes and for association studies and breeding programs. For a practical application, the percentage of variance of the traits of interest explained by the polymorphisms must now be further studied in each breed. If sufficient to justify the genotyping cost, a marker assisted selection could be implemented.We report a comprehensive analysis of genetic variation and population genetic structure based on a panel of candidate genes in a wide panel of European local pig breeds. Results are in agreement with known facts of the breeds\u2019 origin and their phenotype. A clear genetic differentiation and intra-breed homogeneity was observed in some cases, while other breeds showed a high degree of admixture. Alleles with contrasted effects on production and fatness (such as S1 Table(XLSX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file.S1 Fig(TIF)Click here for additional data file.S2 Fig(TIF)Click here for additional data file.S3 Figx axis reports the number of PC retained in each DAPC and y axis the proportion of successful outcome prediction.(TIF)Click here for additional data file.S4 Fig(TIFF)Click here for additional data file.S5 Fig(TIFF)Click here for additional data file.S6 Figa) plot of ln Pr(G|K) values as a function of the number of clusters for each of the 20 runs carried out for each K value using the program STRUCTURE. b) plot of K as the mean of the absolute values of L\u201d(K) averaged over 20 runs divided by the standard deviation of L(K) between successive K values.(TIF)Click here for additional data file."}
+{"text": "The presence of a vitelline vascular remnant is rare, and definitive preoperative diagnosis is difficult. We herein describe a case of intestinal obstruction caused by a vitelline vascular remnant with mild chronic appendicitis successfully diagnosed and treated with laparoscopic surgery.A 14-year-old male was admitted to our hospital with sudden-onset right lower abdominal pain and vomiting. A blood test on admission revealed slight leukocytosis. Computed tomography scan showed that the appendiceal wall was enhanced and thickened. Although the ileum was slightly dilated and ascites was present at the recto-vesical pouch, these were thought to be inflammatory changes secondary to appendicitis. Laparoscopic surgery was performed using three trocars. Strangulated small bowel obstruction caused by a band connecting the right medial umbilical fold to the ileal mesentery was found intraoperatively. After reduction, neither ischemic change of the small intestine nor Meckel\u2019s diverticulum was detected. The appendix was slightly inflamed, and serous ascites was present at the recto-vesical pouch; therefore, appendectomy was also performed. The patient was discharged on postoperative day 4 without complications. Pathological examination revealed that the band consisted of blood vessels, and it was diagnosed as a vitelline vascular remnant. The appendix included fecal stones and showed chronic inflammatory change histologically; the patient was thus diagnosed with chronic appendicitis.Definitive preoperative diagnosis of a vitelline vascular remnant, especially with coexisting appendicitis, might be difficult. Laparoscopic surgery might be useful for patients who demonstrate unusual symptoms because it allows for simultaneous diagnosis and treatment. A vitelline duct remnant is a rare condition that is reportedly present in approximately 2% of the general population , 2, and Despite recent improvements in imaging studies, achieving an accurate preoperative diagnosis of acute abdomen remains difficult. Laparoscopic surgery, which allows for simultaneous exploration of the abdominal cavity and definitive diagnosis, has become a popular technique for patients with acute abdomen. However, reports of the simultaneous occurrence of intestinal obstruction caused by a vitelline vascular remnant and appendicitis treated with laparoscopic surgery are extremely rare. We herein report a case of intestinal obstruction caused by a vitelline vascular remnant with chronic appendicitis successfully treated with laparoscopic surgery.A 14-year-old male was admitted to our hospital with right lower abdominal pain and vomiting. He had no history of abdominal surgery or trauma. Physical examination revealed deep tenderness at McBurney\u2019s point without abdominal distension. A blood test on admission revealed slight leukocytosis (9840/\u03bcl) without elevation of the C-reactive protein level (0.01\u00a0mg/dl). Enhanced computed tomography scan showed a slightly enhanced, thickened appendiceal wall Fig.\u00a0. AlthougLaparoscopic surgery with three trocars was performed . Strangulated small bowel obstruction caused by trapping of ileal bowel loops by a band was observed Fig.\u00a0. After rPathological examination revealed that the band consisted of blood vessels, and it was diagnosed as a vitelline vascular remnant Fig.\u00a0, b. The Vitelline or omphalomesenteric duct remnants are rare congenital anomalies associated with the primitive yolk stalk. The vitelline duct is an embryologic communication between the primary yolk sac and the embryonic midgut, which gradually narrows and finally closes by week of 9 gestation \u20138. IncomA vitelline duct remnant can result in several complications such as gastrointestinal tract bleeding, intestinal obstruction, abdominal pain, and umbilical discharge \u20138. A vitA vitelline duct remnant often contains heterotopic mucosa which can result in some clinical manifestations such as infection and bleeding . FurtherIn the present patient, the preoperative diagnosis was mild appendicitis. Although this diagnosis was pathologically confirmed, the main symptom might have been caused by the intestinal obstruction secondary to the vitelline vascular remnant. Although suspected appendicitis with acute lower abdominal pain is one of the most common indications for emergency surgery in young patients, achieving an accurate preoperative diagnosis remains difficult despite recent improvements in imaging technology. Actually, Aitken  reportedSeveral cases of vitelline duct remnants successfully treated with laparoscopic surgery were recently reported , 15. AltIn conclusion, this is believed to be the first case report of the simultaneous occurrence of intestinal obstruction caused by a vitelline vascular remnant and appendicitis successfully treated with laparoscopic surgery. Achieving a definitive preoperative diagnosis of a vitelline vascular remnant might be difficult, especially in patients with coexisting appendicitis. When young patients demonstrate unusual symptoms, surgeons should consider the possibility of a vitelline vascular remnant, and laparoscopic surgery should be considered because it allows for simultaneous diagnosis and treatment."}
+{"text": "With appropriate optical feedback, a fibered distributed feedback (DFB) diode laser emitting at 1531.6 nm is locked to the resonance of a V-shaped cavity with a free spectral range (FSR) of 300 MHz and a finesse of 14,610. A minimum detectable absorption coefficient of \u03b1min = 2.3 \u00d7 10\u22129 cm\u22121 is achieved in a single scan within 5 s, yielding a detection limit of 17 ppb for NH3 in breath gas at low pressure, and this stable system allows the detection limit down to 4.5 ppb when the spectra to be averaged over 16 laser scans. Different from typical CEAS with a static cavity, which is limited by the FSR in frequency space, the attainable spectral resolution of our experimental setup can be up to 0.002 cm\u22121 owing to the simultaneous laser frequency tuning and cavity dither. Hence, the absorption line profile is more accurate, which is most suitable for low-pressure trace gas detection. This work has great potential for accurate selectivity and high sensitivity applications in human breath analysis and atmosphere sciences.The qualitative and quantitative analysis to trace gas in exhaled human breath has become a promising technique in biomedical applications such as disease diagnosis and health status monitoring. This paper describes an application of a high spectral resolution optical feedback cavity enhanced absorption spectroscopy (OF-CEAS) for ammonia detection in exhaled human breath, and the main interference of gases such as CO Tomberg demonstrated the use of cantilever-enhanced photoacoustic spectroscopy in trace gas detection, where sub-ppt level sensitivity is obtained during the measurement of a strong absorption cross-section of hydrogen fluoride [2H6 and CH4, and \u03b413C-CH4 isotope ratio was presented by Loic et al. using a mid-infrared CEAS technique, and a minimum absorption coefficient of 2.8 \u00d7 10\u22129 cm\u22121 is acquired in a single scan [Exhaled breath gas analysis has a long history and is useful for medical diagnostic and health state monitoring. It has been well known since thousands of years that the exhaled breath of people suffering from certain diseases has a particular smell. In recent years, breath gas analysis combined with some new approaches have been established for scientific studies owing to its noninvasive features, simple sample preparation and harmless nature. More than 1000 different molecules have been demonstrated in human breath gas by a large number of studies . For modfluoride . Further3) is a familiar gas in exhaled human breath, and its concentration for a healthy human is regularly in the 0\u20132.0 ppm range. Excess concentration of ammonia is observed in the breath gas of patients suffering from Helicobacter pylori infections [3 in exhaled breath by Lachish et al. [3 at 10.74 \u00b5m (930.76 cm\u22121). The length of the sample cell is 50 cm, a detection limit of 1 ppm was achieved in an integration time of about 10 s and thus near real-time measurement was achieved. With the development of mid-infrared radiation laser sources, such as the quantum cascade laser (QCL), Manne et al. [3 in exhaled human breath based on the cavity ring-down spectroscopy (CRDS) technique. A thermo-electrically cooled DFB-QCL emitting at 10.3 \u00b5m (970.8 cm\u22121) was applied as the light source, and the system achieved a minimum detection sensitivity of 50 ppb for NH3 in a single scan within 20 s. The CEAS using the optical frequency comb (OFC) as a light source was established by the Ye group to achieve the measurements of multiple components simultaneously [\u22121) was applied, and they achieved a detection limit of 18 ppb for NH3 in human breath, where a standard sample with 4.4 ppm NH3 in N2 was used as a reference to eliminate the interferences of water vapor and carbon dioxide.Ammonia  and I(\u03bb) are the intensities of incident radiation and emergent radiation, respectively, and L is the optical path in the absorption sample. In this formula, \u03b1 can be described as:N is the concentration of absorption gas molecules, \u03c3(\u03bb) and iS represent the absorption cross-section and the line strength of the gas molecule, and g(\u03bb \u2212 \u03bb0) is the normalized line profile.The fundamental theory dominating absorption spectroscopy is the Beer\u2013Lambert law. The attenuation of optical radiation at wavelength 3 in exhaled human breath, which is accomplished by a fibered optical feedback cavity enhanced near-infrared absorption spectrometer. In the very beginning, this technique was introduced by Morville et al. in 2005 [3 in breath gas is achieved at low sample pressure in a single scan within 5 s, and the attainable spectral resolution of this instrument can be better than 0.002 cm\u22121.CEAS is now regarded as one of the most promising techniques for real-time trace gas detection, with a high finesse cavity as the sample cell, CEAS can reach a 100\u201310000 times effective absorption path, yielding an enhancement of the detection sensitivity. In this paper, we report on the measurement of NH in 2005 , with ro in 2005 , which i\u22124 cm\u22121 [\u22129 cm\u22121 [The detection limit of ordinary spectrophotometry is about 10\u22124 cm\u22121 , while t[\u22129 cm\u22121 . CEAS ha[\u22129 cm\u22121 . As an i[\u22129 cm\u22121 . Acting [\u22129 cm\u22121 . The las00 cavity mode to be measured, and obtain a better S/N ratio compared with conventional CEAS system. The sensitivity is improved by orders of magnitude. The OF-CEAS absorption spectrum is obtained within a limited spectral range by scanning the laser emission over hundreds of sequential cavity modes continuously, the recorded mode intensity (I) and the corresponding mode intensity without absorption (I0) are used to calculate the absorption coefficient \u03b1. Assuming that absorption of sample gas in a single pass is small compared to mirror losses [R) is determined by the cavity decay of \u201cempty cavity\u201d.In general, OF-CEAS permits the peak value of TEMr losses , the OF-R).For some typical CEAS systems, the spectral resolution is usually limited by the FSR of the optical cavity when the laser frequency is jumping from one resonance to the next. In our experimental system, one of the end-mirrors (M2) has a specially designed structure, the piezoelectric ceramic transducer (PZT) mounted on M2  and a temperature controller  are used to regulate the injection current and temperature of this laser diode, respectively. During a single laser scan, the operation temperature is constant, and a voltage ramp generated by a Dynamic Signal Acquisition and Generation device  is fed to the current deriver to achieve an accurate laser frequency scanning. The pigtail output from DFB laser diode is coupled into a single-mode polarization-maintaining (PM) fiber, followed by an optical switch which allows instantaneous switching off of the laser (10 ns). Then, the output of the optical switch is connected with the port1 of a PM fiber coupler , the port2 and port3 of this fiber coupler are connected to a fiber collimator and a photo-detector , respectively. The collimated light from the fiber collimator is then injected into the V-shaped cavity at the incident mirror (M0). It should be noted that several PM fiber couplers with splitting ratio between 50:50 and 99:1 are prepared to adjust the OF ratio owing to the easy replacement.\u22128/\u00b0C), and the cavity mirrors are fabricated with fused quartz (whose diameter is 25 mm). Among them, M0 is a plane mirror, M1 and M2 are spherical mirrors with 2 m radius, and M2 is mounted on a PZT to modulate the cavity length in a small region. The ultra-low loss coating (R \u2248 99.99% at 1530 \u00b1 30 nm) lies in the central area (diameter is 10 mm) of the cavity mirrors. Two right-angle prisms with a sharp angle of 27\u00b0 are optically glued on the backsides of M0 and M1, so that the etalon effect is eliminated. The cavity\u2019s main body and three mirrors constitute an optical cavity length (L1 + L2) of 500 mm, and this V-shaped cavity can obtain the resonant optical feedback while avoiding the directly reflected beam of M0.In this experimental setup, the optical resonator is a typical V-shaped structure with two equal arms (250 mm) forming a folded angle of 7.4\u00b0. Glass-ceramic is applied as the cavity body for its ultralow expansion coefficient (~10\u22121 (300 MHz) for this 50 cm long cavity. We enhance the spectral resolution by using simultaneous laser frequency tuning and cavity dither. Cavity mirror M2 has a novel geometry structure, and it is mounted on PZT1 to achieve precise cavity length modulation. In addition, the accurate wavenumber corresponding to the stepping injection current is calibrated in advance with a high precision wavemeter . In order to record the value of peak transmission of successive TEM00 cavity modes during a laser scanning, the optical path DFB-M1 should be arranged with a multiple of the cavity length (L1 + L2) based on the theoretical analysis [For our experimental setup, the maximum available spectral resolution is determined by FSR of the optical cavity if the cavity length is static, corresponding to a spectral resolution of 0.01 cmanalysis , which iThe optical intensity signal transmitted by M1 is detected with a photodiode (PD1) with a high S/N ratio, and another photodiode (PD2) recording the incident laser intensity is used to normalize the absorption spectra. All these components mentioned above are placed on a vibration isolated optical bench. For automatic operation, an analogic feedback circuit for PZT2 regulation is utilized, which apply the characteristics of the cavity mode profile as presented in transmitted optical intensity signal during a laser scan to generate a real-time error signal . The 24-3. Measurements are performed with the sample gas flowing through the internal space of the V-shaped cavity continuously, where a pressure gauge is used to measure the pressure, and the flux is regulated to constant 0.1 L/min. A dry pump is used to control the pressure of internal space owing to the need of low sample gas pressure, for it is necessary to enhance the separation of absorption lines especially when multiple interference gases appear in exhaled human breath gas.The sample preparation for this setup is quite simple. All samples are exhaled into a 10 L Tedlar bag through a disposable mouthpiece and a Midisart-2000 air filter , which removes the air particulates and offers the ability of online sterilization. An ultra-high purity in-line gas filter is applied between the Tedlar bag and the cavity to prevent the organic macromolecules, which gives 3-nanometer particle filtering capability and high flow efficiency with minimum pressure drop. This V-cavity is fabricated to offer a small sample cell, and the internal volume in the cell is about 35 cm0) of the empty cavity is necessary before computing the absorption coefficient spectra of the sample gas. In this experimental setup, an efficient exponential decay cannot be obtained by shutting down the laser current driver due to its limited bandwidth (250 kHz). This procedure is accomplished by using a square pulse to make the driver of optical switch interrupt the laser instantaneously (10 ns). The laser is instantaneously switched off and the resonance light decays exponentially. The fast ring-down decay is recorded by a high sampling rate digitizer , and ring-down time was calculated by an exponential fit, as shown in Measurement of the ring-down time . When the absorption loss of single-pass is small enough (\u03b1L << 1), the equivalent reflectivity (R) can be determined with the empty cavity ring-down time (\u03c40):0 represents the speed of light in vacuum.At 1531.6 nm the ring-down time was measured as 3 in N2 at a total pressure of 0.1 atm and a temperature of 296 K is performed. This spectrum spans from 6528.91 cm\u22121 to 6530.66 cm\u22121, corresponding to a laser-current regulation from 40 to 120 mA at a working temperature of 27 \u2103. During the measurement, the voltage signal generation, synchronous light intensity signal acquisition and transmission peak seeking for all frequency points in a single scan are controlled by a self-compiled Labview program. The cavity transmission values are transformed to absorption coefficient simultaneously using Equation 3 with (1-R) value determined from the ring-down time.Ammonia has several absorption lines around 1531.6 nm. Before the measurement of exhaled human breath gas, the absorption spectrum of 10 ppm of NH3, H2O and CO2 at the temperature of 296 K and a total pressure of 1.0 atm and 0.1 atm, respectively. Absorption cross-section \u03c3 is simulated from the parameters given in the HITRAN database taking into account pressure and temperature [3 are not easily identified at a total pressure of 1.0 atm, owing to the overlap of the neighboring absorption lines of ammonia itself, carbon dioxide and water vapor. By reducing the total pressure of sample gas, the linewidth of each absorption line turns to be narrower, and the interference caused by adjacent absorption lines is approximately eliminated. As shown in \u22121 (cross-section \u03c3peak = 5.3944 \u00d7 10\u221220 cm2) is the optimal option for NH3 detection in this region. The absorption coefficient spectra of 10 ppm of NH3 in N2 computed from HITRAN 2012 data [perature . As Figu3 in N2 at a total pressure of 0.1 atm in a single scan against the simulations from HITRAN 2012 database. A good overall agreement is obtained in this spectral region, and the difference between HITRAN simulation and the measured spectrum is shown in the bottom residuals in \u03b1min = 1.6 \u00d7 10\u22129 cm\u22121 is given by the standard deviation of residuals for the measured cavity ring-down time of \u03c40 = 7.75 \u00b5s. Aimed at the absorption line centered at 6528.77 cm\u22121 which has a cross-section \u03c3peak = 5.3944 \u00d7 10\u221220 cm2 at 296 K, using the relation \u03b1min = nmin\u03c3peak, this \u03b1min yields a detection limit of 12 ppb for NH3 at a total pressure of 0.1 atm and the temperature of 296 K. Noted that this \u03b1min corresponds to a better detection limit of 6.8 ppb for NH3 at a total pressure of 1.0 atm, however, low sample pressure is necessary to eliminate the interference of other components for exhaled human breath gas analysis.Helicobacter pylori infection. The samples of each subject were exhaled into a 10 L Tedlar bag through a disposable mouthpiece, and then the sample was regulated to flow through the V-shaped cavity at a flow rate of 0.1 L/min. The internal pressure is fixed to 0.1 atm by two pressure regulators, which are placed at the input and output of the cavity, respectively. The absorption spectra shown in 3 absorption line at 6528.77 cm\u22121 is sufficiently isolated from H2O and CO2 lines, which are the major interferences in exhaled human breath gas (about 4% CO2 and 3% H2O). The Voigt profile is applied to the fitting of each experimental absorption line, during the fitting process, all parameters of the Voigt profile are floated except the Doppler width, which is a fixed value for the gas with a specific temperature.Finally, we demonstrate two spectra of exhaled human breath gas samples in Helicobacter pylori infection. For every subject, samples are acquired repeatedly to be measured. Results show that the concentration of ammonia in breath gas of healthy adult is in the range of 300\u2013600 ppb, and 2.5\u20135 ppm for patients suffering from Helicobacter pylori. It should be noted that the concentration of NH3 is relevant to gender, age, lung capacity, diet habits and sampling time of day. Two representative subjects are illustrated in 3 measurement in exhaled human breath. In Helicobacter pylori compared to healthy subjects. A good reproducibility of the measurements is given, and a stability of \u00b1 1.2% for long-term measurements of NH3 in exhaled human breath is obtained. In addition, the concentrations of H2O and CO2 can also be calculated in this spectral region, and the concentrations of H2O and CO2 are 2.80%, 2.91% and 3.11%, 2.98% for subject-A and subject-B, respectively. The minimum detectable absorption coefficient of \u03b1min = 2.3 \u00d7 10\u22129 cm\u22121 corresponds to a detection limit of 17 ppb for NH3 at a total pressure of 0.1 atm at the temperature of 296 K. The higher sensitivity of this OF-CEAS instrument is achieved by the consistency of multiple measurements, after fitting the repeated absorption coefficient spectra, a better minimum detectable absorption coefficient of \u03b1min = 6.0 \u00d7 10\u221210 cm\u22121 is acquired for an average of 16 scans, corresponding to a minimum detectable concentration of 4.5 ppb for NH3 in exhaled human breath gas. In addition, the spectra presented in \u22121.In the measurements of ammonia in exhaled human breath, eight subjects are invited, including six healthy adults and two patients suffering from 3 in exhaled human breath. A fibered DFB laser diode is used as light source, the single-mode PM fiber is applied between DFB and cavity for light transmission. We found that this OF scheme requires only a few optical components, and is much more compact, robust and simple with respect to active electronic frequency locking  technique), this structure is better adapted for in-situ measurement. An optical switch allows instantaneous switching off of the laser (10 ns); thus the normalization of transmission intensity signals is accomplished continuously using the optical cavity loss determined by CRDS before each laser scan.We have presented a novel near-infrared OF-CEAS scheme with a V-shaped cavity which enables high sensitivity and enhanced spectral resolution measurement for NH\u03b1min = 2.3 \u00d7 10\u22129 cm\u22121 for a single scan within 5 s, corresponding to a detection limit of 17 ppb for NH3 at a total pressure of 0.1 atm and the temperature of 296 K. This steady experimental setup allows the detection limit down to 4.5 ppb for an average of 16 scans. Reducing the sample pressure is applied to narrow the absorption lines, better separation of NH3 to H2O and CO2 is achieved. Compared with other gas sensors, this OF-CEAS device achieves direct and selective measurement of an NH3 absorption line with high sensitivity and better spectral resolution, and the interference of neighboring lines is approximately eliminated. With dense frequency points to define the line profile, the calculated concentration is much more accurate. Some comparative tests show that the excess concentration of ammonia is always discovered in breath gas of patients suffering from Helicobacter pylori infection compared to healthy subjects. This work demonstrates the ability of our OF-CEAS to real-time breath gas analysis.In the measurements of exhaled human breath, the 1\u03c3 standard deviation of the residuals yields a minimum detectable absorption coefficient of 3 absorption line is one to two orders of magnitude weaker than the strongest line in the mid-infrared range. However, in the near-infrared spectral region, the DFB diode lasers and photodetectors are commercially available owing to the development of telecommunications. Besides, these devices also perform higher capability at room temperature compared with the devices working in the middle-infrared region. Therefore, this near-infrared setup is suitable for high sensitivity and relatively affordable sensors for clinical applications.In general, this sensor presents high sensitivity and accurate discrimination during the detection of gas molecules. Owing to the easy replacement of fibered DFB laser diode, this setup can also be used for the measurement of other gas species by targeting the corresponding absorption lines. It should be noted that the line strength of the measured NH"}
+{"text": "The effective optical path reached to 4.5\u2009km within 35\u2009cm length cavity. Besides, through modulating the cavity length five times automatically, the spectral resolution was improved to 0.0015\u2009cm\u22121 from 0.0071\u2009cm\u22121. Targeting the R(6) line of CO first overtone band at 4285.01\u2009cm\u22121, which is interference free from absorption spectra of SF6 mixtures , the minimum detection limit and detection precision under different gas pressures were performed. At optimum integration time of 30\u2009s determined by Allan deviation analysis and gas pressure of 40 torr, the minimum detection limit and detection precision of CO were better than 18\u2009ppb and 150\u2009ppt, respectively.A ppb-level CO sensor based on multi-comb optical-feedback cavity enhanced absorption spectroscopy with a 2.3\u2009\u03bcm diode laser was developed for SF When insulation faults occur in these gas insulated electrical equipment, such as overheating and partial discharge, the SF6 will decompose and react with C, H and O atom generated from organics or the impurities  in SF6, to form various fault characteristic gases , which can be used as an indicator to identify fault types of gas insulated electrical equipment2.Sulfur hexafluoride  The emission wavelength of diode laser, is tuned over the characteristic absorption lines of a target gas; (b) Then, the gas concentration can be determined through the reduction of the measured signal intensity caused by gas absorption11. In 2007, F. Wang et al.12 developed a TDLAS based sensor for CO detection in CO2 by used of a diode laser operating at 1.58\u2009\u03bcm, which resulted in a minimum detection limit of 200\u2009ppm. In 2009, X. Chao et al.13, used the TDLAS technique and a 2.3\u2009\u03bcm distributed feedback (DFB) diode laser to monitor CO in N2, CO2 and H2O with a minimum detection limit of ~3\u2009ppm. In 2017, J. Dang et al.14 combined TDLAS with techniques of wavelength modulation spectroscopy and multipass gas cell, and adopted a high-power, continuous wave (CW) DFB QCL emitting at 4.7\u2009\u03bcm to detect CO in N2, a minimum detection limit of 26\u2009ppb was achieved. What is more, R. Ghorbani et al.15 presented a compact sensor for CO isotopes in air and exhaled breath based on a 4\u2009m circular multiple gas cell with an interband cascade laser operating at 4.69\u2009\u00b5m, which resulted in a minimum detection limit of 9\u2009ppb. Although a ppb-level CO sensor was easily achieved by combined the TDLAS technique with a mid-IR laser targeting the strongest fundamental ro-vibrational transitions of CO, these CO sensors were developed to operate in an air or exhaled gases environment and may not adapt to detect trace CO in various fault characteristic gas mixtures because the cross interference from absorption of SF6, SO2, H2S, SO2F2, HF, CF4, CO2, COS, O2 and H2O (SF6 mixtures) cannot be ignored. In 2018, R. Cui et al.16 had proven TDLAS CO sensor in mid-IR region is unsuitable for SF6 decomposition analysis since SF6 in high concentration levels  has abundant absorption spectra in infrared area and will strongly interfere the fundamental ro-vibrational band of CO. Based on the test of pure SF6 (99.99%) by Fourier Transform Infrared (FTIR) spectrometer and simulation of SO2, H2S, SO2F2, HF, CF4, CO2, COS, O2 and H2O based on HITRAN database, R(6) transitions located at 4285.01\u2009cm\u22121 in the first overtone band of CO was selected as the target detection absorption line, which is interference free from absorption spectra of SF6 mixtures. Combined with 2\u2009f wavelength modulation spectroscopy and TDLAS technique, the minimum detection limit of CO sensor developed by R. Cui reached 1\u2009ppm. However, this value is not meet the detection limit required by the standards6.Recently, trace gas sensors based on tunable diode laser absorption spectroscopy (TDLAS) are widely used due to their high detection sensitivity and selectivity as well as fast response time, which permits online monitoring of target gas concentrations19. Combined with lasers in mid-IR or single mode laser diodes in near-IR region, the minimum detection limit of optical feedback cavity enhanced absorption spectroscopy can easily reach ppt or ppb, respectively. Besides, many researchers have been demonstrated that a compact, stable and robust spectrometer based on optical feedback cavity enhanced absorption spectroscopy is ideally suited for field measurements23.Optical feedback cavity enhanced technique not only can increase the coupling efficiency of the laser radiation into the gas cell but also can improve effective optical path length between laser and gas sample6 decomposition detection. A piezoactuator attached to the rear of an end mirror of V-shaped cavity is constructed to allow the cavity length to be carefully modulated and change the position of the comb of build-up modes, thus, more data points per frequency unit and a high lineshape precision are achieved. This optical sensor system realizes highly sensitive and precise analysis of SF6 decomposition component CO in SF6, SO2, H2S, SO2F2, HF, CF4, CO2, COS, O2 and H2O at the target absorption line of 4285.01\u2009cm\u22121.In this paper, to our best knowledge, we first describe CO sensor system based on TDLAS and optical feedback V-shaped cavity enhanced technique with a CW diode laser at 2.3\u2009\u03bcm for SF\u22121, a CW monomode DFB laser diode at 2334\u2009nm from Nanosystems and Technologies GmbH is employed as the light source, which is regulated by a temperature controller (TCU151) and home-made current controller. At a typical temperature of 30\u2009\u00b0C and 85\u2009mA current, the diode laser provides 12\u2009mW laser radiation with a temperature and current tuning coefficients of \u22120.412\u2009cm\u22121/\u00b0C and \u22120.051\u2009cm\u22121/mA, respectively.An experimental scheme of multi-comb optical feedback V-shaped cavity enhanced absorption spectroscopy is depicted in Fig.\u00a03, acting as a beam splitter is placed before the optical cavity to monitor the post-cavity signal, Vin, for calibrating power loss resulted from gas absorption, using InGaAs detector A . Another part of laser will transmit through an anti-reflection coated ZnSe window (Crystran) of sample chamber made of stainless steel and comes into a 30\u00b0\u2009V-shaped optical cavity consists of a planar folding mirror (at the center), M4, and two spherical concave mirrors (at the ends), M5 and M6 (radius of curvature 1\u2009m), which are dielectrically coated CaF2 with a reflectivity of 99.99% on the front face (Lohnstar Optics). The laser will reflect back and forth multiple times in the V-shaped cavity, the arm length of which is 35\u2009cm long, giving 70\u2009cm unfolded cavity length. The spectral resolution is equal to 1/2 (L1\u2009+\u2009L2)\u2009\u2248\u20090.0071\u2009cm\u22121 without adjustment of cavity length. The V-shape has the same effect with a Faraday isolator which ensures that the direct back reflection from M4 does not return to the laser and causes wrong frequency locking, but it is more simple and take use of laser power when compared to isolator17. The diode laser beam decaying from M6 will be simultaneously monitored by InGaAs detector B, getting cavity output power, Vout, to give the true value of gas absorption with the help of Vin. A piezoactuator  integrated into M2 mount provided precisely adjustment of the laser-to-cavity distance to equal to V-shaped cavity arm length, L1\u2009+\u2009L2, which ensures phase matching that all cavity resonant frequencies, upon excitation, return to the laser with the same phase. When phase matching, a relatively large amount of radiation circulated in the cavity returns to the laser, locking the output of the laser to the frequency of the cavity mode and therefore also increase the coupling efficiency of the radiation into the cavity. When out of resonance, destructive interference occurs within the cavity and no light returns to the laser, so the laser scans normally at its free running wavelength. Phase matching of the fed-back light to the laser is accomplished by a home-written LabVIEW electronic circuit, which provides an error signal through a data acquisition card  to control PZT. In perfect phase matching, the periodic tuning of the diode current will result in a symmetrical signal (ratio of Vout and Vin). By differentiating and integrating ratio of Vout and Vin, a signed error signal generated from an asymmetric signal and will be fed to the PZT A until the error signal becomes near zero.A wedged ZnSe Mirror, MThe PZT B is a new design in this sensor system which allows to modulate the length of the cavity. This modulation will change the frequencies of the modes formed in resonance with the cavity and therefore cause a controlled shift in the observed frequency comb, therefore more points across the width of an absorption shape will be recorded. Then, a more precise spectral line fitting and concentrations measurement will be obtained.6 (99.99%) and 50\u2009ppm CO, SO2, H2S, SO2F2, HF, CF4, CO2, COS, and O2 (99.99%) are from National Standards Material Center. A valve is placed between the automatic gas distribution system and enhanced cavity to adjust gas flow, while the pressure meter is linked to the enhanced cavity to control the test gas pressure.The automatic gas distribution system from Environics can provide 12 kinds of mixed gases at different concentrations levels. The standard concentration gas of pure SFBy running the home-written LabVIEW electronic circuit of frequency locking with setting the temperature of laser at 31.3\u2009\u00b0C and tuning the applied laser current with a sawtooth signal at 20\u2009Hz, the output frequency of laser will scan or lock in the resonance frequency of the enhanced cavity when phase matching happens, as shown in Fig.\u00a0\u03c40, . The time between modes was 1250\u2009\u00b5s, which can be seen clearly in Fig.\u00a0Over 50\u2009ms, the laser locked to 29 successive cavity modes with a locking time of 510\u2009\u00b5s estimated by the full width at half maximum (FWHM) of mode, much longer than the ring-down time, In Fig.\u00a0\u22121, as determined from lnR\u2009=\u2009\u2212(L1\u2009+\u2009L2)/(2c\u03c40). For a V-shaped cavity, this reflectivity implies the cavity finesse, F, (=\u03c0R/(1\u2009\u2212\u2009R2) equal to 7074, which corresponds to 4504 (=2\u2009F/\u03c0) passes for the average photon of laser in the cavity. Hence an effective optical path length of 4.5\u2009km is obtained in our V-shaped cavity of only 35\u2009cm length18.The effective reflectivity, R, of the sensor is approximately 99.98% at 4285.01\u2009cm\u22121, which is interference free from absorption spectra of SF6 mixtures, and to achieve the maximum possible sensitivity with high precision for trace CO in SF6 mixtures, a spectral search between 4281.64\u2009cm\u22121 to 4289.86\u2009cm\u22121 is undertaken by adjusting the temperature of laser, tuning the applied laser current and comparing their relative intensity of absorption line with the value from HITRAN database.50\u2009ppm CO is injected into the cell to 40 torr through a pneumatic valve near the optical input  and can exit through another such valve near the optical output (ends mirror) if necessary. To find the target transition of R(6) at 4285.01\u2009cm2, SO2, H2S, SO2F2, HF, CF4, CO2, COS in SF6 and H2O at 40 torr can be obtained as presented in Fig.\u00a0\u22121. A low number of points across a molecular absorption feature may lead to difficulties in precisely fitting a line-shape profile, which has consequences for precisely determining the concentration. In Fig.\u00a0\u22121, and will lead to more precisely line-shape profile fitting.The absorption spectrum of 200\u2009ppb CO, O18 is performed for more than 10,000 consecutive spectra by automatically running LabVIEW electronic circuit. Allan variance log-log plot for this sensor system is shown in Fig.\u00a0\u22121/2 slope, as expected from white noise (dashed line). For more average times, the Allan standard deviation starts to increase as a result of system drifts.To decide the optimum time of integration spectral data, Allan variance analysis6 mixtures. The spectrum of 20\u2009ppb CO can be clearly seen. According to the 3s rule (s is noise standard deviation of absorption spectrum baseline fitting), the minimum detection limit of multi-comb optical-feedback cavity enhanced absorption spectroscopy sensor for CO in SF6 mixtures at 40 torr reaches to 18\u2009ppb.Figure\u00a0FA is fitting area of absorption spectra of CO, CCO is concentration of CO. R-square value is 0.994, which confirms the excellent linearity of the sensor response to CO concentrations.To achieve quantitative analysis of CO samples, a linear relationship between fitting area of absorption of CO and its concentrations is developed based on the least squares method as shown in Fig.\u00a06 mixtures are carried out for 5000\u2009mins, which includes 10000 concentration points. In Fig.\u00a0To further examine the stability and precision of this CO sensor system, time series measurements of 200\u2009ppb CO in SF6 mixtures at different gas pressures are obtained as shown in Fig.\u00a0\u22121 for CO meets an enhancement along with the increment of gas pressure until 100 torr while FWHM of absorption spectra increases with the increment of gas pressure. The minimum detection limit of CO according to the standard deviation of noise and the detection precision according to time series measurements at different pressures are summarized as in Table\u00a0In order to obtain the effect of gas pressure on CO minimum detection limit and detection precision, the absorption spectra of 200\u2009ppb CO in SF6 is for insulation. The more SF6 has been taken for measurement, the worse of insulation ability, the more insulation faults happen.Thus, when measuring gas CO on line, if the minimum detection limit can fulfill operational requirements, there are numerous advantages of working at lower pressure where the line broadening is dominated by the Doppler effect and the width of absorption lines are much narrower. In this case, there is less overlapping of spectral features upon an absorption-free baseline, allowing a more precise spectral line fitting and more precise detection which is very important in industrial measurement. Besides, less gas sample is taken from gas insulated electrical equipment for measuring is better because the key role of SF6 decomposition components including SO2, H2S, SO2F2, HF, CF4, CO2 and COS when tuning the same laser through an absorption line of target gas or changing an another DFB laser.What is more, the optical sensor can be expanded to detect other SF6 mixtures . Through cavity down time measurement, the effective optical path of 35\u2009cm length V-shaped cavity reached to 4.5\u2009km. A piezoactuator attached to the rear of an end mirror of the V-shaped cavity was constructed to allow the cavity length to be carefully modulated and change the position of the comb of modes. Through modulating the cavity length five times automatically by self-written LabVIEW electronic circuit, the spectral resolution was improved to 0.0015\u2009cm\u22121 from 0.0071\u2009cm\u22121. Based on Allan deviation analysis, optimum integration time was determined as 30\u2009s with spectrum sans of 120 times, the minimum detection limit and detection precision of CO targeting the R(6) line at 4285.01\u2009cm\u22121 was better than 18\u2009ppb and 150\u2009ppt (40 torr), respectively. Further experiments at measurement of CO at different gas pressures showed that the minimum detection limit goes up nonlinearly with the increment of gas pressure while detection precision suffers a small reduce with the enhancement of gas pressure. When measuring gas CO in SF6 mixtures, the minimum detection limit, detection precision and volume of gas samples should be compromised. In the near future, deployment of this sensor system in gas insulated electrical equipment to further evaluate its performance for on-line monitoring will be conducted.In this work, we first describe a sensor system based on multi-comb optical-feedback V-shaped cavity enhanced absorption spectroscopy with a near-IR CW diode laser at 2.3\u2009\u03bcm for CO detection in SF"}
+{"text": "A Fabry\u2013Perot (F\u2013P) cavity with an effective optical path length of 49.7 m was sealed and employed as a gas absorption cell. Co-axis cavity alignment geometry was adopted to acquire a larger transmitted light intensity and a higher sensitivity compared with off-axis geometry. The laser frequency was locked to the cavity fundamental mode (TEM00 mode) by using the Pound\u2013Drever\u2013Hall (PDH) technique continuously. By introducing a cavity length-locking loop, the drift of the cavity length was suppressed, and the stability of the system was enhanced. To demonstrate the efficacy of the system, a C2H2 absorption spectrum near 6534.36 cm\u22121 was acquired by tuning the laser operation temperature. Measurements of C2H2 samples with different concentrations were carried out, and a good linear relationship between C2H2 concentration and the cavity-transmitted signal voltage was observed. The measurement results showed the system could work stably for more than 2 h without major fluctuations. The Allan variance analysis results demonstrated a detection limit of 9 parts-per-billion (ppb) with an averaging time of 11 s corresponding to a minimum detectable absorption coefficient of 1.1 \u00d7 10\u22128 cm\u22121.A trace acetylene (C The detection of trace C2H2 has attracted much attention due to its inflammable and explosive characteristics [2H2 is a kind of indicating gas dissolved in transformer oil. The monitoring of C2H2 concentration is of great significance for working state and performance evaluation of the transformer [2H2, resonant cavity-based infrared laser absorption spectroscopy techniques have attracted a lot of interest with the advantages of high detection sensitivity, fast response, and small sample volume. Techniques such as cavity ringdown spectroscopy (CRDS) [Acetylene  ,7,8 and y (CRDS) ,10 make CRDS was proposed by Deacon and O\u2019Keefe in 1988 . In CRDS2H2 measurement. A continuous-wave distributed feedback (DFB) laser centered at 1530.72 nm was locked to the cavity fundamental mode (TEM00 mode) by the Pound\u2013Drever\u2013Hall (PDH) scheme [2H2 is reported. Then, the structure of the system and the design of key modules are introduced. Finally, gas detection experiments and the performance of the system are described.In this paper, a mode-locking CEAS-based system was presented for trace C) scheme  at all t2H2 molecule exhibits an overtone rotational\u2013vibrational combination band (v1+v3 band) around 6550 cm\u22121 as shown in \u22121 (corresponding to 1530.37 nm) was selected as the probe line to detect C2H2 in this system because of its relatively strong absorption intensity (S = 1.2 \u00d7 10\u221220 cm/molecule). Furthermore, the silica fiber has a lower transmission loss in this wavelength, which is suitable for the long-distance transmission of the laser and remote monitoring.The C2H2 (1 ppm) and air was simulated on the basis of data in the high-resolution transmission molecular absorption database 2012 (HITRAN 2012) [2O is shown in \u22121 was in 10\u22124 level, which would influence the selectivity of the system. In order to eliminate this interference, a gas purifier  was installed before the cavity inlet, able to dry gases to a dryness of 0.005 mg/l, under a flow rate of up to 300 L per hour. The absorbance of other gases present in the air had minimal interference in trace C2H2 detection, as shown in In order to avoid the interference caused by other major gases that exist in the air, the absorbance of the mixed gas of CAN 2012) . The sim2H2 sensor system is shown in The structure of the cavity-enhanced C\u22121 (1530.72 nm) at an operating temperature of 29 \u00b0C and a driving current of 100 mA, which was equal to the peak wavenumber of the selected probe absorption line. The laser is suitable for frequency modulation and locking with a high side-mode suppression ratio and a small linewidth (the linewidth at \u22123 dB is better than 1 MHz). A fiber isolator  was coupled to the laser output polarization-maintaining fiber to attenuate the optical feedback. The isolation of the isolator was 29 dB at a wavelength of ~1.53 \u03bcm according to the datasheet provided by the manufacturer. The output fiber of the isolator was coupled to a fiber collimator to convert the fiber-transmitted light into spatially transmitted light and narrow the light beam. The infrared beam passed through a polarizer and was guided into an electro-optic modulator (EOM) for laser frequency modulation. Then, the modulated light was directed to the self-developed cavity after passing through two mode-matching lenses (L5 and L6) and two three-dimensionally adjustable mirrors (M1 and M2). The cavity-transmitted light was focused onto an In-Ga-As detector  by a parabolic mirror (M3), and the cavity-reflected light was directed to another photodetector  for laser-cavity frequency locking.(i) Optical module. A DFB laser produced by JDS Uniphase, model number CQF935/908-19570, was used as the optical source. The emission peak wavenumber of the laser is 6534.36 cm(ii) Electrical module. The electrical part of the system included a commercial laser driver , a three-channel piezoelectric transducer (PZT) controller , and a dual-feedback PDH locking loop. An EOM driver  was used for laser frequency modulation with a modulation frequency of 25 MHz. The cavity-reflected signal from PD2 was mixed with the local oscillator signal in the EOM driver and then filtered to produce the error signal. The error signal was processed by a proportional\u2013integral\u2013derivative (PID) controller 1  to generate a laser current feedback signal. Another PID controller was used in the cavity length-locking loop. A detailed description of the dual-feedback loop is presented in 2H2 absorption line.The wavelength tuning characteristics of the DFB laser versus the driving current and the operation temperature were measured by a wavelength meter as shown in 1r and 2r are the ROC (radii of curvature) of the cavity mirrors, d is the cavity length. In this system, the two cavity mirrors (EKSMA optics) with a same ROC of 100 mm and a calibrated reflectivity of 99.4% at 1.54 \u03bcm were spaced by a 15 cm distance. The specifications of the designed cavity were calculated as shown in The stability condition of the cavity resonant field and the laser cavity mode matching are two main factors that need to be considered in the light path design . For a lThe mode-matching system was designed to match the spatial distribution of the light beam to the mode distribution of the cavity and obtain a stable and pure fundamental transverse mode in the cavity. In the system, the light passed through a fiber collimator to shape the beam profile and adjust the direction of the exit light. The divergence angle of the fiber collimator varied with the laser wavelength. When the incident laser wavelength was 1530.7 nm, the divergence angle was 0.1294\u00b0, and the beam waist radius of the collimated light was calculated to be 219 \u03bcm. A concave lens (L5) and a convex lens (L6) were added to the optical path to adjust the beam waist radius. The focal lengths of the two lenses and the lens spacing distances were calculated to generate the correct beam parameters and leave sufficient space for installing other optical components. Two three-dimensionally adjustable mirrors (M1 and M2) were used to adjust the direction and position of the incident laser.The dual-feedback locking loop was designed to consist of a PDH locking loop and a cavity length-locking loop, as shown in To observe the cavity resonance, a periodic sawtooth wave signal was applied to the PZT driver to sweep the cavity length. The measured cavity transmission signal and PDH error signal were captured by an oscilloscope , as shown in The optical cavity was used as the reference frequency standard in this system, and the stability of the cavity length determined the performance of the system. During the operation of the system, the cavity experienced a slow frequency drift on cavity length due to variations in the environment  . This drIn order to eliminate the offset of the error signal, a cavity length feedback locking loop was designed, as shown in 2H2 samples with different concentrations were generated by a gas dilution system , which could produce gas concentrations from percent to ppb levels for single- or multi-point calibration with an accuracy of \u00b11.0%. All experiments were performed at night to make sure the vibration and acoustic noise levels in the lab were at a minimum.In order to achieve the environmental stabilization of the system, some measures were taken to reduce mechanical and acoustic vibrations, pressure variations, and temperature fluctuations. The experiment platform was established in a 23 \u00b0C thermostatically controlled laboratory. The optical components of the system were fixed to a pressurized air-floating optical table to reduce mechanical noise. The acoustic isolation was provided by a layer of fiberglass insulation wrapped around the cavity. The gas pressure inside the cavity was controlled to be 1 atm during the gas detection measurement by the pressure control module, which consisted of an air pump  and a pressure controller . C2H2 sample with a concentration of 10 ppm balanced with pure N2 was pumped into the cavity. The pressure and temperature of the gas were 700 Torr (0.92 atm) and 23 \u00b0C, respectively. In order to make sure the laser wavelength swept across the selected C2H2 absorption line near 6534.36 cm\u22121, the DFB laser current was set to 100 mA, corresponding to a laser power of 18 mW, and the laser operation temperature was modulated from 33.5 \u00b0C to 33.7 \u00b0C in steps of 0.012 \u00b0C, which resulted in the emission peak wavenumber changed from 6533.78 cm\u22121 to 6534.93 cm\u22121 in steps of 0.084 cm\u22121. The laser cavity frequency locking at each wavenumber included two steps. Firstly, the cavity length was adjusted by the PZT driver to make the laser frequency and the cavity resonant frequency roughly the same. Then, the laser frequency was locked to the cavity resonant frequency by a negative feedback current adjustment. The sampling rate of the system was set to 10 Hz, which resulted in 10 data points per second. The average cavity transmission signal voltage within 10 s of each wave number acquired is shown in \u22121, the absorption was in the strongest position, corresponding to an operation temperature of 29 \u00b0C.In the experiment, the C2H2 concentrations . At each concentration level, the voltage was recorded for 5 min. The relation between C2H2 concentration and averaged transmitted signal voltage was acquired as depicted in 2 = 0.997).The cavity-transmitted signal voltage was measured at different CThe linear fitting equation is:2. The measurement lasted for 2 h with a sampling rate of 10 Hz, providing 36000 sampling points, calculated as shown in In order to avoid errors caused by the gas distribution system, the stability of the system was investigated by a long-term measurement of pure N2H2 detection systems is shown in The comparison among this system and other reported C2H2 sensor system in the near-infrared region. An effective optical path length of 49.7 m was obtained by a 15 cm long cavity. We proposed a dual-feedback locking loop to realize laser frequency locking and cavity length locking simultaneously, which reduced the drift of the cavity length and enhanced measurement stability. A series of C2H2 detection experiments were carried out, and the results showed the system could work stably for more than 2 h without major fluctuations. The limit of detection of this system reached 137 ppb at an averaging time of 0.1 s, which could be further improved to 9 ppb by increasing the averaging time to 11 s.In conclusion, we have developed and characterized a frequency-locked CEAS technique-based C"}
+{"text": "TP53 mutation, MYD88 mutation, NOTCH1 mutation, SF3B1 mutation, CD38, ZAP\u201070, Binet staging, gender, and \u03b22\u2010microglobulin, were significantly different in distribution between group <98% and group \u226598%, but not among subgroups 98%\u201098.99%, 99%\u201099.99%, and 100%. In conclusion, 98% is the optimal cutoff of IGHV identity for the prognosis evaluation of Chinese CLL patients.Immunoglobulin heavy chain variable region (IGHV) mutational status has been an important prognostic factor for chronic lymphocytic leukemia (CLL) for decades. Patients with unmutated IGHV (\u226598% identity to the germline sequence) have inferior prognosis and tend to carry unfavorable genetic markers compared to those with mutated IGHV (<98% identity to the germline sequence). However, 98% as the cutoff for IGHV mutational status is a mathematical choice and remains controversial. We have previously reported distinct IGHV repertoire features between Chinese and western CLL populations. Here, we retrospectively studied 595 Chinese CLL patients to determine the best cutoff value for IGHV in Chinese CLL population. Using 1% as the interval for IGHV identity, we divided the studied cohort into seven subgroups from 95% to 100%. Briefer time to first treatment (TTFT) and overall survival (OS) were observed in cases with \u226598% compared to those with <98%, while the differences were obscure within subgroups \u226598%  and <98% . Multivariate analysis confirmed the independent prognostic value of 98% being the cutoff for IGHV identity in terms of both TTFT and OS. All the prognostic factors, including del(17p13), del(11q22.3),  In this article, we focused on whether 98% is the best cutoff value for IGHV in Chinese patients on a 595 CLL cohort with 600 sequences in total. We found that for the whole cohort, 98% showed to be the best cutoff value for IGHV, holding prognostic value for both time to first treatment (TTFT) and overall survival (OS) in univariate analysis and being an independent prognostic factor for TTFT and OS in multivariate analysis. At the same time, all the prognostic factors were also significantly different in distribution between group <98% and group \u226598%, while the distributions among subgroups \u226598% were not significantly different. We proved that 98% IGHV is an optimal choice to predict the prognosis of CLL patients in China at present. Then gDNA or cDNA was subjected to polymerase chain reaction (PCR) amplification following the IGH Somatic Hypermutation Assay v2.0 protocol (InVivoScribe) . The kit provides both leader primers and FR1 primers. The later was used in case of failed detection after using leader primers. In most cases, we used the leader primers to determine the IGHV somatic hypermutation status of clonotypic IGHV\u2010IGHD\u2010IGHJ gene rearrangements. IGHVSequences were aligned to ImMunoGeneTics/V\u2010QUEry and Standardization (IMGT/\u2010VQUEST) database and the IMGT/V\u2010QUEST tool (version 3.3.0). IGHV usages and rates of somatic hypermutation of productive rearrangements were recorded. Adjusted IGHV identity only happened when the option \u201csearch for insertions/deletions\u201d was shown.2.3TP53 (exon 4\u20109), NOTCH1 (PEST domain), SF3B1 (exon 14\u201016), and MYD88 (exon 3\u20105), as described previously.We performed interphase fluorescence in situ hybridization (FISH) of del(11q22.3), del17p13), del (13q14), and trisomy 12 and Sanger sequencings of p13, del 2.4The procedures of immunophenotyping of CD38 and ZAP70 by flow cytometry were described previously.2.5P\u2010values were two\u2010sided and P values\u00a0<\u00a00.05 were considered significant.OS was calculated from diagnosis to death or last follow\u2010up. TTFT was calculated as time between diagnosis and first treatment. Survival curve was generated via the method of Kaplan\u2010Meier. Log\u2010rank test was used for significant associations. Categorical variables were compared by Chi\u2010square test. Cox regression analysis was constructed to determine the hazard ratio (HR). Variables of significance in univariate analysis were included in multiple Cox proportional hazards model. Statistical analyses were performed by IBM SPSS Statistics 23 . Tables and figures were drawn by Microsoft office 2016 software and Graphpad Prism 7.0  software. 33.1The characteristics of 595 patients were summarized in Table After a median follow\u2010up of 45\u00a0months (range 1\u2010279\u00a0months), 359 (61.8%) patients were treated (median numbers of therapies: 2). Three hundred and four patients had unequivocal initial treatment information as follows: 115 (37.8%) patients received rituximab\u2010based therapy , 181 (59.5%) patients received chemotherapy alone, five (1.6%) patients received ibrutinib as single agent, and three (0.99%) patients received other therapies .3.2IGHV\u2010D\u2010J sequencing was conducted on all the 595 patients. A total of 600 sequences were obtained as five (0.8%) patients held double rearrangements Table . With th3.3P\u00a0=\u00a0.001) was significantly different in TTFT when compared with the <95% group (Table P\u00a0<\u00a0.001), while intervals less than 98% had no significant difference compared with the <95% group  cases were M, while 248 (41.3%) cases were UM if we used the classical 98% classification by ERIC. In order to determine the optimal cutoff value, we used 1% as the interval to divide the entire cohort into seven groups according to the mutational rate, which were <95%, 95%\u201095.99%, 96%\u201096.99%, 97%\u201097.99%, 98%\u201098.99%, 99%\u201099.99%, and 100%, respectively. First, we investigated the best cutoff value in Binet A patients (n\u00a0=\u00a0213\uff0cwith one patient lost to follow\u2010up). Cox regression analysis showed that only the 100% group (hazard ratio (HR): 2.46, It has been reported that up to 30% of CLL patients belong to B cell receptor\u00a0(BCR) stereotypy and with \u201csome\u201d subsets conferring specific clinical outcomes, especially those who belong to subset#2 characterized with IGHV3\u201021 usage and predominantly mutated IGHV status.3.4Although 98% was the appropriate cutoff for TTFT and OS in our study, we still wanted to know if there were a maldistribution of other prognostic factors in the M/UM groups and whether it was due to the increase of these poor prognostic factors that led to a gradual increase in the HR of OS among three intervals that are \u226598% .P\u00a0=\u00a0.009), with higher levels of \u03b22\u2010MG at diagnosis (P\u00a0<\u00a0.001) and in advanced Binet stages (P\u00a0<\u00a0.001). The distribution of TP53, NOTCH1, SF3B1, and MYD88 mutations was significantly different , so was the distribution of del(17p13), del(11q22.3), CD38+, and ZAP\u201070+ >3.5\u00a0mg/L), cytogenetic aberrations ), and immunophenotyping (CD38 positive and ZAP\u201070 positive) were prognostic factors for both TTFT and OS. Del(11q22.3) was the prognostic factor for TTFT.In univariate analyses,\u00a0we found out that clinical features  and advanced Binet stages ; P\u00a0<\u00a0.001; stage C: HR: 3.10; 95% CI: ; P\u00a0<\u00a0.001) were independently correlated with TTFT. UM\u2010IGHV ; P\u00a0=\u00a0.002), advanced Binet stages ; P\u00a0=\u00a0.003), the presence of TP53 mutations ; P\u00a0=\u00a0.029), del(17p13) ; P\u00a0=\u00a0.01), NOTCH1 mutations ; P\u00a0=\u00a0.017), and male ; P\u00a0=\u00a0.03) were independently correlated with OS . It should be noted that neither TP53 mutation nor del(17p13) was independent prognostic factors for TTFT in this cohort, probably due to their weak power as indications for treatment of CLL.Then we conducted Multivariate Cox regression analyses containing prognostic factors above. UM\u2010IGHV ; 4SF3B1 mutation.Initially, Damle et al and Hamblin et al chose 98% as the cutoff value mainly based on statistical results.There are differences in IGHV and BCR stereotypy usage between CLL patients from East Asia and those who come from western countries. IGHV1\u201069, IGHV3\u201007, IGHV3\u201023, and IGHV4\u201034 are the most frequently used genes in CLL patients from the West, while IGHV4\u201034, IGHV3\u201023, IGHV3\u201007, and IGHV4\u201039 are the most frequently used genes in patients from East Asia.In this study, we testified 98% is the optimal cutoff for IGHV in Chinese CLL patients for prognosis evaluation. At the same time, ERIC do also note that caution is warranted in borderline cases and that the clinical implications remain to be elucidated. Multivariate analysis showed that 98% cutoff value was an independent prognostic factor for TTFT and OS. All the prognostic factors involved in our study were significantly different in the two groups that were dichotomized at 98%, indicating high efficiency of 98% as a cutoff value for IGHV in assessing patients. We also found in the subgroups of \u226598%, the increased HR was consistent with an increased IGHV identity to germline sequence and not to other prognostic factors. However, the IGHV mutational status seemed to have limited effects on TTFT and OS in our Binet A cohort (accounting for 40% of the whole cohort), which may have resulted from the uneven distribution of numbers in each interval (the five groups of 95%\u201099% had no more than 20 cases in each group). A larger CLL cohort is needed to verify this result.Also, there were some limitations in our study. First of all, follow\u2010up time in our study was shorter compared with that in similar studies.In conclusion, we show that 98% cutoff value for IGHV is still the optimal choice for clinical applications. But nothing stays unchangeable. In the current \u201cnew agent\u201d era, targeted drugs, such as ibrutinib, idelalisib, and venetoclax (ABT\u2010199), have affirmative effects on UM patients.The authors declare that they have no conflict of interest to disclose.JYL, W.X, Y.X, JXF, LLW, and KHY designed the study. K.S, Q.S, C.Q, HYZ, L.W, JZW, and L.F collected and analyzed the data. Q.S and K.S wrote the draft of the paper and all authors contributed to the writing and approved the final version of the manuscript.\u00a0Click here for additional data file.\u00a0Click here for additional data file."}
