diff --git "a/deduped/dedup_0115.jsonl" "b/deduped/dedup_0115.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0115.jsonl"
@@ -0,0 +1,55 @@
+{"text": "Vascular smooth muscle cells (VSMC) lining the vessel wall respond to growth factors and other stimuli released by injured cells. However, the extracellular matrix (ECM) may differentially modulate VSMC responses to these growth factors, such as proliferation, migration and adhesion. Our previous reports of low-level expression of one ECM molecule, laminin-5, in normal and injured vessels suggest that laminin-5, in addition to growth factors, may mediate VSMC response following vascular injury. To elucidate VSMC response on laminin-5 we investigated-the role of platelet-derived growth factor (PDGF-BB) in activating the mitogen-activated protein kinase (MAPK) signaling cascade as a possible link between growth-factor initiated phenotypic changes in vitro assays we assessed rat vascular smooth muscle cell (rVSMC) responses plated on laminin-5 to the addition of exogenous, soluble PDGF-BB. Our results indicate that although laminin-5 induces haptotactic migration of rVSMC, the addition of PDGF-BB significantly increases rVSMC migration on laminin-5, which is inhibited in a dose-dependent manner by the MAPK inhibitor, PD98059, and transforming growth factor (TGF-\u03b21). In addition, PDGF-BB greatly reduces rVSMC adhesion to laminin-5, an effect that is reversible by MAPK inhibition or the addition of TGF-\u03b21. In addition, this reduction in adhesion is less significant on another ECM substrate, fibronectin and is reversible using TGF-\u03b21 but not MAPK inhibition. PDGF-BB also strongly increased rVSMC proliferation on laminin-5, but had no effect on rVSMC plated on fibronectin. Finally, plating rVSMC on laminin-5 did not induce an increase in MAPK activation, while plating on fibronectin or the addition of soluble PDGF-BB did.Using a system of These results suggest that rVSMC binding to laminin-5 activates integrin-dependent intracellular signaling cascades that are different from those of fibronectin or PDGF-BB, causing rVSMC to respond more acutely to the inhibition of MAPK. In contrast, our results suggest that fibronectin and PDGF-BB may activate parallel, reinforcing intracellular signaling cascades that converge in the activation of MAPK and are therefore less sensitive to MAPK inhibition. These results suggest a partial mechanism to explain the regulation of rVSMC behaviors, including migration, adhesion, and proliferation that may be responsible for the progression of restenosis. Angioplasty is a procedure designed to treat vascular stenosis, blockage(s), or atherosclerotic lesions, but it may also, simultaneously, cause damage to the integrity of the blood vessel wall. Restenosis is the subsequent narrowing and occlusion of the blood vessel in response to the injury or damage sustained during angioplastic procedures such as balloon dilation . During The characteristic response of VSMC, endothelial cells, platelets, and macrophages at the site of injury is the release of specific soluble growth factors which include platelet-derived growth factor (PDGF), transforming growth factor (TGF), basic fibroblast growth factor (bFGF), and epidermal growth factor (EGF) -4. VSMC To date, the precise molecular mechanisms that link growth factor-initiated intracellular signaling to ECM-mediated adhesion, migration, and proliferation of VSMC are still unknown. Our previous reports of low-level laminin-5 expression in the intima of normal vasculature and an increased expression of laminin-5 in the neointima of injured vessels suggest that laminin-5, in addition to PDGF and TGF, may mediate VSMC responsiveness following vascular injury -13.in vitro assays to study the role of laminin-5 in modulating these behaviors in rat vascular smooth muscle cells (rVSMC). We report here that PDGF induces differential responses in rVSMC behaviors on laminin-5, but not on fibronectin. In addition, we find that the PDGF-induced responses on laminin-5 are inhibited in a dose-dependent manner by an inhibitor of the mitogen-activated protein kinase (MAPK) pathway, PD98059, but not on fibronectin.To further elucidate VSMC response to growth factors and the intracellular signaling cascades that may be linked to ECM-mediated adhesion, we used in vitro may be the result of different signaling pathways that are initiated by integrin-mediated adhesion to laminin-5. We suggest that rVSMC binding to laminin-5 may initially activate a MAPK-independent signaling cascade that may make these cells more responsive to MAPK inhibition. In contrast, rVSMC binding to fibronectin may activate a signaling pathway shared by PDGF that ultimately converges in MAPK activation. These results suggest that a complex interaction of ECM and growth factors may closely regulate VSMC behavior following vascular injury and these studies may directly identify define molecular targets that may reduce the incidence of restenosis following angioplasty.These differences in MAPK-sensitive rVSMC responses We have previously reported that laminin-5 expression by rat vascular smooth muscle cells (rVSMC) is upregulated by platelet-derived growth factor (PDGF-BB) and that laminin-5 specifically enhances PDGF-BB-stimulated rVSMC migration . In addiThe level of rVSMC migration was observed over 18 hours in transwell migration filters in the presence or absence of laminin-5, with and without PDGF-BB or serum. Maximal cell migration (chemotaxis) was obtained using cell migration media containing ten (10) percent fetal calf serum (FCS). Similar to our previous reports, laminin-5-coated wells induced a greater than four-fold increase in rVSMC migration over that measured in naked plastic controls in three independent experiments as shown in Figure The mitogen-activated protein kinase (MAPK) pathway is known to be activated by PDGF-BB-stimulation in VSMC . To explTo determine if this modulation is restricted to MEK/MAPK-inhibition, we tested the effects of adding exogenous transforming growth factor TGF-\u03b21) for its ability to modulate the PDGF-stimulated increase in rVSMC migration on laminin-5. Our results indicated that the addition of TGF-\u03b21 was able to reduce laminin-5-stimulated rVSMC migration to levels approximating the levels observed in naked plastic controls over all tested ranges (5 \u2013 50 ng/mL), although the most statistically distinct reduction was found over the range of 5 \u2013 25 ng/mL, as shown in Figure  for its in vitro adhesion assays were performed. In the absence of exogenous growth factor stimulation, laminin-5- and fibronectin-coated wells (20 \u03bcg/mL) sustained an approximate two and a half-fold increase in rVSMC adhesion compared with negative controls, as shown in Figure To determine whether or not the PDGF-BB-stimulated increase in rVSMC migration correlates with a reduction in rVSMC adhesion to laminin-5, thirty-minute ed wells 0 \u03bcg/mL sTo investigate if the relationship between the PDGF-BB-stimulated increase in migration and corresponding decrease in adhesion of rVSMC on laminin-5 may be related to MAPK activation, cells were pre-treated with PD98059 (40 ng/mL) for twenty (20) minutes prior to assay and the adhesion media was supplemented with PD98059 (40 ng/mL). The addition of exogenous PD98059 (40 ng/mL) restored the PDGF-BB-stimulated reduction (25 ng/mL PDGF-BB) in rVSMC adhesion to laminin-5, to approximately eighty-five (85) percent of laminin-5 controls . The addition of PD98059, however, did not restore the thirty (30) percent PDGF-BB-stimulated reduction in rVSMC adhesion on fibronectin.To determine if this modulation is restricted to MEK/MAPK-inhibition, we tested the effects of adding exogenous transforming growth factor (TGF-\u03b21). Our results indicated that the addition of TGF-\u03b21 (25 ng/mL) was able to restore the PDGF-BB-stimulated reduction in rVSMC adhesion on laminin-5 by roughly the same level as PD98059, eighty two (82) percent versus eighty five (85) percent, respectively. In contrast to PD98059, the addition of TGF-\u03b21 (25 ng/mL) was sufficient to restore the PDGF-BB-stimulated reduction in rVSMC adhesion on fibronectin.in vitro proliferation assays to determine the relative effects of the extracellular matrix (ECM) and exogenous growth factors described above. First, to test the effects of the ECM substrate on rVSMC proliferation in the absence of exogenous growth factors, quiescent cells were plated in cell-culture plates either coated with or without laminin-5 or fibronectin, in serum-free Dulbecco's Modified Eagle's Medium (DMEM) for one (1) to six (6) days.Based upon our observations of rVSMC migration and adhesion, we performed 0(G1) between forty eight (48) and seventy two (72) hours as determined by flow cytometry and determination of [3H] thymidine-labeled nuclei [To induce quiescence, rVSMC were incubated for forty eight (48) hours without mitogen  at 37\u00b0C and quiescence was verified by proliferation controls, cultured for forty eight (48) hours at 37\u00b0C with mitogen stimulus as shown in Figure d nuclei .Our results suggest that culture of rVSMC plated on exogenous laminin-5 (coated at a concentration of 20 \u03bcg/mL) did not significantly increase cellular proliferation compared with naked plastic controls over a period of four (4) days, as shown in Figure Next, to test the modulating effects of exogenous growth factors on rVSMC proliferation when cultured on these ECM substrates, quiescent cells were plated in cell-culture plates either naked or coated with laminin-5 or fibronectin, in the presence of TGF-\u03b21 or PDGF-BB, both at a concentration of 25 ng/mL, from one (1) to six (6) days. Our results indicated that the addition of exogenous TGF-\u03b21 (25 ng/mL) to the cell culture medium was sufficient to induce a suppressing effect on rVSMC proliferation on naked plastic, as well as laminin-5 and fibronectin, to levels approximating the quiescent growth controls.The addition of PDGF-BB was sufficient to induce an increase in rVSMC proliferation on laminin-5 of nearly one-half (46%) over laminin-5 DMEM  controls . However, our results indicate that the addition of exogenous PDGF-BB (25 ng/mL) did not have a statistically significant effect on cells plated on fibronectin.To examine MAPK activation, rVSMC were plated onto laminin-5- or fibronectin-coated plates, then lysed after thirty minutes and prepared for immunoblotting. Our results indicated that laminin-5 did not induce a detectable increase in MAPK activation over a thirty (30) minute time interval, as shown in Figure The addition of growth factors, such as PDGF-BB and TGF-\u03b21, have been associated with increases in p44/p42 (ERK1/2) or MAPK activation -18. To din vitro VSMC mitogen and may be responsible for initiating the phenotypic changes in VSMC migration and proliferation during restenosis in vivo [PDGF-BB is an  in vivo ,20. Our  in vivo -13.in vitro [The current study augments the body of evidence that suggests VSMC growth is influenced by an ECM-VSMC interaction  and thatin vitro ,8,10. Moin vitro, driven by PDGF-BB responsiveness, can be blocked by MAPK inhibition (via MEK1 inhibitor: PD98059) on laminin-5, but not on fibronectin.Because PDGF-BB stimulation increases the overall levels of intracellular MAPK, as well as MAPK phosphorylation, we sought to explore this signaling cascade to determine its role in modulating these rVSMC behaviors on laminin-5 . SpecifiAn additional signaling regulator, TGF-\u03b21, has been implicated in the negative regulation and decreased rate of proliferation of VSMC stimulated with serum or PDGF -28. Our 1 phase of mitosis.Several lines of evidence now suggest that the anti-mitogenic effects of TGF-\u03b21 may be dissociated from inhibition of ERK1/2 signaling pathways ,18. ThesAlthough our previous reports linked ERK1/2 to rVSMC adhesion and migration, these studies did not examine the possibility for differential signaling initiated by rVSMC binding to laminin-5 or fibronectin ,13. Expain vitro. Based upon these findings, we postulate that PDGF-BB and laminin-5 binding may initially activate different intracellular signaling cascades, causing rVSMC to be more responsive to the inhibition of MEK1 and MAPK on laminin-5 than those activated on fibronectin, as outlined in Figure Our results indicate that laminin-5 activates different intracellular signaling pathways from those of fibronectin and PDGF-BB in rVSMC and that binding to laminin-5 may modulate rVSMC behaviors that are distinctive from those modulated by fibronectin. Although binding of rVSMC to laminin-5 may not cause an initial increase in MAPK activation levels or proliferation, laminin-5 can augment PDGF-BB-stimulated proliferation and migration of rVSMC In contrast to laminin-5, fibonectin and PDGF-BB may have parallel, reinforcing roles in MAPK activation. Our analysis of the effects of TGF-\u03b21 demonstrated that TGF-\u03b21 does not strongly activate MAPK in rVSMC, but rather strongly inhibits the effects of fibronectin and PDGF-BB-stimulation on laminin-5. Our results support the previous findings that TGF-\u03b21 may inhibit mitogenesis and other VSMC behaviors via mechanisms independent of MAPK activation.These results suggest that a clear understanding of the roles and contributions of each ECM may provide new insights into the mechanisms of regulating rVSMC cell behaviors, including migration, adhesion, and proliferation. Further analysis of the events that trigger and sustain the underlying cellular mechanisms of rVSMC behaviors may help aid in the design of more effective therapies for the treatment of restenosis.2 in humidified chambers. Cells were maintained in DMEM High Glucose, supplemented with 10% fetal bovine serum and 1% L-glutamine (29.2 mg/mL), penicillin G , and streptomycin sulfate  (GPS) from Irvine Scientific . Rat aortic smooth muscle cell explants were a gift from RC Smith and were isolated and passaged as previously described [0(G1) arrest can routinely be induced by incubation of cells for 72 h. in low-mitogen (0.5% FBS) medium [Cells were maintained in 100 mm \u00d7 20 mm Corning tissue-culture dishes  at 37\u00b0C and 5% COlutamine .2 mg/mL,) medium ,30, thes5 in each of 96-transwell chamber filters (100 \u03bcL of 1.2 \u00d7 106 cells/mL solution) with and without ECM in the presence or absence of PDGF-BB at the indicated concentrations (5\u201325 ng/mL) and allowed to migrate for 18 hours at 37\u00b0C. Where applicable, the medium was supplemented with PD98059 (MEK1-inhibitor) at the indicated concentration. Cells were counted at the end of an 18-hour interval as indicated, quantified with the following modification. 30 minutes prior to measuring migration, 5 \u03bcM calcein AM from Molecular Probes  was added to the migration wells at 37\u00b0C. To quantitate migration, cells were removed from the top of the filter with cotton-tipped applicators and fluorescence of the incorporated calcein was measured from the bottom of the filter with a fluorescence plate reader. Relative fluorescence values for each experimental condition are expressed relative to controls and untreated samples.Cell migration assays were performed in Costar transwell filter plates either coated with purified matrix (laminin-5 or fibronectin) at a protein concentration of 20 \u03bcg/mL for one hour (60 min.) at room temperature, 25\u00b0C, and washed twice with phosphate-buffered saline 0.2% Tween-20 and 5% skim milk (PBST) prior to assay as previously described ,32. Cell5 in each of 96-transwell chamber filters (100 \u03bcL of 1.2 \u00d7 106cells/mL solution) with and without ECM-coating (described above) in the presence or absence of PDGF-BB (25 ng/mL), TGF-\u03b21 (25 ng/mL), or both, and allowed to attach for 30 minutes at 37\u00b0C. Where applicable, cells were first incubated for 20 minutes with PD98059 (40 ng/mL), a MEK1 inhibitor from New England Biolabs  at 37\u00b0C and the adhesion assay culture medium was supplemented with PD98059 at 40 ng/mL. Following adhesion, non-adherent cells were removed by suspending plates upside down in a rotating tank of PBS for 10 minutes at room temperature, 25\u00b0C. Adherent cells were then fixed and stained and the relative absorbance was measured using a TECAN-SPECTRAFluor spectrophotometer  at 595 nm.Cell adhesion assays were performed as previously described ,32 using5 in 100 mm2 cell culture plates with and without fibronectin or laminin-5 and allowed to attach overnight (12 h.) at 37\u00b0C. Cells were then starved in serum-free DMEM for 48 hours to induce quiescence at 37\u00b0C, as outlined in Cell Culture Methods below. The medium was then replaced with fresh medium containing 25 ng/mL of TGF-\u03b21 or PDGF-BB obtained from Calbiochem  and incubated at 37\u00b0C. Cells were removed from culture wells with trypsin/EDTA and counted using trypan blue stain from Gibco Life Technologies  and a VWR Scientific Counting Chamber  at 24 hour intervals, from 1 \u2013 6 days.Tissue culture plates were coated with purified fibronectin from Calbiochem  or laminin-5 from Demos  at a 20 \u03bcg/mL protein concentration for 1 hour (60 min.) at room temperature, 25\u00b0C as previously described . Cells wQuiescent VSMC were pre-treated with culture medium containing 10% FCS, PDGF-BB (25 ng/mL), TGF-\u03b21 (25 ng/mL), or plated on laminin-5- or fibronectin-coated tissue culture plates with DMEM for 30 minutes at 37\u00b0C. Subconfluent cell cultures were then lysed using ice-cold, 1X lysis buffer  and boiled in SDS Boiling Buffer prior to analysis as previously described . Proteint distribution. All samples were measured using two-tailed t tests as departure from normality can make more of a difference in a one-tailed than in a two-tailed t test. So long as the sample size is even moderate (>20) for each group, quite severe departures from normality make little practical difference in the conclusions reached from these analyses [The differences between untreated and treated cell populations were measured using a analyses .The author(s) declare that they have no competing interests.KK carried out the migration, adhesion, and proliferation assays, the Western Blot analysis and assisted with experimental design. GEP conceived, monitored, and coordinated the experimental design. Both KK and GEP contributed equally to the writing of this manuscript."}
+{"text": "We report that mon encodes the zebrafish ortholog of mammalian transcriptional intermediary factor 1\u03b3 (TIF1\u03b3) (or TRIM33), a member of the TIF1 family of coactivators and corepressors. During development, hematopoietic progenitor cells in mon mutants fail to express normal levels of hematopoietic transcription factors, including gata1, and undergo apoptosis. Three different mon mutant alleles each encode premature stop codons, and enforced expression of wild-type tif1\u03b3 mRNA rescues embryonic hematopoiesis in homozygous mon mutants. Surprisingly, a high level of zygotic tif1\u03b3 mRNA expression delineates ventral mesoderm during hematopoietic stem cell and progenitor formation prior to gata1 expression. Transplantation studies reveal that tif1\u03b3 functions in a cell-autonomous manner during the differentiation of erythroid precursors. Studies in murine erythroid cell lines demonstrate that Tif1\u03b3 protein is localized within novel nuclear foci, and expression decreases during erythroid cell maturation. Our results establish a major role for this transcriptional intermediary factor in the differentiation of hematopoietic cells in vertebrates.Hematopoiesis is precisely orchestrated by lineage-specific DNA-binding proteins that regulate transcription in concert with coactivators and corepressors. Mutations in the zebrafish  A new gene acting early in red blood cell development is discovered by genetic analysis in zebrafish. The gene encodes a member of a well-known family of transcription factors Hematopoiesis involves the coordinated processes of cell proliferation and differentiation of a relatively small number of progenitor cells into billions of circulating red and white blood cells . Hematopgata1 normally in embryonic hematopoietic precursors (moonshine (mon), and another group named a noncomplementing allele vampire , a member of the TIF1 family of transcriptional coactivators and corepressors  visible in circulation ; however, based on TUNEL staining, the differentiating erythroid cells undergo programmed cell death from the 12-somite stage to 22 h postfertilization (hpf)  of all tested alleles survive to adulthood. Adult mon mutants show cardiac hypertrophy, presumably due to the severe anemia leading to a high output state /WIK strain hybrid parents carrying the tg234mon allele. The mon mutant gene was positioned on Chromosome 8 between microsatellite markers z987 and z11001 (http://www.ensembl.org/Danio_rerio/) containing a predicted zebrafish TIF1 family gene. This PAC was hybridized to a kidney cDNA library, resulting in the isolation of four clones that represented the same gene.We identified the d z11001 A . Therefore, the hypomorphic larval phenotype of the m262mon allele is likely due to partial loss of mon function or expression. The presence of mutations in each of the mon alleles indicates that defective Tif1\u03b3 function is the cause of the mon phenotype.We have identified ethyl-nitrosourea (ENU)-induced point mutations in three alleles of mon C and 3D,tif1\u03b3 is expressed in hematopoietic mesoderm, we next examined zebrafish embryos by whole-mount in situ hybridization   . This grd island . The tifse Tif1\u03b3 A and 4B.tif1\u03b3. Using zebrafish expressed sequence tag (EST) sequences, we designed primers to RT-PCR amplify a TIF1-related cDNA from embryonic 10-hpf and 24-hpf RNA. This cDNA encodes a predicted zebrafish ortholog of human TIF1\u03b1 based on predicted amino acid sequences  of tg234mon mutants show significant  rescue of circulating hemoglobinized RBCs in comparison to control sibling mutants (n = 75). Based on the correction of the jagged fin-fold phenotype (mon did not result in expanded blood cell numbers in wild-type embryos and was not toxic at doses that rescue the phenotype of mon mutants (unpublished data). Since there were no expanded or ectopic blood populations in the embryos, these rescue experiments suggest that mon functions as a permissive factor required for hematopoiesis.To further confirm that a mutation in the zebrafish eriments . Microinhenotype , the mestif1\u03b3 expression in erythroid cells suggest that it functions as a cell-autonomous regulator of gene expression in hematopoietic cells. In order to test this hypothesis, we transplanted wild-type adult zebrafish kidney marrow cells carrying a gata1:green fluorescent protein (GFP) transgene into 48-hpf mon mutant embryos  of these demonstrated a marked increase in erythroid cells with 100\u20131,000 GFP+ cells in circulation 6 d later. By day 10, these transplanted embryos showed approximately 3,000 cells in circulation, similar to the number of blood cells in normal embryos. Despite robust reconstitution of blood cells, mutant recipients did not inflate their swim bladders and thus failed to survive longer than nontransplanted sibling controls, all dying by 3 wk of age. In contrast, 13/35 (37%) heterozygous tg234mon transplants survived to early adulthood. Similar transplants of wild-type cells can fully rescue vlad tepes (gata1) mutants . In two different murine erythroleukemia cell lines (MEL and G1E), Tif1\u03b3 is also expressed in nuclear foci, and even though the overall Tif1\u03b3 protein level is reduced, this nuclear foci localization does not change with differentiation (unpublished data). This provides further support for the hypothesis that Tif1\u03b3 acts within novel nuclear foci, during erythroid differentiation.In order to examine the subcellular distribution of Tif1\u03b3 protein, we generated an affinity-purified rabbit polyclonal antiserum directed against the C-terminal 15 amino acids conserved in human TIF1\u03b3 and mouse Tif1\u03b3. Immunofluorescence of mouse embryo fibroblast nuclei with the anti-Tif1\u03b3 antiserum demonstrates that Tif1\u03b3 is localized in small nuclear foci A. The lomoonshine  mutant embryos . We also tested for a direct interaction between Tif1\u03b3 and Gata1 proteins by coimmunoprecipitation and yeast two-hybrid assays and found no association (unpublished data). Although the mutations in each of these genes arrest cells at a similar stage of development, our results suggest that gata1 and tif1\u03b3 act independently. This does not rule out the possibility that parallel genetic pathways involving gata1 and tif1\u03b3, operating together, regulate gene transcription within blood cells.The hematopoietic phenotype of  embryos . In an etif1\u03b3 is required as a permissive cofactor for the erythroid lineage-specific control of hematopoietic gene expression. We reasonably predict that Tif1\u03b3 protein functions as a transcriptional intermediary factor in hematopoietic progenitor cells given that both TIF1\u03b1  for GFP+ cells over a span of 12 d. On day 13 posttransplant, all surviving larvae  were placed in tanks and monitored for survival.Whole kidney marrow cells were isolated from adult Antisera against the human C-terminal TIF1\u03b3 sequence RRKRLKSDERPVHIK was generated in rabbits  and affinity purified. Mouse embryonic fibroblasts grown on coverslips were immunostained with HP1\u03b1  and Tif1\u03b3 antisera simultaneously. In brief, cells were fixed in 4% paraformaldehyde for 5 min, washed with phosphate-buffered saline, and blocked with 5% serum (PBST) for 30 min. After incubation with the primary antibodies  cells were washed three times with PBST and incubated with secondary antibodies  followed by three washes in PBST. Cells were embedded with Vectashield/DAPI and analyzed using an Axioplan 2 microscope . Digital images were processed using the Volocity 1.0 software . G1E cell differentiation experiments were performed essentially as described .gata1:GFP transgene into 2-d-old embryos reconstitutes erythropoiesis, but not viability, in montg234 homozygous mutants. Movies of live embryos at day 3 posttransplant highlight less than 100 GFP+ RBCs in circulation. Transplanted cells were observed to proliferate, resulting in thousands of donor-derived erythrocytes 7 d later. Movies present GFP-fluorescent images of live zebrafish larvae.Transplantation of wild-type zebrafish marrow cells carrying a Video S1(13.7 MB MOV).Click here for additional data file.Video S2(11.3 MB MOV).Click here for additional data file.Video S3(7.9 MB MOV).Click here for additional data file.Video S4(11.2 MB MOV)Click here for additional data file.http://www.ncbi.nlm.nih.gov/Genbank) accession numbers for the genes and gene products discussed in this paper are fly bonus (AAF19646), human TIF1\u03b1 (015164), human TIF1\u03b2 (Q13263), human TIF\u03b3 (Q9UPN9), human TIF1\u03b3 (Q9UPN9), mon (AY59853), mouse Tif1\u03b1 (Q64127), mouse Tif1\u03b2 (AAH58391), and mouse Tif1\u03b3 (NP444400).The GenBank (mon/tif1\u03b3 and tif1\u03b1 have been deposited in GenBank under the accession numbers AY598453 and AY598454, respectively.The cDNA sequences of zebrafish"}
+{"text": "Placental oxidative stress has been implicated in many complications of human pregnancy, including preterm delivery and preeclampsia. It is now appreciated that reactive oxygen species can induce a spectrum of changes, ranging from homeostatic induction of enzymes to apoptotic cell death. Little is known regarding the occurrence of placental oxidative stress in other species. We investigated markers of oxidative stress in the labyrinthine (LZ) and junctional (JZ) zones of the murine placenta across gestational age, and correlated these with expression of the cyclooxygenase enzymes COX-1 and COX-2, and apoptosis. We tested a causal link between the two by subjecting placental explants to hypoxia-reoxygenation (H/R) in vitro, a known stimulus for generation of oxidative stress. Western blotting demonstrated significant increases in the concentrations of hydroxynonenal (HNE), COX-1 and COX-2 with gestational age. Dual-labelling demonstrated co-localisation of HNE, and COX-1 and COX-2 within the trophoblast of the LZ, and glycogen cells of the JZ. An apoptotic index based on TUNEL-positivity demonstrated an increase with gestational age, and dual-labelling showed co-localisation of TUNEL labelling with HNE and active caspase-3 within the trophoblast of the LZ. H/R significantly increased oxidative stress, induction of COX-1 and COX-2, and the apoptotic index. Co-localisation demonstrated the increases in COX to be within the trophoblast of the LZ, and in particular the glycogen cells of the JZ. Apoptosis was restricted to the LZ. We speculate that the induction of COX enzymes is a physiological response to oxidative stress, and may play a role in initiating or augmenting parturition. Generation of oxidative stress may also play a role in influencing the growth trajectory of the placenta, and its component cell types. The mouse may provide an experimental genetic model in which to investigate these phenomena. The mouse is potentially a powerful model in which to study the mechanisms of placental and obstetrical pathologies, and is the best-studied mammalian experimental genetic model system. The definitive murine placenta is a discoid haemochorial organ as in the human, and there are three anatomically and physiologically distinct regions: the labyrinth zone (LZ), junctional zone (JZ) and decidua basalis (DB) The decidua basalis is composed principally of maternal uterine tissues, and contains maternal arteries and veins that are continuous with the arterial and venous channels traversing the JZ. Glycogen cells migrate into the DB and surround the maternal arteries that supply the placenta late in gestation. The mechanisms of myometrial stimulation and activation appear to parallel those of the human In this study we determined the degree of oxidative stress present in the murine placenta at different gestational ages in normal pregnancies. We also tested whether there was a temporal and spatial association between oxidative stress and two markers of placental function, one physiological and one pathological. These were the induction of cyclooxygenase (COX) enzymes and apoptosis respectively.Evidence from other systems points to potential links between oxidative stress and COX induction, resulting in the production of PGs Apoptosis has been described within the LZ of the normal mouse placenta, and is most frequent towards term and in post-mature placentas 22.1Placentas were collected from C57BL/6J inbred mice, and all experiments were carried out in accordance with the UK Government Home Office licensing procedures. Stages E14, E16, E18, and E19 were studied, where E1 of gestation was the morning when a copulation plug was found.2.2Placentas from three different animals at each gestational age were homogenized in ice-cold sample buffer, and centrifuged at 15,000\u00a0rpm. Protein concentration within the supernatant was determined using a colorimetric assay (Bio-Rad Bradford protein assay). An equal amount of protein from each sample (30\u00a0\u03bcg) was subjected to electrophoresis in a 10% SDS-polyacrylamide gel under reducing conditions and transferred onto nitrocellulose membrane by a semidry transfer machine. Membranes were incubated in a blocking solution (TBS containing 5% powdered non-fat milk and 0.01% Tween-20) at room temperature for 1\u00a0h, and then in the same solution containing primary antibody  at 4\u00a0\u00b0C 2.3At each gestational age three placentas were fixed by immersion in 4% paraformaldehyde overnight, dehydrated and embedded in paraffin wax. Sections (6\u00a0\u03bcm thick) were dewaxed and immunostained according to our standard protocol In order to localise expression of the antigens to specific cell types staining intensity was graded visually from 0\u20133, where 0 represented the negative control. Three people scored the sections independently, blinded to the gestational age or experimental protocol, and the mean value was taken.2.4Dual immunofluorescent labelling was performed in order to test for co-localisation of markers of oxidative stress and COX expression in individual cells. Sections were dewaxed, permeabilised in TBS containing Triton X-100 (0.1%) and Tween 20 (0.1%) (TBS-TT) for 30\u201360\u00a0min, and blocked in 5% bovine serum albumin for 20\u00a0min at room temperature. Primary antibodies diluted in TBS-TT were applied overnight at 4\u00a0\u00b0C. Negative control sections had primary antibodies omitted. After three 10-min washes in TBS-TT, sections were incubated for 1\u00a0h at room temperature with a mixture of fluorescent secondary antibodies, containing anti-goat Alexa 488 and anti-rabbit Alexa 568  in TBS-TT. Sections were washed in TBS-TT as before and then twice in distilled water for 5\u00a0min and subsequently mounted in Vectashield mounting medium containing DAPI . Images were captured using a Leica confocal microscope .Co-localisation was identified in overlay images by a yellow signal caused by the combination of the green signal (COX-1/COX-2) and the red signal (HNE).2.5Staining was performed using In-Situ Cell Death Detection kit-Texas Red (Roche Applied Science) according to the manufacturer's instructions. Conditions were adjusted so that the staining pattern matched morphological assessments of apoptosis based on examination of resin-embedded samples. Once the protocol had been optimised an apoptotic index was calculated as follows:2.6Staining was performed using In-Situ Cell Death Detection kit-Texas Red (Roche Applied Science) according to the manufacturer's instructions, and using an Anti-Active Caspase-3 antibody (Promega) at 1:50, and Anti-HNE as previously at 1:200. Samples were also DAPI stained to intercalate the DNA and fluoresce cell nuclei. For negative controls, omission of primary antibody and TdT enzyme were performed separately. For positive controls, post-lactational mouse mammary glands were used. For confocal microscopy, all samples were analysed during one session to avoid bias, and multiple  fields of view per labyrinth were saved for further analysis.2.73, from each placenta were incubated in culture medium ), which had been maintained for several hours in the specified gas composition at 37\u00a0\u00b0C. Data for intraplacental oxygen concentrations are not yet available for the mouse, and so estimates were made on the basis of results for another small mammal, the guinea-pig. The umbilical venous pO2 towards term is 29.5\u00a0mmHg, which is close to that for fetal primates and ungulates 2, 90% N2, 5% CO2 was used, whereas for hypoxia it was 1% O2, 94% N2, 5% CO2. Gas composition was monitored and controlled throughout using Biospherix  Pro-Ox and Pro-CO2 probes. Control samples were cultured for 4\u00a0h in normoxia, whereas samples subjected to H/R experienced 1\u00a0h of hypoxia followed by 3\u00a0h of normoxia. Following culture the tissues were either frozen or fixed for Western blotting and immunohistochemistry respectively.In order to induce oxidative stress placental samples were subjected to hypoxia-reoxygenation (H/R) in vitro 2.8P-value <0.05.Statistical significance was calculated by using one-way analysis of variance (ANOVA). Differences between groups were assessed using Fisher's Least Significant Difference Test. Statistical significance was assumed at a 33.1P\u00a0=\u00a00.003), with low concentrations of HNE at E14, a significant increase at E16, and a subsequent decline by E18  is a marker of lipid peroxidation. Western blotting revealed significant changes across gestational age  staining indicates the formation of the prooxidant peroxynitrite, and of an imbalance in the production of the superoxide ions and nitric oxide. Immunostaining revealed a similar pattern to HNE, with almost undetectable staining in early samples and significant increases from day 16 onwards (data not shown).Therefore, oxidative stress increases during gestation in the murine placenta, specifically in syncytiotrophoblast and glycogen cells.3.2P\u00a0=\u00a00.013). There was an increase from E14 to E16, followed by a significant decrease by E18  staining in the GCs. At E16 strong reactivity (3) was visible in the GCs, with lower intensity staining (1) being present in the spongiotrophoblast and cytotrophoblast cells (data not shown). By E18 there was a general increase in staining, with many of the cytotrophoblast cells (2) reacting positively, along with\u00a0the syncytiotrophoblast (2), and all GCs (3) a,b. ThisTowards term COX-1 and HNE immunoreactivity were present within the same cells in both the LZ and JZ, as evidenced by the dual-labelling experiments c,d.3.3P\u00a0=\u00a00.002), peaking at E19  within the syncytiotrophoblast, spongiotrophoblast and GCs at E14. With advancing gestational age immunoreactivity increased, principally in the cytotrophoblast cells (2), GCs (2.5) and spongiotrophoblast (1) at E18 and E19 a,b. The Again there was strong co-localisation between immunoreactivity for COX-2 and HNE c.3.4During apoptosis cytokeratins within trophoblast cells are cleaved by active-caspase 3 to yield a specific product detected by the M30 antibody Immunoreactivity for M30 also increased with gestational age, and was most abundant at E18, declining slightly at E19 (data not shown).P\u00a0<\u00a00.001). There was a strong temporal and spatial association between TUNEL staining and immunoreactivity for HNE , a known stimulus for the generation of reactive oxygen species Western blotting confirmed increased concentrations of HNE and COX-1 in the explants following H/R compared to control samples frozen at the start of the experiment (time zero) or cultured under normoxic conditions. For COX-2 a significant increase was only observed compared to the time zero controls a,b.IHC localised the HNE to individual cytotrophoblast cells and to the syncytiotrophoblast layers of the labyrinth. In the JZ individual spongiotrophoblast cells were immunopositive, but the strongest staining was seen in the GCs within the JZ and decidua. Dual-labelling revealed strong co-localisation for COX-1 and COX-2 in the spongiotrophoblast and GCs in the JZ, and within the syncytiotrophoblast and cytotrophoblast cells in the labyrinth c.P\u00a0=\u00a00.006). The majority (78%) of TUNEL positive cells were also immunoreactive for HNE on dual-labelling (IHC revealed increased immunoreactivity for M30 within the trophoblast following H/R. The apoptotic index based on TUNEL labelling increased from 2.8% and 1.6% in the time zero and normoxic controls respectively, to 20.6% following H/R (abelling d. From rFrom these data it can be concluded that there is a significant increase in oxidative stress following H/R, and that this is associated with increased expression of COX-1 and COX-2 expression in the LZ and JZ, and with increased apoptosis in the labyrinth.4These results indicate that oxidative stress increases with gestational age in the murine placenta during normal pregnancies, and that it may play a significant physiological role by inducing higher concentrations of the COX-1 and COX-2 enzymes, and hence increasing prostaglandin synthesis. Our data also indicate a close temporal and spatial association between oxidative stress and trophoblast apoptosis within the labyrinth. Trophoblast apoptosis has been linked to the pathophysiology of preeclampsia, and the mouse might provide a useful genetic model in which to elucidate the mechanisms underlying the shedding of apoptotic debris.We have recently proposed that placental oxidative stress arises through fluctuations in oxygenation Induction of the COX enzymes has been linked to oxidative stress through activation of the p38MAPK and the NF-\u03baB family of transcription factors in other cell types Expression of the COX enzymes appears to be mainly altered in placental rather than decidual tissues. Changes with gestational age were observed in the trophoblast populations within the LZ, but the greatest changes in immunoreactivity were seen within the GCs and the spongiotrophoblast cells in the JZ. Expression of COX-1 and COX-2 has recently been reported in the rat placenta, and that of COX-2 similarly increases with gestational age, particularly in the JZ Trophoblast apoptosis increased late in gestation as assessed by IHC for M30 and TUNEL, and cell morphology. There was a close temporal and spatial co-localisation with oxidative stress, although on Western blotting evidence of oxidative stress appeared to decline in the last days of gestation. This may again reflect changes in the cell populations within the placenta and associated decidua. The apoptotic index based on TUNEL-positivity showed a continual increase until term, although M30 immunoreactivity suggested a decline after E19. There is strong evidence that following initial cleavage, exposing the M30 epitope, cytokeratin 18 becomes further cleaved to smaller fragments The increase in oxidative stress and apoptosis in the LZ with gestational age may explain some of the growth dynamics of the murine placenta. Overall placental volume increases with gestational age until E16.5 and then plateaus, coinciding with the rise in oxidative stress. It is notable that within the LZ the volume and surface area of the trophoblast plateaus at E16.5 whereas those of the fetal capillaries continue to increase until E18.5 The links between oxidative stress and apoptosis suggest that the mouse may provide a useful genetic model in which to investigate the relative roles of antioxidant enzymes and signalling pathways in regulating trophoblast apoptosis. Apoptosis increases towards term in normal human pregnancies"}
+{"text": "Valproate, thalidomide and alcohol (ethanol) exposure during the first trimester of pregnancy is known to cause several developmental disorders. All these teratogens are known to pass the placental barrier and interfere directly with the normal development of the fetus. However, these teratogens also alter the formation and function of the placenta itself which may in turn affect the proper nourishment and development of the fetus. Optimum development of the placenta requires adequate invasion of trophoblast into the maternal uterine tissues. Changes in the migratory behavior of trophoblast by maternal exposure to these teratogens during placentogenesis may therefore alter the structure and function of the placenta.in vitro. Cells were cultured in the wells of 48-well culture plates as mono or multilayers. Circular patches of cells were removed from the center of the wells by suction, and the migration of cells into the wound was studied using microscopy. Effects of low and high concentrations of valproate, thalidomide and alcohol were examined on the healing of wounds and on the migration rate of cells by determining the wound areas at 0, 3, 6, 12, 24 and 48 h. Effects of drugs and alcohol on the proliferation and the expression levels of integrin subunits beta1 and alpha5 in cells were examined.In the present study, the effects of sodium valproate, thalidomide and alcohol on the migration of human first trimester trophoblast cell line (HTR-8/SVneo) were examined The migration rates of trophoblast differed between wounds created in mono and multilayers of cells. Exposure to teratogens altered the migration of trophoblast into mono and multilayer wounds. The effects of valproate, thalidomide and alcohol on the proliferation of cells during the rapid migratory phase were mild. Drug exposure caused significant changes in the expression levels of beta1 and alpha5 integrin subunits.Results suggest that exposure to valproate, thalidomide or alcohol during the first trimester of pregnancy may change the ultrastructure of the placenta by altering the migration of trophoblast cells and this effect may be mediated by drug- or alcohol-induced changes in the expression levels of beta1 and alpha5 integrin subunits. Optimum in life . Accordi in life . Therefoin vitro and in vivo [Drugs cross the placental barrier by ultrafiltration, diffusion, active transport or by special processes, such as pinocytosis, or through breaks in placental wall and access the developing fetus . Valproa in vivo -23 and c in vivo ,16,24-26in vitro. Because dose of toxicant is a critical determinant of developmental toxicity and is likely to be a key factor responsible for interspecies variability in response to many test agents [5\u03b21 integrin receptor-mediated adhesion are known to alter migration of trophoblast [1 and \u03b15 integrin subunits were examined in the trophoblast cell line in culture by Western blotting.To date, no study has been conducted to examine the effects of these teratogens on the migration and proliferation of human placental trophoblast. Therefore in this study, the effects of valproate, thalidomide and alcohol on the migration and proliferation of first trimester trophoblast cell line were examined t agents , both lot agents ,29, migrphoblast , the eff2 flasks  containing 40 ml RPMI 1640 medium supplemented with 10% fetal calf serum , 200 \u03bcg/ml Streptomycin sulfate and 200 U/ml penicillin G sodium (Invitrogen) as described earlier [HTR-8/SVneo cells were obtained from Dr. Charles H. Graham . Cells were maintained in 75 cm earlier ,32. Migr2) not encroached upon by the migrating cells were derived using the drawing tool and algorithms of Metamorph software. Data were exported to Excel software and the change in area with time was represented as a percentage of zero hour data of each well. Migration rates (\u03bcm2/h) in control and treated trophoblast cells between two image acquisition times were determined by dividing the differences in percentage wound areas by the time (h) difference.Stock solutions of Valproate (50 mg/ml) and thalidomide (56 mg/ml) were prepared in sterile water and DMSO respectively as suggested by the supplier . Further dilutions of valproate and thalidomide were conducted in the culture medium. Thalidomide at 100 \u03bcM contained 0.05% DMSO. Preliminary experiments were conducted to ensure that DMSO at this concentration did not alter the migration of cells in mono or multilayers within 48 h of culture (data not shown). Ethyl alcohol  solutions were prepared in the culture medium. High and low concentrations of these teratogens for the study were determined from published articles to ensure that the concentrations used would not increase cellular apoptosis and were suitable for migration assays ,33-35. A2, \u03b13, \u03b14, \u03b15, \u03b16, \u03b21 and \u03b23 integrin subunits were obtained from published articles [Primer3 Input software  was used to determine sense (5'-GTGAGCTGCTTCAACATCCA-3') and antisense (5'-TCTCTCAAAGCCCTCGA CAT-3') primers for the amplification of \u03b1IIb integrin subunit mRNA from published human \u03b1IIb subunit cDNA sequence (Accession number M34480). Amplicon representing \u03b1IIb subunit mRNA from the HTR-8/SVneo cells were purified from the gel using QIAGEN gel extraction kit  and sequenced using a commercially available service . The sequence (genBank Accession number DQ841705) was subjected to BLAST search to confirm the identity.Expression of various integrin subunits in the HTR-8/SVneo cells were examined by RT-PCR method. In brief, total RNA from monolayer of cells cultured for 12 h was isolated using RNeasy Mini kit . The concentration of RNA in solution was determined using a NanoDrop spectrophotometer . Total RNA (1 \u03bcg) was treated with DNase I to remove traces of DNA and subjected to reverse transcription using Superscipt III reverse transcriptase. Complementary DNA (cDNA) equivalent to 50 ng of total RNA was used for PCR reactions. Reagents used for cDNA synthesis and PCR reactions were from Invitrogen Inc. Primer sequences for the amplification of cDNA representing transcripts for \u03b1articles -39. PrimBecause valproate, thalidomide and alcohol alter proliferation of cells in culture, effects of these drugs were examined on the number of HTR cells to determine influence of cell-number on the -migration data. Cells were plated in 96-well plates to examine the effects of valproate, thalidomide and alcohol on cell proliferation using a Cell-Quant kit (Invitrogen) and a VICTOR 1420 Multilabeled fluorescence detector . At 3 h, the first batches of assays were conducted to determine fluorescence intensities in wells plated with an increasing number of cells. This data was plotted to determine the linear range of the assay, and the slope was used to determine the relationship between the number of cells and fluorescence intensities. At 3 h, cells in some plates were treated with pre-equilibrated medium containing different concentrations of valproate, thalidomide, or alcohol. The medium of control wells was replaced with only pre-equilibrated medium. After 12 h, fluorescence intensities from untreated and treated cells were measured to determine the number of cells per well.1 integrin subunit (clone 18) at 1:2,500 dilutions, stripped and reprobed with monoclonal antibody against \u03b15 (clone 1) integrin subunit at 1:5000 dilutions. Both antibodies were obtained from BD Biosciences. Images were analyzed using ImageJ software  to determine the intensities of bands in arbitrary units. Intensity data representing the expression level of each integrin subunit from valproate-, thalidomide- or alcohol-treated cells were subjected to statistical analysis with the untreated samples of the same blot separately.Expression levels of integrin subunits were examined in cells at 3 h and 12 h after drug exposure. Cells were cultured in 6-well plates containing 5 ml of culture medium at 75% confluence. The next day, the medium was removed and replaced with 5 ml of pre-incubated medium supplemented with the drug or alcohol. Control wells were supplemented with medium only. High and low concentrations of each drug were used to determine the effects of concentration on integrin subunit expression. At the time of lysate preparation, incubation medium from control and treated wells was discarded. Attached cells were washed with cold phosphate buffered saline (PBS) and lysed with lysis buffer containing a proteinase inhibitor cocktail . Lysate were centrifuged at 4\u00b0C and the supernatants were stored at -20\u00b0C. Protein concentrations in the supernatant were determined using a BCA protein assay kit (Pierce) on a NanoDrop spectrophotometer. Lysate supernatants were mixed with denaturing lane marker (Pierce) and heated in a boiling water bath for 5 min. Equivalent amounts of denatured proteins (10 \u03bcg) were subjected to 10% SDS-polyacrylamide gel electrophoresis and separated proteins were blotted onto nitrocellulose membranes using equipment and reagents from BioRad Labs. Membranes were blocked with 10% non-fat dry milk solution in PBS containing 0.1% Tween-20 (TTBS) and subjected to incubation with primary antibody  in 5% blocking reagent overnight at 4\u00b0C. Membranes were washed three times with TTBS and exposed for 1 h to peroxidase conjugated secondary antibody . Membranes were washed in TTBS and treated with ECL solutions  for the chemiluminescence detection of bands and for acquiring images in tagged format using a Kodak 440 imaging system. To avoid data fluctuations due to experiment-to-experiment variations in the intensity of bands from control and treated samples, membranes containing untreated and specific drug- or alcohol-treated samples were processed simultaneously for the detection of an integrin subunit. Membranes were first probed with the human reactive monoclonal antibody against \u03b2p < 0.05 were considered significant. Wound areas from 6 individual wells were obtained from 3 independent experiments each consisting of two controls and treated wells (N = 6). Cell numbers were determined from two independent experiments each consisting of 8 wells (N = 16). Band intensities for particular integrin subunit were determined from two independent experiments, each consisting of two replicates (N = 4).Post-hoc test was performed using SPSS software  to compare individual mean \u00b1 standard deviations of mean values obtained by repeated measure ANOVA to determine the significance of difference. Differences between means at 2) created in mono (1237279 \u00b1 376135) and multilayers (934459 + 386014) of cells were not significantly different (p > 0.05). Wounds created in multilayers of cells healed faster than those in monolayer  of cells, commencing as early as the initial 3 h of incubation .Suction wound areas  and \u03b15 (~150 kDa) were detected in control and treated cells at 3 and 12 h of incubation by Western blotting . Treatment of cells with valproate, thalidomide or alcohol changed the expression levels of \u03b21 and \u03b15 subunits, but the patterns of these changes were similar for thalidomide and alcohol treatments only. Exposure to high concentration of valproate for 3 h decreased expression levels of \u03b21 subunit  with only the high concentration of drug.Expression levels of \u03b2t Figure  but incrt Figure . Treatme1 and \u03b15 subunits in a similar manner, though not always significantly. For instance, treatments with low or high concentrations of thalidomide for 3 h increased expression levels of both \u03b21 . Therefore, the patterns of \u03b21 and \u03b15 expression levels in cells were similar following thalidomide and alcohol treatments for 3 and 12 h, but were different than those with valproate treatments. This is obvious from the Western blot data presented in the tabulated format . However, the number of cells treated for 12 h with low concentrations of thalidomide (25 \u03bcM) or low (25 mM) or high (100 mM) concentrations of alcohol increased significantly (p < 0.05) from the untreated cells cultured simultaneously for 12 h.Differences in the number of untreated cells between 3 to 12 h of culture were not statistically significant  for study. This obviates measurement errors during imaging at different times of culture that is common with conventional scratch assays and occur because of differences in the width of the wound along the length of the scratch.This study reports a novel way of studying cell migration 1 and \u03b15 integrin subunits.The results suggest that valproate, thalidomide and alcohol may influence migration of human first trimester trophoblast. Therefore, exposure to these teratogens during the first trimester of pregnancy may interfere with the normal development of placenta. This may cause suboptimal nourishment of developing embryos resulting in developmental defects. Results demonstrate that the changes in the migration rate of human first trimester trophoblast after drug and alcohol treatments may result from the alteration in the expression levels of \u03b2in vivo [in vivo, where they invade in multiple layers [Data presented here reveal for the first time that the migration rates of cells in monolayer, and as reported in several studies using scratch assays, differ from those of cells in multilayers, a situation that is relatively more realistic to what is seen in vivo ,29. Althin vivo -48. There layers ,29, may In vitro tests show that valproate may increase or decrease the migration of different glioma cell lines [All three teratogens tested in this study are reported to alter the migration of different cell types, albeit differently. ll lines ,50 and nll lines . Thalidoll lines  and cellll lines ,53. Valpll lines , and migll lines . There all lines ,54-58. T6, \u03b15 and \u03b21 mRNA, and the roles of \u03b16\u03b21, \u03b16\u03b24, \u03b11\u03b21, \u03b12\u03b21, \u03b15\u03b21, \u03b1v\u03b21 and \u03b1v\u03b23 integrin receptors regulating the migration of trophoblast were reported earlier [3A, \u03b14, and \u03b1IIb integrin subunit mRNA and splicing of \u03b16 integrin transcripts in a first trimester human trophoblast cell line. Detection of \u03b1IIb mRNA in first trimester trophoblast cell line and a recent report describing the role of \u03b1IIb\u03b23 integrin receptor in trophoblast migration in mice [6A and \u03b16B mRNA splice variants in the human trophoblast cell line hint for additional regulatory controls of trophoblast invasion mediated by \u03b16\u03b21 or \u03b16\u03b24 receptors [Expression of integrin subunit \u03b1 earlier ,59-61. D in mice  implies eceptors .1 and \u03b15 integrin subunits. Therefore treatments with these drugs or alcohol may alter the migration of trophoblasts by changing the availability of subunits for the formation of active \u03b15\u03b21 integrin receptors on the cell surface. Western blot data presented in the tabulated format . Results from this study suggest that these placental pathologies may partly be due to alterations in the migration rate of trophoblasts by drugs or alcohol exposure, possibly mediated by changes in the expression levels of \u03b1ALC: Alcohol, VPA: Sodium Valproate, THA: Thalidomide.UK Rout planned the project, conducted experiments, analyzed data and wrote the manuscript."}
+{"text": "Ovarian cancer is characterized by a wide-spread intra-abdominal metastases which represents a major clinical hurdle in the prognosis and management of the disease. A significant proportion of ovarian cancer cells in peritoneal ascites exist as multicellular aggregates or spheroids. We hypothesize that these cellular aggregates or spheroids are invasive with the capacity to survive and implant on the peritoneal surface. This study was designed to elucidate early inherent mechanism(s) of spheroid survival, growth and disaggregation required for peritoneal metastasesIn this study, we determined the growth pattern and adhesive capacity of ovarian cancer cell lines (HEY and OVHS1) grown as spheroids, using the well established liquid overlay technique, and compared them to a normal ovarian cell line (IOSE29) and cancer cells grown as a monolayer. The proteolytic capacity of these spheroids was compared with cells grown as a monolayer using a gelatin zymography assay to analyze secreted MMP-2/9 in conditioned serum-free medium. The disaggregation of cancer cell line spheroids was determined on extracellular matrices (ECM) such as laminin (LM), fibronectin (FN) and collagen (CI) and the expression of \u03b12, \u03b13, \u03b1v, \u03b16 and \u03b21 interin was determined by flow cytometric analysis. Neutralizing antibodies against \u03b12, \u03b21 subunits and \u03b12\u03b21 integrin was used to inhibit disaggregation as well as activation of MMPs in spheroids.We demonstrate that ovarian cancer cell lines grown as spheroids can sustain growth for 10 days while the normal ovarian cell line failed to grow beyond 2 days. Compared to cells grown as a monolayer, cancer cells grown as spheroids demonstrated no change in adhesion for up to 4 days, while IOSE29 cells had a 2\u20134-fold loss of adhesion within 2 days. Cancer cell spheroids disaggregated on extracellular matrices (ECM) and demonstrated enhanced expression of secreted pro-MMP2 as well as activated MMP2/MMP9 with no such activation of MMP's observed in monolayer cells. Flow cytometric analysis demonstrated enhanced expression of \u03b12 and diminution of \u03b16 integrin subunits in spheroids versus monolayer cells. No change in the expression of \u03b13, \u03b1v and \u03b21 subunits was evident. Conversely, except for \u03b1v integrin, a 1.5\u20137.5-fold decrease in \u03b12, \u03b13, \u03b16 and \u03b21 integrin subunit expression was observed in IOSE29 cells within 2 days. Neutralizing antibodies against \u03b12, \u03b21 subunits and \u03b12\u03b21 integrin inhibited disaggregation as well as activation of MMPs in spheroids.Our results suggest that enhanced expression of \u03b12\u03b21 integrin may influence spheroid disaggregation and proteolysis responsible for the peritoneal dissemination of ovarian carcinoma. This may indicate a new therapeutic target for the suppression of the peritoneal metastasis associated with advanced ovarian carcinomas. Cancer cells are very responsive to their microenvironment and have been shown to acquire resistance in response to physical and chemical stress associated with the changed microenvironment . The vasin vivo three-dimensional growth conditions  followed by 3 washes in incubation buffer  then incubated for 48 h at 37\u00b0C in incubation buffer before being stained with coomassie blue (G-250) for visualization of activation. After destain , areas void of blue stain indicated areas of enzyme activity. Molecular markers were used to identify pro-MMP2/9 and MMP2/9.Gelatin zymography was performed as described previously . Briefly\u00a9  and sealed with nail polish. Fluorescence was imaged using a Leica TCS SP2 AOBS laser confocal microcope  and associated software.Cryostat sections were fixed in 4% paraformaldehyde, permeablized in 0.1% Triton X-100, and blocked in 1% BSA. Sections were probed with primary antibody (dilution 1/100 to 1/500) for 2 h followed by 1 h with Alexa Fluor 488 labeled secondary. Sections were counter stained with ethidium bromide  and coverslips were mounted using Fluorgaurd6 cells were incubated with primary antibody for 1 h at 4\u00b0C and excess unbound antibody was removed by washing twice with PBS. Cells were stained with secondary antibody conjugated with phycoerythrin for 20 min at 4\u00b0C, washed twice with PBS and then re-suspended in 0.5 ml phosphate buffered saline (PBS) prior to FACScan analysis. In each assay background staining was detected using an antibody-specific IgG isotype. All data were analysed using Cell Quest software . Results are expressed as mean intensity of fluorescence (MIF).Flow cytometric method was used as described previously . BrieflyStudent's t-test was used for statistical analyses of proliferation, adhesion, migration and invasion assays. Statistical significance was indicated by p < 0.05. Data are presented as mean \u00b1 SEM. Each experiment was repeated three times with a minimum of three replicates.Ovarian cancer cell lines HEY and OVHS1 and immortalized ovarian surface epithelial (IOSE) cell line IOSE29 were analysed for formation of spheroids and subsequent proliferation when maintained in a suspension culture. Figure Cellular growth of OVHS1, HEY and IOSE29 cell lines was analysed using an MTT assay. In both cancer and normal ovarian cell lines the growth of spheroids was significantly reduced when compared to growth in traditional monolayer culture Figure . On compThe specific ability of cells within the spheroids to contribute to growth was subsequently confirmed using immunohistochemical staining of Ki67 on OVHS1 and HEY spheroid sections. Nuclear staining of Ki67, a standard histological marker for proliferation, identified a population of proliferating cells in spheroids of both OVHS1 and HEY cell lines Figure . These dThe ability of spheroid cultures to metabolize and proliferate in culture was correlated by western blot analysis of key mediators for cell cycle progression and pro/anti-apoptotic proteins in spheroids collected at 0 (monolayer control) and 6 h and 1, 2 and 4 days. The D-cyclins are integral in early G1 to S phase transition in the cell cycle . The actIn order for spheroids to contribute to cancer metastasis, they must be able to adhere to the extracellular matrix (ECM) of the peritoneal cavity. Compared to monolayer cells, the adhesion of day 2 IOSE29 spheroids decreased by approximately 50% or more (p < 0.05), while adhesion of OVHS1 and HEY remained unchanged with no significant differences on any of the ECM components Figure . Similarin vitro disaggregation assay on various ECM components. Similarly, a comparison of proteolytic activity of spheroids versus monolayer cells was examined by testing the expression and activation of MMP2/9 using gelatin zymography.Peritoneal dissemination of ovarian cancer spheroids occurs when cells within the free-floating spheroids attach to the mesothelial lining of the peritoneum and disaggregate, spreading to the secondary site. This process also involves invasion, which requires proteolysis of ECM proteins underlying the mesothelial layer. To understand if cells within the spheroids exhibit such metastatic properties, spheroids were analyzed by OVHS1 and HEY spheroids began to transform from a three-dimensional structure into flattened cell clusters within 8 h. Figure Serum-free medium (SFM) was collected from monolayer cells and cells grown as spheroids from day 1 to 7. In monolayer cultures, only the expression of pro-MMP2/9 was observed whereas in spheroids the expression of active MMP2 and MMP9 was induced and pro-MMP9 expression was replaced with active MMP9 Figure . The ideCell migration and invasion is facilitated by the cell-surface expression of specific integrins. Expression of \u03b12, \u03b13, \u03b16, \u03b1v, and \u03b21 integrin subunits was determined in spheroids over 4 days of culture and compared to that of monolayers. The expression of \u03b13, \u03b1v and \u03b21 integrin subunits remained unchanged, however, a significant increase was observed in the expression of \u03b12 integrin within 24 h of spheroid culture and there was a decrease in the expression of \u03b16 integrin subunit expression over the 4 days of culture  was significantly reduced by \u03b12, \u03b21 and \u03b12\u03b21 blocking antibodies (p < 0.05) with the greatest inhibition seen in the presence of anti-\u03b12\u03b21 integrin Figure . Under tIn the normal ovarian tissues (n = 10) the expression of \u03b12 and \u03b16 integrin subunits was confined to the basal layer of epithelial cells and displayed continuous labeling Figures  and 9B. Immunohistochemical staining of ascites smears (n = 4) from high-grade ovarian cancer patients demonstrated strong staining for \u03b12 integrin subunits in clusters of malignant cells. Some \u03b16 subunit staining was present in malignant cellular aggregates but it was weaker than \u03b12 subunit staining. Weak staining of \u03b12 and \u03b16 subunits in some single cells  was also present. These results suggest that \u03b12 and \u03b16 integrin is expressed by aggregates of malignant cells present in ascites.in vitro spheroid model which mimics in vivo multicellular spheroids in the peritoneal effusions of women with ovarian cancer. The ability of spheroids to contribute to the spread of cancer has been assessed by growth, adherence and disaggregation capabilities and by investigating the profile of integrins and MMP2/MMP9 that may mediate the dissemination process. In some instances comparisons have been made to a normal ovarian cell line grown under similar conditions.Some recent studies have demonstrated that a significant proportion of ovarian cancer cells in ascites exist as multicellular aggregates and have the capacity to adhere and invade the mesothelial cells lining the peritoneum ,10. FreeCancer cell line spheroids resembled those present in the ascites of cancer patients. Spheroids formed from ovarian cancer cell lines increased in size with time, and formed compact regular spheroid structures. As a product of anchorage-independent culture, multicellular spheroids had decreased proliferative abilities compared to the cells cultured as monolayers. Hence, the monolayer cultures approached confluence within seven days and decreased proliferation, while the slower growing spheroids continued to grow for at least 10 days. This response was supported by staining for the proliferation marker Ki67, which demonstrated the presence of proliferating cells throughout both HEY and OVHS1 spheroids. In addition, cancer cell line spheroids sustained activation of Akt, expression of cyclin D2 and did not display any activation of caspase-3. On the other hand, the normal ovarian cell line (IOSE29) failed to proliferate under similar conditions and its growth response was consistent with reduced size and disintegration of spheroids with time. This disparity in the response of normal versus cancer cell lines in response to anchorage-independent surroundings reflects major differences in the cohesive response required for cell-cell contact in order to maintain survival. Expression of Akt is amplified in many cancers, including ovarian cancer . Akt kinWe and others have shown that ovarian cancer cell lines have the ability to adhere to ECM proteins such as FN, LM, CI, etc . Some stThe peritoneum, omentum and the bowel surfaces are the frequent sites for implantation of metastatic ovarian cancer cells. The outer lining of these metastatic sites is comprised of a single layer of mesothelial cells, which express a variety of ECM proteins, including LM, FN, CI and hylauronan to which tumor cells can adhere before spreading ,41. Signin vitro.In order for the spheroids to disseminate to a secondary site they not only need to adhere, disaggregate and migrate but they also need to invade the mesothelial cell layer to form a stable secondary growth . MMPs plThe biological mechanism(s) by which spheroids are formed and sustained is not known. Both HEY and OVHS1 cell lines express a variety of integrin receptors. We report an enhanced expression of \u03b12 and a decrease in \u03b16 integrin when comparing spheroidal cells to cells grown as a monolayer, changes which were observable within 24 hours. While the increased expression of \u03b12 was sustained in spheroids for 4 days, \u03b16 expression gradually decreased over the same period of time (data not shown). On the other hand, no change in \u03b13, \u03b1v and \u03b21 subunits were observed. In IOSE29 spheroids however, except \u03b1v, there was a decrease in the expression of integrin subunits ranging from 1.5\u20137.5-fold. These results were supported by immunofluorescence studies performed on cancer spheroids that displayed distinct high \u03b12 subunit expression at the periphery of the spheroid and at the outer membraneous layer forming the cell-cell interface of aggregated cells. Very little or no \u03b16 subunit staining was evident in the cell-cell contact regions within the spheroids suggesting very low expression. Based on these observations one can conclude that cellular aggregation and the environmental factors within the spheroids can regulate the expression and localization of a specific sub-set of integrins. Differences in the \u03b12 and \u03b16 integrin expression between monolayer cells and spheroids however, had no effect on their adhesion capabilities on LM or CI suggesting that \u03b12 subunit up regulation may compromise diminution of expression of \u03b16 integrin subtype and hence adhesion on LM. It is reasonable to speculate that in a spheroid scenario it is more cell-cell rather than cell-ECM interaction that will influence integrin expression profile.To assess if increased \u03b12 expression had any effect on spheroid function, spheroids were treated with blocking antibodies for \u03b12 and \u03b21 subunits and \u03b12\u03b21 integrin and then tested for disaggregation on CI-coated plates. Disaggregation was reduced for all three antibodies, with an apparent accumulative inhibition occurring when \u03b12\u03b21 integrin function was blocked in comparison to individual \u03b12 and \u03b21 subunit function. Parallel to that, blocking \u03b12 and \u03b21 subunits and \u03b12\u03b21 integrin also inhibited activation of MMP2, with no observable change in the expression of pro-MMP's. Although the specific participation of individual integrins in spheroid phenotype is not understood, our results suggest that \u03b12\u03b21 integrin may have a role in the disaggregation and invasion of ovarian carcinoma spheroids.Selective regulation of integrin receptors in spheroids of squamous cell carcinoma has been reported previously . In thatStrong expression of \u03b12 and \u03b16 integrin was observed at the basal layer of surface epithelial cells of normal ovaries. In ovarian tumors there was a loss of regular basement membrane structure resulting in irregular staining of \u03b12 and \u03b16 subunits. Intense staining of \u03b12 integrin was observed in ascites spheroids while staining of \u03b16 subunit occurred to a lesser degree. As \u03b12\u03b21 and \u03b16\u03b21 are the major collagen and laminin receptors on basement membranes, one can speculate that a tumor-induced irregular pattern of matrix-modelling can result in the irregular distribution of these subunits in cancer. In ovarian carcinoma, the expression of \u03b16 subunit has been shown to correlate with the expression of basement membrane protein laminin . The samin vitro model for the dissemination of ovarian carcinoma. Using this model we were able to show that \u03b12\u03b21 integrin is up regulated in the spheroids and that functional blockade using monoclonal antibodies reduced the extent of disaggregation and proteolysis of spheroids. These data suggest that molecules that regulate \u03b12\u03b21 integrin functions may have a potential role in inhibiting the invasiveness of peritoneal tumor aggregates or spheroids and may aid in suppressing the dissemination of ovarian carcinoma.The spread of ovarian carcinoma is unique as it involves localized invasion and is rarely dependent on dissemination through lymphatics. In this context, the role of shed tumor cells forming spheroids, implantation onto the mesothelial lining of the peritoneum with consequent disaggregation and dissemination is not well understood. As little is known about the ascites tumor cell aggregates or spheroids and the fact that these cells are often dismissed as non-metastatic and undergoing apoptosis is somewhat disturbing. Better outcomes for ovarian cancer patients can only be projected if a targeted approach can be accomplished to disrupt the invasive processes of spheroids requisite for peritoneal spread. Hence, a more comprehensive understanding of ascites spheroid biology is needed to combat the dissemination of ovarian carcinoma. In this study, we aimed to address this issue by characterizing an"}