+{"text": "This document describes how the Federation of European Laboratory Animal Science Associations (FELASA) accreditation addresses both the Directive 2010/63/EU and the related European Commission guidance document. FELASA accredits courses that fulfil the requirements of Functions A, B, C and D as defined by EU Directive, Article 23, as well as for designated veterinarians and specialists in laboratory animal science. Cohesive courses for Functions and for very specific topics are accredited, but flexibility and mobility are possible: a researcher can start his/her training with one FELASA accredited course and complete other modules with another. A course organizer will deliver a FELASA certificate relating to the successfully completed modules. The process consists of two major steps: (1) a review of full course documentation provided by the applicant will lead, if successful, to FELASA accreditation. The course is posted on the FELASA website as \u2018FELASA accredited\u2019 and the course provider can deliver FELASA certificates upon successful completion of the course; (2) successful accreditation is followed by an on-site course audit. In the case of a negative outcome of the audit, FELASA accreditation is withdrawn, the course is deleted from the list of FELASA accredited courses and FELASA certificates cannot be issued. To ensure that quality is maintained, continuation of accreditation requires regular revalidation. Annex V of the Directive identifies a list of topics to be included in education and training and the National Competent Authorities endorsed a European Union (EU) working document proposing a common education and training framework.1Article 23 of the Directive on the Protection of Animals Used for Scientific Purposes 2010/63/EU , B (designing procedures and projects), C  and D . These four Functions, however, differ from the Categories used previously by the Council of Europe and by the Federation of European Laboratory Animal Science Associations (FELASA) since the 1990s (see Appendix 1). Thus, the FELASA accreditation scheme was adapted to address Functions A to D as defined by 2010/63/EU  and their associated learning outcomes. In addition to these four Functions, FELASA accreditation is also available to the education and training of what we define as specialists in laboratory animal science  \u2013 a person who may be involved in tasks described in Articles 24, 25 and 26 .1 (see Appendix 2). It acknowledged that the objective of initial training is to instil basic knowledge and/or understanding and is only the first step of the learning process. It involves a programme of work/study leading to specific learning outcomes, which provide basic understanding and skills appropriate to the Function.The Expert Working Group established by the Commission recommended a modular approach to the development of competencies, with defined learning outcomesin\u00a0vivo competences for caring for and working with experimental animals in a fully responsible way and in accordance with the \u20183Rs\u2019. This may be developed further with a programme of Continuous Professional Development.Satisfactory completion of this initial training is followed by working with animals under supervision, leading to deeper understanding . This se1 In other cases, the trainee could begin working under supervision before the relevant modules have been satisfactorily completed.1 Responsibility for correct performance of tasks always remains with the supervisor until training has been completed and the requisite competence demonstrated. Guidelines for supervision requirements are available.2The EU Expert Working Group recommended that persons performing one of the Functions A, B, C or D during which there is a likelihood of pain, suffering, distress or lasting harm should have completed relevant training prior to working under supervision.These requirements are reflected in different approaches to the assessment of satisfactory training and attainment of competence. The FELASA accreditation scheme addresses the first steps of the education process \u2013 acquisition of basic knowledge and skills, which are concluded by an examination  \u2013 and enFELASA accreditation is available for courses that develop initial training leading to competency in each of the four Functions identified in the Directive. A course is defined here as a training programme consisting of one or more modules designed to provide the education and training needs of personnel dedicated to a specific Function. It may or may not have been endorsed/accredited by a National or Regional Authority or a Laboratory Animal Science Association. For a few exceptions, please see the section entitled \u2018Accreditation of training for Function and for stand-alone modules\u2019 below. Moreover, the scheme is also available for designated veterinarians and specialists in laboratory animal science .Because of its modular structure, the education scheme recommended by the EU allows the development of competence by following courses tailored to the needs of the participants. A brief description of the modules can be found in Appendix 2.A course provider can therefore build up a course by combining modules. The simplest course structure is the EU Function C for person taking care of animals. It comprises six core modules and one Function-specific module (Module 3.2).The addition of the two modules on minimally invasive procedures without anaesthesia (Modules 7 and 8: theory and skills) leads to a course covering requirements for EU Function A  in addition to EU Function C.1 allow tailoring of training required by specific tasks within a Function. This is the role of the additional task-specific modules  and B (persons responsible for designing experiments). Thus, a person aiming for EU Function B could decide to attend the additional elements required for EU Function A. The benefit of a combined training is that such a person would be better informed regarding the practicalities of performing procedures and the necessity of adopting best practices in the design of projects than a person with only EU Function B education. A course based on such a unified programme would deliver FELASA accredited certificates with relevant modules for EU Functions A If only EU Function B courses are delivered, it is possible to cover the requirements of EU Function C by adding Module 3.2 to the EU Function B course.Humane killing of animals is recognized as a separate Function under the EU Directive (Function D). A stand-alone module (6.3) can fulfil the training requirement for those who carry out euthanasia only. In practice, however, this Function is often carried out alongside others such as caring for animals (EU Function C) or carrying out procedures (EU Function A). In these cases, it is recommended to add Module 6.2 to those of EU Function A or C to fulfil the training requirements of EU Function D as well .1 see Appendix 2) but for these to be accredited they are expected to be part of a broader programme fulfilling the requirements of a specific Function. Thus, a FELASA accredited programme will be expected to consist of at least: a) the \u2018Core Modules\u2019, b) the modules that are prerequisite to that Function (see \u2018Function-specific modules (prerequisite)\u2019 \u2013 The FELASA accreditation scheme is based on the modules set out in the document endorsed by the National Competent Authorities  will accept applications for a few stand-alone modules. These include:See core module.The FELASA E&T Board will not apply the stand-alone module accreditation policy to any In addition to the four Functions mentioned above, the FELASA accreditation covers courses for other roles; the Designated Veterinarian and the Specialist in LAS are already part of its portfolio. Courses for Project Evaluators will be potential candidates for accreditation.1 gives the list of learning outcomes for a Designated Veterinarian. In addition to Module 24 it includes other modules as described below:The European Commission guidance documentThe FELASA scheme accredits courses or training programmes, not persons. The rules governing the accreditation of individuals are, of course, the responsibility of relevant Competent Authorities, not of FELASA. To facilitate access to training as well as mobility of personnel, persons undertaking training for a specific Function will be able to combine FELASA accredited courses in different institutions to gain qualification. In this scenario, students can start training at one institution and complete their training by taking part in another FELASA accredited course at a different institution. Organizers of FELASA accredited courses will be able to deliver a FELASA certificate for the specific module(s) of the course completed by the student.1 recommends that the person designing procedures and projects should have received a university degree or an equivalent degree in the relevant scientific discipline.Although there are no specific entry qualifications for three of the four Functions, the EU Directive indicates that a person with a Function B responsibility \u2018\u2026shall have received instruction in a scientific discipline relevant to the work being undertaken and shall have species-specific knowledge\u2026\u2019 . More specifically the EU Commission guidance document (p. 7),The FELASA E&T Board regards a bachelor\u2019s degree or equivalent as the minimum entry qualification for a Function B course. As a consequence, when a course covers several Functions, including among them Function B, entry qualification criteria for that Function must be satisfied.If there is no legally defined entry qualification, the course organizer has to ensure that, for each module taught, all students should attain the minimal level of understanding of the learning outcomes at the end of the course, irrespective of their prior level of knowledge.3 We believe that this statement remains valid today.The issue of the use of live animals in laboratory animal science education and training courses has been debated for many years. When launching its accreditation scheme in 2003, FELASA issued the following statement: \u2018It can be concluded that the use of live animals in courses for scientists can contribute both to the development of skills and enhancing attitude, when the teaching is of a high standard and stresses the moral dimension\u2026\u2019.1). Such justification is moreover substantiated by past experiences. The FELASA E&T Board has accumulated information with the accreditation of courses under the previous FELASA category scheme. Review of past annual reports and audits indicates that students\u2019 assessments of courses place the manual skills training using live animals among the preferred parts of the course; very often, students ask for more practical sessions. Moreover, the skill acquisition process is performed in a pedagogic and educational environment where theoretical concepts taught during the lectures are directly translated in best practices during skills training; this might not be the case in an on-the-job set-up carried out in the research laboratory . The FELASA E&T Board\u2019s view is that the provision of contextual understanding in educational courses gives a solid basis for building up skills for future research with live animals. This results in a positive effect on scientific integrity and prevents avoidable compromises to animal welfare.The EU commission has made it clear that the Directive allows the use of live animals for education and training and describes under which conditions the use of live animals is justified  should be mandatory. In order to be able to guide students to treat animals humanely and to assess attitude, no alternative to working with live animals exists today. Prior to learning how to perform procedures on animals, certain manual skills could be taught non-invasively, such as handling needles, syringes, or suturing and others. Further, in addition to such training using alternatives, the FELASA E&T Board recommends that, whenever possible, training in minimally invasive procedures (Module 8) is carried out on live animals under specific conditions that are described below:The teaching environment and guidance of students should not be neglected. Rooms and space should be appropriate for skills training. A detailed guide should be provided beforehand to students. The ratio between number of tutors and number of students should not exceed one tutor for five trainees. Waste and personal protection utilities and equipment should be available and clearly marked. Protection against laboratory animal allergies should be included.The certificate should include sufficient details of what has been learnt in order to promote transparency, which will facilitate movement from one institution to another and/or acceptance by a different competent authority. Thus, the certificate should include the FELASA logo, course ID, participant\u2019s details, modules completed and a course email address (in case complementary information is requested). Animals that have been handled as part of the practical parts of the course should be listed by the level of the species  rather than as a group of species  whenever possible. The teaching of the theoretical part, however, can cover either a single species or a group of species at the discretion of the course organizer as long as this is listed in the certificate. Thus, it is possible to cover a group of related species as part of the theory, and focus the practical training on the relevant species. In the case of a future change of animal model from one rodent species to another, for example, the researcher can receive specific hands-on training on the new rodent species in the institution without needing to attend additional lectures.In order to combine flexibility of training and speed of process, the FELASA accreditation scheme is based on a two-stage approach based on verification of course quality .Figure Course organizers seeking accreditation are required to complete an application form obtainable from the FELASA Secretariat.This form seeks information about the applicant and the institution where the course is held. It asks for confirmation that the course has been run in its present form at least once; the frequency with which it is held; the number of students and admission qualifications when appropriate (see above for EU Function B); whether the use of living animals has been authorized by competent authorities and whether the course is recognized as part of a formal educational programme. Applicants must provide information about course structure and topics, practical classes and how the learning outcomes are covered, the way in which knowledge and competency are assessed and the results of those assessments. The credentials of teaching staff must also be provided along with details of how students are able to comment on the quality of the learning experience.1 reviews the mix of teaching methodology and the use made of supporting materials, such as course notes and recommended reading, and ensures that the objectives of the course conform with relevant national laws, recommendations and guidelines with official supporting documents where appropriate. Consideration is also given to the method of student assessment, the range and depth of evaluation of learning outcomes and the way in which practical skills are assessed. Course organizers must have implemented a mechanism by which students can reflect and report on their learning experience, and must provide examples of course evaluations to show that the course is balanced, effective and worthwhile. Copies of all examination papers, all student evaluation results and all teaching materials are not requested at this stage.On the basis of this written submission, the FELASA E&T Board verifies that the training delivered meets the requirements of the relevant EU Function,If the information provided is judged satisfactory, the course will be given accreditation.Following the decision, an accreditation contract is to be signed between FELASA and the Institution that will issue the training certificates. The FELASA certificate is to be distributed to every participant who fulfilled the requirements to enter and attend the course and who passed the examination. There is only one kind of FELASA accredited certificate delivered. The course is posted on the FELASA website as \u2018FELASA accredited\u2019.5 it has become apparent that assessment of course quality based only on written evidence may lack robustness and can on some occasions be misleading. The FELASA E&T Board therefore audits all courses whilst they are running. This enables the gathering of independent first-hand information about the quality of the learning environment.Since the FELASA E&T Board implemented a systematic programme of course audits in 2006The audit consists of a visit lasting usually one or two days by two FELASA auditors. The board requests documentary materials before the visit and a list of materials that will be examined during the audit. The latter includes examination papers and written student course evaluations, as well as notes of teachers\u2019 meetings, records of course attendance, copies of course materials provided to the students, checklists, including teaching aids and those used for practical training, and a list of certificates issued. In addition to reviewing these documents, the auditors attend lectures and practical sessions included in the accredited programme. The auditors interview students who have already completed the course and supervisors, as well as students and teachers of the current course and others responsible for course organization and delivery.At the end of the audit, the auditors submit a report to the FELASA E&T Board. This leads to the decision on whether the course maintains accreditation with or without changes, or if accreditation is required to be suspended until crucial changes are incorporated.The audit is a crucial part of the accreditation. The FELASA E&T Board regards it as the most reliable method of establishing the quality of the student learning experience. It is inevitably a formal process, but it is also an opportunity for an open and constructive discussion on LAS training. Course organizers often report that they have found the audit inevitably formal but surprisingly enjoyable and an opportunity to talk about issues with like-minded people.The FELASA E&T Board reserves the right to conduct audits, other than those involved in the accreditation process, subject to the provision of at least 10 days\u2019 advance notice.www.felasa.eu).The FELASA E&T Board publishes a list of courses that have been FELASA accredited on the FELASA web page , under-staffing for course delivery, inappropriate content or teaching methodology, concerns about animal welfare, occupational health issues etc. could be sufficient cause for the withdrawal of FELASA accreditation.It is expected that course organizers will continually evaluate the content format and teaching methodology of the programme and, where appropriate, introduce modifications to improve the quality of the learning experience in light of comments from participants. In many cases, new ideas should be evaluated by introduction on a trial basis, assessed by teachers and participants and reported in the next annual report.If it is proposed to introduce major changes to a FELASA accredited course, a detailed proposal should be submitted to the FELASA secretariat before these are implemented, so that the FELASA E&T Board can give them prior consideration and, if appropriate, approval. This requirement refers to changes of course structure and/or delivery process and is independent of the obligation to submit an annual progress report.FELASA accreditation will lapse at the end of each accreditation period. If continued accreditation is required, course organizers must submit a new application in accordance with the requirements for accreditation at least six months before the existing accreditation expires. During the renewal process the course will be entitled to retain its status of accreditation.If the first or the renewal audit reveals major problems leading potentially to the cancelling of the accreditation, the FELASA E&T Board will decide whether the application is rejected or, if satisfactory changes have been implemented, that accreditation may be continued. A second audit will then confirm accreditation of the course if the changes have addressed the shortcomings . In the The FELASA accreditation programme is a non-profit making venture, but is required to be financially self-supporting. Applications for accreditation will be processed only after an application fee has been received. The application fee is independent of the number of courses given annually and is non-refundable, irrespective of the outcome of the accreditation application. The FELASA E&T Board will propose a scale of fees annually to the FELASA Board of Management.For courses given in Europe, the fees for the duration of the accreditation period include the cost of the audit. In the case of an audit revealing major failures in the course quality and a second audit being required, the costs of the second audit are covered by the course organizer.For courses offered in countries outside Europe, the fee for accreditation or renewal is identical to that for European courses, but does not include the cost of the audit, which will be levied as an additional cost.An annual fee plus a small fee for each student certificate issued during that year for the accredited course is payable for the duration of the accreditation. This annual fee is payable even if the course has not been held during that year. The current fees are listed on the FELASA website.In the event of a course wishing to opt out of accreditation status, the remaining annual fees for the duration of the accreditation will still be payable."}
+{"text": "Oligonucleotide-based therapies are currently gaining attention as a new treatment option for relatively rare as well as common diseases such as cardiovascular disease. With the remarkable progression of new sequencing technologies, a further step towards personalized precision medicine to target a disease at a molecular level was taken. Such therapies may employ antisense oligonucleotides to modulate the expression of both protein coding and non-coding RNAs, such as microRNAs. The cardiorenal syndrome (CRS) is a complex and severe clinical condition where heart and renal dysfunction mutually affect one another. The underlying mechanisms remain largely unknown and current treatments of CRS are mainly supportive therapies which slow down the progression of the disease, but hardly improve the condition. The small non-coding RNA, microRNA-21 (miR-21), is dysregulated in various heart and kidney diseases and has been repeatedly suggested as therapeutic target for the treatment of CRS. Impressive preclinical results have been achieved by an antisense oligonucleotide-based therapy to effectively block the pro-fibrotic traits of miR-21. Since microRNA-mediated pathways are generally very well-conserved, there is considerable commercial interest with regards to clinical translation. In this review, we will summarize the role of miR-21 within the heart\u2013kidney axis and discuss the advantages and pitfalls of miR-21 targeting therapeutic strategies in CRS. Cardiorenal syndrome (CRS) is a condition that describes interdependent disease conditions where a primary dysfunctional organ causes dysfunction in a secondary organ, in this case, the heart and the kidneys . In an avia RNA interference (RNAi) mechanisms (Owing to the rapid development of next-generation sequencing (NGS) technologies over the last decade, it became evident that vast parts of our genome are actively transcribed into non-coding RNAs (ncRNAs), while the protein coding transcripts, i.e., messenger RNAs (mRNAs), are transcribed by only 1% to 2% of the human genome . In addichanisms . MiRNAs chanisms . The matchanisms . Severalchanisms . Many michanisms Table 1.chanisms . Neverthchanisms , suppresSprouty homolog 1 (Spry1) expression, and thus enhances ERK-MAPK activity which leads to fibroblast activation/proliferation and cardiac fibrosis  protein expression  or ischemic preconditioning (IP), a temporary injury known to be cardioprotective, miR-21 appears to function differently between acute and chronic heart disease. A study conducted by Dong et\u00a0al. showed that miR-21 expression decreased in the infarct area of the heart 6 h after AMI and increased 6 h after IP. Overexpression of miR-21 pression . This coDDAH1  which is a key gene involved in the pathological process of end-stage AKI. In other cases of ischemia/reperfusion-induced AKI, miR-21 was shown to be reno-protective. Song et\u00a0al. showed that miR-21 protects the kidney from ischemia/reperfusion-induced AKI by preventing the apoptosis of renal epithelial cells and inhibiting an inflammatory response . In sepsis-induced cardiac dysfunction, Wang et\u00a0al. showed that miR-21-3p is significantly up-regulated in the heart after lipopolysaccharide (LPS)-induced sepsis in mice. Similar to Bang and colleagues' work, miR-21 altered the cardiac \u03b1/\u03b2MHC ratio and caused cardiac dysfunction through targeting e damage . In a tyammation . Hyperteammation . Howeverammation . Additioammation . It has ammation   et organ . To circet organ , howeveret organ . Currentet organ .The first generation of modified ASOs are phosphorothioate-modified (PS)-ASOs which are characterized by a substitution of the non-bridged phosphate oxygens with Sulphur atoms. The PS-ASOs are highly resistant to nucleases and have high retention rates in the body due to their minimal clearance by the kidney and urinary excretion. However, a negative side effect is that PS-ASOs can also bind non-specifically to proteins, and thus may cause cytotoxicity .Through a methylene bridge between the 2\u2032-O and the 4\u2032-C of the ribose, LNA-ASOs have a stable \u201clocked\u201d 3\u2032-endo-conformation structure which allows them to be nuclease resistant. With this \u201clocked\u201d structure, LNA-ASOs can allow for more stable and much more specific binding to a target RNA. Notably, the pure LNA-ASO structure is not able to induce robust RNase-mediated cleavage of the ASO-miRNA hybrid, but instead, blocks the miRNA from binding to its target. To circumvent this issue, a short stretch of DNA (6\u20138 nucleotides) can by placed between two LNA structures . Such DNin vivo. In addition to nuclease resistance, ribose-ASOs have other advantages including higher specificity to their targeted RNA and reduced immune activation , 2\u2032-fluoro (2\u2032-F), and 2\u2032-methoxyethyl (2\u2032-O-MOE), the ribose-ASOs gain nuclease resistance, enhanced stability, and an increased half-life tivation .In vitro and in vivo treatment with Miravirsen, an ASO with both LNA and PS modifications, showed significant down-regulation of miR-122, reduction of interferon-regulated genes, and improvement of HCV-induced liver pathology . The basement membranes are assembled with collagen type IV, laminins, and proteoglycans. Six different genes (from Col4A1 to Col4A6) encode six chains of collagen type IV (collagen IV \u03b11 to \u03b16), and of them, three chains  are assembled into one protomer. However, in Alport syndrome, the genes responsible for encoding collagen type IV are mutated. For example, the major mutation for the Col4A5 gene is on chromosome Xq26\u201348, and for the Col4A3 and Col4A4 genes, the mutation is located on chromosome 2q35\u201337. These mutations prevent proper protomer assembly and, therefore, result in a defective glomerular basement membrane and kidney dysfunction  and the German Research Foundation .TT has filed and licensed patents about the diagnostic and therapeutic use of several cardiovascular microRNAs. TT is founder and shareholder of Cardior Pharmaceuticals GmbH.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Here, we report four coding-complete severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome sequences from Stockholm, Sweden, sampled in late April 2020. A rare variant at bp 23463 of the SARS-CoV-2 genome was found, which corresponds to the S1 subunit of the spike protein, changing an arginine (R) residue to histidine (H). Here, we report four coding-complete severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) genome sequences from Stockholm, Sweden, sampled in late April 2020. A rare variant at bp 23463 of the SARS-CoV-2 genome was found, which corresponds to the S1 subunit of the spike protein, changing an arginine (R) residue to histidine (H). Coronaviridae and the genus Betacoronavirus, emerged in Wuhan, China, in December 2019 and has rapidly spread around the world (A severe pneumonia disease caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a virus that belongs to the family TC) values ranging from 11 to 35. Viral RNA was extracted, and cDNA was synthesized using the QIAseq FX single-cell RNA library kit (Qiagen). Illumina libraries with an average length of 350\u2009bp were prepared using the ThruPLEX DNA-seq kit (Rubicon Genomics) and sequenced using Illumina MiSeq technology (2 \u00d7 300 bp). The genomes were assembled, and nucleotide variants were assigned for each genome using the Genome Detective virus tool, version 1.126 (MN908947.3) as the reference.Nasopharyngeal swab specimens were collected from 23 patients suspected to have coronavirus disease 2019 (COVID-19), the disease caused by SARS-CoV-2. In 17 of these, a reverse transcriptase PCR (RT-PCR) assay for SARS-CoV-2  , 7. AccoPRJEB39632. The reads of the five SARS-CoV-2 strains were deposited in the ENA under the accession numbers ERR4387391, ERR4387389, ERR4387388, ERR4387386, and ERR4387385. The consensus sequences were also deposited under the accession numbers ERZ1478570, ERZ1478358, ERZ1478357, ERZ1478356, and ERZ1478355.These sequences have been deposited in the European Nucleotide Archive (ENA) under the study reference number"}
+{"text": "The HIV-1 integrase viral protein is responsible for incorporating the viral DNA into the genomic DNA. The inhibition of viral integration into host cell DNA is part of recent therapeutic procedures. Combination therapy with protease and reverse transcriptase inhibitors has demonstrated good synergistic results in reducing viral replication. The purpose of this study is to assess the occurrence of integrase drug resistance mutations from the period comprising 2013 through 2018 in Puerto Rico (PR). We analyzed 131 nucleotide sequences available in our HIV genotyping database, and we performed drug resistance mutation analyses using the Stanford HIV Drug Resistance Database. Twenty-one sequences (16.03%) harbored major or resistance-associated mutations. We identified the Q148HKR, G140S, Y143R, N155H, S147G, and E138EA major drug resistance mutations and the D232DN, T97TA, E157Q, G163GART accessory mutations. We detected high-level drug resistance to Elvitegravir and Raltegravir (76.19% and 85.71%). Moreover, we identified sequences harboring drug resistance mutations that could provide resistance to Dolutegravir. The transmission of strains with integrase antiretroviral resistance has been previously documented in treatment na\u00efve patients. Given the increase of patients treated with integrase inhibitors, surveillance of drug resistance mutations is an essential aspect of PR\u2019s clinical management of HIV infection. Approximately 49,791 people have been diagnosed with human immunodeficiency virus type 1 (HIV-1) in Puerto Rico (PR) from 1981 to July 2019 ,4,5. In The development of new drugs that target different phases of the HIV-1 replication ensures the efficacy of ART regimens . Drugs tThe previous standard treatment for HIV-positive individuals involved the use of a combination of at least three ART drugs belonging to five different classes of medications . CurrentIn Puerto Rico, most of these INSTIs are included in patients\u2019 antiretroviral regimens as treating physicians are encouraged to follow the HIV Treatment Guidelines for Adults and Adolescents published by the Federal Public Health Services (PHS). In this study, we examined INSTIs-associated drug resistance mutations from samples evaluated in our laboratory from 2013 through 2018 to determine the occurrence of drug resistance mutations to these inhibitors.The current study was conducted in accordance with the Declaration of Helsinki, and the protocol was certified by the Institutional Review Board of the Ponce Research Institute to be exempt from the federal policy for the protection of human subjects under the provision of use of existing data and specimens (protocol number 2005039159).n = 131), which were processed with our WHO-accredited HIV-1 genotyping protocol. Briefly, venous blood was obtained using EDTA Vacutainer tubes and centrifuged to collect plasma. The viral RNA was purified using the QIAmp Viral RNA Kit , following the manufacturer\u2019s instructions. For the first-round RT-PCR amplification, we used the OneStep RT-PCR Kit  according to the manufacturer\u2019s instructions using primers: 5\u2032-CACAAAGGAATTGGAGGAAATGAAC-3\u2032 (forward) and 5\u2032-CCTAGTGGGATGTGTACTTCTGAAC-3\u2032 (reverse). Thermal cycling conditions for first-round RT-PCR consisted of reverse transcription at 50 \u00b0C for 40 min, inactivation at 95 \u00b0C for 15 min, followed by 35 cycles of amplification at 94 \u00b0C for 30 s, 53 \u00b0C for 30 s, and 72 \u00b0C for 2 min, with a final extension at 72 \u00b0C for 10 min. The first-round PCR amplifies the region corresponding to positions 4164 to 5219 relative to the reference sequence HXB2. A second-round PCR was performed using FastStart PCR Master (Sigma-Aldrich), according to the manufacturer\u2019s instructions utilizing 1 \u00b5L of the first-round RT-PCR as a template. Amplification was done using forward primer 5\u2032-ATAAATTAGTCAGTGCTGGAA-3\u2032 and reverse primer 5\u2032-GCTTTCATAGTGATGTCTATA-3, with PCR conditions as follows: a denaturing step at 95 \u00b0C for 15 min, followed by amplification for 35 cycles at 94 \u00b0C for 30 s, at 48 \u00b0C for 30 s, and 72 \u00b0C for 2 min, with a final extension at 72 \u00b0C for 10 min. The second-round PCR amplified the region corresponding to positions 4195 to 5178 relative to the reference sequence HXB2.We analyzed the nucleotide sequence data of the HIV-1 integrase gene associated with HIV-1 Puerto Rican isolates . The sequences were 849 bp long (nucleotides 4245\u20135093 relative to the reference sequence HXB2). Sequences were aligned and edited by using BioEdit software v 7.0.5.2. The HIV-1 subtype was characterized using the REGA subtyping tool v3.0 and confirmed by using COMET HIV-1 ,22,23. Tn = 131); however, one case of HIV-1 subtype A (A1) was identified. This sequence did not harbor any major or accessory drug resistance mutations to INSTIs; however, it presented a polymorphic accessory mutation (L74I) common among 20% of the studied patients but with no significant effect by itself. This finding correlates with previous studies that indicate that about 95\u201398.9% of the HIV-1 virus in PR is subtype B, with the remainder corresponding to subtypes A , C, D, F, B/D, and CRF-24BG [We analyzed one hundred thirty-one HIV-1 integrase sequences corresponding to the period of 2013 through 2018. Demographic data showed that the samples were predominantly from males (60.3%), and the mean ages for males and females were 44 and 49 years, respectively . AntiretCRF-24BG ,26. No tCRF-24BG .Intermediate resistance levels then lowered to 25% during 2017 and were not detected in samples from 2018 . High-leThe most frequent integrase mutations in our analyzed patient samples were the Q148HKR 31%), G140S 28%), and, although at lower frequencies, we were able to identify the N155H, S147G, Y143R, and E138EA A. The E1%, and, a%, G140S Among sequences showing INSTI mutations, we observed drug resistance associated majorly with EVG and RAL . MeanwhiThe INSTI-resistance mutations percentage is relatively low when compared with mutations that can compromise nucleoside reverse transcriptase inhibitors (NRTIs) and non-nucleoside reverse transcriptase inhibitors (NNRTIs) in Puerto Rican patients during a similar period . This loOur finding that drug resistance associated mainly with EVG and RAL may be explained by recent studies which established that mutations that provide resistance to RAL could also decrease EVG efficacy ,45. FurtWhile epidemiological and clinical information about these patients was not available for this study, our current analysis provides new information to understand how drug resistance to INSTIs evolves in Puerto Rico. Although the incidence of integrase drug resistance mutations in PR was relatively low and appeared to decrease over the studied period, without close genotypic monitoring, the emergence of drug resistance mutations could increase in the next several years. A recent study established that drug susceptibility and viral fitness may be affected by potential cross-class mutational interactions. Siedner et al. observed that non-nucleoside reverse transcriptase inhibitor resistance before treatment with HIV-1 integrase inhibitors is associated with the long-term failure of integrase-inhibitor-containing first-line regimens .The use of INSTIs in treatment is an excellent opportunity to improve patient\u2019s clinical outcomes, leading to a healthier lifestyle and reducing the risk of viral transmission . Surveil"}
+{"text": "Hormone receptor negative tumors showed significantly higher expression of Ki-67 (p\u2009<\u20090.01), MCM2 (p\u2009<\u20090.01) and Cyclin A (p\u2009<\u20090.01) than hormone receptor positive ones. Tumors with increased TIL showed significantly higher Ki-67 expression (p\u2009=\u20090.04). Pattern analysis suggested that novel cell-cycle marker-based subgrouping reveals predictive and prognostic potential. Tumors with high MCM2, Cyclin A or PHH3 expression showed significantly higher rate of pathological complete remission. Tumors with early relapse  and shortened overall survival also show a higher rate of proliferation. Our cell cycle marker  based testing could identify tumors with worse prognosis, but with a favorable response to primary systemic therapy. The pattern of cell-cycle activity could also be useful for predicting early relapse, but our findings need to be further substantiated in larger patient cohorts.We aimed to analyze the expression of cell-cycle regulation markers \u2013 minichromosome maintenance protein 2 (MCM2), Ki-67, Cyclin-A and phosphohistone-H3 (PHH3)\u2009\u2212\u2009in pre-treatment core-biopsy samples of breast carcinomas in correlation with known predictive and prognostic factors. Totally 52 core biopsy samples obtained prior to neoadjuvant therapy were analyzed. Immunohistochemistry was performed to analyze the expression of MCM2, Ki-67, Cyclin A and PHH3, which were correlated with the following clinicopathological parameters: clinical TNM, tumor grade, biological subtype, the presence of tumor infiltrating lymphocytes (TIL), pathological tumor response rate to the neoadjuvant therapy and patient survival. All investigated markers showed higher expression in high grade and in triple negative tumors (The online version of this article (10.1007/s12253-019-00726-w) contains supplementary material, which is available to authorized users. In breast carcinomas several predictive and prognostic markers have already been defined and used in the daily clinical routine, i.e. TNM stage, tumor grading and biological subtyping , 2. In lIn case of breast carcinoma only a few studies are available which are investigating the predictive and prognostic role of cell cycle markers besides the Ki-67 LI . The minLike Ki-67, the MCM-complex is expressed during the whole cell cycle, except for G0 . The MCMPre-therapy Ki-67 LI (measured in core-biopsies before the initiation of PST) have already been proved to be predictive for pCR in breast cancer patients, but the best predictive cut-off point for the favorable outcome is under debate \u201320. In oBesides its predictive value the prognostic potential of Ki-67 \u2013 namely that high expression of Ki-67 is associated with a poor prognosis and with an earlier onset of metastatic disease \u2013 has also been confirmed, but different prognostic cut-off points were defined in the earlier published literature \u201320. It wIn addition to Ki-67, MCM2 expression also seems to have prognostic value in breast cancer , 12. MCMIn our current study we aimed to further investigate the correlation between these nuclear protein markers either expressed throughout , from post G1 (Cyclin A) or in M-phase (PHH3) of the cell cycle and the routinely examined clinicopathological factors of breast cancers undergoing PST . Additionally, a novel prognostic biomarker, the presence of tumor infiltrating lymphocytes (TIL) was also assessed in our study. Over its prognostic significance, the predictive value of TIL infiltration is under debate in the neoadjuvant setting and its association with tumor proliferation has not been investigated thoroughly yet . Prognos18F-fluorodeoxy-glucose positron emission tomography and computer tomography (FDG-PET/CT) examinations; (4) patients included in the final analysis were those who underwent surgery after completion of PST.Patients diagnosed with primary breast cancer and treated with PST at the Oncology Center of Semmelweis University were retrospectively identified. Inclusion and exclusion criteria were the same as applied in our earlier study published previously . BrieflyClinical TNM was assessed by using routinely applied diagnostic imaging modalities .The study was ethically approved by the Semmelweis University Institutional Review Board (No.: SE TUKEB 120/2013).Before PST detailed histological characterization was performed on the core biopsy samples . Additionally, the core-biopsy samples were evaluated for the presence of tumor infiltrating lymphocytes (TIL) in the stroma of the tumors according to the TILs Working Group guideline published in 2015 .In surgical samples, if residual tumor was present, histological characterization was repeated; in addition, residual tumor size and nodal stage were also assessed with the evaluation of tumor-free margins. For pathological response evaluation the surgical samples were analyzed according to national consensus recommendations  based onFormalin-fixed, paraffin-embedded pre-treatment core biopsy samples were examined. Immunohistochemistry (IHC) was routinely performed to evaluate hormone receptor \u2013 estrogen (ER) and progesterone (PR) \u2013 status, as well as HER2 expression according to international guidelines. Hormone receptor positivity was confirmed if Allred score was above or equal to 3 . HER2 ovKi-67, MCM2, Cyclin A and PHH3 were stained as described previously by T\u0151k\u00e9s et al. . Prolifep values <0.05 were considered significant. Data were expressed as mean\u2009\u00b1\u2009standard deviation (SD). Normality was tested by using Shapiro-Wilks test. Connections between clinicopathological characteristics and expressions of the investigated cell cycle proteins were assessed by using Mann-Whitney and Kruskal-Wallis tests. To compare pCR and non-pCR patient groups Mann-Whitney tests were performed.All applied statistical tests were two-sided and PFS was evaluated after 2\u00a0years follow-up and at the end of the follow-up period 31 May 2017), together with OS. The data of those patients who did not experience progression or cancer-related death was censored at the last control visit at the Oncology Center of Semmelweis University. Patients who experienced progression and those who did not were compared by means of clinicopathological characteristics using Mann-Whitney and Kruskal-Wallis tests. Moreover logistic regression was performed to assess the prognostic potential of the tested cell-cycle markers to PFS. For survival analyses, Kaplan-Meier product limit methods were used with log-rank tests to compare patient groups defined by the high or low expression of proliferation markers. For Ki-67 we used cut-off points described earlier by our research group (for Ki-67 LI 20% for PFS and 30% for OS ); for th, togetheGroup I) low MCM2 expression with any Cyclin A, any PHH3 expressionGroup II) high MCM2 but low Cyclin A and low PHH3 expressionGroup III) high MCM2 with high Cyclin A and low PHH3 expressionGroup IV) high MCM2, high Cyclin A and high PHH3 expressionGroup V) other tumors .Additionally, based on the hypothesis of Loddo et al.  we groupSubgroups were compared using heatmap analysis, regarding the distribution between biological subgroups and clinical outcome.Microsoft Excel 2010  and Statistica 13.2  software were used for data collection and processing.A total of 52 breast cancer patients (mean age: 48.02\u2009\u00b1\u200910.51\u00a0years) were enrolled in our current study  in pre-therapy core-biopsies (Table p\u2009=\u20090.04). The other three cell-cycle markers were also higher in tumors with high TIL score than those with lower scores, but this tendency was not significant (Table p\u2009=\u20090.0008).We also analyzed the correlations between the presence of stromal TILs and the cell cycle activity of the primary tumors. Tumors with increased TIL score showed significantly higher Ki-67 expression (nt Table . Core-bin\u2009=\u200948). After completion of PST, every included patient gave consent to surgery. Regarding the final histological analyses, 17 patients achieved pCR . We detected residual tumors in 35 cases , from these in 4 cases (7%) only the regional lymph nodes contained malignant cells. In 33 patients we did not detect any lymph node metastasis after the PST , in 19 patients nodal involvement was confirmed, but from these in one case only a micrometastasis was detected. Among residual tumors, dominant subtypes were the luminal ones: 22/35 (63%) tumors were luminal B-like \u2013 from these 11 were luminal B-proliferative and 11 were luminal B-HER2 positive \u2013 and 7/35 (20%) lesions were luminal A-like.All patients were treated with PST, most commonly in 3-week schedules, for 6 or 8\u00a0cycles. Mostly taxane-based regimens were administered . Additionally, strong significance was found when the initial cell cycle activity  of ypT0/is patients was compared with other ypT stages. However, we did not find any significant correlation between the initial cell-cycle activity and the lymph node involvement (ypN0 vs. other ypN stages) after the PST (Table 3).We found significantly higher initial Ki-67, MCM2, Cyclin A and PHH3 expression in the pCR cases compared to non-pCR patients  and only 8 patients showed no evidence of tumor response . The partial responder tumors were distributed between TR2a, TR2b and TR2c response categories unevenly . We did not find significant correlation between the degree of tumor response detected in the primary lesions after surgery and the initial cell-cycle activity in the core-biopsies. Amongst the cases with node positive disease detected after PST, only nine patients showed signs of therapeutic response  while in ten patients  the nodal metastases showed no evidence of response to therapy. Regarding regional lymph nodes, we did not find any correlation between the NR response status and the initial cell-cycle activity, similarly to the primary lesions. (Detailed results are presented in Table p\u2009=\u20090.277), MCM2 (p\u2009=\u20090.583), Cyclin A (p\u2009=\u20090.724) or PHH3 (p\u2009=\u20090.267) measured in the core-biopsy samples. Additionally, from the 12 cases with progression 7  were considered as early onset relapse (PFS\u2009\u2264\u20092\u00a0years). From these seven cases in 6 patients the expression of every tested cell cycle markers was high in the core-biopsy samples, but we could not prove any significant predictive potential of the initial Ki-67 (p\u2009=\u20090.097), MCM2 (p\u2009=\u20090.172), Cyclin A (p\u2009=\u20090.932) or PHH3 (p\u2009=\u20090.380) expression towards early relapse.Median follow-up time was 62\u00a0months. We detected disease progression in 12 cases . From these, 8 patients belonged to the non-pCR patient group after PST. However, we did not find any significant differences between these 12 patients and the rest of the patients (40/52) regarding the initial expression of Ki-67 (Five patient deceased during the follow-up (9.6%), all death were cancer-related and all of these patients experienced non-pCR after the PST. In four of these five patients (80%), every cell cycle marker was elevated in their pre-treatment core-biopsy samples.Additional\u00a0file\u00a01).Based on Kaplan-Meier analysis and log rank tests we could not prove any significant prognostic potential of the tested cell cycle markers towards PFS or OS (see n\u2009=\u20099Group I) low MCM2 expression with any Cyclin A, any PHH3 expression: n\u2009=\u20092Group II) high MCM2 but low Cyclin A and low PHH3 expression: Group III) high MCM2 with high Cyclin A and low PHH3 expression: n\u2009=\u20092n\u2009=\u200934Group IV) high MCM2, high Cyclin A and high PHH3 expression: n\u2009=\u20095Group V) other tumors (with high MCM 2 with low Cyclin A and high PHH3 expression): We performed further subgrouping of the patients based on the expression pattern of the investigated \u2013 relatively phase specific \u2013 cell-cycle proteins. The subgroups and distribution of the patients amongst the subgroups were as follows:A heatmap was designed to compare the four patient groups regarding biological tumor subtypes and clinical outcome Fig.\u00a0. HormoneNonetheless, regarding the rate of progression the most unfavorable results were also experienced in Group IV; from 34 patients 9 showed progression (26%), whilst in the other three patient groups  only two, one, zero and one patient showed a relapse, respectively.p\u2009=\u20090.907 and p\u2009=\u20090.551, respectively).Kaplan-Meier plots comparing the PSF and OS of the patients in Group IV with the others are shown on Fig.\u00a0Relationship between the clinicopathological characteristics of breast tumors and the routinely used Ki-67 proliferation marker has already been established. However, due to the known analytical limitations of Ki-67 LI , 6, seveIn our study, while analyzing core-biopsy samples of locally advanced breast cancers, we found that smaller lesions (cT1 and cT2 tumors) showed higher proliferation activity measured by all investigated markers than larger tumors. In case of MCM2 and PHH3 these correlations were significant. If the axillary lymph node status was >cN0, as per clinical-imaging investigations, the expression of every proliferation marker was higher compared to clinically node-negative (cN0) cases, but the relationship was not significant. Earlier published results are contradictory regarding the investigated markers of our study. Wiesner et al. analyzed the data of more than one thousand patients and found significant correlation between the expression of Ki-67 and tumor size as well as axillary involvement . Other sThe expression of all examined cell-cycle markers was higher in high-grade tumors, in agreement with earlier results , 39, 41.In case of hormone receptor negative (ER and PR negative) tumors every proliferation marker showed significantly higher expression \u2013 except PHH3 \u2013 compared to hormone receptor positive carcinomas. This correlation has already been described in case of Ki-67 , 37, 38,In our study we did not find a significant correlation between HER2 positivity and the expression of the investigated markers. Earlier studies also resulted in contradictory findings regarding the relationship between Ki-67 LI and HER2 expression. In some studies a positive correlation was described between these markers, while others did not find any correlation , 37. RegRegarding biological subtypes defined in the core-biopsy samples we detected significantly higher expressions of all four cell-cycle markers in triple negative tumors, while in case of luminal A-like subtypes we found the lowest proliferation activity measured by every tested markers. We did not find any earlier published study on MEDLINE directly investigating the correlations between biological subtypes and MCM2, Cyclin A or PHH3 expression. Regarding the expression of Ki-67 LI it is already descibed that luminal A-like tumors (with the most favourable prognosis) have usually got low Ki-67 LI by definition.  Notably,TIL ratio of breast malignancies has been frequently investigated lately due to its possible connection to the efficiency of immunotherapies and its strong prognostic potential for favourable clinical outcome \u2013 but this prognostic potential depends on the biological subtypes of the tumors. Lymphocyte predominant tumors have favorable clinical response to chemotherapy amongst triple negative cancers and to trastuzumab in HER2 positive cases, but not in hormone receptor positive breast malignancies , 46. In Regarding the predictive and prognostic potential of the investigated markers our study partially supported, but partially disproved earlier published results. As mentioned earlier initial Ki-67 LI have already been proved to be predictive for pCR in breast cancer patients \u201320. In oHowever, we did not find any significant correlation between the degree of the tumor response in the non-pCR patients (neither in the primary tumors nor the involved axillary lymph nodes) and the initial cell-cycle activity of the tumors. Besides the strong predictive potential of high cell-proliferation activity towards pCR, we revealed a lack of any reliable biomaker to differentiate between tumors with partial tumor remission. In the international literature we did not find any earlier published study directly investigating the correlations between TR and NR response grading and MCM2, Cyclin A or PHH3 expression. Regarding the Ki-67 LI, in the earlier study of our research group we could not find any correlation between Ki-67 LI and rate of tumor response. However, the difference was significant when the pCR group and partial pathological responder group were compared, with the exclusion of those tumors which did not show any reactions to the applied neoadjuvant regimens, in agreement with the results of Balmativola et al. , 23.Concerning prognostic potential it is well-known that high expression of Ki-67 is associated with poor prognosis and earlier onset of metastatic progression , 19. HowNonetheless, Loddo et al.  already The limitation of our study is the few disease related events during the follow-up period of our patients, therefore the statistical power of the performed survival analyses is weak. Additionally, to further investigate the clinical usefulness of the above described cell-cycle based subgrouping further studies are needed with higher number of included patients.Selecting patients diagnosed with breast cancer for PST is a critical problem in the daily practice. In our current study the pCR rate was relatively high, compared to international data; however, further assessment of the pretreatment core-biopsies is still advised to define supplementary biomarkers to increase the efficiency of the patient selection.In our current study, we evaluated nuclear protein markers either expressed throughout , from post G1 (Cyclin A) or in M-phase (PHH3) of the cell cycle and their connections with the routinely used predictive and prognostic factors in breast cancer. Significant associations were described between the cell-cycle activity and the cT stage, grade, hormone receptor status and triple negativity of the investigated tumors. Novel biomarkers of tumor response and survival such as the presence of TILs \u2013 which was associated with more frequent occurrence of pCR \u2013 are also related to cell-proliferation, however, only Ki-67 showed significant correlation with stromal TIL.We already proved that Ki-67, MCM2, Cyclin A and PHH3 are good predictors of pCR after the PST, however, not only pCR, but also rate of partial tumor remission is prognostic for the clinical outcome. In our current study, we did not find significant correlation between the degree of tumor response and the initial cell-cycle activity.Regarding prognostic significance, the pattern of cell-cycle protein expression could be promising as predictive and prognostic tool to be applied before the initiation of PST as well as be useful to choose the therapeutic agent applied in this setting.ESM 1(DOCX 118\u00a0kb)"}
+{"text": "Lemnaceae) of the monocot order Alismatales with the fastest growth rate among flowering plants. They comprise five genera  varying in genome size and chromosome number. Spirodela polyrhiza had the first sequenced duckweed genome. Cytogenetic maps are available for both species of the genus Spirodela (S. polyrhiza and S. intermedia). However, elucidation of chromosome homeology and evolutionary chromosome rearrangements by cross-FISH using Spirodela BAC probes to species of other duckweed genera has not been successful so far. We investigated the potential of chromosome-specific oligo-FISH probes to address these topics. We designed oligo-FISH probes specific for one S. intermedia and one S. polyrhiza chromosome (Fig. Duckweeds represent a small, free-floating aquatic family (ome Fig. . Our resThe online version contains supplementary material available at 10.1007/s00412-020-00749-2. Spirodela (2), Landoltia (1), Lemna (12), Wolffiella (10), and Wolffia (11). They represent an emerging aquatic crop for feed, food, and biofuel generation, as well as for waste water remediation, due to their fast growth rate, optimal protein profile, and their ability to accumulate minerals and heavy metals  and size (1.5 cm to less than 1 mm in diameter), genome size (from 160 Mbp to 2.2 Gbp), and chromosome number vary considerably within and between genera , Hi-C conformation study, 454, Illumina, and Oxford Nanopore sequencing platforms  and S. intermedia (2n = 36), both with a genome size of 160 Mbp/1C, are the only two species of the genus Spirodela. Previous cross-FISH with 93 anchored S. polyrhiza\u2013specific BAC probes discovered chromosome homeology and several rearrangements between S. polyrhiza and S. intermedia karyotypes  yielded only weak and dispersed, but no reliable chromosome-specific signals, even under highly stringent conditions , S. intermedia (8410 and 7747), La. punctata (7260), Le. aequinoctialis (clone 2018), Wa. hyalina (8640), and Wo. australiana (7540) were obtained from Elias Landolt\u2019s collection via BIOLEX  via K.-J. Appenroth, Friedrich Schiller University, Jena, Germany, and from Rutgers Duckweed Stock Cooperative . Liquid nutrient medium .Oligonucleotide probes were designed using Abor Biosciences\u2019 proprietary software. Briefly, target sequences are cut into 43\u201347 nucleotides-long overlapping probe candidate sequences that are compared to the rest of the genome sequence to check for potential cross-hybridization based on a predicted La. punctata clone 7260 was performed by Admera Health, LLC  using a KAPA DNA Library kit (Roche) and Illumina platform generating 2 \u00d7 151 nt paired-end reads. The reads were deposited to the European Nucleotide Archive (https://www.ebi.ac.uk/ena) under accession number ERR4463159.Whole genome shotgun sequencing of For repeat analysis, the reads were trimmed to 142 nt and quality-filtered. A total of 1.8 million randomly sampled paired reads was then used for repeat identification by similarity-based clustering implemented in the RepeatExplorer pipeline  and ChrSi09end/ChrSp19 red-labeled probes (ATTO-594) were obtained from Arbor Biosciences . Microsatellite probes were obtained from Eurofins. Lyophilized probes were dissolved in TE buffer [10 mM Tris-HCl, 1 mM NaAfter adding 100 \u03bcL of 70% formamide in 2\u00d7 SSC on chromosome spreads, they were covered with parafilm, and denatured on a heating plate for 2.5 min at 70 \u00b0C. After removing the parafilm, slides were dipped in pre-cooled ethanol series  for 5 min each on a shaker and air-dried.15 and (GAA)10) were pooled together, evaporated under vacuum, and dissolved in 1 \u03bcL of ddH2O and 15 \u03bcL of DS20 buffer. The entire volume was applied onto the slide. Slides were carefully covered by a coverslip to prevent air bubbles inside, and sealed with a line of rubber cement. Chromosome preparations were denatured together with the probes on a heating plate at 70 \u00b0C for 3 min and then incubated in a moist chamber at 37 \u00b0C for at least 36 h. Post-hybridization washing was carried out as follows: slides were briefly washed in 2\u00d7 SSC at room temperature to remove the coverslip, then washed under shaking condition at 42 \u00b0C for 20 min for 5 min in 2\u00d7 SSC at room temperature, dehydrated in an ethanol series , air-dried in the dark, and counterstained with 10 \u03bcL DAPI (2 \u03bcg/mL in Vectashield).Twenty microliters of hybridization mixture  was used for each slide. The stringency for hybridization was 84.6 and for post-hybridization washing 89.6. In the case of the blocking experiment, all probes Widefield fluorescence microscopy for signal detection followed Cao et al. . The imaTo analyze the ultrastructure and spatial arrangement of signals and chromatin at a lateral resolution of ~ 120 nm , 3D-structured illumination microscopy (3D-SIM) was applied using a Plan-Apochromat 63\u00d7/1.4 oil objective of an Elyra PS.1 microscope system and the software ZENblack (Carl Zeiss GmbH). Image stacks were captured separately for each fluorochrome using the 405, 488, and 561 nm laser lines for excitation and appropriate emission filters  and to maintain cross-hybridization capabilities with S. polyrhiza ChrSp08. Another set of 13,682 probes was designed against the rest of ChrSi09 , maintaining cross-hybridization capabilities with S. polyrhiza ChrSp18. Finally, a set of 13,696 probes was designed to cover the entire S. polyrhiza ChrSp19 (ChrSp19:1-3959484) with the ability to hybridize to S. intermedia ChrSi17.A set of 27,116 probes was designed to cover the first 7.79 Mb of Spirodela chromosomes are very similar .As a way to compare probe density along chromosomes and account for potential regions within which probes cannot hybridize to otherwise homeologous chromosomes in species from other genera (for instance due to larger insertions), we defined the Density 100 index (D100) as the probe density of a moving window of a contiguous set of 100 probes expressed in probes/kb of DNA covered by these 100 probes. Each probe set can be described as a collection of D100. Median D100 is used to compare probe set\u2019s potential hybridization to corresponding target chromosomes  and S. intermedia (clones 8410 and 7747). These probes labeled the corresponding three chromosome pairs of S. polyrhiza , , Fig. , confirmSpirodela chromosomes, the same oligo-probe sets were applied to chromosome spreads of species of the other four duckweed genera. The studied species were (with increasing phylogenetic distance to the genus Spirodela): La. punctata clone 7260 , Le. aequinoctialis clone 2018 , Wa. hyalina clone 8640 , and Wo. australiana clone 7540  n and (GAA)n microsatellite motifs , with the prevalence of LTR-retrotransposons (20.9%) and tandem repeats (4.7%). The tandem repeats mainly consisted of microsatellite motifs (GA)n and (GAA)n.The dispersed signals of the ChrSi09end/ChrSp19 probe set on fs Table . A randoLa. punctata, we performed FISH with labeled (GA)15 and (GAA)10 sequences as probes. Both probes hybridized to all chromosomes . One La. punctata satellite repeat revealed a monomer length of 138 bp and an estimated abundance of 0.21% of the genome (LDP_SAT1). FISH with two partly overlapping oligos of 42 nt (H1) and 47 nt (H2) of this GC-rich satellite sequence yielded similar signals as were obtained with labeled (GA)15 and (GAA)10 probes 15 and (GAA)10 sequences were added in excess  to the probe. In spite of a reduction of dispersed signals, no specific labeling of distinct La. punctata chromosomes was recognizable  and Wo. australiana genomes. Le. minor is used here as a surrogate for Le. aequinoctialis, of which the genome is not yet sequenced. Best Blast hits with sequence similarity deemed enough to generate a stable hybridization (> 75% similarity) were sorted by chromosomes , and Wo. australiana chromosome ChrWoa5 (1188 hits). Similarly, probes designed from ChrSi09end match Le. minor chromosomes ChrLemA16 and B16  and Wo. australiana chromosome ChrWoa16 (543 hits). Finally, probes designed from ChrSp19 match Le. minor chromosomes ChrLemB17, A20, and B20  and Wo. australiana chromosome ChrWoa04 (715 hits). To acquire sequence information for evaluating similarities of Spirodela-based oligo-probes to their targets in the La. punctata genome, shotgun Illumina sequencing of the La. punctata genome (clone 7260) was performed and yielded 301.7 million pairs of raw Illumina reads , corresponding to a ~ 215-fold genome coverage. The oligo-probe sequences were blasted against unassembled La. punctuata genome reads, generating 2010 and 1987 hits for ChrSi09beg and ChrSi09end/ChrSp19 probe sets, respectively. Due to the absence of an assembled genome for La. punctuata, likely the number of probes hybridizing to homeologous chromosomes is overestimated since 5 to 15% of all hits on Le. minor and Wo. australiana genomes do not land on preferential chromosomes  yielded chromosome-specific FISH signals within duckweed species of the same genus, but not across genus borders, apparently because of too low density of oligos sufficiently similar to the target chromosome sequences. Minisatellite motifs within the probes may yield dispersed FISH signals, when abundant in the target genome. Oligos containing such motifs should be filtered out. If no assembled genomes are available for the genus of the target species and oligo-FISH across the genus border does not give chromosome-specific results, oligo-probes should be designed from shotgun sequences based on synteny with a related genus. Suitability of probes should be validated by FISH on homologous chromosomes before applied for congeneric karyotyping and identification of homeologous/rearranged chromosomes of congeneric species.ESM 1(PDF 880 kb)"}
+{"text": "The rapid development of antimicrobial resistance is pushing the search in the discovering of novel antimicrobial molecules to prevent and treat bacterial infections. Self-assembling antimicrobial peptides, as the lipidated peptides, are a novel and promising class of molecules capable of meeting this need. Based on previous work on Temporin L analogs, several new molecules lipidated at the N- or and the C-terminus were synthesised. Our goal is to improve membrane interactions through finely tuning self-assembly to reduce oligomerisation in aqueous solution and enhance self-assembly in bacterial membranes while reducing toxicity against human cells. The results here reported show that the length of the aliphatic moiety is a key factor to control target cell specificity and the oligomeric state of peptides either in aqueous solution or in a membrane-mimicking environment. The results of this study pave the way for the design of novel molecules with enhanced activities.  In this scenario, the discovery of antimicrobial strategies alternative to antibiotics represents a huge challenge essential to overcome and reduce the AMR.In the last century, antibiotics saved millions of lives and were essential to treat post-operative infections and avoid the progression of infections in immune-compromised patients,,in\u00a0vivo half-life, etc.)Rana genusRana Temporaria, is one of the most numerous families in terms of isoforms of AMPs (more than 100)2, is a highly potent AMP with activity against both Gram-positive and Gram-negative bacteria3,dLeu9] analogue of TL, named peptide 1A, was previously identified, which it was devoid of toxicity to human erythrocytes, but preserved the activity only against the yeast Candida albicans,3 and Leu9 with proline and d-leucine, respectively, reduced the \u03b1-helical content of native TL, and hence the affinity towards eukaryotic membranes. Another lead compound, TL (1B) derivative, was developed and achieved an enhancement in activity towards Gram-negative bacteria (P. aeruginosa ATCC 27853 and A. baumannii ATCC 19606)1B did not exhibit significant toxicity against human erythrocytes and keratinocytes at its antimicrobial concentrationAntimicrobial peptides (AMPs) account for a novel generation of antimicrobial agents1B we focussed on the establishment of interactions with the Gram-positive and Gram-negative bacterial membranes to enhance membrane permeabilisation. It is well known that the strength of the interaction and the depth of internalisation into the target membrane are related to the antimicrobial capacity and that a strategy to improve interactions and activities is to increase the hydrophobicity,To improve the antimicrobial spectrum activity of peptide 1B and its parent peptide 1A, with the aim to reinforce their interaction with the bacterial membrane and to produce a cell specificity, thus to improve the antimicrobial activity towards Gram-positive and Gram-negative bacterial strains, and also to preserve the non-toxicity of peptide 1B towards eukaryotic cells. The designed compounds were characterised using antimicrobial assays against ATCC reference strains of S. aureus, K. pneumoniae, and P. aeruginosa and cytotoxicity assay. The mechanism of action of the most promising peptides was studied by fluorescence assays such as Laurdan, Thioflavin T, and leakage assays. Their self-assembling in aqueous solution was calculated by critical aggregation concentration (CAC) and their conformational analysis was performed by CD spectroscopy. Additionally, the most active peptide was preliminarily evaluated for its activity against clinically isolated S. aureus, K. pneumoniae and P. aeruginosa strains, and finally, its biostability in human serum was assessed. The results are discussed in terms of parameters involved in their potency, specificity and potential to be developed as novel antimicrobials.Herein, we reported a library of lipopeptides obtained by the conjugation of saturated fatty acids to both N- and C-terminal regions of 2.\u03b1N-Fmoc-protected amino acids used, such as Fmoc-Phe, Fmoc-Val, Fmoc-Pro, Fmoc-Trp(Boc), Fmoc-Ser(tBu), Fmoc-Lys(Boc) and Fmoc-dLys(Boc), Fmoc-Gly, Fmoc-Leu and Fmoc-dLeu, Fmoc-Ile, Fmoc-Arg(Pbf), Fmoc-Phe(4-NO2)-OH, all were purchased from GL Biochem Ltd . Coupling reagents such as N,N,N\u2032,N\u2032-tetramethyl-O-(1H-benzotriazol-1-yl) uranium hexafluorophosphate (HBTU) and 1-hydroxybenzotriazole (HOBt), as well as the Rink amide resin (0.72\u2009mmol/g of loading substitution), used were commercially obtained by GL Biochem Ltd . Fatty acids used, such as tridecanoic, undecanoic, heptanoic, and valeric acids, were purchased by Sigma-Aldrich/Merck. Anhydrous solvents , 1,3-dimethylbarbituric acid, tetrakis-(triphenylphosphine)palladium(0) [Pd(PPh3)4], tin(II)chloride [SnCl2], 2,2,2-trifluoroethanol (TFE) were purchased from Sigma-Aldrich/Merck. Fmoc-Orn(Alloc)-OH, N,N-diisopropylethylamine (DIEA), piperidine, and trifluoroacetic acid (TFA) were purchased from Iris-Biotech GMBH. Moreover, peptide synthesis solvents and reagents, such as N,N-dimethylformamide (DMF), dichloromethane (DCM), diethyl ether (Et2O), water and acetonitrile (MeCN) for HPLC, were reagent grade acquired from commercial sources (Sigma-Aldrich and VWR) and used without further purification.N,N-dimethyl-2-naphthylamine (Laurdan) were purchased by Sigma-Aldrich-Merck. 3\u2013-2,5-diphenyltetrazolium bromide (MTT) and human serum from human male AB plasma, USA origin, sterile-filtered was obtained by Sigma-Aldrich-Merck.Phospholipids: 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-sn glycero-3-phospho-(1\u2032-rac-glycerol) sodium salt (DOPG), and cardiolipin (CL) sodium salt  were purchased from Avanti Polar Lipids , Phosphate-buffered saline (PBS) tablets were bought by Life Technologies Corporation. 8-aminonaphtalene-1,3,6-trisulfonic acid, disodium salt (ANTS) and p-xylene-bis-pyridinium bromide (DPX) were purchased from Molecular Probes. Triton X-100 and the fluorescent probes Nile red, Thioflavin T and 6-dodecanoyl-2.1.2.1.1.1A\u20135A, 1B\u20135B, C, D, E was performed by using the ultrasound-assisted solid-phase peptide synthesis (US-SPPS) integrated with the Fmoc/tBu orthogonal protection strategy\u03b1N-Fmoc-amino acid, HBTU, HOBt (threefold excess), and DIEA (sixfold excess) in DMF to the resin, thus the resulting suspension was irradiated by ultrasound waves for 5\u2009min. After each coupling and Fmoc-deprotection reaction the resin was washed with DMF (3\u2009\u00d7\u20092\u2009ml) and DCM (3\u2009\u00d7\u20092\u2009ml) and Kaiser or Chloranil tests were employed as colorimetric assays to monitor the progress of the synthesis, used for the detection of solid-phase bound primary and secondary amine, respectively. Subsequent Fmoc-deprotection and coupling steps were performed following the same procedures described above.The synthesis of peptides 2.1.2.2A\u20135A, 2B\u20135B was accomplished by reacting the released primary amine in N-terminal region with 3 equiv of valeric (2A and 2B), heptanoic (3A and 3B), undecanoic (4A and 4B), tridecanoic (5A and 5B), acids, respectively, HBTU/HOBt (3 equiv) as coupling/additive reagents, in presence of DIEA (6 equiv) in DMF/DCM (1:1 v/v), by ultrasonic irradiation for 15\u2009min . Upon filtering and washings  of the resin, the lipidation was ascertained by Kaiser test. Thus, peptides 2A\u20135A, 2B\u20135B were released from the resin and simultaneously cleaved by their protecting groups by using a cocktail of TFA/TIS/H2O (95:2.5:2.5 v/v/v) at rt for 3\u2009h. Finally, the resins were removed by filtration and crudes were recovered by precipitation with cool anhydrous Et2O as amorphous solids. As for the synthesis of peptide C, the Fmoc-Phe(4-NO2) reagent was used in the replacement of Fmoc-Phe residue in order to give the valeric acid amide in para position of the aromatic ring of the Phe2) was treated with a 1\u2009M solution of SnCl2 in DMF and the resulting suspension was gently shaken at rt for 12\u2009h2O ], and by chloranil test, as colorimetric assay used to reveal resin-bound aromatic primary amines. Once the reduction of the aromatic nitro group was ascertained, the coupling with valeric acid (3 equiv) was performed by adding HBTU (3 equiv), HOBt (3 equiv), and DIEA (6 equiv) to the resin, and the mixture was therefore stirred on automated shaker at rt for 2\u2009h. The LC-MS analysis and chloranil test were repeated to confirm coupling had achieved >80% conversion. Peptides D and E were otherwise obtained by the introduction of Orn(Alloc) residue at C-terminal. The ornithine allyl protecting group was removed in orthogonal condition with respect to the Fmoc/tBu3)4 (0.15 equiv) and 1,3-dimethylbarbituric acid (3 equiv) in DCM/DMF (3:2 v/v) and gently shaken for 1\u2009h under argon . The resin was filtered and washed with DMF (3\u2009\u00d7\u20092\u2009ml) and DCM (3\u2009\u00d7\u20092\u2009ml), and the Alloc-deprotection procedure was repeated. After the complete removal was ascertained by Kaiser test and LC-MS, the heptanoic (3 equiv) or valeric (3 equiv) acids were coupled to the \u03b4-amine group of Orn by following the same coupling procedure by ultrasonic irradiation as described above. The resin was filtered and washed with DMF (3\u2009\u00d7\u20092\u2009ml) and DCM (3\u2009\u00d7\u20092\u2009ml) and the lipidation was monitored by Kaiser test.The introduction of lipid amidated tails for peptides 2O (95:2.5:2.5 v/v/v), at rt for 3\u2009h, to be released from the resin and cleaved by their protecting groups.Finally, the N-terminal Fmoc group was removed and the peptides were treated with a cleavage cocktail, consisting of TFA/TIS/H1A\u20135A, 1B\u20135B, C, D, E were performed on a Phenomenex Kinetex reverse-phase column  with a flow rate of 1\u2009ml/min using a gradient of MeCN (0.1% TFA) in water (0.1% TFA), from 10 to 90% over 20\u2009min, and UV detection at 220 and 254\u2009nm. Purification of peptides 1A\u20135A, 1B\u20135B, C, D, E was performed by RP-HPLC (Shimadzu Preparative Liquid Chromatography LC-8A) equipped with a preparative column  using linear gradients of MeCN (0.1% TFA) in water (0.1% TFA), from 10 to 90% over 30\u2009min, with a flow rate of 10\u2009ml/min and UV detection at 220\u2009nm. Final products were obtained by lyophilisation of the appropriate fractions after removal of the MeCN by rotary evaporation. All compounds examined for biological activity were purified to >96%, and the correct molecular ions were confirmed by high-resolution mass spectrometry (HRMS) .Analytical UHPLC (Shimadzu Nexera Liquid Chromatograph LC-30AD) analyses to assess critical synthetic steps as well as the purity of final compounds 2.2.2.2.1.Staphylococcus aureus ATCC 25923, Pseudomonas aeruginosa ATCC 27853 and Klebsiella pneumoniae ATCC BAA-1705 (carbapenemase producer) were obtained from the American Type Culture Collection .P. aeruginosa , K. pneumoniae , and S. aureus  were isolated from bloodstream or pulmonary infections, and belong to a collection of bacterial strains established between 2010 and 2018 at the Department of Molecular Medicine and Medical Biotechnologies  for research use. Pa1, Pa2 and Pa3 resulted resistant to carbapenems, fluoroquinolones, and gentamicin; KpCR1, KpCR2 and KpCR3 were carbapenem-resistant since KPC carbapenemase producers; Sa1, Sa2 and Sa3 resulted MRSA strains.Clinical strains of P. aeruginosa was cultured in Brain Heart Infusion broth , S. aureus and K. pneumoniae were cultured in Tryptic Soya broth , under aerobic conditions at 37\u2009\u00b0C, for 24\u2009h on an orbital shaker at 200\u2009rpm.Identification was performed by sub-culturing on Tryptic Soy Agar  and by biochemical characterisation using the Vitek II system (Biomerieux). The antimicrobial susceptibility testing of all isolates was determined using Vitek II system and results were interpreted according to European Committee on Antimicrobial Susceptibility Testing . 2.2.2.2, in 25\u2009cm2 or 75\u2009cm2 flasksSheep red blood cells were purchased from OXOID, SR0051D. The human immortalised keratinocytes HaCaT cells  were cultured in Dulbecco\u2019s modified Eagle\u2019s medium containing 4\u2009mM glutamine (DMEMg), supplemented with 10% heat-inactivated foetal bovine serum (FBS) and 0.1\u2009mg/ml of penicillin and streptomycin, at 37\u2009\u00b0C and 5% CO2.2.3.,6 CFU/ml and a final compound concentration ranging from 0.78 to 100\u2009\u00b5M. Negative control wells were set to contain bacteria in Mueller\u2013Hinton broth plus the amount of vehicle (ethanol) used to dilute each compound. Positive controls included vancomycin (2\u2009\u00b5g/ml), tobramycin (4\u2009\u00b5g/ml), gentamycin (4\u2009\u00b5g/ml), and imipenem (8\u2009\u00b5g/ml). The MIC was defined as the lowest concentration of drug that caused a total inhibition of microbial growth after 16\u201318\u2009h incubation time at 37\u2009\u00b0C.Minimal inhibitory concentrations (MIC) of all the peptides were determined in Mueller\u2013Hinton medium by the broth microdilution assay, following the procedure already described2.2.4.1B, 3B, 2B and C. Controls were erythrocytes treated with vehicle (water). The samples were then centrifuged for 5\u2009min at 900\u2009\u00d7\u2009g. The amount of haemoglobin released in the supernatant by lysed red blood cells was measured at 415\u2009nm using a microplate reader  and compared to the complete lysis (100%), obtained by suspending erythrocytes in distilled water,,4 HaCaT cells, suspended in DMEMg supplemented with 2% FBS, were plated in each well of a 96-well microtiter plate. After overnight incubation, at 37\u2009\u00b0C in a 5% CO2 atmosphere, keratinocytes were treated for 24\u2009h with fresh serum-free medium containing the peptides 3B and C at concentrations ranging from 3.12\u2009\u00b5M to 25\u2009\u00b5M. Afterward, the culture medium was replaced with Hank\u2019s buffer supplemented with 0.5\u2009mg/ml MTT and the plate was incubated at 37\u2009\u00b0C and 5% CO2 for 4\u2009h. At the end, acidified isopropanol was employed to dissolve the formazan crystals. Cell viability was calculated, with respect to cells not treated with peptide, by absorbance measurements at 570\u2009nm using a microplate reader The haemolytic assay was conducted following the procedure described. Aliquots of sheep red blood cells at O.D. of 0.5 (\u03bb\u2009=\u2009500\u2009nm) in 0.9% (w/v) NaCl were incubated for 40\u2009min at 37\u2009\u00b0C with four different concentrations (ranging from 3.12 to 25\u2009\u00b5M) of peptides 2.2.5.18, 4.6\u2009mm x 150\u2009mm, 5\u2009mm) and H2O (0.1% TFA) and MeCN (0.1% TFA) as eluents.Human serum from human male AB plasma was acquired by Sigma-Aldrich-Merk. Water and MeCN were obtained from commercial suppliers and used without further purification. Analytical RP-UHPLC was performed on a Shimadzu Nexera equipped with a Phenomenex Kinetex column . The resulting reaction solution was incubated at 37\u2009\u00b1\u20091\u2009\u00b0C. Aliquots of the reaction solutions were taken at known time intervals , subjected to serum proteins precipitation by addition of MeCN . The cloudy reaction sample was cooled (4\u2009\u00b0C) for 15\u2009min and then spun at 13000\u2009rpm for 10\u2009min to pellet the precipitated serum proteins. The supernatant was then analysed by RP-UHPLC by using a linear elution gradient from 10 to 90% MeCN (0.1% TFA) in water (0.1% TFA) over 20\u2009min. A flow rate of 1\u2009ml/min was used, absorbance was detected at 220\u2009nm, and the analysis was performed at room temperature.Serum stability was evaluated by modification of elsewhere described methods2.3.1B, 2B, 3B, C, were prepared as follows1B, C) or tetrahydrofuran  and sonicating for 15\u2009min. Different aliquots were taken to prepare solutions of each peptide at different concentrations . Then, all solutions were diluted with water, sonicated for 15\u2009min and freeze-dried. Finally, the peptide powders were dissolved with the right volume of solution A and allowed to stand in the dark place for 1\u2009h before measurement. Emission spectra for each solution were measured by a Cary Eclipse Varian spectrometer. Spectra were taken between 570 and 700\u2009nm at a slit width of 5\u2009nm, using an excitation wavelength of 550\u2009nm and a 10\u2009nm slit width. The measurements were performed in triplicate. The data were analysed by plotting the maximum emission fluorescence corresponding wavelength (y) as a function of peptide concentration (x) and fitting with the sigmoidal Boltzmann equation:A1 and A2 correspond to the upper and lower limits of the sigmoid, x0 is the inflection point of the sigmoid and \u0394x is the parameter, which characterises the steepness of the function. The sigmoidal plot allows calculating the CAC value at x0.The solvatochromic fluorescent probe Nile red is widely used to determine the CAC of self-assembling peptides. Nile red shows a blue shift with decreasing solvent polarity. Since Nile red is poorly soluble in water, there is a large preference to partition aggregates, which offer hydrophobic binding sites. Initially, 1\u2009mM methanolic Nile red was prepared. Then, the methanolic Nile red was diluted with water in order to have a final concentration of 500\u2009nM (solution A). The peptides 2.4.Large unilamellar vesicles (LUVs) and small unilamellar vesicles (SUVs) consisting of DOPG/CL (58/42 ratio in moles) and DOPG/DOPE/CL (63/23/12 ratio in moles), mimic the Gram-positive membrane and Gram-negative membrane, respectively. LUVs were prepared using the extrusion method as previously described2.5.iF\u2212F0)/(tF\u2212F0), where F0 represents the fluorescence of intact LUVs before the addition of peptide, and iF and tF denote the intensities of the fluorescence achieved after peptide and Triton-X treatment, respectively.The ANTS/DPX leakage assay was used to measure the ability of peptide to permeabilise and induce leakage of encapsulated dyes. After lipid films were prepared as previously described, ANTS (12.5\u2009mM) and DPX (45\u2009mM) were dissolved in 2\u2009ml water, were added to lipid films and then lyophilised overnight. The lipid films with encapsulated ANTS and DPX were hydrated with PBS 1X buffer, vortexed for 1\u2009h and then treated to obtain LUVs. The non-encapsulated ANTS and DPX were removed by gel filtration using a Sephadex G-50 column (1.5\u2009cm \u00d7 10\u2009cm) at room temperature2.6.ex 365\u2009nm in the absence or presence of peptide. Laurdan emission can shift from 440\u2009nm, in the ordered phase, to 490\u2009nm in the disordered phase. The Generalised Polarisation (GP) is a parameter commonly used to quantify the change in the lipid fluidity. It was calculated as GP = (I440 \u2212 I490)/(I440 + I490), where I440 and I490 are the fluorescence intensities at the maximum emission wavelength in the ordered (\u03bbem 440\u2009nm) and disordered (\u03bbem 490\u2009nm) phasesMembrane fluidity was determined using LUVs containing the fluorescent probe Laurdan2.7.A= (fF \u2212 F0)/(Fmax \u2212 F0)fF is the value of fluorescence after peptide addition, F0 the initial fluorescence in the absence of peptide and Fmax is the fluorescence maximum obtained immediately after peptide addition.Peptide aggregation in bacterial membrane was assayed using fluorescent probe Thioflavin T (ThT). ThT associates rapidly with aggregated peptides giving rise to a new excitation maximum at 450\u2009nm and an enhanced emission at 482\u2009nm2.8.CD spectra were recorded at room temperature on a Jasco J-715 spectropolarimeter in a 1\u2009cm quartz cell under a constant flow of nitrogen gas. The spectra are an average of 3 consecutive scans from 260 to 190\u2009nm, recorded with a bandwidth of 3\u2009nm, a time constant of 16\u2009s, and a scan rate of 10\u2009nm/min. Spectra were recorded and corrected for the blank. A solution of 8\u2009\u00b5M of the peptide with SUVs consisting of DOPG/CL (58/42 ratio in moles) was prepared, as reported above, and then hydrated with phosphate buffer 5\u2009mM3.3.1.1B and its parent peptide 1A. Valeric, heptanoic, undecanoic and tridecanoic acids were linked at the N-terminus of 1A and 1B  in para position of the Phe1B achieving peptides D and E.To induce self-assembling properties in cationic peptides and influence their interaction with bacterial membranes and consequently their antimicrobial and broad-spectrum activity, we designed a library of lipopeptides by the addition of fatty acids of variable length at the N- and C-termini of peptide A and 1B , to obta3.2.1A\u20135A, 1B\u20135B and C, D, E) was initially assessed against the reference bacterial strains of P. aeruginosa ATCC 27853, K. pneumoniae ATCC BAA-1705 and S. aureus ATCC 25923 by evaluating their minimal growth inhibitory concentration (MIC). The MIC values are shown in 1A was active against all tested microorganisms with a stronger efficacy towards S. aureus (MIC of 6.25\u2009\u00b5M), compared to 50\u2009\u00b5M for both P. aeruginosa and K. pneumoniae. Peptide 1B resulted to be active against all tested microorganisms with a stronger efficacy towards S. aureus (MIC of 6.25\u2009\u00b5M), compared to 12.5\u2009\u00b5M for P. aeruginosa and K. pneumoniae. Peptides 4A, 5A, 4B and 5B did not show any antimicrobial effect up to 100\u2009\u00b5M, while the best activity was obtained for peptide 3B on S. aureus (MIC of 3.12\u2009\u00b5M), and peptide C on K. pneumoniae and S. aureus (MIC of 6.25\u2009\u00b5M). In comparison, peptides 2A and 3A were inactive against the Gram-negative bacterial strains while a discrete activity was shown against the Gram-positive S. aureus (MIC of 12.5\u2009\u00b5M).The antimicrobial activity of lipopeptides , while a discrete activity was reported on S. aureus (12.5\u2009\u00b5M). By considering the results here reported, we selected the peptides that showed the best antimicrobial activity both on Gram-positive and Gram-negative bacteria. Thus, peptides 1B and C were further assessed against clinical strains of multidrug-resistant P. aeruginosa, carbapenemase producer K. pneumoniae, and methicillin resistant S. aureus (MRSA). As reported in 1B and C were able to efficiently inhibit the growth of all the tested clinical strains, even though at different MIC values.Peptides 3.3.3.3.1.1B, 2B, 3B, and C, was evaluated at short-term against mammalian red blood cells after 40\u2009min treatment at different concentrations. As reported in 1B, 2B and C showed a weak haemolytic activity (lower than 20%) at 3.12 and 6.25\u2009\u00b5M. Peptide 3B showed the highest haemolytic potency (over 50%), especially at the highest concentrations used. Interestingly, compounds 1B and C had a similar haemolytic profile, with a percentage of lysed cells of about 30% at the highest concentrations tested (12.5 and 25\u2009\u00b5M). For long-term treatment (24\u2009h), the cytotoxic effect of peptides 3B and C was further investigated by the 3\u2013-2,5-diphenyltetrazolium bromide (MTT) assay on human keratinocytes (HaCaT cells) , resulting even less toxic than peptide 1B, already shown in Merlino et\u00a0al. The cytotoxic effect of the active compounds, T cells) . Compoun3.3.2.\u00b1\u20091\u2009\u00b0C within 120\u2009min and the percentage of intact peptide was calculated by the peak area of the RP-HPLC performed on a Phenomenex Kinetex column  chromatograms using a linear gradient from 10 to 90% MeCN (0.1% TFA) in water (0.1% TFA) over 20\u2009min . 1B and C. As expected, peptide 1B, our starting sequence is rapidly degraded and cleaved in fragments, notwithstanding the presence of D amino acids. Chemical modifications in the sequence and formation of the self-assembled structures can significantly modify enzymatic degradation rates. As a matter of fact, we observed that peptide C is stable up to 1\u2009h .In 1B  and heptanoic (3B) acids at the N-terminus showed a significant ability to aggregate with a CAC, respectively, of 20.9 and 9.33\u2009\u00b5M (C is higher (39.5\u2009\u00b5M) indicating that the peptide is still able to aggregate but the presence of the positive charge on the N-terminal amino group reduced its aggregating ability  and DOPG/DOPE/CL (63/23/12) mimicking Gram-positive and Gram-negative membranes were prepared and used for membrane interaction studies.S. aureus  experiment was used to determine the peptide aggregation state in membrane4.,The activity of AMPs in terms of their capacity to permeabilise the membrane of Gram positive and Gram negative bacteria is dependent on different equilibria which take place both in the aqueous and in the lipid milieu. The initial electrostatic interactions between AMPs and negatively charged membranes of bacteria leads to an increased peptide concentration on the membrane surface that favours the membrane penetration through several possible mechanisms such as the carpet, barrel-stave and toroidal pore mechanisms,Much research is focussed on membrane interactions of monomeric AMPs and how to control lipid affinity to obtain selective destruction of bacterial membranesRecently, several studies have been carried out on self-assembling materials such as diphenylalanine to provide model systems for the development of antibacterial agents; these systems although efficient in fighting the infection are difficult to develop further because of toxicity issues. A challenging alternative is to engineer AMPs and tune their self-assembling ability favouring aggregation in membrane environments but not in aqueous media to enhance their activity while reducing their toxicity, establishing an innovative design principle for the development of antibacterial materials. Modifications of native sequences may also aid in increasing the stability and half-life of peptides while augmenting and controlling their local concentration.The spontaneous organisation of molecules into ordered aggregates through supramolecular interactions, known as self-assembly, can be achieved by the rational design. In this context, lipopeptides represent an interesting approach and can be exploited to increase hydrophobicity, favour self-assembly, and boost membrane binding to strongly enhance antimicrobial activity and reduce toxicity against human cells. Residues containing long acyl chains can insert into lipid membranes despite the composition of the latter and induce non-selective, membrane destabilisation. It was also previously shown that single lysine residue attached to palmitic acids are not active, which further supports the view that activity is not only dictated by hydrophobicity but also requires a specific peptide sequenceIn this study, we have investigated different aspects related to the antibacterial activity of TL derivatives both in water solution and in membrane mimetic environment.1A and 1B, obtaining peptides 2A\u20135A and 2B\u20135B (1A (2A\u20135A) resulted in less active than those obtained from peptide 1B (2B\u20135B and C) against both Gram-positive and Gram-negative bacteria  in para position of the Phe1B  compared to C (CAC 39.5\u2009\u00b5M) and 1B, which is not aggregated at the concentration tested (Peptides n tested . The pre1B and C). We thus hypothesised that oligomerisation is a key parameter to aid the interactions with the membrane for AMPs but this process has to take place inside the membrane and any oligomer already present in the aqueous solution may prevent the interaction. The ThT assay allowed us to understand that our compound presents a greater interaction with Gram-positive membranes  and in particular the greatest aggregation in the membrane is observed for compound C  is the only one to show a higher activity against K. pneumoniae and S. aureus. The analysis of the data showed that also from a biophysical point of view the interaction of C with membrane mimicking Gram-negative bacteria is stronger compared to the other peptides. Nonetheless, it is interesting to note that the interaction is very different because the aggregation is less evident but the fluidity of the membrane changes more. The conformational change inside the membrane is clearly involving the presence of \u03b2-structures compared to helical aggregates in Gram-positive membranes. We may hypothesise that the mechanism of interaction with Gram-positive and negative bacteria is completely different, involving different secondary structures although both leading to leakage of the membranes.The balance between hydrophobicity and hydrophilicity also helps to reduce haemolysis and toxicity. Interestingly, the same peptide (Biological data on clinical strains further support the possible application of TL analogues such as those reported in this paper as novel AMPs able to help in the fight against antibiotic resistant bacteria.Click here for additional data file."}
+{"text": "In Vaccinia virus (VACV), the prototype poxvirus, scaffold protein D13 forms a honeycomb-like lattice on the viral membrane that results in formation of the pleomorphic immature virion (IV). The structure of D13 is similar to those of major capsid proteins that readily form icosahedral capsids in nucleocytoplasmic large DNA viruses (NCLDVs). However, the detailed assembly mechanism of the nonicosahedral poxvirus scaffold has never been understood. Here we show the cryo-EM structures of the D13 trimer and scaffold intermediates produced in vitro. The structures reveal that the displacement of the short N-terminal \u03b1-helix is critical for initiation of D13 self-assembly. The continuous curvature of the IV is mediated by electrostatic interactions that induce torsion between trimers. The assembly mechanism explains the semiordered capsid-like arrangement of D13 that is distinct from icosahedral NCLDVs. Our structures explain how a single protein can self-assemble into different capsid morphologies and represent a local exception to the universal Caspar-Klug theory of quasi-equivalence. Immature poxviruses are characterized by nonicosahedral semiordered protein scaffolds critical for morphogenesis. Here, the authors use cryo-EM structures of Vaccinia virus D13 scaffold intermediates to explain their assembly mechanism. Viral infection typically causes skin lesions but can also prove fatal, as in the case of smallpox. Despite eradication of smallpox, zoonotic outbreaks of smallpox-like diseases urge thorough understanding of the poxvirus replication cycle to facilitate the development of strategies for prevention and treatment2. A common feature of NCLDVs is the presence of major capsid proteins with a double-jelly-roll motif that assemble into icosahedral capsids. Notable exceptions are poxviruses, ascoviruses, and pandoraviruses, which exhibit variable capsid diameters and do not follow canonical symmetry4. In Vaccinia virus (VACV), copies of the double-jelly-roll protein D13 bind to the viral membrane via interaction with its partner protein A17 and assemble into a scaffold surrounding the viral membrane6. This process leads to the formation of a spherical immature virion (IV). Subsequent proteolytic processing of A17 releases the D13 scaffold from the viral membrane, leading to a dramatic transformation into the brick-shaped mature virion (MV). Unbound to the viral membrane, D13 exist as trimers and is found forming aggregated hexagonal patches and rodlets in the viral factory. Only with the expression of viral late proteins and in association with the viral membrane, D13 trimers assemble into a crescent-shaped honeycomb lattice followed by complete formation of the spherical immature virion upon DNA uptake8. However, in vitro assembly of D13 demonstrated formation of spherical particles with the morphology comparable to authentic IV scaffolds9. This suggests that the intrinsic curvature induced by D13 self-assembly is playing a major role in governing the shape and size of IVs10. Hence, detailed molecular insights into the intermolecular D13 interactions are needed to understand the scaffold assembly mechanism.Poxviruses share a common phylogeny and replication pathways similar to those of NCLDVs12. D13 adopts a double-jelly-roll structure composed of 8 antiparallel \u03b2-strands. A head domain is inserted between \u03b2-strands of the C-terminal jelly roll. Recently, the structure of D13 in complex with the antibiotic rifampicin was determined by X-ray crystallography, illustrating the mechanism by which the antiviral drug prevents binding of A17, occupying the phenylalanine-rich pocket on the 3-fold axis of the D13 trimer12. Inhibition of the D13-A17 interaction would impair recruitment of D13 onto the viral membrane, leading to aberrant virion formation, as previously demonstrated by mutagenesis17. However, none of the crystallographic packing arrangements from any of the reported structures represent the honeycomb-shaped lattice observed on the surface of authentic IV, and intertrimer interactions that govern D13 assembly have been poorly resolved. Low-resolution electron microscopy and three-dimensional (3D) reconstructions obtained from negatively stained two-dimensional (2D) planar arrays of D13 and its orthologue, orfv075 protein, from orf virus provided the overall organization of trimers in the context of the honeycomb-shaped lattice18. Nevertheless, the molecular details of the intertrimer interface were inconclusive in these studies. Here we show the cryo-EM structures of D13 trimers, trimer doublets, and the tubular assembly of an expanded honeycomb lattice produced in vitro. The structures reveal that the short N-terminal \u03b1-helix is critical for the initiation of D13 self-assembly. The continuous curvature of the immature virion is mediated by electrostatic interactions that induce torsion between the trimers. The results explain the mechanism of semiordered capsid-like arrangement of D13, which is distinct from homologous capsid proteins of icosahedral NCLDVs. Our structures demonstrate how a single protein can self-assemble into different capsid morphologies induced by a small conformational change of a peripheral helix.The 62-kDa D13 protein exists as trimers both in vivo and in vitro, and structures of the recombinantly expressed D13 trimer have been determined by X-ray crystallography12. However, the presence of the short N-terminal tail \u03b1-helix (aa 1-10) was inconsistent with previously reported models. In the first two crystal structures, electron density for this helix was only observed in the D13D513G mutant but not in wild type protein11, whereas subsequently reported crystal structures contain the corresponding density in only two of the three subunits12. Our cryo-EM map showed intact N-terminal tail \u03b1-helices in all three subunits, with or without imposition of 3-fold symmetry, although reduced local map resolution and the increased B-factor suggested that the helix was prone to dislocation . Initial attempts were hampered by problems associated with preferred particle orientation and spontaneous protein assembly into honeycomb-like crystalline patches that consist of rings of five or six trimers  and a hairpin loop between \u03b2-strands C and D (CDH loop) in the head domain. The interface is clustered with polar  and charged amino acid residues  around the two-fold symmetry axis. Side chains of R353 in the EFH loop and D325 in the CDH loop extend toward each other, suggesting salt bridge interactions. Another interface is located at the base of the trimers, which would be proximal to the viral membrane in the IV. At this interface, the major difference of doublet structure in comparison to the singlet trimer is the unambiguous absence of the N-terminal tail \u03b1-helix  and the loop connecting \u03b2-strands G and H of the C-terminal jelly-roll (GHC loop) in the neighboring trimer. Unlike the head-to-head interface, this interaction occurs pairwise between two monomers in each of the two trimers. The clearly resolved features in the reconstructed electron potential map between Y62 and R498 suggests cation-\u03c0 interactions as the main stabilizer at this interface. We found Y62 in close proximity to I6 of the N-terminal tail \u03b1-helices in the singlet trimer structure, suggesting that the hydrophobic interaction between these residues may have been altered in favor of intertrimeric interaction in the doublet structure, upon dislocation of the N-terminal tail \u03b1-helix. Furthermore, the doublet is characterized by a slight twist of the trimer axes defined by a torsion angle of 8.0\u00b0, leading to an arched arrangement when the doublets are linearly expanded  assembled into spherical particles with an average diameter of approximately 340\u2009nm, revealing a distinctive honeycomb-shaped pattern  and the His6-tag, which reach into the hydrophobic pocket as seen in a crystal structure (PDB ID 3SAM)9 and thereby perturb the position of the N-terminal helix  with a truncation of 17 N-terminal amino acid residues, including the N-terminal tail \u03b1-helix. Our cryo-EM reconstruction of the mutant displayed no significant change from wild-type D13 (wtD13) or D13 with an intact N-terminal His6-tag. This mutant assembled into tubular and spherical structures that exhibit a honeycomb-like lattice  showed aggregated honeycomb-like patches and rodlets without any IV-like particles Fig.\u00a0. Under tice Fig.\u00a0 under lo18-548 were subjected to cryo-EM and helical reconstruction  appeared most prominent. In the other moiety, the EFH loop is in close proximity to charged residues in a short \u03b2-strand in the DEN loop (E77 and K79) and a short \u03b1-helix in the HIN loop (E205 and K204). Symmetric Y62-R498 interactions were no longer found in the base-to-base interface of the mode II arrangement. One moiety appears to involve a cation-\u03c0 interaction between Y62 and R446 in \u03b2-strand E of the C-terminal jelly roll (Ec), replacing R498 in the mode I arrangement. The other moiety exhibits close contact between R498 of one monomer and Y62 and D60 of the other monomer. Residues R353 and Y62 were critical in all modes of arrangements for head-to-head and base-to-base interfaces, respectively. This was confirmed by mutation of these residues to alanine, resulting in assembly incompetence in low-salt buffer  major capsid protein, although such curvature depends on the microenvironment within the icosahedron and is dissimilar to continuous curvature in the case of poxvirus scaffolds21.Poxvirus scaffolds consist of loosely connected rings of six trimers in contrast to tightly packed capsomers of icosahedral NCLDV capsids that require additional minor capsid proteins and accessory proteins7. N-terminal helices have been found to act as anchors on proximal lipid membranes in double-jelly-roll capsid proteins of dsDNA bacteriophages and African swine fever virus (ASFV)27. However, such interactions were only proposed to stabilize the capsid and not to initiate assembly.We found that the N-terminal short tail \u03b1-helix of D13 is critical for in vitro assembly into ordered structures. We propose that repositioning of the N-terminal tail \u03b1-helix away from D13 toward the surface of the lipid bilayer may act as a molecular trigger that initiates scaffold assembly in vivo. This scenario implies that D13 assembly into a scaffold occurs in situ only when bound to the viral membrane via the D13-A17 interaction, but not before, thereby preventing the virion assembly sequence without a lipid membrane. This is supported by cellular cryo-electron tomography (cryo-ET) of immature poxvirus, which showed that intact scaffold formation requires association with a lipid membrane14 . The Caspar-Klug theory has been instrumental in understanding the molecular symmetry of icosahedral viruses and many other macromolecular assemblies. With the advent of cryo-EM at near-atomic resolution, a number of deviations from ideal symmetry have been discovered30. The VACV scaffold is an example of such a deviation, in which D13 is uniquely responsible for generating various building blocks and continuous curvature. The observation of pentameric tiling , 600\u2009mM NaCl, 50 mM L-arginine, 50 mM L-glutamic acid and 2\u2009mM \u03b2-mercaptoethanol.The gene encoding D13 of Western Reserve strain Vaccinia virus in the pPROEX-Hta vector was expressed in BL21(DE3) cells and purified by immobilized metal affinity chromatography (IMAC) using HisTrapHP (Cytiva). The N-terminal His18-548) was generated by PCR using a forward primer lacking the leading 51 bases of the D13 DNA sequence. Point mutations R353A and Y62A were introduced to wtD13 and D1318-548 using a Q5 site-directed mutagenesis kit (New England Biolabs Inc.). Expression and purification procedures for the mutant were identical to those of wtD13. Primers used for mutagenesis are listed in Supplementary Table\u00a0The N-terminal truncation mutant D13318-548 wg. Then, 80\u2009\u00b5L supernatant was removed, and the pellet was resuspended using the remaining solution. The pellet sample was negatively stained with 2% uranyl acetate and examined using TEM to confirm the assembly. The remaining supernatant was checked by TEM to confirm the presence of homogeneous trimers. This preparation was used for cryo-EM of singlet trimer particles.A 100-\u00b5L aliquot of purified protein at approximately 2\u2009mg/mL was dialyzed in buffer containing 10\u2009mM Tris-HCl (pH 8.0), 150\u2009mM NaCl, and 2\u2009mM \u03b2-mercaptoethanol at 4\u2009\u00b0C for at least 12\u2009h. The resulting turbid solution was centrifuged at 18,363\u2009\u00d7\u2009Routine TEM examinations were performed using negatively stained samples. A total of 5\u2009\u00b5L of protein at approximately 0.01\u2009mg/mL were loaded onto freshly glow-discharged EM grids with continuous carbon support films. A total of 90\u2009s were allowed for sample adsorption, and then grids were washed with three droplets of distilled water. A total of 5\u2009\u00b5L of 2% uranyl acetate solution were loaded onto grids, followed by 60-s incubation. A piece of filter paper was used to blot excess stain solution and grids were air-dried. Specimen grids were examined using a Talos L120C TEM equipped with a Ceta CMOS detector (Thermo Fisher Scientific (TFS)), operating at 120\u2009kV acceleration voltage.6-tagged D13 trimers and D1318-548 trimers, 3\u2009\u00b5L of protein at 0.12\u2009mg/ml were loaded onto holey EM grids  treated with graphene oxide film flakes (Sigma Aldrich). The sample was vitrified on a Vitrobot Mark IV (TFS) operating at 4\u2009\u00b0C and >90% relative humidity. wtD13 image data were acquired with a Titan Krios TEM (TFS) operating at 300\u2009kV at a nominal magnification of 155,000\u00d7, corresponding to 0.518\u2009\u00c5/pixel at the specimen level, with the defocus ranging between 0.5\u2009\u00b5m and 1.5\u2009\u00b5m. Spot size 8, C2 aperture 70\u2009\u00b5m, OL aperture 100\u2009\u00b5m and 1.8\u2009\u00b5m illumination area were used. 50 movie fractions were collected on a Falcon 3EC direct electron detector in electron counting mode using EPU software (TFS), with a total electron dose of 50\u2009e\u2212/\u00c52 and dose rate of 1.6 e\u2212/\u00c52/s. His6-tagged D13 image data were collected with a Titan Krios TEM (TFS) operating at 300\u2009kV at a nominal magnification of 155,000\u00d7, corresponding to 0.518\u2009\u00c5/pixel at the specimen level, with the defocus ranging between 0.5\u2009\u00b5m and 1.5\u2009\u00b5m. Spot size 8, C2 aperture 70\u2009\u00b5m, OL aperture 100\u2009\u00b5m and 1.8\u2009\u00b5m illumination area were used. 50 movie fractions were collected on a Falcon 3EC direct electron detector in electron-counting mode using EPU software (TFS), with a total electron dose of 50 e\u2212/\u00c52, and dose rate of 1.6 e\u2212/\u00c52/s. D1318-548 data were collected on a Talos Arctica TEM (TFS) operating at 200\u2009kV at a nominal magnification of 92,000\u00d7, which corresponds to 1.12\u2009\u00c5/pixel at the specimen level, with defocus ranging between 0.6\u2009\u00b5m and 1.2\u2009\u00b5m. The spot size was 9. A 70-\u00b5m C2 aperture and 100-\u00b5m OL aperture were used. Exposures were acquired as movies of 50 dose fractions on a Falcon 3 direct electron detector in\u00a0electron counting mode using EPU software (TFS), with a total electron dose of 50 e\u2212/\u00c52 at a dose rate of 0.6 e\u2212/\u00c52/s.For wtD13 trimers, His\u2212/\u00c52 at a dose rate between 0.6 and 0.9\u2009e\u2212/\u00c52/s.For D13 doublets, multiple datasets were collected to enrich the angular orientation of particle images. The first two datasets were collected from a grid prepared for the D13 trimer singlet using holey carbon grids with additional graphene oxide film. For the third and fourth datasets, samples were prepared on gold grids  without a graphene oxide support film. Vitrification methods were the same for all grid preparations. For the third and fourth datasets, in which D13 trimers were preferentially oriented and partially assembled, the microscope stage was tilted to 30\u00b0 and 45\u00b0, respectively. Image data were collected on a Talos Arctica TEM (TFS) operating at 200\u2009kV at a nominal magnification of 92,000\u00d7, which corresponds to 1.12\u2009\u00c5/pixel at the specimen level, with defocus ranging between 0.5\u2009\u00b5m and 5.0\u2009\u00b5m. The spot size was 9 or 10. A 50- or 70-\u00b5m C2 aperture and 100-\u00b5m OL aperture were used. Exposures were acquired as movies of 50 dose fractions on a Falcon 3 direct electron detector in electron counting mode using EPU software (TFS), with a total electron dose of 50 e\u2212/\u00c52 at a dose rate of 5 e\u2212/\u00c52/sec.For tubular D13 assembly, 3\u2009\u00b5L of resuspended pellet from the assembly solution were loaded onto a holey EM grid . Vitrification methods were the same as above. Data were acquired on a Titan Krios TEM (TFS) operating at 300\u2009kV in EFTEM mode (Gatan Quantum 968) at a nominal magnification of 105,000\u00d7 corresponding to 1.39\u2009\u00c5/pixel at the specimen level, with defocus ranging between 0.5 and 2.5\u2009\u00b5m. Spot size 7, a 70-\u00b5m C2 aperture and 100-\u00b5m OL aperture were used. 50 dose fractions/movie were recorded with a K2 Summit direct electron detector (Gatan) and EPU software (TFS), with a total electron dose of 50 e6-tagged D13 into low-salt buffer were mixed with 10-nm gold fiducial marker (AURION) in a 4:1 (v:v) ratio. 3\u2009\u00b5L of the mixture were loaded onto a nonglow-discharged holey EM grid  and vitrified on a Vitrobot Mark IV (TFS) operating at 4\u2009\u00b0C and >90% relative humidity. Tomographic data were acquired on a Titan Krios TEM (TFS) operating at 300\u2009kV at a nominal magnification of 45,000\u00d7 corresponding to 2.26\u2009\u00c5/pixel at the specimen level, defocused between 5.0 and 6.0\u2009\u00b5m. The spot size was 9, and a 70-\u00b5m CL aperture with a 100-\u00b5m OL aperture and a 1.8-\u00b5m beam diameter area were used. A dose-symmetric tomography acquisition scheme was applied on a Falcon 3 direct electron detector in EC mode using Tomography 4 software (TFS) over a\u2009\u00b163\u00b0 tilt with 3\u00b0 intervals. The total dose applied to each tomogram was approximately 120 e\u2212/\u00c52, and 5 movie fractions were collected for each tilt image at a dose rate of 0.14\u2009e\u2212/\u00c52/s.For cryo-ET of spherical IV-like particles, assembly solutions that resulted from introducing His34. Motion correction and contrast transfer function (CTF) estimation were performed using MotionCor235 and CTFFIND436, respectively. Statistics of individual datasets can be found in Supplementary Table\u00a037, Chimera X38 and PyMol .All single-particle datasets were processed with Relion 3.1 software unless stated otherwiseFor wtD13 trimers, 2,168 dose-weighed micrographs were manually inspected. Images without graphene oxide support, poor estimated maximum resolution or strong astigmatism from CTFFIND calculations were discarded. From 1,862 assorted micrographs, particles were automatically picked using 2D class averages of manually picked particles as a template. A total of 668,437 particles were binned by 4 and extracted into 128 pixel squared boxes. The particles were then subjected to two rounds of 2D classification to eliminate poorly aligned particle images .For His18-548 trimers, 1,112 dose-weighed micrographs out of 1,227 total micrographs were selected after removing micrographs with poor estimated maximum resolution or strong astigmatism. A total of 743,834 particles were semiautomatically picked, binned by 2, and boxed in 128-pixel squared boxes. A 2D classification was performed to remove poorly aligned images, and 475,652 good particles were re-extracted from unbinned micrographs (1.12\u2009\u00c5/pixel), into 256-pixel square boxes. 3D classification was performed without symmetry imposition and 156,813 particles that belong to classes with detailed structural features were selected. 3 rounds of 3D refinement with C3 symmetry were performed, with CTF refinement and particle polishing between. The final resolution of the 3D reconstruction was estimated at 4.10\u2009\u00c5 resolution (FSC\u2009=\u20090.143).For D13https://3dfsc.salk.edu/)39. The resulting estimate indicates global resolution at 4.55\u2009\u00c5 at 0.143 FSC and sphericity of 0.769 , in which each movie dataset was independently processed for beam-induced motion correction, CTF estimation, and particle autopicking. Particle autopicking was performed using a template 3D map produced by artificially joining two copies of D13 trimer maps. To minimize the effect of reference bias on the high-resolution signal imposed by particle picking, the template was low-pass filtered to 20\u2009\u00c5. A total of 835,797 particles from a combined 1,695 micrographs were binned by a factor of 2 and extracted into 128-pixel squared boxes. Particle images were subjected to 2D class averaging, from which images that belonged to classes with poor structural features were eliminated . For signal subtraction, a volume segment that corresponds to a ring of six trimers in the tube was generated from the reconstruction using UCSF Chimera. The map was then used to create a binary mask embracing six trimers, which was applied to the symmetry-expanded stack of particle images. Signalsubtracted sextet images were subjected to 2D class averaging using cisTEM41, and 303,052 particles from good class averages were selected for autorefinement in 3 classes  were binned by 4 and extracted into 256-pixel squared boxes. A total of 194,960 particle images were subjected to 2D classification, from which 129,652 images belonging to class averages with good structural details were selected. Helical parameters were estimated by manual analysis of the helical layer-line pattern from the 2D class averages  implemented in IMOD43.For Cryo-ET data, movie frames were aligned and summed using MotionCor2. Images were phase-flipped using ctfphaseflip44 in the Phenix software suite prior to model refinement. All coordinate refinements were performed using the real-space refinement routine in Phenix45. The X-ray crystal structure of D13 (PDB ID 6BEI) was manually fitted into the cryo-EM map of our D13 trimer in UCSF Chimera and used as a reference model for atomic coordinate refinement in Phenix, while enforcing a noncrystallographic symmetry constraint. The resulting refined trimer model was then used as a reference to refine models of the trimer doublet and sextet. These refined models were manually inspected and adjusted in Coot46, followed by final refinement with Phenix. The quality of the final models and map-to-model correlations were calculated using Phenix\u2019 Cryo-EM validation and Mtriage tools47.3D reconstructions were subjected to density modification with the ResolveCryoEM toolFurther information on research design is available in the\u00a0Supplementary InformationPeer Review FileDescription of Additional Supplementary FilesSupplementary Movie 1Reporting Summary"}