+{"text": "Mycophenolate mofetil (MMF), the prodrug of mycophenolic acid (MPA), is a rationally designed immunosuppressive drug. The current study investigates the effect of MMF on key pattern of restenosis in a cascade of in vitro and ex vivo models.Part I of the study investigated in northern blot and cytoflow studies the effect of MMF  on TNF-\u03b1 induced expression of intercellular adhesion molecule 1 (ICAM-1) in human coronary endothelial cells (HCAEC) and human coronary medial smooth muscle cells (HCMSMC). Part II of the study applied a human coronary 3D model of leukocyte attack, the 3DLA-model. HCAEC and HCMSMC were cultured on both sides of a polycarbonate filters, mimicking the internal elastic membrane. Leukocyte attack (LA) was carried out by adding human monocytes (MC) on the endothelial side. The effect of MMF (50 \u03bcg/mL) on adhesion and chemotaxis  and the effect on proliferation of co-cultured HCMSMC (24 h after LA) was studied. In part III of the study a porcine coronary organ culture model of restenosis (POC-model) was used. After ex vivo ballooning MMF (50 \u03bcg/mL) was added to the cultures for a period of 1, 2, 3, 4, 5, 6, and 7 days. The effect on reactive cell proliferation and neointimal thickening was studied at day 7 and day 28 after ballooning.Expression of ICAM-1 in northern blot and cytoflow studies was neither clearly inhibited nor stimulated after administration of MMF in the clinical relevant concentration of 50 \u03bcg/mL. In the 3DLA-model 50 \u03bcg/mL of MMF caused a significant antiproliferative effect (p < 0.001) in co-cultured HCMSMC but had no effect on MC-adhesion and MC-chemotaxis. In the ex vivo POC-model neighter reactive cell proliferation at day 7 nor neointimal hyperplasia at day 28 were significantly inhibited by MMF (50 \u03bcg/mL).Thus, the data demonstrate a significant antiproliferative effect of clinical relevant levels of MMF (50 \u03bcg/mL) in the 3DLA-model. The antiproliferative effect was a direct antiproliferative effect that was not triggered via reduced expression of ICAM-1 or via an inhibition of MC-adhesion and chemotaxis. Probably due to technical limitations (as e.g. the missing of perfusion) the antiproliferative effect of MMF (50 \u03bcg/mL) could not be reproduced in the coronary organ culture model. A cascade of focused in vitro and ex vivo models may help to gather informations on drug effects before large experimental studies are initiated. Stent coating with immunosuppressive or cytostatic agents are valid advances in the struggle against restenosis following coronary intervention. However these therapies are hampered by high costs, especially in the case of multivessel disease. Moreover it is not entirely clear whether restenosis is merely delayed and not inhibited Restenosis is essentially characterized by migration and proliferation of smooth muscle cells and extracellular matrix accumulation. However, there is now increasing evidence for a role of inflammation in the development of restenosis. The underlying molecular mechanisms of restenosis are, in fact, most probably regulated by inflammatory mediators, such as cytokines Mycophenolate mofetil (MMF), the prodrug of mycophenolic acid (MPA), is a rationally designed immunosuppressive drug. The active metabolite MPA is a selective, non-competitive and reversible inhibitor of inosine monophosphate dehydrogenase (IMPDH) and of the type II isoform in particular . The priIn the past data of animal studies could not be transferred easily to the clinical situation due to species differences. In the current study a cascade of human in vitro models in combination with a porcine coronary ex vivo model is applied to investigate the effects of MMF on key pattern of restenosis. Unexpected or conflicting data can be analysed before large experimental studies are initiated. Furthermore attention is focused on the relation between significant inhibitory effects in vitro (SI) and maximal plasma levels in vivo (MPL), the SI/MPL-ratio .Central part of the current study is a 3D human coronary transfilter co-culture model of leukocyte attack . In thisHuman coronary endothelial cells (HCAEC) and human coronary smooth muscle cells (HCMSMC) were purchased at Cambrex Bio Science . HCAEC were cultured in Endothelium Growth Medium (Cambrex) and identified by the typical \"cobble stone\" growth pattern and positive reaction against von Willebrand factor (Dakopatts). HCMSMC were grown in Smooth Muscle Cell Growth Medium (Cambrex). For identification of HCMSMC antibodies against smooth muscle \u03b1-actin  were used. Human MC were isolated from the residual leukocytes of single donors using MACS cell-isolation kit (Milteny Biotec GmbH).\u00ae, Roche, Basel, CH, 0.005 \u2013 500 \u03bcg/mL, dilution: aqua ad inject., MPL: 34 \u03bcg/mL .Fresh hearts of 12 pigs, ranging in age from 3 to 5 months, weighing 100 to 120 kg, were obtained from a local slaughterhouse. In the laboratory, the left anterior descending coronary artery (LAD) was carefully prepared. Section were made at 4 mm intervals perpendicular to the vessel wall axis .For ex vivo angioplasty the prepared LAD segments were placed over a 3 mm balloon catheter  and were treated with 9 bar for a period of 60 s. After ex vivo ballooning MMF (50 \u03bcg/mL) was added to the cultures for a period of 1, 2, 3, 4, 5, 6, and 7 days. At each medium exchange the drug was renewed.After ballooning the segments were transferred to six-well plates  and cultured in a mixture of Waymouth's MB 752/1 and Ham F12 nutrient mixture  supplemented with 15% fetal calf serum (Cambrex) at 37\u00b0C in 5% carbon dioxide. Organ cultures were cultured for 7 and 28 days, culture medium was exchanged every second or third day. Culture conditions for control groups were exactly the same as described for the angioplasty/MMF group.The effect of MMF (50 \u03bcg/mL) on reactive cell proliferation and neointimal thickening was studied at day 7 and day 28 after ballooning, controls were performed with and without ballooning [for detailed information: ].P < 0.05.Data of northern blot and flow cytometry studies were presented as mean \u00b1 S.D. Statistical significance of differences between controls and drug-treated cells was determined by paired Student's t-test. The Mann-Whitney rank-sum test was used to investigate the significance of differences in the 3DLA-model and the organ culture model. Statistical significance was accepted for In monocultures of HCAECs cells were identified by a positive reaction with antibodies directed against von Willebrand factor and by the typical \"cobblestone\" growth pattern in culture. Monocultures of HCMSMC exhibited the \"hill and valley\" growth pattern and reacted positively with antibodies against smooth muscle \u03b1-actin.After TNF-\u03b1 stimulus, band density of mRNA ICAM-1 in HCAEC was increased 30-fold, which corresponds to a relative band density of 100% . Incubation with MMF in the concentration of 50 \u03bcg/mL caused a slight inhibitory effect on band density of mRNA ICAM-1 by 12.02% (n.s.). After incubation of HCMSMC with MMF in concentrations of 100, 150, 200, 250, and 300 \u03bcg/mL relative band density of ICAM-1 was increased by 59.9% (n.s.), 70.61% (n.s.), 68.7% (n.s.), 67.8% (n.s.), and 69.4% (n.s.).Both in HCAEC and HCMSMC, expression of GAPDH after adding of MMF in concentrations of 50, 100, 150, 200, and 250 \u03bcg/ml was identical with untreated controls.The effects of MMF  on the TNF-\u03b1 induced expression of ICAM-1 are demonstrated in Figure In HCAEC, treatment with TNF-\u03b1 increased the mean fluorescence levels (%) of ICAM-1 expression 10.5-fold from 9.48% to 100.00%. Incubation of HCAEC with MMF caused a dose dependent inhibition of ICAM-1 expression. After incubation with MMF in concentrations of 50, 100, and 150 \u03bcg/mL expression of ICAM-1 was significantly decreased by 18.57%, 26.46%, and 37.92% . Incubation with 200, 250, and 300 \u03bcg/mL caused an decrease by 83.77%, 92.41%, and 93.17% .In HCMSMC a very weak inhibition of ICAM-1 expression was detected without statistical significance. After incubation of HCMSMC with MMF in concentrations of 50, 100, 150, and 200 \u03bcg/mL no inhibitory effect on ICAM-1 expression was detected. MMF in concentrations of 250 and 300 \u03bcg/mL caused a 9.03% (n.s.) and 16.68% (n.s.) inhibition of ICAM-1 expression.In HCAEC no toxic effects were detected after adding of MMF in concentrations of 50 \u03bcg/ml, 100 \u03bcg/ml, and 150 \u03bcg/ml, little toxic effects were found after adding of MMF in concentrations of 200 \u03bcg/ml, 250 \u03bcg/ml, and 300 \u03bcg/ml. In HCMSMC no toxic effects were detected after adding of MMF in concentration of 50 \u03bcg/ml \u2013 300 \u03bcg/ml.In 3DLA units the effect of MMF in a concentration of 50 \u03bcg/mL on monocyte adhesion, chemotaxis, and proliferation of HCMSMC was studied. 3DLA-units were successfully established  by more than 90% Fig.  and 4B. The effects of ex vivo ballooning in the porcine organ culture model have been recently characterized by our group (9). Maximal reactive cell proliferation was detected at day 7, maximal reactive neointimal hyperplasia was found at day 28. In the current study the effect of a 1, 2, 3, 4, 5, 6, and 7 days incubation with MMF (50 \u03bcg/mL) on reactive cell proliferation Fig.  and 28 dAt day 7 neointimal cell proliferation was slightly increased (n.s.) in comparison to untreated controls. Adding of MMF for 1, 3, and 5 days did not exhibit an effect on cell proliferation. A stimulatory effect was found after adding of MMF for a period of 2 and 6 days, an inhibitory effect was seen after adding of MMF for a period of 4 and 7 days. 28 days after ballooning cell proliferation in the POC-model was very low, both in untreated controls and after treatment with MMF. Almost no cell proliferation was detected in the media.At day 7 after ex vivo ballooning neointimal hyperplasia was very low in comparison to controls. No neointimal hyperplasia was detected after adding of MMF for 1, 2, 4, and 6 days, an inhibitory effect on neointimal hyperplasia was seen after adding of MMF for a period of 3, 5, and 7 days. 28 days after ex vivo ballooning neointimal hyperplasia was increased by 809% (n.s.). Adding of MMF for a period of 1, 2, 3, 4, and 7 days caused an increase of neointimal thickening by 108.9%, 144%, 51.8%, 104.9%, and 4.5%. Adding of MMF for a period of 5 and 6 days decreased neointimal hyperplasia by 9.2% and 7.7%. Due to high standard deviations statistical significance was not achieved.The present study employes a cascade of in vitro and ex vivo models to investigate the effect of MMF on key processes of coronary restenosis. Three basic conclusions of the study were determined. First, therapeutical concentrations of MMF exhibit a significant antiproliferative effect in HCMSMC. Second, this antiproliferative effect was not triggered via inhibition of adhesion and chemotaxis of MC or reduced expression of ICAM-1 on mRNA or protein levels. Third, a significant antiproliferative effect of MMF could not be reproduced in the porcine coronary ex vivo model.MPA, a product of Penicillium fungus, was originally isolated in 1896, and shown to have anti-neoplastic, anti-viral, anti-fungal and immunosuppressive activity. MMF is the semi-synthetic morpholinoethyl ester of MPA. After oral administration and absorbtion of MMF, the ester linkage is rapidly hydrolyzed by esterases to yield MPA, the active immunosuppressive agent. The bioavailability of oral MPA from MMF is 96% and the maximum of plasma concentration occurs about 2 h after administration The group of Fraser-Smith  demonstrIn accordance with these reports the current study demonstrates a significant inhibition of HCMSMC-proliferation after incubation with 50 \u03bcg/mL of MMF in the 3DLA-model. The SI/MPL-ratio  of 1.47 It has been reported that MMF inhibited the induced expression of adhesion molecules on endothelial cells measured by marked antibodies and scanning fluorimetry . On the With the hypothesis of a direct antiproliferative effect MMF (50 \u03bcg/mL) was studied in the coronary porcine organ culture system of restenosis, the POC-model . In the The current data demonstrate a significant antiproliferative effect of MMF in concentrations close to the systemic plasma level (SI/MPL-ratio: 1.47). The effect was not triggered via inhibitory effects on expression of ICAM-1 or via inhibitory effects on MC-adhesion and MC-chemotaxis. Eighter the effect was a direct antiproliferative effect or it was triggered via pathways not investigated in the present study. Probably due to technical limitations (as e.g. the missing of perfusion) the antiproliferative effect of MMF (50 \u03bcg/mL) could not be reproduced in the coronary organ culture model. A cascade of focused in vitro and ex vivo models may help to gather informations on drug effects before large experimental studies are initiated.The author(s) declare that they have no competing interests.RV, RB, and VH designed the study, RV wrote the manuscript. VK carried out the cytoflow studies, northern blot studies were done by RB and IGB. CMW carried out the studies with the 3DLA-model, coronary organ culture studies were done by SV.The pre-publication history for this paper can be accessed here:"}
+{"text": "IL)-1\u03b2, IL-6, IL-10, iNOS (inducible nitric oxide synthase), MCP-1 (monocyte chemoattractant protein-1), MIP-2 (macrophage inflammatory protein-2), TGF-\u03b21 (transforming growth factor-\u03b21), and TNF-\u03b1 (tumor necrosis factor-\u03b1)] in BAL cells and four genes  in lung tissue. In BAL cells on day 1, high-dose exposure induced a significant up-regulation of IL-1\u03b2, iNOS, MCP-1, and MIP-2 but no change in IL-6, IL-10, TGF-\u03b21, and TNF-\u03b1 mRNA levels. There was no change in the mRNA levels of IL-6, RANTES, ICAM-1, and GM-CSF in lung tissue. Nitric oxide production and levels of MCP-1 and MIP-2 were increased in the 24-hr culture media of alveolar macrophages (AMs) obtained on day 1. IL-6, MCP-1, and MIP-2 levels were also elevated in the BAL fluid. BAL fluid also showed increases in albumin and lactate dehydrogenase. The cellular content in BAL fluid increased at all doses and at all time periods, mainly due to an increase in polymorphonuclear leukocytes. In vitro studies in AMs and cultured lung fibroblasts showed that lung fibroblasts are a significant source of IL-6 and MCP-1 in the lung.Diesel exhaust particles (DEPs) at three concentrations  were instilled into rats intratracheally. We studied gene expression at 1, 7, and 30 days postexposure in cells obtained by bronchoalveolar lavage (BAL) and in lung tissue. Using real-time reverse transcriptase-polymerase chain reaction (RT-PCR), we measured the mRNA levels of eight genes [interleukin ( Diesel exhaust particles (DEPs) are generated by heavy-duty diesel engines used in several industries and motor vehicles used in public transportation. They are ultrafine respirable particles with an average diameter of < 2.5 \u03bcm and contain several mutagenic and carcinogenic hydrocarbons . The advin vitro or in vivo also affects lipopolysaccharide-induced production of cytokines [tumor necrosis factor-\u03b1 (TNF-\u03b1) and interleukin-1 (IL-1)] in alveolar macrophages (AMs) (Exposure to DEPs has been shown to cause adverse reactions in the lungs  and othees (AMs) , 1999. Ses (AMs) .in vitro to DEPs. The genes involved include those for cytokines, such as IL-1\u03b2  methods makes it possible to study the expression of several genes implicated in the inflammatory response under identical conditions to evaluate the time course of expression of these genes. Therefore, we studied the expression of the mRNA levels of several of these cytokines and correlated these observations with the inflammatory response as assessed by measuring the influx of cells and protein into the bronchoalveolar space. Further, cytokine levels were measured in bronchoalveolar lavage (BAL) fluid. The results show that DEPs up-regulate several genes implicated in the inflammatory response, at both the message and protein levels, within 24 hr in cells obtained by BAL, representing both polymorphonuclear neutrophils (PMNs) and AMs. To elucidate the role of interactions between different cell populations in the production of inflammatory mediators in the lung, we also performed Helicobacter, and ciliary-associated respiratory bacillus. Rats were acclimated for at least 5 days before use and were housed in ventilated cages provided with HEPA-filtered air; Alpha-Dri virgin cellulose chips  and hardwood Beta chips  were used as bedding. The rats were maintained on 2018S Teklad Global 18% Rodent Diet  and tap water, both of which were provided ad libitum.The animals used in these experiments were specific pathogen-free Sprague-Dawley rats , weighing about 175 g. The animals were housed in an environmentally controlled facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care. The rats were monitored to be free of endogenous viral pathogens, parasites, mycoplasmas, DEPs with an average mass median diameter of 0.5 \u03bcm were obtained from standardized heavy-duty diesel engine emission . We obtained cytokine kits (rat) for MCP-1 and MIP-2 from Biosource . The culture medium for BAL cells consisted of Eagle\u2019s minimum essential medium , 1 mM glutamine , 10 mM HEPES , 100 U/mL penicillin-streptomycin (GIBCO), 100 \u03bcg/mL kanamycin (GIBCO), and 10% (vol/vol) heat-inactivated fetal bovine serum (BioWhittaker).n = 4 per group) representing each treatment were sacrificed on study days 1, 7, and 30 to obtain BAL cells and lung tissue. We used an additional set of four control and four experimental animals to obtain more data for the 50 mg dose on day 1.Animals were intratracheally instilled with either saline or 5, 35, or 50 mg DEP suspension/kg body weight , respectively. Groups of animals  and sonicated for 1 min. Rats were given 5, 35, or 50 mg DEP suspension/kg body weight or an equivalent volume of PBS.Rats were anesthetized with an intraperitoneal injection of sodium methohexital  and were intratracheally instilled using a 20-gauge 4-in. ball-tipped animal feeding needle. DEPs were suspended in endotoxin-free, Ca2HPO4, and 1.9 mM NaH2PO4, pH 7.4). The cells were separated from the lavage fluid by centrifugation at 300 \u00d7 g for 5 min and then washed three times by alternate centrifugation and resuspension in phosphate-buffered medium. The numbers of AMs and PMNs were determined according to their unique cell diameters, using an electronic cell counter equipped with a cell-sizing unit . The cells were then resuspended in the culture medium for use in all experiments.The animals were anesthetized with pentobarbital sodium (50 mg/kg body weight) and exsanguinated by cutting the abdominal aorta. Alveolar cell populations were obtained by BAL according to the method of 2, 5.5 mM glucose, and 10 mM HEPES, pH 7.4) containing collagenase (0.1%), elastase (40 U/mL), bovine serum albumin (0.5%), and DNAse (0.018%) in a shaker water bath for 30 min at 37\u00b0C. The digested mixture was filtered through two layers of sterile gauze that had been washed with culture medium. The cells were sedimented by centrifugation and plated in six-well culture plates. The medium was changed 24 hr later, and the cells were allowed to grow to confluence.We isolated lung fibroblasts as described by To measure mRNA expression in separated cell populations and to study the interaction of soluble mediators released by cell populations, we conducted experiments in Transwell chambers . For these experiments, cultured lung fibroblasts were trypsinized, and 1 million cells were plated in the outer well of a Transwell plate and cultured for 24 hr. At the end of the 24-hr period, freshly isolated AMs (1 million cells) were placed in the inserts. DEPs (200 \u03bcg/mL) were added either to the macrophages in the inner wells or to the fibroblasts in the outer well and incubated for 4 hr. Total RNA was isolated from each population separately.g, and the supernatant was stored at \u221280\u00b0C until measurements were performed. Lactate dehydrogenase (LDH) and albumin were measured within 24 hr on refrigerated samples with a COBAS MIRA Plus analyzer  using kits from Roche Diagnostics and Sigma-Aldrich , respectively.For measurement of cytokines in the BAL fluid, the first lavage was collected, spun down to sediment cells at 300 \u00d7 We measured the cytokines in BAL fluid and in culture supernatants of AMs after 24 hr of culture. IL-6, MCP-1, and MIP-2 were measured by enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer\u2019s instructions . NO in the supernatants was measured as the stable oxidation product of NO, nitrite. We then measured nitrite production using the Greiss reaction . The amoCT (threshold cycle) method was used to calculate the relative concentrations  and deriving the fold increase compared with control, unstimulated cells. The primer sets for RANTES were as follows: forward, ACT CCC TGC TGC TTT GCC TAC C; reverse, TTG GCG GTT CCT TCG AGT GAC . The primer sets for other genes have been published previously . Total RNA was isolated from AMs (\u2248 2 million cells) or lung tissue after BAL (\u2248 50 mg wet tissue) using RNAqueous-4PCR kits . DNAse I-treated RNA (1\u20132 \u03bcg) was reverse transcribed using SuperScript II . The complementary DNA generated was diluted 1:100, and 15 \u03bcL was used to conduct the PCR reaction according to the SYBR Green PCR kit instructions. The comparative trations . Brieflyeviously .t-test assuming unequal variance, or a Z-test for means, or a nonparametric Wilcoxon/Kruskal-Wallis test. The significance was set at p < 0.05.To evaluate the data we used a We measured the inflammatory response in the lung after DEP exposure by determining the classical inflammatory markers albumin, LDH, and cell numbers in the BAL fluid. Albumin showed significant increases on days 1 and 30 after exposure at all three DEP doses . LDH levTo identify the mediators that may be involved in promoting the inflammatory response, we measured mRNA levels of eight genes in BAL cells immediately after isolation. On day 1, diesel particles at the highest dose (50 mg/kg body weight) induced significant up-regulation of IL-1\u03b2, iNOS, MCP-1, and MIP-2 in BAL cells . By day We isolated total RNA from the lung tissue after lung lavage and measured the mRNA levels of IL-6 , GM-CSF,We used the first BAL sample (\u2248 5 mL) to monitor chemokine protein and NO levels and performed ELISA on a small aliquot of the sample. IL-6 and MCP-1 levels were significantly elevated on day 1 at medium and high dose levels, but returned to basal levels by day 7 and remained at basal levels on day 30 . MIP-2 lAMs were cultured for 24 hr, and inflammatory mediator levels were measured in the culture supernatants. Both MIP-2 and MCP-1 protein levels were increased at all three doses of DEPs on days 1 and 30 after exposure . Data weFibroblasts and AMs were co-cultured in Transwell chambers. We observed no change in the mRNA levels of IL-1\u03b2 under any of the conditions tested . SimilarAMs provide the first line of lung defense by eliminating most foreign material from distal airways . They plin vivo DEP exposure. Four genes  were up-regulated within 24 hr after DEP exposure. Consistent with the observations at the message levels, the protein levels of MCP-1 and MIP-2 went up in BAL fluid within this time period. AM production of NO was increased 24 hr after DEP exposure. However, NO levels in BAL fluid were not elevated. NO has been proposed to play a wide variety of roles in macrophage function . The mRNA expression in BAL cells was very different among the genes studied after function . Up-reguThe expression of mRNA did not always correlate with the cytokine protein levels. Although MCP-1 mRNA levels stayed high throughout the experimental period, the BAL fluid cytokine levels were significantly elevated only on day 1. In the case of IL-6 the situation was reversed; there was a dose-dependent increase in cytokine levels in the BAL fluid on day 1 without a significant change in the mRNA levels. MIP-2 cytokine levels were elevated in the BAL fluid throughout the experimental period and at all dose levels, but message levels were up only on days 1 and 30 and only at high dose levels. These discrepancies may be related to the stabilities of the mRNA species and the proteins of the cytokines concerned and needs further investigation. In fact, posttranscriptional regulation is common among many inflammatory mediators .in vivo, in vitro exposure of AMs to DEPs did not increase MCP-1 mRNA levels. Further, the in vitro studies reveal that lung fibroblasts are an important source of IL-6 and MCP-1. The increase in MCP-1 levels seen in the BAL fluid did not lead to an increase in the number of AMs observed in the BAL fluid at that time point. In contrast, the potent chemotactic factor for neutrophils, MIP-2  in lung tissue after lavage and found no change in the mRNA levels of these genes under any of the exposure conditions. Similarly, there was no increase in mRNA levels of TNF-\u03b1 in BAL cells. Our observations concerning TNF-\u03b1mRNA level expression are consistent with observations that there is no increase in TNF-\u03b1 at the protein level in AMs after in vivo , which showed results similar to those seen with the Transwell experiments. These observations support the concept that complex interactions between various cells and mediators within the lung microenvironment are involved in regulating the final inflammatory response. Our findings provide some clues to the mediators that are important in producing the changes associated with particle exposure that may help in designing informed intervention strategies.Results of the present studies, together with our previous observations concerning cytokine production after silica particle exposure , indicat"}
+{"text": "Furthermore, the effects of bFGF and PDGF-BB regulated expression of integrins \u03b1v\u03b23 and \u03b1v\u03b25 on RPE cells was examined.Proliferative vitreoretinopathy (PVR) is a leading cause of blindness after failed retinal reattachment surgery. PVR is characterized by the proliferation, migration and contraction of retinal pigmented epithelial cells (RPE), and these cellular responses are influenced by the expression and function of integrin receptors. The effect of a cyclic integrin antagonist containing the amino acid sequence Arg-Gly-Asp-D-Phe-Val (RGDfV), specific for the integrin receptors \u03b13-thymidine uptake. The effect of the cyclic integrin antagonist on RPE cell attachment onto different extracellular matrices , RPE cell invasion stimulated by PDGF-BB or serum, and migration stimulated by PDGF-BB, vascular endothelial growth factor (VEGF) or serum was explored. PDGF-BB and bFGF modulation of the integrin receptors \u03b1v\u03b23 and \u03b1v\u03b25 was evaluated by flow cytometry.The effect of a cyclic integrin antagonist and a control peptide (0.01 \u03bcg/ml to 300 \u03bcg/ml) was investigated on serum or cytokine (bFGF or PDGF-BB pretreatment) induced human fetal RPE cell proliferation by Hv\u03b23  and \u03b1v\u03b25 .The integrin antagonist did not inhibit DNA synthesis stimulated by serum, bFGF, or PDGF-BB treatment. RPE attachment onto fibronectin was inhibited in a concentration range of 1\u201310 \u03bcg/ml (p < 0.05). Attachment of the RPE cells onto collagen IV and laminin was inhibited in a range of 3\u201310 \u03bcg/ml (p < 0.05). Serum and PDGF-BB stimulated migration was inhibited by the cyclic integrin antagonist in a concentration range of 1\u201310 \u03bcg/ml (p < 0.05). Furthermore, the cyclic integrin antagonist inhibited PDGF-BB stimulated RPE cell invasion through fibronectin . In each of these experiments, the control peptides had no significant effects. PDGF-BB and bFGF pretreatment of RPE cells increased the expression of integrin receptors \u03b1v\u03b23 and \u03b1v\u03b25 through a cyclic integrin antagonist is able to inhibit RPE cell attachment, migration and invasion. Since these steps are of importance for the progression of PVR, a cyclic integrin antagonist should be further evaluated for the treatment of this disease.A selective inhibition of the integrin receptors \u03b1 Integrins are a family of heterodimeric, non-covalently bound cell surface receptors, which mediate cell-cell and cell to extracellular matrix (ECM) adhesion. They are transmembrane glycoproteins consisting of a larger \u03b1 and a smaller \u03b2 subunit. In mammals, 18 \u03b1- and 8 \u03b2 integrin genes encode polypeptides that combine to form 24 \u03b1\u03b2 heterodimeric receptors  solution (20 \u03bcl/well)  was added for 5 hours of incubation. Then the supernatants were decanted, 150 \u03bcl of 100% DMSO added, and the cells were placed on a shaker for 10 minutes. Absorbance of the cells was measured at 550 nm with a Dynatech MR 600 spectrophotometric microplate reader.Ninety-six well plates were coated with the ECM molecules laminin, fibronectin or collagen IV (25 \u03bcg/ml). RPE cells were pre-incubated with the cyclic integrin antagonist (concentrations as above) or control peptide (10 \u03bcg/ml) over night. Then 15 \u00d7 102). After PBS washing and methanol fixation (10 minutes at 4\u00b0C), counterstaining with hematoxylin was performed. Cells in the upper chamber were wiped away. RPE cells that invaded the lower surface of the membrane were quantified by cell counting (320 \u00d7 magnification).RPE cell invasion was examined in a modified Boyden chambers. The insert membrane was coated overnight with fibronectin (25 \u03bcg/ml). Subconfluent RPE cells were pretreated overnight with the cyclic integrin antagonist (3 \u03bcg/ml) or the control peptide (3 \u03bcg/ml). An RPE cell suspension  in DMEM with 0.4 % FBS and 3 \u03bcg/ml cyclic integrin antagonist or control peptide was added into the upper part of the chamber. 600 \u03bcl DMEM with 0.4% FBS and PDGF-BB (10 \u03bcg/ml) was added into the lower part of the chamber. Invasion was measured with and without PDGF-BB stimulation after 5 hours at 37\u00b0C . Data with a p-value of less then 0.05 were considered to be statistically significant.The RPE cells were stimulated to incorporate thymidine by either 10% serum or by 10 ng/ml bFGF or 10 ng/ml PDGF-BB (p < 0.01). Neither the integrin antagonist, nor control peptide showed any significant effect on serum, PDGF-BB or bFGF stimulated DNA synthesis. (data not shown). In addition, cell counting showed no effects of the integrin antagonist or the control peptide on serum or cytokine stimulated proliferation. Furthermore, a lack of toxicity for the integrin antagonist and the control peptide in the concentration range tested  was determined by use of the trypan blue exclusion assay (data not shown).v\u03b23 and \u03b1v\u03b25  and strongly enhanced the expression of \u03b1v\u03b25 (2.9 fold). PDGF-BB (10 ng/ml) strongly enhanced \u03b1v\u03b23 (2.3 fold), and less strongly upregulated surface expression of \u03b1v\u03b25 (1.5 fold).Pre-stimulation of RPE cells for 5 days with the cytokines PDGF-BB and bFGF 10 ng/ml) increased the expression of the integrin receptors \u03b10 ng/ml i50 of 18.5 \u03bcg/ml cyclic integrin antagonist was calculated for the RPE cell attachment onto fibronectin. The attachment onto collagen IV was inhibited 25 % with 3 \u03bcg/ml (p < 0.001), and 29 % with 10 \u03bcg/ml (p < 0.001). Lower concentrations showed no significant effect. An ID50 of 17.2 \u03bcg/ml cyclic peptide was calculated for RPE cell attachment onto collagen IV. Attachment onto laminin was inhibited by the cyclic integrin antagonist in the range of 3\u201310 \u03bcg/ml ; 10\u03bcg/ml: 23 % inhibition (p < 0.001). An ID50 of 21.7 \u03bcg/ml was calculated for the inhibition of RPE cell attachment onto laminin.RPE cell attachment onto fibronectin was inhibited significantly in the range of 1 to 10 \u03bcg/ml of cyclic integrin antagonist (p < 0.05) Fig. . A conce50 of 18.5 \u03bcg/ml integrin antagonist was calculated for the serum induced migration. The migratory response induced by PDGF-BB (10 ng/ml) (93 % stimulation of migration) was diminished by the cyclic integrin antagonist. ; 3 \u03bcg/ml, 66 % inhibition (p < 0.001); and 10\u03bcg/ml, 74 % inhibition (p < 0.001)). An ID50 of 5.8 \u03bcg/ml was calculated for the inhibition of PDGF-BB induced migration of RPE cells. VEGF induced a migratory response of RPE cells by 39 %. This migratory response was inhibited by the cyclic integrin antagonist in a concentration range of 3\u201310 \u03bcg/ml (p < 0.01).The ECM component fibronectin (30 ng/ml) induced chemotaxis when placed as a soluble agent in the lower part of the Boyden chamber Fig. . This mi50 of 2.3 \u03bcg/ml was calculated for the effects of the cyclic integrin antagonist on PDGF-BB induced RPE invasion through fibronectin.PDGF-BB strongly stimulated RPE cell invasion ) through fibronectin coated onto the lower surface of a membrane insert in a modified Boyden chamber. This invasion was inhibited by the cyclic integrin antagonist ). The control peptide had no significant effect on invasion Fig. . An ID50v\u03b23 and \u03b1v\u03b25 by a specific cyclic integrin antagonist is feasible for inhibiting RPE cell attachment, migration and invasion and may serve as an adjunctive therapy for disorders such as PVR. Integrins have been shown to influence cell signaling pathways that promote cell proliferation in concert with cytokines [v\u03b23 and \u03b1v\u03b25 had no effect on serum, PDGF-BB or bFGF induced proliferation of RPE. Since we also show that bFGF and PDGF-BB upregulate both \u03b1v\u03b23 and \u03b1v\u03b25, and that proliferation is not inhibited in these stimulated cells, we can infer that the lack of effect of the cyclic peptide on proliferation is not due to lack of integrin expression. Consistent with the lack of effect on proliferation, we found that the cyclic integrin inhibitor did not induce significant cell death. This suggests that in the conditions studied here, the effect of integrin inhibition by the cyclic peptide on survival and proliferation of RPE cells may differ from previously described effects on endothelial cells [These data provide support for the suggestion that inhibition of the integrin receptors \u03b1ytokines . Interesal cells , specifial cells  and mammal cells .v\u03b23 or \u03b1v\u03b25 [v\u03b23 receptor with high specificity and affinity, supporting cell adhesion to this matrix protein. The \u03b1v\u03b25 receptor binds in a similar way to fibronectin [v\u03b23 and \u03b1v\u03b25 thus provides a reasonable explanation for the decreased attachment of RPE onto collagen IV, fibronectin and laminin in the presence of the inhibitory cyclic peptide.Cell attachment of RPE cells onto fibronectin, laminin and collagen IV was inhibited by the cyclic integrin antagonist. Because substrate attachment and interaction is important for activated RPE function , it is r or \u03b1v\u03b25 . Blockag or \u03b1v\u03b25 . The ECMronectin . The blo1 inhibits RPE cell migration from wound edges in organ culture [v\u03b23 receptor appears to be involved in pathways that regulate intracellular pH and intracellular Ca2+ [RPE cell migration is another important process in the development of PVR. Without migration, RPE cells would not gain access to the vitreous and form vitreoretinal membranes. For RPE cells, it was shown previously that monoclonal antibody inhibition of integrin subunit \u03b2  culture . Integri culture . The \u03b1v\u03b2lar Ca2+  and may lar Ca2+ . The samlar Ca2+ -38.The cyclic integrin antagonist had a particularly strong effect on RPE invasion into fibronectin. This may be due to the concurrent effects of the peptide on the inhibition of adhesion, migration and proteolytic activity since each of these steps may play a critical role in the invasion of the ECM.v\u03b23 and \u03b1v\u03b25. In contrast, highly selective integrin antagonists such as LM609 block only \u03b1v\u03b23. Therefore, a stronger inhibitory effect of the cyclic integrin antagonist can be expected as has been shown in tumors [The cyclic integrin antagonist described here blocks both \u03b1n tumors . While iThe cyclic integrin antagonist RGDfV inhibits RPE migration, attachment and invasion, and should be further investigated as a potential adjuvant pharmacological treatment for PVR.The author(s) declare that they have no competing interestsAll authors have been involved in the experimental design, data collection and manuscript preparation. The final manuscript has been read and approved by all authors.The pre-publication history for this paper can be accessed here:"}
+{"text": "Sirolimus  has been used successfully to inhibit restenosis both in drug eluting stents (DES) and after systemic application. The current study reports on the effects of SRL in various human in vitro/ex vivo models and evaluates the theoretical clinical relevance of the data by SI/MPL- and SI/DES-ratio's.significant inhibitory effects in vitro/ex vivo and the maximal plasma level after systemic administration in vivo (6.4 ng/ml for SRL). Definition of the SI/DES-ratio: relation between significant inhibitory effects in vitro/ex vivo and the drug concentration in DES (7.5 mg/ml in the ISAR drug-eluting stent platform). Part I of the study investigated in cytoflow studies the effect of SRL (0.01\u20131000 ng/ml) on TNF-\u03b1 induced expression of intercellular adhesion molecule 1 (ICAM-1) in human coronary endothelial cells (HCAEC) and human coronary smooth muscle cells (HCMSMC). Part II of the study analysed the effect of SRL (0.01\u20131000 ng/ml) on cell migration of HCMSMC. In part III, IV, and V of the study ex vivo angioplasty (9 bar) was carried out in a human organ culture model (HOC-model). SRL (50 ng/ml) was added for a period of 21 days, after 21 and 56 days cell proliferation, apoptosis, and neointimal hyperplasia was studied.Definition of the SI/MPL-ratio: relation between Expression of ICAM-1 was significantly inhibited both in HCAEC (SRL \u2265 0.01 ng/ml) and HCMSMC (SRL \u2265 10 ng/ml). SRL in concentrations \u2265 0.1 ng/ml significantly inhibited migration of HCMSMC. Cell proliferation and neointimal hyperplasia was inhibited at day 21 and day 56, significance (p < 0.01) was achieved for the inhibitory effect on cell proliferation in the media at day 21. The number of apoptotic cells was always below 1%.-6 and 10-8 indicate that the described inhibitory effects of SRL have been detected with micro to nano parts of the SRL concentration in the ISAR drug-eluting stent platform. Drug concentrations in DES will be a central issue in the future.SI/MPL-ratio's \u2264 1  characterize inhibitory effects of SRL that can be theoretically expected both after systemic and local high dose administration, a SI/MPL-ratio of 7.81 (cell proliferation) represents an effect that was achieved with drug concentrations 7.81-times the MPL. SI/DES-ratio's between 10 Sirolimus  was initially developed as an antibiotic, then as an immunosuppressant, and recently has been identified as one of the most promising novel agents for prevention of human coronary restenosis, both as the compound in drug eluting stents (DES) or after systemic administration. Antimigratory and antiproliferative properties of SRL were first described almost a decade ago by Poon et al.  and DellHuman ex vivo organ culture models have the advantage that the complexity of the restenosis process can be studied in coherent human arterial tissue -10. In tThere is now clear evidence for a contributory role of inflammatory processes to restenosis following vascular injury and stent implantation. Inflammatory cytokines such as tumor necrosis factor-\u03b1 (TNF-\u03b1) upregulate the intercellular adhesion molecule-1 (ICAM-1). Our group has demonstrated in a three-dimensional transfilter co-culture model of leukocyte attack  that stiFailed systemic restenosis trials in the 80ies and 90ies of the past century have caused an estimated loss of 2.5 billion \u20ac to the pharmaceutical industry ,14, indiRecently a strong dose depending antiproliferative effect of SRL in human coronary vascular cells has been reported by our group . The antThe current study investigates the effect of SRL on key events of restenosis in a cascade of human in vitro and ex vivo models. A theoretical clinical relevance of the data will be characterized by SI/MPL- ,14 and, Endothelial cells from human umbilical veins (HUVEC) were isolated after vaginal delivery by enzymatic disaggregation with collagenase/dispase as described previously . Endothe\u00ae, Sigma, Deisenhofen, D, 0.01 \u2013 1000 ng/ml, dilution: methanol; MPL: 6.4 ng/ml [Sirolimus (SRL): Rapamycin4 cells). SRL  was added to the cultures for a period of 18 h. During the last 6 h of SRL incubation, the expression of adhesion molecules was stimulated by adding of TNF-\u03b1 (20 ng/mL).For flow cytometry analysis of the expression of ICAM-1 in HCAEC, HUVEC, and HCMSMC cells were trypsinized and seeded into 6-well dishes (5 \u00d7 104 cells (100% gated) were analyzed immediately with a flowcytometer .After SRL/TNF-\u03b1 treatment, cells were washed twice with phosphate-buffered saline (pH 7.2) and trypsinized. Cells were resuspended in 100 \u03bcL of a FITC-conjugated monoclonal antibody directed against ICAM-1  and incubated for 20 min at 4\u00b0C. A total of 1 \u00d7 10The effects of SRL (0.01 ng/mL \u2013 1000 ng/mL) on vitality of HCAEC, HUVEC, and HCMSMC was analyzed with propidium iodide using a flowcytometer.4 cells/filter was produced. 300 \u03bcl of this suspension was added in serumfree medium to the upper side of the filter, 500 \u03bcl supplemented with 10% fcs were added to the inferior side of the filter. The Boyden Chamber was cultured for a period of 24 h, thereafter cells on the upper side of the filters were removed. Filters were stained, dried, and incubated with extraction buffer for 15 min. Finally the optical density was measured at 560 nm.For cell migration studies a Boyden Chamber  was used. HCMSMC were cultured for 48 h in SmBM-culture medium with 1% fetal calf serum (fcs), thereafter a cell supension with 4 \u00d7 10During routine-nephrectomies parts of renal arteries of 15 patients  were extracted, 15 arteries were suitable for organ culture preparations. In the laboratory, renal artery segments were carefully prepared and sections were made at 3 mm intervals perpendicular to the vessel wall axis .Ex vivo angioplasty was carried out as described . After eCultivation and fixation of organ cultures was carried out as described earlier . CultureThe effect of SRL (50 ng/mL) on reactive cell proliferation, apoptosis, and neointimal thickening  was studProliferation of cells was analyzed with the Proliferating Cell Nuclear Antigen (PCNA). For immunohistological staining paraffin sections were processed using a avidin-biotin immunoperoxidase technique. PCNA-antibodies  in a concentration of 1 \u03bcg/ml were used as primary antibodies. The number of proliferating cells was calculated as: PCNA positive cells/total cell number \u00d7 100.Apoptotic cells were detected with the TUNEL-technique  according the manufactures's instructions. The number of apoptotic cells was calculated as: apoptotic cells/total cell number \u00d7 100.significant inhibitory effect in vitro and the maximal plasma level after systemic administration in vivo [The SI/MPL-ratio was calculated in order to describe the relation between a  in vivo ,14.significant inhibitory effect in vitro and the drug concentration in a DES.The SI/DES-ratio was calculated in order to describe the relation between a P < 0.05.Data of flow cytometry and migration studies were presented as mean \u00b1 S.D. Statistical significance of differences between controls and drug-treated cells was determined by paired Student's t-test. The Mann-Whitney rank-sum test was used to investigate the significance of differences in the human organ culture model. Statistical significance was accepted for Monocultures of HCAEC and HUVEC were identified by positive reaction with antibodies directed against von Willebrand factor and the typical \"cobblestone\" growth pattern in culture. Monocultures of HCMSMC exhibited the \"hill and valley\" growth pattern and reacted positively with antibodies against smooth muscle \u03b1-actin.The effects of SRL  on the TNF-\u03b1 induced expression of ICAM-1 are demonstrated in figure -3, 1.563 \u00d7 10-2, 0.1563 and SI/DES-ratio's of 1.3 \u00d7 10-9, 1.3 \u00d7 10-8, 1.3 \u00d7 10-7. Incubation of HCAEC with SRL in concentrations of 10, 100, and 1000 ng/mL caused an decrease by 36.92% (p < 0.01), 35.4% (p < 0.01), and 38.4% (p < 0.05), corresponding to SI/MPL-ratio's of 1.563 \u00d7 10-2, 0.1563, 1.563 and SI/DES-ratio's of 1.3 \u00d7 10-8, 1.3 \u00d7 10-7, 1.3 \u00d7 10-6.In HCAEC, treatment with TNF-\u03b1 increased the mean fluorescence levels (%) of ICAM-1 expression 18.83-fold from 5.31% to 100.00%. Incubation of HCAEC with SRL caused a dose dependent inhibition of ICAM-1 expression. After incubation with SRL in concentrations of 0.01, 0.1, and 1 ng/ml expression of ICAM-1 was significantly decreased by 1.13% (p < 0.05), 8.9% (p < 0.05), and 25.73% (p < 0.05), corresponding to SI/MPL-ratio's of 1.563 \u00d7 10-7, 1.3 \u00d7 10-8, 1.3 \u00d7 10-7, 1.3 \u00d7 10-6.In HUVEC, treatment with TNF-\u03b1 increased the mean fluorescence levels (%) of ICAM-1 expression 39.53-fold from 2.53% to 100.00%. Incubation of HUVEC with SRL in concentrations of 0.01 ng/ml and 0.1 ng/ml caused a small stimulatory effect of 2.7% (n.s.) and a small inhibitory effect of 2.22% (n.s.). After incubation of HUVEC with SRL in concentrations of 1, 10, 100, and 1000 ng/ml expression of ICAM-1 was inhibited by 13.76% (p = 0.01), 29.85% (p < 0.01), 34.08% (p < 0.01), and 31.8% (p < 0.01), corresponding to SI/MPL-ratio's of 0.1563, 0.01563, 0.1563, 1.56 and SI/DES-ratio's of 1.3 \u00d7 10-3; SI/DES-ratio: 1.3 \u00d7 10-9) and 0.43% (n.s.) and a small inhibitory effect of 3.35% (n.s.). After incubation of HCMSMC with SRL in concentrations of 10, 100, and 1000 ng/ml expression of ICAM-1 was inhibited by 11.75% , 15.92% , and 11.15% (n.s.).In HCMSMC, treatment with TNF-\u03b1 increased the mean fluorescence levels (%) of ICAM-1 expression 4.93-fold from 20.29% to 100.00%. Incubation of HCMSMC with SRL in concentrations of 0.01, 0.1, and 1 ng/ml caused a small stimulatory effects of 4.37% .The effects of SRL  on migration of HCMSMC are demonstrated in figure -2, 0.1563 and SI/DES-ratio's of 1.3 \u00d7 10-8, 1.3 \u00d7 10-7. Incubation of HCMSMC with SRL in concentrations of 10, 100, and 1000 ng/mL caused an decrease of cell migration of 32.09% (p < 0.01), 25.28% (p < 0.05), and 26.34% (p < 0.05), corresponding to SI/MPL-ratio's of 1.563 \u00d7 10-2, 0.1563, 1.563 and SI/DES-ratio's of 1.3 \u00d7 10-8, 1.3 \u00d7 10-7, 1.3 \u00d7 10-7.After incubation of HCMSMC with SRL in concentrations of 0.01, 0.1, and 1 ng/ml migration of HCMSMC was inhibited by 15.74% (n.s.), 23.1% (p < 0.01), and 24.67% (p < 0.001), corresponding to SI/MPL-ratio's of 1.563 \u00d7 10In the current human ex vivo study the effect of 21 days incubation with SRL 50 ng/ml) on reactive cell proliferation Fig. , apoptos0 ng/ml o21 days after angioplasty (n = 6) cell proliferation in the neointima, plaque-intima, and the media was increased by 11.89% (n.s.), 3.73% (n.s.), and 4.27% (n.s.) in comparison to cell proliferation before angioplasty. After incubation with SRL (50 ng/ml) for a period of 21 days no cell proliferation was detected in the neointima, cell proliferation in the plaque-intima and media was decreased by 93.3% (n.s.) and 95.78% . 56 days after angioplasty (n = 10) cell proliferation in the human organ cultures was very low and did not increase 2%. In the neointima, plaque-intima, and media cell proliferation was increased by 1.96% (n.s.), 1.25% (n.s.), and 0.23% (n.s.) in comparison to cell proliferation before angioplasty and decreased by 70.41% (n.s.), 32% (n.s.), and 52.17% (n.s.) after SRL incubation.The number of apoptotic cells in the artery segments was always very low and did not increase 1%. Apoptotic cells was detected merely in the media, almost no apoptosis was found in the neointima and plaque-intima. 21 days after angioplasty (n = 6) apoptosis in the media was increased by 0.18% (n.s.) in comparison to the percentage of apoptotic cells before angioplasty, 56 days after angioplasty by 0.64% (n.s.). Incubation with SRL caused both stimulating and inhibiting effects. At day 21 the number of apoptotic cells was increased by 52.6% in comparison to the angioplasty group (n.s.), at day 56 inhibited by 42.19% (n.s.).Neointimal hyperplasia after angioplasty was increased by 1.44% at day 21 (n = 5) and 6.11% at day 56 (n = 10) in comparison to neointimal hyperplasia before angioplasty. After a 21-days incubation with SRL (50 ng/ml) no neointimal hyperplasia was detected at day 21 and a reduction by 31.26% was detected at day 56 (n.s.).The current study reports on the effects of SRL in various human in vitro/ex vivo models and evaluates the theoretical clinical relevance of the data by SI/MPL- and SI/DES-ratio's.Expression of ICAM-1 is one of the crucial events for adhesion and chemotaxis of human monocytes from the circulating blood into the coronary artery wall. In the current study TNF-\u03b1 induced expression of ICAM-1 was significantly inhibited by SRL both in endothelial and smooth muscle cells. The corresponding SI/MPL-ratio's of 0.00156 (HCAEC), 1.56 (HCMSMC), and 0.156 (HUVEC) indicate that the inhibitory effects may be expected theoretically both after systemic and local high dose administration. In contrast to the current data Minhajuddin et al.  reportedIn the current study migration of HCMSMC was inhibited after administration of SRL in concentrations \u2265 0.1 ng/ml. The corresponding SI/MPL-ratio of 0.016 indicates that the antimigratory effect was achieved with 1.6% of the maximal plasma level after oral application, resulting in both a systemic and local high dose option for this effect. These data are in accordance with data in the literature . Poon etIn the ex vivo part of the study the effect of SRL in a concentration of 50 ng/ml on cell proliferation, apoptosis, and neointimal hyperplasia was studied. An antiproliferative effect of SRL on cell proliferation was first described by Dell . Marx etNeointimal hyperplasia was inhibited after incubation with SRL in a concentration of 50 ng/ml at day 21 and day 56, statistical significance was not achieved. These data are in accordance with many reports in rabbit ,4 experiApoptotic effects did not play a major role in the restenosis process of the HOC-model, the number of apoptotic cells never increased 1%. In contrast to the current data apoptotic cell death has been documented in numerous animal models of vascular injury -24. Poll2, informations that are useless for a correlation with in vitro/ex vivo drug concentrations. To our best knowledge the only exception is a report of Wessely et al. [-6 and 10-8.In the literature the amount of SRL in DES is described as \u03bcg/stent or \u03bcg/mmy et al. , describThe adhesion molecule ICAM-1 is merely one of a large number of inflammation markers. In the current study we focused on expression of ICAM-1 because our laboratory has already characterized precisely the TNF-\u03b1 induced stimulation of ICAM-1 expression in HCAEC, HUVEC, and HCMSMC .Although ex vivo models are very attractive they are hampered by high standard deviations due to the preparation procedure . The artSI/MPL- and SI/DES-ratio's are merely a theoretical help to evaluate the clinical relevance of in vitro/ex vivo data.-6 and 10-8 indicate that the described inhibitory effects of SRL have been detected with micro to nano parts of the SRL concentration in the ISAR drug-eluting stent platform. It remains to be elucidated whether SRL concentrations in DES can be drastically reduced without loosing the convincing anti-restenotic effects in vivo.SI/MPL-ratio's \u2264 1  characterize inhibitory effects of SRL that can be theoretically expected both after systemic and local high dose administration, a SI/MPL-ratio of 7.81 (cell proliferation) represents an effect that was achieved with drug concentrations 7.81-times the MPL. SI/DES-ratio's between 10Due to the fact that the application of the SI/MPL-ratio ,14 might-6 and 10-8. This is overdone and may partially cause the problems of late thrombosis in DES [-1 to 10-2 are sufficient to create a significant local antiproliferative effect.The application of a SI/DES-ratio is suggested for the first time in the current study. Drug concentrations in current DES are extremely high , resultis in DES . ProbablDrug concentrations in DES will be the central issue of the future. It has to be demonstrated, if the SI/DES-ratio can close a little bit the gap between bench and bedside by keeping the focus on the relation between effective drug concentrations in vitro and the local concentration in DES.The author(s) declare that they have no competing interests.All authors read and approved the final manuscript. RV, RB, VH, JK designed the study, RV wrote the manuscript. SZ and RB carried out PCNA and apoptosis studies, FM and LvM have done cytoflow studies. Cell migration studies were done by RB, FF and RB carried out morphological studies, JB, JG, and MK supplied renal artery segments and critically discussed the manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "The significant reduction of angiographic restenosis rates in the ISAR-SWEET study (intracoronary stenting and antithrombotic regimen: is abciximab a superior way to eliminate elevated thrombotic risk in diabetes) raises the question of whether abciximab acts on clopidogrel-independent mechanisms in suppressing neointimal hyperplasia. The current study investigates the direct effect of abciximab on ICAM-1 expression, migration and proliferation.ICAM-1: Part I of the study investigates in cytoflow studies the effect of abciximab  on TNF-\u03b1 induced expression of intercellular adhesion molecule 1 (ICAM-1). Migration: Part II of the study explored the effect of abciximab  on migration of HCMSMC over a period of 24 h. Proliferation: Part III of the study investigated the effect of abciximab  on proliferation of HUVEC, HCAEC, and HCMSMC after an incubation period of 5 days.ICAM-1: In human venous endothelial cells (HUVEC), human coronary endothelial cells (HCAEC) and human coronary medial smooth muscle cells (HCMSMC) no inhibitory or stimulatory effect on expression of ICAM-1 was detected. Migration: After incubation of HCMSMC with abciximab in concentrations of 0.0002 \u2013 2 \u03bcg/ml a stimulatory effect on cell migration was detected, statistical significance was achieved after incubation with 0.002 \u03bcg/ml (p < 0.05), 0.002 \u03bcg/ml (p < 0.001), and 0.2 \u03bcg/ml (p < 0.05). Proliferation: Small but statistically significant antiproliferative effects of abciximab were detected after incubation of HUVEC , HCAEC , and HCMSMC . The significant inhibition (SI) of cell proliferation found in HCAEC and HCMSMC was achieved with drug concentrations more than 10 times beyond the maximal plasma level (MPL), resulting in a SI/MPL-ratio > 1.Thus, the anti-restenotic effects of systemically administered abciximab reported in the ISAR-SWEET-study were not caused by a direct inhibitory effect on ICAM-1 expression, migration or proliferation. The observations that abciximab was associated with a reduction in angiographic restenosis rates in the ISAR-SWEET- study  was surpThe significant reduction in angiographic restenosis in ISAR-SWEET  and CADIThe current study investigates the effect of abciximab on expression of the intercellular adhesion molecule-1 (ICAM-1), migration, and proliferation in human vascular cells. The clinical relevance of the data is characterized by the so-called SI/MPL-ratio , calculaEndothelial cells from human umbilical veins (HUVEC) were isolated after vaginal delivery by enzymatic disaggregation with collagenase/dispase as described previously . Endothe\u00ae, Lilly, Bad Homburg, D, 0.0002 \u2013 20 \u03bcg/mL, dilution: aqua ad inject., MPL: 0.175 \u03bcg/mL [Abciximab: Reopro75 \u03bcg/mL .4 cells were seeded into 6-well dishes. Abciximab  was added to the cultures for a period of 18 h. During the last 6 h of abciximab incubation, the expression of adhesion molecules was stimulated by adding of TNF-\u03b1 (20 ng/ml).For flow cytometry analysis of the expression of ICAM-1 in HUVEC, HCAEC, and HCMSMC, 5 \u00d7 104 cells (100% gated) were analyzed immediately with a flowcytometer . Controls were carried out with IgG-FITC and actinomycin.After abciximab/TNF-\u03b1 treatment, cells were washed twice with phosphate-buffered saline (pH 7.2) containing 1% fetal calf serum at 4\u00b0C. Cells were resuspended in 100 \u03bcl of a FITC-conjugated monoclonal antibody directed against ICAM-1  and incubated for 20 min at 4\u00b0C. A total of 1 \u00d7 10Migration of HCMSMC was measured by a 24 well colorimetric assay , based on the Boyden Chamber principle. HCMSMC were incubated with SmBM medium supplemented with 1% fetal calf serum (fcs) for a period of 48 h. Thereafter HCMSMC were seeded on the upper side of the polycarbonate membrane (pore size 8 \u03bcm) of the Boyden Chamber. Migration of HCMSMC was stimulated by filling the lower chamber of the kit with SmBM medium supplemented with 10% fcs. Abciximab was added to the medium of the lower chamber in concentrations of 0.0002, 0.002, 0.02, 0.2, 2.0, and 20.0 \u03bcg/mL. After 24 h of incubation HCMSMC were removed from the upper side of the membrane. Thereafter the membranes were stained for 20', airdryed, and incubated with extraction buffer for 15'. The opitical density of 100 \u03bcl of this solution was measured at 560 nm, SmBM medium supplemented with 10% fcs was used as control (100%).3 cells \u00d7 cm-2 in 6-well dishes. 24 h after seeding the corresponding culture medium was renewed and the number of adherent cells was analyzed in a cell counter . Subsequently abciximab was added in concentrations of 0.0002, 0.002, 0.02, 0.2, 2.0, and 20.0 \u03bcg/mL for another five days. Culture medium and abciximab were renewed at day three after seeding. Cell number after incubation with abciximab was calculated as relative cell number in comparison to untreated controls with the concerning solvent. Taking into account that not all cells could be successfully cultured, cell numbers of untreated controls were calculated as:HUVEC, HCAEC, and HCMSMC in passages 3\u20135 were seeded in a density of 3 \u2013 5 \u00d7 10Total cell number at day 6 \u2013 cell number attached at day 1 after seeding = 100%.TM, Promega, Mannheim, D) the effects of abciximab in concentrations of 0.0002, 0.002, 0.02, 0.2, 2.0, and 20.0 \u03bcg/ml  were analyzed for a period of five days in 96 well dishes . Luminescence of luciferase reaction as a marker of cell viability was measured in a CentroLB960 .In a luminescent cell viability assay (CellTiter-GloAs recently reported by our group  a SI/MPLConcentration with a significant inhibition in vitro (SI)Maximal systemic plasma level (MPL)P < 0.05.Data of migration and proliferation studies are presented as mean \u00b1 S.D. Statistical significance of differences between controls and drug-treated cells was determined by paired Student's t-test. Statistical significance was accepted for Monocultures of HUVEC and HCAEC were identified by positive reaction with antibodies directed against von Willebrand factor and by the typical \"cobblestone\" growth pattern in culture. Monocultures of HCMSMC exhibited the \"hill and valley\" growth pattern and reacted positively with antibodies against smooth muscle \u03b1-actin.The effects of abciximab  on the TNF-\u03b1 induced expression of ICAM-1 are demonstrated in Figure The effects of abciximab  on migration of HCMSMC are shown in Figure After incubation of HCMSMC with abciximab in concentrations of 0.0002, 0.002, and 0.02 \u03bcg/ml cell migration was increased by 36.29% (p < 0.05), 36.68% (p < 0.001), and 32.43% (n.s.). The stimulatory effect decreased after incubation with 0.2 and 2 \u03bcg/ml of abciximab, cell migration was increased by 20.37% (p < 0.05) and 10.81% (n.s.), respectively. After incubation of HCMSMC with the maximal concentration of 20 \u03bcg/ml of abciximab no effect on cell migration was detected.The effects of abciximab  on proliferation of HUVEC, HCAEC, and HCMSMC are demonstrated in Figure In HUVEC small but significant inhibitory effects were detected after incubation with abciximax in concentrations of 0.02 \u03bcg/ml and 2 \u03bcg/ml, cell proliferation was decreased to 90.19%  and 83.47% , respectively. No significant inhibitory effects were found after incubation of HUVEC with abciximab in concentrations of 0.0002 \u03bcg/ml, 0.002 \u03bcg/ml, 0.2 \u03bcg/ml, and 20 \u03bcg/ml, cell proliferation was decreased to 96.41%, 93.77%, 90.37%, and 79.34%.In HCAEC no significant inhibitory effects were detected after incubation with abciximab in concentrations of 0.002 \u03bcg/ml, 0.002 \u03bcg/ml, 0.02 \u03bcg/ml, and 0.2 \u03bcg/ml, cell proliferation was decreased to 88.50%, 87.17%, 88.35%, and 85.09%. Small but significant inhibitory effects were found after incubation of HCAEC with abciximab in concentrations of 2 \u03bcg/ml and 20 \u03bcg/ml, cell proliferation was decreased to 91.87%  and 87.70% .After incubation of HCMSMC with abciximab in concentrations of 0.002 \u03bcg/ml, 0.002 \u03bcg/ml, 0.02 \u03bcg/ml, and 0.2 \u03bcg/ml no significant inhibitory effects were detected in comparison to untreated controls, cell proliferation was 100.18%, 91.86%, 90.85%, and 86.90%. Small but significant inhibitory effects were found after incubation of HCMSMC with abciximab in concentrations of 2 \u03bcg/ml and 20 \u03bcg/ml, cell proliferation was decreased to 85.79%  and 81.09% .Cell vitality of HUVEC, HCAEC, and HCMSMC was analyzed after incubation with abciximab in concentrations of 0.0002, 0.002, 0.02, 0.2, 2.0, and 20.0 \u03bcg/ml. Cell vitality was slightly increased in HUVEC and HCAEC and slightly decreased in HCMSMC. Statistical significance of the differences in comparison to untreated controls was not achieved.In HUVEC cell vitality was slightly increased after incubation with abciximab in concentrations of 0.0002, 0.002, 0.02, 0.2, 2.0, and 20.0 \u03bcg/ml. Cell vitality in comparison to untreated controls was 106.83%, 117.57%, 112.30%, 108.43%, 111.31%, and 111.36%.In HCAEC a similar result was detected, cell vitality was slightly increased. In comparison to untreated controls cell vitality was 113.38%, 117.24%, 105.99%, 112.68%, 109.15%, and 106.70%.In HCMSMC a slight decrease of cell vitality was detected after incubation with abciximab in concentrations of 0.0002, 0.002, 0.02, 0.2, 2.0, and 20.0 \u03bcg/ml. Cell vitality in comparison to untreated controls was 86.94%, 86.51%, 96.64%, 82.50%, 97.49%, and 89.82%.The present in vitro study investigated the effects of abciximab on key pattern of human coronary restenosis. Three basic conclusions were determined. First, abciximab (0.0002 \u03bcg/ml \u2013 20 \u03bcg/ml) had no effect on expression of ICAM-1 in HUVEC, HCAEC, and HCMSMC. Second, abciximab (0.0002 \u03bcg/ml \u2013 2 \u03bcg/ml) stimulated migration of HCMSMC. Third, high concentrations of abciximab had a small but significant antiproliferative effect in HUVEC, HCAEC, and HCMSMC, SI/MPL-ratio's > 1 indicate that these effects can't be achieved after systemic infusion.During the last decade, intensive efforts have been made to evaluate the role of the platelet glycoprotein (GP) IIb/IIIa complex in platelet-mediated thrombus formation. Acitivation of the GP IIb/IIIa platelet-surface integrin by endogenous agonists  results in binding of adhesive proteins such as fibrinogen and von Willebrand factor, thus mediating platelet aggregation . SignifiCharo et al.  were theThe current study demonstrates that abciximab in concentrations ranging from 0.0002 \u03bcg/ml \u2013 20 \u03bcg/ml has no effect on expression of ICAM-1 in HUVEC, HCAEC, and HCMSMC. The data are in accordance with a recent report of Massberg et al.  that abcMigration  and prolIn the present study a stimulatory effect on cell migration was detected after incubation of HCMSMC with abciximab in concentrations of 0.0002 \u2013 2 \u03bcg/mL, statistical significance was achieved after incubation with abciximab in concentrations of 0.0002 \u03bcg/ml, 0.002 \u03bcg/ml, and 0.2 \u03bcg/ml. Neither stimulatory nor inhibitory effects on cell migration were detected after incubation of HCMSMC with abciximab in a concentration of 20 \u03bcg/ml. In the applied migration model merely direct effects on cell migration can be studied. Indirect effects that block thrombin-induced migration cannot be considered due to the fact that thrombin is not present in the system . Due to In the present study a small but significant antiproliferative effect was detected after adding abciximab in concentrations of 2 \u03bcg/mL and 20 \u03bcg/mL, resulting in SI/MPL-ratio's beyond 1. The effect of abciximab on cell proliferation in human coronary vascular cells has already been studied by the group of Blindt et al. ,43. BothThe present study investigates direct effects of abciximab on ICAM-1 expression, migration and proliferation. The primary target for abciximab, however, is the platelet GPIIb/IIIa receptor, which is blocked by the antibody thereby preventing complex formation between the platelet and fibrinogen. Inhibition of platelet aggregation results in the release of multiple platelet derived growth factors capable of affecting smooth muscle proliferation and expression of adhesion molecules. Thus, the absence of platelets in the in vitro system, as well as the absence of other cellular components and immunological reactions initiated by increased platelet activity are not replicated in the present experimental protocol.Although an effect of abciximab on expression of ICAM-1 in HUVEC, HCAEC and HCMSMC was excluded in the present study, an effect of abciximab on monocytes is possible and should be confirmed in further studies. One of the possible models for the evaluation of these mechanisms might be the 3DLA-model reported earlier by our group (13).Equally as described for direct anti-migratory effects, a contribution of direct antiproliferative effects of abciximab for the experimental and clinical anti-restenotic effects can be excluded. The small but significant antiproliferative effect of abciximab (SI/MPL-ratio > 1) indicates a local high dose option that might be of clinical use in coated stents (44).The author(s) declare that they have no competing interests.All authors read and approved the final manuscript. RV, RB, and VH designed the study, RV wrote the manuscript. LvM carried out the cytoflow studies, cell migration studies and cell proliferation studies were done bei MA and RB.The pre-publication history for this paper can be accessed here:"}