+{"text": "Introduction: The global spread of emerging infections has increased the demand for infectious disease (ID) experts. There is no established method to evaluate the sufficiency of professionals on a regional basis. We aimed to determine the correlation of the number of ID doctors and certified nurses in infection control (CNIC) with the prevalence of representative antimicrobial-resistant (AMR) pathogens across the 47 prefectures in Japan using publicly available databases.Methods: We determined the number of ID doctors and CNIC registered in each prefecture based on the Japanese Association for Infectious Diseases and the Japanese Nursing Association websites and calculated their numbers per 100,000 population. Data on representative AMR pathogens were extracted from the Japan Nosocomial Infections Surveillance database. Spearman\u2019s correlation coefficient was used to measure statistical associations.Staphylococcus aureus, vancomycin-resistant Enterococcus faecium, cefotaxime- or levofloxacin-resistant Escherichia coli and Klebsiella pneumoinae, and meropenem-resistant Pseudomonas aeruginosa. Solely, the isolation rate of levofloxacin-resistant K. pneumoinae and the number of CNIC were statistically correlated , while\u00a0the isolation rate of cefotaxime-resistant E. coli was paradoxically correlated with the number of ID doctors .Results: There was no epidemiologically applicable correlation between the deployment of ID doctors and CNIC and the isolation rates of methicillin-resistant Conclusions: Our macroscopic analysis using the open database was not a reliable method to evaluate the sufficiency of ID experts across the prefectures in Japan. A scheme to assess the appropriate distribution of ID experts should be developed. With the emergence of a global pandemic of antimicrobial resistance (AMR) , a well-While IPC activities are narrowly defined on a hospital-based approach, its approach should be broader and region-based because the AMR pathogens are transported among medical institutes through patient transfers. An increase in the number of ID experts is expected to decrease the AMR pathogens in a region. However, to the best of our knowledge, there is no consensus on the acceptable methods to verify or confirm this assumption.The Japan Nosocomial Infections Surveillance (JANIS) data have been made publicly available by the Japanese Ministry of Health, Labor, and Welfare; JANIS was launched in 2000 as a sustainable surveillance model for AMR prevalence. It is one of the most extensive national AMR surveillance worldwide ,7. It caThis descriptive study used publicly available data. Ethics committee approval and the need for informed consent were waived by the institutional review board of the Okayama University Hospital because the detailed data on individuals and hospitals were all anonymized (No. 1910-009). An ID doctor was defined as a board-certified physician of the Japanese Association for Infectious Diseases. We collected data on the number of ID doctors in each prefecture  from the website of the Japanese Association for Infectious Diseases . We gathStaphylococcus aureus (MRSA), vancomycin-resistant Enterococcus faecium (VRE), third-generation cephalosporin -resistant Escherichia coli, fluoroquinolone -resistant E. coli, CTX-resistant Klebsiella pneumoniae, LVFX-resistant K. pneumoniae, and carbapenem -resistant Pseudomonas aeruginosa were collected from the JANIS database [S. aureus strain resistant to either oxacillin or cefoxitin (CFX). However, in this study, no corresponding data were available, and we classified the CFX-resistant S. aureus strain as MRSA.We then compared the prefecture-wide isolation rates of AMR pathogens as a comparative parameter. The rates of methicillin-resistant database . MRSA waWe used Spearman\u2019s correlation coefficient to measure the statistical association between the two continuous variables: the prefecture-by-prefecture numbers of ID doctors and CNIC per 100,000 population and the isolation rates of the AMR pathogens. Statistical differences were set at a p-value <0.05.P. aeruginosa . The isolation rates of LVFX-resistant K. pneumoniae correlated with the number of CNIC .As a result, there was no correlation of the deployment of ID doctors and CNIC with the isolation of MRSA, VRE, and MEPM-resistant a Figure\u00a0. In addie Figure . The isoE. coli and ID doctors was found. However, the relationship was paradoxical; an increase in ID doctors was associated with higher pathogen isolation, suggesting a presence of confounding factors. The correlation between LVFX-resistant K. pneumoniae and CNIC indicated that the presence of ID experts could be associated with a reduction in AMR pathogens; however, this could be just a matter of multiple testing. In summary, our macroscopic analysis appears not ideal for estimating the sufficiency of ID experts across prefectures.In the present study, there was mostly no epidemiologically applicable correlation between the number of ID experts per population and the isolation rates of AMR pathogens. A correlation between CTX-resistant E. coli in this report) and fluoroquinolone-resistant E. coli were isolated more frequently in the outpatient setting [P. aeruginosa might be inappropriate because the detection rate was too low for the statistical analysis. Finally, not only the isolation rate but the prevalence or incidence number of each pathogen could be possible parameters.There are possible explanations for the difficulties associated with our method; these could be limitations for this research. The AMR pathogens analyzed in our study were all representative nosocomial organisms necessitating strict control via IPC activities. However, MRSA does not exclusively cause nosocomial transmission owing to the emergence of community-acquired strains . In addi setting . Thus, iIn Japanese hospitals, the ID doctors and CNICs are necessarily not involved in full-time IPC activities; some of them work as part-time ID experts or even as one of the hospital staff in a ward, although being certified. Thus, just not the number of ID experts, but their effort rates in IPC activities should be evaluated to figure out their contribution. Additionally, as for ID doctors, their experience and knowledge on IPC activities vary because it is not a core requirement for certification. Thus, it could be invalid to generalize the involvement of all ID doctors in IPC activities. Lastly, no matter how hard they are engaged, it should certainly take time to reduce the AMR pathogens; infection control is not an overnight solution. After all, the presence of ID experts merely may not guarantee a reduction of AMR pathogens.Countermeasures against AMR require continuous efforts from multidisciplinary perspectives, including medical, educational, epidemiological, governmental, and economic. The following issues should be primarily addressed: (i) founding a platform that enables pharmacists and clinical laboratory technicians to acquire ID certification and actively join IPC activities, (ii) obligatory full-time employment of ID doctors and CNICs at middle- to large-scale hospitals, (iii) improvement of regional imbalance of the ID experts, (iv) amendment of the educational curriculum in medical school, and (v) mandatory training for infectious diseases during postgraduate training.In summary, our macroscopic analysis, integrating certified ID experts and the JANIS database, to compare the inter-prefectural sufficiency of health professionals may be an ineffective approach. ID experts are essential to combat AMR, and continuous efforts for sustainable education are required. A multifaceted and reliable approach to evaluate the carrier development of ID experts in a particular region will be a cornerstone for establishing IPC activities to address the progressive expansion of AMR pathogens. A longitudinal study that can prove causality between an increase in ID experts and a decrease in AMR pathogens is warranted for future approaches."}
+{"text": "ObjectiveDuring the ongoing global pandemic of novel coronavirus disease 2019 (COVID-19), an emerging infectious disease, the implementation and execution of infection prevention and control (IPC) is of paramount importance. In this study, we aimed to assess the current deployment of infection control medical personnel in Okayama prefecture, who are supposed to play an essential role to prevent the outbreak of infectious diseases, and the current prevalence of antimicrobial-resistant (AMR) bacteria isolated in Okayama.Materials and methodsThis was a descriptive study using publicly available data.\u00a0The numbers of infectious disease (ID)-doctors and the certified nurses in infection control (CNIC) per 100,000 population in 47 prefectures in Japan were calculated. We then compared the detected proportions of AMR pathogens among the prefectures in 2019\u00a0to be employed as a comparative parameter, which was obtained from Japan Nosocomial Infections Surveillance (JANIS) data.Results\u00a0highest in Japan; however, they were unevenly distributed in southern Okayama, particularly at three tertiary hospitals. While the deployment of CNIC was\u00a0geographically less uneven\u00a0in the prefecture, their number was lower than the domestic average. According to the JANIS data, isolation rates of AMR pathogens were high in Okayama\u00a0compared to other prefectures in Japan: vancomycin-resistant Enterococcus faecium (the third-worst); cefotaxime-resistant Escherichia coli and Klebsiella pneumoniae ; and meropenem-resistant Pseudomonas aeruginosa (the worst).The number of ID-doctors was the 11thConclusionsOur assessment provides underlying data\u00a0and reinforces the need for educating multi-professional experts in the field of infectious diseases to prevent future public health threats in Okayama. The current global pandemic of novel coronavirus disease 2019 (COVID-19) has strongly raised social awareness concerning the importance of infection prevention and control (IPC) in medical institutions and communities -resistant Escherichia coli (E. coli) and Klebsiella pneumoniae (K. pneumoniae), fluoroquinolone [levofloxacin (LVFX)]-resistant E. coli and K. pneumoniae, and carbapenem [meropenem (MEPM)]-resistant Pseudomonas aeruginosa (P. aeruginosa) were collected from Japan Nosocomial Infections Surveillance (JANIS) data, which was open\u00a0to the public [S. aureus strain showing resistance to either oxacillin or cefoxitin (CFX); however, in this study, no corresponding data were available in the JANIS public information system, and hence we considered CFX-resistant S. aureus strain as MRSA for the purpose of this study.To evaluate the effectiveness of IPC activities in Okayama, we compared the detected proportions of AMR pathogens among the prefectures to be employed as a comparative parameter. Data on the isolation rates of methicillin-resistant e public . The JANe public ,9. MRSA No statistical analysis was performed in this study. Ethics committee approval and the need for informed consent were waived off by the Institutional Review Board of the Okayama University Hospital since the detailed data on individuals and hospitals were all anonymized (No. 2103-042).The number of ID-doctors in Okayama was 27, which amounts\u00a0to 1.42/100,000 population and is the 11th highest in Japan  Figure . The numGeographical deployment of ID-doctors and CNIC in the Okayama prefectureWe have presented the number of ID-doctors and CNIC per 100,000 population in three distinct regions of Okayama prefectures along with the domestic average Figure . Out of Recent epidemiological data on AMR bacteria in Okayama in comparison with other prefecturesThe number of medical institutions in Okayama that provided microbiology data to JANIS in the fiscal year 2019 was 50 in total; two of them had\u00a0more than 900 beds, four had 500-899 beds, 13 had 200-499 beds, and 31 had less than 200 beds. This corresponded to 30.7% of medical institutions registered in the prefecture.E. faecium were 95.0% (the 3rd lowest), i.e., isolation rates of VRE in E. faecium were 5.0%  and 50.1% (the 5th lowest), respectively  and 90.7% (the 2nd lowest), respectively   Figure . VCM sus% Figure . CTX- any Figure . SimilarE. coli and K. pneumoniae, and carbapenem-resistant P. aeruginosa are all representative nosocomial pathogens that should be brought under control by strict IPC activities. Because of its sophisticated system and well-established database, the JANIS data is reported to be a powerful surveillance tool for the regional prevalence of AMR pathogens [In this study, we evaluated the current deployment status of infectious diseases experts in Okayama prefecture based on publicly available data and compared it with that of other prefectures. Briefly, although the number of ID-doctors in Okayama was the 11th highest among the prefectures in Japan, they were unevenly distributed and a higher number of ID-doctors were present in the southern regions, particularly at three tertiary hospitals. There were no ID-doctors at a few of the key regional hospitals. In the northern region, ID-doctors were underrepresented in terms of numbers. In contrast, in the case of CNIC,\u00a0there was a less geographically biased distribution; however, the registered number in Okayama was comparatively small. Notably, based on the JANIS data, the isolation rates of AMR pathogens in Okayama were high in the year 2019. MRSA, VRE, and CTX- and LVFX-resistant athogens  and has Although the number of ID-doctors appears to be sufficient, their skewed distribution in the prefecture limits the promotion of IPC activities across the prefecture. Besides, the ID-doctors would have diverse clinical backgrounds and subspecialties, and thus, their knowledge and experiences in IPC greatly differ from each other. It is also true that non-ID-doctors are responsible for the IPC activities at each facility and function effectively. Thus, it would be not enough to evaluate the activity level of IPC in the whole prefecture solely based on the distribution of ID-doctors, which could be one of the limitations of this study. Other qualifications that potentially cover the ability of IPC for physicians include the Infection Control Doctor (ICD) system, Certified Board of Pediatric Infectious Diseases (accredited by the Japanese Society for Pediatric Infectious Diseases), Fellow of Japanese Antimicrobial Chemotherapy Physician (accredited by the Japanese Society of Chemotherapy), and Certified Fellow of the Japanese Society for Clinical Microbiology. However, none of them can assure the doctor's ability to contribute to the IPC. As of January 2019, the number of ICD holders reached 9,362 in the whole country, but no data by prefectures are open to the public and, hence, we are skeptical as to the\u00a0number of individuals among these ICDs who\u00a0have actually contributed to the IPC activity at their institutions.In contrast with ID-doctors, there was no geographic imbalance in CNIC deployment, although the number of CNIC was comparatively less. A plausible reason for the absence of uneven distribution in CNIC could be that a full-time CNIC on duty is a requirement for obtaining additional reimbursement for infection prevention. In other words, the education and employment of CNIC can directly increase the revenue for healthcare facilities. Another limitation of this study is that it is unclear whether CNIC certificate holders work full-time in such positions at their respective medical institutions. That is, although the registered number\u00a0of CNIC certificate holders appears to be sufficient, some of them may not necessarily be working as CNIC. Similar to medical doctors, there are other career paths or certifications other than CNIC in the nursing profession, and the assessment for CNIC alone may be insufficient to estimate the current sufficiency of nurses involved in IPC activities in Okayama. To get certified as CNIC, a nurse has to join a half-year training course and spend several million Japanese yen at personal capacity. The time and economic constraints have surely hindered the efforts to increase\u00a0the number of CNIC certificate holders. To further ensure that medical institutions in Okayama are well equipped with CNIC, flexible employment and financial support for their education would be indispensable.To evaluate the activity of IPC, antimicrobial stewardship should be a good comparative parameter as well. In the Japanese National Action Plan on Antimicrobial Resistance launched in 2016 , compareNot only the medical doctors and nurses, but also other medical practitioners such as pharmacists, clinical laboratory technicians, and even clerical staff could play an important role in IPC activities. For example, pharmacists should be closely involved in antimicrobial stewardship, or the appropriate use of antimicrobial drugs. Clinical laboratory technicians should make a significant contribution to the rapid detection and data management of AMR bacteria. Professional qualifications systems for the medical personnel, namely, infectious disease chemotherapy pharmacist (IDCP) and board-certified infection control pharmacy specialist (BCIPS) for pharmacists, and infection control microbiological technologist (ICMT) for clinical laboratory technicians, have already been established. Professional education in these fields could further facilitate the IPC activities in a hospital.Our analysis revealed the uneven distribution of ID-doctors and a shortage of CNIC in Okayama, despite the high isolation rates of AMR pathogens. Although the causal relationship between these data is unclear, we should progressively work on improving the current situation. First of all, from a long-term perspective, medical schools need to\u00a0include clinical infectious diseases in the\u00a0pre-graduate education curriculum. Additionally, as a subject of intensive\u00a0post-graduate education, infectious diseases should be more frequently and regularly addressed, which could help in the increase of ID expertise in the future. Currently, we need to establish a comprehensive system for regional cooperation with neighboring healthcare institutions in improving the level of IPC in the entire region. This is the right time to promote a continuous education system concerning infectious diseases to achieve sustainable development goals in terms of infection control and prevention in Okayama."}
+{"text": "Citrus cultivation is affected in many parts of the world because of a devastating disease, huanglongbing (HLB) or citrus greening. In Florida, nearly all commercial citrus is compromised due to HLB, and the disease has spread to other citrus-growing regions of the United States, California and Texas. In California, testing Asian citrus psyllids (ACPs) for the HLB pathogen has been an essential part of integrated pest management. ACP and HLB surveys are essential for disease management in areas where HLB is not widespread. We developed improved ACP traps that can be deployed in the field along with the standard yellow sticky traps. The reusable traps were designed with Rhinoceros computer software and a 3D printer. These traps can be deployed for several months and provide a dynamic sampling mechanism for an improved disease survey strategy. In the present study, ACPs from the 3D-printed traps are collected in a preservative and appear suitable for HLB testing. The evaluation of traps in Florida and California under laboratory, greenhouse, and field conditions indicates that the 3D-printed traps can capture ACPs with about the same efficiency as the sticky traps. They are easy to handle and provide an important field tool for HLB management.Diaphorina citri Kuwayama (Hemiptera: Psyllidae)) and the associated pathogen. In the present study, we utilize three-dimensional (3D) printers and design tools to develop traps that can capture and preserve ACPs. Three novel, 3D-printed traps were designed and evaluated: stem trap, and cylinder traps 1 and 2. The traps and yellow sticky cards were deployed weekly for 8 months in 2 non-commercial citrus groves in Florida; in California, the traps were evaluated for 12 months in field cages and 4 citrus groves. The stem traps captured lower numbers of ACPs at all experimental sites compared to the cylinder traps. Capture rates in the cylinder traps were comparable to the sticky trap, making the device a viable tool for monitoring field ACPs. The two main advantages of using the reusable 3D traps over standard methods of ACP and HLB surveys include dynamic sampling that can be conducted year-round and the capture of ACPs that can be preserved and tested. Improved trapping may facilitate quick management decisions and mitigate HLB.Citrus huanglongbing (HLB) is a severe problem for citrus cultivation. The disease management programs benefit from improved field tools suitable for surveying the ACP vector (Asian citrus psyllid,  Huanglongbing (HLB) or citrus greening is considered the most serious disease of citrus worldwide, because of the extensive damage to citrus industries. The challenges are associated with the difficulties in early diagnosis, the rapid spread of the disease by prolific insect vectors that are difficult to control, the lack of an effective cure, and the financial costs of managing the disease . Citrus Diaphorina citri Kuwayama (Hemiptera: Psyllidae) . The field trees inside the cages were pruned periodically to keep the plant size small. Clean ACPs were maintained inside the field cages for research projects. The field cages were equipped with a double-door entry system to prevent ACPs from escaping. This provided an ideal setting for conducting pilot studies using newly designed traps. Each field cage was estimated to contain about 20,000 to 100,000 ACPs (negative for CLas). In each trial, we evaluated three types of traps  in the field cages for four weeks. A total of six trials was carried out from April 2018 to May 2019. For each trial, we utilized 2 field cages and deployed 48 traps. Sixteen traps of each type were used and positioned at the height of about three-to-six feet, deployed around the inner perimeter of the cages. Each tree had four traps hanging from the branches inside the field cages. Since the comparison was between the three trap models previously selected in Florida, we did not utilize yellow sticky traps in these experiments. At the end of each trial, the traps were removed from the trees, and the number of ACPs captured was recorded. The mean number of ACPs captured in each trap for the duration of the trial were compared using a one-way ANOVA and Tukey\u2019s HSD  , respectively, are used as effective kairomone lures in traps [For oriental fruit flies (in traps . Such efin traps , lightinin traps ,52,53,54in traps ,57,58,59in traps ,61, therin traps . Howeverin traps . Thus, yin traps ,28,40. Min traps . We obseWe developed two basic models of 3D-printed traps that can be used for ACP capture. The cylinder traps were more efficient in ACP capture than the stem traps. The 3D-printed traps are reusable, and the capture of non-target species in the traps is low compared to the sticky traps. Cylinder traps are at least as efficient as sticky traps and can be combined with sticky traps in routine ACP surveys. Since the 3D-printed traps can be deployed on a tree for an extended period, the captured insects represent dynamic sampling over a period of time. One of the major advantages of using a 3D-printed trap is the ability to test the captured ACPs for the presence of the HLB pathogen, CLas. Unlike sticky traps that can only be used for ACP surveys, 3D traps can also be used for HLB surveys since the captured psyllids are suitable for DNA-based testing."}
+{"text": "The Taylor Spatial Frame (TSF) has been widely used for tibial fracture. However, traditional radiographic measurement method is complicated and the reduction accuracy is affected by various factors. The purpose of this study was to propose a new marker- three dimensional (3D) measurement method and determine the differences of reduction outcomes, if any, between marker-3D measurement method and traditional radiographic measurement in the TSF treatment.Forty-one patients with tibial fracture treated by TSF in our institution were retrospectively analyzed from January 2016 to June 2019, including 21 patients in the marker-3D measurement group  and 20 patients in the traditional radiographic measurement group (control group). In the experimental group, 3D reconstruction with 6 markers installed on the TSF was performed to determine the electronic prescription. In the control group, the anteroposterior (AP) and lateral radiographs were performed for the traditional parameter measurements. The effectiveness was evaluated by the residual displacement deformity (RDD) and residual angle deformity (RAD) in the coronal and sagittal plane, according to the AP and lateral X-rays after reduction.P\u2009=\u20090.024, RAD: P\u2009=\u20090.020; Lateral view RDD: P\u2009=\u20090.016, RAD: P\u2009=\u20090.004).All patients achieved functional reduction. The residual RDD in AP view was 0.5  mm in experimental group and 1.74  mm in control group. The residual RAD in AP view was 0  \u00b0 in experimental group and 1.25  \u00b0in control group. As for the lateral view, the RDD was 0  mm in experimental group and 2.02  mm in control group, the RAD was 0  \u00b0 in experimental group and 1.42  \u00b0 in control group. Significant differences in all above comparisons were observed between the two groups (AP view RDD: The present study introduced a marker-3D measurement method to complement the current TSF treatment. This method avoids the manual measurement error and improves the accuracy of fracture reduction, providing potential advantages of bone healing and function rehabilitation. Delayed bone union and nonunion of open tibial fracture was commonly observed in clinical practice , 2. ExteHowever, parameters of TSF system need to be manually measured on radiographs resulting in subjective errors during the traditional radiographic measurement , 11. In In previous studies, markers installed on the rings were introduced to the process of 3D reconstruction \u201320. In tPatients with tibial fracture treated by TSF in Tianjin Hospital were retrospectively analyzed from January 2016 to June 2019. The inclusion criteria were: (1) comminuted fracture (AO/Asif classification C3); (2) compound fractures (Gustilo type II / III); (3) the follow-up time after frame removal was \u22656\u2009months. Exclusion Criteria were: (1) Patients with bilateral tibia fractures ; (2) patients unable to cooperate with regular follow-up. Finally, 41 patients were included in the study. There were 21 patients in the marker-3D measurement group  and 20 patients in the traditional radiographic measurement group (control group).All the treatment procedures were performed by the same surgical team. All patients underwent TSF installation as follows: the frame was fixed to the bone segment firstly with the struts in a sliding state, the fracture was preliminarily reduced by moving the rings under the C-arm followed by the lock of struts, residual deformities were corrected postoperatively by adjusting these struts.The postoperatively standard radiographs  of patients were conducted. The X-rays were imported into computer for parameters measurement Fig.\u00a0. The proParameters need to be measured include six deformity parameters and four mounting parameters according to the instructions. The deformity parameters include angulation and translation in the coronal \u03b11, S1), sagittal , and axial plane . The mounting parameters which describe where the center of the reference ring is located relative to the origin point include anteroposterior view frame offset (L1), lateral view frame offset (L2), axial view frame offset (L3), and the rotary frame angle  . Bilateral lower limbs of each patient in the marker-3D measurement group underwent CT  scan for 3D reconstruction. The following models were generated: the 3D model of the proximal bony fragment of the affected limb , the 3D model of the distal bony fragment of the affected limb , the 3D mirror model of healthy limb bone (Model Reference), the 3D model of external fixator (Model Frame), and the 3D model of Marker Balls   The reconstructed 3D models and the information of the frame and markers were imported into the custom software for virtual fracture reduction. (2) The protuberance tip on the bony segment and the feature point on the joint were used as the references. The Model Proximal was considered as the fixed end, the Model Distal was registered with the Model Reference to achieve fracture reduction directly. It was also possible to add multiple reduction intermediate points according to requirements. \u201ctraction-rotation-alignment\u201d was the motion path of the bone to ensure the reduction safety. (3) The software could automatically generate the reduction path of the free movement end avoiding the collision between the bony segments. Furthermore, the virtual reduction animation was generated according to the initial and final position of the fixed ring. (4) The relative position changes of the two rings could be determined according to step 3. The length changes of the six struts were calculated by the Stewart mechanism kinematics algorithm, the strut \u2018s adjustment plan (electronic prescription) was obtained finally. The schematic diagram was shown in Fig.\u00a0The effectiveness was evaluated by the residual displacement deformity (RDD) and residual angle deformity (RAD) in the coronal and sagittal plane, according to the standard AP and lateral X-rays after reduction.\u2212x\u2009\u00b1\u2009s. The categorical data was compares by Chi-square test. The measurement data of abnormal distribution  was expressed as M  followed by Mann-Whitney U test. Significant difference was set as P\u2009\u2264\u20090.05.SPSS 22  was used for statistical analysis. The comparison between age was conducted by Student\u2019s t test and represented as All patients achieved functional fracture reduction and bone union. They were followed up at least 6\u2009months after frame removal, and none was lost.The experimental group comprised of 15 males and 6 females, with an average age of 49.5\u2009\u00b1\u200914.8\u2009years (range 18 to 73\u2009years). There were Gustilo classification Type II in 13 cases, Type III in 8 cases. Eleven patients with Type II wound were closed primarily within 8\u2009h, while the other 2 Type II wound had delayed primary closure. Six patients with Type IIIA wound had split-thickness skin grafting, and the other 2 with Type IIIB wound were primarily managed by a monolateral fixator with a rotational flap and converted to TSF after 2 weeks.The control group comprised of 17 males and 3 females, with an average of 47.6\u2009\u00b1\u200914.3\u2009years (range19 to 76\u2009years). There were Gustilo classification Type II in 14 cases and Type III in 6 cases. Thirteen patients with Type II wound were closed primarily within 8\u2009h, while the other 1 Type II wound had delayed primary closure. Five patients with Type IIIA wound had split-thickness skin grafting, and the other 1 with Type IIIB wound were primarily managed by a monolateral fixator with a rotational flap and converted to TSF after 2 weeks.2 and 23.4\u2009\u00b1\u20092.2\u2009kg/m2 respectively. No statistical differences between the two groups in terms of gender, age, and fracture type were observed (P\u2009>\u20090.05)  Table\u00a0.Table 1GP\u2009=\u20090.024).The RDD of the experimental group in AP view was 0.5  mm, while the RDD of the control group in AP view was 1.74  mm. There was significant difference between the two groups (P\u2009=\u20090.016)  mm, while the RDD of the control group in lateral view was 2.02  mm. Statistical significance was also observed between the two groups .The RAD of the experimental group in AP view was 0 \u00b0, and the RAD of the control group in AP view was 1.25  \u00b0. The difference between the two groups was statistically significant (P\u2009=\u20090.004)  \u00b0, while the RAD of the control group in lateral view was 1.42  \u00b0. Statistical significance was also observed between the two groups  bon traction and rotation need to be applied to avoid the collision of the fracture segments; (2) the bone segments are aligned with minimal movement to avoid overstretching of soft tissue. Previous studies have proved that the lower limb malalignment will increase the risk of knee osteoarthritis and medial meniscus lesions \u201317. The The use of markers to achieve automatic measurement also had the following shortcomings: (1) During CT scanning, the 3D reconstruction of the bone could be affected by the metal artifacts, affecting the reduction accuracy. (2) A conservative attitude should be adopted regarding the interpretations of our results due to a single-center small sample size. (3) The procedures are tedious and time-consuming in inexperienced hands. (4) Considering the higher radiologic exposure in CT than X-rays, our method is suggested to apply in those unusually complex cases. In the next step, the imaging technology needs to be improved to minimize the metal artifacts in the reconstruction process. The registration remained as a manual point-to-point registration in this study, automatic registration will be performed in the subsequent study. In addition, optical trackers and markers with automatic reduction robot system is our future direction.The present study introduced a marker-3D measurement method to complement the current TSF treatment. The marker is simple to application and compatible with the current mainstream external fixation instruments. This method avoids the manual measurement error and improves the accuracy of fracture reduction, providing potential advantages of bone healing and function rehabilitation."}
+{"text": "Early screening is vital and helpful for implementing intensive intervention and rehabilitation therapy for children with autism spectrum disorder (ASD). Research has shown that electroencephalogram (EEG) signals can reflect abnormal brain function of children with ASD, and screening with EEG signals has the characteristics of good real-time performance and high sensitivity. However, the existing EEG screening algorithms mostly focus on the data analysis in the resting state, and the extracted EEG features have some disadvantages such as weak representation capacity and information redundancy. In this study, we utilized the event-related potential (ERP) technique to acquire the EEG data of the subjects under positive and negative emotional stimulation and proposed an EEG Feature Selection Algorithm based on L1-norm regularization to perform screening of autism. The proposed EEG Feature Selection Algorithm includes the following steps: (1) extracting 20 EEG features from the raw data, (2) classification with support vector machine, (3) selecting appropriate EEG feature with L1-norm regularization according to the classification performance. The experimental results show that the accuracy for screening of children with ASD can reach 93.8% and 87.5% under positive and negative emotional stimulation and the proposed algorithm can effectively eliminate redundant features and improve screening accuracy. Autism spectrum disorder (ASD) is a lifelong neurodevelopmental disorder involving deficits in interpersonal communication and social interactions, as well as restricted, repetitive mannerisms and interests  have drawn more attention. EEG can be used for real-time tracking of the neural activity of the brain in milliseconds and detecting subtle differences in neural oscillations more sensitively . ERP is considered as one of the most effective methods to monitor cognitive processes. Relevant researchers believed that ERP can be used to screen various pathological nerve disorders and achieve higher screening accuracy, such as ADHD and ASD , and the TD group consisted of 32 children .A total of 80 children were recruited in this study. Written informed consent from parents was obtained prior to participation. The participants were divided into ASD group and TD group. According to the experimental cooperation of children recorded by the experimenters, children with high coordination degree were selected as follows: The ASD group consisted of 32 children aged 4\u20136 years  diagnosis in accordance with DSM-V  matched age with the ASD group, (2) no suspected or diagnosed psychiatric disorder and/or other developmental delay or learning disabilities, and (3) normal development of the visual system.In this study, EMOTIV EPOC+   reasonable duration\u2014the fatigue caused by watching for a long time will affect the emotional subjective experience, (2) easy to understand the meaning\u2014the test requires to obtain the emotional information of children in two groups during a short time, and the unclear meaning of the movie clips may affect the emotional response time of participants, and (3) effective emotional elicitation\u2014the movie clips can effectively elicit the emotions of participants, that is, positive and negative emotions  explain the experimental requirements and procedures to parents and children, (2) help participant to wear the device EMOTIV EPOC+, (3) seat the participant in a chair 50\u201360 cm away from the screen and ask them to look at the star fixation point with both their eyes straight ahead, (4) play a piece of light music to make participant relaxed and then begin to record the EEG data, (5) play the positive/negative emotional elicitation materials and continue to record the EEG data. While playing the materials, the response of the participant was observed and recorded. If the participant did not cooperate, the recorded EEG data were excluded and retested, (6) After watching an emotional elicitation material, the participant could rest for a few minutes, and (7) repeat steps (1)\u2013(6) to watch the other materials. Before the data collection, a parent guides his/her child to cooperate with the experimental procedures. In the process of data collection, he/she sits beside the child at a certain distance and monitors the behavior of the child in order to evaluate if the child feels comfortable. When the stimulus material is played, a parent stays quiet to ensure that the attention of his/her child is focused on the stimulus material. All the valid data were sent to a PC and saved in the corresponding folder.To extract the effective features from the EEG data, preprocessing to the raw EEG data is necessary to eliminate the noise and trivial information. The data preprocessing includes four steps, namely, direct current (DC) offset elimination, artifacts removal, signal extraction of different rhythms, and windowing of data. The flowchart of the data preprocessing is shown in (1) DC offset elimination: The method to remove the DC offset that followed the instructions of the tool EMOTIV PRO was to subtract the average value from the whole data channel, and use a 0.16-Hz first-order high-pass filter to remove the noise.(2) Artifacts removal: In this study, the independent component analysis (ICA) was used to remove the artifacts such as electrooculogram, ECG, and electromyography  Signal extraction of different rhythms: To explore the difference of the EEG in different rhythms between ASD group and TD group, a finite impulse response digital band-pass filter based on Hanning window was used to extract five rhythms of the EEG, namely, theta (4\u20138 Hz), alpha (8\u201312 Hz), low beta (12\u201316 Hz), high beta (16\u201325 Hz), and gamma (25\u201345 Hz).(4) Windowing of data: After filtering, the data were split into fixed 4s windows with an overlapping size of 2s.The EEG signal is inherently complex, non-linear, non-stationary, and random. To extract valuable information from the EEG signals, various handcrafted features are presented to describe the EEG signals. However, a single handcrafted feature cannot represent the EEG signal comprehensively. To this end, the study by Li et al.  exploresIn this study, we adopted SVM to learn a binary classifier with extracted EEG features to distinguish TD group and ASD group. SVM is one of the most robust machine learning methods, being based on the statistical learning frameworks proposed by Cortes and Vapnik .yi \u2208 {+1, \u22121}. To this end, SVM optimizes the model by minimizing a hinge loss, which can be formulated as follows:Given the training data w and b are the trainable parameters, w is the normal vector to the hyperplane, and b is the bias. The parameter \u03bb controls the trade-off between the loss and penalty.where According to the structural risk minimization, larger margins should lead to better generalization and prevent overfitting in the high-dimensional feature spaces. The solution of SVM depends only on the points located on the two supporting planes, which are called support vectors. Hence, when compared with other machine learning methods, SVM has better generalization ability in dealing with small samples with high-dimensional features. Considering small size of the available participants with ASD and high-dimensional EEG features, SVM is more suitable for the data analysis in this study.lp-norm penalty. When p = 1, l1-norm penalty forces the normal vector to satisfy sparsity. L1-norm regularization is a wrapper-based strategy for the automatic feature selection. While minimizing the structural risk of model prediction, L1-norm regularization makes unimportant features with weights of zero value being eliminated from the candidate set. The remaining features are useful for the autism screening under positive/negative emotional stimulus. Hence, it is an effective way to measure the importance and discrimination of features through the corresponding weights and eliminate the redundant and unimportant features.The second terms in Formula (1) are regularization terms with l1-regularized SVM for the classification of children with ASD and TD children are evaluated. In order to make a fair comparison, the leave-one-out method is adopted to evaluate the performance of different features, i.e., each child should be used once as test data to evaluate the model trained with the data set composed of all rest children.The discrimination of different EEG handcrafted features from different rhythms and brain regions is investigated. The selected features with To explore the discrimination of different handcrafted features, each kind of handcrafted feature is extracted from five rhythms, all the electrodes are input into an SVM classifier, and the classification accuracy of a single feature is compared. The classification results are shown in It is noted that under positive emotional stimulus, peak\u2013peak mean and differential entropy have the best discrimination, both with 84.4% of classification accuracy, followed by mean square value, variance, Hjorth parameter: activity, power sum, and Shannon entropy, all with 81.3% of classification accuracy, while under negative emotional stimulus, mean square value, variance, Hjorth parameter: activity, maximum power spectral density, and power sum have the best discrimination, all with 82.8% of classification accuracy, followed by differential entropy, with 81.3% of classification accuracy. The features with above 80% of classification accuracy under two emotional stimuli include mean square value, variance, Hjorth parameter: activity, power sum, and differential entropy.To explore the discrimination of different rhythms, 20 kinds of handcrafted features from a single rhythm are input into an SVM classifier and the classification accuracy of features extracted from different rhythms is compared. The classification results are shown in It is noted that under positive emotional stimulus, the features extracted from low beta rhythm have the best discrimination, with 78.1% of classification accuracy, followed by gamma rhythm, alpha rhythm, high beta rhythm, and theta rhythm, while under negative emotional stimulus, the features extracted from theta rhythm have the best discrimination, with 84.4% of classification accuracy, followed by alpha rhythm, gamma rhythm, high beta rhythm, and low beta rhythm. On average, the features extracted from gamma rhythm have the highest classification accuracy under two emotional stimuli.To explore the discrimination of different rhythms, 14 data acquisition electrodes are divided into 5 groups, namely, (1) the left frontal lobe , (2) the right frontal lobe , (3) the temporal lobe (including T7 and T8), (4) the parietal lobe (including P7 and P8), and (5) the occipital lobe (including O1 and O2). A total of 20 kinds of handcrafted features from electrodes of the same group are input into an SVM classifier, and the classification accuracy of features extracted from different brain regions is compared. The classification results are shown in It is noted that under positive emotional stimulus, the features extracted from the temporal lobe and occipital lobe have the best discrimination, with 68.8% of classification accuracy, while under negative emotional stimulus, the features extracted from the occipital lobe have the best discrimination, with 73.4% of classification accuracy. On average, the features extracted from the occipital lobe have the highest classification accuracy under two emotional stimuli.l1-regularized SVM, respectively, which adaptively select good features to distinguish ASD group and TD group. The \u03bb is set between 0.1 and 1, and step length is set to 0.01 to investigate the effect of parameter \u03bb on the classification accuracy. The results are shown in To evaluate the proposed method, 20 handcrafted features are input into an ordinary linear SVM and an When compared with the ordinal linear SVM classification, the highest screening accuracies of children with ASD under positive and negative emotional stimuli are 81.3 and 78.1%, respectively, where the proposed method achieved the highest recognition accuracy of 93.8% when \u03bb = 0.13 under positive emotional stimulus, and 87.5% when \u03bb = 0.24 under negative emotional stimulus.When \u03bb = 0.13, 10 features with non-zero weights were selected for ASD/TD classification under positive emotional stimulus, which are listed in When \u03bb = 0.24, 21 features with non-zero weights were selected for ASD/TD classification under negative emotional stimulus, which are listed in aim for screening children with ASD, this study proposes a linear SVM based on L1-norm regularization, which readily handles the classification of children with autism, with the selected EEG features collected under positive and negative emotional stimuli. To evaluate the performance of the proposed algorithm, we designed an ERP experimental paradigm. We stimulated the subjects with positive and negative emotions, and in the meantime, the evoked EEG data sets were collected. We also linked the EEG signal and social and emotional behaviors to further analyze the pathogeny of children with ASD. Then, the EEG features were obtained for the screening of autism. When compared with the existing work that studied a limited number of features and lacked adequately strong representation ability, this study extracts a wider range of 20 types of the EEG features for the screening of autism. However, increasing the number of features resulted in the redundancy and complementarity of multiple features; to solve this problem, we proposed a linear SVM based on the L1-norm feature selection algorithm to improve the accuracy of screening for children with ASD. The proposed algorithm displayed significant advantages over the existing benchmark, i.e., in the real data set tests, compared with the ordinal linear SVM classification, the accuracies of screening children with autism under positive and negative emotional stimuli were dramatically increased from 81.3 and 78.1% to 93.8 and 87.5%. Our experiments proved that the L1-norm can remove redundant features, screen out better features, and improve the accuracy of screening. In addition, the experimental results suggested that differential entropy of the EEG collected from positive and negative emotional stimuli was able to screen autism, and the differences in emotion could be identified using this feature. We also found that the highest averaged classification accuracy appeared in the occipital lobe under both positive and negative emotional stimuli, which could be the notification point of the difference between TD children and children with ASD.In order to The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Ethics Committee of Central China Normal University. Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin.SP proposed the idea, conducted the experiments, and wrote the manuscript. RX, XY, and XH provided advice on the research approaches, guided the experiments, and checked and revised the manuscript. LiL and LeL offered important help on EEG processing and analysis methods. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Objective: This study examines the impact of transcranial direct current stimulation (tDCS) combined with cognitive training on neurotransmitter concentrations in the prefrontal cortex.Materials and Methods: Twenty-three older adults were randomized to either active-tDCS or sham-tDCS in combination with cognitive training for 2 weeks. Active-tDCS was delivered over F3 (cathode) and F4 (anode) electrode placements for 20 min at 2 mA intensity. For each training session, 40-min of computerized cognitive training were applied with active or sham stimulation delivered during the first 20-min. Glutamine/glutamate (Glx) and gamma-aminobutyric acid (GABA) concentrations via proton magnetic resonance spectroscopy were evaluated at baseline and at the end of 2-week intervention.Results: Glx concentrations increased from pre- to post-intervention (p = 0.010) in the active versus sham group after controlling for age, number of intervention days, MoCA scores, and baseline Glx concentration. No difference in GABA concentration was detected between active and sham groups (p = 0.650) after 2-week intervention.Conclusion: Results provide preliminary evidence suggesting that combining cognitive training and tDCS over the prefrontal cortex elicits sustained increase in excitatory neurotransmitter concentrations. Findings support the combination of tDCS and cognitive training as a potential method for altering neurotransmitter concentrations in the frontal cortices, which may have implications for neuroplasticity in the aging brain. Althougin areas , 2001. Tin areas . Followiin areas  and persin areas . Moreovein areas . In partin areas , facilitin areas . These cpy (MRS) , providipy (MRS) .1H-MRS concentrations have been shown to increase in task-relevant brain regions  completed all MRS/magnetic resonance imaging (MRI) visits and were included in the current study. A prior publication reported functional connectivity from functional MRI (fMRI) and behavioral effects from the parent trial  between subjects design, permitting examination of combined effects of tDCS with cognitive training on neurotransmitter concentrations in healthy older adults. Of these, 23 older adults  structural images were acquired for accurate placement of the MRS voxel and tissue segmentation. Acquisition parameters were repetition time (TR) = 1800 ms, echo time (TE) = 2.26 ms, flip angle = 8 degrees, field of view (FOV) = 240 \u00d7 240 \u00d7 170 mm, 1.0 mm3 voxel positioned medially on the axial plane aligned with the corpus callosum and superior to the genu of the corpus callosum. Voxel placement was performed by experienced MRS operators, referencing the T1 image. MRS was obtained using the following parameters TR = 2000 ms, TE = 68 ms, flip angle = 90 degrees, FOV = 30 \u00d7 40 \u00d7 27 mm, 133 pairs of averages, ON editing pulse at 1.9 ppm, OFF editing at 4.68 ppm.Both GABA and Glx data were acquired in the same MRI session using a MEGA-PRESS sequence from a 3 \u00d7 3 \u00d7 3 cmvia exponential apodization, and fast Fourier transform of time-domain acquired data is applied to frequency-domain spectra. Finally, subtraction is used to generate the edited difference spectrum, and extraction of off spectrum. Each metabolite  was calculated as its ratio relative of Creatine (Cr), which is set to 3.02 ppm. Cr is a common reference standard in 1H-MRS  voxel. This method only considers the partial volume effect of CSF.where Each of the Gannet outputs were visually checked to ensure accurate model fit and voxel placement. A voxel heat map was created to demonstrate MRS voxel overlap between participants across visits, for quality assurance . To achivia a conventional 1 \u00d7 1 tDCS device . Set-up procedures were identical for both active and sham conditions. Two 5 \u00d7 7 cm2 saline-soaked Soterix sponge electrodes  were placed over the frontal cortices at F3 (cathode) and F4 (anode), using individualized head measurements and International 10\u201320 system for electrode locations. Prior behavioral findings support the specified montage and intensity, demonstrating the ability to elicit a 2.0 mA net increase and excitability under both the anode and cathode electrodes . Demographic data and neurotransmitter concentration of the two groups  were compared at baseline. Separate factorial analysis of covariance (ANCOVAs) were calculated for CSF-corrected GABA:Cr and Glx:Cr concentrations as dependent variables, groups  as fixed-factor, and age, MoCA scores, number of intervention days, and baseline GABA:Cr and Glx:Cr concentrations as covariates. Given the hypothesized additive effect of repeated tDCS sessions in metabolite concentrations, the total number of intervention days completed were applied as a covariate. Further, age, baseline neurotransmitter concentrations, and MoCA scores  were incTwenty-three healthy, older adults completed all data collection visits of the study. Participants that completed more than 80% of the intervention sessions were included in this study. No adverse events were reported during this investigation. Age, sex, and education were not statistically different at baseline between the active and sham groups . Descript(21) = 2.06, p = 0.052. The covariates, MoCA scores and baseline Glx:Cr values, were significantly related to post-intervention Glx:Cr concentrations . There was also a significant effect of intervention group  on post-intervention Glx:Cr values after controlling for age, MoCA scores, number of intervention days, and baseline Glx:Cr concentrations  = 0.491, p = 0.629. The covariate of baseline GABA:Cr concentration was significantly related to post-intervention GABA:Cr concentration . No significant GABA:Cr metabolite difference was evident between active and sham groups post-intervention (p = 0.650), after controlling for age, MoCA scores, number of intervention days, and baseline GABA:Cr concentrations. No significant differences were observed in GABA:Cr concentrations between active and sham groups at baseline, The current study explored the combined impact of multiple sessions of tDCS and cognitive training on excitatory and inhibitory neurotransmitter concentrations. Frontal lobe Glx:Cr concentrations increased following 2-weeks of paired cognitive training and tDCS intervention over the prefrontal cortex. Meanwhile, the GABA:Cr concentrations in the frontal lobe was similar for each intervention group. Thus, the combined intervention suggest increased excitatory response with tDCS exposure, but no apparent inhibitory response.1H-MRS is not sensitive to variation in NMDA receptors but rather local tissue neurotransmitter concentration , our interpretation is limited.To our knowledge, this is the first study assessing Glx and GABA concentrations after a multi-session combined prefrontal tDCS and cognitive training intervention in healthy older adults. Following 2-weeks of active tDCS and cognitive training, Glx:Cr concentrations were significantly increased when controlling for age, MoCA scores, number of intervention days, and baseline Glx:Cr values. The shift toward increased excitatory neurotransmitter concentration in the current study coincides with suggestions that tDCS facilitates changes in glutamate . UltimatAlternately, the stochastic resonance hypothesis may provide additional insight into the mechanistic interpretation for improved Glx:Cr concentration. Small amounts of noise added to non-linear systems can increase the quality of the stimulus through stochastic resonance. Stochastic resonance refers to a phenomenon where an optimal level of noise is added to a subthreshold signal, causing the signal to cross the threshold and enhance performance . van der1H-MRS data processing challenges. Nevertheless, future studies and analyses should assess whether enhancement in Glx:Cr concentrations are related to working memory performance, particularly in a larger sample of healthy, older adults.Further, understanding what the increases in Glx:Cr concentration might indicate for cognitive performance in older adults complements our results, although not directly within the scope of the current study. 1H-MRS studies have demonstrated age-related declines in prefrontal GABA and glutamate concentrations, beginning in middle age  following 2-weeks of intervention. These effects may be attributable to stimulation of glutamatergic transmission, which may ultimately facilitate learning in task-associated regions. This maintenance in excitatory concentration following 2-weeks of combined intervention is particularly valuable since recent work has questioned the overall usefulness of combining tDCS and cognitive training in older adults for causing improvement in cognitive performance that outlasts the stimulation session itself . The curajwoods@ufl.edu.The datasets presented in this article are not readily available because the data analyzed in this study is subject to the following licenses/restrictions: Deidentified data presented in the manuscript are available upon request. Requests to access the datasets should be directed to the study PI, AW, clinicaltrials.gov under NCT02137122. The patients/participants provided their written informed consent to participate in this study.The studies involving human participants were reviewed and approved by University of Florida Institutional Review Board. The parent trial was preregistered in SA-A was responsible for data analysis, data interpretation, and manuscript preparation. EB was responsible for data analysis, data interpretation, and drafting of the manuscript. JK and NN were responsible for data acquisition, data analysis, and conducting intervention. AO\u2019S and AA were responsible for data acquisition and data analysis. AI was responsible for data acquisition and conducting intervention. NE was responsible for critical revision of the manuscript. RC was responsible for study concept and design. EP was responsible for study concept and data interpretation. AW was responsible for study concept and design, critical revision of the manuscript, and study supervision. All authors approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "The utilization of locally available renewable resources is crucial for the creation of a sustainable energy system in the future. Biogas, a product of the anaerobic digestion of biogenic residues, exhibits great potential as feedstock to generate hydrogen for fuel cell mobility applications. A 10 kW fixed-bed chemical looping research system, to-date the largest in the world, was operated to prove the applicability of this versatile process for synthetic biogas utilization. In this experimental study, the focus was laid on examining the influence of different operating parameters  on the attainable hydrogen purity and system efficiency. The generated hydrogen, between 90 to 230 g per cycle, was characterized online by ppm-range gas analysis and exhibited a product gas quality between 99.8% and 99.998%. The difference observed is attributed to carbon deposition if synthetic biogas with an increased share of carbon dioxide was supplied. This study involved the longest uninterrupted period of operation of a lab prototype system for fixed-bed chemical looping with 250 hours of time-on-stream, four months of discontinuous service and 50 consecutive experimental cycles. Experimental proof of synthetic biogas utilization for high-purity hydrogen generation (99.998%) with a 10 kW fixed-bed chemical looping system. In the current discussion on the transition to a renewable energy system, hydrogen has been proposed as a suitable energy carrier and the missing link between fluctuating renewable sources and customer energy demands. Besides this, new local and regional energetic resources should be directly integrated into the energy system at the place of origin to avoid costly and energy-intensive transport. This is possible if technologies are used that are economically feasible in small scale and that can handle both fluctuating feedstock availability and energy demands.1,2 The produced biogas consists of methane (45\u201375%), carbon dioxide (25\u201345%) and other gases such as nitrogen (1\u20135%), as well as steam and oxygen in lower proportions.3 Moreover, a complex gas matrix of different trace gas compounds is present in biogas depending on the respective feedstock,4,5 which often hinders its direct utilization or severely affects downstream processes. Depending on the local opportunities available, biogas is currently utilized (i) for heat generation, e.g. for district heating, (ii) in CHP plants equipped with gas turbines or gas engines to co-generate both heat and electricity, (iii) upgraded to biomethane and co-fed into gas distribution networks or (iv) combusted with burners to prevent harmful CH4 emissions, e.g. in landfills.6 In 2014, 58.7 billion Nm3 of biogas were produced worldwide with an approximate energy content of 1.27 EJ (353 TW h), thereof about 50.5% in Europe.7 About 0.51 EJ (142 TW h) of heat and 0.29 EJ (80.1 TW h) of electrical power are generated worldwide from biogas.7Biogas is a product of the anaerobic degradation of organic material in landfills, wastewater treatment plants and digesters. It originates from a wide range of potential feedstock, depending on local available resources, such as various kinds of agricultural residues or energy crops.8 have already been proposed for the decentralized generation of pure hydrogen from biogas, such as steam reforming,9 dry reforming and autothermal reforming,10,11 but also unconventional methods, such as solar reforming, membrane reforming12 and thermal plasma reforming. However, these methods for hydrogen generation from biogas may be inhibited by the presence of common impurities as H2S which poisons downstream nickel-based catalysts, siloxanes or carbon depositions due to methane dry reforming with carbon dioxide.8,13,14Several conventional conversion methods2.9\u201311,15 This is because low temperature fuel cells require very low impurity levels, demanding a pressure swing adsorption as additional purification step after steam reforming.Despite its technical limitations, the decentralized generation of hydrogen is often not economically feasible especially in small scale due to the high costs for hydrogen generation, which range from 5.5 to 9 USD per kg Het al., which included a steam reformer and a steam-iron section within a single reactor, enabling concurrent hydrogen production and purification.16,17 Using this method allows a highly efficient hydrogen production with an efficiency up to 73%18 according to thermodynamic studies. Several studies have presented the feasibility of direct high-pressure hydrogen generation with a release pressure up to 100 bar in a fixed-bed chemical looping system, indicating purity levels of up to 99.97%.19\u201321The Reformer Steam Iron Cycle (RESC), based on fixed-bed chemical looping and the steam iron process, is a promising method that can utilize different renewable resources to generate high-purity hydrogen. Its advantage is its simple process layout as proposed by Hacker 22In recent years, an enlarged lab system was established to investigate the impact of upscaling this process from the level of small-scale test bench that involves several grams of oxygen carrier to a reactor system with a capacity of up to 20 kg of oxygen carrier combined with a reformer section for syngas generation.4 and CO2 as main components) is converted into a synthesis gas by the dry reforming reaction  to reductive compounds (CH4) in the reforming reaction  was investigated and steam was co-fed to inhibit carbon deposition. Relatively low temperatures of 700 \u00b0C for reduction and 500 \u00b0C for oxidation were suggested by Lachen et al.23\u201326 to avoid particle sintering, however, this could inherently lower the reactivity of the gas\u2013solid reaction. Lachen et al.26 reported impurities below the gas analytic system detection limit of 50 ppm for carbon monoxide in all cycles where steam was co-fed, but no explicit data for either carbon dioxide or methane contamination levels were provided to support the applicability of this method in low-temperature fuel cells.State-of-the-art investigations on the conversion of synthetic biogas to pure hydrogen with fixed-bed chemical looping systems are currently performed solely in micro-reactor systems, as presented by Lachen Moreover, a high inert gas share of more than 50% was applied in the abovementioned studies. This share significantly influences the outcomes, as it decreases the probability of solid carbon deposition within the system by lowering the carbon monoxide partial pressure and, therefore, directly affects the Boudouard equilibrium. In industrial applications for biogas upgrading, a high inert gas share may be inefficient due the high levels of inert gas consumption required for system operation.et al., who investigated the applicability of biogas mixtures in a catalyst-assisted, fixed-bed chemical looping system without steam addition in a micro-reactor with an inner diameter of 10 mm.27 The system had an output of 3.5 mol H2 per kg Fe2O3. The hydrogen purity was not explicitly specified for the investigated operating points, but a range between 100 and 200 ppm was given in the study (99.98% to 99.99%).Another study was presented by Galvita et al. in a smaller lab reactor system with a combined reformer and steam iron section,28 comprising of 300 g of oxygen carrier inventory and an inner diameter of 35 mm. The attained hydrogen purity in two experiments feeding a biogas mixture with steam addition was 99.75% and 99.84%, respectively.An earlier experimental series was also performed by Nestl 22 Thus, it can be used to proof the applicability of different process mechanisms and feedstocks for potential applications.However, the influence of endothermic and exothermic reactions in all of these reactor systems with diameters between 10 and 35 mm is considerably lower compared to larger fixed-bed reactors as necessary for industrial applications. In particular, the presented 10 kW lab reactor system is unique because it is considerably larger with an oxygen carrier inventory of 18 kg and an inner diameter of 124 mm.22 To address the limitations that were observed during previous studies conducted on smaller test benches, a lower partial pressure of nitrogen  was applied to ensure minimal effects on the thermodynamic equilibria. The impacts of the process temperature, different biogas compositions and steam addition on feedstock utilization and hydrogen purity were determined. The experimental study was performed in the largest 10 kW fixed-bed chemical looping research system currently available worldwide.The goal of this study was to experimentally verify and define certain limitations of typical biogas compositions with respect to their application in a 10 kW fixed-bed chemical looping system. Two synthetic biogas compositions with different O/R ratios were selected on the basis of previous study findings with steam methane reforming.2O3 and 20% Al2O3 powder . The powders were dry-mixed and pelletized with water as a binding agent using an intensive mixer (Eirich EL1). The pellets were dried at 150 \u00b0C and calcined at 900 \u00b0C for six hours. A commercially available catalyst for steam reforming applications was used for the reformer. The preheating zone for the gaseous feed streams in the reactor system consisted of Al2O3 pellets .The applied pelletized oxygen carrier material consisted of 80% Fedi = 124 mm, L = 1800 mm, see V2, totN = 5 NL min\u22121) to these side tubes.The experiments were carried out in a fixed-bed reactor system  were supplied with mass flow controllers (Bronkhorst High-Tech). Steam was fed using a direct evaporator system (ADrop DV-3) with a liquid flow controller (Bronkhorst High-Tech), mixed with methane and heated to 200 \u00b0C in an integrated superheater. The feed gas entered the reactor with a temperature of 150 \u00b0C.All gaseous components  with a 10 m mole sieve column, a 12 m Pora-Plot-Q column and a separate mole sieve module for ppm-range detection of CO and CHEach experiment (cycle) consisted of two phases:(i) The reduction phase, during which the feed gas was supplied to the reformer section and converted to a syngas. The iron oxide was subsequently reduced in the downstream steam iron section. All reduction phases were carried out for three hours unless otherwise stated.\u22121) was directly introduced into the steam iron section and oxidized the iron-based oxygen carrier, resulting in the formation of hydrogen. The reformer section was bypassed to minimize the contamination of the gas by reoxidation of solid carbon in the reformer. Reoxidation was carried out until complete oxygen carrier conversion was achieved.(ii) The oxidation phase, during which steam  and fed in through the side pipes (5 NL min\u22121). The reactor was purged with nitrogen (10 NL min\u22121) between the reduction and oxidation phase to exclude reduction gas remains from the product gas in oxidation phase.The reactor wall heating temperature in the reformer section was set to 900 \u00b0C. In the steam iron section, two temperature levels of 750 \u00b0C and 850 \u00b0C were investigated. During both reaction stages, 10 NL min4\u2009:\u2009CO2 = 75\u2009:\u200925% and 45\u2009:\u200955%) were chosen as feed for the reduction phase. With regard to the recent studies conducted by our research group, a steam to carbon ratio (S/C ratio) of 1.2 and 1.6 have been observed to provide optimal process efficiency while simultaneously avoiding harmful carbon deposition.22 To attain a comparable O/R ratio during this experimental series, steam was co-fed with the synthetic biogas. In addition, a reference operation point was defined with solely steam methane reforming at a S/C ratio of 1.2, that yielded a high process efficiency and purity in a previous experimental series . The results for the steam ratio X2OH and carbon dioxide ratio X2CO, as indicators for the reduction progress, displayed the characteristic behavior of fixed-bed steam iron processes (see 3O4 is reduced to FeO and Fe with a higher gas conversion observed in the beginning (up until approx. minute 50) and (ii) where Fe3O4 is consumed and a steady steam- and carbon dioxide ratio between 0.3 and 0.4 is reached according to the gas\u2013solid equilibrium.16 At the end of the respective cycle, the syngas conversion declined because lower amounts of FeO were present in the oxygen carrier bed and ended close to the measured reformer gas composition. Throughout the whole experimental series, the Fe3O4\u2013FeO gas equilibrium with a steam- and carbon dioxide ratio of about 0.7 was not clearly visible, a result that is in accordance with those of several other experimental analyses.Two consecutive cycles illustrate the general reduction behavior in the system for two operation points with different O/R ratios, 1.2 (OP 1) and 1.6 (OP 3), but a constant biogas composition , although the same absolute feed gas flow of methane was applied. Therefore, the results indicate that a higher O/R ratio, in turn, impedes the degree of utilization of methane as valuable feed.The reduction reaction showed a reaction front similar to that presented in a previous publication,During the oxidation phase, the hydrogen product gas flow immediately rose to a stable conversion of about 65%, exhibiting a good correlation to the gas\u2013solid equilibrium of iron and wuestite (FeO). Again, a period of declining conversion was observed at the end of the oxidation phase.Taxis (red) is measured near the end of the oxygen carrier bed. Due to the exothermic oxidation reaction, it was noted that the temperature in the center of the oxygen carrier bed is significantly affected in large-scale fixed-bed applications. The temperature increased to a maximum between 940 and 1000 \u00b0C, and a high self-heating rate that ranged from 1.7 to 4.8 \u00b0C min\u22121, averaged from temperature rise onset to offset, was determined throughout the experimental series. Both effects were dependent upon the degree of reduction in the respective cycle. However, these effects may significantly influence the oxygen carrier integrity, an effect that should be considered when characterizing materials applied in fixed-bed operation.The passing reaction front also clearly indicates the oxidation progress in the reactor system, as presented in The material degradation observed throughout the whole test series  is characterized by the decline in the oxygen exchange capacity, which is defined by the amount of hydrogen produced after a full reduction of the oxygen carrier. Based on the available results, no significant loss of the oxygen exchange capacity was observed throughout the experimental series.In 4\u2009:\u200925% CO2, O/C ratio 1.2), no significant difference was found in later experiments  three with overnight storage (15 to 16 hours) of the reduced oxygen carrier and concurrent purging of the reactor and (ii) three with immediate hydrogen release after 15 minutes of purging.As Considering the hydrogen purity obtained when the system was purged overnight, the total carbonaceous impurities were below 0.3 NL for all operating points with steam addition in reduction phase . Only operating point 2 exhibited significantly higher carbon impurities in the product gas. In addition, the total amount of impurities still increased over several cycles for both purging methods see , OP 2. FTo recover the steam iron section from carbon deposition after the experimental series, steam was applied in the same manner as in oxidation phase after cycles 47 and 49 to reoxidize solid carbon. A maximum of 0.35% and 0.45% of carbon-containing impurities, respectively, were found in the off-gas with a co-fed inert purging gas for cycles 47 and 49. This recovery of the steam iron section had only minor effects on the hydrogen purity in subsequent cycles  in later experiments, including all operating points, than it had been before.In this the experimental series, the process temperature of 850 \u00b0C was chosen on the basis of previous experimental findings. This temperature level typically exhibits (i) beneficial thermodynamics and reaction kinetics for iron-oxide reduction, (ii) lower probability for carbon depositions from Boudouard equilibrium favored at temperatures below 700 to 750 \u00b0C and (iii) nearly complete methane conversion for steam reforming with above 800 \u00b0C. Nonetheless, lower process temperatures have been proposed by other research groups, as they mitigate challenges faced in the selection of materials for fixed-bed chemical looping. They are also beneficial in terms of heat integration due to lower heat losses and a more efficient use of high-temperature heat in industrial applications.A comparative experimental series was performed at temperatures of 750 \u00b0C and 850 \u00b0C in the steam iron section. All other parameters, including the reformer temperature, were kept constant to provide unaltered boundary conditions for the experimental series. In order to minimize the impact of oxygen carrier degradation on the total amount of hydrogen produced, only one cycle was performed per operation point.2 in the biogas were less strongly affected.In The reason is explained with the Baur\u2013Glaessner diagram: the gas equilibrium for the conversion of wuestite to iron between 850 \u00b0C and 750 \u00b0C increases for the carbon dioxide ratio, but decreases for the steam ratio. Overall, lowering the process temperature may have other advantages, but significantly lowers the feedstock utilization.29The application of chemical looping technologies for high-purity hydrogen production places a focus on solid carbon deposition, as they are reoxidized by steam during the oxidation phase and contaminate the product gas. As low-temperature fuel cells require low amounts of contaminants, the attainable hydrogen purity was investigated. The ISO 14687-2 defines the maximum tolerable hydrogen impurities for road vehicles to below 2 ppm of total hydrocarbons (methane basis), 2 ppm of carbon dioxide and 0.2 ppm for carbon monoxide.\u22121 (typ.) for OP 1, 2 and 4 and 2 N mL min\u22121 (typ.) for OP 4. To evaluate the hydrogen purity, the first and last 5% of hydrogen produced were excluded from the calculation, because a previous experimental series indicated that the highest relative impurities occur at the beginning and end of the oxidation phase.22Between the reduction and oxidation phases, the reactor system was purged overnight (15 to 16 hours) to exclude gaseous residues from the reduction phase. Nevertheless, residues of carbon monoxide and carbon dioxide were still present in the purging gas to a total extent of 0.3 N mL min4, 25% CO2) exhibited an almost constant level of impurities of below 1 N mL min\u22121 per component. This result was reproducible throughout the whole experimental series, so that no severe carbon deposition can be assumed. The product gas purity of the best 90% of hydrogen obtained ranged from 20 to 40 ppm. Moreover, the reference operating point  exhibited similar results, with a total hydrogen purity of 35 ppm of total impurities obtained. This means that no distinct differences can be found between the appliance of synthetic biogas and methane for distinct operating points. Furthermore, the results for steam\u2013methane reforming (reference operating point) are comparable to those reported in a previous publication presented by our research group.The results of the product gas purity are shown in 4, 55% CO2) exhibited unsteady levels of impurities  compared to all other operating points. The total amount of impurities in the product gas increased consequently to between 1000 and 1500 ppm.Severe contaminations were observed only at operating point 2 with solely dry reforming at an O/R ratio of 1.2. The measured carbonaceous impurities were more irregular in each of the single oxidation phases, and the total flow of contaminants was significantly higher , carbon monoxide accounted for about 20 to 30% of the impurities and carbon dioxide for about 70 to 80%. No methane was found in the product gas feed if the system had been sufficiently purged of residues from the reduction gases. An increase of the absolute carbonaceous species flow during oxidation phase see  can be eTo determine the influence of the process temperature, high-purity experiments were also performed at 750 \u00b0C with elongated purging. The absolute amounts of impurities at all operating points at 750 \u00b0C were comparable to those observed for experiments performed at 850 \u00b0C. However, because the total amount of hydrogen produced at 750 \u00b0C was lower, the relative amount of carbonaceous contaminants increased to between 50 and 70 ppm  and 2311 ppm (OP 2). Therefore, no significant benefit in terms of process efficiency or attainable hydrogen purity was found by lowering the process temperature of the reduction and oxidation phase simultaneously.A fixed-bed chemical looping system was operated to proof the ability of high-purity hydrogen generation for low temperature fuel cells with synthetic biogas. The commercial steam reforming catalyst was suitable for biogas reforming as long as a sufficient proportion of steam was co-fed. Severe degradation was caused by solely dry reforming and led to a non-regenerable decrease in catalytic activity within 21 hours of operation.The applicability of different biogas compositions was investigated by co-feeding steam to attain a desired oxidative to reductive species ratio (O/R ratio). The hydrogen production at an O/R ratio of 1.6 was 15\u201320% lower than that at an O/R ratio of 1.2. Likewise, a higher share of dry reforming reduced the hydrogen output based on an identical amount of methane supplied.The attainable hydrogen purity was largely affected by (i) the purging of the reactor system prior the steam oxidation and (ii) the prevention of solid carbon depositions during the reduction phase. The total carbonaceous impurities for applicable operating points were between 20 and 40 ppm with a proportion of 20% carbon monoxide and 80% carbon dioxide. A slight addition of steam was always necessary to prevent severe solid carbon deposition in the reduction phase.A lower process temperature had considerably disadvantageous influence on both the process efficiency and hydrogen purity: The amount of produced hydrogen, after a fixed reduction time of three hours, decreased by 24\u201357% for a process temperature of 750 \u00b0C compared to 850 \u00b0C. Since the absolute amount of impurities remained almost constant for both temperature levels, the relative amount of impurities in the product gas increased by 50\u2013100% at 750 \u00b0C.There are no conflicts to declare."}
+{"text": "Moreover, they have been successfully used as vaccines during the COVID-19 pandemic. In order to unfold full therapeutical potential, these nano agents have to overcome several barriers. Therefore, directed transport to specific tissues and cell types remains a central challenge to receive carrier systems with enhanced efficiency and desired biodistribution profiles. Active targeting strategies include receptor-targeting, mediating cellular uptake based on ligand-receptor interactions, and chemical targeting, enabling cell-specific delivery as a consequence of chemically and structurally modified carriers. With a focus on synthetic delivery systems including polyplexes, lipid-based systems such as lipoplexes and lipid nanoparticles, and direct conjugates optimized for various types of nucleic acids , we highlight recent achievements, exemplified by several nucleic acid drugs on the market, and discuss challenges for targeted delivery to different organs such as brain, eye, liver, lung, spleen and muscle  Over the last three decades, vectors for the delivery of therapeutic genetic material were extensively evaluated and optimized. Currently, more than 3000 clinical trials on gene therapy have been conducted or are still ongoing. With about 2/3 of clinical trials on cancer diseases, gene delivery to tumors represents the primary target for nucleic acid therapy. However, other indications, such as monogenetic diseases, infections, inflammatory diseases, neurological and ocular disorders are also interesting targets for gene therapy \u20133. For gvia Cas9 mRNA/single guide (sg) RNA or as Cas9 protein/sgRNA ribonucleoprotein complex [Synthetic delivery systems present a second class of transfer agents for nucleic acid therapeutics. They have the advantage that they can be designed to be non-immunogenic and have the potential to deliver a broad range of natural or synthetic and modified nucleic acids. Historically, transfections introduced functional genes by either using DNA transfer into the nucleus or RNA transfer into the cytosol \u20138. In co complex . These s complex , 22. Fir complex , 24, pol complex , 26, pol complex , 28 whic complex . Lipid-b complex , 30.Fig.in vivo studies, synthetic delivery systems need to fulfill further demands. The particles should a) show no interaction with blood components or aggregation tendency in physiological environment, b) show prolonged blood circulation time to reach the target tissue, c) promote efficient cellular uptake and d) release the genetic material into the cytoplasm, so it can reach its site of action.In order to show comparable transfection efficacies to viral vectors, especially for et al. using GalNAc-presenting ligands on PLL-polyplexes for directed delivery to hepatocytes [Within this delivery process, one major challenge remains the transport and transfer of nucleic acids to the desired cell type or tissue. This requirement can be approached by modifying synthetic carriers with functional domains giving targeted delivery systems, which was first successfully implemented 35\u00a0years ago by Wu atocytes , 31.via defined ligand-receptor interactions (receptor-targeting) as well as modulating the physicochemical properties of the nucleic acid nanoparticles based on small structural variations of the synthetic carriers . For tumor-specific targeting of nucleic acids we refer to other published work [In this review, we will give an overview about different active targeting strategies for synthetic delivery systems. We highlight recent advances in nucleic acid delivery to specific healthy tissues including the liver, lung, brain, immune cells, retina and muscle. Specific delivery to cell types can be mediated hed work \u201334.in vitro studies thanks to various optimizations. However, during the delivery process from injection to gene expression, several obstacles and cellular bottlenecks must be overcome to unfold the full therapeutic potential of the nucleic acid. Besides efficient encapsulation of the genetic material to protect against degradation, it must be ensured that the carriers circulate in the blood until reaching the target tissue.Synthetic carriers have proven to be potent transfer vehicles for nucleic acid delivery for In vivo applied nanocarriers, however, are confronted with blood components like plasma proteins that adsorb on particle surface and hence sustainably affect circulation, transport to tissues and cellular uptake [Cellular uptake of positively charged polyplexes is enabled by non-specific endocytosis, in particular macropinocytosis from the extracellular fluid  see Fig. The uptr uptake \u201340. For in vivo. Consequently, to ensure tissue- or cell-selective delivery and to minimize accumulation in off-target sites, the particles can be surface-modified either by specific ligands that will interact with receptors on the targeted cell type for active targeting or by modification of their chemical composition leading to altered biodistribution for chemical targeting.To this end, it is necessary to shield positively charged carriers against unspecific interactions with serum proteins that may result in phagocytosis of the particles. This can be achieved by incorporating shielding domains, for example polymers such as polyethylene glycol (PEG) , polyN-. Shieldi ligands on a single carrier. For example, Nie lization . Additiolization . Dual-talization .et al. developed such a gene delivery system by decorating the carrier with the I6P7 ligand, a heptapeptide derived from interleukin-6, which is able to promote both, BBB crossing and cell-specific delivery to interleukin-6 receptor presenting cells [et al. to deliver siRNA into neuronal cells after crossing the BBB for treatment of Alzheimer\u2019s disease. In this study, BBB crossing was achieved via the ApoA-I ligand, which binds to the scavenger receptor B1, and selective uptake of the particles by neuronal PC12 cells could be demonstrated by incorporation of a peptide ligand, NL4 binding to tropomyosin receptor kinase A (TrkA). These findings were subsequently confirmed by in vivo studies resulting in downregulation of BACE1, an enzyme which is involved in pathogenesis of Alzheimer\u2019s disease [Under certain circumstances, nucleic acid carriers have to overcome several barriers to reach their site of action, e.g., the blood\u2013brain-barrier (BBB), followed by membranes of targeted cells. In order to generate cascade targeting delivery systems, nanoparticles can be designed to cross the BBB first and display targeting ligands selectively binding to receptors on specific cells behind the barrier. For example, Wang ng cells . A casca disease , 97.via receptor-independent endocytosis [via low-density lipoprotein receptor (LDLR) [In addition to actively targeted delivery supported by ligand-receptor specific interaction, chemical properties of the carrier system can also generate cell- or tissue-specific delivery. Unmodified polycationic carriers such as poly-L-lysine or PEI naturally interact with negatively charged heparan sulfate proteoglycans of the plasma membrane which leads to particle uptake , 99. Lipocytosis . Recentlr (LDLR) \u2013104. In r (LDLR) . Therefoet al. observed organ-selective distribution of mRNA-LNPs with a library of amino-polyesters either in liver, spleen, or lung after i.v. injection [et al. by developing a barcode tool in order to track biodistribution in vivo [Chemical targeting has shown great potential for ligand-independent, but yet organ-specific delivery of nucleic acids. For example, Kowalski njection . Localiz in vivo . Further in vivo , 109. Re in vivo .The liver is a highly metabolic organ and source of numerous expressed genes and plasma proteins. Not surprisingly, this organ is also a main target for nucleic acid and gene therapy of a series of severe hereditary monogenetic diseases \u2013113. In via the ASGPR, which is found almost exclusively and abundantly on hepatocytes [Delivering nucleic acids into hepatocytes is mostly achieved by receptor-mediated endocytosis atocytes . ASGPR batocytes \u2013118.et al. by using asialoorosomucoid-modified (ASOR) polylysine polyplexes mediating delivery to the liver via ASGPR in vitro and in vivo after intravenous (i.v.) injection [et al. used an artificial tetra-antennary galactose ligand for gene transfer of pDNA-poly(lysine) polyplexes to hepatocytes in vitro [The first targeted delivery of DNA by a non-viral delivery system was reported by Wu njection , 31. Latin vitro . Artificin vitro .et al. developed a dynamic polymer-nucleic acid conjugate, that fulfilled several tasks in one: The backbone itself provided endosomolytic properties, served as reaction site for the covalent attachment of siRNA and was grafted with GalNAc and PEG, giving a targeted and shielded vehicle. This formulation induced gene silencing activity in the liver after i.v. injection in mice [Rozema  in mice .One milestone in both RNAi therapeutics and ASGPR mediated nucleic acid delivery is represented by the market release of Givosiran (Givlaari) in 2019 by the U.S. Food and Drug Administration (FDA) and European medicines agency (EMA). The nucleic acid, a chemically modified and stabilized siRNA, is directly conjugated to a tri-GalNAc ligand optimized towards ASGPR binding sites Fig.\u00a0. When adet al. demonstrated that the conjugation of GalNAc to anti-miRNA ASOs led to highly increased potency [D\u2009<\u2009100\u00a0pM) mediated receptor-dependent, hepatocyte specific delivery and selective gene editing of CRISPR/Cas9 RNP complex [Additionally, the approach of direct conjugates has been further expanded to other cargos, e.g., antisense oligonucleotides \u2013134 or C potency . A novel complex .via ASGPR by GalNAc-modified formulations, uptake of lipid formulations can be also achieved by LDLR-mediated endocytosis. For example, cholesterol-siRNA direct conjugates for apolipoprotein B (ApoB) silencing have been found to exhibit gene silencing activity in hepatocytes in vivo [et al. to enhance uptake and ASO activity in hepatocytes [In addition to active targeting of hepatocytes  in vivo . LDLR-meatocytes .via LDLR [Furthermore, it was found that neutral liposomes interact mostly with apolipoprotein E (ApoE) in the blood, which directs the transport to hepatocytes by LDLR-mediated endocytosis \u2013103. Basvia LDLR .via LDL receptor [et al. the therapeutic effect of Cas9-mRNA/sgRNA targeting TTR, encapsulated by LNPs was evaluated. As a result of efficient TTR gene knockout, an average decrease of 87% of TTR protein levels was observed after one month in the patient group that received 0.3\u00a0mg/kg, accompanied with only mild side-effects. [In particular, Patisiran (Onpattro), the first siRNA product which was approved by FDA and EMA in 2018, is using LDLR interaction for the delivery of siRNA against transthyretin (TTR) mRNA to treat hereditary TTR mediated amyloidosis. By using a sheddable PEG-component, the formation of ApoE protein corona was observed, resulting in hepatocyte uptake receptor , 138. Ineffects. .Approximately 80% of the liver is composed of hepatocytes. However, other cell types which are part of the hepatic reticuloendothelial system (RES), such as liver sinusoidal endothelial cells (LSECs), hepatic stellate cells (HSCs) and Kupffer cells (KCs) also represent interesting targets for nucleic acid therapeutics. Although KCs are very effective in removing and destroying nanosystems, they are much more difficult to be productively transfected with commonly used nucleic acid carriers. Therefore, several attempts were made to enable nucleic acid delivery to these cell types, including receptor-targeting strategies as well as the development of novel lipids for LNPs aiming for chemical targeting Fig.\u00a0.Fig. 4StWhile hepatic stellate cells make up about 5\u20138% of the cells in a healthy liver, the fibrotic liver consists of 15% HSCs. Nucleic acid delivery to activated HSCs is believed to reduce fibrosis by regulating fibrogenic cytokines , 140.et al. accomplished HSC-targeted delivery of liposomes and LNPs by decorating the particle surface with vitamin A [For example, Sato itamin A , 141. Asitamin A  and showitamin A .in vivo screening of lipid compositions aimed for delivery of chemically different LNP formulations beyond hepatocytes and the understanding of particle distribution in the liver microenvironment without the requirement for additional receptor-targeting ligands [Studies conducted by the Dahlman group using the barcode technology described before for  ligands .Targeted nucleic acid delivery to LSECs and KCs, which belong to the hepatic RES using chemical targeting has moved into the focus of attention.et al. used their barcode screening tool to tune the LNP biodistribution in mice based on alterations in the cholesterol component. As a consequence, the biodistribution shifted from hepatocytes to LSECs and KCs, respectively, using cholesterol-oleate or oxidized cholesterol [Dahlman lesterol , 144. Adlesterol . Furtherlesterol .et al. developed LNPs for delivery of mRNA to hepatic RES resembling the Onpattro\u00ae formulation. By replacing the phospholipid within the LNP from the zwitterionic 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) to the anionic 1,2-distearoyl-sn-glycero-3-phosphoglycerol (DSPG) a negative surface charge was created and specific uptake by LSECs under participation of Stabilin receptors in embryonic zebrafish and mice was achieved [Recently, Pattipeiluhu achieved .Immune cells represent an interesting target for nucleic acid delivery as they play an important role in a wide range of diseases, including cancer, inflammatory or autoimmune diseases, etc. Besides the hepatic RES, immune cells are ubiquitous in the organism, especially in the spleen. Delivery of nucleic acid therapeutics to leukocytes, which include macrophages and dendritic cells as well as lymphocytes, offers the way to introduce genetic material with anti-inflammatory potential or to provoke T-cell modulation as a mean of immune stimulation , 148.et al. using mannosylated PLL polyplexes by interaction with the mannose receptor [in vitro and in vivo, which offers the opportunity for targeted gene regulation in immunosuppressive macrophages [et al. demonstrated efficient, ligand dependent gene silencing activity of a direct conjugate between siRNA and a tetravalent, chemically modified mannose in macrophages, which represents the first report of systemic delivery of siRNA-ligand conjugates to leukocytes [Macrophages, including the aforementioned Kupffer cells, express membrane lectins which recognize certain carbohydrate patterns, such as the mannose receptor CD206, that mediate endocytosis as a central function of immune response , 150. Threceptor . Mannosyreceptor . Moreoverophages , 154. Inukocytes .via phagocytosis or receptor-mediated endocytosis, dependent on their size and surface modifications. However, for immunotherapy it can be desirable to target DCs specifically , play a crucial role in antigen recognition of antigens and activation of immune response after uptake of foreign particles. Particles are internalized ly Table .Table IIvia mannose receptor was described by Diebold et al. by using mannose functionalized PEI polyplexes. Receptor-specific uptake was demonstrated in a competition assay with mannose albumin, which lowered gene expression of Man-polyplexes [et al. designed mannose ligands optimized towards the carbohydrate recognition domains of mannose receptor and the DC-specific intercellular adhesion molecule-3-grabbing non-integrin , respectively. Liposome uptake by DC2.4 cells and DC-SIGN expressing HEK293 cells was observed in a ligand-dependent manner. These particles were not yet used to deliver nucleic acids to DCs but provided deeper insight in the understanding of ligand design to improve receptor interaction [DNA delivery to DCs lyplexes . Gao et eraction . The imperaction . Recentleraction .via DEC205, another receptor from the mannose receptor family [et al. formulated LNPs bearing a single-chain antibody to target DEC205 expressing murine DCs. Receptor-specific binding and uptake of the siRNA-LNPs were determined via flowcytometry, showing that uptake was twofold improved by targeted LNPs. DEC205-dependent internalization was further confirmed by reduced knock-down efficacy in DEC205 deficient mice [Targeting of dendritic cells was also achieved r family , 159. Kaent mice .The spleen and more specifically DCs were chemically targeted by lipoplexes with an inversed lipid/RNA charge ratio giving negatively charged particles. After systemic administration, these particles successfully delivered mRNA encoding for antigens and promoted stimulation of APCs for cancer immunotherapy .et al. achieved gene transfer to human T-lymphocytes by decorating Tf-PLL polyplexes with antibodies against the CD3 T cell receptor [et al. aspired to deliver siRNA-LNPs to CD4\u2009+\u2009T-lymphocytes by attachment of anti-CD4-monoclonal antibody, whereby the specific delivery to CD4\u2009+\u2009lymphocytes could be confirmed ex vivo. Additionally, i.v. injection in mice showed gene silencing activity in spleen, lymph nodes, bone marrow and blood [et al. evaluated LNPs loaded with modified mRNA for delivery to Ly6c\u2009+\u2009inflammatory leukocytes [via incorporation of lipoproteins interacting with antibodies [T-lymphocytes also play a crucial role in cellular immune response . Therapyreceptor . Ramishend blood . Veiga eukocytes . For thitibodies . Decorattibodies .et al. studied the distribution of a library of 168 siRNA-LNP formulations with structural changes regarding the lipids in different cell types in vivo and showed that constrained LNPs preferably delivered the genetic material to splenic T lymphocytes instead of hepatocytes making these formulations interesting for immunotherapy [Great advances regarding nucleic acid delivery to T-lymphocytes were made using the chemical targeting approach. Using the barcode screening technology, Lokugamage otherapy .et al. The biodistribution after i.v. injection in mice showed accumulation in spleen for piperazine head group and in liver for tertiary amine head group [A screening of 14 structurally different ionizable lipids by variation of linker backbone, head group and alkyl chains for delivery of siRNA-LNPs into leukocytes was reported by Ramishetti ad group . In the ad group .via local and systemic administration routes. However, protective mechanisms and physiological barriers such as mucosal barrier or immune cells may impair the delivery of nucleic acids [Table Many severe, eventually lethal diseases are associated with the lung, for example cystic fibrosis, chronic obstructive pulmonary disease (COPD), asthma or pulmonary fibrosis amongst others. One advantage of nucleic acid delivery to the lung is certainly the accessibility of the lung ic acids . For selet al. The hybrid polymer-lipid formulations used in their studies, consisting of poly(\u03b2-amino esters) (PBAEs) and PEGylated lipids, generated protein expression in the lung after i.v. injection in mice, but not in other organs [Due to their positive surface charge, many polyplex (PEI) as well as cationic liposome formulations automatically accumulate in the lung when injected systemically \u2013172. In r organs \u2013175.et al. studied the selective delivery to different lung epithelial cell types. It was reported that pDNA/PEI polyplexes modified with lactoferrin delivered the nucleic acid selectively to bronchial epithelial cells via lactoferrin receptor, but not alveolar epithelial cells, whereas adsorption of insulin to pDNA/PEI polyplexes showed increased luciferase gene expression in alveolar epithelial cells, but not in bronchial epithelial cells [via caveolae-dependent pathway by incorporation of arginine-glycine-aspartic acid (RGD) motifs into the delivery system [et al. observed targeted delivery of pDNA-polylysine complexes conjugated with Fab fragments of immunoglobulins directed against the polymeric immunoglobulin receptor (IgR) which is involved in the transport of immunoglobulins A and M from cell surface into lung epithelial cells. A competition assay with excess of Fab ligand blocked delivery gives further evidence for receptor-mediated uptake [et al. were able to generate higher gene expression after i.v. injection of anti-PECAM-mAb decorated pDNA-PEI polyplexes in mice, furthermore observing reduced cytotoxicity when using ligand-modified carriers [Active targeting of lung epithelial cells resulting in receptor-mediated uptake of non-viral delivery systems was obtained by several classes of ligands, such as peptides, proteins, antibodies, carbohydrates and also small drugs. Elfinger al cells , 91. Inty system , 177. Mod uptake . Additiocarriers . More recarriers .et al. has shown that transferrin modification led to enhanced cellular uptake and efficient, selective gene knockdown in vitro as well as in an asthma mouse model after intratracheal application [et al. developed a virus-inspired polymer for endosomal release (VIPER) [in vitro and in vivo [ex vivo in human lung tissues and in mouse models [Transferrin (Tf) was used as targeting ligand to mediate the delivery of PEI-siRNA polyplexes to pulmonary activated T cells (ATCs). A study by Xie lication . Furtherlication . In fact (VIPER) , which w in vivo . VIPER/se models .et al. demonstrated enhanced gene expression in alveolar epithelial cells in vitro as well as in vivo after inhalation of Clenbuterol-functionalized polyplexes [et al. using guanidinylated chitosan carriers [in vivo in the lungs of mice after aerosol administration [Furthermore, small chemical compounds, which have already been used effectively as drugs for asthma treatment were used as targeting ligands coupled to synthetic nucleic acid carriers for targeted nucleic acid delivery to the lung. For example, agonists for the \u03b22-adrenoceptor were successfully used for targeted and improved delivery of nucleic acids to lung epithelial cells. Elfinger lyplexes . Specificarriers . In addistration . For theet al. showed that gene expression of pDNA/polylysine polyplexes could be increased through functionalization with \u03b2-galactose, \u03b1-glucose as well as lactose compared to other monosaccharides and the non-targeted formulation after transfection to cystic fibrosis cells [in vivo experiments after intratracheal administration [Additionally, lectins have been studied for lung-specific uptake of non-viral delivery systems. Several studies by Kollen is cells \u2013188. Trastration . In bothvia systemic administration routes remains challenging due to poor accessibility of the brain through the blood\u2013brain barrier (BBB). Therapeutic nucleic acids compacted into synthetic carrier systems are not able to cross the BBB via diffusion [via systemic administration is highly desired, as topic routes like intracranial or intracerebroventricular injections as well as physical methods that enhance the permeability of the BBB are highly invasive. Thus, synthetic carriers must be decorated with ligands, which are recognized by receptors or carriers embedded in the BBB, becoming \u201ctrojan horses\u201d, which are enabled to deliver nucleic acid to the brain through receptor-mediated transcytosis (RMT) or carrier-mediated transcytosis (CMT). Various synthetic carrier systems were modified with several ligands, ranging from proteins, peptides and aptamers to generate brain-targeted gene delivery  originate in the central nervous system (CNS). Treatment of these diseases iffusion . HoweverA possible approach to facilitate nucleic acid transfer into the CNS is to use receptor-mediated transcytosis by transport proteins that enable the passage of essential nutrients, proteins or lipids across the BBB.et al. prepared Tf-modified siRNA-lipoplexes that showed superior uptake by neuronal cells as well as significant gene silencing in both, in vitro and in vivo compared to non-targeted particles [via delivery of plasmids encoding for short hairpin RNA (shRNA). It could be demonstrated that TfR-targeted immunoliposomes provided a dual targeting effect, as they promoted BBB crossing and subsequent uptake of glioma cells, which are also overexpressing TfR [Transport of iron across the BBB is mediated by several iron transport protein receptors, including transferrin, lactoferrin or melanotransferrin. Above all, transferrin receptor was widely studied for targeted uptake of synthetic carriers to the CNS. As known from previous studies, the transferrin protein itself holds great potential to mediate receptor-dependent polyplex uptake by TfR-expressing cells and therefore, was explored for mediating transcytosis across the BBB , 192. Foarticles . Moreovearticles , 195. Tfsing TfR . Recentlsing TfR . The retsing TfR .in vivo compared to untargeted particles. In addition, selective delivery to the brain was reported after systemic administration [Besides TfR, the lactoferrin receptor (LfR) is also involved in cellular iron uptake and expressed on the BBB . By usinstration . Additiostration .in vivo gene silencing of NOX4, a gene that is upregulated during stroke [Furthermore, a short 12-amino acid peptide which has shown interaction with the iron transport protein melanotransferrin was able to mediate entry in the brain. Conjugation to siRNA enabled not only accumulation in the brain, but also g stroke , 202.et al. developed Kunitz domain derived peptides from aprotinin, named Angiopep, that showed the ability to overcome BBB via LRP1-mediated transport [in vitro and a shift of the biodistribution from spleen (for untargeted carriers) to brain (for targeted polyplexes) in vivo [. The same ligand was later included in siRNA-LNP formulations by Bruun et al. for in vitro studies on uptake and gene silencing activity in human glioblastoma U87MG and murine brain endothelial bEnd.3 cell line. In addition to an increased gene knock-down, it could be observed that uptake could be improved about 2.4-fold by Angiopep-2 modification [in vivo by interaction with LRP1 [Nucleic acid transfer across the BBB was furthermore achieved by low-density lipoprotein receptor related protein (LRP1) mediated transcytosis. Demeule ransport , 204. An in vivo . The samfication . Moreoveith LRP1 . Compareith LRP1 .Moreover, the leptin receptor, which is responsible for recognition and transcytosis of the appetite regulating peptide leptin, was used for nucleic acid delivery to the brain . It was In addition to ligands interacting with receptors which transport essential molecules across the BBB, another approach is to modify the carrier system with peptides deriving from viruses, bacteria or venoms that naturally show capabilities to enter the brain.et al. [et al., using RVG29-PEG-PAMAM/DNA polyplexes, revealed involvement of GABA receptor in uptake [For example, the peptide RVG29 was studied for nucleic acid transfer across the BBB. The ligand derived from rabies virus glycoprotein (RVG), which naturally shows the ability to enter the brain as part of its pathology and targets mainly the nicotinic acetylcholine receptor (nAChR) . RVG29 wet al.  reportedn uptake . Efficien uptake -216. Furn uptake .et al. demonstrated the capability of a peptide sequence derived from meningitis-causing pathogen to mediate brain-specific delivery of surface-modified PLL/DNA-dendrimers via laminin receptor, resulting in enhanced cellular uptake by BCECs and U87MG cells compared to an endogenous laminin-targeting ligand [Furthermore, Liu g ligand .et al. explored the specific delivery of antibody-modified mRNA-LNPs using an anti-vascular cell adhesion molecule 1 (anti-VCAM1) antibody to the inflammatory brain. It was found that the particles were delivered to brain endothelial cells but not to leukocytes. Furthermore, as a consequence of successful mRNA delivery, expression of anti-inflammatory thrombomodulin could be observed in a mouse model [A recent study by Marcos-Contreras se model .Some of the aforementioned ligands, such as Angiopep and RVG-29, as well as further peptide ligands were used for direct conjugation to phosphorodiamidate morpholino oligomers (PMOs), which function as splice-switching oligonucleotides. It was demonstrated that a truncated peptide-derivative of ApoE mediates PMO delivery in the CNS .et al. developed glucose-decorated polymeric carriers, which facilitated nanoparticle delivery to GLUT1-rich cancer cells under glycemic control [An additional pathway to overcome BBB is through transcytosis by glucose transporter 1 (GLUT1). As transport carrier for glucose, GLUT1 is abundantly expressed on brain capillary endothelial cell (BCEC) membrane, ensuring adequate glucose supply of the brain . Researc control , 222. Th control . Another control -227.3.4\u00a0kDa-all-trans-retinylamine to target the interphotoreceptor retinoid binding protein (IRBP), a key protein in the retinoid cycle [3.4\u00a0kDa-spacer, was used for IRBP-mediated delivery of ECO/DNA particles and gene expression of ABCA4 in ARPE-19 cells as well as in abca4-/- mice [Many genetic eye disorders, either inherited or environment-dependent, may lead to loss of vision eventually due to impaired functions of photoreceptors or retinal pigment endothelium (RPE). Therapeutic approaches mostly use classic gene therapy with DNA for gene replacement or gene-editing methods. Formulations are usually injected subretinal or intravitreal due to the blood ocular barrier and in order to reduce off-target effects or elimination by immune system. Furthermore, persistent high levels of gene expression after single injections are highly desired for retinal gene therapy. Sustainable gene expression was achieved by using PEG-PLL/DNA polyplexes, which were locally injected in mouse models -230. Delid cycle . In thisid cycle . Additio-/- mice .Furthermore, liposome-protamine complexes have shown potential to promote long term gene expression or gene knock-down, respectively -242. Moret al. developed HA-chitosan nanoparticles loaded with reporter DNA which successfully transfected human corneal epithelial (HCE) cells and conjunctiva cells via the CD44-receptor [et al. using HA-coated PEI/DNA polyplexes demonstrating that nanoparticles coated with low-molecular weight HA generated well shielded, stable particles while maintaining efficient transfection activity [In order to address corneal gene delivery, researchers used hyaluronic acid as a targeting ligand for the CD44-receptor, which is expressed by human corneal epithelial cells and is responsible for turnover of HA -247. Forreceptor , 249. Fureceptor . CD44-reactivity .in vivo ASO potency was observed in rodents, but only a modest improvement in monkeys [The delivery of nucleic acids to skeletal and cardiac muscles allows the treatment of muscle-related disorders such as muscular dystrophy. Efforts were made to develop lipid-siRNA conjugates that enable muscle-targeted delivery upon systemic injection. Therefore, a library of lipid-ASO conjugates were screened regarding their ability to deliver functional ASOs to muscle cells after i.v. injection in mice. It was demonstrated that delivery to muscle cells was dependent on the length of the fatty acid, with C16 to C22 showing highest accumulation based on their affinity to albumin which mediated transport to muscle cells . The pal monkeys . Moreove monkeys . Compare monkeys .in vitro performance. However, most formulations have not taken the step to product development for in vivo applications.It is noticeable that delivery systems using targeting ligands are rather rare on the medical market. Only a few products such as GalNAc direct siRNA conjugates and ApoE endogenously targeted Patisiran were approved by FDA. In fact, the majority of targeting ligands was evaluated in cell culture studies, demonstrating improved in vitro studies and in vivo performance, making predictions for (pre-)clinical studies questionable when drawn from cell culture evaluation [Potential reasons for this observation must be considered and evaluated in order to find explanations for this translational bottleneck. There is a great discrepancy between the results obtained from aluation -40.In vivo nucleic acid delivery appears to be affected by several barriers. In contrast to small molecule drugs, nucleic acids exhibit unfavored pharmacokinetic and pharmacodynamic profiles due to their high molecular weight and charge, excluding membrane diffusion as internalization route. The demand for endocytic internalization pathways, membrane barriers become more difficult to overcome and formulation properties have to be carefully tailored, resulting in complex, multi-component nanoparticle formulations. Furthermore, different types of nucleic acid therapeutics have different requirements on the formulation. Therefore, addressing new obstacles, i.e., cellular barriers such as nanoparticle uptake and endosomal escape represent major bottlenecks for clinical translation, as discussed in detail by several researchers [in vitro protein corona depleted targeting capability, whereas a protein corona resembling in vivo conditions caused only a reduction in specific receptor-mediated uptake [earchers -259. Priearchers -262. Thed uptake .Fig. 5Inin vivo protein corona even enhanced the overall uptake of the nanoparticles, hypothesizing redirection of cellular uptake by the protein layer and opening new paths for particle internalization [et al. observed that antibodies covalently bound to nanoparticles lose their targeting ability almost completely in presence of serum. Particles with physically adsorbed antibodies, however, maintained their targeting ability, probably due to the fact that these antibodies were not completely exchanged or masked by serum proteins [Interestingly, two studies could prove that the lization , 263. Asproteins .in vivo [in vivo. It is commonly known that plasma proteins adsorption depends on particle surface characteristics. Hence, slight structural changes of the particle surface have shown to affect the protein corona composition. As a consequence of protein corona modification, transport to target cells by coating with certain plasma proteins which serve as endogenous ligands can be obtained in vivo. For example, DOTAP/DNA lipoplexes have shown to adsorb vitronectin which mediated receptor-dependent uptake by tumor cells expressing \u03b1V\u03b23 integrins [in vivo and therefore targeted delivery to other cell types could be achieved by an altered protein corona as a consequence of exchanging certain lipid components of the Patisiran formulation [et al. used \u201cnanoprimers\u201d administered shortly before injection of therapeutic LNPs that were taken up by cells of the hepatic RES  and even allows receptor-mediated transport across internal barriers . New, high-affinity ligands for specific delivery are discovered continuously and can be conjugated to synthetic carriers in numerous ways. Chemical targeting achieved by structural alterations of the particle components has also shown great potential for promoting cell-specific nucleic acid delivery. As a result, shifted biodistribution profiles were observed which enabled delivery to desired cells. In addition, new technologies as the barcoding method combined with high throughput processes could path the way for future applications, readily adjustable formulations and a deeper understanding of in vivo performance.Cell-specific delivery, especially for"}