+{"text": "Idiopathic pulmonary fibrosis (IPF) is a progressive and lethal disorder characterized by fibroproliferation and excessive accumulation of extracellular matrix in the lung.osteopontin as one of the genes that significantly distinguishes IPF from normal lungs. Osteopontin was localized to alveolar epithelial cells in IPF lungs and was also significantly elevated in bronchoalveolar lavage from IPF patients. To study the fibrosis-relevant effects of osteopontin we stimulated primary human lung fibroblasts and alveolar epithelial cells (A549) with recombinant osteopontin. Osteopontin induced a significant increase of migration and proliferation in both fibroblasts and epithelial cells. Epithelial growth was inhibited by the pentapeptide Gly-Arg-Gly-Asp-Ser (GRGDS) and antibody to CD44, while fibroproliferation was inhibited by GRGDS and antibody to \u03b1v\u03b23 integrin. Fibroblast and epithelial cell migration were inhibited by GRGDS, anti-CD44, and anti-\u03b1v\u03b23. In fibroblasts, osteopontin up-regulated tissue inhibitor of metalloprotease-1 and type I collagen, and down-regulated matrix metalloprotease-1 (MMP-1) expression, while in A549 cells it caused up-regulation of MMP-7. In human IPF lungs, osteopontin colocalized with MMP-7 in alveolar epithelial cells, and application of weakest link statistical models to microarray data suggested a significant interaction between osteopontin and MMP-7.Using oligonucleotide arrays, we identified Our results provide a potential mechanism by which osteopontin secreted from the alveolar epithelium may exert a profibrotic effect in IPF lungs and highlight osteopontin as a potential target for therapeutic intervention in this incurable disease. Osteopontin may have a critical role in the pathogenesis of idiopathic pulmonary fibrosis, and be a target for therapeutic intervention in this disease. Idiopathic pulmonary fibrosis (IPF) is a chronic fibrosing interstitial pneumonia of unknown etiology characterized by alveolar epithelial cell injury/activation, fibroblast proliferation, and exaggerated accumulation of extracellular matrix in the lung parenchyma ,2. The dA distinctive morphological feature of IPF is the development of fibroblastic/myofibroblastic foci, represented by widely scattered, small aggregates of subepithelial mesenchymal cells immersed within a myxoid-appearing extracellular matrix . These fv\u03b23 integrin, some CD44 isoforms, and fibronectin ) for 5 min and then fixed in cold acetone for 10 min, twice. Tissues were incubated in blocking buffer  for 30 min. The slides were then incubated with a rabbit antibody to osteopontin  for 1 h at room temperature and washed in PBST (0.05% Tween-20 in 0.01 M PBS [pH 7.4]) for 10 min, three times. A mouse anti-MMP-7 monoclonal antibody  was added and the slides were incubated for an additional 1 h at room temperature. After three 10-min washes in PBST, slides were incubated with secondary antibodies  for 30 min. Slides were then washed in the same buffer and mounted with antifade medium (containing DAPI to stain cell nuclei).Primary human normal lung fibroblasts were obtained as previously described , and the3 and 5 \u00d7 103 cells/well respectively, and incubated in Ham's F-12 and DMEM media, respectively , supplemented with 10% FBS at 37 \u00b0C in 5% CO2 and 95% air. After 12 h, the medium was replaced by medium with 0.1% FBS alone or 0.1% FBS plus increasing concentrations of osteopontin  and the cells were maintained in culture for another 48 h. Cell growth was determined using the cell proliferation reagent WST-1  as previously described [v\u03b23 integrin , the pentapeptide Gly-Arg-Gly-Asp-Ser , or antibody to human CD44 , and then osteopontin was added (2 \u03bcg/ml). Additionally, A549 cells were pretreated with antibody to human epidermal growth factor receptor .Lung fibroblasts or A549 cells were seeded in 96-well culture plates at a cell density of 7.5 \u00d7 10escribed . All ass5 cells/well) were added to the upper chamber. The lower chamber contained 0.3 ml of medium with 5% BSA alone or with 10 \u03bcg/ml of recombinant human osteopontin . PDGF (8 ng/ml) and epidermal growth factor  were used as positive controls for fibroblasts and for A549 cells, respectively. Additional BSA-coated chambers were used as blanks for each sample. After incubation for 8 h at 37 \u00b0C in a humidified incubator with 5% CO2 and 95% air, the nonmigrating cells on the top of Boyden chamber were scraped and washed. The migrating cells were quantitated according to manufacturer's instructions. Briefly, the cells were stained and the color eluted with 300 \u03bcl of extraction buffer, and 150-\u03bcl aliquots were measured in an ELISA plate reader at 545 nm. All assays were performed in duplicate. In parallel experiments, A549 cells and fibroblasts were pretreated as described above for growth rate.Migration of fibroblasts and A549 cells was assayed using commercially available 24-well collagen-coated Boyden chambers (Chemicon) with an 8-\u03bcm pore size. Briefly, a semi confluent (\u223c80%) monolayer of lung fibroblasts or A549 cells was harvested with trypsin-EDTA, centrifuged, and resuspended in Ham's F-12 medium containing 5% BSA. The cell suspensions . All experiments were repeated twice.Total RNA was extracted from lung fibroblasts and A549 epithelial cells using the RNeasy Mini Kit . Cells were lysed and homogenized in the presence of a highly denaturing guanidine isothiocyanate-containing buffer. The samples were then applied to an RNeasy minicolumn, and RNA was eluted in 30 \u03bcl of water. Total RNA (20 \u03bcg/lane) was fractionated on a 1% agarose gel containing 0.66 M formaldehyde . Ribosom1 \u03bcg of RNA was treated with 1 unit of DNAase . First-strand cDNA was synthesized by reverse transcription with random primers and Moloney-murine leukemia virus reverse transcriptase according to manufacturer's protocol .2, 200 \u03bcM dNTPs, 0.2 \u03bcM specific 5\u2032 and 3\u2032 primers for 18S rRNA, 0.6 \u03bcM specific 5\u2032 and 3\u2032 primers for gene target, 0.2 \u03bcM of each probe TAQMAN (18S rRNA and gene target), and 1.25 units of AmpliTaq GOLD DNA polymerase (PE Applied Biosystems). A dynamical range was built with each product of PCR on copy number serial dilutions from 1 \u00d7 108 to 1 \u00d7 101; all PCRs were performed in triplicate. Standard curves were calculated referring the threshold cycle (Ct) to the log of each cDNA dilution step. Results were expressed as the number of copies of the target gene normalized to 18S rRNA. Some primers used in PCR reactions were designed using Beacon Designer software 2.1 (BioRad) and checked for homology in BLAST. The cycling conditions for PCR amplification were performed using the following protocol: Initial activation of AmpliTaq Gold DNA polymerase at 95 \u00b0C for 7 min; and 40 cycles of denaturation at 95 \u00b0C for 30s, annealing at 60 \u00b0C for 30 s, and extension at 72 \u00b0C for 30 s. The sequences of the PCR primer pairs and probes for each gene are shown in Real-time PCR amplification was performed using i-Cycler iQ Detection System , using TAQMAN probes  labeled with FAM and TET. PCR was performed with the cDNA working mixture in a 25-\u03bcl reaction volume containing 3 \u03bcl of cDNA, 20 mM Tris-HCl (pH 8.3), 50 mM KCl, 2 mM MgCl2 and 50 nM ZnCl2. Identical gels were incubated but in the presence of 20 mM EDTA. Gels were stained with Coomassie Brilliant Blue R250 and destained in a solution of 7.5% acetic acid and 5% methanol. Recombinant human MMP-7 (Chemicon) was used as positive control.For MMP-7 analysis, conditioned media was electrophoresed in 12.5% SDS gels containing as substrate bovine CM-transferrin (0.3 mg/ml) and heparin . After eg at 4 \u00b0C for 30 min to remove cell debris, then concentrated by lyophilization. Samples were solubilized in water, and aliquots containing 5 \u03bcg of protein were mixed with Laemmli sample buffer and electrophoresed on 10% or 12.5% SDS-polyacrylamide gels. Proteins were transferred to nitrocellulose filters at 15 V for 20 min using semi-dry transfer cell (BioRad). Nonspecific sites were blocked overnight with 4% (w/v) nonfat dried milk in PBS, and membranes were incubated with rabbit antibody to human interstitial collagenase IgG , antibody to human TIMP-1 (Chemicon), antibody to human MMP-7 , or monoclonal antibody to human \u03b1-smooth muscle actin  for 2 h at room temperature. Filters were incubated with secondary antibody conjugated to peroxidase for 1 h at room temperature. Finally, the filters were developed with the Enhanced Chemiluminescence detection system  using radiograph film  according to the instructions of the manufacturer. Western blots were repeated twice.Serum-free conditioned media was centrifuged at 300 http://www.ncbi.nlm.nih.gov/geo). Gene expression patterns clearly distinguished IPF lungs from normal lungs. Osteopontin was the most up-regulated gene among the genes that distinguished IPF lungs (p = 0.000221), or Student's t-test (p = 0.0000035). We corrected for multiple testing by controlling the false discovery rate at the 5% level [The complete microarray dataset is available at the Gene Expression Omnibus database with GEO serial accession number GSE2052 (PF lungs A. OsteopPF lungs B. This i5% level . Osteopop < 0.01).Osteopontin protein was quantified in BAL fluids from 18 IPF patients and 10 healthy controls. As shown in To examine the cellular source of osteopontin we analyzed IPF and control lungs by immunohistochemistry. As illustrated in p < 0.01), while in two different experiments A549 cell lines exhibited 60% and 80% increases of growth rate over control (p < 0.01).To determine the effect of osteopontin on the growth rates of fibroblasts and epithelial cells, cells were stimulated with increasing concentrations of osteopontin, and the cell number was determined after 48 h using the cell proliferation reagent WST-1. Significant dose-dependent increases in cell proliferation were observed with 1 \u03bcg/ml and 2 \u03bcg/ml. Two different fibroblast lines reached 220% and 380% over controls (p < 0.01) and by antibody to \u03b1v\u03b23 integrin (p < 0.05), suggesting that the effect of osteopontin on growth rate was mediated by the interaction of the GRGDS domain of osteopontin with \u03b1v\u03b23 integrin (p < 0.05) (v\u03b23 (Osteopontin-induced fibroblast proliferation (2 \u03bcg/ml) was significantly suppressed by GRGDS-pentapeptide, which interrupts binding of RGD-containing proteins to cell surface integrins (integrin A. In con < 0.05) B. Epithe05) (v\u03b23 B.p < 0.01), an enhancement similar to that obtained with the potent fibroblast mitogen platelet-derived growth factor, used as a positive control . To analyze possible mechanisms by which osteopontin stimulates migration, different blockers were used. Fibroblast migration was significantly reduced by GRGDS and antibody to \u03b1v\u03b23 integrin (p < 0.01), and by antibody to CD44 (p < 0.05). The inhibition of cell migration was specific, since incubation with IgG had no effect (unpublished data).To examine the effect of osteopontin on cell migration, we used collagen-coated Boyden chambers, a well-established in vitro assay system. The number of cells that migrated in absence of osteopontin was used as control (0% migration). As revealed in p < 0.01). Epidermal growth factor, used as a positive control, induced a 168% \u00b1 14% increase in cell migration (unpublished data). Osteopontin-induced migration was abolished when the epithelial cells were pretreated individually with GRGDS, anti-\u03b1v\u03b23 integrin, or anti-CD44 . In this context, the effect of osteopontin on MMP-1 expression was examined by Northern blot analysis in a cell line producing MMP-1 under basal conditions, and in a cell line that did not produce MMP-1 but was stimulated by APMA A and 6B.TIMP-1 gene expression in fibroblasts is illustrated in TIMP-1 gene expression at 0.4 \u03bcg/ml and 1 \u03bcg/ml osteopontin when compared to control. This result was confirmed by real-time PCR (p < 0.01). Both anti-CD44 and anti-\u03b1v\u03b23 integrin abolished this increase. Osteopontin also increased TIMP-1 protein expression in conditioned medium as illustrated in The effect of osteopontin on time PCR B. Osteop\u03b11 type I collagen gene expression. Expression of \u03b1-smooth muscle actin in fibroblasts was induced by TGF-\u03b21 but not by osteopontin  induced an up-regulation of MMP-7 gene expression as illustrated by Northern blot in Since we have previously demonstrated that IPF lungs strongly express MMP-7 in alveolar epithelial cells , we evalp < 0.001). This joint relationship is illustrated in p < 0.05) with MMP-1, MMP-2, and MMP-11 but none was as statistically significant as MMP-7. We also ran weakest link models combining osteopontin with each of 400 genes that passed the false discovery rate of less than 0.05 for differential expression between IPF and control samples. The interaction of osteopontin with MMP-7 in a weakest link model was more significant than 371 of these 400 genes.To determine whether MMP-7 and osteopontin expression levels jointly distinguish IPF and control samples, we applied weakest link statistical models . WeakestIn the present study we focused on the profibrotic effects of osteopontin, a multifunctional cytokine that mediates diverse biological functions, including cell adhesion, chemotaxis, and signaling, as well as tissue reparative processes ,11,12. WSeveral studies in experimental tissue fibrosis have suggested a possible profibrotic role of osteopontin. In kidney fibrosis, osteopontin enhances macrophage recruitment and stimulates the development of renal scarring after an acute ischemic insult . Also, oMMP-7 and osteopontin are \u03b2-catenin target genes [Positive feedback mechanisms have been previously proposed for osteopontin and MMP-2 , where oet genes ,33. Receet genes . They haet genes . Collecttype I collagen gene expression, suggesting that osteopontin may facilitate a profibrotic environment not only by its effect on epithelial cells but also by inducing a nondegradative microenvironment similar to the one observed in IPF and experimental lung fibrosis [Although intriguing, this proposed positive, self-perpetuating loop in itself cannot explain increased collagen deposition, the critical hallmark of fibrosis. In this context, our results suggest that osteopontin affects the critical balance between MMPs and their inhibitors through its cell-specific effects. In agreement with the inhibition of interleukin 1\u03b2-stimulated increases in MMP-2 and MMP-9 observed by Xie et al. , we obsefibrosis ,37. InteMigration and proliferation of fibroblasts are essential for the expansion of their populations and the formation of the fibroblastic foci that seem to represent the \u201cleading edge\u201d of the progressive fibrotic process . The obsv\u03b23 inhibition seemed to affect mostly fibroblasts. This integrin is a receptor for a wide variety of extracellular matrix ligands with an exposed RGD sequence, including vitronectin, fibronectin, fibrinogen, thrombospondin, proteolyzed collagen, von Willebrand factor, as well as osteopontin, and appears to play a critical role in cell migration [The mechanisms by which osteopontin influences epithelial and fibroblast cells are not fully understood. In general it has been proposed that osteopontin affects cells by binding to CD44 isoforms, certain integrins, and EGFR ,42. It iigration . The hyaigration ,49,50. IOur study focused on human tissues and human cell lines because of the unique features of IPF that are not readily mimicked by any animal models. We insisted on using primary human lung fibroblasts in our experiments; therefore, we are confident that these results represent a mechanism that may actually occur in the human lung. Unfortunately, it is nearly impossible to work with primary alveolar epithelial cells, and we had to resort to the epithelial cell line A549. However, we present evidence obtained from human lungs that suggest that the mechanisms that we proposed in vitro do exist in the human IPF lung.In summary, in this study we highlight the role of osteopontin in human IPF. Although previous studies have suggested that osteopontin has a potential profibrotic effect in animal models of lung fibrosis, its role in human IPF was unclear. We demonstrated that osteopontin is highly expressed in IPF lungs, and that it is primarily expressed by hyperplastic alveolar epithelial cells. We demonstrated that osteopontin affected fibroblast and epithelial cell proliferation and migration, and that it had fibrosis-relevant effects on MMP and TIMP expressions. Our results suggest a mechanism explaining most of the profibrotic effects of osteopontin by its direct effects on fibroblasts and epithelial cells in the lungs. Furthermore, our results suggest that in IPF the interaction between MMP-7 and osteopontin may be involved in the relentlessly progressive nature of the disease, and highlight osteopontin as a potential target for therapeutic intervention in this incurable disease.Protocol S1(746 KB ZIP).Click here for additional data file.Protocol S2(2.1 MB ZIP).Click here for additional data file.http://www.ncbi.nlm.nih.gov/) accession numbers of the genes discussed in this paper are R18S (X03205), MMP-1 (NM_002421), MMP-7 (XM_017384), and TIMP-1 (X03124).The GenBank (Idiopathic pulmonary fibrosis is a chronic progressive disease of the lung that leads to increasing amounts of scar tissue with subsequent destruction of the lung. There is no specific cure at present. Patients may be treated with corticosteroids or drugs to suppress their immune system, although these drugs are usually not effective. Some patients receive lung transplants.Previous work has suggested that a protein called osteopontin is increased in mice that have lung fibrosis and that mice that do not have the gene for osteopontin are protected from lung fibrosis. The researchers wanted to investigate if osteopontin was also involved in the human disease.They looked at samples taken from the lungs of people with idiopathic pulmonary fibrosis and other diseases and measured many genes that are expressed there. They found that osteopontin was increased in the lungs of people with idiopathic pulmonary fibrosis. They then looked at cultures of lung cells and found that osteopontin caused an increase in the number and movement of cells that are involved in lung fibrosis. Its presence also affected other proteins that seem to be involved in fibrosis.Osteopontin may have a key role in the pathway that causes fibrosis to occur in the lungs of people with idiopathic pulmonary fibrosis. Further work will need to be done to confirm these results, but in the future drugs directed against osteopontin or one of the related proteins might be a possible treatment for the disease. Currently there are no such drugs. Additionally osteopontin may be useful in the diagnosis and early detection of the disease, but further studies are required.Medline Plus has links to many pages with information on the disease:http://www.nlm.nih.gov/medlineplus/pulmonaryfibrosis.htmlThe Coalition for Pulmonary Fibrosis is a nonprofit organization that has information for patients as well as physicians:http://www.coalitionforpf.org/The Dorothy P. and Richard P. Simmons Center for Interstitial Lung Diseases contains information about IPF for patients and their families:http://simmonscenterild.upmc.com/"}
+{"text": "Wallerian degeneration slow (Wlds); these mice have three copies of a particular stretch of their DNA. Because this piece of DNA includes the gene for nicotinamide mononucleotide adenylyltransferase (NMNAT), which synthesizes a molecule called NAD, there has been a great deal of interest in whether NMNAT or NAD can protect against axonal degeneration. Hugo Bellen and colleagues show that NMNAT can, at least in the fruitfly Drosophila\u2014and that its protective ability is independent of its function as a NAD synthase.When a nerve is injured, axons beyond the site of injury die through a process called Wallerian degeneration. This degeneration is delayed in mice that have a mutation called Drosophila. But mice in which NMNAT is overexpressed show no protection.Investigations into the putative protective role of NMNAT have produced conflicting results. In vitro evidence supports the idea that NMNAT protects against degeneration, as do studies in which NMNAT was overexpressed in Drosophila for abnormalities in phototaxis . They then tested the visual responses of the identified flies and looked for abnormal synapse structure in the eyes. This screening process identified two \u201cnonsense\u201d mutations in the gene for Drosophila NMNAT that prevents the gene from generating the correct protein.The authors used a screening system that allowed them to look for flies that are homozygous for mutations\u2014meaning that both copies of a gene are mutated\u2014that result in death in cells of the visual system but are heterozygous, with one normal copy and one mutated copy, in the rest of the body. This means that mutations that would normally be lethal can be investigated in living flies. To look for mutations that affect synaptic function or development, the authors screened mutated When they characterized the protein, the authors found that it was highly homologous to NMNAT proteins in humans and mice. Staining with an antibody against NMNAT showed that the protein is highly enriched in the fly nervous system, mainly in the cell nuclei and nerve terminals. Flies carrying the NMNAT mutation had abnormal photoreceptors that became progressively damaged with age, indicating a degenerative process. Mutant photoreceptors appeared to develop normally but did not survive. NMNAT therefore seems to be required for the maintenance of mature neurons.nmnat mutant photoreceptors? When mutant flies were raised in the dark, their degeneration was much less severe than when they were raised in the light, indicating that photoreceptor activity contributes to the degenerative process. Flies with double mutations that lacked both NMNAT and functioning photoreceptors also showed reduced neurodegeneration. This led the authors to conclude that the normal function of NMNAT is to protect photoreceptors against light-induced degeneration. They also showed that overexpression of NMNAT could protect photoreceptors against the degeneration caused by excessive activity in flies with mutations that cause continuous activation of photoreceptors.What is the mechanism of degeneration in nmnat mutants. However, this inactive NMNAT could not stop a full, homozygous nmnat mutation from being lethal to flies. These results indicate that NMNAT has two functions: its NAD synthase activity is essential for survival, but another activity is responsible for neuroprotection.To investigate the importance of NAD synthesis in neuroprotection by NMNAT, the authors generated an enzymatically inactive form of NMNAT. To their surprise, they found that expression of this protein could prevent neurodegeneration in This study sheds new light on the mechanisms of neural degeneration and the functions of NMNAT. Attention will now turn to the identification of its second, non\u2013NAD-dependent activity, as well as to continued attempts to reconcile the apparently conflicting results of earlier overexpression experiments."}
+{"text": "Standard reaction conditions for the desilylation of acetylated furanoside  derivatives facilitate acyl migration. Conditions which favour intramolecular and intermolecular mechanisms have been identified with intermolecular transesterifications taking place under mild basic conditions when intramolecular orthoester formations are disfavoured. In acetyl ribosides, acyl migration could be prevented when desilylation was catalysed by cerium ammonium nitrate. Over the years, a number of methods aimed at achieving chemoselective acylation of carbohydrates have been developed.\u20133 In addO-acetyl adenosine diphosphate ribose (AcO-ADPR) incorporating modified acetylated ribosides, xylosides and arabinosides in place of the ribose moiety. The synthesis of such compounds requires access to well-characterised acetylated xylose, arabinose and ribose synthetic precursors and while few acetylated furanosides have been reported in the literature, those that have, have often been obtained in modest yields and reliable compound characterisations have been limited.[We aim to prepare analogues of 1''- limited.\u201311O-acetyl, 2,3-isopropylidene riboside 1a from the 5-O-silylated precursor 1 (1\u20135) were synthesised. Product distribution due to acetyl migration was carefully examined when these compounds were treated under neutral or mildly basic/acidic reaction conditions that promote the unmasking of a silylated alcohol.Whilst attempting the synthesis of 1-cursor 1  using mi1 was synthesised from ribose in 47% overall yield via a chemoselective silylation of the C-5 primary hydroxyl group of 2,3-O-isopropylidene ribose . Riboside e ribose . The ace4 was synthesised from arabinose  were treated with tetrabutyl ammonium fluoride (TBAF) in THF, with KF in the presence of 18-crown-6 in benzene, with ceric ammonium nitrate IV (CAN) in aqueous acetonitrile and with H2-Pd/C in THF. No attempts were made to examine standard protic acid-catalysed desilylations such as AcOH in H2O/THF[2O in DCM[1\u20135, all incorporating either an acetonide or a methyl ketal moiety.To identify the reaction conditions and the structural features of the acetylated furanosides facilitating acetyl migration upon protecting group manipulation, the various protected carbohydrates  but not for compound 3  and non-acetylated (compounds d) compounds have also been isolated  when 1 was reacted with TBAF, while 1b formation remained rapid with no detection of 1a formation. Similarly, complete transesterification took place when riboside 6 was treated with acetyl riboside 1 under basic conditions (In addition, the formation of the hemistry,\u201323 this nditions .1 was prevented when CAN was used instead of fluoride-containing reagents, indicating that the seven membered ring orthoester was not favoured under these mildly acidic conditions. This reagent was also found suitable for the silyl-removal in the other riboside 3 and 5 and arabinoside 4 with no trans-esterification occurrence. Unfortunately, the formation of a six-membered ring orthoacetate appears to be facilitated under acid-catalysed reaction conditions and total intramolecular acetyl migration occurred in xyloside 2 in the presence of CAN, showing how finally balanced things are in these systems.Acetyl migration in riboside In conclusion, to minimise acetyl migration in furanoside derivatives, base-catalysed reactions should be conducted under dilute conditions when the formation of an orthoacetate is disfavoured to minimise intermolecular transesterification. Unfortunately, we have been unable to identify a set of reaction conditions which could minimise the readily occurring intramolecular migration resulting from the formation of a five or six membered ring orthoacetate intermediate. Under such circumstances, migration can only be circumvented by controlling the stereochemistry of the reactive centres and opting for a multistep synthetic approach. However, it can be said that in mild acidic conditions provide better control over intra- and intermolecular acetyl migration than basic conditions. Finally, CAN has been identified as a very useful alternative reagent to TBAF in preventing unwanted base-catalysed acetyl migration in the deprotection of silylated furanosides.File 1contains all experimental data"}
+{"text": "Currently, conflicting evidence raises questions as to whether NMNAT is the protecting factor and whether its enzymatic activity is required for such a possible function. Importantly, the link between nmnat and axon degeneration is at present solely based on overexpression studies of enzymatically active protein. Here we use the visual system of Drosophila as a model system to address these issues. We have isolated the first nmnat mutations in a multicellular organism in a forward genetic screen for synapse malfunction in Drosophila. Loss of nmnat causes a rapid and severe neurodegeneration that can be attenuated by blocking neuronal activity. Furthermore, in vivo neuronal expression of mutated nmnat shows that enzymatically inactive NMNAT protein retains strong neuroprotective effects and rescues the degeneration phenotype caused by loss of nmnat. Our data indicate an NAD-independent requirement of NMNAT for maintaining neuronal integrity that can be exploited to protect neurons from neuronal activity-induced degeneration by overexpression of the protein.Wallerian degeneration refers to a loss of the distal part of an axon after nerve injury.  The first mutant analysis of NMNAT (nicotinamide mononucleotide adenylyltransferase 1) reveals an essential neuronal protective role that functions independently of NMNAT's enzymatic activity. NMNAT can also be exploited to protect neurons against activity-induced neurodegeneration. Following nerve injury, distal axons and synaptic terminals undergo Wallerian degeneration within 48 h . This prs), the entire coding sequence of Nmnat1, and a unique 18\u2013amino acid linking region translated from the 5\u2032 untranslated region (UTR) of Nmnat1 [S phenotype [Drosophila also protects axons from degeneration [Nmnat1 do not exhibit protection from Wallerian degeneration [s chimeric protein in the central nervous system (CNS) suggests that the increased level of Nmnat1 is significant in sWld mice and that there is no obvious change in ubiquitination. Hence, its protective effects seem to be unrelated to the ubiquitination function of Ube4b [Drosophila, overexpression of nmnat can delay axonal degeneration [The discovery of the slow Wallerian degeneration mutant neration \u201310. The f Nmnat1 ,12. Overhenotype , and recneration . Howeverneration \u201318, becaneration ,16. In cof Ube4b . In Drosneration . On the neration . Hence, sWld mice do not exhibit increased NAD levels [Two in vitro studies pinpoint Nmnat1 as the protective agent and suggest that it acts either in the nucleus  or localD levels . This fis protein. Here we show that loss of Drosophila nmnat causes severe neuronal and synaptic degeneration without affecting neural development. Importantly, this nmnat-dependent degeneration in photoreceptors can be attenuated by blocking phototransduction. NMNAT therefore functions to protect against activity-induced deterioration under normal conditions, and overexpression of NMNAT protects neurons from excessive activity-induced degeneration. This role is independent of its NAD synthesis activity, because overexpression of NMNAT protein with less than 1% activity can rescue the degeneration caused by loss of nmnat and has strong protective effects. We conclude that NMNAT is required to maintain neuronal integrity independent of its NAD synthesis function.Understanding the normal neuronal function of endogenous Nmnat in vivo is crucial to unveiling the mechanisms of neural degeneration and neural protection offered by WldeyFLP system [eyFLP system allows screening of flies that are homozygous for lethal mutations in the visual system but heterozygous in the rest of the animal [To identify genes that are involved in synapse development and function, we carried out a forward genetic screen using the P system \u201324. The e animal . Our prie animal . We scree animal . We nextDrosophila compound eye consists of 800 unit eyes, or ommatidia, each of which contains eight photoreceptors. Photoreceptors 1\u20136 (R1\u2013R6) project to the first optic neuropil, or lamina, whereas R7 and R8 project deeper into the brain [1(3R4 and 2)3R4 were isolated. As shown in 3R4 are smooth and have a normal external morphology, suggesting that eye development is normal. ERGs, extracellular recordings that measure the response of photoreceptor neurons to a light stimulus, were performed on animals with eyes mutant for either allele. 3R4 mutants exhibit a reduced depolarization and reduced on/off response in young animals  [\u03944790\u20131 and \u03944790\u20132, were generated that cause deletions of the first three or four exons   insertedur exons B; blue. CG13645 encodes NMNAT, a nicotinamide mononucleotide adenylyltransferase, which is a conserved, essential enzyme in most organisms. In humans, three isoforms, NMNAT1, \u22122, and \u22123, have been cloned, and their enzymatic properties have been analyzed [Nmnat1 has been characterized, mostly as part of the chimeric Wlds protein. Drosophila CG13645 is equally homologous to mouse and human NMNAT1, \u22122, or \u22123 with approximately 45% identity over the entire protein , or two amino acids in the substrate binding motifs are mutated (W98G/R224A and \u201cWR\u201d), the enzymatic activity is reduced to approximately 1% or less of the wild-type protein  and P365 trp [nmnat mutant retinae have similar but more severe defects  , revealsnmnat mutant eyes, we compared the morphology of mutant photoreceptors with neighboring wild-type cells by immunofluorescence labeling with several markers. We immunolabeled with antibodies against Actin to reveal rhabdomere structures, Armadillo to reveal the presence and morphology of adherence junctions between photoreceptors, and NMNAT to identify mutant cells. Photoreceptor subtype specification and differentiation are mostly completed by 50% of pupal development [nmnat is not required for photoreceptor differentiation and development, but rather for the maintenance and integrity of mature neurons. In addition, loss of nmnat causes a general and severe neurodegenerative phenotype that spans all structures of the neuron including rhabdomeres, cell bodies, axons, and active zones. Hence, nmnat is required for neuronal integrity after differentiation.To assess whether the development of the photoreceptors and accessory cells are affected in elopment . We thernmnat mutant photoreceptors are raised in the dark and sectioned at 1 d of age for TEM, they exhibit an overall normal organization of ommatidia similar to wild-type controls  encodes a phospholipase C, which is required for phototransduction [P24norpA mutants, phototransduction is blocked [P24norpA and nmnat, neurodegeneration is partially suppressed   , indicat(actin-GAL4), only the wild-type NMNAT is able to rescue the mutant animal to adulthood trp [nmnat. Finally, overexpression of nmnat in flies that are exposed to intense light potently protects against neuronal degeneration. These observations provide evidence that NMNAT functions to maintain the integrity of mature neurons by protecting them from use-dependent degeneration. This protection is likely to be independent of the NAD synthesis activity of NMNAT, because enzymatically inactive NMNAT proteins protect as effectively as the wild-type protein. Hence, our data indicate that a normal neuronal function of nmnat is to protect from activity-induced neurodegeneration. It is possible that the endogenous level of NMNAT is only sufficient to cope with the deterioration caused by normal levels of neuronal activity, but not enough for injury, which would require higher levels of restorative NMNAT. We propose that in the absence of NMNAT, the deterioration caused by normal activity cannot be overcome and is enough to induce degeneration.Our mutant analyses provide the first evidence that neuroprotection is a normal function of the endogenous protein, in contrast to previous overexpression reports ,18. SevetrpP365) ,39,48, anmnat mutant eyes suggests that nmnat is not required for neuronal specification, differentiation, axon pathfinding, or synapse formation. Given that NAD is required for cell survival, it is likely that NAD production by other enzymes compensates for the NAD synthesis function of nmnat, because NMNAT catalyzes one of the salvage pathways of NAD synthesis [The normal development of ynthesis . The de ynthesis   in vitro, and relocates it to the nucleus in cultured cells, suggesting a potential role for chaperones [If the neuroprotective effect of MNNAT/Wldrocesses ,54\u201361. Stination . Interesaperones .nmnat is to maintain neuronal integrity under normal conditions, and neuronal activity potentiates the degeneration that occurs when Nmnat is lost. By extension, more NMNAT protects neurons from neuronal activity induced degeneration. This activity, which is enzyme independent, indicates that the protein has two independent functions: NAD synthesis and maintenance of neuronal integrity.In conclusion, our genetic and functional analyses present evidence that, in addition to its NAD synthesis activity, a neuronal function of Flies were reared at room temperature in ambient light under a normal 12-h light/dark cycle. For dark-rearing experiments, flies were kept in complete darkness from the first instar larval stage onwards. For pupal staging experiments, flies were reared at 25 \u00b0C .The full-length cDNA was cloned into the pET28a  vector for protein expression (gift of S. Wu). The cDNA fragment was cloned into EcoRI and NotI restriction sites using PCR primers that introduced those sites into the cDNA fragment as described for the cDNA rescue construct. Guinea pig antibodies against this domain were raised by Cocalico Biologicals  using the purified recombinant protein. The polyclonal antisera were purified using the Protein A IgG Purification kit . Antibody specificity was confirmed by lack of staining in mutant clonal tissue incubated with anti-NMNAT  and S2.+t7.2=neoFRT}82By w;; P{ry isogenized flies were used for mutagenesis and as control animals. Mutagenesis, ERGs, and phototaxis assays were performed as described [eyFLP screen of chromosome arm 3R is described in Mehta et al. [escribed . The eyFa et al. .nmnat genomic locus flanked by 0.4 kb of upstream genomic sequence and 0.5 kb of downstream sequence. The following primers were used to amplify this sequence from a clone in P1 phage library containing the CG13645 locus: primer1 5\u2032-accgaattcgagcaggagcccgccacac-3\u2032 and primer 2 5\u2032-ataagaatgcggccgcgtggactcttccaagggaagcaagc-3\u2032. Primer 1 contains an EcoRI site and primer 2 contains a NotI site to facilitate cloning. After sequence verification, the genomic fragment was cloned into the vector pP{CaSpeR-4}, and transgenic flies were generated. For cDNA rescue experiments, we cloned the full coding sequence of cDNA clone AT23490  into pP{UAST} and pP{UAST-HA} (gift from B. Tavsanli), and generated several transgenic lines. The following primers were used to introduce EcoRI and NotI sites at the ends of the nmnat coding sequence for ease of cloning: 5\u2032\u2013CCGGAATTCATGTCAGCATTCATCGAGGAAAC-3\u2032 and 5\u2032\u2013TTTTCCTTTTGCGGCCGCAGAGTCGCATTCGGTCGGAGCCG-3\u2032.Our genomic rescue construct consists of the nmnat cDNA in pET28a vector using QuikChange Site-Directed Mutagenesis Kit . The H30A, W98G, and R224A mutations were made by one round of mutagenesis, and the WR double mutation was made by sequential mutagenesis. The recombinant protein was generated, and the protein concentration was measured by Bradford assay . The mutant cDNAs nmnat-H30A and nmnat-WR were subcloned into pP{UAST}, and transgenic lines were generated.Inactive enzyme was created by site-directed mutagenesis of full-length 2, 1.17 mM ATP, 15 U yeast alcohol dehydrogenase , purified recombinant NMNAT, and was initiated by adding NMN to a final concentration of 0.625 mM. The activity is determined from the linear progression curve using the following formula:Co\u03b2-NADH, the extinction coefficient of \u03b2-NADH at 340 nm, is 6.22.Activity of NMNAT (synthesis of NAD) was measured in a continuous coupled enzyme assay by monitoring the increase in absorbance at 340 nm caused by the reduction of NAD to NADH as described . Briefly2 (pH 7.2), and postfixed in 2% OsO4. The 200 nm\u2013thick sections of retina were stained with 1% toludine blue O, 1% sodium tetraborate . The 50-nm thin sections were stained with 4% uranyl acetate and 2.5% lead nitrate. Synaptic features of laminae were scored double-blind by several observers. For photoreceptor terminal quantification, photoreceptor terminals were identified by the presence of capitate projections [Flies of different ages were dissected and fixed at 4 \u00b0C in 2% paraformaldehyde; 2% glutaraldehyde; 0.1 M sodium cacodylate; 0.005% CaCljections . In all Eye discs, third instar larval fillets, and larval, pupal, and adult brains were fixed in phosphate buffered saline (PBS) with 3.5% formaldehyde for 15 min and washed in phosphate buffered saline with 0.4% Triton X-100, or with 0.2% Tween 20 for larval neuromuscular junction preparations. Antibody dilutions used: anti-NMNAT 1:1,000; anti-Armadillo 1:200; mAb nc82 1:100; anti-Actin mAb C4 1:200 ; and TOTO3 1:2,000 . Anti-HRP and secondary antibodies conjugated to Cy3, Cy5, or Alexa 488  were used at 1:250. All antibody incubations were performed at 4 \u00b0C overnight in the presence of 5% normal goat serum.Images from fluorescently labeled specimens were taken on a Zeiss LSM510 confocal microscope  and processed using Amira 3.0  and Adobe Photoshop 7.0 .nmnat mutant photoreceptor cells compared to their wild-type neighbors. All eye discs and laminae shown with 50% mutant photoreceptor terminals are from animals of the following genotype: +=UAS-mCD8::GFP.L}LL4 / GMR-GAL4; FRT82B nmnat/ FRT82B P{w+=tub-GAL80}y w eyFLP GMR-lacZ; P{{w. The negatively marked mutant eye disc clones in +mC=Ubi-GFP.nls}.y w eyFLP GMR-lacZ; FRT82B nmnat/ FRT82B P{wWe used the MARCM technique  to analyFigure S1GMR-GAL4 in the 1nmnat mutant background (E). Both genomic DNA and cDNA expression rescue the magnitude of depolarization and on/off transients. The genotypes are marked at the top of each column. (B), (D), and (F) Retinal structures of each genotype. Both genomic DNA and cDNA expression restore the ommatidial morphology.(A\u2013F) ERG recordings of mutant photoreceptors (A), photoreceptors expressing the CG13645 genomic DNA (C), or photoreceptors expressing CG13645 cDNA driven by (G\u2013I) TEM micrographs of lamina cartridges of each genotype. Both genomic DNA and cDNA expression restore the photoreceptor terminal structure and organization. Demarcating glia are colored blue and photoreceptor terminals green. Scale bar in (G) for (G\u2013I) indicates 1 \u03bcm.(J\u2013O) Individual terminals boxed in (G\u2013I). The active zone structures are well organized with defined platform structures (arrowheads), compared to the amorphous structures in the mutant terminals (arrows in J and K). Scale bar in (J) for (J\u2013N) indicates 200 nm.(8.8 MB TIF)Click here for additional data file.Figure S2(iso) or 1,\u03944790\u20131, \u03944790\u20132, nmnat or 2nmnat mutant clones are negatively marked. GFP marks the wild-type patch. Eye discs are labeled with NMNAT antibody and TOTO3 to reveal the nuclei. In 1,\u03944790\u20131, \u03944790\u20132, nmnat or 2nmnat mutant clones, NMNAT staining is dramatically reduced. The level of reduction in staining in 1nmnat or 2nmnat clones is similar to the level in \u03944790\u20131 or \u03944790\u20132 clones, suggesting that 1nmnat and 2nmnat are likely protein null alleles. Scale bars indicate 5 \u03bcm.Mosaic analysis of third instar larval eye disc. Wild-type control (8.3 MB TIF)Click here for additional data file.Figure S3Click here for additional data file.GMR-GAL4 DriverNMNAT and NMNAT-WR Are Expressed at Similar Levels Using the GMR-GAL4 or elav-GAL4 in a wild-type background. Endogenous NMNAT and overexpressed NMNAT or NMNAT-WR show slightly different migration patterns, in which endogenous protein is highest around 35 kDa (arrow head 1), and overexpressed NMNAT (arrowhead 3) at around 30 kDa and NMNAT-WR (arrowhead 2) at 32 kDa. The difference in size is likely due to post-translational modification. The expression level of NMNAT-WR is slightly lower than NMNAT when driven with elav-GAL4. Blotting for Actin was used as a control for equal loading.Western blot of fly heads showing the level of NMNAT or NMNAT-WR overexpression driven by either (1.3 MB TIF)Figure S4NAD can be synthesized through the de novo pathway from L-tryptophan, or two salvage pathways from either nicotinic acid (Na) or nicotinamide (Nam). The fly homologs identified based on sequence homology are shown in red.(2.6 MB TIF)Click here for additional data file.Table S1nmnat mutant photoreceptors. However, only the wild-type NMNAT, but not the enzymatically inactive NMNAT, can rescue the organismal lethality caused by loss of nmnat.Both the wild-type and the inactive enzymes can rescue the morphological and physiological phenotypes of (33 KB DOC)Click here for additional data file."}
+{"text": "There is no evidence for a gradient of sdf1a expression, however, and the origin of the directionality of migration is not known.The formation of the posterior lateral line of teleosts depends on the migration of a primordium that originates near the otic vesicle and moves to the tip of the tail. Groups of cells at the trailing edge of the primordium slow down at regular intervals and eventually settle to differentiate as sense organs. The migration of the primordium is driven by the chemokine SDF1 and by its receptor CXCR4, encoded respectively by the genes cxcr7, in the migrating primordium. We show that cxcr7 is highly expressed in the trailing cells of the primordium but not at all in the leading cells, a pattern that is complementary to that of cxcr4b. Even though cxcr7 is not expressed in the cells that lead primordium migration, its inactivation results in impaired migration. The phenotypes of cxcr4b, cxcr7 double morphant embryos suggest, however, that CXCR7 does not contribute to the migratory capabilities of primordium cells. We also show that, in the absence of cxcr4b, expression of cxcr7 becomes ubiquitous in the stalled primordium.Here we document the expression of a second chemokine receptor gene, Our observations suggest that CXCR7 is required to provide directionality to the migration. We propose that directionality is imposed on the primordium as soon as it comes in contact with the stripe of SDF1, and is maintained throughout migration by a negative interaction between the two receptors. This has led to substantial progress in understanding the cell biology of migration as well as the many receptor molecules and signaling cascades involved. Migration is crucially dependent on the cell environment, however, and ideally one would like to study its control in a system where migration can be visualized in vivo and in real time.Directed cell migration is involved in many aspects of development including the establishment of the embryonic body plan, organogenesis and organ function. It also plays a role in several pathological processes, notably the spread of tumour cells and formation of metastases. Identification of the molecules governing cell migration is therefore of major importance. Most work on cell migration relies on The lateral-line system of the zebrafish has emerged recently as a useful model for studying the process of long-distance cell migration and for unraveling its genetic control . The latAll neuromasts of the PLL originate from a sensory placode that forms just posterior to the otic vesicle ,6. A grocxcr4b, is expressed in the migrating cells and is down-regulated in the cells at the trailing edge of the primordium [sdf1a in morphant embryos, or of cxcr4b in mutant or morphant embryos, results in an arrest of migration [cxcr4b inactivation has been observed in a mutant line of the more derived fish Oryzias latipes (medaka) [The primordium is guided along a trail of cells that express the chemokine SDF1, and its migration depends on the partner of SDF1, the chemokine receptor CXCR4 ,12. One imordium . The inaigration ,12. A si(medaka) . Medaka In an attempt to discover other elements that contribute to the control of migration we have examined other genes that display heterogeneous patterns of expression within the migrating primordium. Here we report the description of another chemokine receptor, CXCR7. Although long considered an orphan receptor, CXCR7 has recently been shown to recognize SDF1  and posscxcr7 as an EST potentially involved in the control of PLL primordium migration based on its pattern of expression . Interestingly, however, there is essentially no conservation between the C-terminals of the two receptors (an amazingly low 6% in either fish or human), strongly suggesting that CXCR4 and CXCR7 act through different cytoplasmic effectors and play different roles in the control of migration.The PLL placode is first detected around 19 hpf (hours post fertilization) and segregates in a static cell mass that becomes the sensory ganglion, and a migrating primordium that moves posteriorwards . The pricxcr7 during primordium migration was assessed by in situ hybridization in whole mount embryos. Expression of cxcr7 is confined to the trailing cells of the migrating primordium , nose, eye, and kidneys (not shown). In most places the pattern of expression of cxcr7 appears highly dynamical.Besides the PLL, cxcr7 is expressed in the trailing part of the primordium, that is, in the cells that are about to be deposited  and double in situ hybridization is not as sensitive as single in situ in our hands.A comparison of the profiles of sdf1a at the onset of migration. At around 20 hpf sdf1a is expressed in a few cells at the anterior edge of the most anterior somites (not shown). Expression then extends to intervening cells such that a thin stripe of cells express the gene  at a concentration of 1.25 mM. At this concentration the survival rate is 95% and the embryos show no detectable delay in development or morphological abnormality. The embryos were labeled at 48 hpf for alkaline phosphatase. This enzyme is specifically expressed in the mature neuromasts and to a lesser extent in the undifferentiated cells of the PLL system, primordia and interneuromastic cells , or that it migrates at a reduced speed (9 cases). The speed varied between 0.2 somite and 0.7 somite per hour depending on the embryo, with an average of 0.4 \u00b1 0.17 somite per hour. The speed in the wild type is 1.5 \u2013 1.7 somite/hour. In the 9 embryos where migration was slowed down, the position reached by the primordium at 48 hpf was at most two somites beyond the position that the primordium occupied at 36 hpf, suggesting that migration stopped a few hours after 36 hpf, at about the time when migration stops in the wild type (40 hpf).cxcr4b is essential for proper migration of the primordium. Its pattern of expression fits well with this role, as it is highly expressed in the migrating cells of the primordium and less so in the trailing cells which are beginning to slow down. We have shown that the gene cxcr7 is also required for proper migration, yet its pattern of expression is opposite to that of cxcr4b as it is highly expressed in the cells that are being deposited, and not at all in the actively migrating cells.The gene cxcr4b and cxcr7, we first compared the phenotypes of cxcr4b-MO, of cxcr7-MO and of double cxcr4b-MO, cxcr7-MO embryos at 48 hpf. We used two different cxcr4b morpholinos, as discussed in Methods, one with a low survival rate, low penetrance and very high expressivity  and oner4b-MO2, ). Since cxcr4b-MO1 is very similar to the strongest phenotype of cxcr7-MO, with one or two neuromasts around somite 1 . The primordium never extends beyond somite 5 in embryos that are injected with cxcr4b-MO alone. It appears, therefore, that the expression of cxcr7 aggravates the effect of cxcr4b deprivation. We conclude that CXCR7 may have an antagonistic role to that of CXCR4 in the primordium, consistent with their complementary patterns of expression.The phenotype of embryos injected with cxcr4b-MO2 is milder than that of cxcr4b-MO1 morphants and resembles that of cxcr7 morphants  where primI is stalled between 10s-15s, in 35% of the cases (5/14) when primI is found between 16s-25s and in 100% of the cases (N = 10) when primI migrates normally.We examined the effect of cxcr7 morphants neuromast D1 is present in all cases, suggesting that the secondary primordium forms normally , supporting the idea that the inactivation of cxcr7 affects specifically the migration of primII.We verified this result in 6 days-old larvae where primII has deposited 3\u20134 neuromasts and the dorsal line also comprises 2\u20133 neuromasts. Secondary PLL neuromasts can be distinguished from primary neuromasts by their polarization which is revealed by anisotropic alkaline phosphatase labelling. Among 42 severely affected cxcr7 is not detectably expressed in primII, the easiest explanation for the lack of primII migration in morphant embryos is that primII relies on a trail left by primI  such that if primI does not migrate neither can primII. The effect of cxcr7 inactivation on primII migration would therefore be indirect. We cannot, however, exclude the possibility that cxcr7 is transcribed in primII at such a low level that its expression would escape detection by in situ hybridization.Since The zebrafish lateral line is emerging as an attractive system to study programmed cell migration. A number of studies have conclusively demonstrated that in this system migration depends on the interaction between the chemokine SDF1, which labels the path of migration, and its receptor CXCR4, which is present on the migrating cells ,11,12. SMuch has been learned about the implication of the SDF1/CXCR4 system in cell migration in the immune system, where cells seem to behave independently of each other. In the case of the PLL, however, cells move as a disciplined cohort and act in a coordinated manner. They keep their relative positions during migration and the cells that are deposited are always the trailing cells of the primordium ,8. In thcxcr4b is expressed in all cells of the primordium but its level of expression is lower in the trailing cells, consistent with the fact that those cells will soon slow down and stop migrating. Thus the pattern of expression of cxcr4b fits perfectly with an active role in cell migration. In this paper we describe the expression of the gene that encodes another chemokine receptor, CXCR7. The gene cxcr7 is expressed in the primordium in a pattern that is complementary to that of cxcr4b. Thus cxcr7 is maximally expressed in the cells that will be deposited next, and not at all in the actively migrating cells of the leading half of the primordium. It came as a surprise, therefore, to find that the inactivation of cxcr7 blocks migration much as the inactivation of cxcr4b. We heard from Darren Gilmour, at a recent meeting  that he has obtained very similar results about the expression and inactivation of cxcr7.The gene cxcr7 comes from the analysis of the simultaneous inactivation of cxcr7 and of cxcr4b, as compared to the inactivation of cxcr4b alone. The phenotype of cxcr4b morphants, where cxcr7 is active, is substantially stronger than the phenotype of the double morphant, where cxcr7 is not active. We conclude that in conditions of reduced cxcr4b expression, the expression of cxcr7 has a negative effect on the residual migration of the primordium, consistent with its expression in the cells that are slowing down in wild type embryos.A cue to the function of cxcr7 comes from the observation that the inactivation of cxcr4b results in a deregulation of cxcr7, which becomes expressed in most or all cells of the primordium instead of being confined to its anteriormost (trailing) region. The down-regulation of cxcr7 by SDF1/CXCR4 in wild type embryos is consistent with the idea that the presence of CXCR7 in the leading cells would be detrimental for migration. Deregulation of cxcr7 in cxcr4b-MO embryos probably contributes to the aggravation of phenotype observed in cxcr4b-MO1 embryos vs the double cxcr4b, cxcr7 morphants.A second cue to the function of cxcr7 inactivation would not impair migration per se, but would make it impossible for the primordium cells to move coherently in one direction, thereby resulting in stalling of the direction-less primordium.How could a receptor that has a negative effect on migration be indispensable for migration? One obvious possibility is that CXCR7 is involved in defining the directionality of migration. Thus sdf1 appears constant along the myoseptum. This suggest that the primordium has an intrinsic polarity, with a \"plus\" end at its leading edge and a \"minus\" end at the trailing edge. The idea that the primordium is intrinsically polarized is supported by experiments showing that a primordium confronted to an interruption in the SDF1 trail will sometimes make a U-turn and follow the trail of SDF1 in the opposite direction, towards the head [cxcr4b is inactivated [cxcr4b expression underlies the directionality of primordium migration. Our results suggest that this intrinsic asymmetry depends at least in part on the localized expression of cxcr7 in the trailing region and/or on its absence in the leading region.The PLL primordium migrates consistently from anterior to posterior even though the expression of the head . Furtherctivated . These rcxcr7 in polarizing primordium migration? We suggest that the expression of cxcr7 defines the \"minus\" end of the primordium, such that even though the distribution of SDF1 is uniform along the pathway the primordium will move in the direction of its \"plus\" end. CXCR7 could define this \"minus\" end by maintaining or amplifying an early asymmetry in the activity of CXCR4 and/or expression of cxcr4b (see below for a possible origin of this asymmetry). Directional migration would then ultimately depend on the asymmetry in CXCR4 activity as cartooned in Fig. What could be the role of cxcr4 gene. The activation of CXCR4 by SDF1 promotes the formation of NF\u03baB [cxcr4 [cxcr4b expression. Thus an antagonistic effect of CXCR7 on CXCR4 activity may be achieved at two levels: first by sequestering its ligand SDF1, second by preventing the self-activation of cxcr4b. We cannot rule out, of course, that in addition to an inhibition of CXCR4 signalling, CXCR7 activation by SDF1 also has a more direct effect on migration directionality.An antagonistic effect of CXCR7 on CXCR4 activation could be based on the high affinity of CXCR7 for SDF1, ten times higher than the affinity of CXCR4 for the same ligand . The eff of NF\u03baB , which iB [cxcr4 . We havecxcr4b expression may result in fluctuations in the cellular concentration of CXCR4, with some cells having a higher or lower concentration relative to their companions. The cells with a higher residual level of CXCR4 may then take the lead and the cells with a lower level may end up in the trailing region [cxcr7 is not expressed. This would explain why, depending on the strength of cxcr4b morpholino inactivation, the expression of cxcr7 may either prevent migration altogether (cxcr4b-MO1), or simply make it more erratic (cxcr4b-MO2).In morpholino conditions, reduced levels of g region , therebycxcr4b and cxcr7 be initiated? We have observed that cxcr4b is expressed before the onset of migration, while cxcr7 is expressed later on. As the primordium splits from the ganglion and elongates, its most posterior cells come in contact with the stripe of SDF1 . Activation of CXCR4 by SDF1 will induce migration of these cells along the SDF1 track, bringing the next cells in contact with SDF1. The migration of more and more cells along the myoseptum will lead to a progressive depletion of SDF1 through internalization of the ligand-receptor complex. Thus the last cells to come in will have a reduced level of CXCR4 activation, thereby allowing cxcr7 to become expressed. This would establish an early anisotropy of the primordium which would then be maintained due to the negative effect of cxcr4b on cxcr7 expression in the leading cells, and to the reciprocal negative effect of CXCR7 on CXCR4 function (through masking of SDF1) in the trailing cells.How could the anisotropy in the expression of Such a stable anisotropy would explain why, when a primordium turns back due to an interruption in the trail of SDF1, the cells do not simply go the other way around but the entire primordium doubles upon itself in a spectacular U-turn, such that its leading region will remain at the leading edge . The facThe migration of primordium cells as an organized cohort  may thusWe propose that the directional migration of the PLL primordium is determined by an intrinsic asymmetry due to the reciprocal distribution of two chemokine receptors that recognize the same ligand, chemokine SDF1: CXCR4 at the leading edge of the migrating primordium, and CXCR7 at its trailing edge. The interplay between the two receptors ensures that a constant distribution of SDF1 along the pathway is translated as a graded distribution of activated CXCR4 along the primordium, forcing primordium cells to move in the direction of higher SDF1/CXCR4 signalling, that is, in the direction of the leading cells and away from the trailing cells. The reciprocal expression of the two receptor genes is maintained through antagonistic interactions, and may originate automatically at the onset of migration due to the presence of the SDF1 stripe at one side of the newly born primordium.Zebrafish (Danio rerio) were obtained from Singapour through a local company, Antinea, and maintained in standard conditions . Embryoscxcr7 was initially identified as an EST (cb900) and selected on the basis of its expression pattern [Homo sapiens, Mus Musculus and Rattus norvegicus) revealed that this gene codes for the fish homolog of the chemokine receptor CXCR7.The gene  pattern . This EScxcr7 or cxcr4b mRNA. The MO-cxcr7 sequence is: 5'TCATTCACGTTCACACTCATCTTGG-3'. The control morpholino had the following mismatches (underlined) : 5'TCATACACCTTGACACACATCTAGG-3'.Morpholinos oligonucleotides  were dissolved at 1.25 mM in 0.2 mM KCl and injected at the one-cell stage. This concentration gave the best combination of survival and phenotype. When 2 morpholinos were injected simultaneously, the solution contained each morpholino at a concentration of 1.25 mM. The antisense Morpholino sequences were designed to inhibit the translation of cxcr4b, two Morpholinos sequences were used: MO1-cxcr4b  but a high expressivity . Inactivation of sdf1a was done as described previously [In the case of ATTT-3', ) and MO2CCAT-3', ). The boCCAT-3', , MO1-cxceviously .20 to 35 hpf embryos were manually dechorionated, fixed in PBS-4%PFA for 2 hr at room temperature, rinsed in PBS and in 100% methanol and kept at -20\u00b0C. They were then processed for in situ hybridisation as described in ,36.48 hpf embryos were dechorionated, fixed in PBS-4%PFA for 2 hr at room temperature, rinsed in PBS and, if necessary, kept at 4\u00b0 in PBS for up to a week. They were then processed for alkaline phosphatase labeling as described in .The author(s) declare that they have no competing interests.CDC designed and performed all the experiments. NC took care of fish handling including morpholino injections. AG contributed to the conclusions and drafted the manuscript. All authors read and approved the final manuscript."}
+{"text": "A clear negative correlation between PCA and random migration ability was demonstrated. Our results suggest that the local induction of coagulation by macrophages may immobilize the cells at the site of inflammation.The importance of macrophage procoagulant activity (PCA) to cell migration is presumed. In this study we assayed the relationship between the two functions in guinea-pig peritoneal resident macrophages and cells elicited by a sterile inflammation induction, which lasted up to 6 days. The findings pointed to an"}