+{"text": "Irritable bowel syndrome (IBS) is a common gastrointestinal disorder characterized by recurrent visceral pain and altered bowel habits (diarrhea or constipation). However, the molecular and pathological mechanisms are poorly understood. This study found neonatal colorectal distension to induce visceral hypersensitivity and anxiety. The expression of hippocampal circKcnk9, a novel circRNA, was significantly increased in IBS-like rats. Interestingly, CA1 shcircKcnk9 treatment inhibited long-term potentiation (LTP) and alleviated visceral hypersensitivity and anxiety in IBS-like rats, whereas overexpression of CA1 circKcnk9 induced LTP, visceral hypersensitivity, and anxiety in controls. Several experiments indicated that increased CA1 circKcnk9 acted as a miR-124-3p sponge, which resulted in the inhibitory effect of miR-124-3p on gene silencing. There was a negative correlation between circKcnk9 and miR-124-3p expression. As expected, CA1 administration of agomiR-124-3p decreased CA1 LTP, visceral hypersensitivity, and anxiety in the IBS-like rats. In contrast, CA1 treatment with antagomiR-124-3p induced LTP, visceral hypersensitivity, and anxiety in the controls. Furthermore, bioinformatic analysis and experimental data showed that EZH2 is a circKcnk9/miR-124-3p target gene, and increased EZH2 expression was involved in visceral hypersensitivity and anxiety in IBS-like rats by enhancing hippocampal synaptic plasticity. In conclusion, early life stress induces increased expression of circKcnk9 in the CA1 of IBS-like rats. Increased circKcnk9 expression regulates synaptic transmission and enhances LTP, leading to visceral hypersensitivity and anxiety in IBS-like rats. The underlying circKcnk9 signaling pathway is miR124-3p/EZH2. Increased circKcnk9 reinforces its sponging of miR124-3p and strongly suppresses miR124-3p activity, resulting in increased expression of the target gene EZH2. This study provides a new epigenetic mechanism for visceral hypersensitivity and anxiety in IBS-like rats. Irritable bowel syndrome (IBS) is characterized by recurrent episodes of abdominal pain and irregular bowel habits (diarrhea or constipation) without recognizable organic pathological changes  stimulation once daily for 1 min during postnatal days 7\u201314  and fixed on a stereotactic instrument . Following routine skin sterilization, a midline scalp incision was made, and local anesthesia was administered with lidocaine. The skull was exposed and cleaned by scraping it with 10% hydrogen peroxide. All surgical procedures were performed under aseptic conditions, and no infection was detected.The coordinates of the injection locations were centered at 4.0 mm in the anteroposterior plane, 2.5 mm in the mediolateral plane, and 2.8 mm in the dorsoventral plane. The rats underwent stereotaxic surgery for double cannula  implantation and were allowed to rest for at least seven days. Continuous intrahippocampal administration  was administered once daily for 3 days.IBS-like rats that received an intrahippocampal injection of LV-hSyn-mcherry-5'MiR-30a-shcirc7685-3'MiR-30a-WPRE .The open field test (OFT) was performed in the novel environment, which was a black Plexiglas area (100 \u00d7 100 \u00d7 60 cm). The equipment was wiped with 10 % ethanol three times to eliminate odor clues between each rat. The rats were placed in the center of the Plexiglas area and allowed to freely explore the field for 5 min. The total travel distance, travel distance in the central area, and time spent in the central area were measured as anxiety indicators. The rat's body tracks were recorded by the Yishu Vision tracking system .The elevated plus maze (EPM) test consisted of four arms: two open and two closed arms (LWH 500 \u00d7 100 \u00d7 450 mm). At the beginning of the experiment, the rats were individually placed at the junction of the four arms. The equipment was wiped with 10% ethanol three times to eliminate odor clues between each rat. The tracking of the rats was recorded for 5 min using video-tracking software and saved for future analysis on a computer. Additionally, the number of open-arm entries, open-arm time, and open-arm distance in EPM was recorded for the indicators of anxiety-like behavior. The video-tracking system was the same as that of the OFT analysis system.Electromyography (EMG) was performed to assess visceral hypersensitivity. Rats (6\u20138 weeks old) were anesthetized with isoflurane. Before the CRD procedure, a glycerol-lubricated balloon was inserted into the rectum. A pair of bipolar electrodes were implanted in shallow anesthetized rats' abdominal external oblique musculature to detect EMG activity. Under isoflurane superficial anesthesia, the discharge of the rat ventral oblique muscle was recorded at CRD pressures of 40 and 60 mmHg. The EMG responses to different degrees of CRD were recorded using the RM6240BD system . Data were analyzed by averaging the baseline amplitudes. Values over the baseline were used to assess visceral hypersensitivity  consisted of a circular tank circled with dark curtains and was used to assess hippocampal-dependent spatial learning and memory. The water was made opaque by adding the prepared Chinese ink and separated into four equal quadrants. The first day of water maze training was dedicated to adapting rats to the aquatic labyrinth. In the center of the fourth quadrant, a hidden platform was located 1 cm below the water's surface. The trials were performed four times per day for a total of 6 days, and the rats' latency in finding the platform was recorded .A radioimmunoprecipitation assay (RIPA) buffer was obtained from Millipore. A protease inhibitor (PMSF) was purchased from Sigma-Aldrich. Proteins from the hippocampus of rats were extracted using RIPA and PMSF, separated by 8% SDS-PAGE, and electro-transferred onto PVDF  membranes, which were probed with rabbit anti-enhancer of zeste homolog 2 (EZH2) , rabbit anti-EED , rabbit anti-SUZ12 , and mouse anti-\u03b2-actin primary antibody . Furthermore, protein expression levels and quantification of IF were detected using ImageJ . An Evo-M-MLV reverse transcription kit  was used to perform reverse transcription of circRNA and mRNA. The miRNA 1st-strand cDNA synthesis kit  was used to perform reverse transcription for microRNA. After reverse transcription, qRT-PCR was performed. The primer sequences are shown in The hippocampi were fragmented using ultrasonography. RNA immunoprecipitation was performed using the RNA immunoprecipitation (RIP) RNA-Binding Protein Immunoprecipitation Kit   was used to test luciferase activity. The relative firefly luciferase activity was normalized to Renilla luciferase activity.PC12 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 5% FBS  and 1% penicillin/streptomycin and were transfected with mimic124-3p/nc at a concentration of 50 nM oligonucleotides using Lipofectamine 3000 (Invitrogen), according to the manufacturer's protocol. For the luciferase reporter assay, pmirGLO dual-luciferase vectors  were used to construct dual-luciferase reporter plasmids. The sequences of miR-124-3p and circKcnk9 were separately cloned into vectors . PC12 cein situ Hybridization (FISH) kit  and an RNA probe from Exiqon , according to the manufacturer's protocol. For combined RNA FISH and immunostaining, we first performed RNA FISH, followed by immunofluorescence.Rats were deeply anesthetized with Ulatan (0.5 mL/100 g) and transcardially perfused with 500 mL of ice-cold 0.9% NaCl, followed by 750 mL of 4% paraformaldehyde. The brains were removed from the skull and placed in 4% paraformaldehyde overnight. After gradient dehydration with 20% and 30% sucrose , tissues were embedded with an optimal cutting temperature (OCT) compound and sectioned using a cryotome . RNA localization and quantification were determined using a Fluorescence RNA degradation was ruled out in all the steps by using diethyl pyrocarbonate-treated water.TMX-100 at room temperature for 2 h (or 37\u00b0C for 30 min) and then incubated with primary antibodies at 4\u00b0C for 24\u201348 h. Sections were incubated with secondary antibodies at room temperature for 2 h before being washed with PBS (three times for 15 min). Immunofluorescence analysis of frozen sections was performed using the primary antibodies described in The sections (20\u201340 \u03bcm) were removed from the \u221220\u00b0C refrigerator for half an hour before use. Phosphate buffer solution (PBS) was used to wash out the OCT. A Pap pen was used to circle the tissues. The sections were blocked with an immunostaining blocking buffer solution containing 5% goat serum and 0.3% TritonSecondary antibodies: Goat anti-Rabbit lgG, 488 ; Goat anti-Mouse lgG, 488 ; Goat anti-Rabbit lgG 594 ; Goat anti-Mouse lgG, 594 .Immunofluorescence and FISH images were captured using a Leica SP5 confocal microscope equipped with 405, 488, and 594 lasers. The contrast of the final images was adjusted using Photoshop .http://www.microrna.org/microrna/home.do). Circular plots of circRNA-miRNA-binding sites were plotted using (http://www.bioinformatics.com.cn), a free online platform for data analysis and visualization. Venn diagrams were created using the Lianchuan Cloud platform . A PPI network of the HUB gene was obtained using the STRING database (https://string-db.org) and visualized using Cytoscape  artificial cerebrospinal fluid (ACSF). The slices were incubated in an interface-recording chamber maintained at a constant temperature and allowed to equilibrate for at least 1.5 h. Each brain slice was recorded only once.Rats (6\u20138 weeks) were anesthetized with isoflurane (2%), and the brain was rapidly removed by decapitation. Acute coronal slices (400 \u03bcm thick), including the hippocampus, were obtained using a vibrating-knife microtome (Leica VT1000s) in an oxygenated, ice-cold, high-sucrose cutting solution . The coronal hippocampal slices were rapidly removed and transferred to 30\u00b0C oxygenated . The Schaffer collaterals were stimulated, and fEPSPs were recorded from the dendritic layer of the CA1 pyramidal cells, as reported by Kleppisch and colleagues for local field potential recordings in the hippocampus -LSD-t comparisons if the data were normally distributed. The rank sum test, Kruskal\u2013Wallis H test, and Nemenyi test were performed when the data did not satisfy the normal distribution, and there were more than two groups. In addition, repeated-measures ANOVA was performed to analyze electrophysiological results. The EMG results were analyzed using two-way ANOVA. Correlation analysis was performed using a two-tailed Pearson correlation. Data analysis was performed using GraphPad Prism8 and R4.0.3, and a An IBS-like model was established using neonatal CRD . Viscera+ cells was higher in IBS-like rats than in controls  was microinjected into the CA1 of control rats to overexpress circKcnk9, whereas shcircKcnk9 was microinjected into the CA1 of IBS-like rats to knockdown circKcnk9. IF and qPCR assays confirmed that the circKcnk9 AAV/shRNA virus was successfully expressed in the hippocampus ,F. FieldTaken together, increased circKcnk9 was expressed in CA1 of IBS-like rats, and CA1 shcircKcnk9 treatment inhibited LTP and alleviated visceral hypersensitivity and anxiety in IBS-like rats. In contrast, overexpression of CA1 circKcnk9 enhanced LTP and induced visceral hypersensitivity and anxiety in control rats. Accordingly, we inferred that increased CA1 circKcnk9 expression induced by early life stress regulates visceral pain and anxiety by enhancing LTP in IBS-like rats.The literature reports that circRNAs could act as miRNA sponges to modulate the expression of target genes (Kristensen et al., As the expression of CA1 miR-124-3p decreased in IBS-like rats, we examined the influence of modifying CA1 miR-124-3p expression on LTP, visceral pain, and anxiety in rats. AntagomiR-124-3p was microinjected into the CA1 of control rats to inhibit the expression of miR-124-3p, whereas agomiR-124-3p was microinjected into the CA1 of IBS-like rats to increase the expression of miR-124-3p. Field potential experiments showed that inhibiting miR-124-3p enhanced CA1 LTP in the hippocampal slices of control rats, whereas increasing miR-124-3p attenuated CA1 LTP in IBS-like rats ,B. CompaBecause a single miRNA has the potential to regulate hundreds of transcripts, we predicted putative targets for miR-124-3p using five databases: miRanda, Targetscan, miRDB, miRmap, and miRwalk . We usedIn light of our finding that CA1 EZH2 expression was increased in IBS-like rats, we microinjected siEZH2 into CA1 to knock down EZH2 and examine its effects on visceral hypersensitivity, anxiety, and CA1 LTP. Western blotting confirmed that CA1 EZH2 expression decreased after CA1 treatment with siEZH2 in IBS-like rats . The EMGThis study explored the epigenetic molecular mechanisms underlying visceral hypersensitivity and anxiety comorbidities in IBS-like rats. Neonatal CRD-induced visceral hypersensitivity and anxiety in IBS-like rats. The expression of hippocampal circKcnk9, a novel circRNA, was significantly increased in IBS-like rats. CA1 shcircKcnk9 treatment inhibited LTP and alleviated visceral hypersensitivity and anxiety in IBS-like rats, whereas overexpression of CA1 circKcnk9 enhanced LTP and induced visceral hypersensitivity and anxiety in control rats. Several experiments indicate that increased CA1 circKcnk9 acts as a miR-124-3p sponge, inhibiting the role of miR-124-3p in gene silencing from causing enhanced LTP, visceral hypersensitivity, and anxiety in IBS-like rats. CA1 administration of agomiR-124-3p decreased CA1 LTP amplitude, visceral pain response, and anxiety in IBS-like rats. In contrast, CA1 treatment with antagomir-124-3p induced LTP, visceral hypersensitivity, and anxiety in the control rats. Furthermore, bioinformatics analysis and experimental data showed that EZH2 is a target gene of miR-124-3p and that increased EZH2 expression is involved in visceral hypersensitivity and anxiety in IBS-like rats by regulating synaptic plasticity.The current study shows neonatal CRD-induced visceral hypersensitivity and anxiety in IBS-like rats. Our previous study demonstrated that LTP is enhanced in the hippocampal CA1 region of IBS-like rats (Chen et al., Chronic phenotypes are often associated with the epigenetic modulation of gene expression. In light of the literature suggesting that hippocampal circRNAs may be involved in the regulation of pain (Zheng et al., Because of the increased expression of CA1 circKcnk9 in IBS-like rats, we hypothesized that intervention in the expression level of CA1 circKcnk9 could regulate LTP, visceral pain, and anxiety in rats. In support of this, AAV was microinjected into the CA1 of control rats to overexpress circKcnk9, while shcircKcnk9 was microinjected into the CA1 of IBS-like rats to knockdown circKcnk9. As expected, overexpression of hippocampal circKcnk9 induced visceral hypersensitivity and anxiety in controls, whereas knockdown of circkcnk9 attenuated visceral hypersensitivity and anxiety in IBS-like rats. Behavioral evidence supported our finding that the CA1 circKcnk9 is a key molecule for visceral hypersensitivity and anxiety comorbidity in IBS-like rats. In line with the behavioral results, electrophysiological experiments revealed that overexpression of CA1 circKcnk9 facilitated high-frequency-induced LTP in controls, whereas knockdown of circkcnk9 inhibited LTP in IBS-like rats, indicating that circKcnk9 could affect synaptic plasticity and cause central sensitivity. Furthermore, it was reported that neural circRNAs are derived from synaptic genes and are regulated by development and plasticity (You et al., Studies have reported that circRNAs can act as miRNA sponges to modulate the expression of target genes (Zeng et al., Furthermore, the miRanda database and dual-luciferase reporter assay suggested that circKcnk9 could directly adsorb miR-124-3p through three predicted sites. Meanwhile, qPCR quantification showed that hippocampal miR-124-3p expression was decreased in IBS-like rats. Since circKcnk9 acts as a miR-124-3p sponge, there is a negative correlation between circKcnk9 and miR-124-3p. It is conceivable that the gene regulation of CA1 miR-124-3p will have opposite effects on CA1 LTP and behavior in rats. Electrophysiological and behavioral experiments confirmed this speculation that CA1 miR-124-3p upregulation decreased CA1 LTP amplitude, visceral hypersensitivity, and anxiety in IBS-like rats, while miR-124-3p downregulation induced LTP, visceral hypersensitivity, and anxiety in control rats. Intrahippocampal supplementation with miR-124-3p could be a novel therapy for IBS, which has also been studied in epilepsy (Wang et al., MicroRNAs are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within the untranslated regions of mRNAs. Studies have reported that the miR-124-3p/EZH2 signaling pathway is involved in cancer (Sha et al., In conclusion, the most important finding of this study is that early life stress induces increased expression of circKcnk9, a novel circRNA, in the CA1 of IBS-like rats. Increased circKcnk9 expression regulates synaptic transmission and enhances LTP, leading to visceral hypersensitivity and anxiety in IBS-like rats. The underlying signaling pathway of circKcnk9 is miR-124-3p/EZH2. Increased circKcnk9 reinforces its sponge for miR-124-3p, strongly suppressing miR-124-3p action and resulting in increased expression of the target gene EZH2. This study provides a new epigenetic mechanism of visceral hypersensitivity and anxiety comorbidity in IBS-like rats, and circKcnk9 may be a key molecule in the treatment of IBS.The original contributions presented in the study are included in the article/The animal study was reviewed and approved by the Animal Care and Use Committee of Fujian Medical University.YL and CL wrote the first draft and designed the research. YL, WL, ZL, and YZ performed the experiments. YC, ZC, YZ, and BW contributed to data acquisition. YL performed the bioinformatic analysis. BW, ZC, and YZ analyzed the data. YL, WL, CL, and AC wrote and revised the manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Adherence to prescribed medication is an essential component of diabetes management to obtain optimal outcomes. Understanding the relationship between medication adherence and ethnicity is key to optimising treatment for all people with different chronic illnesses, including those with diabetes. The aim of this review is to examine whether the adherence to antidiabetic medications differed by ethnicity among people with diabetes.A systematic review was conducted of studies reporting adherence to antidiabetic medication amongst people from different ethnic groups. MEDLINE, Embase, CINAHL, and PsycINFO were searched from their inception to June 2022 for quantitative studies with a specific focus on studies assessing adherence to antidiabetic medications (PROSPERO: CRD42021278392). The Joanna Briggs Institute critical appraisal checklist and a second checklist designed for studies using retrospective databases were used to assess study quality. A narrative synthesis approach was used to summarize the results based on the medication adherence measures.Of 17,410 citations screened, 41 studies that included observational retrospective database research and cross-sectional studies were selected, each of which involved diverse ethnic groups from different settings. This review identified a difference in the adherence to antidiabetic medications by ethnicity in 38 studies, despite adjustment for several confounding variables that may otherwise explain these differences.This review revealed that adherence to antidiabetic medication differed by ethnicity. Further research is needed to explore the ethnicity-related factors that may provide an explanation for these disparities. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 2. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0N/AReviewer #2:\u00a0N/A********** <font color=\"black\"> 3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 4. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0In this systematic review, Asiri et al aimed to examine whether ethnicity could impact the adherence to antidiabetic medications among people with diabetes. Authors deserve praise for trying to address a relevant clinical issue through an adequate methodology and a well-written manuscript. Unfortunately, the available studies are far from conclusive and their review did not provide a clear novelty. In particular, adherence to therapies is heavily influenced by numerous clinical, social and pharmacological factors, which are rarely comprehensively addressed in observational studies. Indeed, the interpretation of the results of the individual studies varies based on numerous factors, such as country, sample size, type of drugs, number of centers, study design, adherence measures, inclusion and exclusion criteria, clinical and social characteristics of the population, comorbidities, adjusted confounders, etc. The fact that the confounding factors considered in the multivariate models are different in the various studies and that the individual ethnic groups are compared with different groups undermines the reliability of the results presented in a systematic form. Unfortunately, these limitations and concerns are of fundamental nature.Specific comments:- Authors should briefly define the various adherence measures.- How do individual studies (and your review) deal with mixed ethnicity?- In the results section, the authors often report \"other races\" and in some cases (eg lines 253-255) a difference of some ethnic groups is reported without reporting the comparison group.- In the results section, the authors often report \"other races\u201d, which should be reported in full. Furthermore, in some cases , a difference of some ethnic groups is reported without mentioning the comparative group.Reviewer #2:\u00a0The authors performed a systematic review investigating the adherence to glucose-lowering treatment in patients with diabetes according to different ethnicities.The results are interesting and this overview is much needed, significantly contributing to current knowledge.My main concerns are:- on page 6, the authors correctly state that they prefer the term \"ethnicity\" to \"race\". This might be preferable not only for semantic reason, but also because, giving that ethnicity encompasses those cultural and geographical characteristics that are more likely to account for differences in medication adherence. In other words, it is also more technically sound to use the term ethnicity in this context because it ideally allows to take more confounders into account. This should be better reported in the methods section.- The discussion could might be better elaborated. The main differences between ethnicities are not summarized in a narrative statement in the discussion, although they are thoroughly reported in Table 1.- were there any important differences between glucose-lowering classes? Is there any factor that makes different ethnicities prefer oral antidiabetics rather than injectables?https://www.who.int/publications/i/item/9789241565257- access to diabetes medication in the world cannot be ignored, please refer to the latest WHO report - moreover, despite the lack of studies on type 1 diabetes, it is fundamental to better develop the discussion regarding the challenges of treatment adherence in type 1 vs type 2 patients. Although I understand that this is not the main focus of the paper, discussing adherence in type 1 diabetes cannot disregard the need of injectables, the difference in availability of glucose-monitoring system and a substantially different target population.Consider for example citing \"Hsin O, La Greca AM, Valenzuela J, Moine CT, Delamater A. Adher-ence and glycemic control among Hispanic youth with type 1 diabetes:role of family involvement and acculturation.J Pediatr Psychol. 2010;35(2):156-166\" and- it is certainly true that the cause of these disparities should be better investigated in future research, however that is not the only necessity and is also already partly known. The authors should speculate on possible tools for identifying adherence issues and improving it across different ethnic groups.********** <font color=\"black\"> 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoReviewer #2:\u00a0No**********https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 9 Nov 2022Academic editor comments Authors\u2019 Response1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. We have verified that all formatting and style requirements have been met.2. Thank you for stating in your Funding Statement: \"This work was supported by the Saudi Arabian Cultural Bureau in the United Kingdom and King Khalid University in Saudi Arabia.\"http://journals.plos.org/plosone/s/submit-now. Please also include the statement \u201cThere was no additional external funding received for this study.\u201d in your updated Funding Statement. Please provide an amended statement that declares *all* the funding or sources of support  received during this study, as detailed online in our guide for authors at Please include your amended Funding Statement within your cover letter. We will change the online submission form on your behalf.Thanks for the comment. We have changed the funding statement. Our updated statement is as follows:\"This work was supported by the Saudi Arabian Cultural Bureau in the United Kingdom and King Khalid University in Saudi Arabia. There was no additional external funding received for this study.\"3. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. Thanks for your kind reminders. We revised the data availability statement.Our updated statement is as follows:\"All data related to this study are included in this published article  into objective and subjective measures[2]. Subjective measurements include methods needing either patient self-report or health care professional evaluations of adherence to prescribed medicines[2]. On the other hand, objective measurements involve counting of pills, electronic monitoring, analysis of the secondary database[2]. \"3-How do individual studies (and your review) deal with mixed ethnicity? Thanks for your question.For individual studies, only six reported details about dealing with people from mixed race/ethnicity [3-8], three of them included people from a mixed ethnicity. Two of these studies reported mixed ethnicity based on the Office of National Statistics official UK ethnicity categories and the third included people from mixed ethnicity in Hawaii based on self-reported data from member surveys[3].For the remaining three studies, they excluded people from mixed ethnicity from the analysis.For this review:Mixed ethnicity was reported according to what was reported in each individual study.4-In the results section, the authors often report \"other races\" and in some cases (eg lines 253-255) a difference of some ethnic groups is reported without reporting the comparison group. In the results section, the authors often report \"other races\u201d, which should be reported in full. Furthermore, in some cases , a difference of some ethnic groups is reported without mentioning the comparative group.In the results section, the authors often report \"other races\"Thank you for pointing this out.We agree that \"other races\" should be reported in full. However, \"other races\" are reported in this review according to what is reported in each individual study.in some cases (eg lines 253-255) a difference of some ethnic groups is reported without reporting the comparison group.Thank you very much for the reminder. We have made revisions accordingly as follows::\"Of these, seven studies indicated that people from Black, Hispanic, and Asian ethnicity were more likely to be non-adherent to antidiabetic medications than people of White ethnicity, and these findings were statistically significant in four studies. \"In some cases , a difference of some ethnic groups is reported without mentioning the comparative group.:\"The authors found that the adherence varied significantly by ethnicity, and the odds of adherence were lower for people of Black ethnicity than those of White and Hispanic ethnicity. \"Also, we went through the results to make sure that the difference between some ethnic groups was reported with reporting the comparison group. Therefore, we have revised another sentence as follows::\"Lopez and colleagues and Osborn and colleagues demonstrated a significant association between increased adherence to antidiabetic medications and White ethnicity compared to African American, Hispanic, Asian, and American Indian ethnic groups. \"Response to reviewer #2Reviewer #2 comments 1- The authors performed a systematic review investigating the adherence to glucose-lowering treatment in patients with diabetes according to different ethnicities.The results are interesting, and this overview is much needed, significantly contributing to current knowledge. Thank you very much for the supportive comment.2- on page 6, the authors correctly state that they prefer the term \"ethnicity\" to \"race\". This might be preferable not only for semantic reason, but also because, giving that ethnicity encompasses those cultural and geographical characteristics that are more likely to account for differences in medication adherence. In other words, it is also more technically sound to use the term ethnicity in this context because it ideally allows to take more confounders into account. This should be better reported in the methods section. We very much appreciate this comment and agree that ethnicity encompasses cultural and geographical characteristics that are more likely to account for differences in medication adherence, we revised in the method section as follows::\"While some included studies use the term 'race', we prefer the term 'ethnicity', which is defined in this review according to Senior and Bhopal 'implies one or more of the following: shared origins or social background; shared culture and traditions that are distinctive, maintained between generations, and lead to a sense of identity and group; and a common language or religious tradition [9].' The term of 'ethnicity\u2019 is preferred as it encompasses cultural and geographical characteristics, which will allows to take more confounders into account that are more likely to account for differences in medication adherence. For the included studies, we used labels provided by the authors of the original studies. \"3-The discussion could might be better elaborated. The main differences between ethnicities are not summarized in a narrative statement in the discussion, although they are thoroughly reported in Table 1. Thank you for your suggestion. Due to the limitation of variation between included observational studies in terms of setting, sample size, type of drugs, number of centres, study design, adherence measures, inclusion and exclusion criteria, clinical and social characteristics of the population, comorbidities, adjusted confounders as highlighted by reviewer#1, we cannot pull the data from table 1 and give a summary of differences by each ethnic group, so we added an overall difference between ethnicities as follows::\"This variation was statistically significant in 34 studies out of 41 included studies and was overall observed between people from ethnic minorities and the majority populations in each specific study setting. Moreover, it is reported when adherence was measured using various measurement methods. \"4-were there any important differences between glucose-lowering classes? Is there any factor that makes different ethnicities prefer oral antidiabetics rather than injectables? Thank you for this question. It would have been interesting to explore this aspect. However, in the case of our review, it is out of scope for our research question as we mainly focus on exploring whether general adherence to antidiabetic medication varied by ethnicity. This suggestion has been noted for future research ideas.https://www.who.int/publications/i/item/97892415652575- access to diabetes medication in the world cannot be ignored, please refer to the latest WHO report Thank you for pointing this out. We agree that access to diabetes medication is an important determinant of adherence. However, the majority of studies (33 out of 41) in this review are retrospective database studies, which analyse the data of people who already have access to their antidiabetic medications. We do accept that this is something that needs to be investigated but would be part of a different review in our opinion. The question of ability to pay for medicines would also be very relevant in this space, especially in certain healthcare systems around the world 6-Moreover, despite the lack of studies on type 1 diabetes, it is fundamental to better develop the discussion regarding the challenges of treatment adherence in type 1 vs type 2 patients. Although I understand that this is not the main focus of the paper, discussing adherence in type 1 diabetes cannot disregard the need of injectables, the difference in availability of glucose-monitoring system and a substantially different target population.Consider for example citing \"Hsin O, La Greca AM, Valenzuela J, Moine CT, Delamater A. Adherence and glycemic control among Hispanic youth with type 1 diabetes:role of family involvement and acculturation.J Pediatr Psychol. 2010;35(2):156-166\" Thank you for this suggestion. It would be interesting to explore this aspect in future work. However, in our review, it seems slightly out of scope as we mainly focus on exploring whether adherence to antidiabetic medication varied by ethnicity in people with type 1 or type 2 diabetes. \"Hsin O, La Greca AM, Valenzuela J, Moine CT, Delamater A. Adherence and glycemic control among Hispanic youth with type 1 diabetes: role of family involvement and acculturation .J Pediatr Psychol. 2010;35(2):156-166\"Thank you for giving this study as an example. However, this study did not meet the inclusion criteria for our systematic review, as it only included one ethnic group; the eligibility criteria for our systematic review specified that the study must have more than one ethnic group in order to reflect on comparisons. 7-it is certainly true that the cause of these disparities should be better investigated in future research, however that is not the only necessity and is also already partly known. The authors should speculate on possible tools for identifying adherence issues and improving it across different ethnic groups. Thank you for this suggestion. We added it to discussion section as follows::\"Therefore, developing a cross-culturally validated adherence measure in future work may help identify and improve adherence issues across different ethnic groups. \"References:1. Lam WY, Fresco P. Medication adherence measures: an overview. BioMed research international. 2015;2015.2. Organization WH. Adherence to long-term therapies: evidence for action: World Health Organization; 2003.3. Taira DA, Seto BK, Davis JW, Seto TB, Landsittel D, Sumida WK. Examining Factors Associated With Nonadherence And Identifying Providers Caring For Nonadherent Subgroups. J Pharm Health Serv Res. 2017;8(4):247-53.4. Lee R, Taira DA. PEER REVIEWED: Adherence to Oral Hypoglycemic Agents in Hawaii. Preventing chronic disease. 2005;2(2).5. McGovern A, Hinton W, Calderara S, Munro N, Whyte M, de Lusignan S. A Class Comparison of Medication Persistence in People with Type 2 Diabetes: A Retrospective Observational Study. Diabetes Ther. 2018;9(1):229-42.6. Sutton CX, Carpenter D-A, Sumida W, Taira D. 2016 Writing Contest Undergraduate Winner: The Relationship Between Medication Adherence and Total Healthcare Expenditures by Race/Ethnicity in Patients with Diabetes in Hawai \u2018i. Hawai'i Journal of Medicine & Public Health. 2017;76(7):183.7. Juarez DT, Tan C, Davis JW, Mau MM. Using quantile regression to assess disparities in medication adherence. American journal of health behavior. 2014;38(1):53-62.8. Langley CA, Bush J. The Aston Medication Adherence Study: mapping the adherence patterns of an inner-city population. Int J Clin Pharm. 2014;36(1):202-11.9. Senior PA, Bhopal R. Ethnicity as a variable in epidemiological research. Bmj. 1994;309(6950):327-30.AttachmentResponse to reviewers AKH.pdfSubmitted filename: Click here for additional data file. 5 Feb 2023Ethnic disparities in medication adherence? A systematic review examining the association between ethnicity and antidiabetic medication adherencePONE-D-22-18891R1Dear Dr. Husband,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Dured Dardari, Ph.DAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressed********** <font color=\"black\"> 2. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0Yes********** <font color=\"black\"> 3. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0N/A********** <font color=\"black\"> 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0Yes********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0Yes********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0I thank Authors for accepting and answering my questions. All my concerns has been well addressed.While I believe the presentation of results with the above-mentioned problems may be confusing, this manuscript may bring to light the issue of ethnic disparities.********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0No********** 10 Feb 2023PONE-D-22-18891R1 Ethnic disparities in medication adherence? A systematic review examining the association between ethnicity and antidiabetic medication adherence Dear Dr. Husband:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Dured Dardari Academic EditorPLOS ONE"}
+{"text": "Bone tissue remodeling is a highly regulated process balancing bone formation and resorption through complex cellular crosstalk between resident bone and microenvironment cells. This cellular communication is mediated by direct cell and cell\u2013matrix contact, autocrine, endocrine, and paracrine receptor mediated mechanisms such as local soluble signaling molecules and extracellular vesicles including nanometer sized exosomes. An impairment in this balanced process leads to development of pathological conditions. Bone tissue engineering is an emerging interdisciplinary field with potential to address bone defects and disorders by synthesizing three-dimensional bone substitutes embedded with cells for clinical implantation. However, current cell-based therapeutic approaches have faced hurdles due to safety and ethical concerns, challenging their clinical translation. Recent studies on exosome-regulated bone homeostasis and regeneration have gained interest as prospective cell free therapy in conjugation with tissue engineered bone grafts. However, exosome research is still in its nascent stages of bone tissue engineering. In this review, we specifically describe the role of exosomes secreted by cells within bone microenvironment such as osteoblasts, osteocytes, osteoclasts, mesenchymal stem cell cells, immune cells, endothelial cells, and even tumor cells during bone homeostasis and crosstalk. We also review exosome-based osteoinductive functionalization strategies for various bone-based biomaterials such as ceramics, polymers, and metals in bone tissue engineering. We further highlight biomaterials as carrier agents for exosome delivery to bone defect sites and, finally, the influence of various biomaterials in modulation of cell exosome secretome. Bone tissue remodeling involves a balance between bone formation and bone resorption process mediated by several signaling mechanisms  includinExosomes are nanometer-sized extracellular vesicles of endocytic origin that are secreted in the extracellular matrix by various cells for paracrine signaling and communication ,19. ExosBone homeostasis is highly regulated with coordinated crosstalk between osteoblasts, osteocytes, and osteoclasts, which interact with their microenvironment ,33,34,35RUNX2), is upregulated [Bone is a highly mineralized connective tissue consisting of resident cells such as osteoclasts, osteoblasts, osteocytes, bone lining cells, and an organic and inorganic extracellular matrix . Bone hoegulated ,70. A suegulated . Osteocyegulated . The proegulated . Osteocyegulated . Osteoclegulated . A celluegulated . This poegulated . Bone reegulated . The proegulated . Additioegulated . The celegulated . Additioegulated . TherefoWhile the signaling pathways have been very well studied to understand bone tissue homeostasis, there have been relatively few studies to understand the role of exosomes mediated bone remodeling ,84. In cOsteoclasts are multinucleated bone cells derived from hematopoietic precursors such as peripheral blood/bone marrow monocytes and macrophages and are responsible for bone resorption during remodeling. Extracellular vesicles (EVs) released from osteoclasts are regulators of osteoclastogenesis. While EVs from the precursor cells stimulate osteoclast differentiation, EVs from mature osteoclasts inhibit osteoclastogenesis in the same cultures. This is attributed to competitive inhibition by Receptor activator of nuclear kinases (RANK) present in mature EVs . A detaiRUNX2 or Yes-associated protein-1 (YAP1) mediated Metallothionein 1D Pseudogene (MT1DP) inhibition [Osteoclast-derived exosomes have been demonstrated to promote osteogenic differentiation of stromal cells prior to osteogenesis . Contrashibition . Thus, EApart from role in signaling mechanisms, osteoclast-derived exosomes could also be crucial for discovering potential diagnostic markers for early detection of bone disease. For instance, increased serum exosomal levels of miR-214-3p have been associated with reduced osteogenesis in elderly women as well as ovariectomized mice, which is rescued upon treatment with miR-214 inhibitor, indicating circulating levels of this microRNA as an crucial marker for bone loss . This fuOsteoblasts are the resident bone cells derived from bone marrow mesenchymal stem cells responsible for the synthesis and mineralization of bone matrix through release of collagen and glycoproteins. Mineralizing osteoblast-derived exosomes have been demonstrated to induce osteogenic differentiation of mesenchymal stromal cells via activation of Wnt signaling (inhibition of Axin1 and overexpression of beta catenin proteins), calcium signaling, and microRNA profile modulation . These eNFATc1, a master transcription regulator of osteoclast differentiation [Osteoblast-derived EVs have also been demonstrated to stimulate osteoclast differentiation via RANKL-RANK signaling. These EVs were found to be rich in RANKL protein, which was internalized by osteoclast precursors and also caused nuclear translocation of ntiation . In an intiation   pathway through release of Matrix Metalloprotein2 (MMP2) . This crOsteoblast EVs are not mere regulators of intercellular bone communication but are also able to deliver anti-osteoclastic drugs and active molecules for targeted therapies. Cappariello and colleagues demonstrated that osteoblast-derived EVs can be loaded with clinically approved anti-osteoclastic drugs for malignancies (dasatinib) and osteoporosis (sodium zoledronate) with retained efficacy and functional effects even both in vitro and in vivo mouse models . Future Osteocytes are terminally differentiated bone cells that constitute the majority of the resident cell population in bone. While soluble factors and signaling molecules released by osteocytes have been proposed to play key role in bone homeostasis, there are currently very limited studies on osteocyte-secreted exosomes. Studies have shown that osteocyte-secreted exosomes are found to circulate in blood and also contain miRNA that may contribute to bone remodeling . OsteocyOsteocyte-derived exosomes have been correlated with development of bone pathologies. In one study, osteocytes were found to secrete mir-124-3p containing EVs, which increased under high glucose conditions (simulated for Diabetes mellitus). The mir-124-3p targeted galectin-3 in osteoblast cells, a factor specifically associated with inflammatory conditions and Diabetes . This suThere is huge scope for study of osteocyte-derived exosomes on 3D bone tissue constructs, an area that has been completely unexplored till now. Since osteocytes in vivo are embedded within heavily calcified matrix, which affects mechanosensing as well as oxygen diffusion, the current 2D in vitro models are unable to fully mimic the natural osteocyte function. Preliminary attempts to generate osteocytes 3D models have used collagen gels or biphasic calcium phosphate microbeads . Future Angiogenesis/neovascularization has a key role in bone microenvironment ensuring remodeling and repair. Osteogenesis is known to be closely coupled with angiogenesis during neo-bone formation. Endothelial cell-derived exosomes are able to efficiently target bone cells to stimulate bone regeneration . In a stEPC also prevent osteoporosis through promotion of osteogenesis or inhibition of osteoclastogenesis. EC-derived exosomes were found to be internalized more efficiently by bone marrow macrophages than osteoblasts or mesenchymal stem cells. Further, these exosomes are able to inhibit osteoclasts through upregulation of miR-155 and, thus, shown to play role in preventing osteoporosis in mice models . In a biImmune cells in the bone microenvironment have demonstrated a specific activating or inhibiting response towards osteoblasts and osteoclasts through the release of cytokines and paracrine factors . DendritMesenchymal stem cells (MSC) are the precursors for osteoblast differentiation. MSC have been widely reported to promote bone repair and regeneration through their paracrine action. Secretome analysis of MSC has revealed that this role is mediated through modulation of the microRNA profile in the released exosomes . While eSeveral reports have indicated that MSC-derived exosomes could repair bone fractures through enhanced osteogenesis as well as angiogenesis ,64. ZhanApart from bone fracture healing, MSC-derived exosomes have been found to play protective role in alleviation of osteoarthritis (OA) through bone and cartilage healing . MSC-exoExosomes could also potentially be used for treatment of osteosarcoma by direct intravenous injection. Studies have shown that exosomes have similar regenerative abilities as MSC transplantation. Since these exosomes are immune privileged, this could potentially be a cell-free therapy for cancer patients without risk of any teratoma formation. They can also be loaded with chemotherapeutic drugs such as Doxorubicin for enhanced anti-tumor activity .While MSC-exosomes have a healing response towards bone disorders, they are also responsible for tumor progression and invasion into the bone. MSCs have been shown to be recruited to the tumor site and modulate their microRNA profile to mediate metastasis. Zhao et al. demonstrated that bone marrow MSC-derived lncRNA plasmacytoma Variant Translocation 1(PVT-1) is transported to the osteosarcoma site where it binds directly with the oncogenic protein ERG while sponging miR-183-5p to mediate metastasis . SimilarThus, MSC-derived exosomes have been demonstrated to both promote ,95,96,97RUNX2-AS1, which are transmitted to MSCs, thus repressing their osteogenic potential [Several tumor cells such as those with prostrate, lung, breast, and oral origin are highly prone to bone invasion through crosstalk with osteoblast and osteoclast cells. This initial communication of tumor cells with bone microenvironment is mediated through paracrine secretion by tumors and is crucial for pre-metastatic niche formation. There is substantial evidence directing a role of extracellular vesicles and specifically exosomes in tumor progression via bone invasion and metastasis. Tumor-derived exosomes have demonstrated to interact with osteoclasts for promoting bone invasion and osteoclastogenesis ,161. Thiotential .In osteosarcoma, which is a primary bone tumor, the released exosomes were found enriched in miR-501-p, which aggravated bone loss through the PTEN/PI3/Akt pathway . RaimondSeveral studies have reported specific microRNA and protein profiles of the tumor-derived exosomes involved in bone remodeling. A study of the exosomal cargo of lung adenocarcinomas associated with bone metastasis has shown promotion of osteoclast differentiation via upregulation of miR-21  and miR-Another pathway for tumor-induced osteoclastogenesis was recently described. Tumor-derived exosomes, namely from oral squamous carcinoma cells, target osteoclast precursor cells to induce osteoclastogenesis, which was shown to be resistant to RANKL and TGFB1 inhibitors, which normally block this process . InteresApart from targeting osteoclasts, exosomes from tumor cells, namely, prostate cancer cells, can also induce osteogenic differentiation of human mesenchymal stem cells in vitro and promote osteoblastic metastasis in the bone microenvironment in vivo via hsa-miR-940 .There have been recent efforts made to prevent bone metastasis and tumor progression. Faict and colleagues demonstrated in multiple myeloma cells that blocking the exosome secretion from the tumor cells resulted in strong anti-tumor response with increased cortical bone volume, indicating a potential therapeutic target for the disease . FurtherBone tissue engineering has been a widely studied field wherein several biomaterials are investigated as suitable bone graft substitutes for clinical transplantation . The scaThis is an upcoming exploratory field encompassing a completely innovative paradigm in bone regenerative strategies, with potential for the discovery of biomolecules in exosomes for targeted therapy strategies, with potential for the discovery of biomolecules in exosomes for targeted therapy.Traditional bone research has focused on embedding mesenchymal stem cells on bone specific biomaterials to mediate enhanced repair and regeneration ,193. HowDirect injection of bone marrow mesenchymal stem cells has been widely investigated for clinical application due to their superior osteogenic differentiation potential. However, local injection of cells at the damage site is often not suitable for large-sized bone defects due to insufficient mechanical support, pressure, and load bearing capacity . To overSynthetic biodegradable polymer systems have been investigated as efficient delivery platforms for exosomes due to their tunable release kinetics. Exosomes derived from adipose mesenchymal stem cells were immobilized onto poly (lactic-co-glycolic acid) (PLGA) scaffolds with polydopamine coating. The exosomes were shown to release consistently in vitro, and promote bone regeneration in vivo. This was linked to its capacity for promoting MSC homing to the site of bone injury . Co-polyMetals have been the oldest bone graft choice for implantation due to their mechanical properties . Among mExosomes are an attractive alternative to cell-based transplantations to avoid safety and ethical concerns. They are also excellent osteoinductive agents. However, exosome delivery alone is met with several challenges including poor retention and lower therapeutic concentrations at the defect site. This is caused mainly due to rapid release of the exosomes to non-target sites and clearance from the reticuloendothelial system. Therefore, carriers for exosomes are required for sustained release and controlled local doses . HydrogeWhile there have been recent studies on functionalization of biomaterials incorporating osteogenic exosomes, there is very little known about modulation of the secretome of cells in response to different biomaterials. Recent reports suggest that this type of biomaterial may influence the fate of cell-secreted exosomes in promoting or inhibiting osteogenesis. In one study, magnetic nanoparticle-infused hydroxyapatite scaffolds were used to study osteoporosis and it was found the scaffold promoted osteoblast differentiation through modulation of osteoclast exosome cargo including reduction in ubiquitin, ATP, and reactive oxygen species . In anotExosomes from various types of bone cells play a crucial role as signaling molecules in bone remodeling as well as in the progression of bone disorders ,223. ExoCurrently, extracellular vesicle research faces challenges in clinical translation including large scale production and scale up from the originating cells ,259. MorExosomes regulate bone remodeling process by mediating crosstalk between resident bone cells and interacting microenvironment. They have enormous potential in the field of bone tissue engineering as an acellular substitute on bone grafts. They act as excellent osteoinductive agents. Despite existing challenges in their clinical translation, they hold promising potential for regeneration and diagnosis of bone diseases and disorders. Nevertheless, it is crucial to study detailed signaling mechanisms and their cargo modulation on various biomaterials and, therefore, future studies are encouraged in this niche field."}
+{"text": "Metallic ions have been widely investigated and incorporated into bone substitutes for bone regeneration owing to their superior capacity to induce angiogenesis and osteogenesis. Exosomes are key paracrine mediators that play a crucial role in cell-to-cell communication. However, the role of exosomes in metallic ion-induced bone formation and their underlying mechanisms remain unclear. Thus, this review systematically analyzes the effects of metallic ions and metallic ion-incorporated biomaterials on exosome secretion from mesenchymal stem cells (MSCs) and macrophages, as well as the effects of secreted exosomes on inflammation, angiogenesis, and osteogenesis. In addition, possible signaling pathways involved in metallic ion-mediated exosomes, followed by bone regeneration, are discussed. Despite limited investigation, metallic ions have been confirmed to regulate exosome production and function, affecting immune response, angiogenesis, and osteogenesis. Although the underlying mechanism is not yet clear, these insights enrich our understanding of the mechanisms of the metallic ion-induced microenvironment for bone regeneration, benefiting the design of metallic ion-incorporated implants. In recent decades, with rapid economic advancement and the aging population, large bone defects caused by musculoskeletal diseases  have affected hundreds of millions of people across the world. Autografts from patients are considered the gold standard for clinical treatment. However, limited donor resources and complications have restricted its widespread application. Presently, orthopedic implants derived from biomaterials are used in therapeutic strategies, such as calcium phosphate as a bone defect filler  or titan2+, Zn2+, Sr2+) and anions  are co-incorporated in the apatite structure. Various metallic elements have been proven to play key roles in bone formation and healing processes [2+, Mg2+, and Ca2+ can enhance osteogenesis, while Cu2+, Co2+, Li+, and Fe3+ can increase neovascularization. Specifically, approximately 99% of Ca is stored in bone in forms of HA. Ca acts as an ionic messenger and participates in a series of cellular process, including exocytosis, apoptosis, and motility. During bone healing processes, Ca2+ plays key roles in the activation and aggregation of platelets, blood clot formation, the stimulation of bone mineralization, and subsequent bone healing [As a part of the musculoskeletal system, bone plays a role in both the support and movement of the body, and is a storage reservoir for calcium, phosphorus, and other trace elements. Bone is mainly composed of inorganic minerals , collagen fibers 20\u201340%), and water (5\u201310%). The inorganic minerals in bones are mainly carbo-hydroxyapatite (HA); meanwhile, trace elemental substitutions exist in biological apatite. For example, metallic ions  and present in blood, urine, saliva, and other bodily fluids . ExosomeIt is noteworthy that when biomaterials co-cultured with cells, the various chemical signals derived from implants can directly act on the cells, which is followed by cell behaviors being affected . Additionally, the released chemical signals can change the microenvironment where such cells are located, therefore affecting the exosome secretion from cells. Findings in the literature combined with our previous studies confirmed that metallic ions incorporated with bone substitutes could obviously enhance the angiogenic and osteogenic capacities of various cells and promote new bone formation in vivo ,17,18. DMSCs are multipotent stromal cells which exist in connective tissues that can differentiate into multiple cell types  and have strong self-renewing abilities. According to their isolated locations, MSCs are mainly divided into adipose tissue-derived MSCs (ADMSCs), bone marrow-derived MSCs (BMSCs), dental pulp-derived MSCs (DPMSCs), umbilical cord-derived MSCs (UCMSCs) and peripheral blood MSCs (PBMSCs), etc. As the most commonly used stem cells, MSCs have been widely used to improve bone tissue repair, including the local injection of MSCs with/without scaffolds ,21. HoweMSC-derived exosomes have various regenerative capabilities, including guiding immunomodulatory regulation, angiogenesis, and osteogenesis. Thus, MSC-derived exosomes have potential for treating bone diseases, such as osteoarthritis, osteoporosis, and bone fractures, using their biological cargoes . Compared with MSC-based therapies in bone regeneration, MSC-derived exosomes show some advantages, such as non-living, stable preservation in the body and high loading capacity for RNAs and proteins. Moreover, exosomes derived from different MSCs exhibit various therapeutic effects. Wang et al. reported that ADMSC-derived exosomes have superior immune regulation capacity, BMSC-derived exosomes have excellent regeneration ability, and UCMSC-derived exosomes play a vital role in tissue damage repair . In addiRecently, the crosstalk between bone cells and immune cells has become regarded to be a vital factor in tissue homeostasis and new bone formation. Among these cells, the effect of macrophages on bone metabolism has attracted great attention. Macrophages possess different functional states under various pathophysiological conditions that could affect bone repair. Macrophages can be divided into nonactivated (M0), classically activated (M1), and alternatively activated (M2) subtypes. M1 macrophages can induce a pro-inflammatory response and enhance the host\u2019s defense reaction by producing high levels of reactive oxygen species (ROS), nitric oxide (NO), and proinflammatory cytokines , IL-2, IL-6, and IL-12). Conversely, M2 macrophages can produce anti-inflammatory cytokines  and enhance immune suppression. Meanwhile, M2 macrophages can produce growth factors, including VEGF and BMP-2, and can accelerate bone fracture healing . Both M2Similarly, macrophages secrete exosomes that are important for cell-to-cell communication, immune regulation, and tissue regeneration. Exosomes derived from M0, M1, and M2 exert different effects in bone healing. Studies proved that M1 macrophage-derived exosomes have inhibitory effects on bone healing, whereas M2 macrophage-derived exosomes elicit osteoinductive effects in bone regeneration . Moreove2+/Sr2+ released from collagen/HA can enhance the communication between macrophages and BMSCs by inducing an osteoimmune microenvironment [2+/Sr2+ release up-regulated the osteogenic genes  of macrophages, and then enhanced the osteogenesis-related gene expression  of BMSCs and bone regeneration in vivo. However, the cell-to-cell communication mechanisms involved in the chemical signals derived from biomaterials are complex and are difficult to clarify. In addition to the conventional approaches to investigating mechanisms, exosomes have emerged as potential candidates with paracrine capacity which has been contributed to cell-to-cell communication. In addition, exosomes production and functions are highly dependent on physiological conditions, suggesting that variations in the microenvironment can modify the production of exosomes. However, reports on the effects of metallic ions on exosomes secretion are limited. Nevertheless, recent research efforts focused on this area, and may provide insight for us to design biomaterials for bone regeneration. Here, we mainly focus on the roles of those metallic ions that are widely incorporated into bone substitutes in exosomes production, as well as the biological function in intercellular communication and bone regeneration . Cobalt ions serve as hypoxia-mimicking agents for promoting tissue angiogenesis by enhancing the secretion of HIFs. Additionally, studies proved that the hypoxia condition promotes osteogenesis at an early stage by inducing an HIF1a\u2013Twist1 pathway while suppresses osteogenesis maturation at the late stage by inhibiting the HIF1a\u2013Twist1 pathway . Thus, tBased on the key roles of exosomes in intercellular communication, the underlying mechanism of exosomes derived from macrophages upon cobalt stimulation on angiogenesis were studied by Zhang et al. . They fo2+ concentrations (2\u20134 mM) in culture media improve osteoblast proliferation, medium concentrations (6\u20138 mM) enhance osteoblast differentiation and extracellular matrix mineralization, and high concentrations (>10 mM) are toxic [4-containing scaffolds enhance BMSCs migration, osteoblast gene expression, and new bone formation in a concentration-dependent manner by activating the PI3K\u2013AKT pathway [2+ release from mesoporous silica xerogels could improve osteoblast proliferation and osteogenic differentiation by activating ERK1/2 signaling pathway [As ionic messengers in cells, calcium ions play key roles in living systems, and are involved in many processes such as apoptosis, movement, signal transduction, gene transcription, and gene differentiation, etc. As essential inorganic components, 99% of calcium ions are stored in bone and present in the form of HA in combination with phosphate. It is important to maintain appropriate concentrations of intracellular and extracellular calcium ions during the formation of mature bone. Low Care toxic . Additio pathway . Another pathway .\u00ae is high in calcium content and shows good degradable capacity and bioactivity. In particular, 45S5 Bioglass\u00ae is composed of 46.1 mol.% SiO2\u201426.9 mol.% CaO\u201424.4 mol.% Na2O\u20142.6 mol.% P2O5, which can form a strong bond with the surrounding bone. The high bioactivity of the material can be attributed to hydroxycarbonate apatite formation on its surface, which occurs due to glass dissolution. The dissolution products of bioglass  have a positive effect on the proliferation and osteogenic differentiation of bone-forming-related cells, as well as the regulation of macrophage polarization [With knowledge of exosomes in intercellular communication developing, the effects of calcium-containing biomaterials on exosomes production and their mechanisms are investigated. As the first bioactive glass introduced by Hench in 1971, 45S5 Bioglassrization ,71. Wu erization  investigrization . Rab27a,rization . Thus, trization . Studiesrization ,76. Addirization . Thus, trization .2+ in the acidic microenvironment . Then, a Ca2+ increase resulted in the collapse of their membranes and the Ca2+ release into cytosol, which induced the increase in intracellular calcium concentration and exosome release. Thus, CaP particles have potential applications for improving the production efficiency of exosomes, while not affecting the Ca2+ concentration in exosomes. Additionally, calcium oxalate was found to alter the protein expression levels in the macrophage-derived exosomes, which were involved in the immune response, cell migration, transcription regulation, and calcium binding [In addition, calcium ions also regulate the exosome secretion derived from bone-resorbing cells. Calcium phosphate (CaP), as a calcium-rich biomaterial, has good biocompatibility. When amorphous-phase CaP nanoparticles were cocultured with macrophages, it was observed that the particles could increase the number of exosomes more than twofold . However binding ,80. Furt binding ,80. All 2+ could enhance ALP activity, osteogenic gene expression in osteoblastic cells, and calcium nodule deposition [2+ enhances the migration and tube formation of endothelial cells, as well as increasing the expression of VEGF and Angiopoietin-1 (Ang-1) [2+-containing bioactive microspheres can enhance the transformation of macrophages toward to M2 phenotypes and secrete high levels of PDGF-BB, resulting in the improved angiogenic capacity of endothelial cells and early vascularization in vivo [As a nonessential element, approximately 98% of strontium ions are stored in human bone tissue, and have strong bone-seeking behavior. Presently, strontium is widely used in the form of strontium ranelate as a treatment for osteoporosis, especially for postmenopausal women. Thus, strontium is incorporated into various biomaterials to enhance bone regeneration, including bioactive glass, calcium phosphate, and metallic implants ,82. The  in vivo . However in vivo  investig in vivo ,85. In a in vivo ,87. Addi in vivo . Thus, e in vivo . Therefo+ addition can enhance the proliferation of BMSCs by glycogen synthase-3\u03b2 (GSK-3\u03b2) inhibition, and the \u03b2-catenin/Wnt activation that follows [+ inhibits GSK-3, activating HIF-1 that induces vasculogenesis [+ is a new additive for incorporation into bone substitutes due to its stimulating effects on vasculogenesis and bone formation. Since high glucose inhibits the migration of BMSCs through the activation of GSK-3\u03b2, Chen et al. [+-containing bioactive glasses and found that Li+ addition could reverse the suppression of migration, proliferation, and osteogenic differentiation of BMSCs, which is induced by high glucose, by activating the \u03b2-catenin/Tcf7/Ccn4 signaling pathway. Moreover, the Li+ released from bioactive glasses has been proven to facilitate the proliferation and tubules formation of endothelial cells by activating the canonical Wnt/\u03b2-catenin pathway and increasing the expressions of proangiogenic cytokines including insulin-like growth factor 1 (IGF-1) and TGF\u03b2 [Lithium ions have long been widely used to treat psychiatric disorders and bipolar disease. Due to its association with hyperparathyroidism, lithium has attracted great interest in bone tissue treatment. Zamani et al.  found th follows . GSK-3\u03b2  follows . Moreoveogenesis ,93. Thusn et al.  preparedand TGF\u03b2 .+ in bone regeneration, the underlying mechanisms between intercellular communications remain unclear. During the bone healing process, the communication between BMSCs and endothelial cells is very important for vascularized bone regeneration. Liu et al. [+-containing bioactive glass is beneficial for communication between BMSCs and endothelial cells through paracrine secretion. Subsequently, it enhances angiogenesis by the activation of the PTEN/AKT signaling pathway, which can up-regulate HIF-1\u03b1 expression and VEGF secretion [Despite advances in the exploration of the roles of Liu et al.  found thu et al. . Second,u et al. . More imu et al. . Thus, eecretion .During skeletal development and remodeling, exosomes derived from cells including immune cells and bone-forming-related cells, play crucial roles in regulating cell-to-cell communication and followed angiogenesis and osteogenesis. Moreover, metallic ions, either alone or incorporated with bone substitutes, have been proven to affect the amount or cargoes of exosomes, subsequent modification of cell adhesion, proliferation, and differentiation as well as bone regeneration . AlthougFor an investigation of the effect of metallic ions on exosome secretion, the following issues must be resolved: First, the number of exosomes obtained in cell culture mediums is always not sufficient. Two possible approaches are in use at present: one is to use commercial isolation kits to increase the rate of recovery from the culture medium; the other is to stimulate the secretion of cell-derived exosomes as much as possible. Thus, the modification of bone substitutes by the incorporation of metallic ions may be a promising method for the creation of favorable microenvironments that can enhance the amount and biofunction of cell-secreted exosomes. Second, since our understanding of the underlying mechanism of the effect of (implanted) metallic ion-mediated exosomes on bone regeneration is still in its infancy, more efforts should be devoted into investigating the mechanism by how chemical signals derived from biomaterials affect exosomes, and how these exosomes affect the subsequent immune reaction, angiogenesis, and osteogenesis. To achieve this, the types and release kinetics of the metallic ion-incorporated bone substitutes should be further investigated so that we can work toward fabricating tailor-made biomaterials that generate an ideal microenvironment, enhancing exosome biofunctions and bone regeneration. Moreover, investigations into the roles of metallic ion-incorporated bone substitutes in relation to exosome secretion are currently focused on bioglasses and other bioceramics. Metallic alloy- and polymer-based bone substitutes should also be taken into consideration in future studies. Moreover, since exosomes play an important role in cell-to-cell communications, the effects of metallic ion-mediated exosomes on the interactions among different cells should be further studied. We do not currently fully understand how metallic ions regulate cell response by paracrine secretion, or how these responses affect the subsequent bone formation; however, through careful research design, it will be possible to investigate the role of exosomes in inflammation, angiogenesis, and osteogenesis. Such research advances would enrich our understanding of the biological mechanism of metallic ion-mediated bone regeneration, and would be beneficial for the design of metallic ion-incorporated bone substitutes. Similarly, in addition to chemical composition, the surface structure and mechanical signals derived from biomaterials should be explored when investigating the stimulation effects on exosomes secretions. Finally, due to their low immune rejection and high therapeutic effects, metallic ion-stimulated functional exosomes can serve as potential drugs for various clinical diseases."}
+{"text": "This study compared government sub-district hospitals in Bangladesh without globally standard midwives, with those with recently introduced midwives, both with and without facility mentoring, to see if the introduction of midwives was associated with improved quality and availability of maternity care. In addition, it analysed the experiences of the newly deployed midwives and the maternity staff and managers that they joined.n\u2009=\u200918), and eight quality maternity care practices (n\u2009=\u2009641) were carried out using three separate tools. Willing maternity staff (n\u2009=\u2009237) also completed a survey on their knowledge, perceptions, and use of the maternity care interventions. Descriptive statistics and logistic regression were used to identify differences between the hospital types. The qualitative component comprised six focus groups and 18 interviews involving midwives, other maternity staff, and managers from the three hospital types. Data were analysed using an inductive cyclical process of immersion and iteration to draw out themes. The quantitative and qualitative methods complemented each other and were used synergistically to identify the study\u2019s insights.This was a mixed-methods observational study. The six busiest hospitals from three pre-existing groups of government sub-district hospitals were studied; those with no midwives, those with midwives, and those with midwives and mentoring. For the quantitative component, observations of facility readiness (p\u2009=\u20090.001), delayed cord clamping , skin-to-skin . Hospitals with mentors were significantly more likely to use five: ANC card , partograph , upright positioning for labour , delayed cord clamping , and skin-to-skin contact following birth  Qualitative analysis identified overall acceptance of midwives and the transition to improved quality care; this was stronger with facility mentoring. The most resistance to quality care was expressed in facilities without midwives. In facilities with midwives and mentoring, midwives felt proud, and maternity staff conveyed the greatest acceptance of midwives.Quantitative analysis found that, of the eight quality practices, hospitals with midwives but no mentors were significantly more likely than hospitals without midwives to use three: upright labour (94% vs. 63%; OR\u2009=\u200922.57, Facilities with professional midwives had better availability and quality of maternity care across multiple components of the health system. Care quality further improved with facility mentors who created enabling environments, and facilitated supportive relationships between existing maternity staff and managers and the newly deployed midwives.The online version contains supplementary material available at 10.1186/s12884-022-05096-x. Despite decades of global prioritization, pregnancy-related morbidity and mortality remain a significant public health and human rights concern for the world\u2019s poorest . BetweenA critical challenge is that, as MMR declines, further reductions become more difficult to achieve. Care quality and availability, health systems challenges, and socioeconomic determinants of health make up a multi-layered context where significant change is needed to continue to advance progress . ProfessYet, significant gaps exist in midwives educated to global standards, and working in enabling environments, in low- and middle-income countries (LMICs). The potential of midwives to improve quality of care in these settings is yet to be fully realized . There aThe International Confederation of Midwives (ICM) defines a professional midwife based on standard pre-service education and a scope of practice that includes a focus on women\u2019s right to quality maternal health care . While fThis study examined if the introduction of professional midwives was associated with improved availability and quality of maternity care provision in 12 sub-district government hospitals in Bangladesh. It also documented the experiences of the midwives, as well as the maternity staff and managers they joined, in navigating barriers and facilitators to midwives serving as autonomous maternal health care providers. The aims of this research were 1)\u00a0to determine if\u00a0introducing\u00a0international standard midwives\u00a0in rural sub-district hospitals in Bangladesh,\u00a0both\u00a0with and without mentoring,\u00a0was associated with improved availability and quality of maternal and newborn health care; and 2) to explore the experiences of the midwives, and the\u00a0other maternity staff and managers,\u00a0following their introduction. Key objectives were to examine the enabling environment and document barriers and facilitators to midwives providing quality care. This research sought to document lessons from implementation to inform similar work in other countries, and expand the global body of knowledge on introducing globally standard midwives distinct from nurses in LMICs.Standards for improving quality of maternal and newborn care in facilities and WHO recommendations on antenatal care for a positive pregnancy experience were used to frame the analysis  but it may happen that my seniors are trying to avoid this.\u201dMidwife 1, midwivesIt was shared by some of the managers that it was common for midwives to have restricted clinical autonomy in hospitals without mentors and to work as nurses\u2019 assistants during births, or even be assigned to general wards while nurses performed births. Notably, in the area of obstetric emergencies, many staff expressed that they did not feel that the midwives were competent. Midwives themselves described the experience of their supervisors preventing them from treating emergencies:Midwives described that treating emergencies without the support of doctors put them at risk. Doctors shared that their resistance to caring for obstetric emergencies was due to the possibility that a woman might die in their facility and wanting to avoid potential retaliation from the community. Midwives shared that if the nurse in charge decides not to treat a woman who presents with an emergency they did not have the power to go against her. In this regard, midwives expressed frustration that their managers and supervisors restricted their autonomy, limiting both their scope and voice.We are happy with the improved care the midwives have brought! (Maternity staff).We feel proud! (Midwives with mentors).Overall, in settings where facility mentoring was ongoing, respondents communicated a general sense that the availability and quality of care was improving. Doctors, nurses and midwives expressed comfort with the new quality care interventions and with providing emergency obstetric care. Managers explained that the mentors facilitated positive relationships between midwives and nurses, and supported enabling environments for midwives and improved quality care. In addition, maternity staff spoke about midwives providing quality care autonomously, and expressed that maternity wards now had the needed expert staff.Nurses specifically talked about midwives\u2019 specialized education and gave examples of midwives expanding services, including counselling and education for women, and\u00a0promotion\u00a0of vaginal birth over caesarean section. They also expressed that the ANC that\u00a0midwives provide is \u201ccorrect\u201d. Nurses in mentored hospitals were less concerned about the midwives\u2019 youth. They rather referred to them as being young but mature and \u201cnot inferior\u201d in knowledge. Supervisors described feeling better about the care given by midwives as opposed to nurses, and expressed that midwives have more expertise. Nurses and managers also talked about the midwives motivating the nurses to make positive changes.\u201cbefore the midwives joined the facility, we were not familiar with these techniques. When we saw these practicing in front of our eyes, then we felt motivated to do the proper service.\u201dNurse 2, midwives with mentorsA nurse shared that,\u201cno, I don\u2019t, the midwives do. I do mouth-to-mouth. The Ambu bag is very new, so I am not comfortable with it.\u201dNurse 1, midwives with mentorsStaff and managers at the mentored facilities were the most likely to state that they do manage obstetric emergencies and some shared that this was relatively new. Most of the non-midwife maternity staff talked about midwives providing initial stabilization of emergencies. When asked if she was capable of resuscitating an asphyxiated newborn, a nurse stated that nurses are not comfortable with the new Ambu bag, but that the midwives were,In some cases, nurses and managers described concerns about midwives managing emergencies. In one focus group, nurses talked about women lacking confidence in midwives\u2019 ability to perform an emergency intervention for first trimester bleeding. In another instance, an obstetrician talked about midwives not being experienced enough to manage PPH and eclampsia yet, reiterating that women want doctors to treat emergencies. Yet, these were minor comments when weighed against the more frequent messages about greater willingness to respond to emergencies and greater use of evidence-based practices. One example is that nurses spoke of respectful care, and doing what women want. Nurses also explicitly talked about companionship helping women feel comfortable. When maternity staff were asked what has helped them make changes to more evidence-based care in their units, they described both the introduction of the new midwives, and the importance of mentoring.\u201cIt was both the midwives and the mentors who made changes to the delivery position, and [appropriate use of] oxytocin for delivery, and increasing ANC.\u201dNursing Supervisor 1, midwives with mentorsOne respondent shared that,The quantitative and qualitative findings were looked at together and found to largely agree, with some distinctions. Overall, the greatest resistance to quality care was conveyed in hospitals without midwives, and the greatest use of quality care was found in hospitals with midwives and mentors. There was some disagreement, however, between qualitative comments and survey results with regard to managing obstetric emergencies. In the survey more than 50% of all staff reported that they provided initial stabilization for eclampsia, and close to 100% of hospitals with midwives reported providing initial stabilization for women who present with PPH. However, in the focus groups all talked of referring a women with obstetric emergencies. In addition, and not in line with the study\u2019s broader findings, hospitals with midwives were generally less equipped with the necessary supplies and equipment for responding to obstetric emergencies than the other hospital types. In the survey, maternity staff in hospitals with midwives but no mentors also reported slightly less confidence and action around responding to cases of eclampsia than maternity staff in\u00a0hospitals without.Table The objectives of this research were\u00a0to determine if\u00a01) introducing\u00a0international standard midwives\u00a0in rural sub-district hospitals in Bangladesh,\u00a0both\u00a0with and without mentoring,\u00a0improved the\u00a0availability and quality of maternal and newborn health care; and 2) to explore the experiences of the midwives, and the\u00a0maternity staff and managers they joined. It was found that ICM-standard diploma prepared midwives were able to negotiate complex systems, address barriers, and improve care quality and availability.The quantitative findings suggest that midwives alone\u2014without mentors\u2014may increase the likelihood of women receiving four of the eight evidence-based birthing practices examined. Greater use of evidence-based practices was observed in hospitals with mentors creating an\u00a0enabling environment\u00a0by assuaging nurses\u2019 and doctors\u2019 concerns about midwives\u2019 competencies and navigating solutions to the resistance posed. Some minor exceptions to the continuum were also noted. For example, while mentored hospitals performed well in readiness for obstetric emergencies, hospitals with only midwives underperformed in this area. In addition, the practices of companionship during labour and birth and AMSTL were routine in all hospitals, indicating that they are common even without midwives. Finally, in the survey, providers\u2019 agreement with the value of evidence-based care was largely homogeneous, apart from delayed cord clamping and non-supine labour, the results for which did follow the continuum.Three key observations were drawn from the qualitative analysis. First, it was noted that resistance to adoption of evidence-based care, including emergency care, was prevalent across hospitals. Habitual patterns of care not in alignment with recommendations were observed to be deeply ingrained. Second, the differences observed between the hospitals indicated that the presence of midwives lessened maternity staff and managers resistance to change, and that the least resistance occurred when mentors were present. Facility mentoring thus potentiated midwives\u2019 employment of evidence-based antenatal and birth care, particularly in areas where complex changes were needed. Third, that midwives expressed pride in their roles, and an explicit motivation to serve the poor, indicates the possibility of broader social and economic repercussions of quality maternity care.Together, the quantitative and qualitative findings were examined against the WHO health systems building blocks comprising leadership and governance, service delivery, financing, information systems, workforce, and access to essential medicines . The resThe limitations of this study included insufficient data on the management of obstetric emergencies, possible loss of subtleties in the translation process, and that the small number of hospitals within each hospital type resulted in a loss of power in the mixed-effect regression models. Facilities did not sufficiently record obstetric emergencies coming from the community, as many were transferred before admission. This meant that the findings on this topic were limited to statements made by the midwives, maternity staff and managers. Translation was conducted by professional translators who did not have medical training. However, the translators did not have perfect fluency in English. This may have resulted in some nuances being lost in translation during interviews and in the transcriptions. In addition, although most aspects of both the midwives and the facilities in general were standard, some potential confounders such as the number of staff out on leave were not collected. Finally, the focus groups and interviews were short as they were carried out with working managers and health care staff this may have led to less depth of exploration.Resistance to changes in healthcare delivery is generally motivated by a desire for control, entrenched habits, the perception that change would increase workload, and/or patient demand for existing practices . For exaHospitals with globally standard midwives were observed to perform more WHO recommended quality interventions than those without midwives. The dramatic improvement for some of these interventions just with the introduction of midwives is remarkable. These findings contribute new knowledge to the field, as attribution to professional midwives for their roles in expanding both availability and quality of care in LMICs is still emerging. While many countries have had success introducing midwives as part of a package to improve maternal health, the research has not been able to zoom in on midwives, and specifically link them with transitioning to WHO recommended quality standards . This stWhile we acknowledge these successes, gaps in enabling environments for midwives in hospitals posed barriers. The ICM defines the enabling environment for midwives as one that, \u201csupports the infrastructure, profession, and system-level integration needed for midwives to effectively practice their full scope of work\u201d. It includes aspects of gender equality, infrastructure, professional status and agency, and system-level integration . BarrierFacilities with mentors had improved use of ANC cards, partograph, and upright positions for birth. Low use of these interventions is found in the literature from other LMICs. Both in Africa and Asia, including in Bangladesh, there are gaps in the use of these interventions . Both paIt is likely that mentors were able to successfully address complex barriers due to their status in the social hierarchy. As doctors themselves, they were more listened to by hospital managers, doctors and nurses. Their impact was thus largely derived from the combination of their social positioning as doctors, their knowledge of midwives\u2019 scope of practice and evidence-based care, and their own scope of work around facilitating enabling environments for midwives.Most of the existing literature only hints at a role for mentors focused on enabling environments, and tends to examine mentorship focused on capacity building. Only two articles published within the past 10\u00a0years described relationship and/or team building as part of mentors\u2019 roles. One was a scoping review of mentorship interventions in LMICs aimed at improving the quality of primary health care. Four studies were included in the review, covering research in Rwanda, Afghanistan, Jordan and Botswana. Both relationship building and communication skills were identified as key elements of successful mentorship programs. The review specifically highlighted that mentorship plays a role in shifting power dynamics within social hierarchies in healthcare settings. It characterized this shift as being from didactic supervision to power-sharing . In an aThe entrenched systemic barriers to providing emergency obstetric care were described in all facility types, but less so\u00a0in those with mentorship. In this research, nurses, managers, and doctors described referring women facing critical emergencies to higher-level facilities without treatment. Midwives described their supervisors preventing them from providing emergency care. There is literature discussing emergency obstetric care refusal in Bangladesh, and in other countries , 44. TheThe research found that the introduction of midwives contributed to the strengthening of nearly all of the health systems building blocks. Shown in Fig.\u00a0Midwives felt proud. This finding emerged without solicitation and was iterated with conviction. The profundity of this in a context in which taking care of women in labour has been considered dirty  has the This study\u2019s findings support that ICM standard midwives can be a catalyst for change in the quality and availability of maternity care. It is one of the first studies to clearly find an association between midwives in an LMIC setting and better-quality care. Enabling environments after midwives\u2019 deployment were crucial. With weaker enabling environments  midwives improved quality, but greater quality improvement occurred with mentorship. In addition, managing critical patients improved with mentorship, but substantial gaps remained. Though this study was not designed for generalizability, the sample size is notable. The findings from this research can thus inform governments to create globally standard midwife cadres distinct from nurses, distinct midwife posts, and enabling environments for midwifery. Future research to refine the essential components of enabling environments for midwives, as well as mentorship, could stem from this study.Additional file 1:Table S1. Quotations and codes contributing to the theme \u201cresistance to change\u201d."}
+{"text": "Patients hospitalized with acute coronary syndrome (ACS) in Sweden routinely undergo an echocardiographic examination with assessment of left ventricular ejection fraction (LVEF). LVEF is a measurement widely used for outcome prediction and treatment guidance. The obtained LVEF is categorized\u00a0as normal (>\u200950%) or mildly, moderately, or severely impaired  and reported to the nationwide registry for ACS (SWEDEHEART). The purpose of this study was to determine the reliability of the reported LVEF values by validating them against an independent re-evaluation of LVEF.A random sample of 130 patients from three hospitals were included. LVEF re-evaluation was performed by two independent reviewers using the modified biplane Simpson method and their mean LVEF was compared to the LVEF reported to SWEDEHEART. Agreement between reported and re-evaluated LVEF was assessed using Gwet\u2019s AC2 statistics.p\u2009<\u20090.005).Analysis showed good agreement between reported and re-evaluated LVEF (AC2: 0.76 [95% CI 0.69\u20130.84]). The LVEF re-evaluations were in agreement with the registry reported LVEF categorization in 86 (66.0%) of the cases. In 33 (25.4%) of the cases the SWEDEHEART-reported LVEF was lower than re-evaluated LVEF. The opposite relation was found in 11 (8.5%) of the cases (Independent validation of SWEDEHEART-reported LVEF shows an overall good agreement with the re-evaluated LVEF. However, a tendency towards underestimation of LVEF was observed, with the largest discrepancy between re-evaluated LVEF and registry LVEF in subjects with subnormal LV-function in whom the reported assessment of LVEF should be interpreted more cautiously. Left ventricular ejection fraction (LVEF) is one of the most robust predictive parameters post-myocardial infarction offering guidance in both treatment and follow-up strategies . HoweverThe SWEDEHEART registry contains patient data from subjects admitted to Swedish hospitals nationwide due to acute coronary syndrome (ACS). The registry was established in 2009 by merging of four preexisting registries on ischemic heart disease into a larger, more comprehensive registry. The registry encompasses more than 450 variables including left ventricular ejection fraction (LVEF) by echocardiography . SWEDEHEGiven the importance of LVEF and that the LVEF assessments in SWEDEHEART, and\u00a0in several other registries, have not previously been validated we aimed to validate the LVEF assessments reported to SWEDEHEART.The study cohort consisted of a random sample of 177 patients with ACS from three different Swedish hospitals , in whom LVEF had been assessed according to local routine by 2D echocardiography during the index hospital stay. LVEF was then reported to SWEDEHEART in four categories:\u2009<\u200930%, 30\u201339%, 40\u201349%, and\u2009\u2265\u200950%. Missing data on LVEF in the registry prompted exclusion from the study  with manual delineation of the endocardial border . Subjectp\u2009<\u20090.05. The results were presented in a tabular format with 95% confidence intervals. The study was approved by the Regional Committee for Medical Research Ethics (DNR 2017/759-31).Spearman\u2019s rank correlation was used to test correlation and Wilcoxon signed-rank test was used to assess bias. Gwet\u2019s AC1 and AC2 statistics were used to test agreement between SWEDEHEART data and the reassessments. The Gwet\u2019s AC2 analysis was performed with pre-specified linear weights. The Intraclass correlation coefficient (ICC) was used for inter-observer variability assessment between the two reference reviewers by a two-way mixed-effects model examining consistency in \u201csingle rater\u201d type , 11. TheThe median age in the study population was 65\u00a0years, and 76% were men. See Table R of 0.88 (p\u2009<\u20090.001). Figure After LVEF was re-evaluated by the two reviewers with the modified biplane Simpson method, the mean LVEF was calculated for comparison with the SWEDEHEART data. The inter-observer variability between the two reference reviewers re-evaluating LVEF by biplane Simpson was close to excellent [ICC 0.87 (95% CI 0.82\u20130.92)]. Likewise, there was an excellent correlation with Spearman\u2019s r\u2009=\u20090.69, p\u2009<\u20090.01). Agreement as assessed by Gwet\u2019s AC1 was moderate [0.58 (95% CI 0.47\u20130.69)], however, when adjusted for misclassification errors (AC2), the agreement between SWEDEHEART LVEF and the gold standard was good [0.76 (95% CI 0.69\u20130.84)]. There was a trend towards lower LVEF values in the registry when compared to the reassessments. This bias was further explored in Table p\u2009<\u20090.001) of cases in SWEDEHEART and an absolute agreement in 66% of cases. Figure As displayed in Table Independent validation of LVEF in the SWEDEHEART registry shows an overall good agreement when re-evaluated by two independent reviewers using the modified biplane Simpson method. However, there was a tendency towards underestimation of LVEF in SWEDEHEART, with the largest discrepancy between re-evaluated LVEF and SWEDEHEART LVEF in subjects with LVEF\u2009<\u200950%. Only five patients had a greater than one category difference.To our knowledge this is the first validation study of LVEF assessed by echocardiography in a quality registry by reassessment of the raw data. Consequently, it may be difficult to put these results in relation to previous registry validations. In 2016, Govatsmark et al. published a validation of the Norwegian myocardial infarction register with medical records as reference, without reinterpretation of the echocardiography raw data . This apThere were 47 subjects (36%) with LVEF\u2009<\u200950% in this study sample collected between 2008 and 2014. As of 2014, 35% of all the subjects registered to SWEDEHEART had an LVEF\u2009<\u200950%, indicating that the study sample was representative of the overall population .Assessment of LVEF by visual eye-balling was, at the time of enrollment, the most common method of LVEF assessment at all three participating centers. This approach has repeatedly shown to underestimate LVEF compared to quantitative assessment by the modified Simpson method \u201321. VisuKappa statistics has repeatedly been used in inter-observer variability studies on LVEF due to its property of adjusting for chance agreement . HoweverThere was an agreement on categorized LVEF in roughly 50% of the cases with reduced LVEF (as determined by the reference method). This discrepancy is largest in the mid-range categories of 30\u201349% where important clinical cut-off limits are present. An improved precision of LVEF assessments in this subgroup would be most favorable. A Japanese study examined two different teaching interventions with regard to improved inter-rater variability in visually assessed LVEF , 31. SucThere is a theoretical risk that some LVEF assessments have been misclassified into the wrong category in SWEDEHEART since this process is performed manually. As we have not validated the registry LVEF in relation to patient records such faults cannot be accounted for in this study which may be considered a limitation. The extreme outlier in Fig. The patients were included at three university hospitals which may give rise to questions of sample representation since SWEDEHEART contains data from all Swedish hospitals treating ACS. A larger nationwide follow-up with a greater variation in hospital size may provide additional information on the data validity in SWEDEHEART. However, as previously mentioned, the representability of the material is supported by the concurring proportion of subjects categorized with reduced ejection fraction in this study and in the SWEDEHEART registry .Independent validation of SWEDEHEART-reported LVEF shows an overall good agreement with the re-evaluated LVEF. However, a tendency towards underestimation of LVEF was observed, with the largest discrepancy between re-evaluated LVEF and registry LVEF found in subjects with subnormal LV-function in whom the reported assessment of LVEF should be interpreted more cautiously."}
+{"text": "M = 39.25, SD = 12.56; range 18\u201371 years; 49.6% women) and 179 were residents in Spain . Data collection was carried out in September (T1) and November (T2) 2020, through online surveys administered via Survey Monkey\u00ae platform. Overall, results show, as expected, greater identification with proximate categories rather than superordinate ones, and an association between STEs and IWAH, but also with national and community identification. IWAH, but not STEs decreased significantly (T1\u2013T2) in both countries. Thereafter, these emotional and behavioral responses decline as a symptom of growing fatigue with the pandemic situation, and also reflect a shift from broader to more local concerns. Analysis regarding comparisons between countries indicated higher levels of identification with community and with all humanity in Spain and with country in Chile. The results are discussed in the context of new developments in studies on IWAH.Recent studies suggest that identification with all humanity (IWAH), apart from being related to universalistic values, could also be related to self-transcendent emotions (STE). In this scenario, the general objective of this cross-cultural longitudinal study is to examine the relationship between identification with proximate categories  and superordinate one , and their association with positive self-oriented and STEs during a traumatic global phenomenon such as COVID-19 pandemics. Additionally, we explore variations regarding the patterns of those associations in different cultural contexts (Chile and Spain) and examine whether they change among two different time points (T1\u2013T2). The total sample was composed of 403 participants, of whom 224 were residents in Chile ( The recent pandemic affected humans\u2019 lives on an enormous scale, both at an individual and collective level. This experience showed all of us that more than ever we require common solutions for shared problems and collective threats. However, in the absence of a global governance system , it is nThe Social Identity Theory  has beenSocial Identity Theory  states tIn contrast to proximate identifications or in-group identifications, like identification with the world or superordinate identification categories implies seeing ourselves as members of the human race, regardless of nationality, culture, religion, race, political orientation, or socioeconomic status , 2013. IThe idea of IWAH dates back to the times of Diogenes of Sinope (412 BC) and Chrysippus who argued that cosmopolitanism would take hold by diminishing the importance of national identities. Within modern psychology, the concept of IWAH appeared in the theories of Adler, Maslow, Allport, and Erikson  by adopting practices and values of a global culture  such as Furthermore, several studies confirmed that openness to experience, empathy, and universalism-tolerance values are the psychological underpinnings of this identification, whereas ethnocentrism, blind patriotism, right-wing authoritarianism, social dominance orientation, and religious fundamentalism are negatively related . HoweverNevertheless, studies on cross-cultural validation and replicability of these findings are still scarce, especially outside Europe and the United States. Consequently, as Within the various emotional families, a classic dichotomization of emotions is based on their orientation; SOE and others-oriented emotions. Various studies proved that individuals experience STEs, such as kama muta or \u2018being moved by love\u2019  or moralConsequently, studies have found that STEs like elevation and social awe, can be evoked by exemplary actions of health care workers and by supportive community responses to the pandemic of COVID-19 . Thus, iWithin the family of positive emotions, STEs can mobilize individuals to connect with the people around them . Some stFor example, studies show that STEs such as kama muta make people feel love, solidarity, compassion and identification with others . That isFurthermore, In general, it is known that the various manifestations of STEs like elevation, awe and kama muta have shown strong associations with values which emphasizes appreciation, protection and voluntary concern for the well-being of others  and prosIn sum, given that it has been shown that STEs can promote both proximate and superordinate identifications it is especially necessary to explore those associations especially in uncertain and difficult times.In a two-time longitudinal design, we analyze the responses of the general population of Chile and Spain collected in September and November 2020, when each country was going through its particular sanitary situation.In Spain, the alert declaration approved by Parliament on March 14, 2020, granted sole command to the central government to manage the health crisis. It brought a lockdown of the entire population and mobility restrictions until June 21, 2020, when the decree was lifted, and the autonomous governments took control over their respective Autonomous Communities. From then on, free movement within the national territory was allowed, although borders with other countries by land and air were not opened until July 1, 2020. After the lockdown in the summer period (July and August), new infections increased progressively and significantly, which constituted the so-called \u201csecond-wave\u201d of coronavirus. In the first half of September, 122,700 new cases were recorded and the total number of deaths since the beginning of the pandemic reached 30,000. The second half ended with 778,607 people diagnosed positive for coronavirus, a 16.7% occupancy rate in Intensive Care Units (ICU) and a total of 31,973 deaths nationwide . By NoveIn Chile, on March 3rd, Chilean health authorities reported the first case of COVID-19. Two weeks later, on March 16th, the government announced the closure of universities, schools and 2 days after, on March 18th, the closure of the country borders and declaration of the national emergency, accompanied by several concrete interventions to further contain the outbreak in the region . Soon afBy July 19th, the Chilean government implemented the \u201cstep by step\u201d strategy. This plan considered five different stages of gradual opening, at the municipality level, based on the monitoring of epidemiological and health system indicators. In September, Chile had a total of 462,991 infections, an ICU occupancy rate of 39% and a death toll of 12,741 people , with paStudies on responses to collective disasters have found that in a first phase  there is a positive emotional arousal and a significant altruistic response and openness to those affected, which lasts for a few weeks. Thereafter, these emotional and behavioral responses decline, and people focus on more limited issues . For insDespite the long theoretical research on IWAH, on the one hand, and STEs on the other, empirical evidence examining their relationship is almost non-existent. In this scenario, the present study aims to examine the pattern of relationships between different levels of identification and their association with STEs in two different countries in the context of the COVID-19 pandemic. Specifically, we first propose to test whether proximate identifications  are compatible with superordinate identifications . Second, we will explore how these are associated with experiences of STEs. Hence, these are the hypotheses on which this study is based:(H1a) We expect that the levels of proximate identifications (community and country) will be higher than the level of superordinate identification (IWAH). (H1b) We assume that the relationship between all the different levels of identification will be positive.(H2a) STEs should be strongly associated with both proximate and superordinate identifications, more than SOE. (H2b) We also expect that the more STEs participants experience, the more they will identify with a superordinate category (IWAH).(H3) In addition, we expect a decline in STEs and all humanity identification from Time 1 to Time 2.(H4) Finally, as a more exploratory goal, we want to know if there are mean differences between the two countries, as well as differences in the association between the study variables (levels of identification and emotions).M = 39.25, SD = 12.56; range 18\u201371 years; 49.6% women) and 179 were residents in Spain . Sociodemographic characteristics of the sample can be found in \u00ae platform. The data collection process took place between September and November 2020. We contracted the services of Offerwise, a research panel company that provides programming, data collection, processing and analysis services1. This company convenes panelists through television advertising and social networks, currently managing a panel of more than 6 million active participants, who have their socio-demographic characteristics mapped and classified into consumer profiles. In this way, it was possible to adjust the recruitment to the characteristics of the population required for the present research, i.e., Chilean and Spanish citizens over 18 years of age. Finally, all participants received informed consent for the study, in which the voluntariness and anonymity of their participation were made explicit. The procedure was approved by the Ethics Committee of the Universidad Cat\u00f3lica del Norte (Ref: 0041/2019).The total number of participants was 403 persons of legal age, of whom 224 were residents in Chile  = 12.513; p = 0.000; d = 0.613] and their country  compared to IWAH. In this sense, it is observed that participants reported higher identification with their own community, followed by their country, and finally, with humanity as a whole. However, the concern subscale of all humanity dimension showed higher mean scores than all other levels of identification, being these differences statistically significant in the case of identification with one\u2019s own community , as well as in the case of identification with one\u2019s own country .First, regarding H1a, in order to compare the levels of proximate (community and country) and superordinate  identifications we carried out In addition, Pearson correlation analyses were carried out to explore the association among all levels of identification see also . Supportr = 0.40), followed by all humanity dimension (r = 0.33), and finally, with the community dimension (r = 0.27). Considering that STEs are the central element of the study, we wanted to test the differences of the magnitude of the above presented correlations. For this purpose, we carried out sample-weighted correlations comparison analyses , and we compared it with the correlation values of the community (r = 0.27) and country (r = 0.40) dimensions, respectively. The comparison of correlations did not result statistically significant for community dimension , whereas for country dimension it did . Additionally, we performed partial correlations between self-oriented and STEs and IWAH controlling for identification with community and country , we carried out repeated measures analysis. Following what we expected, we observed a decline in the levels of STEs and IWAH from Time 1 to Time 2. As can be seen in Regarding differences between nations (H4), as can be seen in t-test analysis to examine the differences between the two countries at both T1 and T2 separately , we used a comparative tely see .t(395) = 4.086; p = 0.000; d = 0.424], all humanity dimension , and its concern subscale . On the contrary, statistically higher means were found in Chile compared to Spain regarding country dimension  and STEs , although mean differences are not significant in the case of bond subscale , and SOE .Results for both Spain and Chile show mean-above the arithmetic average at T1 (September), with higher levels in people residing in Spain compared to those who reside in Chile, on community dimension , all humanity dimension , and concern subscale , with higher averages in the Spanish population. However, the Chilean sample showed statistically higher means of country dimension , SOE , and STEs . As can be seen, the differences are not statistically significant in the case of bond subscale (p = 0.195), showing a similar pattern as at T1. The differences at T2 are not statistically significant in the case of bond subscale  as at T1. However, in contrast to T1, SOE did show an increase at T2.With respect to the differences found at T2 (November) comparing the Spanish and Chilean populations, it should be noted that the means were statistically higher in the case of community dimension [d = 0.318) and STEs (d = 0.193). No statistically significant differences were found in any of the dimensions nor subscales (bond and concern).To find out which country had undergone the greatest change over time in the study variables, we calculated the subtraction of T2 and T1 to obtain the resulting score as a comparative value. Cross-country mean-comparison analyses were carried out see . The onlFinally, to find out the association between the study variables in both countries, correlation analyses were carried out by summing both times, T1 and T2. As can be observed in Exploring the differences between Spain and Chile, between-country correlation analysis  showed sMoreover, we conducted correlation analysis between the two families of emotions (self-oriented and self-transcendent) and the different levels of identification in T1 and T2 in Spain and Chile see . Overallr-values had a confidence interval that did not include zero.In addition, The aim of this study was to explore the associations between STEs and proximate and superordinate identifications based on analysis of cross-cultural longitudinal data gathered during first wave of COVID-19 in 2020. Moreover, we sought to explore the existence of variations regarding the patterns of those relations in two different cultural contexts, that is in Chile and in Spain. Subsequently, we aimed at examining within-person and between country changes in the levels of proximate and superordinate identifications and emotions during two time points of the pandemic.As to H1, our study partially confirmed what was expected, since the results showed that, in times of pandemic, participants reported greater identification with proximate identities. Specifically, they were more likely to identify with their own community, secondly with their country and finally with broader identifications such as all humanity. More precisely, it was concern , the subscale of the all humanity dimension, which obtained the highest scores. In addition, in the total sample, all of the dimensions of the IWAH scale were positively associated with each other, indicating that a proximate level of identification does not exclude being able to identify oneself with superordinate categories (H1b).Although both self-transcendent and SOE were associated with all the levels of identification, the former showed stronger associations with superordinate levels of identification, being all the differences statistically significant and supporting H2a. Globally, results confirmed that STEs are more strongly associated with different dimensions of identifications than SOE. Regarding H2b, STEs showed an association with all humanity dimension, but the strongest association was the one with country dimension.Considering the longitudinal nature of our study, we wanted to explore the differences between T1 and T2 on the study variables (H3). In both countries, IWAH, but not STE levels decrease. In the case of Chile, the dimension of country decreased significantly. In contrast, SOE increased significantly in T2; this variable was the only one with a significant magnitude of change between T2 and T1 and between the countries. The results confirm that over time the initial inclusive response triggered by the collective catastrophe weakens . HoweverWith respect to between-country exploratory analysis (H4), we observed statistically significant differences regarding almost all the study variables in both countries. In the case of Spain, participants reported higher levels of identification with the community (this dimension being the one with the highest means) followed by IWAH, and its subscale of concern. The differences found between the means of subscale of bond, in comparison with Chile, were not statistically significant. On the other hand, Chile showed higher means for the country dimension. With respect to emotions, participants in Chile reported experimenting significantly more self-oriented and STEs in comparison with those form Spain. As for the associations between the variables, we found, in a generalized way, significantly greater strength between the study variables in Chile, both between the levels of identification and emotions.COVID-19 has caused a great alteration in the way we live, feel and identify with social groups. In the psychological impact of the pandemic, it is difficult to identify aspects that have not been negatively marked at both the individual  and grouIn the case of our study, identification with the community was also more salient in both countries  which could be explained by the tendency of human beings to identify more closely with proximate identities, with the pandemic being a factor that may have accentuated this tendency see . However2 from both countries. As found by Furthermore, our results considering country-comparison revealed that IWAH was higher among participants in Spain than in Chile. One of the possible explanations could be related to the differences in levels of national identification and patriotism see . On the Accordingly, emotional mechanisms involved in enhancing broader social identifications in case of adverse circumstances are certainly complex and urgently require attention and rigorous research due to its important social implications. Thus, this study intended to examine positive emotions that may have some important influence in shaping the superordinate identifications. Several studies have confirmed the increase in negative emotions, stress, anxiety, and depression disorders, both, in Spain  and in COur results indicated that participants experienced more self-transcendent (than self-oriented) emotions. This is in line with studies on STEs that were conducted during collective traumatic events . For exaAccordingly, recent studies also suggest that cultivating STEs serve as a buffer against pandemic suffering and help to minimize its negative impact on mental health . For exaOur data indicated a positive and strong relationship between self-transcendent and SOE. However, the STEs showed the strongest associations with all the social or collective identification levels. These results may suggest that, although related, these two types of emotions may involve qualitatively different effects, being the identification with collectives  a central aspect of STEs. Moreover, our data demonstrated that STEs, as compared to self-oriented ones, were significantly more strongly associated with IWAH dimension. In short, according to other studies, we corroborated that self-transcendent and not SOE, allow individuals to connect with people and feel part of something bigger than the self, such as humanity see ,b.Regarding differences between countries, as to proximate identities, in Chile we observed a decrease in identification with the country (in Spain it remained stable). It may be related to citizens\u2019 dissatisfaction with governments\u2019 facing the COVID-19 pandemic as suggested by It is important to note that understanding and studying self-transcendent positive emotions can help to understand the new gap that has been created within the field of positive and social psychology. In this respect, in recent years, emotional processes have become of interest to researchers in the framework of studies on relationships where social identity becomes salient. Such a conception, if well channeled, could help to develop an active change in the way individuals and specific social groups think , and, perhaps, in how they act. On the other hand, the study of superordinate identities may also be relevant. According to the Common In-group Identity Model , the salPrevious studies in the midst of the pandemic have already shown that individuals have diminished social cohesion and identification with broader categories feeding polarization and extremism, such as an increase in rejection toward the out-group, greater prejudice, discrimination, stigma, race-based threat, and xenophobia . In thisAlthough our study makes several important contributions to the literature, of course it is not without its limitations. First, it should be noted that the samples used for the study were not entirely representative at the country level. On the other hand, despite the fact that most of the patterns of the results obtained in the Chilean context have also been confirmed in the Spanish, which definitely gave stability and scope to the results and conclusions of the study. Nevertheless, in order to better understand the relationships raised, it would be of great interest to expand the sample to other cultural contexts and countries as suggested by Another important limitation to consider is that, although one of the objectives of the study was to evaluate the relationship between IWAH and STEs in the context of a pandemic, this study has no precedents, so there is no empirical evidence on this matter. As a result of the aforementioned, it is not possible to make an adequate prediction of the behavior that people will maintain and how this will influence their IWAH. This is also related to the fact that the hypotheses proposed in the present study were not fulfilled, since, for example, it was expected that within the pandemic context to which the individuals were exposed, they would experience more SOE, whereas participants reported more STEs. All these limitations will be considered, and an attempt will be made to reduce them in future studies.Further studies are needed that include more representative population groups of different socio-economic and educational levels, ethnicity, etc., which would allow us to assess whether there are socio-demographic or socio-economic, or other psychosocial variables that could explain the differences in the interaction between these phenomena.On the other hand, as Following this line, the study of the different STEs would also make it possible to design useful interventions for everyday life that not only seek to alleviate negative emotions but also produce positive effects on creating a superordinate identity.The original contributions presented in this study are included in the article/The studies involving human participants were reviewed and approved by Ethics Committee of the Universidad Cat\u00f3lica del Norte (Ref: 0041/2019). The patients/participants provided their written informed consent to participate in this study.AW was the primary investigator of the study, provided comments and ideas, and drafted and revised the manuscript. AW, LM, and OC worked equally in the data collection, data analysis performance and development, and revision of the manuscript. ST, JM, and DP contributed providing ideas and discussing the results. JM, MB, DD, FB, and AL contributed significantly to data collection. All authors contributed to the last revision and approved the submitted version of the manuscript."}