+{"text": "Signal transducer and activator of transcription (STAT) 5b is a transcription factor involved in pro-proliferative and pro-survival signaling in a number of solid tumors, including breast cancer. The contribution of STAT5b to breast cancer cell motility has not been explored. This work aims to elucidate the role of STAT5b in breast cancer cell migration.STAT5b was knocked down by using siRNA in two aggressive, highly migratory breast cancer cell lines (BT-549 and MDA-MB-231), and transwell migration assays were performed to determine the importance of STAT5b for their migration. Knockdown-rescue experiments were used to validate the specificity of STAT5b knockdown and to determine which regions/functions of STAT5b are necessary for its role in migration. Live-cell imaging of wound healing and spreading was carried out to examine cell morphology and motility after STAT5b knockdown.1- integrin-mediated migration of breast cancer cells to fibronectin was inhibited with STAT5b knockdown, and loss of STAT5b correlated with loss of directional migration and formation of multiple, highly contractile protrusions upon attachment to fibronectin.Knockdown of STAT5b, but not STAT5a, inhibited migration of BT-549 and MDA-MB-231 breast cancer cells to serum by 60% to 80%, and inhibited migration equally over a range of serum concentrations (0.1% to 10% serum). Migratory inhibition upon STAT5b knockdown could be rescued by reintroduction of wild-type STAT5b, as well as Y699F- and dominant-negative STAT5b mutants, but not an SH2 domain defective R618K-STAT5b mutant. \u03b21-integrin-mediated migration of highly aggressive breast cancer cells.The data presented here demonstrate that STAT5b is integral to breast cancer cell migration and identify a novel, SH2-dependent function of STAT5b in regulating \u03b2 Breast cancer is the second most common cancer in American women. Despite improvements in detection and the development of new treatment strategies, the American Cancer Society estimates that more than 180,000 new cases of breast cancer will be diagnosed, and more than 40,000 women will die of breast cancer this year alone. Because many cancers arise from dysregulation of signaling pathways found in normal cells, one of the difficulties in treating cancers is identifying cancer-specific therapeutic targets. Current targeted therapies have not been as successful as anticipated. This lack of success is due in part to the ability of cancer cells to upregulate alternative signaling pathways to promote growth and tumor progression. Many tumorigenic signaling pathways converge on common nuclear transcription factors, and therefore, targeting these downstream proteins may be more effective [c-myc and cyclin D1 and the anti-apoptotic genes Bcl-xL and Pim-1, to stimulate tumor growth and survival [One such group of transcription factors is the signal transducer and activator of transcription (STAT) family. STATs are a family of transcription factors activated by cytokines or growth factors or both. Seven members of the STAT family are known: STAT 1, 2, 3, 4, 5a, 5b, and 6. STAT proteins are latent in the cytoplasm and require phosphorylation of a conserved C-terminal tyrosine residue for activation. This allows dimerization to occur between the phosphorylated tyrosine of one STAT and the Src homology 2 (SH2) domain of another. Active dimers are translocated to the nucleus, where they bind DNA and regulate gene transcription. STAT proteins regulate transcription of genes involved in a variety of biologic processes, including proliferation, survival, and angiogenesis, all of which are involved in cancer development and progression. Thus, it is not surprising that in the last several years, a role for STATs in tumorigenesis has emerged. Activation of STAT5a and STAT5b occurs in a variety of cancers including both hematopoietic cancers and solid tumors, such as those of the breast, prostate, lung, head and neck, and brain [survival . In addisurvival .To date, most of the work examining STAT5b in breast cancer has focused on its pro-proliferative function, and its role in breast cancer cell migration has not been examined. Importantly, a recent study investigating the effects of STAT5a on breast cancer cell migration and invasion showed that prolactin (Prl)-induced activation of STAT5a inhibited migration and invasion of BT-20 and T-47D human breast cancer cells . STAT5a Given this background, we sought to investigate the potential role of STAT5b, specifically, in the migration of two highly aggressive, highly migratory breast cancer cell lines. We found that STAT5b knockdown inhibited serum- and fibronectin-stimulated migration of both BT-549 and MDA-MB-231 human breast cancer cell lines in a transwell assay. This inhibition was rescued by co-expression of wild-type, Y699F-, and dominant-negative STAT5b but not STAT5b containing a mutation in the SH2 domain. With real-time imaging, we showed that knockdown of STAT5b resulted in decreased directional migration and the formation of multiple protrusions, giving rise to an overall reduction in motility. These results establish, for the first time, an important SH2-dependent function of STAT5b in aggressive breast cancer, further defining its role in tumorigenesis and supporting its potential as a therapeutic target for the treatment of breast cancer.BT-549 and MDA-MB-231 human breast cancer cell lines were obtained from the American Type Culture Collection . Cells were passaged twice per week and maintained in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS). All tissue-culture reagents were purchased from Invitrogen .BT-549 and MDA-MB-231 cells were transfected with siGENOME SMARTpool siRNA targeting human STAT5b or individual custom oligonucleotides specific for STAT5a or STAT5b (siGENOME STAT5b SMARTpool duplex #3), or luciferase duplex control, all purchased from Dharmacon . Transfections were performed by using either Oligofectamine (Invitrogen) or Amaxa nucleofection , by using solution T and program X-013 (MDA-MB-231 cells) or A-023 (BT-549 cells) as per manufacturers' instructions. For knockdown-rescue experiments, cells were transfected simultaneously with siSTAT5b SMARTpool duplex #3 and HA-tagged wild-type-, Y699F-, dominant-negative-, or R618K-STAT5b engineered to be immune to knockdown by introduction of four silent point mutations in the siRNA target sequence. These point mutations were introduced by using QuikChange site-directed mutagenesis , and constructs were sequenced to verify mutations.Cells were lysed in RIPA buffer  containing protease inhibitor cocktail  and sodium orthovanadate , and boiled in 2\u00d7 Laemmli buffer containing \u03b2-mercaptoethanol or 20 mmol/L dithiothreitol for 5 minutes at 100\u00b0C. Protein lysates were separated on 7.5% or 12.5% polyacrylamide gels and transferred to nitrocellulose . Membranes were blocked and incubated with primary antibodies in TBST  containing 5% nonfat dry milk or 3% BSA. STAT5a- and STAT5b-specific polyclonal antibodies were developed by our laboratory, as previously described . Monoclo4 BT-549 cells or 1 \u00d7 105 MDA-MB-231 cells were plated in serum-free (DMEM/0.1% BSA) media into the upper chambers of BD BioCoat Control Chambers , and DMEM containing 0 to 10% FBS was placed in the lower chamber. For \u03b21-integrin blocking experiments, cells were pretreated for 1 hour with DMSO (vehicle control) or 10 \u03bcg/ml monoclonal anti-human \u03b21-integrin antibody , and treatment was left on for the duration of the assay. For migration to extracellular matrix components, the undersides of filters were coated with 0 to10 \u03bcg/ml human plasma fibronectin (FN) (BD Biosciences) or recombinant human vitronectin (VN) (R&D Systems) overnight at 4\u00b0C, as indicated, and DMEM/0.1% BSA was used in both the upper and lower chambers. Plates were incubated at 37\u00b0C, and migration was allowed to proceed for 3 to 6 hours. After this time, nonmigratory cells in the upper chambers were removed with cotton swabs, and the remaining cells were stained with 0.1% crystal violet (Sigma) in 20% ethanol. Cells were counted by using a Zeiss Invertoskop light microscope. Four fields were counted on each of two filters. Results are expressed as average cells per field or relative migration (compared with control).BT-549 and MDA-MB-231 cells were transfected with siRNA, as described earlier. Seventy-two hours after transfection, 5 \u00d7 10Cell were plated on FN-coated (5 \u03bcg/ml) 35-mm Bioptechs delta T dishes . Confluent cell monolayers were wounded by using a 20-\u03bcl pipette tip, and cells migrating into the wound were filmed at 37\u00b0C with time-lapse microscopy by using a Nikon TE200 inverted microscope with a 20\u00d7 differential interference contrast objective and a Bioptechs heated stage. Images were taken with a Hamamatsu Orca camera every 5 minutes for 6 hours and collected with Openlab software . Movies were analyzed by using Image J Manual Tracking software . Single cell nuclei were tracked over time, and migratory speed was calculated by dividing the length of the migration path by the total movie time. Directional persistence was determined as the net displacement divided by the total length of the migration path.Cells were transfected with siRNA oligonucleotides, mKO-paxillin, and GFP-speckle-actin by using Amaxa nucleofection, as described earlier. Seventy-two hours after transfection, cells were plated on FN (2 \u03bcg/ml), and after 20 to 30 minutes of spreading, TIRF images were acquired by using an inverted microscope, 60\u00d7 objective . GFP was excited by using the 488-nm laser line of an Ar ion laser, and RFP was excited by using the 543-nm laser line of an He-Ne laser . Time-lapse images were taken every 3 seconds for 5 minutes with a charge-coupled device camera  and analyzed by using MetaMorph . Protrusion rates were determined by using ImageJ Kymograph software  and calculated as the length of the protrusion divided by the total time of the movie.To determine the importance of STAT5b for breast cancer cell migration, we used siRNA transfection to knock down STAT5b in the highly migratory BT-549 breast cancer cell line. Knockdown of STAT5b to virtually undetectable levels in these cells inhibited their migration to serum by approximately 70% Figure . To ensuIt is well established that STAT5b promotes cell-cycle progression and survival of breast cancer cells -19. To dBy using BT-549 cells, we determined the optimal migration conditions for trans-well assays to be the migration to 1% serum over a 3-hour period. Because these cells require a low dose of serum to migrate, we used them to determine whether increasing concentrations of serum could overcome the effect of STAT5b knockdown. As seen in Figure 5). The total SMARTpool, previously used in the BT-549 cells, was used to determine the effect of dual knockdown of STAT5a and STAT5b in our MDA-MB-231 model system. Whereas knockdown of STAT5b inhibited migration of MDA-MB-231 cells by greater than 50%, knockdown of STAT5a had no significant effect on migration of these cells -tagged wild-type STAT5b that is resistant to knockdown. Consistent with previous experiments, knockdown of STAT5b inhibited migration of MDA-MB-231 cells by approximately 60%. Re-introduction of wild-type STAT5b restored migration to approximately 76% of control levels Figure , confirmAdditional knockdown-rescue experiments were performed to identify the functional domains required for rescue of the siRNA phenotype. We introduced Y699F-, dominant-negative (dn)-, and R618K-STAT5b mutants to test the requirement of transcriptional activity and active Y699-SH2 STAT5b dimers for promoting migration. Y699F-STAT5b cannot be phosphorylated on the conserved tyrosine residue Y699, and dn-STAT5b lacks the C-terminal transactivation domain, rendering these constructs transcriptionally inactive ,17,20. RWe sought to determine the serum component responsible for migration of breast cancer cells as a means of gaining insight into those migratory signaling pathways to which STAT5b contributes. Despite previously published work, we did not observe migration of BT-549 or MDA-MB-231 cells to the chemokine stromal cell-derived factor-1\u03b2 (SDF-1\u03b2) . In addi1-integrin in combination with various \u03b1-integrins. To confirm that fibronectin was indeed a major serum component stimulating migration, we pretreated cells with a \u03b21-integrin blocking antibody and measured migration to serum. Inhibition of \u03b21-integrin receptor inhibited migration of both cell lines to serum by approximately 50% compared with the vehicle control  and vitronectin (VN). Both BT-549 and MDA-MB-231 cells migrated to FN, whereas only BT-549 cells migrated significantly to VN Figure . Therefol Figure .1-integrin-mediated migration, we examined the effect of STAT5b knockdown on migration to FN. Knockdown of STAT5b inhibited migration of both cell lines to FN, to the same extent that knockdown inhibited migration to serum, approximately 40% to 60% . Fibronectin dose curves were performed, and it was found that optimal migration of both BT-549 and MDA-MB-231 cell lines occurred at 2 to 3 \u03bcg/ml FN (data not shown). This is consistent with a study by Hayman and colleagues [% Figure . Taken tWound-healing assays were performed to examine cell morphology and motility during wound closure of cells plated on FN. After STAT5b knockdown, wounds were allowed to close for 6 hours, and time-lapse microscopy was used to track cell movement into the wound. Figure To examine focal adhesion and actin dynamics at the membrane, total internal reflection fluorescence (TIRF) microscopy was used to image cells plated on FN. STAT5b-knockdown cells spread slightly faster on FN and exhibited a striking phenotype characterized by the formation of multiple irregular protrusions Figure . STAT5b-The work presented here establishes an important, previously undiscovered role for STAT5b in the migration of highly aggressive breast cancer cells. Knockdown of STAT5b inhibits migration of BT-549 and MDA-MB-231 human breast cancer cells to serum and fibronectin  or the C-terminal transactivation domain (TAD), evidenced by equivalent rescue of migration with either wt-, Y699F-, or dn-STAT5b Figure . Phosphon Figure , it remaLoss of STAT5b leads to a polarity defect that impedes directional movement Figure . During In summary, these studies are the first to report a role for STAT5b in the migration of breast cancer cells. It is well established that STAT5b positively regulates breast cancer cell proliferation and survival, two processes important for initial tumor formation and growth. These data implicate STAT5b in the later stages of tumorigenesis also, such as migration. Future studies will further elucidate the mechanism by which STAT5b exerts its effect on migration, thereby broadening our understanding of how STAT5b promotes tumorigenesis and possibly metastasis. This will facilitate the long-term goal of defining conditions whereby STAT5b would be an effective therapeutic target for the treatment of breast cancer.Our studies demonstrate a novel function of STAT5b in breast cancer cell migration. The importance of STAT5b in mediating breast cancer cell proliferation and survival has already been established. This work is the first to show a positive regulatory role for STAT5b in breast cancer cell migration. Therefore, STAT5b not only may function in the initiation of tumorigenesis, through its pro-proliferative and pro-survival signaling, but also may promote tumor progression by mediating migration.BSA: bovine serum albumin; DMEM: Dulbecco's modified eagle's medium; DMSO: dimethyl sulfoxide; dn: dominant-negative; EGF: epidermal growth factor; EGFR: epidermal growth factor receptor; F: phenylalanine; FBS: fetal bovine serum; FN: fibronectin; GFP: green fluorescent protein; GH: growth hormone; HA: hemagglutinin; K: lysine; LPA: lysophosphatidic acid; PBS: phosphate-buffered saline; Prl: prolactin; R: arginine; RFP: red fluorescent protein; SCCHN: squamous cell carcinoma of the head and neck; SH2: Src homology domain 2; STAT: signal transducer and activator of transcription; TAD: transactivation domain; TIRF: total internal reflection fluorescence; VN: vitronectin; wt: wild type; Y: tyrosine.The authors declare that they have no competing interests.TMB, CMS, and JTP designed the studies, and TMB performed the experiments. JZ assisted with the TIRF microscopy. All authors analyzed the data, and TMB drafted and revised the manuscript. All authors read and approved the final manuscript."}
+{"text": "The antibacterial activity of bacteriophages has been described rather well. However, knowledge about the direct interactions of bacteriophages with mammalian organisms and their other, i.e. non-antibacterial, activities in mammalian systems is quite scarce. It must be emphasised that bacteriophages are natural parasites of bacteria, which in turn are parasites or symbionts of mammals (including humans). Bacteriophages are constantly present in mammalian bodies and the environment in great amounts. On the other hand, the perspective of the possible use of bacteriophage preparations for antibacterial therapies in cancer patients generates a substantial need to investigate the effects of phages on cancer processes.In these studies the migration of human and mouse melanoma on fibronectin was inhibited by purified T4 and HAP1 bacteriophage preparations. The migration of human melanoma was also inhibited by the HAP1 phage preparation on matrigel. No response of either melanoma cell line to lipopolysaccharide was observed. Therefore the effect of the phage preparations cannot be attributed to lipopolysaccharide. No differences in the effects of T4 and HAP1 on melanoma migration were observed.We believe that these observations are of importance for any further attempts to use bacteriophage preparations in antibacterial treatment. The risk of antibiotic-resistant hospital infections strongly affects cancer patients and these results suggest the possibility of beneficial phage treatment. We also believe that they will contribute to the general understanding of bacteriophage biology, as bacteriophages, extremely ubiquitous entities, are in permanent contact with human organisms. Melanoma and other skin cancers are still among the most serious public health problems. According to the World Health Organization, more than 210,000 skin cancer cases occur every year and about 66,000 patients die as a result. Skin cancers mostly affect humans with light skin; the mortality ratio per 100,000 persons per year is highest in Australia and New Zealand (7.6\u20137.8), in Europe 1.6\u20136.4), and in Canada and the United States 3.3\u20133.8) [.3\u20133.8 [3, and in Bacteriophages, bacterial viruses unable to infect eukaryotic cells, constitute a serious alternative to antibiotic therapy of bacterial infections . These vThe antibacterial activity of bacteriophages has been described rather well and its molecular mechanisms and qualifying agents are also well known. However, knowledge about the direct interactions of bacteriophages with mammalian organisms and their other  activities in mammalian systems is quite scarce. As bacteriophages are unable to infect mammalian cells, they are considered a neutral object characterised by their antigenic properties . It mustThe perspective of the possible use of bacteriophage preparations in cancer patients generates a substantial need to investigate the effects of phages on cancer processes. Interestingly, antimetastatic activity and some inhibition of tumour with T4-like  bacteriophage preparations were observed in mice ,14. A hyin vitro. The study was intended to provide further necessary data on bacteriophages' activity in cancer processes and to verify previous observations. The in vivo anticancer effects of bacteriophages may result from an impact of the investigated preparations on immunological systems (which has to be seriously considered) or from direct interactions with cancer cells. In vitro migration excludes the effect of complex mammalian immunology. As T4-like phages are coliphages, their preparations contain lipopolysaccharide (LPS); even highly purified preparations contain a residual amount of LPS [Here we report our observations of the effect of T4-like phages on human (Hs294T) and mouse (B16) melanoma migration t of LPS . LPS is Escherichia coli B from the Collection of Microorganisms at the IIET. The material comprised highly purified preparations of bacteriophages T4 and HAP1. The bacteriophages were purified by filtration through polysulfone membranes and by two chromatographic techniques: gel filtration on Sepharose 4B  followed by cellulofine sulfate  chromatography [9 pfu/ml (lysates: approx. 3000 U/ml), as determined by chromogenic Limulus amebocyte lysate assay . The phage concentrations were measured by the double-layer method of Adams [108, T4119, and HAP1112, all finally dialysed against phosphate-buffered saline (PBS).T4 phage was purchased from American Type Culture Collection (ATCC) . HAP1 (a T4 sub-strain with a high affinity to melanoma cells) was selected at our institute: the Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Wroclaw (IIET) . The bactography . The purof Adams . The batg. The water phase was collected. Distilled water was added to the remaining phenol phase and the extraction process was repeated. Both phases were dialysed against water for 72 h (water phase) or for 120 h (phenol phase) and lyophilised. To remove nucleic acids, the resultant LPS was ultra-centrifugated , and the LPS suspension was lyophilised again. For the tests, 1 \u03bcg/ml of LPS suspension in PBS was prepared by sonication (30 s). The activity of LPS was determined by chromogenic Limulus amebocyte lysate assay  and it was defined as 4 \u00d7 104 U/ml in the 1-\u03bcg/ml preparation. The residual LPS in the bacteriophage preparations allowed a final concentration in the migration assay of 10 U/ml, which equals 0.25 ng/ml. The LPS sample was diluted with PBS to the various desired concentrations (dose gradient); the control for the phage preparations was 10 U/ml.LPS was prepared at the IIET. Bacteria were grown for 48 h at 37\u00b0C in standard (0.5% NaCl) Luria-Bertani Broth (LB) vigorously aerated by shaking. The bacteria were killed with 0.5% phenol and centrifuged at 39,000 rpm using a flow centrifuge  . The bacThe B16 mouse melanoma cell line and the Hs294T human melanoma cell line were obtained from the ATCC . The lines are maintained at the Cell Culture Collection at IIET.The cells were cultured with normal foetal bovine serum (FBS) media. One day before the migration, the medium was changed: (i) Hs294T was cultured again with medium containing FBS before both fibronectin and matrigel migration and (ii) B16 was cultured in medium containing FBS before the fibronectin migration assay, but in Dulbecco's modified Eagle's medium (DMEM) before the matrigel migration assay as its migration activity was poor and the FBS deficiency stimulated the cells' response to FBS attraction in the migration assay. Before the assay, cells were collected with non-enzymatic Cell Dissociation Solution , centrifuged, resuspended in DMEM (with no FBS), counted in a Burker counting chamber  in light microscopy with trypan, and diluted to the desired concentration. The cells were used immediately in the migration assay.Fibronectin assay: 8-\u03bcm insert membranes  were sterilely covered with fibronectin . Both sides of the membrane were covered with 20 \u03bcl of the fibronectin suspension and incubated for 30 min at 37\u00b0C. Fibronectin was removed and the inserts were washed three times with sterile water. Subsequently, both sides of the membrane were immersed in a 0.1% albumin solution and incubated for 15 min. The inserts were washed three times with sterile water and dried. The prepared inserts were not stored, but used immediately after preparation.2 of the membrane) and slowly dried (overnight in a covered plate) at 37\u00b0C. Such prepared inserts can be stored at -20\u00b0C. If frozen, they were defrosted at 37\u00b0C, and rehydrated with DMEM for 2 hours, and directly applied in the migration assay.Matrigel assay: according to the manufacturer's instructions, the 8-\u03bcm insert membranes  were covered with matrigel diluted 1:4 with DMEM under sterile conditions, with cooling. Only the upper side of the membrane was covered with 10 \u03bcl of the matrigel suspension  were correlated and added at the same final volumes of PBS (125\u2013135 \u03bcl), both in the upper and the lower sections of the migration chamber. All the preparations and cells in the upper section were completed with DMEM and with FBS-containing medium to 0.5 ml in the lower section (according to the manufacturer's instructions). Final concentrations of the bacteriophage preparations were 1.5\u20132.5 \u00d7 109 pfu/ml containing 10 U/ml residual LPS. Concentration of the attracting agent, FBS, in the lower section of the migration chamber was 7.3\u20137.5%.The cells were suspended in DMEM with no FBS, and applied to the upper section of the migration chamber, with 1 \u00d7 102. The time of migration was initially optimised and was 2 h for B16 on fibronectin, 7\u20138 h for B16 on matrigel, 1 h 20 min for Hs294T on fibronectin, and 4.5\u20135 h for Hs294T on matrigel. After this time (following the manufacturer's instructions) the cells from the upper side of the membrane were removed with a cotton swab. The cells on the bottom side of the membrane were fixed and stained with a Diff-Quick Set  and counted by light microscopy. The number of cells per membrane was determined, accumulated into groups, and the average was presented.The migration was carried out at 37\u00b0C with COhttp://www.statsoft.pl.One-way analysis of variance (ANOVA) and the Kruscal-Wallis test with the Statistica 8.0 software package were applied Fibronectin is one of the ECM proteins. Its primary function is cell adhesion to the ECM, which is mediated by fibronectin's RGD sequences, and engagement of specific cell surface receptors. It may involve the probable mechanisms of phage action, so the migration studies were initiated with this protein.The migration assay of B16 melanoma with the bacteriophage preparations and LPS revealed marked and statistically significant inhibition of migration by both T4 phage and HAP1 phage, which was almost the same for both bacteriophages. Migration was inhibited by 34% p = 0.0235) and 36% (0.0164), respectively, compared with the control and by 42% (p = 0.0008) and 44% (0.0006), respectively, compared with 10 U/ml LPS, identical to the residual LPS content in the phage preparations . Its migration was decreased by 31% (p = 0.0423) by T4 compared with PBS. A significant difference between PBS and HAP1 was not observed  . A significant difference between PBS and T4 was not observed . Human melanoma migration was not affected by 10 U/ml LPS  was not observed and the differences from those of the bacteriophage preparations were marked, so the antimigration activity of the studied preparations cannot be attributed to LPS. It should be pointed out that the LPS content in the purified phage preparation was minimal; in this study the final concentration was 0.25 ng/ml (10 U/ml by the chromogenic Limulus amoebocyte lysate assay).The high variability of the assay hindered analysis of the observations. The more general assay with matrigel was also much more variable and it ascertained only an inhibitory effect of HAP1 on Hs294T migration. In the fibronectin assay, significant inhibition was observed both for the mouse (T4 and HAP1) and human (T4) melanoma. This is in line with the hypothesis on the RGD-engaging mechanism of changes in cell migration  as cell in vitro studies allow investigating the direct effects of preparations on migrating cells. This brings us closer to understanding previously observed in vivo antimetastatic effects [in vivo anticancer effects may result from an impact of the investigated preparations on immunological systems, which has to be seriously considered. In vitro migration excludes the effect of complex mammalian immunology. Observations of the \"antimigratory\" effect of bacteriophages suggest that they are able to influence (at least some) cancer cells directly. Previously we investigated the interactions of bacteriophage T4 with mammalian cells, observing an unexpected ability of the bacteriophage to bind weakly to melanoma cells in vitro. We selected bacteriophage HAP1, which was able to bind cancer cells more strongly. Importantly, HAP1 was also much more effective against melanoma metastases in vivo [hoc gene that differentiates bacteriophage HAP1 and its parental strain T4 was found [in vitro. This may suggest that some immunological components are engaged in the activity of HAP1. This phage is different (from T4 phage) in, among other properties, the time and means of clearance from a mammalian organism, which may contribute to these observations. On the other hand, the difference between T4 and HAP1 interactions with melanomas may simply be undetectable in the types of tests conducted.Models of  effects ,14. The  in vivo . A mutatin vitro. We also work on this issue and we hope to be able to present data in the future. It should be pointed out that bacteriophages constitute a strongly diversified group of microorganisms and our observations apply to T4-like phages. Other types of bacteriophages (with different genetics and protein construction) must be investigated and analysed independently. As the risk of antibiotic-resistant hospital infections strongly affects cancer patients, we consider that such investigations are greatly needed. We also believe that they will contribute to the general understanding of bacteriophage biology. Bacteriophages, extremely ubiquitous entities, are in permanent contact with human organisms. They are present in water, food, and soil and constitute a part of the \"microbial flora\" of human skin and gastrointestinal tract and penetrate all tissues. Knowledge about their influence on the human body may be very useful, similar to the knowledge about the \"beneficial\" strains of bacteria that make up our microflora. There may also be some \"beneficial\" bacteriophages in our bodies and in our environment.We believe that our observations are of importance for any further attempts to use bacteriophage preparations in antibacterial treatment. To the best of our knowledge, there are no published data on the effect of bacteriophages on macrophage or lymphocyte  migration The migration of human and mouse melanoma can be inhibited by purified T4 and HAP1 bacteriophage preparations. A response of melanoma cells to LPS (within the investigated range) was not observed, so the antimigration activity of the studied preparations cannot be attributed to LPS. No differences in the effects of T4 and HAP1 on melanoma migration were observed.KD: design and planning of the experiments, migration assays, cell cultures and preparation, bacteriophage sample preparation, LPS sample preparation, results analysis, drafting the manuscript; GS: migration assays, results analysis; PJ: migration assays, cell cultures and preparation; AK: migration assays, JW: cell culture design and control, consultation on cancer cell lines, media, BO: purification of bacteriophages, LPS content determination by chromogenic Limulus amoebocyte lysate assay, MZ: purification of bacteriophages, LPS content determination by chromogenic Limulus amoebocyte lysate assay, KSJ: LPS purification, JB: bacteriophage purification process, GP: preparation of the membranes used in bacteriophage purification, MM: cell cultures and media, AG: design and planning of the experiments, results analysis, manuscript revision."}
+{"text": "Atopic dermatitis (AD) is an inflammatory skindisease in which pathogenesis chemokines arepartially involved. The aim of the paper was toassess the serum level of CXCL-9, CXCL-10, CXCL-11,CXCL-12, CCL-17, CCL-20, CCL-21, CCL-22, CCL-27, andIL-18 chosen in AD patients by ELISA assay. Fortypatients (mean age 11.4 years old) with AD and 50healthy controls were enrolled into the study. Thepatients and controls were divided into two agecategories: under 10 years old (Group 1 and Control 1)and over 10 years old (Group 2 and Control 2).Significantly lower serum concentration of CXCL-9,CXCL-10, CCL-17, and IL-18 and higher concentrationof CXCL-12 and CCL-27 were found in Group 1 whencompared to Control 1. In Group 2 serumconcentration of CXCL-12, CCL-17, CCL-22 was higherthan in Control 2. The obtained results indicate theimbalance in chemokine serum levels in AD whatsuggests their role in the disease pathogenesis. Atopic dermatitis (AD) is a chronic and recurrent disease which concerns 10\u201320% of population , 4. Histopathologically skin lesions present mainly with a dermal infiltrate of mainly CLA+ memory T cells and Langerhans cells . LeukocyIn active skin lesions in the course of AD infiltrates of Th-2 lymphocytes releasing IL-4 and/or IL-13 are found. These cells express CCR4, CCR8, and CRTH2 receptors on their surface. Lymphocytes Th-2 migration is selectively induced by such chemokines as CCL17 and CCL22, which are highly overexpressed on the keratinocytes in AD patients epidermis. These phenomena lead in a consequence to development of local inflammation , 10. In Shimada et al.  found inInterleukin (IL)-18 is involved in pathogenesis of type-2 helper cells-mediated diseases including atopic dermatitis. According to literature, its serum concentration is significantly elevated in AD patients and correlates with clinical severity of the disease , 16.Most literature data point out an important role of chemokine network imbalance in development of atopic dermatitis, however there are scarce data on the complex analysis of serum levels of Th-1- and Th-2-derived chemokines in AD patients. Thus, the aim of the paper was to assess the serum level of CXCL-9, CXCL-10, CXCL-11, CXCL-12, CCL-17, CCL-20, CCL-21, CCL-22, CCL-27, IL-18 in two AD patient groups, below and over 10 years old. Additionally we analyzed serum levels of the chosen chemokines in two groups of healthy volunteers, aged-matched, to note any age-dependent variations in healthy population.n = 23) and over 10 years old . According to this criterion, the control group was divided as well . We used criterion of 10 years old as a cut-off point because this age is believed to initiate adolescence life period. Clinical characteristics of the patients are presented in Forty patients  with AD and 50 healthy controls, age and sex matched were enrolled into the study. AD was diagnosed according to criteria proposed by Hanifin and Rajka . The enrEach patient or his/her parents gave written informed consent before entering the study, and all the experiments were approved by the Local Ethics Committee. The investigations were carried out in accordance with Declaration of Helsinki. Before entering the study the subjects underwent thorough physical examination, and scoring atopic dermatitis (SCORAD) index was assessed . The patP-value of <.05 was considered as statistically significant.Data were analyzed using the Mann-Whitney U test, and correlations coefficients were determined by using the Spearman rank correlation test. A Median concentrations of all the analyzed proteins: CXCL-9, CXCL-10, CXCL-11, CXCL-12, CCL-17, CCL-20, CCL-21, CCL-22, CCL-27, IL-18 are presented in P = .003; 84.8 pg/mL versus 98.0 pg/mL; P = .04; 405.2 pg/mL versus 620.1 pg/mL, P = .04; 64.8 pg/mL versus 94.7 pg/mL, P = .0001; resp.). In Group 1 the median serum concentration of CXCL-12 and CCL-27 was significantly higher than that in the Control 1 group . For other chemokines median serum values did not differ statistically when compared to the Control 1 .The median serum CXCL-9, CXCL-10, CCL-17, and IL-18 level was statistically significantly lower in AD patients from Group 1 when compared to the Control 1 . For other chemokines median serum values did not differ statistically when compared to the Control 2 .The median serum CXCL-12, CCL-17, and CCL-22 levels were significantly higher in AD patients from Group 2 than in the age-matched Control 2 .Comparing serum median levels of analyzed chemokines between two AD groups (Group 1 versus Group 2) the only significant difference was found for CCL-20 which median value was higher in children below 10 years old than in older population (Group 2) . For other chemokines median serum values did not differ statistically when compared two control groups .Comparing CXCL-9, CXCL-11, CCL-17, CCL-20, CCL-22, and IL-18 serum median concentration between Controls 1 and 2 we found significantly higher values in younger population (Control 1) than in Control 2 , CXCL-9 and CXCL-10 , and CXCL-10 and IL-18  was found in AD patients below 10 years old (Group 1).Positive correlation between median serum concentration of CXCL-11 and CXCL-9 , CXCL-11 and CXCL-10 , CXCL-11 and CCL-20 , CXCL-9 and CXCL-10 , CXCL-9 and CCL-20 , CXCL-10 and CCL-20 , and CCL-17 and IL-18 . Moreover in this group we observed a positive correlation between serum median concentration of CCL-22 and patients' age .In Group 2 (AD patients over 10 years old) we found positive correlations of the median serum levels of the analyzed proteins for the following parameters: CXCL-11 and CXCL-9 , CXCL-11 and CCL-22 , CXCL-11 and CCL-17 , CXCL-9 and CXCL-10 , CCL-17 and CCL-22 . Contrary, negative correlation between serum level of CCL-21 and CXCL-9  was noted. Analysing correlation between serum chemokine levels and patients' age we found a negative link for CCL-21 and CCCL-22 .In Control 1 we found positive correlations between serum levels of the following chemokines: CXCL-11 and CCL-21 .In the Control 2 positive correlations were found only between CXCL-10 and CCL-21, and CXCL-17 and CCL-20 .Taking the whole AD group (Group 1 and 2) into statistical analysis we found no correlation between serum levels of analyzed parameters and patients' age, while doing the same analysis for whole control group (Control 1 + Control 2) we found negative correlations between age of the subjects and the following proteins: CCL-17, CCL-22 and IL-18 , while in Group 2 it was found for CCL-17 , CCL-27  and IL-18 . Analysing all the subjects from AD group (Group 1 and 2) IgE serum concentration correlated positively only with CCL-17 .In Group 1 a positive correlation between mean total IgE serum concentration and CCL-20 was found  and IL-18  was noted while in Group 2 eosinophilia correlated positively with CCL-27 . Analyzing all the subjects from AD group (Groups 1 and 2) eosinophilia correlated positively only with CCL-22 .In AD patients below 10 years old (Group 1) a positive correlation between eosinophilia and CCL-20  we found elevated serum levels of CCL-17, CCL-22, and CXCL-12 what also proves their role in AD pathogenesis. Other authors also showed significantly higher concentrations of CCL-17, CCL-22, and eotaxin in AD patients than in healthy control. They found positive correlations between serum level of CCL-17 and CCL-22 and total IgE concentration and as well these chemokines correlated positively with SCORAD index . In our \u03b1 or TNF-\u03b1. In healthy epidermis CCL20 is constitutively expressed in epidermal basal layer, however its expression is significantly lower than in inflammatory skin [In skin biopsies taken from AD patients CCL-20 expression is observed in basal layer of epidermis. This protein is a strong chemoattractant for immature dendritic cells and memory T cells via interactions with CCR6. CCL20 may be induced on keratinocytes under proinflammatory cytokines such: IL-1ory skin , 27. TheTo our knowledge, there are no data on CCL-21 serum levels in AD patients. We examined this chemokine as it is strongly chemoattractive to lymphocytes T, enhances expression of LFA-1 on these cells, and mediates cell-to-cell adhesion. Besides, CCL-21 and CCR7 receptor influence naive T cell migration to lymph nodes where antigen is presented. In healthy skin immunostaining for CCL21 is negative, however it is expressed on dermal endothelial cells in atopic dermatitis . WeningeTo assess chemokines serum levels depending on age in healthy population, we attempted to check differences between Controls 1 and 2. Our analysis revealed a distinct pattern in healthy population than that in AD groups. In younger healthy population we found increased levels of CXCL-9, CXCL-11, CCL-17, CCL-20, CCL-22, and IL-18 while comparing Groups 1 and 2 the only significance concerned CCL-20.  In the study published by Furusyo et al.  no diffe Concluding, we may assume that in younger children with AD a decreased serum level of Th-1-derived chemokines is one of the factors involved in the disease development. The imbalance between Th-1 and Th-2 is probably involved in AD pathogenesis as well, what in our paper is especially emphasized by differences in chemokine concentration between two AD groups and two age-matched controls. Our study, similar to others, revealed significant changes between chemokine levels in AD patients and controls, however not always consistent with other authors what may result from two main reasons. The first one is a new aspect of AD pathogenesis, mostly focused now on the impairment of epidermal barrier and innate immune defense as the primary causative factors involved in AD; only these disturbances lead secondary to induction of adaptive immune response, inflammation development involving chemokines disturbances. The second reason may be the lack of objective and standardized method for AD clinical evaluation, thus the patients enrolled to the studies in different centers, although with the same SCORAD index, may have a little different clinical picture.  Based on literature and our results we conclude that chemokine imbalance is involved in AD pathogenesis, however discrepancies obtained in many studies and relatively small number of the patients included in our study do not allow to draw equivocal conclusions. In our opinion further studies correlating chemokine serum levels, their expression in the skin, and AD clinical picture are required and probably will give new light on the disease pathogenesis."}
+{"text": "Increased serum level of parathyroid hormone (PTH) was found in metastatic prostate cancers. Calcimimetic R-568 was reported to reduce PTH expression, to suppress cell proliferation and to induce apoptosis in parathyroid cells. In this study, we investigated the effect of R-568 on cellular survival of prostate cancer cells.Prostate cancer cell lines LNCaP and PC-3 were used in this study. Cellular survival was determined with MTT, trypan blue exclusion and fluorescent Live/Death assays. Western blot assay was utilized to assess apoptotic events induced by R-568 treatment. JC-1 staining was used to evaluate mitochondrial membrane potential.In cultured prostate cancer LNCaP and PC-3 cells, R-568 treatment significantly reduced cellular survival in a dose- and time-dependent manner. R-568-induced cell death was an apoptotic event, as evidenced by caspase-3 processing and PARP cleavage, as well as JC-1 color change in mitochondria. Knocking down calcium sensing receptor (CaSR) significantly reduced R-568-induced cytotoxicity. Enforced expression of Bcl-xL gene abolished R-568-induced cell death, while loss of Bcl-xL expression led to increased cell death in R-568-treated LNCaP cells,.Taken together, our data demonstrated that calcimimetic R-568 triggers an intrinsic mitochondria-related apoptotic pathway, which is dependent on the CaSR and is modulated by Bcl-xL anti-apoptotic pathway. Calcimimetic agents, like NPS R-568 , is an allosteric agonist for parathyroid calcium-sensing receptor (CaSR) and was shown to lower circulating levels of parathyroid hormone (PTH) in patients with secondary hyperparathyroidism due to late-stage renal diseases . In ain vitro , since in vitro  and to pin vitro . TherefoIn fact, a functional CaSR was detected in human prostate cancer cells ,10. Howe2, RPMI 1640 supplemented with 10% fetal bovine serum (FBS) with antibiotics . Antibodies for PARP, caspase-3, CaSR and Actin were purchased from Santa Cruz Biotech . CaSR small interference RNA (siRNA) mixture and the negative control siRNA were obtained from Santa Cruz Biotech. The calcimimetic R isomer of N-[3-[2-chlorophenyl]propyl]-[R]-\u03b1-methyl-3-methoxybenzylamine (NPS R-568) and its inactive isomer NPS S-568 were kindly provided by Amgen, Inc. .Human prostate cancer PC-3 and LNCaP, as well as LNCaP sublines (LNCaP/Bclxl and LNCaP/LN11) were described in our previous publication -2,5-diphenyl tetrazolium-Bromide] assay, which is based on the conversion of MTT to MTT-formazan by mitochondrial enzyme, a cell growth determination kit  was utilized according to the instruction from the manufacturer. Briefly, cells were seeded at a density of 2 \u00d7 10For trypan blue assay, cells were seeded in 12-well plates, and then treated with various reagents as indicated in the figures. At the end of experiments, viable cells was counted using a hemocytometer after staining with trypan blue as described in our recent publication .For siRNA transfection, cells were plated in 6-well plates and transfected with the siRNA mixture as indicated in the figure using OligoTransfectamine\u2122 , as described in our previous publication . Three d\u00ae Viability/Cytotoxicity kit  was utilized. This kit provides two molecular probes, of which one probe labels the living cells as green based on an intracellular esterase activity and the other probe simultaneously labels the dead cells as red due to the disruption of plasma membrane integrity. The assay was conducted by following the protocol provided by the manufacturer. Briefly, cells were placed in 24-well plates overnight, and treated with R-568 for different time periods as indicated in the figures. At each time points, cells were incubated with the fluorescent dyes (2.0 \u03bcM) for 15 min before micro-images were taken under a fluorescent microscope.To assess the cell death objectively, a LIVE/DEADTo examine the change of mitochondria membrane potential, JC-1 staining assay was used, as described in our previous publication . BrieflyWestern blot was carried out as described previously . BrieflyAll cell culture-based experiments were repeated two or three times. Western blots are presented from representative experiments. The mean and SEM for cell viability assay are shown. The significant differences between groups were analyzed as described in our previous publication , using tThe calcimimetic agent R-568 has been shown to activate CaSR and to induce apoptotic cell death in parathyroid cells in addition to reducing PTH secretion -3. In thTo further illustrate the death inducing effect induced by R-568 treatment, we utilized a Live/Dead assay to objectively evaluate cell death. As shown in Fig It has been shown that CaSR activation is involved in osteoblast cell apoptosis  and R-56via a mitochondria-related mechanism.To further characterize R-568-induced apoptosis, we examined the change of mitochondrial membrane potential using the JC-1 dye, which accumulates in the mitochondria of viable cells as aggregates, which are fluorescent red in color. Conversely, in apoptotic cells, the mitochondrial potential collapses and the JC-1 dye could no longer accumulate in the mitochondria and remains in the cytoplasm in a monomeric form which fluoresces green. As shown in Fig Anti-apoptotic protein Bcl-xL is mainly localized on the mitochondrial membrane and plays an important role in maintenance of membrane potential . Recent The primary goal of this study was to determine the biological effect of the calcimimetic NPS R-568 on prostate cancer cells. Using two commonly used prostate cancer cell lines, AR-positive LNCaP and AR-negative PC-3, we demonstrated that R-568 reduced cell viability of both cell lines in a dose- and time-dependent manner. R-568-induced cell death is an apoptotic response through a mitochondria-related mechanism and CaSR is essential for R-568-induced cell death. These data provided the preliminary evidence that the calcimimetic R-568 might be useful as adjunctive therapeutic agent for advanced prostate cancers although further pre-clinical testing is desirable.Currently, limited information is available for calcimimetic NPS R-568-induced apoptosis in mammalian cells. In this study, we showed that R-568 treatment disrupted mitochondrial membrane potential and that modulation of the anti-apoptotic protein Bcl-xL expression attenuated R-568-induced caspase-3 activation and cell death, suggesting that an intrinsic apoptosis pathway is triggered by R-568 treatment. In both LNCaP and PC-3 cells, R-568-induced cell death was found in a range of concentrations that are similar to the doses used in a recent report to induce apoptosis in isolated rat parathyroid cells , and calvia a CaSR-dependent pathway.CaSR signaling has been studied in multiple cancers and different effects were reported depending on the cell types and agonists used [reviewed in ref. ]. For exvia a mitochondria-related pathway. The usefulness of the calcimimetic agent in managing prostate cancer patients needs further testing in pre-clinical and clinical study.In conclusion, we demonstrated that the calcimimetic R-568 induces apoptotic cell death in prostate cancer cells. R-568-induced apoptotic cell death is AR: androgen receptor; CaSR: calcium sensing receptor; FBS: fetal bovine serum; MTT: -2,5-diphenyltetrazolium bromide]; PARP: poly [ADP-ribose] polymerase; PBS: phosphate-buffered saline; PTH: parathyroid hormone; PTHrP: PTH-related protein; SEM: standard error of mean; SHPT: secondary hyperparathyroidism; TBS-T: Tris-buffered solution plus Tween 20.The authors declare that they have no competing interests.HL, BL and MZ designed the experiments, HL, GR participated in most of the experiments, ZL and XZ carried out the siRNA experiments, HZ and GC conducted the JC-1 experiments, HL and MZ drafted the manuscript. BL was involved in design of the study and performed the statistical analysis and helped to finalize the manuscript. All authors read and approved the final manuscript."}
+{"text": "Protocetidae are middle Eocene (49\u201337 Ma) archaeocete predators ancestral to later whales. They are found in marine sedimentary rocks, but retain four legs and were not yet fully aquatic. Protocetids have been interpreted as amphibious, feeding in the sea but returning to land to rest.Maiacetus inuus, are described from the early middle Eocene Habib Rahi Formation of Pakistan. M. inuus differs from contemporary archaic whales in having a fused mandibular symphysis, distinctive astragalus bones in the ankle, and a less hind-limb dominated postcranial skeleton. One adult skeleton is female and bears the skull and partial skeleton of a single large near-term fetus. The fetal skeleton is positioned for head-first delivery, which typifies land mammals but not extant whales, evidence that birth took place on land. The fetal skeleton has permanent first molars well mineralized, which indicates precocial development at birth. Precocial development, with attendant size and mobility, were as critical for survival of a neonate at the land-sea interface in the Eocene as they are today. The second adult skeleton is the most complete known for a protocetid. The vertebral column, preserved in articulation, has 7 cervicals, 13 thoracics, 6 lumbars, 4 sacrals, and 21 caudals. All four limbs are preserved with hands and feet. This adult is 12% larger in linear dimensions than the female skeleton, on average, has canine teeth that are 20% larger, and is interpreted as male. Moderate sexual dimorphism indicates limited male-male competition during breeding, which in turn suggests little aggregation of food or shelter in the environment inhabited by protocetids.Two adult skeletons of a new 2.6 meter long protocetid, Maiacetus to support its weight on land and corroborates previous ideas that protocetids were amphibious. Specimens this complete are virtual \u2018Rosetta stones\u2019 providing insight into functional capabilities and life history of extinct animals that cannot be gained any other way.Discovery of a near-term fetus positioned for head-first delivery provides important evidence that early protocetid whales gave birth on land. This is consistent with skeletal morphology enabling  Archaeoceti are basal cetaceans that document the evolutionary transition of whales from land to sea during the Eocene before the appearance of modern Mysticeti and Odontoceti Artiocetus and Rodhocetus represented by skulls and partial skeletons with artiodactyl-like ankle bones Maiacetus, described below, was part of this early diversification , and comprise fifteen genera and 16 species that range from South Asia and Africa to North America fication . Basal aDorudon  and were widely distributed in the world's oceans. The best known is the 5-meter long Dorudon . BasilosTwo specimens of a new early middle Eocene (ca. 47.5 Ma) protocetid whale are described below, providing the first nearly complete skeleton of a protocetid whale, the first remains of a fetal skeleton of an archaeocete, and the first direct evidence for birth, life history, and sexual dimorphism in early archaeocetes\u2014 at a time when whales were still amphibious mammals spending some time on land and some time in the sea.Fossil specimens described here were located during surface surveys in Pakistan in 2000 and 2004. These were found as articulated skeletons, and each specimen was separated into blocks of manageable size along cracks during excavation. The blocks were encased in plaster jackets and transported to the laboratory for preparation.The two specimens described here were prepared differently. The three plaster jackets of the adult female (GSP-UM 3475) were opened and cleaned to expose the articulated bones . The venThe nine plaster jackets of the adult male (GSP-UM 3551) were prepared manually with a micro-airscribe. Each block containing bones was molded and cast to create an archive of the position of the bones as found in the field. Each block was then fully prepared to free individual skeletal elements. These associated elements were then assembled into a full skeletal mount for exhibition in the University of Michigan Exhibit Museum see .The fetal dentition described here was imaged with computed tomography using a Philips Tomoscan AVE1 scanner at the Radiologische Klinik, Universit\u00e4t Bonn (Germany).Ma, geological age in millions of years before present.C, cervical vertebra; Ca, caudal vertebra; L, lumbar vertebra; Mc, metacarpal; Mt, metatarsal; R, rib; S, sacral vertebra; and T, thoracic vertebra.I), canines (C), premolars (P), and molars (M) distinguished by superscripts and subscripts, respectively.Teeth are numbered sequentially from front to back , with upper and lower incisors : named for the sex and gravid state of the holotype.Maiacetus inuus sp. nov.Artiocetus clavis and Rodhocetus balochistanensis in having solidly co-ossified left and right dentaries. In the ankle, the astragalus has deep proximal and distal trochleae as in Rodhocetus, but differs in having an indented dorsolateral border; cuboid is less deeply notched for the calcaneum than in Artiocetus and more deeply notched than in Rodhocetus. Metacarpals, carpal phalanges, and all hind limb elements are shorter relative anterior thoracic centrum length than comparable ratios in Rodhocetus.Medium-sized protocetid archaeocete with a skeleton 2.6 m in length and an estimated weight of 280\u2013390 kg. Skull has the medium-length rostrum, anteriorly-positioned nares, large mandibular canals, narrow frontal shield, broad cranial base, and large tympanic bullae typical of early protocetids. Differs from contemporary Maiacetus inuus sp. nov.Inuus, god of fecundity (Latin): named to acknowledge both the exceptional recovery of a gravid female in the cetacean fossil record, and the importance of life history in mammalian evolution.GSP-UM 3475a, articulated skull, thorax, and left forelimb of an adult female. Holotype contains the skull and partially ossified skeleton of a near-term fetus, GSP-UM 3475b . The motKunvit, Kohlu District, eastern Balochistan Province, Pakistan . GPS cooGSP-UM 3551, virtually complete skeleton interpreted as male  and its associated fetal skeleton (GSP-UM 3475b) were collected in three blocks: (1) a cranial block with the female skull, cervical vertebrae, some anterior thoracic vertebrae, and partial scapulae; (2) a block containing the left forelimb of the adult female; and (3) a block containing the thorax of the adult mother whale, and the skull and remaining skeleton of the fetus . Blocks The adult female skull and skeleton came to rest on their dorsal surfaces before burial, as is typical for archaeocetes. This stomach-up orientation may be caused by a buildup of gases in the abdomen during decomposition. Skulls are seemingly more stable lying on their dorsal surface than in any other position.The nearly complete skull of the adult female has been exposed in ventral and dorsal views , 6. It mOn the dorsal surface of the cranium, the external nares open above the upper canine teeth . The nasOn the ventral surface of the cranium the glenoid fossa for articulation of the dentary is open and relatively flat as in other early protocetids. Remnants of the basihyal, tympanohyals, and stylohyal bones can be identified on the ventral surface of the basicranium . The tym2 . All incisors are caniniform with simple conical crowns on a single root. I1\u20132 are large and I3 is relatively small . P3 has the anteroposteriorly longest crown in the upper dentition , I2 is large, and I3 is small  of the adult female (GSP-UM 3475a) are preserved in articulation in the cranial block, but these are difficult to study or measure individually , 5. The A sternebrum and some ribs are present in the cranial block , 6. The The left forelimb was preserved in articulation on the left side of the thorax , 7. A frThe distal row of carpal bones is alternating rather than serial relative to the proximal row. Metacarpal I is the smallest, metacarpals III and IV are the largest, and metacarpal III is distinctly longer than metacarpal IV. With the exception of the pollex (digit I), all of the proximal phalanges are about the same length . Similarly, middle phalanges of digits II through V are similar in length, although phalanx III-2 is distinctly more robust. Terminal phalanges of digits I and V are simple and pointed and probably did not bear a hoof, whereas the blunt end of terminal phalanx II-3 indicates that it was hoof bearing. Terminal phalanges II-3, III-3, and IV-3 in the adult male (GSP-UM 3551) all bore hooves.Preservation of the vertebral column ends at L5. Nothing remains of L6, the sacrum, or the tail. Very little of a hind limb is preserved in the adult female . The lefThe fetal skeleton (GSP-UM 3475b) is preserved within the ribcage of the type specimen (GSP-UM 3475a) , serve as landmarks for identification of more anterior and posterior teeth. Anterior to dP4 and dP4, there are partial crowns of all of the third deciduous premolars (left and right dP3 and dP3), as well as upper and lower deciduous canines. Teeth anterior to dP3 and dP3 were identified by their morphology and by their stage of development, using an undescribed protocetid skull with a good deciduous dentition for comparison.The largest tooth in each quadrant is the distinctive fourth deciduous premolar. These four premolars . It opens internally at the posterior end of the dentary. The mandibular condyles are positioned well below the apex of the coronoid process, and the gonial angle of the mandible is compressed and square in outline  is large and anteroposteriorly expanded. The upper first premolar (P1) is small, while P2 is closer in size to P3 and P4. P3 has the largest crown of the upper cheek teeth. P3-M3 are closely spaced with no diastemata. A protocone is well developed on P4 and on M1. This primitive cusp decreases in size on M2 and nearly disappears on M3. In the lower dentition, C1 and P1 are represented only by impressions of the crowns and roots. The crown of the lower canine crown is longer anteroposteriorly and the root thicker than in the female (GSP-UM 3475a), while P1 is small. Lower P2, P3, and P4 are all relatively large, with P3 or P4 the largest of the lower cheek teeth. The lower molars are closely spaced, with a high anterior cusp (protoconid) and lower posterior cusp (hypoconid).Upper and lower incisors are missing in the adult male (GSP-UM 3551), but the upper canine  is 7C-13T-6L-4S-21Ca for a total of 51 vertebrae, which differs by only two caudal vertebrae from the formula found in some primitive artiodactyls The sacrum is composed of four vertebrae, the first three fully co-ossified and the fourth with fused pleurapophyses. Robust auricular processes are present on S1 for articulation with ilia of the pelvis. The spinous processes of all sacral vertebrae have massive bases. Presence of a solidly fused sacrum precluded smooth undulatory motion of the body during swimming.The caudal series is composed of 21 vertebrae , 9. The The ribs are elongate and moderately curved, with no sign of pachyostosis or osteosclerosis. All but the last few are double-headed. The sternum includes eight elements with a T-shaped manubrium, six sternebrae, and an elongate xiphisternum.The delicate scapula is longer than wide, with a projecting acromion and shallow glenoid; the coracoid process forms a large tubercle above the glenoid. The scapular spine divides the scapular blade unequally into smaller anterior and larger posterior portions. The humerus is relatively long, flattened, and anteriorly curved. Proximally, the head is ovoid with a narrow bicipital groove. Distally, the humerus is narrow with a deep trochlea for the ulna. Posteriorly, there is a deep olecranon fossa. The convex articulation for the radial head is located lateral to the ulnar trochlea. The medial epicondyle is robust and projecting. Ulna and radius are shorter than the humerus . The ulnThe carpus is composed of a series of proximal and distal carpals that vary in shape from ovoid to polygonal . ProximaThe innominate is anchored to the sacrum. The ilium is short anterposteriorly relative to the length of the pelvis. The round, well buttressed acetabulum is notched with a pit for the ligamentum teres. The obturator foramen is large. The ischium is large, flattened, and extends farther from the acetabulum than does the ilium . The pubRodhocetus balochistanensis more than that of similar-sized Artiocetus clavis  The fossils described here include the first association of adult female and fetal whale skeletons, the latter apparently near term and in birth position  . The aduMaiacetus has a piscivorous dentition and, like other early protocetids, is interpreted as an amphibious, semiaquatic, foot-powered swimmer that fed in the sea and came ashore to rest, mate, and give birth, as anticipated by Fordyce Maiacetus from traveling any substantial distance from water. Maiacetus differs from other early protocetids in having dentaries fused at the mandibular symphysis  enables the first unequivocal determination of sex for an archaeocete: GSP-UM 3475a is female. The presence of one fetal skeleton and no trace of a second indicates that birth in Maiacetus, this may have been the fetal position during all of late gestation. Because the head of the fetal skeleton of Maiacetus is not in the mother's pelvic canal, the fetus may have been near term but not full term. Partially formed M1 crowns in the fetal cranium suggest that the fetus was at least near term.The rostrum of the fetal skeleton is pointing opposite that of the mother . PosteriThe fetal skeleton is positioned for head-first birth, a universal birthing posture in large-bodied land mammals, but one that is anomalous in fully-aquatic marine mammals Cephalic presentation at birth is generally held to be advantageous on land as it enables a newborn to breath during labor. Caudal presentation at birth, in contrast, is generally held to be advantageous at sea as it may reduce the risk of drowning Dorudon; Birth at sea was a prerequisite for the first fully-aquatic whales, the Basilosauridae (including 1) are visible posterior to dP4 (best exposed on the left side). The main paracone cusp appears almost fully formed, with the crown as a whole being about one-half mineralized. Formation of the crowns of many deciduous teeth, and particularly formation of M1, indicates that the fetal skeleton of Maiacetus was advanced in development and near full term.The dentition of the fetal skeleton (GSP-UM 3475b) can be mapped in detail . Here pain utero. The permanent dentition, however, shows an enormous range, with some mammals showing no mineralization of permanent teeth at all , and precocial IV at the other  Maiacetus described here shows development of the deciduous dentition to have been well underway, with partial mineralization of upper first permanent molars in utero. The fetal dentition of Maiacetus is as developed as that of a newborn fallow deer  as male because it contains no fetus, averages 12% larger in linear measurements than the known female, and has canine teeth that are 20% larger  to males that are much larger than females  Maiacetus indicates moderate sexual dimorphism and probably limited male-male competition for mates. Limited opportunity to monopolize mates suggests in turn that food and shelter were dispersed in protocetid habitats. This is corroborated by the geographically extensive but environmentally uniform shallow marine deposits of the Habib Rahi Formation, which were deposited on a broad, shallow marine shelf that would have provided little spatial aggregation of food or shelter.The male-female length difference of 12%  in Maiacetus suggests that sexual dimorphism appeared early in cetacean evolution. Males were larger than females, but the difference was modest on the scale of dimorphism observed in marine mammals today.Much remains to be learned about mating systems in cetaceans because their behavior is so difficult to study Maiacetus inuus, that include an adult female skeleton, a near term fetal skeleton, and an adult male skeleton. Maiacetus differs in size and proportions from younger, more derived basilosaurids such as Dorudon atrox  protocetid whale, on atrox , 12, 13,kasranii . Maiacet swimmer .Preservation of an intact near-term fetal skull and partial skeleton indicates that birth in early archaeocetes involved a single calf that was born head-first as in land mammals, not tail-first as in living whales. This, in turn, indicates that birth almost certainly took place on land during this phase of early whale evolution. The presence of partially mineralized permanent first molars in the fetal skull indicates precocial development, which may have been a key life history trait in early whales facilitating the transition from land to sea. Sexual dimorphism in body and canine size are moderate, suggesting limited competition among males for mates."}
+{"text": "Cooling greenhouses is essential to provide a suitable environment for plant growth in arid regions characterized by brackish water resources. However, using conventional cooling methods are facing many challenges. Filtering out near infra-red radiation (NIR) at the greenhouse cover can significantly reduce the heating load and can solve the overheating problem of the greenhouse air. This paper is to review (i) the problems of using conventional cooling methods and (ii) the advantages of greenhouse covers that incorporate NIR reflectors. This survey focuses on how the cover type affects the transmittance of photosynthetically active radiation (PAR), the reflectance or absorptance of NIR and the greenhouse air temperature. NIR-reflecting plastic films seem to be the most suitable, low cost and simple cover for greenhouses under arid conditions. Therefore, this review discusses how various additives should be incorporated in plastic film to increase its mechanical properties, durability and ability to stand up to extremely harsh weather. Presently, NIR-reflecting covers are able to reduce greenhouse air temperature by no more than 5\u00b0C. This reduction is not enough in regions where the ambient temperature may exceed 45\u00b0C in summer. There is a need to develop improved NIR-reflecting plastic film covers. Under such conditions use of conventional cooling methods for greenhouses worldwide faces many difficulties that will be discussed later. In addition, such harsh weather conditions negatively affect the plastic films used for covering greenhouses and rapidly degrade their optical and mechanical properties. Apart from the composite cooling systems such as earth-to-air heat exchanger, methods commercially used to reduce the inside greenhouse air temperature under hot and sunny climatic conditions can be divided into three main categories: ventilation, evaporation, and heat prevention. A survey of the literature and of greenhouse growers revealed that neither ventilation nor evaporation is sufficient for cooling greenhouses in arid regions. However, preventing heat from entering the greenhouse is the most appropriate technique for cooling greenhouses. The objectives of this survey were to (i) summarize the conventional methods used for cooling greenhouses worldwide and the limitations to applying these methods to greenhouses in arid regions, (ii) discuss heat prevention methods, especially those that use covering systems able to block near infrared radiation (NIR: 700\u20132500\u2009nm) as one of the most suitable techniques for greenhouse in arid regions, (iii) review the NIR-reflecting covers that are available in the literature in terms of their transmittance of photosynthetically active radiation (PAR: 400\u2013700\u2009nm) and their reflectance of NIR, and (iv) survey NIR-reflecting film additives that increase the film's mechanical properties, durability, and resistance to harsh and dusty weather.The main technical problem of greenhouses is to maintain air temperatures and relative humidity that are favorable for plant growth in the greenhouse. This can be achieved by heating greenhouse air in winter and cooling it in summer. In cool regions, the technology for heating greenhouses is well established and straightforward. However, in hot and sunny regions, cooling the greenhouse air is a more difficult challenge than heating due to the fact that advances in the greenhouse cooling technology are still limited compared with heating systems. In addition, cooling systems are more expensive to install and operate than heating systems. Several efforts have been made worldwide to adopt greenhouses to hot and sunny climate conditions. Even though, an extensive survey was provided for the greenhouse cooling technologies worldwide , 2; howe Ventilation is accomplished by replacing the existing hot air in the greenhouse with cooler air from the outside. If the outside temperature is low enough, and if the temperature inside the greenhouse is not too high, warm air is exhausted passively through the greenhouse vents . The effectiveness of this system depends on the temperature difference between inside and outside the greenhouse (bouncy effect) and on the wind speed outside the structure (wind effect). At low wind speed, exhaust fans are needed to induce air circulation through the vents (forced ventilation). Many researchers have studied the phenomenon of natural and forced ventilation in agricultural greenhouses \u20138. In ar3 of air space, under atmospheric pressure, this can reduce air temperature by about 2.5\u00b0C. This technique can lower the greenhouse air temperature significantly below the ambient air temperature and can enhance the relative humidity in the greenhouse to the required and desired levels by controlling the evaporated cooling water. Therefore, under arid climatic conditions, evaporative cooling is the most efficient cooling method for controlling the temperature and humidity in greenhouses. Commercial evaporative cooling systems commonly used for cooling greenhouses are the well-known wet-pad and fan system [\u22122 at noon), a single stage evaporative cooler having a new pad could reduce the greenhouse air temperature by about 12\u00b0C and increased the relative humidity by about 30%. These systems operate efficiently in an arid climate if a pure and fresh water resource is available for wetting the pad or for pumping through the nozzles of a fogging system. However, the Arabian Peninsula is characterized by a lack of water resources and the salinity of the water is very high. This causes a fast deterioration in the cooling performance of the wet-pad fan systems due to clogging the pad as affected by salt buildup on the pad surfaces that also restricts the air flow. Clogged pads were found to reduce the cooling system performance significantly, increase the electric energy consumed by the fan motors by about 22%, increase the inside greenhouse air temperature up to 55\u00b0C, and reduce the relative humidity below 10% [Evaporative cooling involves no change in the enthalpy of air/water vapor mixture. It is known that if one gram of water evaporated into 1\u2009mn system \u201311 and fn system \u201317. In on system  reportedn system  found thFor these reasons, neither ventilation nor evaporative cooling techniques are suitable in a region characterized by an arid climate, extensive solar radiation, and high salinity of water resources. Accordingly, deflecting the heat load at the greenhouse cover may provide a promising solution for the overheating problem of the greenhouse air in hot summer seasons under such conditions. This technique will be discussed in the following section. The spectral distribution of global solar radiation flux, on a horizontal surface, that is incident on or transmitted into a greenhouse can be divided into ultraviolet radiation , visible light or photosynthetically active radiation , and near infrared radiation . Over the entire spectrum range of global solar radiation, only the PAR is very important for plant growth; it is absorbed by plants for photosynthesis. Therefore the desirable covers for greenhouses in hot and sunny regions should highly transmit PAR and reject NIR and UV. The contribution of UV radiation to greenhouse heating load is insignificant because it represents only 5% of the global radiation. However, the UV should be rejected because it may harm crops and increase insect population and fungal and diseases. Recently most of the plastic films used for covering greenhouses are UV-absorbers. This reduces pest and disease impact on the crops and lower pesticide load and costs. The NIR is less absorbed by the plants but it is absorbed mainly by the greenhouse floor soil, installations, and construction elements of the greenhouse. Then it is released again to the greenhouse air as convected heat that increases the greenhouse air temperature. Accordingly, NIR is the main source of heat load that should be removed from the greenhouse air to prevent the overheating problem in summer in many sunny areas worldwide.Through heat prevention methods, the radiative heat load can be eliminated or reduced before entering the greenhouse by either absorbing and/or reflecting a portion of the incident radiation on the greenhouse cover. This is accomplished by using commercial shading devices  or by using a radiation filtering roof (blocking the NIR via reflection or absorption and transmitting the PAR).2). Whitening the greenhouse roof is inexpensive, has positive effects on both microclimate and crop behavior, and can be considered an efficient means for alleviating the large heat load during summer [Shading the roof of a greenhouse is usually performed by various conventional methods such as whitening the roof , 21, extg summer , 21. Howg summer . The whig summer . DisadvaFor greenhouses in hot and sunny regions, scientists and companies have worked for many years to develop greenhouse covering systems able to reduce the heat load as well as the air temperature in the greenhouses. Among the previous studies, two systems have been introduced for filtering out the incident solar radiation at the greenhouse cover, that is, a double-layer, fluid-roof cover that includes a liquid radiation filter and a solid-roof such as glass or plastic films that includes NIR reflectors.4 in water has been used to selectively transmit most of the PAR and absorb most of the NIR . A concentration of 1.5%~2% CuSO4-water solution as LRF flowing through a hollow-channeled, rigid plastic (polycarbonate or acrylic) roof of semiclosed greenhouses has been examined via simulation studies and practical tests [2 can be enriched with little or no loss to the outside. Although the fluid-roof cover prevents a considerable amount of heat from entering the greenhouse, its transmission of PAR is relatively low because of the complex structure. For example, for double layers made of polycarbonate sheets (1.5\u2009mm thick) and filled with liquid radiation filter (1.5% CuSO4-water solution), the transmittance of PAR did no exceed 63% [One of the first attempts to eliminate the maximum temperature of air in a glasshouse was carried out by Morris et al.  by flowial tests \u201342. Baseal tests . The heaTo avoid the complexity, possible hazards and the high cost of the fluid-roof covers, many studies have investigated film covers (plastic sheets or glass) that can provide a cooling effect in greenhouses. To accomplish this, plastic films for greenhouse coverings under harsh weather conditions have to match the following requirements: (1) high transmission of PAR, which is the most important portion of the spectrum for plant growth; (2) high reflection of NIR, which is the main source of heat load that needs to be removed from the greenhouse; (3) sufficient light scattering or diffusive effect, which prevents direct radiation which could damage the plants by rising the tissue temperature; (4) resistance to dust accumulation, which is important because it could affect the transmission of light, especially PAR; (5) drip resistance, which prevents the formation of small water droplets on the covering film and the risk of them falling onto the plants and causing fungal disease; (6) high mechanical strength to prevent wind damage; (7) High durability to retard degradation by UV radiation, chemical (pesticide), and high temperature; (8) cooling effect, especially during summer season; and (9) Low cost.This survey covers only three of the previous requirements: cooling effect, high mechanical properties, and durability against photodegradation (UV radiation). These three properties are the most important for greenhouses in arid areas like the Arabian Peninsula. Monolayer PE films, especially Low-Density Polyethylene (LDPE) films, will be considered here because of their low cost and popularity.4-water solution) [4-water solution) on air, plant and, soil temperatures in Japan [Japanese companies  have started since 2000 to develop different types of fluoropolymers and polyethylene-(PE-) based films and acrylic-based rigid sheets with NIR-reflection additives. Samples of these products have been evaluated to compare their suitability for covering greenhouses in hot regions with fluid-roof covers  . The resin Japan . Closed 2. This makes the interference film reflects the NIR without significantly affecting the transmission of PAR. Two German companies (Hyplast/Klerk's and Merck KGaA) joined together to develop an interference film called Kool Lite/Astrolux. This film was commercialized for climate control in regions with high solar irradiance. In order to obtain a stronger reflection of NIR combined with a higher PAR transmission, Merck KGaA had developed Lite/Astrolux film by increasing the coated layers to six including two TiO2 layers, one on each side of the film. The new film was designated as \u201cKool Lite Plus\u201d and has been evaluated and compared with Lite/Astrolux film and a standard diffusive PE film [Pearlescent pigments have been used to produce the so-called interference films. These films consist of three single, nonabsorbing layers, in which the central layer serves as a substrate. The substrate is a fine platelet, and is covered with a fine coating of metal oxides such as TiO PE film . Three iThe NIR can be rejected by applying absorption, reflection, or interference pigments to the polymer during manufacturing the covering materials. Interference pigments reflect the NIR and also the PAR according to the incident angle of solar beam radiation. Therefore, optimizing the orientation of the interference pigment in the polymer is necessary to get the maximum NIR reflection, and maximum PAR transmission through the day. Hoffmann and Waaijenberg  discusseRunkle et al.  investigHemming et al.  examinedHemming et al.  conducte2-water solution) and a newly developed one. According to the reported results in [Hemming et al.  also measults in , the PARGarcia-Alonso et al.  examined2-water solution, a PE film with NIR-reflecting pigment, and a reference PE film without additives for covering identical greenhouses in Southern Spain. The results showed that the whitened cover and the NIR-reflecting cover reduced the PAR transmitted into the greenhouse, respectively, by 24% and 15% compared to the standard PE cover. The whitened cover and the NIR-reflecting cover reduced the NIR transmitted, respectively, by 21.5% and 19.2% compared to the standard PE cover. At around noon, the NIR-reflecting cover and the whitened cover reduced the greenhouse air temperature by 3\u00b0C compared to the standard PE cover. The NIR-reflecting and whitened covers had similar beneficial effects on crop production and quality.Lopez-Marin et al.  examinedImpron et al.  studied NIR-reflecting materials were also added to shading paints, which can be applied as a removable coating to the greenhouse cover. This type of shading is easy to apply and is useful for greenhouses in northern countries with short summer seasons. In 1997, Tanaka  studied Collaboration between Merck Inc. and the University of Hanover (Germany) led to the development of NIR-reflecting pigments  that can be added to shading paint to selectively reflect the NIR and transmit the PAR. Von Elsner and Xie  covered Mutwiwa et al.  studied 2 concentration in the greenhouse, and (iii) applying NIR-reflecting cover in a mild climate should be coupled with a CO2 enrichment facility. The NIR-reflecting materials became somewhat available in the forms of (i) transparent sheets (glass or plastic films), (ii) movable screens or nets, and (iii) water-soluble powders (coating paints). The benefits of using such materials for covering greenhouses permanently or seasonally depend on the external climate conditions. For example, using NIR-reflecting materials for covering greenhouses permanently in northern countries may have negative effect on crop growth and productivity in winter months. Kempkes et al.  used greRecently, two NIR-reflecting materials with promising radiative properties have been developed: one is a metallic multilayered material  and the other is a dielectric multilayered based on plastic film . These films are very durable and their life time is about ten years . The aveOne of the biggest enemies of greenhouse covering films is the wind. Wind loads increase the tensile and shear stresses on covering films and also mechanically degrade them by abrasion and friction. In particular cases, strong winds mixed with sand (sandstorms) can be especially destructive . The wayResearch study about LDPE/EVA films has been done by many researchers. Fasce et al.  studied In order to evaluate the performance of polyethylene film used as a greenhouse cover, several qualitative criteria are used to characterize degradation. The easiest and most common way to evaluate the durability of polyethylene film is to measure the changes in mechanical properties. Particularly, the changes in elongation at break were found to be more sensitive to the degradation process. Therefore this value was usually used as an indicator of degradation . Other mDegradation of physical properties of PE films due to UV radiation (photodegradation) remains the major cause for limited life of PE film . PhotodeSeveral studies have investigated the performance of commercial UV stabilizers includ UVA and HALS. Al-Salem  studied Similar research study was done by Basfar and Ali . They peAnother research study about UV stability enhancement was done by Salem et al. . They coBualek et al.  studied Many UV stabilizers are commercially available. However, according to a survey, little information is available about their incorporation with local PE film and their use for greenhouse in the Arabian Peninsula. This will be one of our goals to identify such covers for greenhouses.NIR-reflecting coatings are formulated with special pigments. It has been reported that it was theoretically impossible to predict the IR reflectivity of a pigment. The only and best way to find it is to evaluate the available NIR-reflecting pigment for their IR reflectivity. There are several factors affecting the reflectivity of NIR-reflecting pigment, which are individual pigment selection of NIR-reflective pigments, particle size (at least 0.35 to 0.55 microns), blending NIR-reflective pigments, opacity, and contamination . The harsh weather (high air temperature and high solar irradiance) in arid regions having brackish water resources makes it difficult to grow plants in open fields during summer. On the other hand, growing plants in greenhouses requires an efficient cooling system to remove a considerable amount of heat. Under such conditions, conventional cooling methods (ventilation or evaporative cooling using wet pad and fans or fogging systems) face many challenges due to the nature of the weather and water resources. NIR-reflecting plastic films seem to be the most suitable and simplest technique for covering greenhouses under these conditions. NIR-reflecting materials are more efficient than NIR-absorbing materials. The solar spectrum in the wavelength range 700\u20131100\u2009nm includes most of the NIR and should be reflected out of the greenhouse whereas wavelengths in the range 1100\u20132500\u2009nm do not carry significant amounts of heat. Many NIR-reflecting and NIR-filtering additives (pigments) are commercially available, but few of them have been investigated. Additionally, their use in greenhouses in the Arab Peninsula with high global radiation is still limited. Therefore, further studies are needed to determine which of these additives are best suited for this region.In mild climates NIR-filtering is not desirable during winter time. NIR-filtering covers should not be used in heated greenhouses in Northern countries since they cause an undesirable temperature drop. NIR-filtering white washes and movable screens can be applied during periods when needed. However, they still reduce PAR too much. NIR-filtering movable screens should be used for shading outside the greenhouse cover to avoid effecting the greenhouse ventilation. Using NIR-reflecting plastic film for covering greenhouses permanently in the Arabian Peninsula is preferable because the winter season is relatively short and the daytime ambient temperature and solar radiation flux are relatively high. The maximum drop in air temperature that could be achieved under an NIR-reflecting greenhouse cover was 5\u00b0C; however, this reduction is not enough in regions having an ambient temperature exceeding 45\u00b0C in summer. A perfect NIR-filtering plastic film cover that is suitable for an arid climate with high solar radiation flux is not yet available. More research is needed to develop such kinds of NIR-reflecting PE film covers.The most important characteristics of greenhouse covering films are ability to provide cooling, high mechanical strength, and durability against photodegradation. A model of such a film covering is shown in The reflected NIR energy can be utilized by PV cells to generate electric power, which can be used for many purposes including generating distilled water for evaporative cooling systems."}
+{"text": "We study estimation of the date of change in persistence, from  Specifically, we provide representations of the limiting distributions of the KBA and BT break point estimators, 2Our key results are provided in Assumption\u00a01(a) Lemma\u00a01Suppose that the conditions of\u00a0hold and thatin the model for a change fromto, given by\u00a0(1) and (2). Fordefined in\u00a0and givenwhereis a standard Brownian motion on\u00a0\u00a0and. Consequently,defined by\u00a0is not consistent since it converges to a random variable, having asymptotic upper bound of.A proof of this lemma is provided in the Corollary\u00a01Suppose that the conditions of\u00a0hold and thatin the model given by\u00a0(1) and (2). Fordefined in\u00a0and giventhenwhereis defined in\u00a0Lemma\u00a01. Consequently,defined by\u00a0is not consistent and converges to a random variable, having asymptotic upper bound of.Remark\u00a01The representation of the asymptotic distribution for neither Remark\u00a02The inconsistency of Remark\u00a03Remark\u00a04When Remark\u00a05Each expression Remark\u00a06For When considering a change in persistence from 3This section uses Monte Carlo simulations to investigate the properties of the BT\u00a0and KBA estimators for a change-point in persistence from Although the DGP always exhibits a change in the order of integration, we follow empirical practice and employ a pre-test for the presence of a change in persistence using the 3.1The sample mean and mean absolute deviation of the break fractions for a change from The finite sample results for the BT and KBA estimators shown in 3.2lies see , the KBAtors see . Indeed,4This paper shows analytically that the ratio-based break fraction estimators of BT and KBA are not consistent for the true break point when mean effects have to be taken into account through a prior regression. To be specific, both estimators converge to random variables which have upper bound equal to the true break fraction and hence exhibit large sample downward biases when persistence changes from Finally, it should be noted that the lack of consistency of the KBA and BT break fraction estimators is not shared by the estimator of"}
+{"text": "Tea, a beverage consumed worldwide, has proven anti-hyperglycemic effects in animal models. Better efficacies of tea beverages are frequently associated with high-dose levels, whose safety attracts considerable attention. Based on the inherent nature of tea catechin oxidation, fresh tea leaves are manufactured into diverse tea types by modulating the oxidation degree of catechins. The present study aimed to assess various tea types for their safety properties and anti-hyperglycemic effects. Mice were allowed free access to tea infusion  for one week, and the rare smoked tea caused salient adverse reactions, including hepatic and gastrointestinal toxicities; meanwhile, the widely-consumed green and black teas, unlike the rare yellow tea, suppressed growth in fast-growing healthy mice. When mice were fed a high-fat diet and allowed free access to tea infusion  for 25 days, only yellow tea significantly reduced blood glucose. Therefore, various teas showed different safety profiles as well as anti-hyperglycemic efficacy strengths. To achieve an effective and safe anti-hyperglycemic outcome, yellow tea, which effectively suppressed high-fat diet-induced early elevation of hepatic thioredoxin-interacting protein, is an optimal choice. Camellia sinensis L. is one of the most commonly consumed beverages worldwide, and has been considered a crude medicine for over 4000 years in China, the origin of teaTea made from the plant Drosophila melanogasterIn the past two decades, catechins extracted from green tea, particularly purified epigallocatechin-3-gallate (EGCG), which accounts for more than half of total catechins and is the most biologically active green tea catechin, have been demonstrated to be effective in alleviating metabolic syndrome, reducing neurodegenerative disease incidence, and cancer prevention467910111213Compared to green tea, other teas (except for black tea) that undergo different degrees of fermentation have not been extensively studied for their health benefits. Limited comparative studies using different tea types only focused on efficacy, without considering the other side of the coin, namely, safety. Do all teas provide equal health benefits? The present study addressed this issue, focusing on safety and efficacy. A total of four tea types purchased from the market were compared for safety profiles in healthy mice and anti-hyperglycemic efficacy in mice fed a high-fat diet. Compared to commonly consumed green or black tea, a rare tea assessed, herein termed as \u201csmoked tea\u201d (distinguished from other tea types by prolonged exposure of tea leaves to smoke), had a lower safety profile; meanwhile, the rare yellow tea made from coarse old leaves exhibited a unique feature of higher safety and better efficacy.There was a wide distribution range of both total catechin (0.10\u22124.33\u2009mg/mL) and EGCG (0.04\u22122.52\u2009mg/mL) amounts in the four tea infusion types  examined. The order of either total catechin or EGCG levels was green tea\u2009>\u2009smoked tea\u2009>\u2009yellow tea\u2009>\u2009black tea, and EGCG always accounted for the largest catechin proportion . Lower l16Mice were fed a regular diet with free access to water as control or tea infusion  for one week. The first day of tea drinking, mice were not familiarized with tea location, irrespective of its type, as evidenced by body weight loss ; howeverSmoked tea was excluded from subsequent functional experiments for potential toxic reactions. Mice were fed a regular diet (control group) or high-fat diet for 25 days. Compared with the control diet, high-fat diet caused no further body weight increase, and green, black and yellow teas showed no effects on body weight in mice fed a high-fat diet . Average1819202223To further characterize the intriguing transcriptional adaption found above and explore yellow tea effects, we extended the feeding time with high-fat diet to 36 days. High-fat diet significantly increased body weight compared to control; however, yellow tea had no effect on body weight gain enhanced by high-fat diet . NonetheThe present study showed that various teas have different safety profiles and anti-hyperglycemic effects. Importantly, the yellow tea known as Huang-Da-Cha, exhibited higher safety and better anti-hyperglycemic efficacy.Drosophila melanogaster25262829303132A recent clinical trial indicated that daily intake of only 800\u2009mg (400\u2009mg twice daily) green tea catechin extracts for half a year causes hepatotoxicity in many participantsDrosophila melanogasterTo overcome the unpredictable side effects occurring with green tea catechin extracts or EGCG, and mimic the human consumption style of tea drinking, the present study employed hot water infusion of tea and allowed mice free access to tea infusion. Most people consume 5 to 10\u2009g of tea daily. However, a few individuals are accustomed to drinking large amounts of tea, as high as 20\u2009g per day. The present study in mice used 1/30 tea infusion, which is a little lower than the dose (1/20 green tea infusion) used to improve glucose tolerance in rats exposed to high-fat diet9To our great surprise, infusion of smoked tea, which is baked to dryness by charcoal fire under a heavy-coated wet and compressed environment, caused not only hepatotoxicity but also gastrointestinal abnormalities. The levels of EGCG and tea catechins of smoked tea infusion were nearly equivalent to those found in green tea infusion. It is plausible that certain exogenous compounds, such as polycyclic aromatic hydrocarbons deposited on tea leaves exposed to wood combustion fumes, may render some tissues susceptible to high-dose EGCG and tea catechins. It is worth noting that several kinds of smoked black tea that originated from Taiwan and south-eastern China contain much high levels of benzo(a)anthracene and chrysene compared with non-smoked black teaTea has many beneficial functions, among which alleviation of metabolic syndrome has attracted attention in recent years. There is a high likelihood that enhanced safety incurs compromised drug efficacy. We thus compare anti-hyperglycemic effects of yellow, black and green teas. The latter two tea types have been extensively investigated independently or comparatively, concerning metabolic syndrome improvements. Most studies showed that black tea, with catechins undergone pronounced oxidation, still yields an efficacy almost identical to green tea with abundant tea catechins40411616We preformed two high-fat diet experiments in the present study. Surprisingly, we found that high-fat diet did not stimulate body weight increase in the 25-day experiment , whereasThe present study has several limitations that need to be addressed in additional studies. (1) The components responsible for the beneficial effects of yellow tea and the deleterious effects of smoked tea have not been identified. We assumed that moderately oxidized products of tea catechins derived from yellowing process, the abundant polysaccharides in coarse old tea leaves used for preparing yellow tea, and specific compounds that confer yellow tea a unique caramel flavor might synergistically or independently contribute to the pharmacological effects. Exogenous compounds formed during wood combustion may be a predominant factor lowering the tolerance of mice to smoked tea. (2) Toxic reactions induced by smoked tea may be attributed to necrosis, inflammation and hyperplasia in target organs. Histological investigations were not conducted to investigate these adverse effects.In conclusion, the present study demonstrated that various teas differ in safety and anti-hyperglycemic efficacy. Rigorous risk evaluation of smoked tea is required according to the present findings. To achieve an effective and safe anti-hyperglycemic outcome, the yellow tea made from coarse old leaves, previously considered to have a lower economic value compared with popular green and black teas, is an optimal choice.Commercial kits for alanine aminotransferase (ALT), aspartate aminotransferase (AST) and lactate dehydrogenase (LDH) activity measurements were obtained from Jiancheng Bioengineering Institute . Glucose was determined by the glucose oxidase method using a commercial kit from Huili Biotech Co., Ltd . ELISA kits for measurement of insulin and leptin levels were purchased from EMD Millipore Corporation, Billerica . Other chemicals were of the highest grade available.Green, black, yellow and smoked teas were purchased from the market in China. The major manufacture processes are outlined in Healthy male ICR mice (20~22\u2009g) were purchased from Shanghai SLAC Laboratory Animal Co. Ltd., and housed in a temperature (22\u2009\u00b1\u20092\u2009\u00b0C) and humidity (40\u201360%) controlled environment with a 12\u2009h light/dark cycle with free access to water or tea infusion, and regular or high-fat diet. High-fat diet  and paired regular diet  were purchased from TROPHIC Animal Feed High-Tech Co. Ltd, China. At the end of each experiment, mice were fasted for 12\u2009h, anesthetized and sacrificed by cervical dislocation after peripheral blood collection from the ophthalmic vein. Serum was obtained by centrifugation at 10,000\u2009rpm for 10\u2009min, and stored at \u221280\u2009\u00b0C until analysis. Liver tissues were excised and rinsed in ice-cold saline and then stored at \u221280\u2009\u00b0C. All animals were humanely treated in accordance with the Guide for the Care and Use of Laboratory Animals (Ministry of Science and Technology of the People\u2019s Republic of China) and all animal protocols were reviewed and approved by the ethics committee of Anhui Agricultural University. We stated the key parameters of each of the five experiments, including the route of administration, experimental period, tea infusion dose and animal number in each Figure or Table legend.TM 3 software was used for instrument operation control and data collection. Chromatographic separation was performed on a Gemini 5u C18 110A column , with a solvent system consisting of 0.17% (v/v) acetic acid (A) and 100% acetonitrile (B); a linear gradient at a flow rate of 1.0\u2009mL/min was set as follows: B from 8 to 28% (v/v) in 30\u2009min was initiated, followed by B from 28 to 100% (v/v) between 30 and 37\u2009min, and B from 100 to 8% (v/v) between 37 and 46\u2009min. Peaks were identified by comparison of retention times with those of standardsCatechins, theanine and caffeine were analyzed on a Waters High Performance Liquid Chromatography (HPLC) system equipped with Waters 600 controller and Waters 2489 UV Detector (280\u2009nm). The Empower 260\u2009nm:A280\u2009nm above 1.8 were used for RT-PCR. cDNA was prepared using 50\u2009ng of total RNA, oligo dT primer and PrimeScript RT Enzyme Mix  according to the manufacturer\u2019s instructions, in a total volume of 20\u2009\u03bcL. Real-time PCR was performed on a CFX System (Bio-Rad). \u2206CT values were determined by normalization to \u03b2-actin. Fold change values were calculated using the 2\u2212(\u2206\u2206CT) method. The primers used in this study are described in Total RNA was isolated using TRIzol reagent (Takara Biotechnology) according to the manufacturer\u2019s protocol. RNA samples with A+ detection system ; densitometric analysis was performed using Quantity One\u00ae Image Analyzer (Bio-Rad).Homogenized liver tissue specimens were boiled with 2\u2009\u00d7\u2009SDS-PAGE loading buffer at 95\u2009\u00b0C for 10\u2009min. Then, proteins were separated by 10% SDS-PAGE gel electrophoresis and transferred onto a PVDF membrane. After blocking with 5% nonfat dried milk in TBS-T  for 2\u2009h at room temperature, the membrane was incubated with anti-TXNIP antibody  or anti-\u03b2-actin antibody, diluted 2,000 to 5,000 fold, for at least 3\u2009h at room temperature. The membrane was then washed and incubated with anti-rabbit secondary antibodies  for 1\u2009h at room temperature. Protein bands were detected using the ChemiDoc XRSpost hoc Tukey\u2019s test  or Dunnett\u2019s multiple comparison test (otherwise). Graph Pad Software  was used for statistical analyses. A P-value less than 0.05 was considered statistically significant.Data are mean\u2009\u00b1\u2009standard error of the mean (SEM). Event incidence was compared using Fisher\u2019s exact test. Differences of body weights were examined by two way ANOVA; the remaining parameters were evaluated by unpaired t test or one way ANOVA with How to cite this article: Han, M. et al. Safety and anti-hyperglycemic efficacy of various tea types in mice. Sci. Rep.6, 31703; doi: 10.1038/srep31703 (2016)."}
+{"text": "Indications discussed for the implantation of expandable prostheses in bone sarcoma patients are unclear. This survey aimed to analyse common practice with this implant type in orthopaedic oncology.  A web-based survey was sent to 98 orthopaedic oncology surgeons. Factors reported in literature to influence the decision on the implantation of a growing prosthesis were covered in individual questions and three case scenarios. n\u2009=\u200944). Twenty-seven of 44 surgeons (61%) had implanted between 1 and 15 expandable prostheses within three years. The minimum median patient age was 6.5 years, and 3\u20135\u2009cm of predicted growth deficit was the minimum before implanting a growing prosthesis. One-third of surgeons do not use growth calculation methods. Two out of three surgeons would rather not implant a growing prosthesis in children with metastatic disease.  The completion rate of the survey was 45% ( Our survey confirmed the literature with 3-4\u2009cm as the minimum estimated growth deficit. The minimum age for the implantation of a growing prosthesis is approx. 6.6 years, and therefore the patients are younger than those reported in previous publications. One-quarter of orthopaedic surgeons do not use growing prostheses at all. It remains unclear whether growing prostheses are indicated in patients with metastatic disease. Paediatric bone sarcoma frequently arises in the metadiaphyseal regions of the distal femur or the proximal tibia. Wide resection can include the growth plate, and there will be a leg-length discrepancy by skeletal maturity. In the past, amputations in the very young patients or multiple revision surgeries were performed to address the leg-length discrepancy .In 1976, the first expandable prostheses (synonyms: extendible or growing prostheses) were introduced, allowing minimally invasive lengthening via a small skin incision . Still, To implant a growing prosthesis, at least 3-4\u2009cm of growth has to be expected for the child until skeletal maturity \u20139. FurthOur survey aimed to clarify the indications for implantation of a growing prosthesis in bone sarcoma patients by conducting a survey among experts in orthopaedic oncology. Furthermore, we aimed to identify alternative methods other than expandable prostheses to compensate for limb-length inequality.A ten-minute web-based survey (Question Pro\u00a9) was distributed via email to 98 active orthopaedic surgeons of the European Musculo-Skeletal Oncology Society (EMSOS) . NonortThe questionnaire consisted of 15 items on 3 pages including case-specific questions. The first three survey questions asked about participants' personal experience with expandable prostheses, including years in practice, previous experience in orthopaedic oncology, and experience with the implantation of growing prostheses over the last three years. Questions 4\u201310 were based on relevant factors reported in literature . Questions 11 and 12 asked for other methods to maintain limb-length equality including epiphysiodesis. Finally, to check consistency, there were three case scenarios based on osteosarcoma patients aged 6.5, 8, and 10.5 years. For all three case scenarios, bone sarcomas were located in the distal femur and tumour extent was depicted. Total femur length as well as required minimal resection lengths of different types of growing prostheses was provided for each case. In addition to multiple choice answers, survey participants could provide information on their own surgical technique in a separate comment field. None of the cases involved skip metastasis, metastatic disease, intra-articular tumour infiltration, or pathological fracture.The survey was constructed according to the \u201cChecklist for Reporting Results of Internet E-Surveys (CHERRIES)\u201d . Before Statistical analysis was conducted with Microsoft Excel (Excel Version 2010). Categorical variables are presented as absolute and relative frequencies and numerical variables as means and ranges.n\u2009=\u200913) of survey participants had not implanted any  had implanted between 1 and 15 expandable prostheses within the last three years, whereas about 30% . To calculate the growth potential, one specific method is used by 45% (18/40), multiple methods by 20% (8/40), and none by 35% (14/40) of surgeons  . The minsurgeons . In detaAs alternative surgical option, about one-half of orthopaedic surgeons  would lengthen by callus distraction, either with intramedullary nailing devices or with Ilizarov technique. Additionally, 40% (17/42) of participants often or always consider epiphysiodesis as an option to guide growth.n\u2009=\u200923/43) for Case A to 76% (n\u2009=\u200932/42) and 83% (n\u2009=\u200934/41) for Cases B and C. Amputation was not considered by any of the respondents in any of the three case scenarios. Approximately one-quarter of surgeons  would use other surgical options for Case A, 14% (n\u2009=\u20096/42) for Case B, and 12% (n\u2009=\u20095/41) for Case C  years. Apart from that, answers for specific factors were quite heterogeneous for the remaining questions. Demographics of survey participants, including years in practice and percentage of time dedicated to orthopaedic oncology, were representative of an expert population. It is unclear why one-third of participating surgeons do not consider the implantation of a growing prosthesis. Apart from individual surgical preferences, nonmedical reasons like the availability of implants in some countries and other socioeconomic reasons might influence the use of expandable prostheses.We looked at factors influencing the surgical indication for a growing prosthesis that have been described in the literature, including age, expected growth deficit, growth prediction methods, metastatic disease, and alternative treatment options to compensate for leg-length discrepancy , 6\u201310. AIt is important to predict growth accurately since 3-4\u2009cm of remaining growth is seen as an indication for a growing prosthesis \u20139. This Opinions as to whether expandable implants should be considered in patients with metastatic disease were divisive, though a majority would rather not use them with metastatic disease. The literature offers only minimal information, apart from Schinhan et al. , who seeSince this made it difficult to decide which patients would have a favourable prognosis at the time of implantation, some centres began to use dummy prostheses. The costly motor is implanted only later since response to chemotherapy cannot be predicted before surgery. It must also be considered here that chemotherapy reduces the growth velocity and most relapses occur within 2-3 years following initial diagnosis. There is no peer-reviewed literature on this practice, but our survey results showed that a considerable number of surgeons do use dummy prostheses.The use of growing prostheses is only one possibility to compensate for leg-length discrepancy. In the case scenarios, we could see that the younger the patients were, the more cautious the participants were in opting for an expandable prosthesis. Instead, participants proposed biological reconstruction, temporary spacer, or callus distraction techniques. Our survey does not explain why one-third of surgeons do not consider expandable implants. In any case, alternative treatment option for paediatric sarcoma patients has to be discussed, since the currently available noninvasive expandable prostheses are still associated with complications, such as prosthetic joint infection or mechanical failure , 8. EndoExtendable implants were constructed to compensate for the limb-length discrepancy following metaepiphyseal sarcoma resection. At least 3-4\u2009cm of leg-length discrepancy should be expected before a growing prosthesis is considered. Otherwise, there is no consensus on surgical indications among orthopaedic oncologists. Our survey showed that the opinions of experts in orthopaedic oncology from a wide geographic range are quite divergent that it would be a matter of some priority to work toward a consensus on the use of expandable prostheses in paediatric bone sarcoma patients."}
+{"text": "The nuclear receptor farnesoid-X-receptor  is expressed not only in the liver, gut, kidney and adipose tissue but also in the immune cells. FXR has been shown to confer protection in several animal models of inflammation, including experimental autoimmune encephalomyelitis (EAE), an animal model of multiple sclerosis (MS). FXR agonists are currently tested in clinical trials for treatment of human metabolic diseases. The beneficial effect of FXR agonists in EAE suggests that FXR might represent a potential target in inflammatory-demyelinating CNS diseases, such as MS. In MS, oligodendrocytes not only undergo cell death but also contribute to remyelination. This repair mechanism is impaired due to a differentiation block of oligodendroglial progenitor cells. Activation of other nuclear receptors that heterodimerize with FXR promote oligodendroglial differentiation. Therefore, we wanted to address the functional relevance of FXR for glial cells, especially for oligodendroglial differentiation.We isolated primary murine oligodendrocytes from FXR-deficient (FXR Ko) and wild-type (WT) mice and determined the effect of FXR deficiency and activation on oligodendroglial differentiation by analysing markers of oligodendroglial progenitor cells (OPCs) and mature oligodendrocytes (OLs) using qRT-PCR and immunocytochemistry. Additionally, we determined whether FXR activation modulates the pro-inflammatory profile of astrocytes or microglia and whether this may subsequently modulate oligodendroglial differentiation. These in vitro studies were complemented by histological analyses of oligodendrocytes in FXR Ko mice.FXR is expressed by OPCs and mature oligodendrocytes. However, lack of FXR did not affect oligodendroglial differentiation in vitro or in vivo. Furthermore, activation of FXR using the synthetic agonist GW4064 did not affect oligodendroglial differentiation, remyelination in an ex vivo model or the expression of pro-inflammatory molecules in astrocytes or microglia. Concordantly, no effects of supernatants from macrophages cultured in the presence of GW4064 were observed regarding a possible indirect impact on oligodendroglial differentiation.Our data suggest that FXR is dispensable for oligodendroglial differentiation and that FXR agonists, such as GW4064, represent a potential therapeutic approach for MS which specifically targets peripheral immune cells including macrophages but not brain-resident cells, such as oligodendrocytes, astrocytes or microglia.The online version of this article (doi:10.1186/s12974-017-0833-6) contains supplementary material, which is available to authorized users. Nuclear receptors are a large group of transcription factors that comprises 49 family members which enable the organism to quickly adapt to environmental changes by inducing the appropriate gene program . NuclearInterestingly, several members of the nuclear receptor family are also involved in molecular mechanisms regulating oligodendroglial differentiation. Downregulation of retinoid X receptor gamma (RXR\u03b3) expression or application of RXR\u03b3 antagonists significantly impaired oligodendroglial differentiation. Similarly, mice lacking RXR\u03b3 showed delayed remyelination after induction of demyelination in vivo . In oligThe nuclear receptor farnesoid-X-receptor  is expressed not only in the liver, gut, kidney and adipose tissue, but also in the immune cells , 10. FXRGiven its recently illustrated relevance in macrophage-mediated protection from CNS autoimmunity and the functional role of several nuclear receptors for oligodendroglial differentiation, we addressed the functional relevance of FXR in different brain-resident cells, especially focusing on oligodendrocytes. Here, we show that FXR is expressed in murine oligodendrocytes. However, lack or activation of FXR did not influence oligodendroglial differentiation in vitro or in vivo. Furthermore, FXR activation did not affect key immune functions of astrocytes and microglial cells. These data demonstrate that, in contrast to other nuclear receptors, FXR is dispensable for oligodendroglial differentiation as well as for brain-resident astrocytes and microglia and hence suggest that pharmacological activation of FXR to downregulate CNS inflammation does not interfere with repair mechanisms, such as remyelination.FXR Ko mice  were purPrimary OPCs were isolated using the immunopanning method as described earlier , 23. OPCz-stacks of whole slices were acquired with a Zeiss LSM 700 confocal microscope, and images were analysed using NIH ImageJ. The extent of myelination was quantified by determining the ratio between MBP and NFL staining. Two independent experiments were performed, and in each experiment, six brain slices and three z-stacks from six brain slices were analysed for each concentration of GW4064 or DMSO.Sagittal, cerebellar slices from P1 mice were dissected as described earlier . After 1Preparation of bone marrow-derived macrophages and generation of primary astrocyte cultures via mixed glial culture preparation were performed as described previously . The murTo produce BMM-conditioned supernatant, BMMs were treated with 15\u00a0\u03bcM GW4064 or DMSO and cultured for 72\u00a0h .TNF\u03b1 in cell culture supernatants was quantified using ELISA Ready-SET-Go!\u00ae  according to the manufacturer\u2019s recommendations. Nitrite concentrations were measured in the supernatants using the Griess Reagent Kit (Invitrogen) according to the manufacturer\u2019s instructions.2 FirstStrand Kit (Qiagen) was utilized. Afterwards, the RT2 Profiler\u2122 PCR Array Inflammatory Response & Autoimmunity  was performed with RT2 Real-Time SYBR Green PCR Master Mix (SuperArray Bioscience) according to the manufacturer\u2019s protocol. For normalization, the housekeeping gene Hsp90ab1 was taken as internal control. Analysis was performed at the RT2 Profiler PCR Array Data Analysis Web portal (provided from Qiagen).Treated ESdMs and astrocytes were stimulated with LPS and INF\u03b3 for 6\u00a0h. RNA isolation was performed with RNeasy Mini Kit (Qiagen) combined with the RNase-Free DNase Set (Qiagen) to digest DNA. For transcription to complementary DNA (cDNA), the RTFxr fw: GCCACAGATTTCCTCCTCGT, Fxr rev: CAGTCTCTCCCTGGTACCCA, Mbp fw: GTACAAGGACTCACACACGAGA, Mbp rev: GTTCGAGGTGTCACAATGTTCT, RPLP0 fw: CGACCTGGAAGTCCAACTAC and RPLP0 rev: ATCTGCTGCATCTGCTTG, and data were normalized using RPLP0 as internal control.Total RNA from cells was isolated using peqGOLD Total RNA Kit . Messenger RNA (mRNA) was transcribed into cDNA by reverse transcription reaction , and cDNA was diluted to a final concentration of 0.75\u00a0ng/\u03bcl. qRT-PCR was performed using Power SYBR\u00ae Green PCR Master Mix (Applied Biosystems) and StepOne Plus real-time cycler (Applied Biosystems). The following primers were used: OPCs were fixed directly after seeding or differentiated and fixed after 48\u00a0h as mature oligodendrocytes. Cells were permeabilised for 10\u00a0min in 0.5% Triton X-100 in PBS and blocked using 5% FCS/PBS for 30\u00a0min. The primary antibodies were rat anti-MBP , rabbit anti-PDGFR\u03b1 , rabbit-FXR NR1H4  and mouse anti-Olig2 . Incubation was performed at 4\u00a0\u00b0C over night. Secondary antibody staining was performed using Cy\u21223 Anti-Rat (1:500)  and anti-Rabbit Alexa Fluor\u00ae 488 conjugate (1:500)  for 2\u00a0h at RT before embedding with Roti\u00ae-Mount FluorCare DAPI . Images were taken using the laser scanning microscope . At least 200 cells were quantified, and the numbers of MBP+ and PDGFR\u03b1+ cells were assessed as percentage of total DAPI+ cells.2 each defined by an ocular morphometric grid.Ten-day and 8-week-old WT or FXR Ko mice were sacrificed and intracardially perfused. The spleens, spinal cords and brains were removed and fixed in 4% PFA overnight. Paraffin sections (4\u00a0\u03bcm) were pretreated with citrate buffer (pH 6) and stained using an automated immunostainer . Primary antibodies were specific to FXR , NogoA  and Olig2 . Numbers of oligodendroglial cells were quantified in a blinded fashion in the corpus callosum, cerebellum and spinal cord in standardized microscopic fields of 10,000\u00a0\u03bcmt test. p values <0.05 were considered significant.All cell culture experiments were performed in triplicates and replicated at least three times. All statistical analyses were performed using GraphPad Prism 5.03 . In text and figures, results are provided as mean\u2009\u00b1\u2009SEM. Multiple comparisons in the same data set were analysed by the Bonferroni-corrected (for selected groups) one-way ANOVA tests. Single comparisons to control were made using two-tailed Student\u2019s Fxr gene expression demonstrated an increase in Fxr mRNA expression during oligodendroglial differentiation . mRNA expression levels of the myelin-associated gene tes Fig.\u00a0. Using ites Fig.\u00a0. AdditioTo analyse a potential impact of FXR activation on the process of remyelination, we made use of cerebellar slice cultures that were demyelinated by lysolecithin. We applied two different concentrations of GW4064 to demyelinated cerebellar slice cultures during 14\u00a0days of remyelination. Evaluation of the amount of MBP+ and NFL+ axons revealed no influence of GW4064 treatment on the remyeliation capacity of oligodendrocytes after toxic demyelination in this ex vivo model (Additional file Mbp expression levels and numbers of mature MBP+ oligodendrocytes were significantly reduced in cerebral oligodendrocytes exposed to BMM supernatants; however, this was independent of GW4064 treatment (Fig.\u00a0Mbp gene expression, but a significant decrease in MBP+ mature oligodendrocytes after addition of BMM supernatants compared to controls without BMM supernatants; however, conditioning with GW4064 had no additional effect on oligodendroglial differentiation (Additional file Since peripheral macrophages migrate into the CNS during MS pathogenesis and then modulate the inflammatory activity of brain-resident cells and given the strong immune-modulatory properties of FXR in macrophages , we nextent Fig.\u00a0. No signent Fig.\u00a0, f. CereIn light of the described anti-inflammatory properties of FXR on macrophages , we wondWe next investigated the influence of conditioned supernatant from FXR-activated BMMs on astrocytes and microglial cells. However, there was no modulation of TNF\u03b1 Fig.\u00a0 or NO F, l produHere, we demonstrate that FXR is expressed by OPCs and mature oligodendrocytes, like microglia and astrocytes . HoweverSeveral nuclear receptors, such as RXR\u03b1, RXR\u03b2, RXR\u03b3, VDR, TR, LXR\u03b1 and LXR\u03b2, are expressed by oligodendrocytes and have been shown to affect oligodendroglial function , 8, 26. Activation of several nuclear receptors such as RXR\u03b3, TR, VDR and LXR\u03b1/LXR\u03b2 promotes oligodendroglial differentiation , 5\u20138. ThIt has recently been shown that activation of FXR in BMM induced an anti-inflammatory phenotype characterized by downregulation of pro-inflammatory and induction of anti-inflammatory genes . In lighThe anti-inflammatory phenotype induced by GW4064-mediated activation of FXR in peripheral myeloid cells, such as BMMs, is well documented , 25. HowIn summary, we demonstrated that activation of FXR by GW4064 does not modulate oligodendroglial differentiation directly or indirectly via FXR activation in macrophages. Furthermore, there is no indication that GW4064 directly or indirectly influences the pro-inflammatory profiles of CNS-resident astrocytes or microglia. These data suggest that FXR agonists, such as GW4064, represent a potential therapeutic approach for MS which specifically targets peripheral immune cells including macrophages, but not brain-resident cells, such as oligodendrocytes, astrocytes or microglia."}
+{"text": "An approach utilizing the long-read capability of the Oxford Nanopore MinION to rapidly sequence bacterial ribosomal operons of complex natural communities was developed. Microbial fingerprinting employs domain-specific forward primers (16S rRNA subunit), reverse primers (23S rRNA subunit), and a high-fidelity Taq polymerase with proofreading capabilities. Amplicons contained both ribosomal subunits for broad-based phylogenetic assignment (~\u20093900\u00a0bp of sequence), plus the intergenic spacer (ITS) region (~\u2009300\u00a0bp) for potential strain-specific identification.n\u00a0=\u00a024), on two separate 6-h runs using the MinION system . From nearly 90,000 MinION reads, roughly 33,000 forward and reverse sequences were obtained. This yielded over 10,000 2D sequences which were analyzed using a simplified data analysis pipeline based on NCBI Blast and assembly with Geneious software. The method could detect over 1000 operational taxonomic units in the sample sets in a quantitative manner. Global sequence coverage for the various rRNA operons ranged from 1 to 1951x. An iterative assembly scheme was developed to reconstruct those rRNA operons with >\u200935x coverage from a set of 30 operational taxonomic units (OTUs) among the Proteobacteria, Actinobacteria, Acidobacteria, Firmicutes, and Gemmatimonadetes. Phylogenetic analysis of the 16S rRNA and 23S rRNA genes from each operon demonstrated similar tree topologies with species/strain-level resolution.To test the approach, bacterial rRNA operons (~\u20094200\u00a0bp) were amplified from six DNA samples employing a mixture of farm soil and bioreactor DNA in known concentrations. Each DNA sample mixture was barcoded, sequenced in quadruplicate  contains supplementary material, which is available to authorized users. Molecular biological approaches for the genetic analysis of environmental samples have become the most widely accepted way to characterize microbial communities. Initially, a clone and sequence scheme was largely used to characterize 5S or 16S rRNA genes . Later, As an alternative approach, we tested if the portable DNA sequencer (MinION) from Oxford Nanopore Technologies (ONT) could be used to profile the microbiota using tools that can be purchased for a low cost and data analysis methods that are readily available to many laboratories. The MinION is a third-generation platform for direct sequencing of individual strands of DNA translocating nanoscale pores in a semiconductor membrane , 11. A mFor this study, we tested whether the MinION could be used to rapidly sequence bacterial ribosomal operons from complex environmental samples. To validate the approach, we generated a mixture of complex genomic DNA from two different sources where a large number of unknown microorganisms exist rather than a simple mock community of a few model organisms. After rRNA operon sequencing, each individual read was assigned to an operational taxonomic unit (OTU) by screening against an NCBI 16S rRNA gene database. An rRNA consensus sequence was then reconstructed for a particular OTU using an iterative alignment approach with a commercially available DNA software program  which can be run on Windows, Mac, or Linux operating systems. These efforts were designed to test if consensus building would yield data for environmental rRNA operons that are reproducible, quantitative, and similar to known rRNA genes within online databases.In order to determine if the MinION can provide relative abundance data for the rRNA operons from environmental samples, genomic DNA from two different complex microbial communities were mixed in known concentrations . These Soil and bioreactor DNA were combined in known proportions to generate six sample communities to test the ability of the MinION to sequence nearly complete rRNA operons and determine if read numbers could measure the relative abundance of the different OTUs Fig.\u00a0. After pStenotrophomonas maltophilia, Comomonas nitrativorans, Comomonas denitrificans) had random errors and indels introduced along the entire length creating copies with similarities ranging from 79 to 100% . However, the robustness of this correlation declines with the number of OTUs <\u200910 within the sample set . The 16S rRNA genes from these biological replicates were independently aligned and used to build independent consensus sequences for each replicate as was done for the entire rRNA operon. All four replicate consensus sequences for the three OTUs were found to be identical  to generate millions of short reads (often <\u2009200\u2013400\u00a0bp) and to report results at the phylum-order-family level. This approach inherently groups all members of a bacterial phyla-order-family together into a single unit and obscures species or strain-level dynamics that may be occurring in an environmental or experimental perturbation . In this study, we tested a portable sequencing technology for the ability to distinguish bacterial species or strains in environmental samples. The Oxford MinION sequences single DNA molecules and enables very long reads to be obtained, compared to most second-generation sequencing approaches . When applied to rRNA gene characterization, this approach can provide nearly full-length rRNA operon sequence data yielding robust species resolution as demonstrated by both the tree topologies and the bootstrap values in Figs. Escherichia coli K12 -AGA GTT TGA TCC TGG CTC AG 3\u2032)  and modiLibrary construction for the MinION relies on ligation of adaptor and hairpin to rRNA amplicons in order to perform nanopore sequencing. For this study, 100\u00a0ng of each barcoded amplicon were combined  into DNA Lo-Bind tubes at a volume of 85\u00a0\u03bcl (by adding reagent grade PCR water) with 10\u00a0\u03bcl end-repair buffer and 5\u00a0\u03bcl of the end-repair enzyme . After a 20\u00a0min incubation at room temperature, the end-repair reaction was concentrated/purified by adding 100\u00a0\u03bcl of 5\u00a0M NaCl, 100\u00a0\u03bcl of 30% PEG/1.5\u00a0M NaCl, and 15\u00a0\u03bcl of Ampure Beads and allowed to bind for 10\u00a0min on a vortex shaker. The beads were removed from the supernatant using a magnet and washed twice with freshly made 70% ethanol. The end-repaired DNA was eluted in 25\u00a0\u03bcl of water at 55\u00a0\u00b0C for 10\u00a0min and dA-tailing was done by adding 3\u00a0\u03bcl of tailing buffer and 2\u00a0\u03bcl of enzyme (NEB) and incubating at 37\u00a0\u00b0C for 10\u00a0min. The DNA was re-purified on AMPure beads using the NaCl/PEG protocol as above and re-suspended in 15\u00a0\u03bcl of water at 55\u00a0\u00b0C for 10\u00a0min.For the ligation, \u201chalf-reactions\u201d were utilized with slight modifications. Fifteen microliters of DNA was combined with 9\u00a0\u03bcl of water, 5\u00a0\u03bcl of ONT adaptor mix, 1\u00a0\u03bcl of HP adaptor, and 25\u00a0\u03bcl of Blunt/TA ligase master mix (NEB). Additionally, a critical modification was to add 1\u20132\u00a0\u03bcl of freshly prepared ATP solution (~\u20094\u00a0mg/ml). The mixture was incubated for 10\u00a0min at room temperature, then 0.5\u00a0\u03bcl of HP tether was added, and the reaction was allowed to incubate an additional 10\u00a0min. The library was then purified using streptavidin C1 magnetic beads as per ONT instructions with the exception that the elution was done by incubating the bead in 25\u00a0\u03bcl elution buffer overnight at 4\u00a0\u00b0C then by a 30-min incubation at 37\u00a0\u00b0C. The library was loaded into R7 flow cells and run as per the manufacturer\u2019s instructions.After sequencing on the MinION, the 2D reads were opened using Poretools  and the https://www.arb-silva.de/aligner). Settings included rejecting sequences <\u200970% identity, search-kmer candidates 100, lca-quorum 0.8, search-kmer length 10 using the SILVA, RDP, and Greengenes RefNR databases.The MinION 16S rRNA genes for each barcode were screened against an NCBI 16S rRNA gene bacterial and archaeal database (Bioproject 33175) using Discontinuous MegaBLAST in Geneious 10.1.2. Settings included a word size of 11, gap cost of 5/2, scoring of 2/\u22123, and a seed length of 18. The top BLAST output was exported as .csv files and opened in a spreadsheet program  to group by best BLAST hit, count the number of OTUs, and parse for comparisons across samples. Additionally, the MinION sequences were analyzed by SINA online at the Arb-SILVA website  was used to reconstruct phylogenetic trees by first aligning full-length sequence for the ribosomal subunits with MUSCLE. The alignment was edited in Geneious to retain only unambiguously aligned bases (16S rRNA genes-1292\u00a0bp and 23S rRNA genes-1767\u00a0bp)."}