+{"text": "Endometriosis is a common disease of reproductive-age women and an important cause of dysmenorrhea and infertility. Information on endometriosis is complex and there is a lack of summarization of available results. The study aims to evaluate the overall distribution of publications related to endometriosis to provide a foundation for further research. The Web of Science Core Collection was searched for articles published in the field of endometriosis. Our survey revealed the structure, hotspots, and development trends of endometriosis-related research and publications. Treatment of endometriosis is difficult; treatment usually involves surgery and drugs, and relapse occurs frequently. The annual worldwide cost of treatment is estimated to exceed 20 billion US dollars, a great burden for society and patient families.Endometriosis is a common disease of women of childbearing age, with a prevalence of 5% to 10%. Endometriosis is an important cause of dysmenorrhea and infertility, which negatively affect the quality of life and physical and mental health of women.Research and journal publications on endometriosis have increased dramatically, and the large number of articles has brought many new directions and ideas for development of medical treatment. However, few attempts have been made to systematically analyze the evolution of scientific results of endometriosis research. At the same time, the academic literature regarding endometriosis continues to expand, which makes it increasingly difficult to focus on particular areas and institutions, and possible interconnections and gaps between disciplines.,4 In this report, we review VOSviewer and CiteSpace bibliometric methods for use in endometriosis research. Our goal was to obtain fruitful visual information on the global scientific output of endometriosis research, to help readers better understand research progress, and to encourage new researchers to seize the frontier of the field. This report will help new researchers comprehend current research on endometriosis and the investigators and institutions active in the research. We also report which journals are more likely to see reports on endometriosis and keyword outbreak of articles, which can help readers identify research trends.Bibliometric analysis maps the knowledge domain of academic literature and can address the aforesaid challenge by identifying current trends, research networks, and related topics.endometriosis. The time span was set to 2002 January 1st through 2021 December 31st. The publication type was not limited. For each publication, authors, keywords, institutions, and cited references were downloaded.The literature data used in this study were downloaded from the Web of Science Core Collection on October 21, 2022, which is composed of the following databases: Science Citation Index Expanded, 1990-present, Social Sciences Citation Index, 1983-present, Arts & Humanities Citation Index, 1983-present, Conference Proceedings Citation Index-Science, 1996-present, Conference Proceedings Citation Index-Social Science & Humanities, 1996-present, Emerging Sources Citation Index, 2017-present, Current Chemical Reactions, 1985-present, and Index Chemicus, 1993-present. Online retrieval was performed using keyword  Some results may provide reference for possible interdisciplinary studies. In the density visualization picture, the more items in the vicinity of a point, the greater the weight of adjacent items, and the color of the point will be closer to yellow. Conversely, the smaller the number of items in the vicinity of a point, the lower the weight of adjacent items, and the closer the color of the point will be to blue. CiteSpace is another information visualization software tool used to visualize trends and mutations of keywords in a specified period of time. For this paper, VOSviewer 1.6.18 was used to analyze the number of articles published by authors, institutions, and countries, and journal co-citation and literature co-citation. CiteSpace 5.7.R2 was used to make a timeline diagram of synthetic keywords. GraphPad Prism 9 was used to construct histograms to visualize the number of publications on endometriosis during the aforesaid 20-year period.VOSviewer is a software tool for constructing and visualizing bibliometric networks. The VOSviewer constructs a graphical representation of bibliometric data to understand a research field in an easily interpretable way.\u00ae to draw the growth rate chart  and 6.353 (2021), respectively. Those 2 journals contributed 3518 articles in 20 years, 16.49% of all the articles. Four of the top 10 most frequently cited journals are in Table Fertility and Sterility, Human Reproduction, European Journal of Obstetrics Gynecology and Reproductive Biology, and Journal of Minimally Invasive Gynecology. The journal citation synthesis network , well ahead of other countries. China was the second highest contributing country, with less than half the number of articles compared with the United States. Five of the top 10 institutions with the largest number of publications  and Mauricio SA (No. 8), who published 10 articles together in 20 years. Of these top 10 Authors, 5 were from 1 or more of the 10 institutions shown in Table The color of the node represents the different categories, the size of the node represents the number of nodes, and the line between the nodes represents the connection between the nodes Figs. \u20135.Fertility and Sterility, which was cited 70,883 times. Among the top 10 co-cited references and co-cited journals, 4 overlapped: Fertility and Sterility, American Journal of Obstetrics and Gynecology, New England Journal of Medicine and Human Reproduction. The 4 journals included 7 top 10 co-cited references. In addition, 2 of these 4 journals coincided with the most frequently published journal: Fertility and Sterility (ranked first) and Human Reproduction (ranked second). About references co-cited and journals co-cited, most of the references were cited more articles is a system of endometriosis is introduced, including the pathogenesis, clinical diagnosis, and disease-related factor of contact. These highly cited references show that a thorough understanding of the theoretical knowledge is essential before in-depth study of the disease. The reference co-citation . Subsequent research is subjected to meta-analyses of various diagnoses. Meta-analysis is used to collect, sort, and analyze many studies performed for a particular topic and to seek therefrom a clear relation between the problem or the variables concerned. A meta-analysis can make up for the deficiency of a traditional review article. There is no fixed format nor protocol for the writing of traditional reviews, and there is no uniform standard for evaluating the quality of included studies. The quality of traditional reviews is greatly affected by the experience of the authors, the breadth of data collection, and the quality of the included literature; in addition, the total effect size of interventions cannot be quantitatively analyzed. Different authors who study the same particular issue are likely to reach completely different conclusions. The words with the greatest burst in the prior decade were impact, outcome, transvaginal ultrasound, validation, and migration.We used CiteSpace 5.7.R2 to capture the research frontier keywords with the strongest citation outbreak from 2002 through 2021. Keywords are the core summary of a paper, and analysis of keywords can provide an overview of the topic of a paper. The top 25 keywords were screened according to the outbreak intensity Fig. . The gre; the incidence of dysmenorrhea is 40% to 60%, low fertility is 21% to 47%, and/or pelvic pain is 71% to 87%. Endometriosis not only affects the quality of life, but also it poses a heavy economic burden on society.Worldwide, 10% of women of reproductive age, more than 176 million women total, experience endometriosis Bibliometric analysis methods can provide a comprehensive understanding of a field, which is of great help to subsequent research and, in the case of human studies, clinical application. For this paper, we used VOSviewer and CiteSpace to analyze the articles on endometriosis published in the prior 20 years and to examine the current development of endometriosis research.Bibliometrics, in a scientific and feasible manner, can display visually the massive amount of literature and present the highly active research topics and trends by cluster analysis and the construction and drawing of a network atlas.We found 21,336 related articles in the Web of Science Core Collection database for bibliometric analysis and visualization. From 2002 to 2012, the number of articles published yearly was hundreds, and from 2013 to 2021, the yearly number increased to more than 1000. Since 2017, the number of publications on endometriosis has been in a positive growth state each year, which indicates that research on endometriosis is in a rising period. Especially in recent years, attention has been focused on the topic, and treatment and pathogenesis are being studied intensively.Fertility and Sterility and Human Reproduction were the 2 most common journals, with 2215 and 1303 articles, respectively. The impact factors of these 2 journals are 7.49 and 6.353. Endometriosis is an inflammatory, estrogen-dependent disease associated with pelvic pain and infertility. We often find that \u201cendometriosis\u201d is related to \u201cinfertility\u201d; thus, it is easy to see the literature related to endometriosis in journals that address fertility and infertility.In terms of publications, This inconsistency led us to speculate that because the number of institutions that publish is large enough, and the proportion of all institutions in the world is large enough, more research will naturally be produced. We found that the authors with large numbers of reports also published more review papers than experimental research papers; thus, new researchers can understand the theoretical knowledge of endometriosis from these reviews. The importance of Interleukin-8(IL-8) in the pathogenesis of endometriosis was reinforced by the detection of IL-8 in peritoneal fluid. Suggested that Interleukin-17(IL-17) has an important function in the pathogenesis of early endometriosis and endometriosis-related infertility. The increased concentrations of hepatocyte growth factor, Interleukin-6(IL-6), and estradiol in peritoneal fluid demonstrate the combined activities of these cytokines and ovarian steroids in the production of hepatocyte growth factor from endometrial tissues in active endometriosis.In terms of keywords, at that time, studies on peritoneal fluid focused mainly on the determination of hormone levels and inflammatory factors therein. For example, peritoneal fluid confirmed that the expression of the estrogen receptor in macrophages was related to macrophage activation, which also supported the theory that the estrogen receptor was involved in development and persistence of endometriosis by acting on macrophages in the peritoneal cavity.mRNA was important for ten years (2002\u20132012). Endometriosis literature related to mRNA is generally concerned with determination of enzymes, such as matrix metalloproteinase and P450. Messenger RNA can also be used for the detection of signal pathways, such as glucocorticoid, eicosanoid, and sphingosine pathways.The term Epithelial mesenchymal transition, transvaginal ultrasound, meta-analysis, migration, and anxiety have been frequent keywords. In the first decade of endometriosis research, investigators tended to focus on the expression and measurement of various cytokines, whereas the second decade seems to have a focus on disease diagnosis and impact. Often, endometriosis is not diagnosed in time, mistaken for other diseases, or overlooked for the best opportunity for treatment. With considerable advances in diagnostic imaging such as transvaginal ultrasound and magnetic resonance imaging, exploratory laparoscopy should no longer be used to diagnose endometriotic lesions. Transvaginal ultrasound has become the main diagnostic method for pelvic endometriosis and adenomyosis. Critical analysis of the value of transvaginal ultrasound in noninvasive, pre-operative diagnosis of enteral endometriosis. Review of the diagnostic accuracy of transvaginal ultrasound in the preoperative detection of uterosacral ligaments in patients with clinical suspicion of deep infiltrating endometriosis. Advances in diagnostics have transformed invasive diagnoses into noninvasive tests, greatly improving the patient experience. Epithelial-mesenchymal transition is integral in development, wound healing and stem cell behavior, and pathologically promotes fibrosis and cancer progression.Migration is also closely related to the development of cancer. Although endometriosis is a benign disease in terms of histomorphology, it has the same biological behaviors of invasion, implantation, and adhesion as the behaviors of malignant tumors; in fact, some endometriosis patients will incur malignant transformation. Therefore, it is possible to further study the pathways or targets involved in metastasis.Some questions addressed by a meta-analysis of endometriosis research are the following: Accuracy of ultrasonography in the diagnosis of endometriosis in different locations.Our analysis had limitations. The selection of a single database made it impossible for us to include more data. There was no unified standard for the setting of software algorithms and parameters.Our research makes up for the absence of a comprehensive summary of endometriosis literature. We analyzed 20 years of global endometriosis research and its trends. Our analysis can shape the direction of further research and provide new points of view for solutions to a prominent women health problem.Conceptualization: Xiuhong Wu, Qiyao Li, Lihuang Lu.Data curation: Haoran Dai.Methodology: Weikang Tang.Supervision: Xiuhong Wu.Validation: Lihuang Lu.Visualization: Jing Liu.Writing \u2013 original draft: Siyao Deng.Writing \u2013 review & editing: Dongxia Yang."}
+{"text": "This is a peer-review report submitted for the paper \u201cMedical Brain Drain From Southeastern Europe: Using Digital Demography to Forecast Health Worker Emigration.\u201dThank you for the opportunity to review this paper . I thinkDataHave digital traces been used as an indicator of migration before? If so, please cite.I have concerns that some of the Google terms used indicate wider emigration rather than health worker migration.If you want to refer to the wider emigration from Croatia to Germany/Austria , you need to be clear that this is not health care worker (HW) migration you're referring to. I've compared HW migration with migration more generally in a recent paper .As an indication of health migration or HW migration intent, you should only focus on the doctor/nurse\u2013specific information.It would greatly strengthen your paper if you had stronger secondary/official data on the migration of nurses/doctors from Croatia/Bosnia and Herzegovina (B&H)/Serbia to Germany/Austria.Can you get data on the number of Croatian/Bosnian/Serbian\u2013trained nurses/doctors who have joined a nursing/medical register in Germany/Austria?Can you get data on the number of Bosnian/Serbian citizens who have obtained visas to work in Germany/Austria?This data would greatly strengthen your argument that digital traces can provide an early indicator of HW migration.Paper structureThe Introduction jumps around between source and destination countries. I would suggest that the paper discusses source countries and destination countries separately.Also, I think it's important to separate out push from pull factors and to be specific about the impact on each of the source countries; for instance, as an EU member state, Croatian doctors and nurses can freely migrate and work in Germany/Austria, but doctors/nurses from Serbia or B&H would need visas to work there, right?The pandemic as a push factor is really interesting and an important issue to raise.Western Balkan if it does not include Croatia? Better to use the countries that you\u2019re talking about .Why use the term Engaging with the wider literatureI think that the World Health Organization (WHO) Global Code on the International Recruitment of Health Personnel (2010), which is mentioned on page 11, should be more central to the paper, especially in relation to the concept of sustainability and the need for high-income countries to train and retain sufficient HWs to meet needs (article 5.4).Perhaps the paper also needs to mention the WHO 2006 list or the WHO 2020 safeguard list, which lists countries with critical health care shortages. Your paper makes an interesting contribution in highlighting that these issues are also relevant in European countries (see ).In relation to Europe, the paper should connect back to the European Observatory books on HW migration from 2014/2015, which highlighted health worker migration from new EU member states to older EU member states [In the Introduction, the paper should also connect with the wider literature on brain drain/health worker migration.Thank you for the revised manuscript; it is a much stronger paper, and the potential of digital demography in forecasting HW migration is now much clearer.Perhaps the title should read: Medical Brain Drain From Southeastern Europe: Using Digital Demography to Forecast Health Worker Emigration.You need to be consistent in the terms used throughout the paper (title/abstract/main text). At present the following terms are used to refer to the same places:Western Balkans and CroatiaSoutheastern EuropeB&HI\u2019d suggest using one term that includes Croatia and/or refer to the individual countries and use it throughout the paper.B&H is misspelled once in the Abstract.In displaying numbers/percentages use either decimals  or commas in figures, not both.a shortage of in place of a lack of.Throughout the paper, perhaps use Measuring health worker mobility is a challenge for most countries , which is why registration and/or visa data from the destination country is often used as a measure of health worker emigration.On page 4, you say that 65,288 nurses emigrated, and I think you\u2019re saying that there are more Croatian/Bosnian nurses in Germany than in Croatia and Bosnia; are you? Perhaps tighten up this sentence as it\u2019s a strong statement.in Austria is unclear. Rewrite these sentences.On page 7, the paragraph beginning In Table 3, perhaps mark the stock data versus the flow data .what could the European Union do to address the problem, I think this should be moved out of the Introduction and into the Discussion.On page 11, the section beginning I think you could bring one or two issues out in the Discussion that you\u2019ve mentioned in the text already but could make more of:The issue of the European Union drawing health workers from EU countries (Croatia) and nearby countries  is an important issue to raise in the Discussion, as it is a clash between free movement (EU free movement) and the right to health care/need to ensure a health workforce in all regions .normal ways of data collection are simply too slow . Your method is a really good way of generating timely insights into intent to migrate among health workers. As you mention in your paper, this should be useful for policy makers (but obviously only if they respond/react to the data). And then the next question for policy makers is how can they retain health workers during a pandemic? Increased salaries? Improved working conditions? Which links nicely to the section on what the European Union can do.I think that this method is a really interesting way of generating timely data on health worker migration. During the pandemic, the"}
+{"text": "P = .029), total urologic events (P < .001), and less use of additive alpha-blocker was observed in the carvedilol group (P = .022). In multivariate analysis, less carvedilol use (P = .019), heart failure (P < .001), stroke (P < .001), and cardiomyopathy (P = .046) were independent risk factors for arrhythmic events. In addition, less carvedilol use (P = .009) and older age (P = .005) were independent risk factors for urologic events based on BB type at the median 36-month follow-up. The use of carvedilol was associated with less arrhythmic events in BPH patients with palpitation and decreased the incidence of urologic events in BPH compared with the use of non-carvedilol BBs in long-term follow-up.Benign prostatic hypertrophy (BPH) is associated with autonomic dysfunction and sympathetic nervous system mediated by the alpha receptor. However, limited data exist regarding the effects of the beta-blocker (BB) carvedilol on arrhythmia and urologic outcomes in BPH patients. Our database of patients diagnosed with BPH from 2015 to 2020 was used to obtain echocardiography and electrocardiogram data. Inclusion criteria were BPH patients taking BBs. International Prostate Symptom Score questionnaire were used to evaluate the urinary symptoms and quality of life. Among 448 patients with BPH (69.2\u2009\u00b1\u200910.9 years) taking BBs, 219 patients took carvedilol (48.9%) and 229 patients took a non-carvedilol BB . Difference in the baseline characteristics was not observed. During the median 36-month follow-up, a lower incidence of arrhythmic events ( Recently, reactive oxygen species, which are formed during ureteral obstruction, have been suggested to play a role in this process.Benign prostatic hyperplasia (BPH) is a common disease affecting middle-aged and elderly males. The disease may affect up to 50% of males 60 to 69 years of age and its prevalence increases with age. Individual symptoms of BPH may vary, although the condition is chronic and can significantly influence quality of life. Although lower urinary tract symptoms are common urologic problems, the pathophysiologic changes in urinary tissue are not fully understood. Known factors in the pathophysiology of lower urinary tract symptoms-related BPH include intrapelvic pressure elevation, vasoactive, and inflammatory mediators such as activation of the renin-angiotensin system, expression of transforming growth factor alpha, endothelial growth factor, and prostaglandin.\u20135 AF is often associated with other cardiovascular diseases including diabetes, hypertension (HTN), heart failure (CHF), ischemic heart disease, valvular heart diseases, and other cardiomyopathies. In 10% to 15% of the cases, AF occurs in the absence of any such comorbidities and is considered lone AF. However, in recent studies, other factors having a role in the genesis of AF have gained attention including obesity, sleep apnea, alcohol abuse and other intoxications, exercise, latent HTN, genetic factors, acid reflux disease, and local or systemic inflammation.\u20136Increasing evidence links inflammation to a broad spectrum of cardiovascular conditions such as coronary artery disease. In addition, emerging data support the association between inflammation and arrhythmia including atrial fibrillation (AF), the most common clinically significant arrhythmia in clinical practice.,7Carvedilol is a nonselective beta-blocker (BB) with additional alpha-blocker properties. Carvedilol competitively blocks alpha-1, beta-1, and beta-2 adrenergic receptors, and has vasodilatory properties. Carvedilol has been commonly used for the clinical treatment of HF, HTN, and myocardial infarction. Carvedilol has antioxidant properties in addition to antiadrenergic effects. Due to its antioxidant properties, carvedilol can treat many pathologic conditions associated with enhanced cellular oxidative stress.However, data regarding the effect of carvedilol on the long-term clinical outcomes in BPH patients are limited. In the present study, the effects of carvedilol on the long-term urologic and arrhythmic events in BPH patients with palpitation were evaluated.In the present study, the medical records of 832 patients diagnosed with BPH at Kosin University Gospel Hospital from April, 2015 to December, 2020 were retrospectively reviewed.Inclusion criterion was BPH patients diagnosed with ICD code  who received BB. Exclusion criteria included patients who took 5-alpha reductase inhibitor (PROSCAR) before carvedilol, patients lost to follow-up, history of valvular or congenital heart disease, hepatic or renal disease , acute cardiovascular or cerebrovascular event within the preceding 3 months, major trauma or surgery within the preceding 3 months, hyperthyroidism, or uncontrolled HTN. In addition, the following disease-specific exclusion criteria for prostate disease were used: previous prostatic surgery, urinary symptoms caused by conditions other than BPH, prostatic malignancy or a prostate-specific antigen level > 4\u2009ng/mL, or both, and persistent postvoid residual urine volume (PVR) > 200\u2009mL.,9 that were defined including frequency, urgency, weak stream, nocturia, surgical, and interventional procedures for BPH based on the use of carvedilol during follow-up.Finally, 448 consecutive BPH patients  were enrolled in the study. All patients were monitored to evaluate arrhythmic events and urologic parameters including total International Prostate Symptom Score (IPSS), voiding volume, voiding volume, maximum urinary flow rate (Qmax), IPSS change, IPSS storage change, Qmax change, incidence of additive prescription of alpha-blocker or anticholinergics, and urologic eventsThe study protocol conforms to the ethical guidelines of the 1975 Declaration of Helsinki, and the research protocol was approved by the ethics committee of Kosin University Gospel Hospital (IRB no. 2015-11-010). All patients provided written informed consent.2).After electrocardiogram (ECG) and chest X-ray, cardiovascular status was evaluated for each patient using echocardiography, an exercise test, 24-hour Holter recordings, and blood laboratory data from the initial visit, as determined by the attending physicians. From the database, the following information was collected: Patient data, including sex, age, height, and weight; Cardiovascular risk factors, including HTN  and diabetes mellitus ; Cardiovascular disease status, including structural heart disease, congestive CHF, or a history of a disabling cerebral infarction or transient ischemic attack; Use of medication. Body mass index was calculated as weight in kilograms divided by the square of height in meters . The IPSS questionnaire was used to determine the severity and bother scores of BPH symptoms in patients. Study medication compliance and concurrent medications were evaluated. Adverse events were recorded and monitored accordingly.The primary end points were arrhythmic events including atrial premature beat, atrial tachycardia, atrial fibrillation, ventricular premature beat, and ventricular tachycardia during follow-up. The secondary end points were defined as the change in PVR, Qmax, and IPSS, and total urologic events including frequency, urgency, weak stream, nocturia, urologic interventional procedure, medication changes, and rehospitalization. The left ventricle ejection fraction was obtained via the modified biplane Simpson method from the apical 4- and 2-chamber views.All enrolled patients underwent 2-dimensional transthoracic echocardiography. The examinations were performed using a commercially available Vivid 7  ultrasound system. All recorded echocardiograms were measured and interpreted with clinical information blinded using a computerized off-line analysis station . All measurements were derived from 3 consecutive cardiac cycles and averaged. The left ventricular dimensions, wall thicknesses, and left atrial dimensions were determined in the parasternal long-axis view with the M-mode cursor positioned immediately beyond the mitral leaflet tips perpendicular to the long-axis of the ventricle according to the recommendations by the American Society of Echocardiography.t test or the Mann\u2013Whitney U test depending on the data distribution. Categorical variables are presented as frequencies (percent) and were analyzed using the chi-squared test. To determine whether any of the variables were independently related to arrhythmic and urologic events based on type of BBs, a multivariate analysis of variables with a P value < .05 in the univariate analysis was performed using linear logistic regression analysis. All correlations were calculated using Spearman rank correlation test. All statistical analyses were conducted using the SPSS statistical software, version 19.0 , and statistical significance was set at P < .05 (2-sided).All continuous variables are expressed as either the mean \u00b1 standard deviation or median  depending on the distribution. For continuous data, statistical differences were evaluated using Student The baseline demographics for both groups are listed in Table The baseline laboratory and echocardiographic findings did not differ between the groups Table .P = .034), total urologic events (P < .001), and less use of an additive alpha-blocker were observed in the carvedilol group (P = .022). A higher IPSS voiding change (P = .001) and decreased Qmax (maximum urinary flow rate) change (P = .006) were observed in the non-carvedilol group.The clinical outcomes at the median 36-month follow-up are shown in Table P = .019), CHF (P < .001), stroke (P < .001), and CMP (P = .046) were independent risk factors for arrhythmic events at the median 36-month follow-up  were significantly associated with arrhythmic events including atrial premature beat, atrial tachycardia, atrial fibrillation, ventricular premature beat, and ventricular tachycardia in patients with BPH. In multivariate analysis, less carvedilol use (P = .009) and older age (P = .005) were independent risk factors for urologic events including frequency, urgency, weak stream, nocturia, and surgical and interventional procedures for BPH based on BB type at the median 36-month follow-up  did not differ between groups, the incidence of urologic events (P < .001) were lower in the carvedilol group than in the non-carvedilol BB group.This is the first study in which stratification was validated to assess the probability of arrhythmic events using carvedilol compared with non-carvedilol BBs and the effects of carvedilol evaluated on long-term urologic clinical prognosis in patients with BPH. Although the total IPSS (The results showed the use of carvedilol was associated with less arrhythmic events in BPH patients with palpitation and decreased the incidence of urologic events for BPH in the long-term follow-up. Although the mechanism remains unclear, the control of vagal tone increase associated with dysuria due to BPH using nonselective beta adrenoceptor and selective alpha-1 adrenoceptor blockers may reduce trigger activity and can be used as an important prevention tool for arrhythmia.Further prospective studies are needed to determine if a true causal mechanism exists between the carvedilol use and arrhythmia as well as to determine whether the mechanism is dependent on a specific subtype of arrhythmia. In addition, the potential for carvedilol treatment to reduce the development of BPH-related urinary symptoms warrants further investigation.The present study had several limitations. First, this was a single-center, retrospective study derived from a real-world practice with inherent limitations. Therefore, the study results should be considered as hypothesis-generating, and future prospective studies are warranted to confirm the results. Second, asymptomatic episodes of arrhythmia including AF may not have been recognized because arrhythmic events were based on clinical symptoms and ambulatory monitoring for a short period. Third, patients with potentially reversible causes were excluded from the study. Therefore, the results of this study cannot be extrapolated to other patient populations with previously detected paroxysmal tachyarrhythmia, such as paroxysmal AF. Fourth, the patients with BPH could not be continuously treated, therefore, a direct correlation of carvedilol treatment with urologic and arrhythmia-associated clinical outcomes could not be made. However, chronic inflammation and autonomic imbalance have been proposed as plausible pathophysiological mechanisms of urologic and arrhythmic events including AF. In addition, the results of this study have revealed a novel perspective for the use of carvedilol focusing on both the anti-arrhythmogenic effects and additive effects on BPH-related urologic symptom relief.The use of carvedilol was associated with less arrhythmic events in BPH patients with palpitation and decreased the incidence of urologic events for BPH compared with the use of non-carvedilol BBs in long-term follow-up.We thank all members of the Division of Cardiology, Department of Internal Medicine, and Department of Urology, Kosin University Gospel Hospital for their assistance and support with data collection.Conceptualization: Sung Il Im.Data curation: Soo Jin kim, Sung Il Im.Formal analysis: Sung Il Im.Investigation: Han Su Park.Methodology: Bong Joon Kim, Hyun Su kim.Supervision: Jung Ho Heo, Taek Sang Kim, Sung Il Im.Validation: Pil Moon Kang, Sung Il Im.Visualization: Sung Il Im.Writing \u2013 original draft: Sung Il Im.Writing \u2013 review & editing: Sung Il Im."}
+{"text": "Erythromelalgia is a rare disease, involving pain, edema, redness, and hyperthermia in the limbs. It is extremely refractory to drugs, has no defined treatment, and causes psychological comorbidities in the patient. We describe a case of erythromelalgia involving a 17-year-old boy who had been suffering from the disease for almost 4 years prior to finding an effective treatment. A bilateral endoscopic lumbar sympathectomy was performed, limited to L2 and L3 resections. Four weeks after the procedure, the patient\u2019s symptoms were significantly mitigated and at 8 months follow-up he remained almost asymptomatic. Endoscopic lumbar sympathectomy was an effective treatment for primary erythromelalgia in this teenager, with exceptional reduction of his symptoms. Erythromelalgia (EM) is an extremely rare disease and is especially rare in kids. It involves episodes of erythema and burning pain in the limbs that can be extremely bothersome. The prevalence is unknown, but it is predominant among girls and it usually appears during adolescence. It is divided into 2 types: primary and secondary. The secondary type has an underlying cause and is rarer in children. The primary type may have an inheritable cause, but in most cases the cause is unknown.A 17-year-old boy came to us seeking surgical treatment of primary erythromelalgia as a last resort, after several attempts to treat this unusual disease. Initially, when he was 14 years old, he had noticed bilateral allodynia of the ankles, assessed at level 3-4 on a verbal numerical rating scale (VNRS). A first evaluation with an orthopedist detected edema and discoloration extending from the feet to the inferior third of the thighs , 3, 4,5.Primary EM was diagnosed based on the clinical history of pain, triggers, full body thermography, and a negative genetic mutation test for SCN9A.Progressively, the disease was profoundly affecting his quality of life. Pain could only be relieved by lying down, elevating his legs, and setting the air-conditioner to 18\u00ba C.He tried different treatments, including consulting with a neurosurgeon specialized in pain relief and a psychiatrist. Pregabalin was used for 5 months at 75 mg twice a day, with no effect. At that point his VNRS score had worsened, reaching 5-6. Several other medications were also prescribed, including antidepressants, acetaminophen 300 mg twice a day, and tramadol 30 mg twice a day for 5 months, with almost no change in the general picture, but additional side effects. Episodes became constant, affecting his sleep and social life.One year after the diagnosis of EM, a combination of venlafaxine 250 mg/day and tramadol 100 mg twice a day was finally able to reduce the pain intensity score from 8 to 4 and give mood support, stabilizing his condition. This allowed him to return to some social activities and the treatment was maintained for 2 years.This afforded considerable relief, but the condition was still causing pain, so the family decided to seek a different approach. They consulted our team to try to achieve better control of the EM. We explained that endoscopic lumbar sympathectomy (ELS) could sometimes be used as a last resort for his condition and that if we could achieve 50% pain relief, that would be a tremendously positive result and could possibly help him lower his medication dosages and reduce their side effects. Four years after the patient\u2019s first episode, his family agreed to surgery and he underwent bilateral ELS.The patient underwent general anesthesia with endotracheal intubation and was placed in a dorsal decubitus position, slightly lateralized, with a cushion under the lumbar region. Retroperitoneal access was obtained using an intraperitoneal view to guide retroperitoneal placement of the first trocar halfway between the iliac crest and the inferior costal facet on each side, at the median axillary line.Once the 10 mm scope had been positioned, the retroperitoneal space was dissected, using the optics initially. After the extraperitoneal space was established, the other trocars were placed equidistant to the first one in a semi-lunar distribution. Then, two 3-mm ports were inserted under direct view and the space was further developed. The transversalis fascia was dissected, reaching the psoas muscle, the main landmark in this space. Care was taken to keep in contact with the psoas, avoiding the wrong plane of the quadratus lumborum. The genitofemoral nerve was identified in a medial direction, above the psoas tendon. The ureter was then located and isolated in the direction of the peritoneum. Dissection continued until the lumbar vertebra. Just before reaching it, on the left side, we found the aorta and the iliac arteries, and on the right side, the vena cava. Following this, the lumbar sympathetic trunk was identified medially to the muscle, where it is covered by a capsule formed by the insertion of the psoas muscle at the lumbar spine.As the capsule was opened, the trunk and its ganglia were revealed. After correct identification, we proceeded with careful resection of the sympathetic ganglia - the second and third lumbar ganglia. The chain removed was 4 cm in length. The entire surgical procedure lasted around 72 min, with no complications.After discharge, the patient was reevaluated after 4 weeks, 1 month, 4 months, and 10 months. The first 3 weeks showed no great improvement in his condition. Edema was still present, although control of pain relief was slightly better. After 4 weeks, the symptoms started decreasing and at 4 months he reported a 95% reduction in his symptoms. Today, 10 months after ELS, he rates his pain as level 1 and has no other symptoms, enabling a full return to an active and social life. He has weaned off venlafaxine and has stopped taking tramadol and antidepressants. Besides compensatory sweating in his torso and anhidrosis in his feet, he has had no other side effects of ELS.The project was approved by the research ethics committee at Universidade Positivo, protocol number 5.659.788.,3,1,Erythromelalgia is a rare disease. The classic symptoms of EM are redness, pain, increased temperature, and swelling, usually triggered by heat or physical exercises.1,3,4,6,1,The physiopathology of primary EM is not very clear, but theories regarding abnormal vascular dynamics have been raised. Accordingly, the precapillary sphincters located in the skin of feet and hands would be constricted in EM, reducing nutritional flow, whereas anatomical vascular shunts would be opened, allowing for high blood flow, causing the characteristic symptoms of EM, hypoxia, and tissue damage.2,There is no specific treatment for EM and patients have variable responses to the pharmacological and surgical treatments that are available.1,10,9,9,11,13,14,Lumbar sympathectomy (LS) is a surgical procedure in which part of the sympathetic trunk and ganglia are irreversibly damaged, most commonly L2-L4. This interrupts the efferent signals to \u03b1-1 receptors, causing relative vasodilation in small vessels of the lower limbs. Also, exocrine glands and nociceptors lose their efferent and afferent signals, respectively, reducing sweating and perception of pain. Lumbar sympathectomy is indicated in severe cases of ischemic lower limb disease, hyperhidrosis, and pain. It can be performed in various ways. The endoscopic approach has more benefits and fewer complications for the patient.9,18,The indication of LS for EM is not well-defined because of the small number of cases, but it has been performed to treat EM since the last century.15The initial edema after the operation is consistent with vasodilation caused by the sympathectomy. However, 4 months after surgery his condition had improved remarkably. The collateral effects were expected of ELS and the patient reported a reminiscent memory of the pain. This shows how striking the EM was to him. The results of ELS helped his mental health to improve outstandingly, enabling him to return to normal activities.Endoscopic lumbar sympathectomy was used successfully in a teenager as treatment for primary erythromelalgia, with remission of symptoms and a remarkable improvement in his quality of life."}
+{"text": "Hypertensive disorders in pregnancy (HDPs) are no longer seen as \u201ctransitory diseases cured by delivery.\u201d It accounts for up to 50% of maternal deaths. Information concerning HDPs is less in developing countries like Ghana. This study was conducted to find out the prevalence, awareness, risk factors, control, and the birth outcomes of HDPs. This was a retrospective cohort study conducted among pregnant women seeking care in selected health facilities in the Ashanti Region. Data on demographics, HDPs, and its associated birth outcomes were collected. Logistic regression models were used to examine the association of the independent variables with HDPs. The burden of HDPs was 37.2% among the 500 mothers enrolled with chronic hypertension superimposed with preeclampsia accounting for 17.6%, chronic hypertension, 10.2%, and preeclampsia 6.8% whilst gestational hypertension was 2.6%. It was observed that 44% (220) of the mothers had excellent knowledge on HDPs. Oral nifedipine and methyldopa were frequently used for HDP management, and it resulted in a significant reduction in HDP burden from 37.2% to 26.6%. Factors that influenced the increased risk of HDPs were grand multigravida , family history of hypertension , and the consumption of herbal preparations  and alcohol  during pregnancy. HDPs increased the risk of preterm delivery , stillbirth , and undergoing caesarean section  amongst mothers during delivery. The burden of HDPs is high amongst pregnant mothers seeking care in selected facilities. There is the need for intensified campaign on HDPs in the Ashanti Region of Ghana. Hypertensive disorders in pregnancy (HDPs) are the leading cause of maternal mortality . It contFactors such as educational level, age, higher parity, occupation, family of HDPs, gravida, complications of pregnancy, and others such as healthcare systems and social, cultural, and economic factors are seen to be associated with HDPs . StudiesTarget 3.1 of the Sustainable Development Goals (SDG) as set by the United Nations is aimed at reducing the maternal mortality ratio to 70 per 100,000 live births by 2030 [However, the burden of hypertension has been increasing over the past few decades in SSA, and a large percentage of the population with hypertension remains untreated, ineffectively treated, or even undiagnosed . FurtherThis was a retrospective cohort study, which employed a well-structured, pretested, close-response questionnaire to obtain data from pregnant women who were seeking care at four hospitals in the Ashanti Region. The Ashanti Region is the second most populous region in Ghana (GSS 2019) with over 100 hospitals, both private and public hospitals. The study sites included the Ejisu Government Hospital , Kwame Nkrumah University of Science and Technology (KNUST) Hospital , Kumasi South Hospital , and the Komfo Anokye Teaching Hospital (KATH) . These facilities were chosen because of their location in the region and the large coverage of patients they cater for.This study included pregnant women above the ages of 18 years who had been admitted for delivery and those who had delivered at the hospital during the period of the study. Pregnant women who were on admission for other reasons besides delivery were excluded.At a significance level of 5%, the Yamane method was used to determine the sample size . The estConsented participants were screened for eligibility. Participants who were eligible for this study were numbered and randomly sampled using an online number generator. Participants whose numbers were generated were included in the study.The questionnaire was developed after reviewing several literatures to ensure that the items capture a meaningful construct to have causality to the outcome of interest. The questionnaire was piloted within a selected hospital. To assess the reliability of the construct of composite variables such as the level of knowledge, a Cronbach alpha test was conducted. For the Cronbach alpha test for level of knowledge, the score was 0.73 which indicates that the composite variable is reliable. Information was collected on their sociodemographic characteristics, factors influencing their risk of hypertensive disorders in pregnancy, level of awareness, management of the disorders, and the birth outcomes.The level of knowledge was assessed as an 18-item composite variable. For a correct response a code of 1 was assigned, and for a wrong response, a code of 0 was assigned. Therefore, a participant can score a maximum of 18 and a minimum of 0. Where a participant scores less than 5, and then, the participant has poor level of knowledge, scoring between 5 and 9 was considered satisfactory level of knowledge, and 10 to 14 was considered good level of knowledge. A participant is considered to have an excellent level of knowledge on HDPs if the participant scores 15 to 18.Code of 1 was assigned to participants who had HDPs and 0 to participants who did not have evidence of HDPs. Thus, the dependent variable hypertensive disorder in pregnancy was measured as a binary outcome.A research team comprising medical officers, pharmacists, pharmacy house officers, research scientists, and midwives was formed and oriented through series of meetings on the procedures and the objectives of the study. Each member had a specific role to play. The team was grouped into four smaller groups for each hospital. All consenting women who had delivered had their antenatal record booklets reviewed retrospectively from 16 week gestation to the point of delivery by a member of the research team and underwent a confidential face-to-face interview (where possible) in vernacular or English using a pretested structured questionnaire. The questionnaire was used to collect data on demographic, socioeconomic characteristics, patient-related factors, and knowledge on hypertension related disorders in pregnancy (HDPs). Antenatal record books were reviewed for the outcome and mode of pregnancy, blood pressure control during the gestational period, antenatal quality indices, and any diagnosis of HDPs. The mode of deliveries was recorded in patients' records by physicians or the midwives.Women who had been admitted for delivery but had not delivered were recruited after delivery and then interviewed. The participants were allowed to withdraw from the study at any time if they wish to do so and reasons for withdrawal documented.p values. Statistically significant was considered at a p < 0.05.Data was entered in Excel and cross-checked, cleaned, and exported to Stata version 14 for the analysis. There were no missing data due to the use of interviewer administered questionnaire and a check on women medical records. A univariate analysis employing the Pearson's Chi square test and simple logistic regression analysis was carried out to assess the factors associated with HDPs. Multiple logistic regression analysis was considered to assess the association between independent variables that proved to be statistically significant under the univariate analysis. The results obtained from the multivariable analysis were expressed as odds ratio with their respective 95% confidence intervals (CIs) and A total of 500 pregnant women participated in this study. A fifth of the participants were aged 18 to 24 years, 174 (34.8%) aged between 25 and 29 years, and a quarter were aged 30 to 34 years. Respondents were more likely to be educated , married , Christian , managing their own private businesses , prefer to receive antenatal care (ANC) in a health facility located in an urban area , and have some knowledge on HDPs  .Women attending the health facilities were more likely to be multigravida , with no history of miscarriage  nor caesarean section , and do not have history of chronic condition , nor HDPs . Most of them, 342 (68.67%), had their first antenatal visit in their first trimester .The results indicated that, out of the 500 respondents, 314 (62.8%) had no hypertension throughout their pregnancy while 186 (37.2%) were with HDPs. Fifty-one (27.4%) were chronic hypertensive, chronic hypertension superimposed with preeclampsia was 88 (17.6%), preeclampsia was 34 (6.8%), and gestational hypertension was 13 (2.6%) .n = 81) and oral methyldopa  were often prescribed, 7.6% (n = 14) of respondents received IV magnesium sulphate, 4.7% (n = 09) were on injection, and hydralazine and tab prazosin were 1.3%. The parenteral medications were prescribed during pregnancy for those who recorded high blood pressure or were at risk of developing eclampsia . Grand multigravida mothers were 4.5 times more likely to have HDPs compared to primigravid mothers . Additionally, mothers with family history of hypertension were 4.3 times more likely to have HDPs . Herbal consumption during pregnancy was associated with an increased risk of HDPs , and also, mothers who consumed alcohol were more likely to have HDPs  .Tables 5Similarly, mothers who are diagnosed of HDPs have 70% increased chance of experiencing caesarean section mode of delivery compared to mothers who were not diagnosed of HDPs . Mothers who consumed alcohol were 2.37 times more likely to experience caesarean section compared to mothers who did not consume alcohol . Mothers who had family history of hypertension were 1.61 times more likely to undergo caesarean section during delivery  .In addition to the birth outcomes of the study, it was realized that mothers who were diagnosed of HDPs were 12.47 times more likely to have stillbirth during delivery compared to mothers who were not diagnosed of HDPs . Other predictors such as maternal age, anxiety over pregnancy, history of chronic medical condition, and consumption of alcohol did not influence the risk of stillbirth amongst mothers .Hypertensive disorders in pregnancy (HDPs) have been established to be a leading cause of maternal deaths, accounting for about 26.4% to 50% of all maternal deaths in the country . In a stThe burden of HDPs in this study was 37.2%, and 62.8% of the participants had no HDPs, which is comparable to a study by Awuah et al. , in whicThe disparity of the disease burden among the various studies could be attributed to a lack of consensus on the diagnostic criteria of the various hypertensive disorders. This is because the health facilities in this study all use treatment protocols similar to the national standard treatment guidelines  for manaDespite the above explanation, Ghana has often recorded a high burden of HDPs, and this should be of national health concern because it has been a major cause of maternal and prenatal morbidity and mortality.Knowledge of an individual on a particular health condition influences the health seeking behaviour of individual . Thus, k\u03b1-agonist that decreases sympathetic outflow to decrease BP, it has a very long duration of action and the best safety profile amongst the antihypertensive drugs used during pregnancy [Oral nifedipine and oral methyldopa, at different doses, were the drugs often prescribed. This finding is similar to the findings of Kumar et al. where it was observed that both nifedipine and methyldopa are the most prescribed antihypertensives in pregnancy . Nifedipregnancy . CurrentThe mean blood pressure of pregnant women at 16 week gestation was 119.7/76.9\u2009mmHg, which is considered normal. However, this average is confounded by several factors such as the gestational stage and the baseline blood pressure at the start of the pregnancy. At around the fifth week of gestation, there is an expansion of the blood volume which causes a drop in the blood pressure of the mother. At this critical stage, hypertensive mothers may appear to have a normal blood pressure . This maAgain, from the results obtained, it was realized that there was a significant decrease in the proportion of mothers who had high blood pressure by 10.4% . This inThe level of education influenced the risk of being hypertensive in pregnancy such that mothers who had junior high school education were 68% less likely to develop HDPs compared to the likelihood of mothers without any formal education developing HDPs. This finding is consistent with the findings of Abalos et al.  where evIt was also realized that high number of pregnancies greatly influenced the risk of HDPs . Though Genetics has been explained to influence the risk of chronic disease in several populations. The evidence of this study suggests that mothers who have family history of HDPs were at 3.6 times increased risk of developing HDPs compared to women who have no family history of hypertensive disorders. This is in sync with the systematic review by Tesfa et al.  which coThe use of complementary and alternative medicine (CAM) is predominant in Ghana, and it is recognized by the health system . NonetheThis study's finding does not imply that the use of herbal medicines negatively increases blood pressure. This is because the study is methodologically limited to the use of herbal medicines. It did not assess the type of herbal medicine used, how the herbal medicines were used, and whether it was prescribed or was appropriate for use. However, this finding reveals a very critical issue of the appropriate use of herbal medicines in pregnancy. Herbal medicines are made up of several constituents, and the safety of their use should be ascertained. Currently, there is paucity of information on the use of herbal medicine in the management of hypertensive disorders, particularly in pregnancy. More research evidence would be needed to understand why pregnant women in selected health facilities use these medicines, its constituents, and appropriateness for use in hypertensive disorders.Alcohol consumption is known to influence hypertensive disorders in adults. Several studies have propounded that alcohol consumption, particularly heavy consumption, increases the risk of hypertension in normotensive individuals . From thThe aetiology of these HDPs, however, is not known . It is tSome studies have established that HDPs influence the birth outcomes at delivery. From this study, mothers who had HDPs were 2.66 times more likely to have preterm babies. This finding is consistent with a study by Xiong et al. , where iAnother evidence from this study reveals that hypertensive mothers were 1.70 times more likely to undergo caesarean section. This finding is consistent with the findings of Roberts et al. , where iThe overall prevalence of HDPs was 37.2% with chronic hypertension superimposed with preeclampsia having the highest prevalence of 17.6%. Lack of formal education, family history, multigravida, consumption of alcohol, and herbal preparation were identified as factors that could influence the risk of HDPs. The use oral nifedipine and methyldopa considerably reduced the proportion of mothers with high blood pressure. The selected mothers with HDPs were likely to undergo caesarean sections, experience stillbirth, or have preterm babies. The burden of HDPs is high amongst pregnant women seeking care in selected facilities. There is the need for intensified campaign on HDPs in the Ashanti Region of Ghana.Considering the increasing risk of HDPs in the Ashanti region, its increased adverse association to obstetric outcomes such as stillbirth, preterm, and caesarean section, there is the need to investigate the cost impact of HDPs on the mother and the household. Additionally, the quality of life of mothers diagnosed with HDPs and the impact of HDPs on the risk of prenatal and postnatal depression should be assessed further.This study was well powered considering the sample size as such reducing the risk of type 1 error. Additionally, the participants were clearly defined using the inclusion and exclusion criteria, outcomes were appropriately measured, and potential confounding factors were considered in the analysis. Therefore, findings of this study are generalizable to pregnant women seeking antenatal care in the Sub-Saharan African region.This study required mothers to recall past event, and this subjected the responses to recall bias. To minimize this bias, where mothers could not recall an event, they were permitted to skip the item on a questionnaire. Additionally, this study does not establish causality but rather provides the strength of association between the outcome variables and predictors, as such interpretations of the findings should be done carefully."
\ No newline at end of file