+{"text": "The Yemen cholera outbreak has been driven by years of conflict and has now become the largest in epidemiologically recorded history with more than 1.2 million cases since the beginning of the outbreak in April, 2017. In this report we review and discuss the cholera management strategies applied by the major international humanitarian health organizations present in Yemen. We find the response by the organizations examined to have been more focused on case management than on outbreak prevention. Oral Cholera Vaccines (OCVs) were not delivered until nearly 16\u2009months into the outbreak. A recent scale-up of the global OCV stockpile will hopefully allow for rapid mass deployment of the OCV in future humanitarian emergencies. Continuous funding to this stockpile will be crucial to maintain this option for prevention and control of cholera outbreaks. Of equal importance will be the timely recognition of the need for mass OCV deployment and development of more specific, comprehensive and actionable evidence-based frameworks to help guide this decision, however difficult this may be. The outbreak highlights the importance for international humanitarian health organizations to have a continuous discussion about whether and to what extent they should increase their focus on pre-emptively addressing the environmental determinants of communicable diseases in humanitarian emergencies. Strong advocacy from the public health community for peace and the protection of human health, by bringing to attention the public health impacts of armed conflict and keeping the world\u2019s political leaders accountable to their actions, will remain crucial. The United Nations have deemed the situation in Yemen the world\u2019s worst humanitarian crisis . In the 16 million [people] lack access to safe water and sanitation, and 16.4 million lack access to adequate healthcare\u201d [How could an outbreak of this scale occur? Already before the conflict erupted, approximately half of all children under 5 were stunted reflecting a high prevalence of chronic malnutrition, lowering their resilience towards cholera , 7. Watelthcare\u201d . The coslthcare\u201d , lowerinIt is clear that such a collapse of infrastructure has created fertile ground for a cholera outbreak, and that the critical triggering cause was conflict , 19\u201322. We reviewed publicly available information on the official websites and in reports from the major international health organizations involved in the humanitarian response in Yemen in December 2017, and academic English language literature on the Medline, Embase and Global Health databases published from 2015 and onward until submission in May 2018 (search string: \u201cYemen AND cholera\u201d), to inform a discussion of potential shortcomings and lessons to be learned from the humanitarian response by health organizations. Our academic literature search yielded 40 results, the relevant of which are included in this paper. Our review findings are summarized in Table\u00a0The Yemen Health Cluster consists of 40 member organizations and is coordinated by the WHO . In JuneAs part of their general response in Yemen, the WHO described having sustained functionality of 414 health facilities, operation of 406 general health and nutrition mobile teams and delivery of child and nutrition interventions in 323 districts, having established 36 cholera treatment centers, expanded disease surveillance capacity and having distributed more than 2 million liters of fuel for hospital generators, ambulances etc. . SpecifiUNICEF described having provided safe water to over one million people and delivered 40 tons of medical equipment including medicine, Oral Rehydration Solution (ORS), IV fluids and diarrhea kits . UNICEF Lancet appeal, IRC staff further described providing seven hospitals with drugs, supplies and infrastructure, deploying mobile health teams and establishing community health volunteer networks for referral of malnourished children to treatment and counsel [On their webpage for Yemen, the International Rescue Committee (IRC) described delivering health, nutrition, WaSH services, essential drugs and medical supplies, training health staff on cholera treatment and advocating for a direct humanitarian air service and for peace . In a La counsel .The International Committee of the Red Cross (ICRC) reported having sent medical supplies including IV fluids, ORS, antibiotics and chlorine tablets for cholera management, supported 17 cholera treatment facilities and provided care to nearly one in five cholera cases in Yemen, and they had dispatched engineers to restore water supply systems in the country , 39.M\u00e9decins Sans Fronti\u00e8res (MSF) described having admitted more than 103,000 patients to 37 cholera treatment centers and oral rehydration points  and planto prevent a full-blown humanitarian catastrophe in Yemen\u201d [While the above is not an exhaustive list of all the activities of these organizations, it should at least provide an overview of some of their main focus areas in Yemen up until the time of review. It is also important to note that it was not within the scope of this paper to review the activities of all major engineering and infrastructure organizations present in Yemen, as well as the examined health organizations, and the following discussion of sanitation efforts will pertain only to organizations with a health mandate. Furthermore, the humanitarian crisis in Yemen has been neglected by the international community \u201325, and n Yemen\u201d . An addin Yemen\u201d . This wan Yemen\u201d \u201350.Lancet Gastroenterology & Hepatology editorial it is stated that \u201c\u2026 plans for a vaccination effort were deemed futile and scrapped, citing security issues, challenges in distribution and administration, and the sheer scale of the epidemic...\u201d [A striking observation from our review of the humanitarian response is the absence of delivering OCVs in any of the examined organizations\u2019 attempts to control the outbreak, except for the WHO, Health and WaSH clusters\u2019 description of plans to explore the feasibility of OCVs. At the time , nearly 1 million cases had already occurred . In Julyemic...\u201d . In Auguemic...\u201d , 55.OCVs for emergency settings are stored in a donor-funded stockpile managed by the International Coordinating Group on Vaccine Provision (ICG) . A recenAccepting the unacceptable premise that the Yemeni conflict became reality, the question that arises is: Could the largest cholera outbreak ever recorded have been avoided or at least managed, had enough OCVs been deployed earlier on in the conflict?ex post facto rationalization of a deeply chaotic situation that, as indicated above, most probably did not lend itself to orderly and comprehensive public health interventions such as mass vaccination.The solely theoretically based answer to this question is: Most likely, given the available evidence of the qualities of OCVs. However, considering the nature of this humanitarian emergency, this answer becomes little more than an Lancet Gastroenterology & Hepatology editorial mentioned earlier [Human Rights Watch have reported utterly chaotic conditions in Yemen . If thei earlier . Also, g earlier , and thaNature [However, this explanation is challenged by the magnitude of the other humanitarian operations that it evidently has been possible to carry out in Yemen. In light hereof, some level of criticism may be warranted of the international humanitarian response as being very adept at managing cases when the outbreak had begun, as reflected by the impressively low case fatality rate of 0.21%, but ill-equipped in terms of preventing a cholera outbreak in the approximately 2 years of conflict and humanitarian presence that preceded the outbreak (this view is shared by Dr. Anita Zaidi in a recent opinion piece in Nature ), or conConcerning water and hygiene interventions, it appears that the Health and WaSH clusters, the IRC, MSF and ICRC have been thoroughly engaged. However, we were unable to document any major dedicated sanitation interventions carried out by the international humanitarian health organizations investigated. As mentioned, this may likely be due to the type of organizations examined, but nevertheless it leads to the question of whether and to what extent international humanitarian health organizations should increase their focus on addressing the environmental determinants of health rather than managing the cases they generate. This is a core discussion in humanitarian health that it is not within our mandate nor our abilities to answer, but the case of Yemen underlines the necessity of having this discussion on a continuous basis within each implementing humanitarian health organization. Going forward, given the current breakdown of sanitation systems  and the cholera outbreaks are entirely containable\u201d  [OCVs were not delivered until nearly 3.5\u2009years into this humanitarian emergency, which has most likely been due to ongoing conflict, logistical circumstances, the scale of the epidemic, impairment of the humanitarian response by the parts to the conflict and some degree of negligence from donors, politicians and other decision makers. Whatever the reasons, OCVs were not distributed until nearly 16\u2009months into the cholera outbreak by which time more than a million cases had accumulated. Neither were they in the two years of WaSH infrastructure breakdown that preceded the outbreak. This should serve as a historic example of the failure to control the spread of cholera given the tools that are available. Today, \u201cBased on their experience with the cholera outbreak in Juba, South Sudan, Parker et al. (2017) advocate among other things for improved laboratory and surveillance capacity in countries to be able to declare outbreaks faster, and for simplification of the mechanisms to access the ICG stockpile to allow for timely deployment of vaccines .Single-dose killed oral cholera vaccination has been attempted, and the strategy has shown a mean short-term effectiveness of 69% in meta-analysis based on two studies , and 40%The 2011 Sphere Handbook applicable in the Yemen conflict did not specifically recommend reactive or pre-emptive mass OCVs , but it Assessment of the need for mass OCVs should happen pre-emptively in a humanitarian emergency. Regarding this issue, Qadri et al. (2017) and Parker et al. (2017) argue for the development of validated predictive tools to help guide the decision on when and to which humanitarian emergencies OCVs should be deployed, a notion we do support, whilst acknowledging the difficulty of the task of predicting the outbreak of cholera , 69. TheBased on the example of Yemen, Dureab et al. (2017) argue for the institution of emergency preparedness systems by countries in conflict capable of preventing epidemics . While wThe Lancet editorial board notes that high-level attention for Yemen is necessary with continued advocacy including at the UN level for the protection of health in conflict situations [Finally, in terms of advocacy, tuations . We willThe conflict in Yemen has caused the largest cholera outbreak in epidemiologically recorded history. OCVs were not delivered pre-emptively, nor until nearly 16\u2009months into the outbreak, during which time more than a million cases occurred. We are, hopefully, entering into a new era in which OCVs will be amply available for rapid disbursement to humanitarian emergencies. Continuous funding to the ICG OCV stockpile will be crucial to maintain this option for prevention and control of cholera outbreaks. Of equal importance will be the timely recognition of the need for mass OCV deployment and development of more specific, comprehensive and actionable evidence-based frameworks to help guide this decision, however difficult this may be. The Yemen cholera outbreak highlights the importance for international humanitarian health organizations to have a continuous discussion about whether and to what extent they should increase their focus on pre-emptively addressing the environmental determinants of communicable diseases in humanitarian emergencies. Finally, strong advocacy from the public health community for peace and the protection of human health, by bringing to attention the public health impacts of armed conflict and keeping the world\u2019s political leaders accountable to their actions, will remain crucial."}
+{"text": "BAFFR promoter suggests that the transcriptional activator promotes the increase in BAFFR expression observed in about 50% of pre-B-ALL patients carrying the t translocation. BAFF binding to BAFFR led to the processing of NF-\u03baB2 p100 in pre-B ALL cells suggesting that BAFFR can activate the NF-\u03baB2 pathway in pre-B ALL cells. Surprisingly, we found that BAFF treatment promotes the cell death of primary BCR-ABL+ BAFFR+ pre-B-lymphoblasts in adult B-ALL. It also enhances glucocorticoid-induced apoptosis in the E2A-PBX1+ pre-B-ALL cell line 697. These data suggest that BAFF/BAFFR signaling in B-ALL cells differs from normal B cells and that it may affect the pathogenesis of the disease.BAFF, APRIL and their receptors regulate the survival, maturation and homeostasis of mature B-cells. Despite the lack of a functional role of BAFF/APRIL system during normal early B-cell development, previous studies indicated a contribution of these molecules in the pathogenesis of B-lineage acute lymphoblastic leukemia (B-ALL). Here, we evaluated the expression of this system in B-ALL and its involvement in spontaneous and drug-induced apoptosis of B-lymphoblasts, taking into consideration the distinct disease subtypes. We found that BAFFR is the most predominant aberrantly expressed receptor in B-ALL and that its expression, along with BCMA and APRIL, positively correlates with the maturation stage of B-lymphoblasts. Moreover, the binding of the E2A-PBX1 chimeric protein to the  BAFF is produced as a membrane-bound protein and upon proteolytic cleavage it is released as a soluble ligand, which exists either as trimer or 60-mer, which combines 20 BAFF trimers to form a virus-like structure \u20134. BAFF  B-cells , 8 and b B-cells , 10, BAFSeveral reports provided evidence that the BAFF/APRIL system also plays a role in the pathogenesis of mature B-lineage cancer \u201313 as thBAFFR gene in pre-B-lymphoblasts, suggesting that E2A-PBX1 plays a role in the upregulation of BAFFR expression. Moreover, the aberrantly expressed BAFFR surprisingly acts as a cell death-promoting receptor of pre-B-ALL cells.Since B-ALL is a heterogeneous type of leukemia, different mechanisms may account for the aberrant expression and function of BAFF/APRIL system molecules. For example, the chromosomal translocation t is found in ~50% of pre-B ALL cases and correlates with intermediate prognosis. The translocation leads to the expression of a protein which combines the transactivation domains of the transcription factor E2A with the DNA binding domain of PBX1 . Here weSeventy-one patients with ALL , diagnosed according to standard criteria , 25, wer+ subsets. For the mRNA analysis of BAFF/APRIL ligands and receptors, monocytes, and B-cells were purified from normal PB mononuclear cells. Details on cell isolation are provided in Supplementary Methods.Mononuclear cells were obtained by density-gradient centrifugation from 70 out of 71 patients with ALL, from 4 BM samples of patients with non-Hodgkin lymphoma of the control group and from all  normal P+) and the T-ALL cell line Jurkat were cultured in IMDM, supplemented with 10% heat-inactivated FBS and 1% penicillin-streptomycin-glutamine .The pre-B-ALL cell line 697 .TACI and BAFFR was determined by quantitative Real-Time RT-PCR, while the expression of BCMA, APRIL, BAFF, and deltaBAFF (\u0394BAFF) transcripts was determined by semi-quantitative conventional RT-PCR using beta-2-microglobulin (B2M) transcripts as reference (Supplementary Methods). TEL-AML1, E2A-PBX1, BCR-ABL (p190 and p210) chromosomal translocations were detected in B-ALL patients by two-step multiplexes RT-PCR as described  and compared to respective isotype-matched Ig controls. Cells were analyzed on Coulter FC-500 flow cytometer .+, BAFFR+) were crosslinked in culture medium with 1% formaldehyde for 15 min at room temperature. Following sonication, ChIPs were performed according to EZ-ChIP\u2122-Chromatin Immunoprecipitation Kit  protocol using a mouse anti-E2A-PBX1 antibody  or mouse IgG1 kappa isotype control (BD Biosciences). DNA was amplified by qPCR with primers flanking putative E2A-PBX1 binding sites on BAFFR gene  or negative control primers as listed in InputCt\u2212ChIPCt) (Six hundred ninety-seven (697) cells (E2A-PBX1\u2212ChIPCt) .Western blot analysis was performed as described before , 31, usi4 cells were incubated in IMDM-10% FBS in the presence or absence of 60-mer BAFF , with/without marimastat . At the indicated time points , CD19+ 7-AAD\u2212cells were analyzed in triplicates by flow cytometry by timed acquisition , or 60-mer (5 ng/mL) for 2 days and treated with 3-mer (5\u2013800 ng/mL) or 60-mer BAFF (5 ng/mL) with or without hypotoxic concentrations of aracytine , dexamethasone , prednisolone , methylprednisolone , hydrocortisone  for 697 cells and 200 \u03bcg/mL dexamethasone for Jurkat cells; according to titration assays, we chose those drug concentrations below the threshold of 50% B-lymphoblasts apoptosis (IC50) to prevent that glucocorticoid-induced cell death would mask potential effects of BAFF. After 72 h, cell death was analyzed using an annexin V cell apoptosis kit (Beckman Coulter); data represent the average of 2\u20135 experiments.Six hundred ninety-seven (697) and Jurkat cells were grown in 48-well plates at 10Based on our findings, 697 cells were also incubated with/without 8 \u03bcM of marimastat, 20 ng/mL dexamethasone and 5 ng/mL BAFF for 3 days and apoptosis was assessed as described above.U and Kruskal-Wallis H tests. Correlations at expression level were made according to Spearman's rank correlation coefficient. Statistical significance for in vitro cell assays with drugs was tested with Wilcoxon signed-rank test. Graphs were made on Graphpad Prism 6. P value (2-sided) <0.05 was considered statistically significant.Data analysis was performed with SPSS 22.0. Comparisons of gene expression between ALL groups were based on the non-parametric Mann-Whitney BAFFR, TACI, BCMA, BAFF, and APRIL relative to B2M transcripts, we found that BAFFR and BCMA transcripts are expressed by B-ALL cells (n = 63), although at lower levels compared to primary B-cells or EBV lines, while TACI seems to be expressed only at background levels , with all of them suffering from pre-B-ALL ; interestingly, when TACI was expressed, it was significantly correlated to BAFFR mRNA levels . Moreover, we found a significant association of BAFF expression with its alternatively spliced isoform \u0394BAFF  and APRIL , while the latter two were also correlated to each other .Similar to LL cases  and its activity , it may BAFF, \u0394BAFF, APRIL, BAFFR, TACI, and BCMA with clinicolaboratory findings at diagnosis , initial response to treatment and survival of our cohort of patients .Finally, no significant associations were observed between the expression of BAFFR mRNA expression was found in about 60% of the E2A-PBX1+ pre-B-ALL cases, to functionally investigate the mechanisms underlying this phenomenon, binding of E2A-PBX1 to regulatory sequences in the BAFFR locus was analyzed. ChIPs in pre-B-ALL cells (697) that carry the E2A-PBX1 fusion and express only BAFFR, mimicking patients' phenotype, evaluated whether E2A-PBX1 binds in vivo to sequences of the BAFFR gene that include PBX consensus motifs . E2A-PBX1 was shown to bind to the promoter of BAFFR, with the enrichment being 3.3-fold vs. the IgG control , we found that B-ALL cells of 8/12 patients expressed BAFFR, although at lower levels than mature B cells from the same patients . Differe+ pre-B ALL patients and from one BAFFR\u2212 common B-ALL patient with BAFF overnight in a dose-dependent manner. The immunoblotting analysis revealed processing of p100 into p52 in BAFFR+ pre-B-ALL cells and in the 697 cell line, but not in the BAFFR\u2212 common B-ALL sample .ES, HE, and MS provided the study concept and design. ES, EK, CS, E-NK, NA, AG, HE, and MS performed acquisition, analysis, and interpretation of data. MP, NG, GV, MA, MM, and SP provided samples and insight. ES, HE, and MS made drafting of the manuscript. EK, CS, GV, MM, SP, AG, HE, and MS provided critical revision of the manuscript for important intellectual content. ES and MS performed statistical analysis. MS supervised the study.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Rosa hybrida) petal extract (WRPE) in mice that are challenged with kainic acid (KA) were examined using behavioral epileptiform seizures as well as biochemical and morphological parameters of oxidative stress and inflammation. WRPE (50\u2013200 mg/kg) was orally administered to male ICR mice for 15 days, and intraperitoneally challenged with KA (30 mg/kg). Seizure activity, lipid peroxidation, inflammatory cytokines, and related enzymes were analyzed in the brain tissue, in addition to the morphological alterations in the hippocampal pyramidal neurons. Separately, antioxidant ingredients in WRPE were analyzed, and antioxidant, anti-inflammatory, and neuroprotective activities of WRPE were investigated in HB1.F3 human neural stem cells (NSCs) to elucidate underlying mechanisms. Total polyphenol and flavonoid contents in WRPE were 303.3 \u00b1 15.3 mg gallic acid equivalent/g extract and 18.5 \u00b1 2.2 mg catechin/g extract, respectively. WRPE exhibited strong radical-scavenging activities and inhibited lipid peroxidation in vitro, and protected glutamate-induced cytotoxicity in NSCs by suppressing inflammatory process. Treatment with WRPE attenuated epileptiform seizure scores to a half level in KA-challenged mice, and decreased hippocampal pyramidal neuronal injury and loss (cresyl violet and DAPI staining) as well as astrocyte activation (GFAP immunostaining). Lipid peroxidation was inhibited, and mRNA expression of antioxidant enzymes  were recovered in the brain tissues. Inflammatory parameters (cytokines and enzymes) including NF-kB, IL-1\u03b2, TNF-\u03b1, IL-6, HMGB1, TGF-\u03b2, iNOS, COX2, and GFAP mRNAs and proteins were also down-regulated by WRPE treatment. Taken together, the results indicate that WRPE could attenuate KA-induced brain injury through antioxidative and anti-inflammatory activities.Since oxidative stress and inflammation are involved in seizure-related neurotoxicity, the neuroprotective effect of a white rose ( Seizures induce neuronal death through over-activation of glutamate receptors , which mOver the past 10 years, several studies have confirmed that inflammatory processes in the brain might constitute a crucial mechanism of seizures and epilepsy ,5,6. ForKainic acid (KA), an analogue of glutamate, has been used as a model compound for the study of neurotoxicity of various excitatory amino acids (EAAs), because KA triggers temporal lobe epileptiform seizures that are known to be associated with the excessive release of glutamate that may underlie the pathogenesis of neuronal injury ,11,12. SAlthough various antiepileptic drugs have been prescribed to prevent seizures, interfere with epileptogenesis, and eliminate neurodegeneration in most patients, the development of novel natural products is important for patients who experience drug resistance and deleterious side effects to traditional drugs . Thus, mPreviously, we reported that white rose petal extract (WRPE) displayed a broad spectrum of antioxidant , anti-baRosa hybrida Colorado were procured from a rose farm . The flowers were collected in May 2014, completely dried in the shade to obtain dried petals, and then ground in a rotor mill . The dried petal powder was extracted in an ultrasonic bath with 50% ethyl alcohol three times at 60 \u00b0C, and then filtered to obtain WRPE. The resulting fractions were completely dried in a vacuum evaporator.Fresh white flowers of v/v) using a separatory funnel. The upper phase was evaporated using a rotatory evaporator at 40 \u00b0C , dissolved in methanol, and filtered through a 0.2-\u03bcm syringe filter . An HPLC series system  with a UV detector was used, and separation was achieved using a Mightysil RP-18 GP column . The absorbance was measured at 280 nm. The mobile phases were 0.1% acetic acid in acetonitrile (solvent A) and 0.1% acetic acid in water (solvent B). The injection volume was 20 \u03bcL and the gradient was as described in High-performance liquid chromatographic (HPLC) analysis was performed while using a slightly modified protocol of Kim et al. . WRPE wa2CO3 (2 mL). At least 3 min later, 50% Folin-Ciocalteu reagent (100 mL) was added, and the absorbance was measured at 750 nm while using a spectrophotometer . The amount of phenolic ingredients was quantified using a calibration curve prepared with standard gallic acid solutions (0.1\u20130.5 mg/mL).In order to measure total phenolic compounds, the sample (100 \u03bcL) was mixed with 2% Na2 (75 \u03bcL). Five min later, 10% AlCl3 (150 \u03bcL) was added. After 6 min, 1 M NaOH (500 \u03bcL) was added, and the absorbance was measured at 510 nm using the spectrophotometer. A calibration curve was made using (+)-catechin hydrate solutions (0.1\u20130.5 mg/mL) under the same procedures.To determine total flavonoid content, distilled water  was added to the sample (250 \u03bcL) and mixed with 5% NaNOAntioxidant activities of WRPE were measured with radical-scavenging and lipid peroxidation assays in vitro. 2,2\u2032-azino-bis-3-ethylbenzthiazoline-6-sulphonic acid (ABTS) and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical-scavenging activity and determining the formation of thiobarbituric acid (TBA)-reactive substances (TBARS) were measured of WRPE as previously described . All samLipid peroxidation was measured by determining the formation of thiobarbituric acid (TBA)-reactive substances (TBARS) as previously described .2 at 37 \u00b0C in tissue culture flasks. The cells were grown to 90% confluency and subjected to the cytotoxicity test.The HB1.F3 human NSCs  were cul6 cells) were treated with various concentrations (0\u201350 mM) of sodium glutamate for 2 h. After washing with DMEM medium, the cell viability was determined 24 h later while using the LDH assay. The LDH content was determined using a commercial non-radioactive LDH assay kit  according to its protocol. In order to evaluate the protective effect of WRPE, HB1.F3 cells were treated with various concentrations (0\u20131250 \u00b5g/mL) of WRPE and, 30 min later, with 2.5 mM glutamate. After washing with fresh medium in 2 h, the cells were cultivated for 24 h further to measure LDH release. The experiments were performed in triplicate.Cytotoxicity of glutamate and protective effect of WRPE were quantified by measuring LDH release from HB1.F3 NSCs. To determine median lethal concentration (50% LDH release), HB1.F3 cells  according to the manufacturer\u2019s instructions. Quantitative real-time PCR were measured according to previously described methods . Glycerat method .NSCs were homogenized in 10 volumes of RIPA buffer  containing protease inhibitors  and phosphatase inhibitors . Western blot analysis was conducted according to previously described methods . The memad libitum.Seven-week-old male ICR mice were purchased from Daehan Biolink . They were housed in an environmentally-controlled room with constant temperature (23 \u00b1 3 \u00b0C), relative humidity (50 \u00b1 10%), and 12-h light/dark cycle. The animals were fed a standard rodent chow and purified water n = 15/group) were assigned to treatment groups. WRPE at 50, 100 or 200 mg/kg/day or its vehicle (purified water) was orally administered for 15 days, and KA was injected into the intraperitoneal cavity to induce epilepsy 30 min after the last WRPE treatment. Nine animals from each group were sacrificed 4 h after KA injection to analyze the oxidative and inflammatory reactions in the brain. The remained animals (n = 6/group) were sacrificed three days later for the analysis of histopathological alterations. All of the experimental procedures were carried out in accordance with the Standard Operating Procedures of the Laboratory Animal Center, Chungbuk National University (CBNU), Korea, and this protocol was approved by the Institutional Animal Care and Use Committee of CBNU .After acclimation to the laboratory environment for one week, the mice  according to the manufacturer\u2019s instructions. The protein concentration of the supernatants was analyzed using a Pierce\u2122 BCA Protein Assay kit . All of the samples were analyzed in duplicate and the data were expressed as pg/mg protein.Lipid peroxidation in the brain homogenate was performed described above.Quantitative PCR in total RNA isolated from the brain homogenate was performed described above. The primer sets were used to amplify NF-\u03baB, TNF-\u03b1, IL-6, iNOS, COX2, and SOD2 .Western blot analysis in the brain homogenate was performed described above.In order to observe morphological alterations, brain tissues were removed and post-fixed overnight, followed by cryoprotection in a 30% sucrose solution for 48 h. Brain coronal cryosections (15 \u03bcm in thickness) including the hippocampus (\u22121.8 to \u22122.2 mm from the bregma) were obtained using a microtome  and stained with cresyl violet . Neurons with normal appearance in the pyramidal cell layer of the CA3 region  were counted.To visualize degenerative neurons, brain sections were stained with an FJC kit , according to the manufacturer\u2019s instructions with some modifications. In brief, after immersing in DW for 2 min, brain cryosections were incubated in potassium permanganate solution for 10 min, rinsed with DW for 2 min, and incubated in FJC solution for 10 min. The slides were then washed and mounted on coverslips with Vectashield mounting medium . All of the sections were observed and photographed under a fluorescence microscope with a blue excitation light .For immunohistochemical staining of astrocytic GFAP, brain cryosections were rinsed in TBS and treated with 3% hydrogen peroxide for 5 min to block endogenous peroxidase activity. After washing with TBS and blocking with 5% BSA, the sections were incubated overnight at 4 \u00b0C with an antibody specific to GFAP  and with a secondary antibody being conjugated with Alexa Fluor-594 . The sections were counterstained with 4\u2032,6-diamino-2-phenylindole  to identify cellular nuclei and viewed under a laser-scanning confocal microscope .p < 0.05. All data were expressed as the mean \u00b1 SD.Statistical comparisons between the groups were performed using one-way analysis of variance followed by a Tukey\u2019s multiple comparison test. All analyses were conducted while using the Statistical Package for Social Sciences for Windows software, version 12.0 . Statistical significance was assessed at The total polyphenol and flavonoid contents in WRPE were 303.3 \u00b1 15.3 mg gallic acid equivalent/g extract and 18.5 \u00b1 2.2 mg catechin/g extract, respectively A. Althou3 (50 \u00b5M). However, treatment with various concentrations (0\u20135000 \u03bcg/mL) of WRPE significantly reduced the lipid peroxidation in a concentration-dependent manner  of glutamate for 2 h, cell death (LDH release) increased in a concentration-dependent manner between 0.8 and 12.5 mM A. HigherExposure of NSCs to 2.5 mM glutamate resulted in 176% increase in LDH release B. NotablTreatment of NSCs with glutamate (2.5 mM) significantly up-regulated the NF-\u03baB mRNA expression C. IntereIn the western blot analysis, in addition to iNOS and COX2, the production of proteins of proinflammatory cytokines such as TGF-\u03b2 and high-mobility group box 1 (HMGB1) was increased by glutamate H,I. HoweSeizure activity increased up to 60 min after KA injection, reaching mean score of 4.78 \u00b1 0.14, and then gradually disappeared, lasting to 110\u2013120 min A. NotablIntensive seizures that were induced by KA challenge increased the TBARS concentration up to 3 times the control level B. HoweveThe concentration of IL-1\u03b2 and TNF-\u03b1 significantly increased in the brain tissue of KA-challenged mice A,B. As iIn the western blot analysis, the production of proteins of inflammatory enzymes iNOS and COX2 as well as proinflammatory cytokines TGF-\u03b2 and HMGB1 was markedly increased by KA-induced seizures H,I. NotaIn cresyl violet staining, KA-induced neuronal death exhibiting many halos around shrunk cells was mainly observed in the CA3 pyramidal cell layer F. HoweveMany FJC-positive (green colored) cells were observed in the hippocampal pyramidal cell layer of KA-challenged mice B,F. SuchInflammation-activated CNS astrocytes are characterized by hypertrophy and proliferation, along with an up-regulation of their cytoskeletal GFAP. There were intensive GFAP-immunoreactivities (red-colored) of activated astrocytes in the subventricular zone and striatum of the KA-challenged mice B,F. HoweIn the present study, we demonstrated that WRPE containing polyphenols and flavonoids exerted neuroprotective effects via antioxidative and anti-inflammatory activities in glutamate-treated NSCs and KA-challenged mice.Generally, over-stimulation of glutamatergic neurons is major risk factor of excitotoxicity . The mecSince oxidative stress plays a critical role in excitotoxicity , antioxiin vivo are related to the number of hydroxyl functional groups in their structures [It is well known that phenolic and flavonoid compounds are secondary metabolites with high antioxidative and anti-inflammatory properties ,33. The ructures . As actiructures . PyrogalIn our previous studies, WRPE has been shown to improve allergic dermatitis, skin aging, and especially ischemic stroke via its antioxidant and anti-inflammatory properties ,22,23,24Over the past decades, experimental and clinical findings have supported a crucial role of inflammatory processes in epilepsy, particularly in the mechanism underlying the generation of seizures . SeizureInterestingly, excitotoxicity also contributes to neuronal injury in diverse acute and chronic neurodegenerative diseases including cerebral infarction and traumatic brain injury (TBI) . In partNotably, iNOS is an enzyme that is responsible for production of nitric oxide (NO) mediating oxidative and inflammatory responses during epileptogenesis . AstrocyWRPE containing polyphenols and flavonoids exerted neuroprotective effects via antioxidative and anti-inflammatory activities. Specifically, WRPE exhibited radical-scavenging and lipid peroxidation-inhibitory activities in vitro, and protected against glutamate-induced cytotoxicity in neural stem cells. Also, pretreatment with WRPE attenuated epileptiform seizures in KA-challenged mice, and reversed hippocampal pyramidal cell loss and astrocyte activation, in which the antioxidant and anti-inflammatory parameters were restored. Therefore, it is suggested that WRPE could be a good candidate as an anti-epileptic or neuroprotective agent for clinical trials to attenuate seizure-related brain injury."}
+{"text": "The blood group of Malagasy patients with cancer have never been the subject of previous publications. Our objective was to determine the blood group of Malagasy patients with cancer followed in the Medical Oncology Unit of the Soavinandriana Teaching Hospital, Antananarivo. This was a one-year retrospective study (November 2012 to October 2013) in patients over the age of 15 with histological or pathological evidence of their cancer. One hundred and thirty of the 258 patients identified had an ABO blood group determination (50.39%). Among these 130 patients, 114 patients (87.69%) had solid tumors and 16 patients (12.31%) had hematologic malignancies. Thirty seven (28.49%) patients were transfused and 93 (71.54%) not transfused. There were 57 men and 73 women (sex ratio = 0.78), the average age was 55.11 +/- 14.76 years. With regard to their blood group, 52 patients (40%) were blood group B, 44 (33.84%) group O, 27 (20.76%) group A and 7 (5.38%) group AB. The order of blood group frequency of cancer patients in our series differs from other studies. This study has allowed us to know the proportion of each blood group in our Unit and thus help us in the management of stocks of labile blood products in our hospital. One hundred and thirty of the 258 patients identified had an ABO blood group determination (50.39%). Among these 130 patients, 114 patients (87.69%) had solid tumors and 16 patients (12.31%) had hematologic malignancies. Thirty seven (28.49%) patients were transfused and 93 (71.54%) not transfused. There were 57 men and 73 women (sex ratio = 0.78), the average age was 55.11 +/- 14.76 years. With regard to their blood group, 52 patients (40%) were blood group B, 44 (33.84%) group O, 27 (20.76%) group A and 7 (5.38%) group AB (Few studies on the Malagasy blood group have been conducted in the general population and among certain categories of population , 2. For group AB .This is the first ABO blood group study in Malagasy patients with cancer. It allow us determine the blood groups' repartitions of some Malagasy patients suffering from cancer. Although in the Malagasy population, knowing the blood group is not common , 2, the The order of blood group frequency of cancer patients in our series differs from other studies. The possible biases of our study remind us of the need to carry out studies determining the association between blood groups ABO and the risk of developing cancers in our country. Nevertheless, this study has allowed us to know the proportion of each blood group in our Unit and thus help us in the management of stocks of labile blood products and awareness of donations of blood in our hospital.The authors declare no competing interests."}
+{"text": "Satureja hortensis L.) extract in diet on broilers performance, immune response, hematology, and microbiota. Based on findings, dietary supplementation with summer savory extract, as natural feed additive, sustained growth traits and improved the feed efficiency and health status of broilers.The growth-promoting effect of many herbs and their extracts in poultry has been reported in literature. Therefore, the objective of this feeding trial was to determine the effect of different levels of summer savory (Satureja hortensis L.) extract (SSE) on growth, plasma constituents, immune response, and gut microbiota of broiler chickens. A total of 300 day-old broiler chicks were randomly assigned to five dietary treatments containing five replicates of 12 birds each. The treatments consisted of a controldiet without feed additive and experimental diets supplemented with four levels of SSE . Results showed no significant effect of SSE supplementation on broiler body weight gain (p > 0.05), but feed conversion ratio was significantly (p < 0.05) improved when fed 400 mg/kg SSE compared to control. Most of the blood parameters and immune response criteria studied were improved (p < 0.05) by SSE supplementation. There was no dietary effect on Lactobacilli count (p > 0.05); conversely, Escherichia coli count was reduced and the Lactobacilli/E. coli ratio improved with SSE (p < 0.05). Based on our findings, it was concluded that supplementation of the diet with SSE up to 400 mg/kg sustained growth traits and improved the feed efficiency and health status of broilers. However, more research is needed on this subject in order to better understand the mode of action of the extract used.This study investigated the effects of summer savory ( The gradual ban of antibiotics in animal feed due to their health hazards to both animal and human consumers of animal products has increased the research interest into natural products with antimicrobial activity ,2. The uSatureja hortensis L.) is an annual herbaceous aromatic and medicinal plant belonging to the Lamiaceae family. Savory is a good source of essential oils, mainly carvacrol and thymol, which have several health benefits including anti-inflammatory [Savory  could improve and sustain the growth performance, plasma constituents, immune response, and ileal microflora of broiler chickens during a 42-day production cycle.Savory plant aerial parts were harvested and sun-dried, and extract was prepared as previously described . BrieflyThe study was conducted on a commercial poultry farm in Rasht, Iran. The experimental protocol was approved by the Animal Ethic Committee of the Islamic Azad University, and the experiment was conducted in accordance to the International Guidelines for Research involving animals (Directive No. 2010/63/EU). A total of 300 Ross 308 male broiler chicks were used in the feeding trial. Thermo-neutral ambient temperature was maintained in accordance to standard brooding practices and adapted to the birds rearing stages . Lighting was provided for 24 h on day 1, and 23 h per day thereafter. Broiler diets were formulated  for three growth periods  as mash form . Birds wFeed consumption was assessed by difference between the quantity fed and left over. Birds were weighed at the beginning of the experiment and end of each growth phase to determine the body weight gain. Feed conversion ratio (FCR) was calculated as the ratio of feed consumed to body weight gained.g \u00d7 10 min at room temperature) and stored at \u221220 \u00b0C until analyses. Parameters determined were as follows: glucose, triglycerides, uric acid, total cholesterol, high density lipoprotein (HDL), low density lipoprotein (LDL), HDL to LDL ratio, and alkaline phosphatase. Blood traits were determined based on standard protocols using commercial kits as reported in Nahavandinejad et al. [At the end of the experiment (42 days), two birds were randomly selected from each replicate (eight birds per treatment) and fasted (4 h) and used for blood sampling. Blood samples (~5 mL/bird) were collected from wing vein into tubes containing 10 mg ethylene diaminetetra-acetic acid (EDTA) for plasma separation. Serum was separated by centrifugation  was inoculated under skin of breast. In each replicate, only two birds were tested. In these birds a pre-immune blood sample was collected. For the assessment of the immune parameters, blood samples (~2 mL) were collected from wing vein on the pre-scheduled days. The samples were centrifuged at 1500 rpm \u00d7 10 min and serum was harvested and stored at \u221220 \u00b0C until analysis. Response to the Newcastle lentogenic vaccine was assessed in blood twice, at days 15 and 26. Lyophilized vaccines  were prepared with strains Hitchner B1, Lasota, and Clon 30, and administered on days 1, 35, and 42, respectively. Hemagglutination inhibition (HI) assays were used to determine the vaccine titres of Newcastle disease (ND) following the procedure described in previous trials [g \u00d7 15 min) and antibody titers against the infectious bursal disease (IBD) and infectious bronchitis (IB) viruses were measured using commercially available ELISA kits [To evaluate the immunity, three birds per pen were challenged with sheep red blood cells (SRBC) twice, at days 13 and 24, and blood was sampled at days 22 and 38 for assessment of total antibody, IgG, and IgM production. For the SRBC challenge, 0.5 mL of a 10% suspension of SRBC in sterile phosphate buffered saline (PBS) solution  [p < 0.05. Data were analyzed using one-way ANOVA of GLM procedure (IBM SPSS Statistics software for Windows\u00ae) . The penp > 0.05). In the grower phase (15\u201328 d), feed intake was quadratically reduced (p < 0.05) when broilers were fed more than 300 mg/kg SSE. None of the growth parameters evaluated were affected (p > 0.05) by dietary treatments during the finisher phase (29\u201342 d).The growth performance results are summarized in p < 0.05). Feed intake was not different (p > 0.05) among the control, 200, 300, and 400 mg/kg SSE and between the SSE groups. The FCR was improved linearly when fed 400 mg/kg diet (p < 0.05) compared to control and 300 mg/kg SSE. The combined growth performance (1\u201342 d) showed lower feed intake on 100 mg/kg SSE compared to the control (p < 0.05) at 200 and 300 mg/kg compared to 100 and 400 mg/kg SSE. Inclusion of SSE reduced serum uric acid concentration . Total cholesterol was lowered at 300 mg/kg and triglycerides concentration was reduced  at 200 and 300 mg/kg SSE in diet. Significantly lower HDL and higher LDL cholesterol and alkaline phosphatase values were observed in the control diet group . In addition, plasma LDL was also lowered  in groups on 300 and 400 mg/kg SSE compared to the control.Serum glucose concentration  showed tp < 0.01). The IgG values were not different (p > 0.05) among control, 100, 200, and 300 mg/kg groups at 42 d. The IgM was not affected by treatments at 28 d (p > 0.05), but higher values were observed among SSE groups at 42 d .The immune response of the broilers  showed ap < 0.05 and quadratic, p < 0.01). The titre of IBD virus was not affected by the treatment (p > 0.05), but titre of IB virus was significantly increased by SSE supplementation . The anti-Newcastle disease hemagglutination-inhibition titre increased above 100 mg/kg SSE in diet ; the count of Lactobacilli was not affected by treatments (p > 0.05), but the ratio of Lactobacillito E. coli was significantly increased with SSE supplementation  and maximized at 100 mg/kg SSE.The ileal microflora count  showed aThe available published literature on the use of summer savory as feed supplement in poultry diet is scanty. In the present study, the inclusion of SSE did not affect broilers body weight gain and the pattern of feed intake could not be traced to any specific treatment effects. The pattern of weight gain observed in our study is in agreement with the report of Nobakht et al.  who fed Essential oils are reported to have several beneficial functions in poultry diet, including increased feed intake ,18, digeE. coli, similarity to Lactobacilli counts, and the higher ratio of Lactobacillito coliforms suggests better gut health of the SSE-treated birds. This pattern of IBD and IB virus titres, E. coli and Lactobacilli counts observed may suggest a selective antimicrobial activity of savory extract. Moreover, the improved gut ecology may explain the increase in the antibody titers due to nutrient sparing effect. However, more studies are needed in this area.There is a current lack of published data on the effects of feeding of savory products on plasma constituents in broiler chickens. The pattern of serum constituents observed in this study may be speculatively linked with the digestive properties of essential oils in savory. Dietary supplementation of thymol was reported to significantly increase pancreatic activity in broilers . IncreasIn conclusion, the dietary supplementation with summer savory extract up to 400 mg/kg, as natural feed additive, sustained growth performance and improved the health status of broiler chickens. However, further investigation is recommended in order to establish a better understanding of the mode of action of the extract."}
+{"text": "Patients with a deficient allele (n = 476) and with a normal genotype were compared. Results: A statistically significant association was found between deficient genotypes and GOT (p < 0.0003), GPT (p < 0.002), and GGT (p < 0.006). Comparing GOT levels in patients with PI*Z deficient variant versus those with normal genotype, an odds ratio (OR) of 2.72 (CI: 1.5\u20134.87) (p < 0.0005) was obtained. This finding was replicated with the PI*Z allele and the GPT values . In addition, a statistically significant association was found between liver enzymes and AAT values. Conclusion: The PI*Z allele seemed to be a risk factor for the development of liver damage. AAT deficient genotypes were associated with GOT, GPT, and GGT altered values. Low AAT levels were associated with high GPT and GGT levels.Background: Patients with liver disease associated with alpha-1 antitrypsin deficiency (AATD) are homozygous for the Z mutation, leading to chronic liver damage. Objective: To assess the serum levels of glutamate-oxaloacetate transaminase (GOT), glutamate-pyruvate transaminase (GPT), and gamma-glutamyl transpeptidase (GGT) in patients with different genotypes for the alpha-1 antitrypsin (AAT) gene. Methods: Patients ( Alpha-1 antitrypsin (AAT) is a glycoprotein synthesized and secreted primarily by hepatocytes, whose main function is to neutralize excess elastase released by activated neutrophils, thereby protecting the extracellular matrix of the lungs from the harmful effects of this protease [PI*M, while the most common deficient alleles are PI*S and PI*Z, with a prevalence among Caucasians of 3\u201310% and 1\u20133%, respectively [The two alleles that an individual possesses for this genetic locus are transmitted by autosomal Mendelian inheritance. The phenotypic relationship between normal and deficient alleles is partial dominance when circulating AAT levels are analyzed, or codominance when different protein variants are detected by isoelectric focusing . Normal alleles, found in 85\u201390% of individuals, are called ectively .PI*ZZ genotypes, which promotes the development of various diseases, including: chronic obstructive pulmonary disease (COPD), with onset in early adulthood in up to 50% of deficient subjects ; childhood-juvenile cirrhosis in 2.5% of individuals with the PI*ZZ genotype; adult cirrhosis in 30% ; hepatocarcinoma in 2\u20133% of elderly individuals with PI*ZZ genotype; systemic vasculitis (Wegener\u2019s) in 2\u20133%; and neutrophilic panniculitis  [Severe alpha-1 antitrypsin deficiency (AATD) is a hereditary condition, typically associated with PI*SZ heterozygotes can form hepatic heteropolymers that can cause cirrhosis [In clinical practice, most patients with AATD-associated liver disease are homozygous for the Z mutation Glu342Lys). This genetic defect causes an abnormal folding of the PiZ protein, 80\u201390% of which is retained in the rough endoplasmic reticulum 2Lys. Thi. The PiSirrhosis .The transaminases glutamate-oxaloacetate transaminase (GOT), glutamate-pyruvate transaminase (GPT), and gamma-glutamyl transpeptidase (GGT) are enzymes routinely used as general laboratory markers of liver disease. GPT and GGT are expressed in hepatocytes. As well as in the liver, GOT is expressed in the myocardium, skeletal muscle, kidneys, brain, pancreas, lung, leukocytes, and erythrocytes .The objective of this study was to determine whether patients with AAT deficiency have a higher risk of liver involvement according to the different genotypes.Pi*MM) and another group of subjects whose genotyping result was different (Pi* \u2260 MM). In addition, two comparable age-based groups were created (\u226425 years and >25 years). The study was conducted in accordance with the Declaration of Helsinki. This study was approved by the ethics committee of the hospital, and all patients were informed of the study objectives and signed an informed consent. In the case of minors, their parent or guardian signed the consent.An observational, cross-sectional, and descriptive study was carried out, in which a total of 1494 patients who attended the pulmonology outpatient clinic for any reason were included and analysed. They were divided into two comparable groups, those with a normal genotyping result . In addition, imaging studies were performed using liver ultrasound or computed axial tomography in some patients with abnormal laboratory tests to rule out involvement from other causes .PI*S alleles, PI*Z alleles, and rare variants of the SERPINA1 gene. To make comparisons, the sample of patients was subdivided into two groups: 476 patients with a genetic diagnosis of AATD and 1018 with a normal genotype for the SERPINA1 gene.Each patient underwent genotyping to check for HybProbes [The genotype was determined using so-called hybridization probes or ybProbes , which aybProbes .The AAT serum levels of each patient were quantified by immunonephelometry, while the serum concentrations of the enzymes GOT, GPT, and GGT were determined by standard clinical analysis procedures. Cut-off levels were those determined by the reference laboratories.2 test or Fisher\u2019s exact test. Continuous variables were expressed as absolute (n) and variables (%). Differences between both groups were evaluated by univariate analysis and multiple logistic regression to calculate odds ratios (ORs). The different ORs are shown with their respective 95% confidence intervals (CIs). Multivariate logistic regression was used to assess independent associations. Linear correlations between clinical variables and biomarkers were evaluated by Pearson\u2019s or Spearman\u2019s correlation coefficient. A significant difference was considered when p < 0.05. Statistical analysis was performed with the IBM\u00ae SPSS Statistics version 25 program.The descriptive analyses of the variables were expressed as median (interquartile range (IQR)) or number (%). Differences in the distributions of patient characteristics by subgroups of outcomes were reported using differences with a 95% CI. Categorical data were compared using the \u03c72 with a range between 14.9 and 53.6. The median AAT level of the patients was 82.14 mg/dL with a range between 5 and 308.2. The rest of the baseline characteristics of the patients are shown in Of the 1494 patients, elevated GOT levels were observed in 5.7%, elevated GPT in 10.6%, and elevated GGT in 20.3%. Most cases were male, with a mean age of 51.4 years and a range between 1\u201394, a weight of 76.14 kg ranging between 36 and 152, and a median BMI of 27.67 kg/mp < 0.0003; GPT = 20.19, p < 0.002; GGT = 17.78, p < 0.006). It was found that serum GPT and GGT values changed more frequently the more deficient the genotypes : GOT = 25.32, enotypes . SimilarPi*Z allele and comparing them with patients of normal genotype (Pi*MM), an OR of 2.72 (CI: 1.5\u20134.87) was obtained for GOT with a significance level of p < 0.0005, and for GPT an OR of 2.31 (CI: 1.45\u20133.67) with a level of statistical significance of p < 0.0003 was obtained. When analyzing the GGT levels, an OR of 1.25 (CI: 0.82\u20131.88) was obtained, but this time without reaching statistical significance. Pi*Z allele in more detail.Regarding the GOT and GPT serum levels, when measuring the prevalence of exposure in patients who had a genotype with the PI*S allele and altered transaminase levels, with OR values for GOT, GPT, and GGT levels of 1.003 (CI: 0.55\u20131.81), 0.88 (CI: 0.56\u20131.37), and 0.70 (CI: 0.50\u20131), respectively.No statistically significant relationship was found between the p < 0.002) and 17.12 for GPT (p < 0.0007). The result was not significant for GGT (p > 0.05). Our study found that low levels of AAT were associated with high levels of GPT and GGT transaminases  negative correlation between AAT levels and GOT, GPT, and GGT levels.Correlation studies showed a statistically significant , and no statistically significant results were found for any of the three transaminases  that indicated that our patients had a higher degree of liver disease in childhood and that it progressively disappeared as adulthood was reached, although our sample was lacking a significant population of patients aged 25 or under (9.86%).PI*Z allele may not only have altered lung function (determined by spirometry), but also that, in these patients, liver involvement is more frequent than expected, often going unnoticed, and transaminase alteration may be the first indication of underlying liver disease. For this reason, closer long-term follow-up should be considered with serial analytical controls that include, in addition to transaminase levels, levels of bilirubin and albumin, and a complete blood count with coagulation, to detect abnormalities that guide us towards established liver damage. The influence of potential confounding factors, such as toxic habits affecting the liver, including alcoholism and drug-related liver toxicity, as well as hepatotropic viral infections, was minimized by the application of exclusion criteria.Our analysis has the limitations of a cross-sectional observational study. The temporal sequence of the variables studied could not be established, making it difficult to separate risk factors from prognostic factors. Furthermore, as no imaging study was performed using fibroscan or serial abdominal ultrasound over time, it is impossible to know which patients with altered transaminases developed liver fibrosis or cirrhosis. Despite this major limitation, our data indicate that it must be considered that patients with a PI*Z allele seems to be a risk factor for the development of liver involvement, since the different genotypes of AAT deficiency were associated with abnormal GOT, GPT, and GGT values. Furthermore, lower levels of AAT imply a greater involvement of GOT and GPT transaminases.In conclusion, the results of this study indicate that the presence of a"}
+{"text": "Electrocardiogram (ECG) signal is critical to the classification of cardiac arrhythmia using some machine learning methods. In practice, the ECG datasets are usually with multiple missing values due to faults or distortion. Unfortunately, many established algorithms for classification require a fully complete matrix as input. Thus it is necessary to impute the missing data to increase the effectiveness of classification for datasets with a few missing values. In this paper, we compare the main methods for estimating the missing values in electrocardiogram data, e.g., the \u201cZero method\u201d, \u201cMean method\u201d, \u201cPCA-based method\u201d, and \u201cRPCA-based method\u201d and then propose a novel KNN-based classification algorithm, i.e., a modified kernel Difference-Weighted KNN classifier (MKDF-WKNN), which is fit for the classification of imbalance datasets. The experimental results on the UCI database indicate that the \u201cRPCA-based method\u201d can successfully handle missing values in arrhythmia dataset no matter how many values in it are missing and our proposed classification algorithm, MKDF-WKNN, is superior to other state-of-the-art algorithms like KNN, DS-WKNN, DF-WKNN, and KDF-WKNN for uneven datasets which impacts the accuracy of classification. In the present scenario, heart disease is one of the major problems that threaten human health worldwide. Some of them may be indicated by disorders of cardiac rhythm called cardiac arrhythmias. The cardiac arrhythmias can be divided into different types, some kinds of which can cause irreparable long-term damage to the heart, even sudden death . Thus, iAs being noninvasive and easy to record, electrocardiogram (ECG) becomes a preferred diagnostic tool for the detection of arrhythmias and has been broadly used in medical institutes and hospitals. The bioelectrical activity generated by the heart can be recorded and displayed in a graph called the electrocardiograph . One ECGThe medical practitioners can interpret the morphology of such an ECG waveform and then detect some irregular changes which are called arrhythmia. However, due to the huge number of patients, the visual checks for arrhythmia are tedious and time-consuming. In addition to it, the conventional manual analysis methods are also usually subjective, which may cause the inaccuracies of the diagnosis results. It is therefore important to apply an automated computing aided approach to detect and classify the arrhythmia more efficiently and precisely. For the last few decades, various techniques have been proposed to assist with the physicians hoping to improve the arrhythmia therapy. In the literature, these processing techniques contain signal processing , patternThe remainder of this paper is organized as follows. In By far, numerous arrhythmia databases processed by the above techniques have been used as the benchmark by researchers to compare the performance of their research methods with others. Generally, the arrhythmia databases can be classed into two types: signal  and numeric . In this paper, we research on the arrhythmia databases that consist of numeric, which have been preprocessed to multidimensional feature vectors by some signal processing and pattern recognition techniques like digital filters and peak analysis . HoweverM is the observed matrix and the set \u03a9 is the indices of M. And, this approach is capable to recover matrices of rank about 10 with nearly a billion unknowns from just about 0.4% of their sampled entries T. The optimization problem of Formula  denotes the trace of the matrix G, and \u03b7 = 10\u22120~10\u22123 is the regularization parameter. Finally, the weights w of KNNs are determined by solving the linear equation in Formula (w is similar to that of the DF-WKNN described above. Please refer to [Let  Formula  can be tFormula (Gk=Gk+\u03b7trrefer to  for the w generated by KDF-WKNN by setting a correction factor \u03b3 to punish these classes with a large number. Denote by \u03c6(x) a function to count the number of a certain class, the algorithm of \u03b3 is inductively defined as:i refers to the label of certain class belonging to the c classes in the training dataset, and n stands for the number of training samples. \u03b6 is a positive constant parameter which can be justified according to the sample. And \u03b3i = round(max(\u03c6(i))/avg(\u03c6(i))), in which the numerator and the denominator stand for the maximal and average number of all the classes, respectively. Then, the final weight can be written as wi\u2254wi\u2217\u03b3i. From Formula . All the experiments are carried out with Intel(R) Core(TM) i5-4590 CPU (3.30\u2009GHz) and 32GB RAM under the Matlab2012a programming environment. The dataset comes from the UCI machine learning repository described in The first step is to delete different proportion values on the original UCI arrhythmia dataset at random to generate some different proportions of missing value datasets.The second step involves imputation of these missing values using different methods for all created datasets. In our experiment, we apply four methods, i.e., Zero, Mean, PCA, and RPCA imputation methods. \u201cZero method\u201d means to input the missing values with zero which is used for comparison; \u201cMean method\u201d refers to replace each missing value with the average value of the corresponding attribute which is commonly applied in arrhythmia classification; The PCA and RPCA method are the two inductive learning-based methods we introduced in k is unified into 151. In our experiment, the value of the parameter in MKDF-WKNN, \u03b6, is 10\u22124. To reduce bias, the performance of these classifiers is evaluated by running 10-fold cross-validation with 9-fold for training and 1-fold for testing. We split the arrhythmia database into 10 folds and the mean classification accuracy is adopted by the average of 10 splits.Then, we classify these datasets using different classifiers , and the VALUE of At last, we compare the performance of these methods for arrhythmia classification and visualize the experiment result.The experimental flow on the UCI arrhythmia dataset is delineated in the flow block diagram , which iIn this section, we show the experiment results that were implemented using an accuracy indicator to examine the performance of missing value imputation methods and five classifiers for classifying cardiac arrhythmia. The experiments compare the performance on different proportions of missing value datasets generated from the UCI arrhythmia database. And the whole result is shown in From We empirically tested 7 simulations based on the dataset with the percentage of missing values range from 10% to 70%  using four methods to estimate the missing values, and the accuracy is obtained by the classification on the data after imputation.Form Based on the experimental results, we conclude that for arrhythmia classification, when the small part (0% to 30%) of data is missing, we can apply any of the other three imputation methods except the \u201cZero method\u201d. And when the missing values are large (30% to 70%), we can use the \u201cRPCA-based method\u201d to replace the classical method, i.e., the \u201cMean method\u201d.What is more, we also make a histogram of one column in Missing value is a crucial problem, which could compromise the quality of data, so missing value estimation is a significant preprocessing step for further experiments. In this paper, we compare the main methods for estimating the missing values in electrocardiogram data like the \u201cZero method\u201d, \u201cMean method\u201d, \u201cPCA-based method\u201d, and \u201cRPCA-based method\u201d. In our comparative study, the \u201cRPCA-based method\u201d can successfully handle missing values in the arrhythmia dataset no matter how many values in it are missing, which indicates that the higher classification accuracy can be expected in the practical application when a large number of values in the dataset are missing. As for the imbalance data classification problem, we also propose a modified KNN-based classification algorithm, i.e., MKDF-KNN, which is modified by a correction factor to handle the imbalance datasets problem to get better performance. In the future, we will further study the modified factor for the weight of the weighted-KNN and improve the robustness of the method of selecting better parameters of our MKDF-WKNN."}
+{"text": "The scalable delivery of genomic medicine requires collaboration between genetics and non-genetics providers. Thus, it is essential to investigate and address the perceived value of and barriers to incorporating genetic testing into the clinical practice of primary care providers (PCPs). We used a mixed-methods approach of qualitative interviews and surveys to explore the experience of PCPs involved in the pilot DNA-10K population genetic testing program. Similar to previous research, PCPs reported low confidence with tasks related to ordering, interpreting and managing the results of genetic tests, and identified the need for additional education. PCPs endorsed high levels of utility for patients and their families but noted logistical challenges to incorporating genetic testing into their practice. Overall PCPs were not familiar with the United States\u2019 Genetic Information Nondiscrimination Act and they expressed high levels of concern for patient data privacy and potential insurance discrimination. This PCP feedback led to the development and implementation of several processes to improve the PCP experience with the DNA-10K program. These results contribute to the knowledge base regarding genomic implementation using a mixed provider model and may be beneficial for institutions developing similar clinical programs. Increased availability and awareness of genetic testing has challenged the traditional clinical model in which genetics professionals serve as the sole provider responsible for ordering and interpreting genetic tests. As of 2019, there were approximately 5 medical geneticists and 12 genetic counselors per million people in the United States [Research conducted over the past several years has explored non-genetics providers\u2019 views and perceived barriers related to integrating genomics into their practice. Several studies show that the majority of non-genetics providers report low confidence in genetic concepts, testing and interpretation of results ,9,10,11.Non-genetics providers also report mixed levels of perceived utility of genetic testing ,14,15,16TM. Patients were invited to participate in the clinical program via email and through their NorthShore patient portal. Individuals who agreed to testing consented online in advance of their annual preventative care visit, at which time their PCP could place an order for clinical testing. Over 10,000 patients completed testing in the DNA-10K initiative. To explore the inclusion of non-genetics providers in genetic service delivery, NorthShore University HealthSystem (NorthShore) implemented a combined PCP-genetics provider approach for population genetic testing. This clinical pilot program, the DNA-10K, was launched in 2019. Through this program, patients, regardless of family history, were offered complimentary clinical-grade genetic testing of 60 genes associated with hereditary cancer and cardiac conditions, a 14-gene panel for pharmacogenomics (PGx) testing, ancestry and common trait information (such as lactose intolerance) through ColorTM for more information. Pathogenic/likely pathogenic variants were considered positive results and all other results were labeled as negative and integrated into NorthShore\u2019s electronic health record (EHR). Positive results were imported into the EHR with variant level detail. PCPs were notified of the results via the EHR, and results were available to patients through both ColorTM\u2019s and NorthShore\u2019s patient portals. All patients with positive results were encouraged and provided with the opportunity to speak with a ColorTM genetic counselor. Medical follow-up care related to the test results took place in the NorthShore system.For the panels related to hereditary cancer and cardiac conditions, pathogenic/likely pathogenic variants and negative results were reported to patients and PCPs. If a variant of uncertain significance (VUS) was detected, a generic statement about VUSs was included on the report. Patients who desired specific details (such as the gene and specific variant) about the VUS were referred to ColorThe purpose of this implementation study was to elicit PCP perceptions of and experiences with incorporating large-scale genetic testing into their clinical practice. The findings aided in evaluation and improvement of program implementation and may more broadly inform best practices for delivering genomic medicine in a mixed primary-care, genetics provider model.An exploratory sequential mixed-methods design  was seleStudy participants were NorthShore PCPs practicing at one of the 14 sites offering the DNA-10K program. A purposive sampling plan included identification of PCPs from a range of practice locations and primary care specialties, including internal medicine, family medicine and obstetrics/gynecology (OB/GYN). To be eligible for the study, PCPs needed to have at least five patients who received genetic results from the DNA-10K. PCPs received an email invitation to participate in a research interview and two follow-up reminders. Interview participants were compensated with a USD 100 service award.Qualitative semi-structured interviews were conducted to allow for discovery of unanticipated findings, clarification of viewpoints and as a strategy to learn more about PCP barriers and facilitators in utilizing population genetic testing in their practice. Two interviewers trained in qualitative research  used an interview guide that contained eight open-ended questions that directly related to the study aims . The intRecordings of interviews were transcribed verbatim and independent checks by two investigators confirmed accurate transcription. Atlas.ti, a qualitative software program, was used to organize and manage the data . The intAll NorthShore PCPs participating in the DNA-10K who had patients with results returned were invited by email to participate in the online research survey. Two follow-up email reminders were also sent. PCPs who responded received a USD 10 Panera gift card for completing the survey.The Tailored Survey Design method was used as a general guide in survey development and format . Findingp < 0.05. All statistical analysis was performed using SAS 9.3 [Survey results were summarized using frequencies and percentages. Because participants were allowed to skip individual items, the sample size varied by question. Throughout the paper, percentages reported reflect the valid percent (excludes missing answers). For questions using the five-point Likert scale response  and the four-point response scale , data were first summarized and reviewed in their original form and then collapsed to two categories to facilitate analysis and interpretation. Comparisons between demographic factors were assessed using two-tailed chi-square or Fisher\u2019s exact  tests. Statistical significance was defined as  SAS 9.3 . Audiotaped telephone interviews were conducted from October to December 2019. Interviews lasted on average 30 min and saturation was reached after 17 interviews, which falls within the reported range for this type of qualitative approach .Approximately 70% of the 17 PCPs participating in the interview portion of the study were female (n = 12). In total, 8 practitioners were in internal medicine, 5 were in family medicine and 4 were in OB/GYN. In total, 10 of the 14 practice sites were represented.Three broad themes emerged regarding PCP experiences with the DNA-10K population genomics testing program: benefits to clinical care provision, challenges in practice and recommended improvements. These themes and sub-themes are presented, along with exemplary quotes from the PCP interviews, in Overall, PCPs highlighted the value of genetic testing in identifying risk to detect and prevent disease in patients and their families. Major challenges related to patient privacy concerns, prioritizing genetic discussions amongst other preventive care and a lack of knowledge and skill discussing positive results. Recommended improvements suggested by PCPs included the need for both patient and provider educational resources. Surveys were collected from February to April 2020. Seventy of the 104 eligible PCPs responded to the survey for a response rate of 67.3%, and the mean length of time to complete the online survey was 6.5 min. PCPs from all 14 practice sites responded to the survey. The characteristics of the 70 PCPs who responded to the survey are presented in The utility of the genetic test result was endorsed by PCPs across several survey questions. Seventy-seven percent of PCPs somewhat or strongly agreed that the genetic testing program is useful to change their current management of patients\u2019 care, and most PCPs agreed that the genetic testing program has value in identifying the need for increased disease screening (81.4%) and supporting management of patients\u2019 care that is already underway (69.6%). Most PCPs (81.4%) also agreed that there is value in identifying at-risk family members. PCPs reported recommending patients\u2019 family members undergo genetic testing most commonly for cancer risk results (61.4%), followed by cardiac risk results (21.7%) and PGx results (8.8%). PCP concerns for patient privacy and genetic discrimination, as well as a lack of awareness of the United States\u2019 Genetic Information Nondiscrimination Act (GINA) of 2008, were highlighted in the survey data . Most PCPCPs reported varying degrees of confidence with their knowledge and skills across the genetic testing process. Approximately half (52.8%) of PCPs agreed that they feel confident explaining the risks and benefits of genetic testing to their patients, and less than half somewhat or strongly agreed they feel confident in their ability to explain genetic test results related to cancer risk (42.9%), cardiac risk (27.2%) and PGx (32.8%). PCPs\u2019 reported confidence in explaining results was slightly higher than their reported ability to articulate clear next steps for the different categories of results . Most PCPs (86.8%) reported that the genetic testing program has increased their workload, and approximately a third (37.3%) either somewhat or strongly agreed that this increase was reasonable. However, more than half (56.5%) were satisfied overall with the DNA-10K program, and the majority reported satisfaction with the workflow for offering (61.4%) and ordering (70.0%) genetic testing. Comparatively, PCPs reported lower satisfaction with the process by which patients (29.8%) and providers (42.0%) receive test results. Over one quarter of PCPs (28.9%) somewhat or strongly agreed that they have received adequate training to offer genetic testing in their practice. Less than half (40.0%) reported being somewhat or very confident in their knowledge of genetics, their ability to explain genetic concepts (47.1%) and results (34.8%) to patients and their ability to respond to patient questions about genetic technologies (27.9%). Additional education about medical management options for patients with a positive result (88.4%) and clinical testing guidelines (86.6%) were most frequently requested, and the majority of PCPs endorsed the value of patient education handouts (78.6%) and physician reference sheets (78.5%). Preferred educational topics and modalities regarding genetic testing are summarized in p = 0.044). However, PCPs aged 50 or older were more likely to feel somewhat or to a great extent prepared to discuss privacy concerns  and health insurance discrimination . PCPs who did not identify as White were more likely to report higher levels of concern for privacy of patients\u2019 genetic test results . With regard to utility of testing, internal medicine PCPs were more likely to somewhat or strongly agree that the genetic testing program is useful to change their current management of patients\u2019 care than family medicine or OB/GYN providers . The age of PCPs influenced how likely they were to report feeling confident and prepared for several aspects of the genetic testing process. PCPs aged 50 or greater were more likely to report they were not at all confident in their ability to explain a genetic test result compared to those less than 50 years old  is assigned to the genomic indicator as \u201cBRCA1 pathogenic variant\u201d. Each genomic indicator is presented to providers with a clinical explanation and recommendations for next steps. Additionally, genomic indicators provide information used to trigger other clinical decision support tools in the EHR, such as genetic care pathways. A care pathway is intended to track a patient\u2019s progress through the recommended enhanced screening protocol based on a positive genetic result. To date, one care pathway has been implemented and three additional care pathways are in development. By tracking patients\u2019 progress, the Center for Personalized Medicine is able to provide continued support and oversight of patients\u2019 medical management, and it is able to identify areas in need of further process improvement to ensure our patients are receiving appropriate care based on their genetic results. Finally, to further assist PCPs in providing appropriate medical management to patients with positive results, and to more seamlessly transfer patients from primary care to specialty care, we are piloting the Genetic Care Coordinator (GCCs) role. GCCs are responsible for guiding patients through their screening and risk reduction activities after a positive genetic result. EHR utilization data will be used to assess the impact of these interventions. In response to the identified need to support PCPs with the return of genetic results and next steps in medical management, a section called \u201cgenomic indicators\u201d was enabled in the EHR. Genomic indicators are groupings based on the gene and the reported pathogenicity of the variant. For example, The participation of PCPs as key stakeholders in a primary care-based genetic screening program is imperative for scaling the safe and effective delivery of precision medicine . Here wePrevious research has identified mixed levels of utility endorsed by PCPs with respect to genetic and genomic testing ,14,15,16Similar to existing literature ,14,28,29Several of our findings are consistent with previous studies exploring PCP perspectives towards incorporating genomic medicine into their practice. Previous qualitative and quantitative studies have identified a lack of PCP confidence in their genetics knowledge as a barrier to incorporating genetics into their practices ,7,8,9,10Previous studies have also identified barriers to incorporation of genomic testing into clinical practice by PCPs related to logistical or health system-level issues ,10. MostUsing a learning healthcare system model , we haveThis study explores several factors involved in the practice of genomic medicine by PCPs, and our findings both support and add to previous research in this area . The mixPCPs involved in the DNA-10K endorsed high levels of utility for genetic testing but cited logistical challenges with implementing the program into their clinical practice. Similar to previous research in non-genetics providers, PCPs involved in the DNA-10K also reported low confidence in this context and a need for additional genomics education and resources. Findings from this mixed-methods research were key to the development of several interventions to support PCPs and ongoing implementation efforts. As PCPs are the foundation of preventive medicine, it is important they be engaged in the integration process in order to realize the potential of genomics in health care and reduce risk for disease. Findings from this study and their implications for the DNA-10K program may be beneficial for other institutions undertaking the challenge of clinical implementation of genomics-guided care across their health system. Future research is needed to examine PCPs\u2019 perspectives and experiences with population genetic testing in diverse patient populations and in a variety of healthcare settings."}
+{"text": "Candida albicans, Candida auris, Candida glabrata, and Cryptococcus neoformans are pathogenic yeasts which can cause systemic infections in immune-compromised as well as immune-competent individuals. These yeasts undergo replicative aging analogous to a process first described in the nonpathogenic yeast Saccharomyces cerevisiae. The hallmark of replicative aging is the asymmetric cell division of mother yeast cells that leads to the production of a phenotypically distinct daughter cell. Several techniques to study aging that have been pioneered in S. cerevisiae have been adapted to study aging in other pathogenic yeasts. The studies indicate that aging is relevant for virulence in pathogenic fungi. As the mother yeast cell progressively ages, every ensuing asymmetric cell division leads to striking phenotypic changes, which results in increased antifungal and antiphagocytic resistance. This review summarizes the various techniques that are used to study replicative aging in pathogenic fungi along with their limitations. Additionally, the review summarizes some key phenotypic variations that have been identified and are associated with changes in virulence or resistance and thus promote persistence of older cells. Cryptococcus neoformans, Candida albicans, Candida auris, and Candida glabrata are pathogenic yeasts, expand clonally in the host, and similar to the unicellular yeast Saccharomyces cerevisiae, they undergo asymmetric mitotic divisions. Throughout this clonal expansion, budding mother cells progressively age after each division, which is a process referred to as \u201creplicative aging (RA)\u201d . ,9. 8,9].The method is labor intensive and time consuming. As mentioned above, RLS analysis can take as long as four weeks. Further, this method creates a discontinuity in the analysis, as at the end of the day the culture plates are refrigerated to slow down the replication time. This can cause unnecessary stress on the cells resulting in erroneous RLS determination.Since this method is time consuming and often lasts one to four weeks, the culture media can degrade or get contaminated, causing defects in cell growth affecting RLS.Only a small number of cells (around 30\u201340) can be used to analyze RLS. RLS varies from cell to cell within the same strain, which is referred to as stochasticity of life span. Hence, since a large number of cells are required to accurately analyze the stochasticity of RLS, this method is not ideal for that analysis.This method requires proper identification of mother and daughter cells after each budding event. For the first few generations, both mother and daughter cells are similar in size. This makes identifying daughter cells difficult, causing erroneous RLS analysis.Limitations using this method to determine RLS are as follows:C. neoformans, it was reported that 62% of the cells could be retained in the buckets throughout their entire life span [To overcome the outlined disadvantages of the microdissection method, microfluidic systems were designed by several laboratories ,12,13,14ife span .The microfluidic technique is high throughput, and RLS can be determined in hundreds of cells simultaneously. Since so many cells can be analyzed for RLS at the same time by this method, the method permits modeling of RLS stochasticity and variance within a population. This technique is semiautomated, as each budding event is recorded by a video, and the number of budding events can retrospectively be determined and RLS can be calculated. The process of determining the actual RLS is continuous with this method, thereby shortening the experimental time significantly. This method can potentially also improve the accuracy of RLS, as the mother cells are not subjected to unnecessary stress from constant temperature changes, to which mother cells are exposed with the conventional method.Extreme longevity RLS is difficult to assess with the help of this device. The device may get clogged due to a cell overgrowing during prolonged runs. Further, the method requires a continuous supply of fresh media through syringes. The volumes of syringes are limited, and if the cells have excessively long life spans, the device may run out of fresh media. As a result, buckets may get clogged.The microscope is sensitive to any liquid spills, so the system needs to be continuously monitored to prevent any leaks.Any extreme phenotypic change  will clog the system and abort the recording of RLS on that specific cell.There are still no reliable programs that permit automatic determination of bud count and RLS computation. Budding events are therefore still counted manually by reviewing the video images.The microfluidic technique has the following limitations:4 cells).Each time a yeast cell divides, it produces a bud that eventually separates from its mother and becomes a daughter cell. The cell surfaces of the daughter cells are newly synthesized and do not share any cell surface components with the mother cells. Therefore, the mother cell surface proteins can be tagged, and the tag can be used to isolate the mother cells from a mixed culture containing mother and daughter cells. In this isolation method, cell surface proteins are first conjugated with biotin, and then biotinylated cells are grown in liquid cultures for the desired number of generations. After cell growth, fluorochrome-conjugated streptavidin is added to the culture. The fluorochrome attaches to the biotin-labeled old cells and can be separated using fluorescence-activated cell sorting (FACS). This method allows rapid purification of the old cell population; however, the total yield of the old cells is low  mother cells from younger  daughter cells. The sucrose gradient separates the mixed population into two distinct bands of cells, one of which is mostly comprised of young cells. These young cells are then exposed to mating pheromones and allowed to replicate for at least three generations. Daughter cells are separated from the mother cells by repeating the sucrose gradient, and this time the band of cells containing the older cell population is selected. This cycle is repeated to isolate cells of a desired generational age with as little as 10% impurity. Thus, this technique allows relatively pure large-scale isolation of older generation cells. This technique has been used for the isolation of generationally aged ns cells .The technique is labor intensive and requires multiple rounds of manipulation to isolate cells of the desired age.Limitations of this technique are as follows :The techSince the above technique is labor intensive, another centrifugation method of studying RA was designed that is described below.S. cerevisiae, C. neoformans, and C. glabrata [This is another technique that relies on the cell size difference between mother and daughter cells for isolation of old cells. The specialized elutriation rotor contains chambers in which cells are grown and eluted based on size and sedimentation during centrifugation. This technique can be used to continuously separate daughter cells from mother cells. Isolated daughter cells are collected in different fractions and subjected to a second round of elutriation during which the daughter cells are discarded and mother cells are retrieved. This process is continuously carried out for several divisions to isolate cells of the desired age. This technique allows the rapid isolation of older cells and is less labor intensive than sucrose gradient centrifugation, requiring fewer manipulations. This technique is cheap if the specialized centrifuge is available. It has been commonly used in glabrata ,21,22.Elutriation does not often deliver a pure population if used repeatedly (cells older than 10 generations).Further, elutriation is not reliable for fungal populations that exhibit cell size heterogeneity at baseline.Limitations of this technique are as follows :ElutriatThe limitations of both types of centrifugation techniques still exist. Hence, presently, the other techniques are preferred in studying RA in pathogenic yeasts.S. cerevisiae [UBC9 (encoding SUMO-conjugating enzyme) and CDC20 (encoding activator of the anaphase-promoting complex)\u2014in the daughter cells. Both genes are required for cell cycle progression and disrupting them results in permanent M-phase cell cycle arrest in the daughter cells. The Cre recombinase system is regulated by a daughter-specific promoter SCW11P, which is expressed by transcription factor Ace2p. Ace2p is a transcription factor that is asymmetrically distributed in the daughter cell nuclei before cytokinesis. In this system, an estradiol-binding domain (EBD) is also fused, which post-transcriptionally regulates the Cre activity in the presence or absence of estradiol. In the presence of estradiol, the fusion protein is transported to the nucleus where the protein acts on loxP DNA substrates [This highly innovative technique uses an inducible genetic system in which mother cells maintain a normal replicative life span, while the daughter cells are eliminated . This terevisiae ,25,26 anbstrates . This rebstrates . This teC. neoformans, which are more difficult to transform than S. cerevisiae.The technique requires genetic manipulations that need to be introduced in the desired strains. This can be difficult in organisms such as Mutations in MEP strains can arise that can prevent the selection of the transformants.The technique is labor intensive.S. cerevisiae, it was found that the M-phase-arrested daughter cells do not senesce immediately, were metabolically active, and continued growth in the arrested state for at least 24 h. These cells produced 6.9 progenies before lysing in the presence of estradiol.Purity has to be verified. In Limitations of MEP are as follows :The techSaccharomyces cerevisiae, Cryptococcus neoformans, Candida albicans, Candida glabrata, and Candida auris, including those involving cellular morphology  and cytosolic components  , which is a key virulence factor [The fungal cell wall is a complex and flexible structure composed of chitin, \u03b1- and \u03b2- linked glucans, glycoproteins, and in some cases pigments such as melanin . Howeverve aging ,46. In coformans , C. glabglabrata ,18, and C. auris ,43 cellsescribed ,48. In 1e factor  located C. auris, generationally older cells also exhibit a thickened cell wall and enhanced adhesion in cell culture, which is also supported by upregulation of several conserved adhesin proteins [C. albicans and C. glabrata, epithelial adhesion proteins that inhabit the cell wall may be differentially exposed from cell wall thickening [Candida species, where increased phagocytosis and inflammatory response are associated with increased adhesion [In proteins . In C. aickening . This isadhesion .S. cerevisiae. In C. neoformans, ALL2 helps to maintain intracellular pH and is upregulated under low glucose conditions similar to what the pathogen encounters in the host environment. Interestingly, ALL2 also accumulates during aging under low glucose conditions [S. cerevisiae, glycogen accumulation and upregulation of genes involved in glycogen production have been associated with aging mother cells [C. albicans, where increasing levels of glycogen have been observed with increasing age [C. albicans, a high number of carbonylated proteins have been shown to accumulate with age [S. cerevisiae cells [Plasma membrane proteins ,52,53 annditions . In S. cer cells ,57 and hsing age . Furtherwith age , and thiae cells ,58.Cryptococcus neoformans [C. neoformans, a disproportionate inheritance of melanin in mother cells has been established [LAC1 and LAC2, which contribute to melanin formation, in 10-generation-old C. neoformans cells [LAC1 is widely conserved in Candida and its role in age-related phenotypic variation should be examined further in Candida species, especially in the emergent C. auris.Melanins are biologically prominent macromolecules that are formed by oxidative polymerization of phenolic compounds. They have been linked with virulence in several pathogenic fungi, especially oformans ,61,62,63oformans ,65,66. Iablished . Notablyablished . The disns cells . LAC1 isS. cerevisiae, age-related changes of MDR protein expression between old mother and young daughter cells are reported. Similarly, 10-generation-old mother cells from C. neoformans, C. glabrata, and C. auris also show altered MDR expressions that corelate with increased tolerance to the antifungals fluconazole and amphotericin B [C. glabrata and C. auris [In ericin B ,16,17,18C. glabrata and C. auris. In these yeasts, fluconazole tolerance corelated with increased expression of genes encoding the fluconazole drug target 14\u03b1 demethylase (Erg11p) in the older mother cells. Besides the drug target, overexpression of membrane transporters was also observed in the mother cells from C. glabrata and C. auris [C. glabrata 14-generation-old cells [C. auris [C. auris, it was found that the observed increased expression of CDR1 was associated with an increased copy number of CDR1 in the older mother cells [CDR1 resulted from whole chromosome duplication. Importantly, it was observed to be transient and not observed in the daughter cells that budded off the mother cell. Further investigation with whole-genome sequencing needs to be undertaken once the C. auris genome is more completely curated.To date, the mechanisms of increased tolerance to fluconazole in old mother cells have only been studied in C. auris ,17. BothC. auris . Severalld cells  when comS. cerevisiae, as this yeast is only rarely a pathogen in humans. Interestingly, despite slower doubling time in older mother cells, increased virulence was observed in older mother cells from C. neoformans, C. glabrata, and C. auris [Galleria mellonella (waxworm) larvae, the survival rates of the larvae were significantly lower than the survival rates of the larvae infected with the young daughter cells [Of particular interest is the change in virulence for pathogenic fungi during aging. Virulence changes do not apply to C. auris ,18,29. Wer cells ,18,29. Ter cells ,18,29.C. neoformans indicate that older cells accumulate during chronic infection. Both in an intrathecal infection model in rats as well as during chronic human infection, cells of advanced generational age could be recovered from the spinal fluid after weeks of chronic central nervous system infection. Again, this is consistent with gene expression analysis of older C. neoformans cells that indicated increased expression of three important established virulence factors. These factors include antiphagocytic protein (App1p) and laccase proteins (Lac1p and Lac2p) [C. glabrata have also suggested that older C. glabrata cells accumulate during chronic infection as evidenced by a higher bud scar count in yeast cells isolated from infected mice. Importantly, depletion of neutrophils appeared to remove the selection pressure, and as a result, the C. glabrata cell recovered from the infected, neutrophil-depleted mice exhibited a bud scar count suggesting that accumulation of older cells was indeed dependent on selection by resistance to neutrophil attack. This data were further supported by bud scar counts of C. glabrata derived from humans with Candiduria. In these patients who were chronically colonized/infected with C. glabrata, the median bud scar count was also higher than expected in a nonselected exponentially growing cell population [One caveat is that animal experiments investigating if aging is relevant for virulence are challenging because any inoculum of old cells will multiply in vivo and the infecting cells will be predominantly young within a few duplications. However, several investigations in d Lac2p) . Murine pulation .Several studies have now demonstrated that replicative aging in several major fungal pathogens leads to important changes that affect the fungus resistance to phagocytic clearance and antifungal treatment. Therefore, the natural process of aging functions can be viewed as a process of adaptation that contributes to the pathogen\u2019s phenotypic and genotypic variation, and subsequent resilience and virulence. The phenotypic changes of aging are not genetically inherited, and old cells only emerge because of selection pressures that promote the persistence of old cells and favor the killing of young fungal cells. Thus, for the pathogen, this form of adaptation is advantageous as it avoids the risk of random permanent mutations and instead assures that all adaptive changes are easily reversed in the daughter cells that are borne from asymmetric budding ,52.S. cerevisiae to pathogenic fungi by genetically modifying model strains to enable estradiol-inducible mitotic arrest of only daughter cells would permit cheap isolation of larger numbers of older cells compared with what is currently available. Ultimately, such a system could provide further novel molecular insights into why drug resistance is associated with advanced generational age.These findings highlight the importance of further investigating phenotypic variations that are associated with aging and convey resistance. This research can potentially identify valuable targets for drug development. Furthermore, as younger cells are more sensitive to antifungal medications and phagocytic attack, antiaging compounds may be useful drugs that can be used as combination therapy. This would pave the way for innovative and targeted antifungal therapies that could greatly add to the thinning drug pipeline. Adapting the >10-year-old MEP system from"}
+{"text": "Alexithymia, a personality trait characterized by difficulties interpreting one\u2019s own emotional states, is commonly elevated in autistic adults, and a growing body of literature suggests that this trait underlies a number of cognitive and emotional differences previously attributed to autism, such as difficulties in facial emotion recognition and reduced empathy. Although questionnaires such as the twenty-item Toronto Alexithymia Scale (TAS-20) are frequently used to measure alexithymia in the autistic population, few studies have attempted to determine the psychometric properties of these questionnaires in autistic adults, including whether differential item functioning (I-DIF) exists between autistic and general population adults.We conducted an in-depth psychometric analysis of the TAS-20 in a large sample of 743 verbal autistic adults recruited from the Simons Foundation SPARK participant pool and 721 general population controls enrolled in a large international psychological study (the Human Penguin Project). The factor structure of the TAS-20 was examined using confirmatory factor analysis, and item response theory was used to further refine the scale based on local model misfit and I-DIF between the groups. Correlations between alexithymia and other clinical outcomes such as autistic traits, anxiety, and quality-of-life were used to assess the nomological validity of the revised alexithymia scale in the SPARK sample.The TAS-20 did not exhibit adequate global model fit in either the autistic or general population samples. Empirically driven item reduction was undertaken, resulting in an eight-item unidimensional scale (TAS-8) with sound psychometric properties and practically ignorable I-DIF between diagnostic groups. Correlational analyses indicated that TAS-8 scores meaningfully predict autistic trait levels, anxiety and depression symptoms, and quality of life, even after controlling for trait neuroticism.Limitations of the current study include a sample of autistic adults that was overwhelmingly female, later-diagnosed, and well-educated; clinical and control groups drawn from different studies with variable measures; and an inability to test several other important psychometric characteristics of the TAS-8, including sensitivity to change and I-DIF across multiple administrations.http://asdmeasures.shinyapps.io/TAS8_Score).These results indicate the potential of the TAS-8 as a psychometrically robust tool to measure alexithymia in both autistic and non-autistic adults. A free online score calculator has been created to facilitate the use of norm-referenced TAS-8 latent trait scores in research applications (available at  Alexithymia is a subclinical construct characterized by difficulties in identifying and describing one\u2019s own emotional state , 2. IndiAlexithymia is a construct of particular interest in research on autism spectrum disorder (hereafter \u201cautism), a condition frequently associated with difficulties in processing, recognizing, communicating, and regulating emotions \u201332. A rer\u2009=\u20090.92 and 0.81 for the TAS-20 and BVAQ-B total scores, respectively, with all subscale rs\u2009>\u20090.62). The internal consistency of the TAS-20 and its three subscales has also been reported in a sample of 27 autistic adults by Samson et al.  for t tests, r\u2009=\u2009 for bivariate correlations, and rp\u2009=\u2009 for partial correlations. Evidence both for or against this interval null hypothesis can be quantified by calculating the ROPE Bayes factor (BFROPE), which is defined as the odds of the prior effect size distribution falling within the ROPE divided by the odds of the posterior effect size distribution falling within the ROPE , BFROPE\u2009=\u20095.77\u2009\u00d7\u200910\u20136), likely due to the absence of older adults  in our sample. Alexithymia also showed a nonzero negative correlation with education level, although the magnitude of this relationship was small enough to not be practically significant . Unlike in the general population, females in the SPARK sample had slightly higher TAS-8 scores , although this difference was small and not practically significant (BFROPE\u2009=\u20090.265). Additionally, there was an absence of practically significant differences in alexithymia by race/ethnicity . Lastly, age of autism diagnosis was positively correlated with TAS-8 scores , although this correlation was also small enough to not be practically significant (BFROPE\u2009=\u20090.014).The relationships between TAS-8 scores and demographic variables were also examined in order to determine whether relationships found in the general population apply to autistic adults. As hypothesized, TAS-8 scores showed a small and practically insignificant correlation with age  to be 10.2 . This estimate was several grades higher than that produced using the Flesch\u2013Kincaid algorithm . Using the FORCAST algorithm, the TAS-8 items demonstrated a grade level of 8.8, indicating a moderate decrease in word difficulty. This decreased reading level compared to the TAS-20 was also reflected in the Flesch\u2013Kincaid measures . Thus, in addition to improving the psychometric properties of the measure, our item reduction procedure seemingly improved the overall readability of the TAS.While alexithymia is theorized to account for many traits associated with the autism phenotype \u201351, studM\u2009=\u20090, SD\u2009=\u20091) and can similarly be scaled to the familiar T-score metric . As scores on the TAS-8 are both norm-referenced and psychometrically robust, we believe they present a viable alternative to TAS-20 total scores in any study protocol that includes the TAS-20 or one of its short forms . To facilitate the calculation and use of the TAS-8 latent trait scores in alexithymia research, we have created an easy-to-use online scoring tool (available at http://asdmeasures.shinyapps.io/TAS8_Score) that converts TAS-8 item responses into general population-normed latent trait scores and corresponding T-scores.While the 20-item TAS possessed adequate composite score reliability in our sample, bifactor confirmatory factor models failed to support the theorized structure of the questionnaire in the autistic population. The TAS-20 items assessing the EOT facet of the alexithymia construct and the form\u2019s reverse-coded items were particularly problematic, both exhibiting poor subscale reliabilities and contributing little common variance to the general alexithymia factor. These psychometric issues were further confirmed in our general population HPP sample, indicating that these problems were not unique to the autistic population. Removal of the EOT and reverse-coded items from the model greatly improved overall fit, but three additional items needed to be removed in order to meet our a priori standards of adequate IRT model fit and negligible I-DIF by diagnostic group. The final TAS-8 short form consisted of five DIF items , 13, 14 In addition to deriving a psychometrically robust short version of the TAS-20, the current study also sheds light on the areas of the form that are most psychometrically problematic, notably the EOT subscale. This subscale was the primary driver of poor TAS-20 model fit in the current study, and even when method factors were appropriately modeled, the reliability of the EOT subscale score was unacceptably low. Notably, it is not uncommon for researchers to perform subscale-level analyses using the TAS-20, examining correlations between DIF/DDF/EOT subscale scores and other constructs of theoretical interest . As the r|s\u2009<\u20090.2 and |d|s\u2009<\u20090.2). Moreover, despite a fairly large correlation between TAS-8 scores and neuroticism, partial correlation analyses demonstrated that alexithymia still explained substantial unique variance in autism symptomatology, depression, generalized anxiety, and quality of life over and above that accounted for by neuroticism. However, partial correlations with somatic symptom burden, social anxiety, and suicidal ideation failed to exceed the pre-specified interval null hypothesis, indicating that alexithymia in the autistic population only predicts these symptom domains insofar as it correlates positively with trait neuroticism. A particularly important future direction in alexithymia research will be to re-examine studies wherein alexithymia was found to be a \u201cmore useful predictor\u201d of some clinical outcome when compared to autistic traits [Tests of convergent and divergent validity of the TAS-8 score were largely in line with prior results, indicating that self-reported alexithymia is moderately to strongly correlated with autistic traits, repetitive behaviors, internalizing psychopathology, suicidality, and poorer quality of life. Relationships were also observed between TAS-8 scores and sex, age of autism diagnosis, and education level, although these effects were small enough to be practically insignificant , which in addition to assessing the experience of undifferentiated emotions common in alexithymia also seemingly captures the phenomenon of medically unexplained symptoms. We confirmed that this was in fact the case in our SPARK sample, as the polyserial correlation between this item and PHQ-15 total scores was very high  and very minimally attenuated after controlling for overall alexithymia as measured by the TAS-8 latent trait score . Notably, a recent study has found that item 3 of the TAS-20 is the single most important item when discriminating individuals with a functional somatic condition  from healthy controls [One particularly surprising finding is the poor correlation between alexithymia and somatic symptom burden, given the theoretical status of alexithymia as a potential driver of somatization and a large literature showing relationships between these constructs . One parcontrols , providicontrols  or PAQ [controls , an obsecontrols , and an controls , althougd\u2009=\u20091.014) was approximately 15% larger than the same group difference in TAS-20 scores (d\u2009=\u20090.880), indicating that the TAS-8 is better able to discriminate between autistic and non-autistic adults than its parent form. Although the current study did not validate this form for use in other clinical populations where alexithymia is a trait of interest , future studies in these populations are warranted to determine whether the improved measurement properties of the TAS-8 are useful in improving inferences about alexithymia in those groups as well.This work has meaningful implications for the study of alexithymia in the autistic population and in general, as it provides strong psychometric support for the TAS-8 questionnaire as a general-purpose measure of alexithymia across multiple clinical and non-clinical populations. These findings are particularly useful for autism research, as they indicate that the TAS-8 can be used to compare levels of alexithymia between autistic and general-population samples without worry that differences in scores are significantly biased by qualitative differences in the ways individuals in each group answer the questionnaire items. Moreover, the between-group difference in TAS-8 scores , while both recruited online, were drawn from different studies with dissimilar protocols and different versions of the TAS questionnaire. The HPP sample completed the TAS-16 questionnaire, which omits four of the more poorly performing items of the original TAS-20. Thus, in order to estimate TAS-20 total scores in this group of individuals, we were required to impute those items for all 721 participants with an unknown degree of error. Interestingly, the HPP sample reported TAS-20 scores that were 1.5\u20136 points larger on average than previous large-scale general-population studies using the TAS-20 , 165, anAn additional limitation is that the HPP sample was not screened for autism diagnoses, and there remains a possibility that some of these individuals could have met diagnostic criteria for autism or had a first-degree relative on the autism spectrum. However, previous studies have indicated that a small portion of autistic individuals  in an oIn addition to the limitations of the HPP sample, several limitations of the better-characterized SPARK sample were also present. As discussed in our previous work with this sample , it is nshould change over time, incorporating relevant findings such as empirical tests of latent variable models. Future research in alexithymia would greatly benefit from additional psychometric studies that aim to generate optimal instruments to measure all facets of the alexithymia construct, coupled with tests of the incremental validity of the EOT/DFAN trait facets over and above a score composed of solely DIF/DDF items.Another limitation concerns the correspondence of the TAS-8 to the theoretical alexithymia construct itself, as initially proposed by Sifneos and colleagues , 170. AsA final limitation of our study is the fact that we were unable to test all meaningful psychometric properties of the TAS-8. In particular, our study was cross-sectional, necessarily prohibiting us from assessing test\u2013retest reliability, temporal stability, and I-DIF across repeated test administrations. Additionally, as alexithymia appears to be amenable to change with psychological interventions , 176, fuhttps://asdmeasures.shinyapps.io/TAS8_Score/). Although the measurement properties of the TAS-8 were strong in this study we stress that this single measure should not be considered the \u201cgold standard\u201d of alexithymia measurement in autism or any other population. In agreement with the original authors of the TAS [The TAS-20 is a widely used measure of alexithymia that has more recently become the de facto measure of choice for this construct in the autism literature. However, this measure has so far lacked robust psychometric evidence for its reliability and validity in the population of autistic adults. Leveraging two large datasets of autistic and general-population adults, we performed an in-depth investigation of the TAS-20 and its measurement properties in autistic adults, revealing several psychometric shortcomings of this commonly used questionnaire. By reducing the number of items on the measure, we were able to produce a unidimensional short form, the TAS-8, which exhibited superior psychometric properties to the TAS-20 in samples of both autistic and non-autistic adults. Furthermore, in order to allow others to utilize the population-normed latent trait scores generated by our IRT model, we have created a user-friendly online score calculator for the TAS-8 that is freely available to interested researchers (Additional file 1. Supplementary Materials and TAS-8 Questionnaire."}
+{"text": "There is a growing recognition of sex and gender influences in autism. Increasingly, studies include comparisons between sexes or genders, but few have focused on clarifying the characteristics of autistic girls\u2019/women\u2019s physical health.A scoping review was conducted to determine what is currently known about the physical health of autistic girls/women. We screened 1112 unique articles, with 40 studies meeting the inclusion criteria. We used a convergent iterative process to synthesize this content into broad thematic areas.Autistic girls/women experience more overall physical health challenges compared to non-autistic girls/women and to autistic boys/men. Emerging evidence suggests increased prevalence of epilepsy in autistic girls/women compared to non-autistic girls/women and to autistic boys/men. The literature also suggests increased endocrine and reproductive health conditions in autistic girls/women compared to non-autistic girls/women. Findings regarding gastrointestinal, metabolic, nutritional, and immune-related conditions are preliminary and inconsistent.The literature has substantial heterogeneity in how physical health conditions were assessed and reported. Further, our explicit focus on physical health may have constrained the ability to examine interactions between mental and physical health. The widely differing research aims and methodologies make it difficult to reach definitive conclusions. Nevertheless, in keeping with the goals of a scoping review, we were able to identify key themes to guide future research.The emerging literature suggests that autistic girls/women have heightened rates of physical health challenges compared to non-autistic girls/women and to autistic boys/men. Clinicians should seek to provide holistic care that includes a focus on physical health and develop a women\u2019s health lens when providing clinical care to autistic girls/women. Autism spectrum disorder (hereafter autism) is a neurodevelopmental condition characterized by early-onset social communication difficulties and repetitive, stereotyped behaviors. The estimated prevalence rate of autism is approximately 1% worldwide , 3. The Autism is highly associated with co-occurring health conditions . It is hphysical health in this context to encompass non-mental health conditions within the broad category of medical disorders or problems.) Accurate and in-depth information in this domain, especially concerning autistic girls/women, is essential to the provision of comprehensive and sex- and gender-sensitive health care and is important for elucidating clinically useful subgroups within the autism spectrum. In view of this, we conducted a scoping review of the literature, focused on the extent and range of research pertaining to the physical health of autistic girls/women. Two research questions guided our review: (1) What do we know about the physical health of autistic girls/women; and (2) How specific are these physical health concerns to autistic girls/women, as compared to autistic boys/men, and to non-autistic girls/women?Most research on co-occurring conditions in autistic girls/women relative to boys/men has focused on psychiatric conditions, suggesting increased internalizing psychopathology in autistic girls/women compared to in boys/men \u201314. The We conducted a scoping review of the literature following the methodological framework outlined by Arksey and O\u2019Malley  and recehttps://www.mendeley.com/).We systematically searched the following databases according to PRISMA standards : CINAHL,A systematic selection process was used to determine the final articles included in this review. After duplicates were removed, two authors (CK and SB) screened titles and abstracts with support from senior authors (M-CL and GE), using broad criteria to allow for the inclusion of any potentially relevant study for further evaluation. Full-text articles were evaluated for inclusion by CK and SB. The pool of studies identified based on screening titles, abstracts, and consultations with senior authors determined the inclusion and exclusion criteria. At this stage, articles were included if they: 1) reported on co-occurring physical health conditions in people with a diagnosis of autism as defined by the DSM-IV, DSM-5, or ICD-10 criteria, or had direct relevance to the physical health of autistic girls/women; 2) included a clearly articulated sex-specific or gender-specific description or analysis of these conditions; (3) studied biological females only, or if the total female autism sample size was \u2265\u200915 and with at least one-eighth (12.5%) of the total autism sample being biologically female (to ensure that included studies had a sufficient number of girls/women to derive sex-specific or gender-specific information); (4) reported original, English-language research articles or reviews published in peer-reviewed scientific journals; and (5) in the case of review articles, used systematic search methods and included sex-specific or gender-specific analyses and interpretation. Articles were excluded if they were: (1) review articles using non-systematic search methodology; (2) opinion pieces; (3) editorials; (4) case reports; or (5) conference papers. Final decisions on which articles to include were made in discussion within the research team. Articles were grouped by main topic area and study design for organizational clarity. Data were extracted as shown in Tables  reported includedWe screened a total of 1112 unique citations and reviewed the full text of 201 articles, with 40 studies ultimately meeting the inclusion criteria  Epilepsy has been most commonly researched and seems more common in autistic girls/women compared to autistic boys/men and non-autistic girls/women; and (3) Autistic girls/women may experience more menstruation-related complications, endocrine and reproductive health conditions compared to non-autistic girls/women. Finally, studies that met the inclusion criteria but that did not align with the three major themes are described in a fourth section, Miscellaneous Emerging Findings. Details of sample characteristics, methodology, and statistics are provided in Table Three major themes on the physical health status of autistic girls/women emerged from the existing literature: (1) s/women;  EpilepsyThirteen out of the 40 included studies focused on the overall physical health status of autistic girls/women \u201331, withSix studies explored the prevalence of various co-occurring physical health conditions in autistic girls/women and autistic boys/men \u201324. Two Two studies further examined sex/gender as a predictor of physical quality of life and overall health status in 370  and 255 Three studies with population-based registry samples examined the overall physical health status of autistic girls/women compared to non-autistic girls/women \u201331. Two Eleven out of the 40 included studies specifically focused on, or included, epilepsy when examining sex/gender differences in neurological conditions in autistic individuals , 30\u201339.Five studies compared autistic girls/women to autistic boys/men with respect to epilepsy , 32\u201335. In addition, two studies specifically explored neurological profiles including seizure disorders in autistic children from community-based samples , 37. OneFour studies reported risks of epilepsy in autistic girls/women against non-autistic girls/women , 38, 39.Ten out of the 40 included studies focused on endocrine and reproductive health conditions in autistic girls/women only  or in coTwo community-based studies reported menstruation-related health challenges in autistic girls/women , 41. OneEight studies examined endocrine and reproductive health conditions in autistic girls/women compared to non-autistic girls/women , 42\u201345. Thirteen out of the 40 studies \u201358 were Three studies reported on neurological conditions beyond epilepsy in autism \u201348, withTwo studies focused on obesity and overweight (via body mass index) , 50. OneFour studies focused on gastrointestinal, metabolic, or nutritional conditions, comparing autistic girls/women and autistic boys/men \u201354. One Three studies focused on sex-specific immunological features in autism \u201357. CytoLastly, one meta-analysis examined sex/gender differences in 254 autistic adults regarding self-reported autistic characteristics, which included sensorimotor symptoms, some of which related to physical health, such as sensitivity to pain. Results revealed more severe sensorimotor symptoms in autistic women than in autistic men .The purpose of this scoping review was to explore what is known about co-occurring physical health conditions in autistic girls/women. Out of the 201 full-text articles we reviewed, only 40 met our inclusion criteria, mainly due to the paucity of reporting on sex or gender differences among populations with autism and the low percentages of autistic girls/women included in the current literature. There is a pressing need for more research that includes large numbers of autistic girls/women in order to better understand their physical health. This should be prioritized in order to advance the best clinical care for autistic individuals .Emerging patterns of co-occurring physical health conditions are worth further examination and replication. With respect to Theme 1, the current literature suggests that autistic girls/women tend to have more overall physical health challenges and lower overall health and quality of life than do autistic boys/men \u201331. HoweFindings in Themes 1 and 2 regarding differences between autistic girls/women and autistic boys/men need to be interpreted in light of the general pattern of case ascertainment in autism research so far, and the complexity associated with sex/gender-related differences in comorbidity pattern  and etiological load. With regard to ascertainment bias, some have suggested that the observed association between autism and epilepsy is largely driven by co-occurring intellectual disability , which iAt the same time, these observed sex/gender differences could be associated with variations in etiological load. At a group level, autistic girls/women tend to carry more de novo protein-truncating genetic variants likely causal to autism compared to autistic boys/men . Given tAnother pattern that emerged (Theme 3) was the greater burden of co-occurring endocrine or reproductive health concerns in autistic girls/women . Nevertheless, these findings should be viewed as preliminary, owing to the moderate sample sizes \u201342 and tFinally, there is increasing evidence that gastrointestinal  and metaThe finding that autistic girls/women experience more overall physical health challenges than non-autistic girls/women and autistic boys/men is of immediate clinical relevance. Improving physical health is integral to the care of all autistic individuals , 85. FroAnother key consideration is the interplay between physical and mental health. Autistic people are prone to experiencing mental health challenges (which we did not review here) . HoweverTimely diagnosis and treatment will enhance well-being associated with both physical and mental health of autistic individuals across the life span. This review has revealed that autistic girls/women are a population with unique health\u00a0needs. Therefore, it requires us to develop comprehensive services that integrate developmental, mental, and physical health for autistic girls/women.There are several limitations to consider in interpreting our findings. First, it is possible that we were unable to identify all studies relevant to our guiding questions due to the heterogeneity in how physical health conditions were assessed and reported in the literature. Nevertheless, based on the principles of a scoping review, we have identified potential areas in the literature that warrant future investigation and areas with insufficient information as yet to make firm conclusions. Second, the decision to focus on physical health, thus excluding studies only focusing on psychiatric co-occurring conditions, meant that we could not explore how mental health and physical health are intertwined in autistic people, particularly in girls/women. Finally, our scoping review demonstrates that understandings of the physical health of autistic girls/women are still emerging. The limited number of studies in each theme, and their varying quality and research methodologies, makes it difficult to reach definitive conclusions.However, several lessons about significant gaps in the clinical and research literature about autism can be learned from our review to inform future research directions. There is a lack of consistent, basic epidemiological information on the prevalence and incidence for co-occurring physical health conditions in the autism population by sex and, in particular, by gender. Reliable and valid measurement tools for physical health in autistic individuals need to be further developed. Additionally, there are insufficient longitudinal studies to chart the emergence of co-occurring conditions and randomized control trials to assess treatment for these conditions. There are also insufficient biological studies on the mechanisms of the development of physical health challenges in autism by sex and by gender. Further, there is significant underrepresentation of autistic girls/women in most studies, and only a small minority of studies are equipped to or have formally examined and reported sex/gender differences in their primary analyses. These highlight the ignorance about how sex and gender influence autism, perhaps due to a male-biased lens. The relative lack of awareness about women\u2019s health and female experiences in the scientific and clinical knowledge about physical health and autism leaves girls/women diagnosed with autism at distinct disadvantages. Targeted research on autistic girls/women is clearly needed. Future studies on autism should be designed to achieve sex/gender equity by ensuring a male/female ratio closer to the general population rate  . For resTo our knowledge, this is the first scoping review on physical health in autistic girls/women. Emerging themes suggest that autistic girls/women tend to have heightened rates of a variety of co-occurring physical health challenges compared to autistic boys/men and non-autistic girls/women. Clinicians should provide holistic care that integrates not only developmental and mental health, but also physical health. Future studies need to include sufficient numbers of autistic girls/women to achieve adequate power, attend to physical health and the intertwined nature of developmental, mental, and physical health, and use sex- and gender-informed lenses.Additional file 1. Appendix: Search Strategy."}
+{"text": "Hypothenemus hampei (Ferrari) (Coleoptera: Curculionidae: Scolytinae), severely affects the quality and production of coffee. To understand how to control this pest, we studied their capture patterns at different trapping heights over time. Baited column traps captured more coffee berry borers at 0.5m height than at higher heights irrespective of temperature changes, rainfall, and relative humidity. Understanding the height position for the most efficient insect capture is useful for developing future cost-effective management strategies to control this coffee pest.Globally, the Coffee Berry Borer, The coffee industry loses millions of dollars annually worldwide due to the Coffee Berry Borer (CBB); these losses imply a decrease in quality and production. Traps are used to monitor their flight and for pest control. The main objective of this study was to determine the capture pattern and trap capture percentages of the CBB population over time using column traps (CTs) in two independent field experiments. CTs were composed of four traps installed at four different heights 0.5, 1.5, 2.5, and 3.5 m above ground. Our results demonstrated a significant difference in CBB capture by traps placed at different heights above the ground. The CT capture maintained a pattern throughout this study\u2019s lag: the lower the height, the greater the percentage of CBBs captured. The study was conducted in two independent experiments (A and B). In Experiment A and B, the traps placed at 0.5 m caught 67% and 85% of the CBBs captured, respectively. Furthermore, the trap set at 1.5 m above the ground in the multi-level CT showed a higher capture percentage than the single placed trap . The pattern of the capture and proportion of the CBB in the CTs was maintained throughout the study despite the season, changes in temperature, and relative air humidity. We suggest that CTs could be explored as a useful tool for capturing the CBB, considering its monitoring and management.  Hypothenemus hampei  (Coleoptera: Scolytidae), is a major invasive species in coffee [The Coffee Berry Borer (CBB), Ferrari, 867 , over distinct stages of the coffee phenology and weather periods . The three plots used in this study were cultivated in monoculture and in full sun conditions. The main blossoms came between February and March and the coffee harvest was carried out by hand-picking between the months of October and December. The harvest was done only for the mature berries and multiple flowering during the season provided a constant presence of the fruits. Experiment A  was conducted between April and September 2019 in the first plot, which has an area of 2280 m2; Experiment B , conducted between October 2019 and March 2020, was established in a second plot that has an area of 2800 m2. In the referential coffee plot  with an area of 1200 m2, single traps  at 1.5 m height were installed  at 585 m above sea level (masl) in nstalled . The col\u00ae) placed at four heights above ground. Five CTs (repetitions) were positioned 25 m from each other in a zig-zag pattern in each plot, and at 30 cm from the tree canopy. Each trap contained a 30 mL container with a chemical lure . The lure was replaced every six weeks or sooner if it was observed to have evaporated. The traps were fixed one above the other at 3.5 m, 2.5 m, 1.5 m, and 0.5 m above the ground; and five STs at 1.5 m above the ground were placed at the reference plot , see 2\u03c7 = 10.85, df = 15, P-value = 0.001 . The other variables\u2014total rain , temperature , and RH% \u2014were not significantly different in either experiment. Nonetheless, for Exp B, there were no significant differences between CBB captured and environmental variables.The results showed that independent of the season (sampling date) and coffee variety (\u2018Limani\u2019 or \u2018Catua\u00ed\u2019), the height that collected more CBB was 0.5 m above the ground. The total rain events RE,  by the tBait traps have been used worldwide, to monitor CBB populations\u2019 flight on coffee plantations and then implement some sanitation strategies ,18,19,26The berries remaining on the ground after the harvest are a potential refuge for the CBBs in the following months and in future coffee production. During this period (January to March), a significant number of the population of the CBBs are close to the ground ,26. TherRegarding the environmental variables analyzed, we noticed a correlation between the rain events and total CBB captured in Exp A. The use of state-of-the-art automated-weather stations at these experimental sites increases the accuracy of the relationship between CBB capture and the considered environmental variables . The continued acquisition and use of data throughout the seasons and different locations will potentially allow us to build better predictive patterns of CBB outbreaks and understand their relationship to environmental variables .Both chemicals (ethanol and methanol) used in the trapping are heavier than the air. The CT design under normal conditions would produce an expanded zone of influence with an overall increase in attractiveness towards the lower areas. Our experiment also observed a positive column attraction in the CBB captures  as indicated in the results. This design would likely increase CBB capture in the lower height trap throughout the study period. However, different environmental conditions, the coffee crop stage, plant density, variety, and the crop cultivation system could influence the results. Additional work should investigate CT effectivity during young coffee plant stages.CT is a useful element in indicating CBB infestation density and population distribution by height. Traps placed at a lower height always maintained the highest capture of CBB throughout the study period. Under the environmental conditions of this study, the traps with the maximum capacity to capture the CBB throughout the evaluation periods were those placed at 0.5 m from the ground. Further studies on column trapping design should be conducted to optimize and explore their use as a proper pest management tool."}
+{"text": "Personalized models of cardiac electrophysiology (EP) that match clinical observation with high fidelity, referred to as cardiac digital twins (CDTs), show promise as a tool for tailoring cardiac precision therapies. Building CDTs of cardiac EP relies on the ability of models to replicate the ventricular activation sequence under a broad range of conditions. Of pivotal importance is the His\u2013Purkinje system (HPS) within the ventricles. Workflows for the generation and incorporation of HPS models are needed for use in cardiac digital twinning pipelines that aim to minimize the misfit between model predictions and clinical data such as the 12 lead electrocardiogram (ECG). We thus develop an automated two stage approach for HPS personalization. A fascicular-based model is first introduced that modulates the endocardial Purkinje network. Only emergent features of sites of earliest activation within the ventricular myocardium and a fast-conducting sub-endocardial layer are accounted for. It is then replaced by a topologically realistic Purkinje-based representation of the HPS. Feasibility of the approach is demonstrated. Equivalence between both HPS model representations is investigated by comparing activation patterns and 12 lead ECGs under both sinus rhythm and right-ventricular apical pacing. Predominant ECG morphology is preserved by both HPS models under sinus conditions, but elucidates differences during pacing.The online version contains supplementary material available at 10.1007/s10439-021-02825-9. Anatomically and functionally personalized models of cardiac electrophysiology (EP) are considered a promising complementary tool for tailoring future cardiac precision therapies28a priori knowledge of the HPS and replicate QRS complexes in all electrocardiogram (ECG) leads can be considered likely and plausible approximations of a given patient\u2019s EP. Integrating models of the HPS in models of human ventricular EP and tailoring these to create a CDT is complicated by two major factors. First, there is limited knowledge about the actual topology of the HPS, its variability within the general human population,Of pivotal importance for a sound mechanistic representation of cardiac EP is the consideration of effects mediated by the His\u2013Purkinje system (HPS) in the ventricles. Computational models that integrate Personalized models of the HPS are thus needed for building CDTs that are capable of capturing ventricular EP mechanisms under a broad range of conditions. To achieve clinical feasibility, workflows for building models of the HPS must achieve a high degree of automation to facilitate the robust production of models at scale. To be credible, CDTs must be able to replicate QRS complexes observed in body surface potential maps or in the clinically standard 12 lead ECG with sufficiently high morphological fidelity.We introduce an automated two stage approach for generating HPSs of high-fidelity for use in digital twinning pipelines. First, an abstract general representation of emergent features of the HPS was formulated and personalized in a previous studyA model for the subject was created from clinical magnetic resonance images (MRIs) and fitted with an anatomical reference frame allowing automated control of all model parameters relating to both the architecture of the HPS, as well as ventricular EP. Discrepancies within the ventricular activation and concomitant 12 lead ECG between the topologically realistic Purkinje model featuring antidromic activation and the simpler fascicle-based model, accounting for HPS effects in a phenomenological sense, are elucidated by simulating both healthy sinus rhythm and right ventricular (RV) apical pacing. Sinus rhythm is also analyzed in terms of the goodness of fit with the measured 12 lead ECG.Seg3D.Seg3D when required. Registration of the heart into the torso was also performed within Seg3D using a modified iterative closest point algorithm. An anatomically-accurate multi-label finite element model was then generated at an average spatial resolution of the cardiac domain of As part of an MRI study approved by the ethics review board of the Medical University of Graz (EKNr:\u00a024-126\u00a0ex\u00a011/12), MRI data consisting of both a torso and iso-volumetric 3D whole heart were acquired for a healthy volunteer. The volunteer was male of 47 years of age. A 12 lead ECG was recorded using MRI-compatible electrodes at the time of the study at z), transmural Supplementary file2 (MP4 1887 kb)Supplementary file3 (MP4 1550 kb)Below is the link to the electronic supplementary material."}
+{"text": "With the advance of sequencing technology, an increasing number of populations have been sequenced to study the histories of worldwide populations, including their divergence, admixtures, migration, and effective sizes. The variants detected in sequencing studies are largely rare and mostly population specific. Population-specific variants are often recent mutations and are informative for revealing substructures and admixtures in populations; however, computational methods and tools to analyze them are still lacking. In this work, we propose using reference populations and single nucleotide polymorphisms (SNPs) specific to the reference populations. Ancestral information, the best linear unbiased estimator (BLUE) of the ancestral proportion, is proposed, which can be used to infer ancestral proportions in recently admixed target populations and measure the extent to which reference populations serve as good proxies for the admixing sources. Based on the same panel of SNPs, the ancestral information is comparable across samples from different studies and is not affected by genetic outliers, related samples, or the sample sizes of the admixed target populations. In addition, ancestral spectrum is useful for detecting genetic outliers or exploring co-ancestry between study samples and the reference populations. The methods are implemented in a program, Ancestral Spectrum Analyzer (ASA), and are applied in analyzing high-coverage sequencing data from the 1000 Genomes Project and the Human Genome Diversity Project (HGDP). In the analyses of American populations from the 1000 Genomes Project, we demonstrate that recent admixtures can be dissected from ancient admixtures by comparing ancestral spectra with and without indigenous Americans being included in the reference populations. With advances in sequencing technology, an increasing number of populations have been sequenced to study the histories of worldwide populations, including their divergence, admixtures, migration and effective sizes . The varMethods using rare variants for ancestry inference or analysis of population structures are also limited. https://github.com/eat1000/ASA, and are applied in analyzing high-coverage sequencing data from the 1kGP  specific to the reference populations. The eigenvalues and eigenvectors of the genetic relationship matrix based on population-specific SNPs (GRM-PS) are shown to be population specific in the reference populations. When analyzing the study samples, the principal scores associated with the reference populations are computed by projecting the genotype matrix onto the asymptotic principal directions defined by the reference populations. The principal scores are shown to be unbiased estimates of the ancestral proportions of maximum variances. Ancestral information, the best linear unbiased estimator (BLUE) of the ancestral proportion, is proposed, which can be used to infer ancestral proportions in recently admixed target populations and measure the extent to which reference populations serve as good proxies for the admixing sources. The methods are implemented in a program, Ancestral Spectrum Analyzer (ASA) available at the 1kGP  and the the 1kGP . In the PCA-based methods have been developed for ancestry inference  and the K reference populations, there are kN individuals from population k, k = 1,2,\u22ef,K, and the total sample size is N = N1 + N2 + \u22ef + NK. We assume that there is a panel of M biallelic SNPs that are population specific; that is, each SNP is polymorphic in one and only one of the K reference populations. Suppose that \ud835\udd0ak is the index set of SNPs that are polymorphic in population k and Mk = |\ud835\udd0ak| is the number of SNPs specific to population k; then, the total SNP number is M = M1 + M2 + \u22ef + MK. Let fkm be the MAF of SNP m in population k; then, we have fkm > 0 if m \u2208 \ud835\udd0ak, and otherwise, fkm = 0.Considering a sample of individuals from X be a genotype matrix of dimension N\u00d7M whose elements X are coded as the number of minor alleles of SNP m in individual n. Suppose that \ud835\udd16k is the index set of individuals who belong to population k, k = 1,2,\u22ef,K. For rare SNPs, X approximately follows a binomial distribution that takes values 0 and 1 with probabilities 1\u22122fkm and 2fkm, respectively, provided that n \u2208 \ud835\udd16k and m \u2208 \ud835\udd0ak. It is easy to show that the genotypic mean and variance areLet X are ordered by the populations to which the individuals belong, and the columns are ordered by the populations to which the SNPs are specific. That is, the first N1 rows are genotypic values of individuals from population 1, the next N2 rows are from population 2, and so on. Similarly, the first M1 columns are SNPs that are polymorphic in population 1, the next M2 columns are SNPs that are polymorphic in population 2, and so on. Since all SNPs are population specific, X is zero if n \u2208 \ud835\udd16k, k\u2260k\u2032. Therefore, X is a block-diagonal matrixFor convenience, we assume that the rows of Xk is of dimensions kN = kM, k = 1,2,\u22ef,K.where We define the GRM-PS asZ is a block-diagonal matrix of dimension N\u00d7N,Clearly, the GRM-PS wherei and j are the indices of individuals i and j in Z, respectively, and i\u2032 and j\u2032 are their indices in Zk.Z is block-diagonal, the eigenvalues of submatrix Zk are the eigenvalues of Z, and the associated eigenvectors of Zk padded with Z. Therefore, the eigenvalues and eigenvectors of the GRM-PS are population specific in the reference populations.Since the GRM-PS M1,M2,\u22ef,MK become large, the GRM-PS will converge to its mathematical expectation, that is, the expected GRM-PS (EGRM-PS). The EGRM-PS Z is also a block-diagonal matrixAccording to the law of large numbers, as the SNP numbers kZ is the expectation of Zk, k = 1,2,\u22ef,K.where submatrices kZ is compound symmetricMoreover, whereZ provides the asymptotic results of the eigenanalysis of the GRM-PS Z when M1,M2,\u22ef,MK are large. Submatrix Zkk has the largest eigenvalue \u03bbk = kz + (Nk\u22121)zkk with the associated eigenvector 1Nk is the column vector of dimension kN in which each element is 1. The eigenvalue \u03bbk can be decomposed asAn eigenanalysis of the EGRM-PS  1Nk/Nk , where 1\u03bbk depends on the MAFs of SNPs specific to population k, and the second consists of the intrapopulation variance of the SNPs. When plotting the PC associated with \u03bbk, that is the k-th eigenvector scaled by k share the same coordinates, which represent the center of population k in this dimension  = 0,1.where Without the constraint k = 1,\u20052,\u22ef,K. The numerator is the number of alleles specific to population k that are observed in individual n, and the denominator is the expected number of alleles for individuals from population k. The maximum likelihood estimate of where Proofs and an approximate maximum likelihood estimate are presented in the k as follows:We define the ancestral information vector for population wherebk for computing the principal score vector, dk weights SNPs equally. Similar to the principal score, ancestral information from different studies can be inferred based on the same panel of SNPs, and the results are comparable. Genetic outliers, related samples and the sample sizes of the target populations will not affect the results. It is worth emphasizing that interpreting the ancestral information as the ancestral proportion is valid only if its associated reference population approximates an ancestral population of the study sample well. Otherwise, it simply measures the co-ancestry between the reference population and the study sample.In the The samples and the high-coverage sequencing data of the 1kGP were described previously . We extrN = 61) from the HGDP-CEPH with AFR, EAS, EUR, SAS populations from the 1kGP, we obtained a set of five reference populations. There were 161,088 SNPs specific to AMR, and the numbers of SNPs specific to AFR, EAS, EUR, and SAS were slightly smaller than those in The HGDP-CEPH panel consists of 929 high-coverage human genome sequences from 54 diverse populations throughout the world . The 929Using the 200,000 populations-specific SNPs, we conducted PCA on the reference populations, which included 2,000 non-admixed individuals. Scatter plots of the top four PCs are shown in We conducted a uniform manifold approximation and projection (UMAP) 0.4.3 analysis  on the tThe principal scores of the 2,504 individuals are shown in The ancestral spectra of the 2,504 individuals are shown in For the admixed populations, summary statistics of their AFR, EAS, EUR, and SAS information are presented in For AMR populations, the average AFR, EAS, and EUR information varies in different populations. PUR shows the highest AFR (0.136), the lowest EAS (0.045) and the highest EUR information (0.577), and PEL shows the lowest AFR (0.033), highest EAS (0.232) and lowest EUR information (0.194). Because of the lack of an indigenous AMR population in the reference populations in this analysis, EAS serves as a proxy. Indigenous AMRs are considered to have migrated from Siberia via Beringia approximately 15,000\u201323,000 years ago . BecauseSome genetic outliers can be observed whose ancestral spectra deviate from the distribution centers of the populations with which they are labeled. For example, NA20314 from ASW has AFR, EAS, and EUR information of 0.007, 0.203, and 0.316, respectively, and has almost no AFR ancestry. HG01880 from ACB has AFR, EAS, EUR, and SAS information of 0.570, 0.018, 0.079, and 0.369, respectively, and is the only member of AA showing substantial SAS ancestry. HG01241 from PUR has AFR, EAS, and EUR information of 0.693, 0.024, and 0.212, respectively, and is closer to AAs. It is interesting to note that the total ancestral information of NA20314 is only 0.531, which increases to 0.934 when the second SNP panel was used, see latter part of the results. This is because that she has a lot of AMR ancestry which was not well-represented by the EAS-specific SNPs in the first panel. With the second SNP panel, NA20314 has AFR, AMR, EAS, and EUR information 0.007, 0.588, 0.017, and 0.321, respectively.Using the panel of 250,000 population-specific SNPs, ancestral spectra of the 2,504 individuals are shown in It is also interesting to note that for CLM and PUR, the EAS information is close to zero when analyzed with the second SNP panel. In contrast, some individuals from MXL and PEL still have a substantial amount of EAS ancestry. For example, HG01944 from PEL has AMR, EAS, and EUR information of 0.474, 0.377, and 0.101, respectively. The 0.101 EUR information should come from admixtures sometime after the Columbian contact and the 0.377 EAS information is possibly to be more recent. With the first SNP panel, the EAS information of HG01944 is 0.528. Because the 0.377 EAS information is from his contemporary EAS ancestor, the rest 0.151 is attributable to his indigenous AMR ancestor.In the first panel of 200,000 population-specific SNPs, 183,328 SNPs had at least one copy of rare alleles in the HGDP dataset. The ancestral information of the 929 individuals based on the first panel of SNPs is presented in Oceanian populations have the least total ancestral information (0.251) from AFR, EAS, EUR, and SAS combined. This reflects their ancient separation and isolation from Eurasian populations . Due to The ancestral information of indigenous AMRs is mainly from EAS (0.289) and EUR (0.065). If ancestors of indigenous AMRs were admixed between EAS and EUR populations sometime before the migration of indigenous American ancestors across the Bering Strait, obviously, contemporary EAS the EUR populations are not good proxies of their ancestral populations and the ancestral information cannot be interpreted as the ancestral proportion. In fact, the chance of having good proxies using contemporary populations decreases as the admixture is more ancient. It is worth noting again that some of the EUR ancestry is likely due to recent admixture . There iInspecting the ancestral spectra of individuals, some genetic outliers can be identified. For example, HGDP00544 from the Papuan Sepik population has AFR, EAS, and SAS information values of 0.019, 0.217, and 0.089, respectively, which are closer to the average values of 0.014, 0.208, and 0.087 in the Bougainville population than the 0.023, 0.082, and 0.111 in the Papuan Sepik population. HGDP00871 from the Mayan population has EUR information of 0.245, which is much larger than the average of 0.065 in AMR. Similar to the AMR populations in the 1kGP, some EUR components of HGDP00871 may be due to recent admixture.Ancestral spectra with the second panel of 250,000 population-specific SNPs are shown in Our ancestral information was derived based on the estimate of ancestral proportions. It can be interpreted as an ancestral proportion only if its associated reference population is recently related to an ancestral population, thus approximates the ancestral population well. For the recently admixed AAs in the 1kGP, contemporary AFR and EUR populations appear to serve as good proxies of their ancestral populations, and the results are close to the estimated ancestral proportions reported in literature . HoweverTechnical issues may confound the estimation of ancestral information and prevent the comparison of absolute values between samples with different genotyping methods, such as sequencing platforms, sequencing coverage, reference genomes, quality control criteria, and bioinformatics software. Out of the first panel of 200,000 SNPs, we extracted 193,902 SNPs from the genotype data of the 1kGP released in phase 3. Ancestral spectrum analysis was conducted based on the 193,902 SNPs, and the results are shown in Our selection of population-specific SNPs may be subject to misclassification errors. Alleles classified as specific to one population may have undetected and much lower frequencies in another population due to the limited sample sizes of the reference populations. For example, the average EAS, EUR, and SAS information in the Biaka population from the HGDP are 0.005, 0.007, and 0.008, respectively, which are unexpected. Increasing the sample sizes of the reference populations will reduce such errors. Since the ancestral information due to misclassification errors is typically very small, the overall ancestral spectrum will not be greatly affected. In addition, such a small amount of unexpected ancestral information can also be caused by sequencing errors.K = 4, 5, and the results are shown in We used AFR, EAS, EUR, and SAS populations from the 1kGP and AMR populations from the HGDP as the reference populations, some of which may be admixed as well. We conducted an unsupervised ADMIXTURE 1.3.0  analysisWe further analyzed the 20 populations from the 1kGP that serve as reference populations for AFR, EAS, EUR, and SAS, the results are shown in a priori. The ancestral spectrum analysis in the study samples does not affect the estimates of allele frequencies in the reference populations; hence, genetic outliers and related individuals can be included in the target populations. Ancestral information from different studies can be inferred and compared based on the same panel of SNPs, and the results do not depend on the sample sizes of the studies.Model-based approaches, such as STRUCTURE , FRAPPE Another difference between our ancestral information and the model-based approaches is that we do not constrain the total ancestral information to be one. This allows for comparing results with different reference populations. As illustrated in the analyses of AMR populations from the 1kGP, choosing different reference populations allows recent admixtures to be dissected from ancient ones. Moreover, our ancestral information is directly associated with one of the reference populations, and its interpretation is straightforward. Although we assumed that population-specific alleles are rare, it can be shown that the ancestral information estimated by the method of moment holds for low-frequency or common alleles as well. For the maximum likelihood estimate, the binomial approximation of the genotypic distribution is not valid any longer and the inference based on Eq. 14 will be less accurate. In addition, the estimator by the method of moment is the linear estimator that minimizes variance, is statistically consistent in nature and incurs minimal computational cost.We conducted supervised ADMIXTURE 1.3.0  analysesIn this work, we use only five reference populations, which have publicly available deep sequencing data and reasonable sample sizes. With more populations sequenced in the future, more reference populations of larger sizes will be able to be used, and much finer ancestral spectra in worldwide populations will be able to be inferred.ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/data_collections/1000G_2504_high_coverage. Genotype data from high coverage sequencing data of the HGDP are available from ftp://ngs.sanger.ac.uk/production/hgdp/hgdp_wgs.20190516/.Genotype data from high coverage sequencing data of the 1kGP are available from Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements.GS and QK: conceptualization, writing, review, and editing. GS: methodology, funding acquisition, supervision, and writing original draft. QK: visualization. Both authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "R(t) \u221d t0.5). The model is then applied to rising bubbles to demonstrate the impact of transport of species on both the bubble velocity and shape as well as the concentration field in its wake. This improved model enables the incorporation of electric fields and chemical reactions that are essential for studying the physicochemical hydrodynamics in multiphysics systems.Understanding the generation, growth, and dynamics of bubbles as they absorb or release dissolved gas in reactive flows is crucial for optimizing the efficiency of electrochemically gas-evolving systems like alkaline water electrolysis or hydrogen production. To better model these bubbly flow systems, we use a coupled level set and volume of fluid approach integrated with a one-fluid transport of species model to study the dynamics of stationary and rising bubbles in reactive two-phase flows. To accomplish this, source terms are incorporated into the continuity and phase conservation equations to allow the bubble to grow or shrink as the species moves through the interface. Verification of the hydrodynamics of the solver for non-reactive systems demonstrates the requisite high fidelity interface capturing and mass conservation necessary to incorporate transport of species. In reactive systems where the species impacts the bubble volume, the model reproduces the theoretically predicted and experimentally measured diffusion-controlled growth rate (i.e.,  One-fluOne-fluid methods differ in terms of describing the interface between the two phases, which can be done either by using interface tracking or interface capturing techniques. The interface tracking methods track the interface with a high degree of precision; however, these techniques require more computational resources and are difficult to implement in cases where breakup or coalescence between interfaces occur . InterfaThe change in the bubble volume, due to transport of chemical species, has a direct impact on the bubble hydrodynamics in the two-phase flow. These hydrodynamics, such as the buoyancy force, depend on the bubble volume. For example, a bubble growing in a reactive medium experiences higher buoyancy force as the volume increases, which will change the bubble dynamics such as the rising velocity. Studying the effects of material phase change due to the chemical species transport on bubble hydrodynamics requires coupling the fluid dynamic and transport of species physics. Several studies model bubbles rising with transport species without coupling both the fluid dynamics and transport of species together, keeping the bubble volume fixed \u201334. HaroIn this paper, we present an algorithm and verification studies that couples the one-fluid transport of species model  with the2.To model the transfer of species through the bubble interface, the one-fluid approaches volume of fluid and level set methods are combined to provide the necessary high fidelity scheme to model the interface. These two approaches have previously been combined in the simple combined level set and volume of fluid (s-CLSVOF) to model the hydrodynamics of bubbly flow. The combined method is presented in 2.1.The failure to conserve mass by the LS method and inaccurate interface capturing in VOF methods prompted the development of another efficient technique to address these issues. Coupling these one-fluid computational methods benefits from the advantages of the two well-established methods and limit the disadvantages of using each of the single method separately. The coupling we implement, the simple CLSVOF method, combines the level set and volume of fluid methods ,31,38. T\u03b1. Momentum conservation is achieved by solving Navier-Stokes equation over the fluid domain. The equations are simplified by assuming the two-phase, immiscible fluid system is isothermal, and that both phases are incompressible with constant density. This assumption is reasonable for bubbles moving at a low Mach number and with low mass transfer rates.Simulating two-phase flows in the non-reactive case requires satisfying the mass and momentum equations. The mass conservation of each fluid is satisfied by imposing the continuity equation and the advection of the liquid volume fraction u is the velocity field, \u03c1 is the fluid density, p is the pressure, \u03c4 is the shear stress tensor that is defined as \u03bc is the fluid dynamic viscosity, the superscript T indicates the transpose of the vector, g is the gravitational acceleration, and f\u03c3 is the volumetric surface tension force. Computing f\u03c3 depends on the interface curvature and is calculated from the reinitialized LS interface. Since we are adapting a one-fluid approach, \u03b1 is the volume fraction and the subscripts b and \u2113 stand for the bubble and the liquid phases, respectively. Finally, the VOF method\u2019s volume fraction advection equationMass conservation and momentum conservation are given as follows:\u03b1 is reinitialized using the LS method to sharpen the interface. The LS method removes the smearing inherent to the VOF while maintaining the total \u03b1 and thus the mass of the phases is conserved. The more precise interface also helps in accurately calculating the curvature, normal vector, and surface tension force. At the conclusion of a given time step, the s-CLSVOF approach creates an initial LS function, \u03c80, from the \u03b1 field by the relationship\u03c80 is the initialized LS function and \u0394x is the computational cell width at the interface. Albadawi et al. (2013) selected this mapping as an approximation of the signed distance function where cells far from the interface are given a nominal value of \u00b11 and cells on or next to the interface get an intermediate value [While the VOF method is used to advance the system through time, the LS method is used between steps forward in time to sharpen the interface. At the end of each time step, te value . This in\u03c4 is an artificial time not connected to the time marching of the VOF method. The \u0394x is included in the denominator of the signed function to avoid indeterminate results [The reinitialization is carried out by solving the PDE results .\u2207\u03c8| = 1 [\u03c4 = 0.1\u0394x. This provides a small enough artificial time to avoid large changes in the LS function till the stopping condition is reached. The number of needed iterations satisfies the condition:Ncorr is an upper bound for the number of iterations [\u03c80 provides a good estimate of the converged level set, which also reduces the number of reinitialization iterations [\u03b1.A stopping condition has been determined, which yields a sharp interface without unnecessary extra iterations. Based on \u2207\u03c8| = 1 . Equatioerations . For theerations . Once th\u03c1 and \u03bc) are calculated byWith the updated volume fraction field, it is necessary to also update the physical transport properties. The physical properties of the one-fluid  as shown in Ro = 0.003 m for both simulations which is within the typical reported size range in the literature [Bo = 17.7 and the Morton number is M = 711. The skirted bubble has the properties Bo = 243 and M = 266. Unlike our other simulations, which allow the time step to vary, a fixed time step is established by the ratio \u0394x/\u0394t = 1.2 for all simulations to ensure that the Courant number is approximately the same for all simulations.The bubble starts freely rising from an initial position  and \u0394x/Ro = 0.016 (black). At the coarsest resolution, the bubble is slightly narrower. In the case of the spherical bubble, this results in an elongated bubble, and in the case of the skirted bubble, this produces thicker filaments. The thicker filament reflects the challenge of resolving the filament with relatively larger cells and demonstrates the importance of having a highly resolved interface for the more complex bubble shapes.We also present the bubble shape at three different mesh resolutions in 3.2.x/Ro = 0.04 due to the computational cost of the three-dimensional domain. Unlike the previous section, which used a fixed time step, an adaptive time step is used for computational efficiency and convergence. The maximum Courant number and time step are Comax = 0.25 and \u0394tmax = 5(10\u22124) s, respectively.Having established the necessary resolution to get converged terminal velocity and interface shape, we need to confirm that the s-CLSVOF method is mass conserving. To test the mass conservation, simulations of the spherical and skirted bubble rising from For the spherical bubble simulations, the two and three-dimensional simulations produce almost identical bubble shapes. The results of the skirted bubble, however, produce different interface shapes for the two domains. Because the three-dimensional skirted bubble is wider, the projected area is smaller than the two-dimensional skirted bubble. Despite this difference, the shape itself remains a skirted bubble. For the spherical bubble, there is a less than 3% difference in the terminal velocity, but the more complex shape of the skirted bubble results in a 15% difference in the terminal velocity. It is possible that at higher resolutions the more complex skirted bubble terminal velocity will converge for the two domains, but due to the computational cost, we were not able to verify this. Overall though, the qualitative shape is accurately captured in two dimensions, and at least for the simpler bubble shape, the terminal velocity is accurately predicted by two-dimensional simulations.3.3.Modeling of a single rising bubble in an initially stagnant liquid phase is a benchmark test case to verify the numerical simulations. Several experimental and numerical investigations have been devoted to bubbly flows focusing on the bubble\u2019s terminal shape and velocity in viscous liquids ,43\u201347. TBo and M values. These simulations are selected based on the experimental and numerical data to provide direct comparison between the s-CLSVOF method and a front-tracking method [Bo and M are varied by changing the surface tension, fluid density difference, and fluid viscosity difference while keeping the ratio of these later two properties fixed. The Bo and M combinations simulated are presented in x/Ro = 0.024 and fixed time step \u0394t = 5(10\u22125) s.To validate the hydrodynamics of the model, we run two-dimensional simulations of a bubble rising in a quiescent viscous liquid without incorporating transport of species. The simulation domain, bubble size, and boundary conditions are set to match those presented in the g method ,46. Two The results of the rising bubble study are presented in Cases 7 and 8 feature skirted bubbles where the simulation trends are slightly different. The experimental results of the bubble shape for cases 7 and 8 show the experimental bubble has a skirted shape with the filament pointing inward at the bottom, which is more closely captured by the s-CLSVOF simulations. While the s-CLSVOF results underestimate the terminal velocity by 5.35% and 5.24% for cases 7 and 8, respectively, the front tracking simulations produced lower error values for both cases. In the previous section, we identified some discrepancies between the two and three-dimensional skirted bubbles, which were possibly amplified by the requisite lower resolutions. For the comparison with experimental bubbles, a higher resolution is used which may be the reason for the reduced error, but there is still the potential that using two-dimensional simulations is causing the underestimation. Overall, the accurate modeling of the terminal velocity and bubble shapes of the s-CLSVOF method compared to experiments provide additional verification of the s-CLSVOF method to model bubbles rising in a non-reactive flow and improvements over existing models.4.Having examined the hydrodynamic accuracy of the method, we now incorporate transport of species into the simulations. 4.1.R(t) = Ct\u03b2, where C is a constant that is determined by the concentration difference between the two phases and the associated diffusion coefficient, and \u03b2 = 0.5 [In this section, we present a study where transport of species causes the bubble to grow but the bubble center of mass remains stationary. The results of these simulations can be compared to the well established behavior known as diffusion-controlled growth, in which the rate of species diffusion across the bubble interface controls its growth and is well known. The bubble radius in diffusion-controlled medium scales as  \u03b2 = 0.5 ,49. The c and He. In fact, the He determines the steady-state concentration ratio between the inside and outside of the bubble. For the simulations in this section, He is greater than one, which requires the steady-state concentration inside the bubble to be larger than the concentration of the liquid to satisfy the He condition. Thus, the growth of the bubble takes place till the concentration inside the bubble becomes greater than the liquid concentration. In the case of these simulations, steady state is not achieved, so the experimentally observed growth rate is expected to persist after an initial transience.The concentration difference between the bubble and the nearby liquid is not the sole factor that drives the transport of the concentration. As we showed in Ro. The bubble is initially at the center of the domain with Ro = 0.005 m and zero concentration of the species inside the bubble. The concentration inside the liquid, c\u221e, is varied to ensure that there is limited variation in the bubble growth rate as a function of the concentration difference. The simulation properties used for this study are g = 0 to maintain the bubbles position, D\u2113/Dg = 1, He = 33, \u03c1\u2113/\u03c1g = 100, \u03bd\u2113/\u03bdg = 1, MW = 32(10\u22123) kg mol\u22121, and \u03c3 = 1 N m\u22121. The molecular weight and the Henry number correspond to dissolved oxygen in water at 25 \u00b0C. A structured uniform mesh with \u0394x/Ro = 0.05 is used. All boundaries permit an outflow as the bubble grows and the concentration boundary condition is set to c = c\u221e on all four boundaries.The stationary flow simulation of single chemical species transport is carried out in a two-dimensional, square domain with edge length 32\u03b2 for each of the c\u221e approach the theoretical 1/2. The power-law increase of the bubble radius with an exponent equals 1/2 is physically expected for homogeneous growth of stationary spherical bubble in a supersaturated solution where the volume fraction of the bubble is large [c\u221e increases, the bubble doubles in size, and the growth curve reaches the steady-state behavior faster. Because the growth rate coefficients closely match the experimentally observed and theoretically predicted growth rates, this indicates that the s-CLSVOF solver is accurately modeling the reactive interactions particularly for larger species concentration.The bubble growth behavior as a function of liquid concentration is presented in is large . As the 4.2.Next, we simulate some of the bubbles from \u22123, respectively. The boundary conditions of the species are set to zero gradient at all boundaries, with Hei = 33, MWi = 32 (g mol\u22121), and Comax value is reduced to 0.25 to take smaller time steps.The simulation properties are the same as those used to simulate the rising bubbles presented in The velocities of the rising bubbles normalized by the non-reactive terminal velocity are presented in 4.3.In the previous study, we demonstrated that including transport of species in the modelling of rising bubbles does impact the velocity of the bubble. In all cases, however, the shape of the bubble remained the same throughout the simulation. It is possible for bubbles to absorb enough dissolved gas for the shape of the bubble to change types relative to the non-reactive case. We perform a pair of studies here that demonstrate the potential for the bubble to change type as it grows or shrinks.RG = 0.0025 m and the bubble that shrinks starts with a radius of RS = 0.01 m. Because the shrinking bubble is larger than previous simulations the domain was expanded to be 6RS \u00d7 9RS with a mesh resolution of \u0394x/RS = 0.0072. The initial concentration of the dissolved gas in both the liquid and bubble and the boundary concentration are all 1 mol m\u22123.The simulations are similar to those performed in Bo = 12.3 and Mo = 0.10. The bubble position and shape at four time instances is presented in He = 33, the bubble grows as it rises. The evolution of the growing bubble is presented in We start by simulating a bubble rising in non-reactive flow with the initial flow parameters Bo = 196.9 and Mo = 0.10. First the larger bubble is simulated without transport of species, and the evolution of the bubble is presented in He = 1/33, which will result in the bubble shrinking. The evolution of the shrinking bubble is presented in The second case considers a bubble that is initially four times as large as the bubble used for the growth case, and in this case, we investigate the impact of a non-volume conserving species escaping from the bubble. The initial flow parameters are Bo and Re, which both depend on the bubble volume. The change in these properties over time is presented in Bo and Re number are initially the same for the simulation of the smaller bubble in the non-reactive (black line) and reactive flows (blue line). After the growing bubble begins to absorb the species the two lines diverge and the Bo of the growing bubble begins to increase as the bubble accelerates upwards. The gradual increase in both the Bo and Re causes the growing bubble to leave the ellipsoidal bubble regime and ultimately enter the skirted bubble regime based on the bubble map in Bo and Re but quickly diverge. In this case, the shrinking bubble in the reactive flow decreases in volume so the Bo decreases, and as the bubble is rising, it is decelerating from its initial maximum velocity resulting in the Re decreasing. This decay in both the Bo and Re causes the bubble ultimately to move into the spherical region but not before reaching a skirted form at the begging of the simulation. In both the growing and shrinking cases, the bubble map gives a good indication of the instantaneous shape of the bubble despite this map being based on terminal bubble shapes.The transitions between shapes can be quantitatively observed when plotting the time dependence of the bubble\u2019s 4.4.He = 33 as in the previous sections, which allows concentration from the layer to be absorbed into the bubble. The other two simulations have He = 0.01, which effectively prevents transport from the layer into the bubble. Because the species is volume-conserving, the bubbles do not change shape.We have demonstrated how accounting for transport of species into the bubble will cause the bubble velocity and shape to change. Next, we demonstrate that the absorption of material into the rising bubble also impacts the concentration field in the liquid and cause a significant difference in the distribution of the concentration. To do this, four simulations were run with a rising bubble passing through a layer of high concentration. The bubble and surrounding liquid both initially have zero concentration as depicted in He = 33 cases (c) and (e), but negligible transport is permitted in the He = 0.01 cases. After the bubble has passed through the layer, concentration fills the entirety of the He = 33 bubbles. At this point, the impact of the bubble absorbing concentration is apparent in the wake of the bubble. The concentration remains relatively high immediately behind the bubble in the He = 0.01 cases while it is depleted in the He = 33 case. This is further demonstrated in the last (top) row where the concentration in the He = 33 bubbles has become nearly uniform and there is limited concentration immediately below the bubble. Eventually the high concentration wake of the He = 0.01 case will detach from the bubble, and the impact of the bubble on the concentration field will stop. Because the He = 33 have absorbed a significant amount of the species, it will continue to slowly leak this concentration into the liquid as it rises. Ultimately this results in a greater impact on the concentration field.The evolution of the concentration layer for the four simulations is presented in 5.Because multiphase flows and in particular electrochemical systems featuring chemical reactions are pervasive, there is a need to better model transport of species across the interfaces of the different phases in order to best optimize these systems. We have presented a one-fluid approach based on the s-CLSVOF method to simulate bubbles in systems where the transport of species has the potential to change the volume of the bubble. The s-CLSVOF method takes advantage of the sharp interfaces produced by the level set method and the volume conservation of the volume of fluid approach. The incorporation of source terms into the governing equations allowed us to expand the scope of the method to model bubbles that grow or shrink. The approach was implemented in OpenFOAM v4.1 and verification studies were performed to ensure that both the hydrodynamics and the transport of species are being faithfully modeled.After describing the method and the algorithm, verification studies were presented to ensure the simulated bubble hydrodynamics matched results previously observed. A convergence study was performed on two-dimensional rising bubble simulations to determine the necessary grid resolution to achieve convergence for our system. Terminal velocities converged to less than 1% and a baseline for grid resolution was established. Mass conservation was next verified to within 1% for the two rising bubbles in both two and three-dimensional domains. Finally, the s-CLSVOF method was compared to experimental results  and fronBo and Re numbers reflects the change in expected shape, which is a new measure that can link the bubble volume change to the bubble shape transitions. Finally, we demonstrated that modeling the transport of species better captures the impact of absorption of concentration and better represents the concentration field in the wake of the bubble.Having established the accuracy of the hydrodynamics, we next studied the impact of incorporating transport of species in the simulations. For a stationary bubble, we verified that the steady-state growth rate approximately follows the 1/2 power law predicted by theory and measured experimentally. Next, we incorporated transport of species into simulations of different types of rising bubbles. When the transported species did not impact the volume of the bubble, the simulations accurately reflect the negligible change in terminal velocity to less than 1%. When the species does impact the bubble volume, the maximum velocity increase by between 3% and 24% depending on the surface area of the rising bubble. Then, a pair of comparison studies were performed to demonstrate that the incorporation of transport of species can cause the rising bubble to change shape from the one predicted in the non-reactive case. For one of the studies, the bubble grows and transitions from an ellipsoid to a skirted bubble, and in the other, the bubble changes from skirted to spherical as it shrinks. Observing the time dependence of the The presented solver in this paper helps to simulate and understand the fundamental aspect of bubble hydrodynamics in reactive flows. While, this s-CLSVOF solver can now model physicochemical properties of stationary and rising bubbles in reactive flows, there are multiple avenues for further research. The presented solver has been tested with structured and stationary meshes, but the libraries used are capable of incorporating both an unstructured and adaptive mesh. By incorporating these meshes into the solver, it would be possible to more efficiently model the rising bubble as only the region near the interface must be highly resolved. The enhanced efficiency would then make it more feasible to extend the simulations to larger three-dimensional domains. Another important advancement would be to investigate how the presence of multiple rising bubbles in a reactive system impacts the global absorption or release of species. This could be valuable in optimizing the release of chemicals via bubbles, which has application in water remediation and better understanding oil spill propagation . FinallySupplementary Material A"}
+{"text": "The MSNM@SFN was prepared by solvent evaporation method. The solubility, dissolution, and bioavailability of SFN in MSNM@SFN were also investigated. The anti-tumor activity of MSNM@SFN was evaluated in vitro and in vivo. Our results indicated that the solubility and dissolution of SFN in MSNM@SFN were significantly increased. The oral bioavailability of SFN in MSNM@SFN was greatly improved 7.7-fold compared with that in SFN suspension. The enhanced anti-tumor activity of MSNM@SFN was confirmed in vitro and in vivo experiments. This nanomatrix developed in this study could be a promising drug delivery platform for improving the therapeutic efficacy of poorly water-soluble drugs.In the present study, we select the Sylysia 350 (Sylysia) as mesoporous material, distearoylphosphatidylethanolamine-poly(ethylene glycol) Many strategies have been used to improve the solubility of poorly water-soluble drugs, including solid dispersions, soluble cyclodextrin complexes, self-emulsifying drug delivery systems, nanocrystals, ordered mesoporous silica, etc.  and downstream intracellular serine/threonine kinases of the RAF/MEK/ERK pathway  leading to a dual mechanism of action by targeting tumor cell proliferation and tumor angiogenesis  is an oral multi-kinase inhibitor. It was initially identified as a Raf-1 kinase inhibitor. Further The relative bioavailability of current marketed tablet formulation of SFN, compared to an oral solution, was 38\u201349% . The characteristics and the anti-tumor activity of MSNM@SFN were evaluated 2000 (DSPE-PEG) was provided by NOF Co. ORPORATION . Hoechst 332589 (blue) and FITC goat anti-rabbit secondary antibodies (1:1000) were supplied by Molecular Probes Inc. . Rabbit polyclonal CD31 antibody (10\u2009\u03bcg/ml) was obtained from Abcam Inc. . Leibovitz\u2019s L-15 cell culture media, penicillin\u2013streptomycin, fetal bovine serum (FBS), and L-glutamine were obtained from GIBCO, Invitrogen Corp. . All other chemicals were of analytical or HPLC grade.SFN was purchased from MERYER Chemical Technology Co. Ltd. . Mesoporous silica (Sylysia 350) was obtained from Fuji Silysia Chemicals . Hydroxy propyl methyl cellulose  was obtained from Alfa Aesar Chemical Co. Ltd. . Distearoylphosphatidylethanolamine-poly (ethylene glycol)The MDA-MB-231 cell lines (a human breast cancer cell) were obtained from the Chinese Academy of Sciences Cells Bank  and cultivated in Leibovitz\u2019s L-15 medium which was supplemented with 10% FBS , 100 units/ml penicillin, and 100\u2009\u03bcg/ml streptomycin. The cultures were maintained at 37\u2009\u00b0C, 95% relative humidity.Male Sprague-Dawley (SD) rats (190\u2013210\u2009g) and female BALB/C nude mice (18\u201320\u2009g) were obtained from the Experimental Animal Center of Peking University Health Science Center. All care and handling of the animals were performed with the approval of the Institutional Authority for Laboratory Animal Care of Peking University.The MSNM@SFN was prepared by solvent evaporation method. Briefly, a volume of 1\u2009ml SFN methanol solution (10\u2009mg/ml) was dropped into Sylysia dichloromethane suspension  in a round flask by sonication for 30\u2009min, and then evaporated into dryness under reduced pressure at 40\u2009\u00b0C. After that, a volume of 10\u2009ml HPMC dichloromethane solution (3\u2009mg/ml) was dropped into the mixtures and stirred for 24\u2009h and then evaporated into dryness under reduced pressure at 40\u2009\u00b0C. Subsequently, a volume of 3\u2009ml of DSPE-PEG dichloromethane solution (10\u2009mg/ml) was added, mixed by sonication and evaporated into dryness under reduced pressure at 40\u2009\u00b0C. Then, the residue was stored in a desiccator until further evaluation. The ratio of SFN:Sylysia:HPMC:DSPE-PEG was 1:3:3:3 (w/w/w/w).Physical mixtures were prepared by simple intensive mixing of SFN, Sylysia, HPMC and DSPE-PEG  for 3\u2009min in a mortar until a homogeneous mixture was obtained. The resulting mixtures were stored in a desiccator at room temperature until use.An excess amount of MSNM@SFN was added into 10\u2009ml distilled water in a glass test tube. Then, the capped tube was shaken at 37\u2009\u00b0C in a thermo statically controlled water bath for 48\u2009h. After equilibrium had been attained, the saturated solution immediately and rapidly filtered through a 0.45\u2009\u03bcm Millipore filter  and diluted with medium. Each diluted sample was analyzed by HPLC to determine the amount of dissolved SFN.The release of SFN from MSNM@SFN was investigated. Briefly, MSNM@SFN  was placed in 200\u2009ml release medium (pH 1.2 containing 1% (v/v) Tween 80 or PBS pH 6.8 containing 1% (v/v) Tween 80) at 37\u2009\u00b0C and 100\u2009rpm. Samples (0.5\u2009ml) were taken at predetermined time intervals from the release medium for 60\u2009min, and replaced by a similar volume of fresh medium. Each sample was passed through a 0.45\u2009\u03bcm millipore filter to obtain about 0.3\u2009ml subsequent filtrate. The concentration of SFN was determined by HPLC.Twelve male SD rats were randomly assigned to two groups (six rats per group). Group 1 received an oral administration of SFN suspension at a dose of 20\u2009mg/kg. Group 2 received an oral administration of MSNM@SFN at a dose of 20\u2009mg/kg SFN. After administration, approximate 0.5\u2009ml of blood was collected by heparinized tube from the orbit venous plexus of the rat at different time points. Plasma samples were harvested by immediately centrifugation at 6000\u2009g for 5\u2009min and stored at \u221220\u2009\u00b0C until analyzed by HPLC.Cmax was the observed value. The AUC was calculated using the linear trapezoidal method and was extrapolated to infinity (AUCinf) by dividing the last measured concentration by the terminal rate constant, lz, which was determined from the slope of the terminal phase of the plasma concentration-time curve. The terminal half-life (t1/2) was calculated as 0.693 divided by lz.Pharmacokinetic parameters were calculated from SFN concentration-time data using noncompartmental methods as implemented by the program WinNonlin version 3.1 . 4 cells per well) were seeded in a 96-well plate and grown in medium for 24\u2009h. Then, the cells were treated with cell culture medium containing the different amounts of MSNM@SFN for 48\u2009h at 37\u2009\u00b0C. The cell viability was determined by SRB assay. Absorbance was measured at 540\u2009nm using a 96-well plate reader . The survival percentages were calculated using the formula: survival %\u2009=\u2009(A540\u2009nm for the treated cells/A540\u2009nm for the control cells)\u2009\u00d7\u2009100%, where A540\u2009nm is the absorbance value. Each assay was carried out in triplicate. Finally, dose\u2013effect curves were constructed and IC50 values were calculated.The cytotoxicity of MSNM@SFN against MDA-MB-231 cells was measured by sulforhodamine B assay (SRB assay). Briefly, MDA-MB-231 cells . Then, mice were given an oral administration of physiological saline, SFN suspension or MSNM@SFN at a dose of 40\u2009mg/kg SFN every day. The tumor volume was measured every 2 days using a calculation based on the equation (a\u2009\u00d7\u2009b2)/2, where a and b are the length and width of the tumor, respectively. The animals were also weighed every 2 days during the experimental period. After 32 days, all the mice were sacrificed, and the tumor tissues were removed and weighed.The Tumor sections were used for TUNEL and CD31 straining experiments. TUNEL and CD31 staining was preformed according to the standard protocols provided by the manufacturers.g for 10\u2009min. A volume of 300\u2009\u03bcl of supernatant was collected, and dried under a gentle nitrogen gas at 40\u2009\u00b0C in a water bath. The residue was dissolved in 100\u2009\u03bcl mobile phase as blew by vortex. The supernatant (20\u2009\u03bcl) was injected into the HPLC system.SFN in plasma samples were extracted following the method. Briefly, plasma (100\u2009\u03bcl) was mixed with 420\u2009\u03bcl of methanol by a vortex mixer for 30\u2009s. The mixture was centrifuged at 3000\u2009The HPLC system was equipped with a Waters 2487 Dual \u03bb Absorbance Detector and 1525 pump . An Epic C-18 analytical column  was used and the wavelength was set at 265\u2009nm. The mobile phase, consisting of acetonitrile\u2013methanol\u20131% acetic acid , was delivered at a flow rate of 1\u2009ml/min.p\u2009<\u20090.05.All data are shown as mean\u2009\u00b1\u2009SD unless stated otherwise. One-way analysis of variance (ANOVA) was used to determine significance among groups, after which post-hoc tests with the Bonferroni correction were used for comparisons between individual groups. Statistical significance was established at Table S2, the solubility of SFN in pure SFN in distilled water was under the lower detection (less than 0.1\u2009\u03bcg/ml), however, the solubility of SFN in MSNM@SFN was 106.64\u2009\u03bcg/ml, significantly higher than that of pure SFN.As shown in Supplementary Supporting information and Supplementary Table S3, the solubility of SFN in the SFN-nanomatrix or SFN-HPMC solid dispersion in distilled water was under the lower detection (less than 0.1\u2009\u03bcg/ml) or 0.9\u2009\u03bcg/ml. The solubility of SFN in SFN-DSPE-PEG solid dispersion, SFN-Sylysia-HPMC nanomatrix or SFN-Sylysia-DSPE-PEG nanomatrix was significantly increased to 10\u201330\u2009\u03bcg/ml. However, the solubility of SFN in MSNM@SFN was significantly higher than that of other SFN nanomatrixes in distilled water. In addition, this system could also significantly enhance the solubility of the poor water soluble drug paclitaxel (PTX) and 7-ethyl-10-hydroxycamptothecin (SN38), as shown in Supporting information and Supplementary Tables S4 and S5.The influence of Sylysia, HPMC, or DSPE-PEG on SFN solubility was also investigated. As shown in Supporting information and Supplementary Figures S1-S3 and Supplementary Table S1.In addition, the characteristics of MSNM@SFN were evaluated, as shown in The release of SFN from MSNM@SFN is shown in Cmax of SFN in MSNM@SFN (2.62\u2009\u00b1\u20090.56\u2009\u03bcg/ml) was about 5.8-fold than that in SFN suspension (0.45\u2009\u00b1\u20090.08\u2009\u03bcg/ml) (p\u2009<\u20090.01). Also, the AUC0\u201324 of SFN in MSNM@SFN (43.29\u2009\u00b1\u200910.41\u2009h \u03bcg/ml) was about 7.7-fold than that in SFN suspension (5.61\u2009\u00b1\u20092.43\u2009h \u03bcg/ml) (p\u2009<\u20090.01). There was no significant difference in Tmax, MRT0\u201324\u2009h and t1/2 of SFN between the SFN suspension group and the MSNM@SFN group.The mean SFN plasma concentration-time profiles after oral administration of a single dose of SFN suspension or MSNM@SFN to rats are depicted in in vitro cytotoxicity of MSNM@SFN was evaluated in the MDA-MB-231 cell lines. The calculated IC50 values are displayed in The in vivo anti-tumor activity of the MSNM@SFN was investigated in MDA-MB-231 tumor-bearing nude mice. As shown in p\u2009<\u20090.01). SFN suspension has a slight anti-tumor activity which has no significant compared with control group. The anti-tumor activity of the MSNM@SFN was significantly higher than that of SFN suspension and control groups (p\u2009<\u20090.01).The 3, respectively, compared with 2919\u2009\u00b1\u2009735\u2009mm3 in the control group. Corresponding tumor growth inhibition in the SFN suspension and MSNM@SFN groups was 38.9% and 90.2%, respectively.The mean tumor sizes at day 32 after implantation in the SFN suspension and MSNM@SFN groups were 1783\u2009\u00b1\u2009706 and 286\u2009\u00b1\u200988\u2009mmThe typical tumors of control, SFN suspension and MSNM@SFN group at day 32 were shown in We also evaluated the effect of tumor cell apoptosis by TUNEL analysis staining of tumor tissue sections. As shown in Figure 4.p\u2009<\u20090.01 versus the physiological saline treatment group as a control. $$p\u2009<\u20090.01 versus the SFN suspension treatment group.Effects of MSNM@SFN on apoptosis and anti-angiogenesis in MDA-MB-231 tumors. A: TUNEL staining of the paraffin-embedded tumors was performed according to the standard protocols provided by the manufacturers. Tumor apoptosis cells were detected by TUNEL. DNA strand breaks were labeled (green) and nuclei were stained with Hoechst 332589 (blue). Apoptotic cells exhibited a turquoise color as a result of color merging of these two labels. B: The fluorescence area of each group was used for the statistical analysis of apoptosis activity. C: Frozen tumor sections were examined by confocal microscopy. Blood vessels were labeled with anti-CD31 (green), and nuclei were stained with DAPI (blue). D: The fluorescence area of each group was used for the statistical analysis of apoptosis activity. **in vivo, the microvessel density was assessed by immunohistochemistry. As shown in To evaluate the anti-angiogenic activity of MSNM@SFN treatment SFN is slightly absorbed in the GI due to its poor solubility in water. It has been reported that mesoporous materials, such as, mesoporous silica or mesoporous carbon, could be used as poorly water-soluble drug carriers  and 7-ethyl-10-hydroxycamptothecin (SN38), indicating that this nanomatrix could be a promising drug delivery platform for improving the oral bioavailability and therapeutic efficacy of poorly water-soluble drugs.in vitro and in vivo experiments. This nanomatrix developed in this study could be a promising drug delivery platform for improving the oral bioavailability and therapeutic efficacy of poorly water-soluble drugs.In the present study, we select Sylysia 350 as mesoporous material, DSPE-PEG as an absorption enhancer and HPMC as a crystallization inhibitor to prepare MSNM@SFN for improving the anti-tumor activity of SFN. Our results indicated that the SFN, which dispersed within the Sylysia pore or absorbed on the Sylysia surface, in MSNM@SFN was amorphous form. The solubility, dissolution, and oral bioavailability of SFN in MSNM@SFN were significantly increased. The enhanced anti-tumor activity of MSNM@SFN was confirmed Click here for additional data file."}
+{"text": "N-acetylcysteine (SFN-NAC), a major sulforaphane metabolite, has presented similar pharmacological activities to those of SFN, it is crucial to simultaneously analyze the pharmacokinetics and activities of SFN and SFN-NAC, to comprehensively elucidate the efficacy of SFN-containing products. Accordingly, the anti-pulmonary fibrotic effects of SFN and SFN-NAC were assessed, with simultaneous evaluation of permeability, metabolic stability, and in vivo pharmacokinetics. Both SFN and SFN-NAC decreased the levels of transforming growth factor-\u03b21-induced fibronectin, alpha-smooth muscle actin, and collagen, which are major mediators of fibrosis, in MRC-5 fibroblast cells. Regarding pharmacokinetics, SFN and SFN-NAC were metabolically unstable, especially in the plasma. SFN-NAC degraded considerably faster than SFN in plasma, with SFN being formed from SFN-NAC. In rats, SFN and SFN-NAC showed a similar clearance when administered intravenously; however, SFN showed markedly superior absorption when administered orally. Although the plasma SFN-NAC concentration was low owing to poor absorption following oral administration, SFN-NAC was converted to SFN in vivo, as in plasma. Collectively, these data suggest that SFN-NAC could benefit a prodrug formulation strategy, possibly avoiding the gastrointestinal side effects of SFN, and with improved SFN-NAC absorption.Sulforaphane (SFN), belonging to the isothiocyanate family, has received attention owing to its beneficial activities, including chemopreventive and antifibrotic effects. As sulforaphane  Pulmonary fibrosis (PF) is pathologically characterized by accumulation of fibroblastic foci, excessive matrix deposition, and aberrant remodeling that result in impaired gas exchange, diminished lung capacity, and eventually death ,2. FibroN-acetylcysteine (SFN-NAC) [Isothiocyanates are sulfur-containing phytochemicals with the general formula R-N=C=S. Sulforaphane , known to belong to this group of chemicals, is mainly present in broccoli as a glucosinolate conjugate. On the crushing and chewing of vegetables, the glucosinolate precursor of SFN is metabolized to SFN via enzymatic hydrolysis by myrosinase . PreviouSFN-NAC) ,14. SFN SFN-NAC) ,16. FurtSFN-NAC) ,18,19. TSeveral studies have reported the pharmacokinetics of SFN ,21,22. SThe structures of SFN and SFN-NAC are shown in Human lung fibroblast cells (MRC-5) were purchased from the Korean Cell Line Bank and cultured in Dulbecco\u2019s modified Eagle\u2019s medium  supplemented with 100 \u03bcg/mL streptomycin (WelGene), 100 U/mL penicillin (WelGene), and 10% fetal bovine serum (WelGene). Then, cells were treated with different concentrations of SFN (10 and 20 \u03bcM) and SFN-NAC (10 and 20 \u03bcM) for the indicated time periods. The cells were also treated with 0.1% dimethyl sulfoxide (DMSO) as a vehicle control.In brief, cells were seeded into 96-well plates and exposed to various concentrations of SFN and SFN-NAC for 24\u201372 h prior to the addition of 10 \u03bcL MTT solution -2,5-diphenyltetrazolium bromide; 5 mg/mL in DPBS) to each well. After 4 h of incubation at 37 \u00b0C, the medium was gently removed, and 100 \u03bcL DMSO was added. The absorbance was measured at 550 nm using a microplate reader .Total RNA was extracted using RNAiso Plus reagent , and cDNA was synthesized from total RNA using a Prime Script RT reagent kit (Takara Bio). qRT-PCR reactions were performed using a SYBR Premix kit (Takara Bio) and run on a CFX96 detection system . GAPDH was used as an internal control, and all experiments were performed in triplicate. The expression levels were calculated from the PCR profiles of each sample using the threshold cycle (Ct), corresponding to the cycle with a statistically significant increase in fluorescence. The Ct values for the endogenous control (GAPDH) were subtracted from those of the corresponding sample to correct for differences in the amount of total cDNA in the starting reaction.The primers used for qRT-PCR were as follows: 5\u2032-CCATCGCAAACCGCTGCCAT-3\u2032 (FN-F) and 5\u2032-AACACTTCTCAGCTATGGGCTT-3\u2032 (FN-R); 5\u2032-ACTGAGCGTGGCTATTCCTCCGTT-3\u2032 (\u03b1-SMA-F) and 5\u2032-GCAGTGGCCATCTCATTTTCA-3\u2032 (\u03b1-SMA-R); 5\u2032-TGGCCAAGAAGACATCCCTGAAGT-3\u2032 (COL1A1-F) and 5\u2032-ACATCAGGTTTCCACGTCTCACCA-3\u2032 (COL1A1-R); 5\u2032-TGTGGGCCAGCCAGGCATTG-3\u2032 (COL4A1-F) and 5\u2032-CAGGGGGTCCGATCGCTCCA-3\u2032 (COL4A1-R); 5\u2032-TTGGTATCGTGGAAGGACTCA-3\u2032 (GAPDH-F) 5\u2032-TGTCATCATATTTGGCAGGTTT-3\u2032 (GAPDH-R).In brief, cells were lysed in radioimmunoprecipitation assay (RIPA) buffer  with 1X protease inhibitors. Protein concentration was determined using a Pierce BCA protein assay . Then, protein was separated by 8\u201310% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a PVDF membrane . After blocking with 5% non-fat milk, the membrane was incubated with primary antibodies. The primary antibodies used were anti-fibronectin , anti-type 1 collagen (COL1A1) , anti-type 4 collagen (COL4A1) , anti-alpha-SMA , and anti-GAPDH . The membrane was washed and then incubated with horseradish peroxidase (HRP)-conjugated anti-mouse  or anti-rabbit secondary antibodies . Antibody-bound protein was detected using a Western BLoT Hyper HRP Substrate kit . Band intensities were normalized to those of GAPDH using the ImageJ software . All experiments were independently performed four times.The stability of SFN and SFN-NAC was investigated in human and rat plasma. Test compounds (1 \u03bcM) were incubated with rat and human plasma. The amount remaining (%) was determined at 0, 15, 30, 60, 120, 180, and 240 min using liquid chromatography-tandem mass spectrometry (LC-MS/MS).The metabolic stability of SFN and SFN-NAC was evaluated in human and rat liver microsomes as previously reported , with mi4 cells/cm2. Next, to measure the absorptive transport of drugs, the inserts were moved to a well containing fresh transport media, replaced every 30 min for 2 h. The cumulative amount on the basolateral side was calculated following sample analysis using LC-MS/MS. Finally, the apparent permeability of the apical-to-basolateral side was calculated by dQ/dt, the rate of appearance of the drug on the receiver side, divided by A \u00d7 60 \u00d7 Co, where A is the surface area of the Caco-2 cell monolayer (1.12 cm2) and Co is the loading concentration of the drug on the apical side.Apparent permeability in the direction of absorption  was determined as previously reported . BrieflyFor SFN and SFN-NAC, pharmacokinetics was assessed in male Sprague-Dawley rats  obtained from Orient Bio Inc. . Rats were maintained under a standard 12:12 h light/dark cycle for 1 week. All experiments complied with the guidelines for animal care and use issued by Gachon University, and experimental animal protocols were reviewed and approved by the Animal Care and Use Committee of Gachon University .n = 4). Blood samples (100 \u03bcL) were collected from the femoral artery 1, 5, 15, 30, 45, 60, 120, 180, and 240 min after administration, then immediately centrifuged at 14,000 rpm for 15 min at 4 \u00b0C, and the plasma obtained was stored at \u221270 \u00b0C prior to LC-MS/MS analysis. For the oral study, the femoral vein was cannulated for blood sampling, followed by administration of SFN  or SFN-NAC (0.5 mg/kg) using oral gavage. Blood samples (100 \u03bcL) were collected from the femoral artery 15, 30, 45, 60, 120, 180, 240, 480, and 1440 min after administration and processed in the same way as in the intravenous study.For the intravenous study, overnight fasted rats were intramuscularly anesthetized using tiletamine/zolazepam  (20 mg/kg). Then, the femoral vein and artery were surgically cannulated with polyethylene tubing  for intravenous administration of test compounds and blood sampling, respectively. The cannula was flushed with 20 IU/mL heparinized saline to prevent clotting. After the rats had recovered from anesthesia, SFN or SFN-NAC was injected intravenously at 0.1 mg/kg (inf) or to the last measured time (AUClast), total body clearance (CL), elimination half-life (t1/2), volume of distribution at steady-state (Vss), and mean residence time (MRT). The AUC was calculated using the trapezoidal rule extrapolation method. The maximum plasma concentration (Cmax) and time to reach Cmax (Tmax) were directly determined from the experimental data, and the area from the last datum point to time infinity  was estimated by dividing the last measured plasma concentration by the terminal-phase rate constant. The absolute bioavailability (F%) was calculated as the dose-normalized ratio of the AUC after oral and intravenous administration.Noncompartmental analysis of SFN and SFN-NAC was performed using the WinNonlin program  to calculate the following pharmacokinetic parameters: area under the plasma concentration-time curve from time zero to infinity . Data acquisition and processing were performed using the MassHunter software . The limit of quantitation was 0.2 ng/mL for SFN and 0.5 ng/mL for SFN-NAC.In the present study, sample concentrations from in vitro or in vivo pharmacokinetic studies were determined using LC-MS/MS in positive electrospray ionization mode. The LC-MS/MS system consisted of an Agilent 6490 QQQ with a 1290 Infinity HPLC system . To separate the analytes, SFN and SFN-NAC, from endogenous substances, a SynergiTM 4 \u03bcm polar RP 80A column  was employed. The LC conditions were as follows: mobile phase, 0.1% formic acid and acetonitrile (50:50); flow rate, 0.2 mL/min; injection volume, 2 \u03bcL. Multiple reaction monitoring was achieved with p-values less than 0.05 were considered statistically significant.Data are expressed as mean \u00b1 standard deviation (SD) of at least three independent experiments. For statistical analysis, one-way analysis of variance (ANOVA) with post-hoc Dunnett\u2019s test was performed using GraphPad Prism software . We evaluated the effect of SFN and SFN-NAC on lung cell viability. Accordingly, MRC-5 cells were incubated with different concentrations of SFN and SFN-NAC (10 and 20 \u00b5M). At maximal SFN and SFN-NAC concentrations, MRC-5 cells showed no cytotoxicity . The depSFN levels were reduced in rat and human plasma, presenting mean half-lives of 76.0 and 57.4 min, respectively a,b. The After liver microsomal incubation for 240 min, the decrease in SFN concentration was substantially more gradual when compared with that in plasma, with 83.7% and 70.3% remaining in rat and human microsomes, respectively c,d. Simiapp,A-to-B) of SFN were 1.33 \u00b1 0.01 \u00d7 10\u22125 cm/s, whereas the Papp,A-to-B of SFN-NAC was much lower, 0.16 \u00b1 0.01 \u00d7 10\u22126 cm/s, suggesting a much higher intestinal absorption of SFN compared to SFN-NAC in terms of permeability.The apical-to-basolateral transport of SFN and SFN-NAC across Caco-2 monolayers was investigated . Comparemax ranged between 5\u201330 min for the three different doses. The increase in the oral AUC of SFN was more than dose-proportional, indicating non-linear pharmacokinetics of SFN even in the low dose range  was lower than that of SFN . This coSFN and SFN metabolites are known to possess various pharmacological activities. In the present study, our findings first revealed the antifibrotic effects of SFN and SFN-NAC, the major metabolite of SFN. Furthermore, the pharmacokinetic profiles of SFN and SFN-NAC were evaluated to confirm their potential as therapeutic agents for pulmonary fibrosis.In the present study, we observed that SFN and SFN-NAC inhibited TGF-\u03b21-induced fibrosis in pulmonary fibroblasts. Both SFN and SFN-NAC significantly inhibited the overexpression of fibrosis-related proteins, including FN, \u03b1-SMA, COL1A1, and COL4A1, induced by TGF-\u03b21 in fibroblast cells without observed cytotoxicity . TGF-\u03b2, Therefore, to accurately understand the pharmacological effects of SFN and SFN-NAC, we evaluated the pharmacokinetics of both SFN and SFN-NAC. Both SFN and SFN-NAC were stable during liver metabolism, but their concentration rapidly decreased in the plasma, indicating that the rapid clearance of SFN might be due to plasma metabolism. The volume of distribution of SFN was moderate, implying that SFN could be distributed to target tissues such as the lung and liver to exhibit antifibrotic effects. Following oral administration, the bioavailability was over 70%; sufficient for development as a therapeutic agent. As large variabilities in pharmacokinetic parameters of SFN have been reported in previous studies, we evaluated the pharmacokinetics of SFN at low doses, ranging from 0.1 to 0.5 mg/kg. The pharmacokinetic parameters of SFN presented linear kinetics up to 0.2 mg/kg; however, at 0.5 mg/kg, the drug exposure exceeded the proportional dose , which cDespite its various therapeutic benefits, SFN presents several problems that need to be resolved prior to oral administration. Broccoli sprout extracts containing glucosinolates (the precursor of SFN) and SFN have shown good tolerability and no significant side effects in humans . HoweverThe anti-pulmonary fibrotic effects, as well as the in vitro and in vivo pharmacokinetics of SFN and SFN-NAC, a major metabolite of SFN, were evaluated to elucidate the effects of SFN-containing products. Our findings revealed that SFN and SFN-NAC present similar antifibrotic activities. Furthermore, as SFN-NAC is reconverted to SFN in the body, SFN-NAC can be potentially developed as an alternative to overcome the gastrointestinal side effects associated with SFN. If the low absorption of SFN-NAC can be improved by chemical modification in the future, SFN-NAC could be a promising therapeutic agent to achieve a prolonged duration of action, with reduced side effects of SFN and its metabolites."}
+{"text": "Reprogramming of metabolic priorities promotes tumor progression. Our understanding of the Warburg effect, based on studies of cultured cancer cells, has evolved to a more complex understanding of tumor metabolism within an ecosystem that provides and catabolizes diverse nutrients provided by the local tumor microenvironment. Recent studies have illustrated that heterogeneous metabolic changes occur at the level of tumor type, tumor subtype, within the tumor itself, and within the tumor microenvironment. Thus, altered metabolism occurs in cancer cells and in the tumor microenvironment . Herein we describe how these growth advantages are obtained through either \u201cconvergent\u201d genetic changes, in which common metabolic properties are induced as a final common pathway induced by diverse oncogene factors, or \u201cdivergent\u201d genetic changes, in which distinct factors lead to subtype-selective phenotypes and thereby tumor heterogeneity. Metabolic heterogeneity allows subtyping of cancers and further metabolic heterogeneity occurs within the same tumor mass thought of as \u201cmicroenvironmental metabolic nesting\u201d. Furthermore, recent findings show that mutations of metabolic genes arise in the majority of tumors providing an opportunity for the development of more robust metabolic models of an individual patient\u2019s tumor. The focus of this review is on the mechanisms governing this metabolic heterogeneity in breast cancer. Breast Cancer. Breast cancer is the most common non-dermatological malignancy in women representing approximately one third of all malignancies diagnosed in US women , 2. In a+\u00a0status, better outcome and activation of the Wnt pathway -2HG , 39. In Warburg observed that cancer cells primarily supply energy from glucose through avid glycolysis, even in aerobic conditions where more efficient mitochondrial oxidative phosphorylation (OXPHOS) was potentially available. Per molecule of glucose, glycolysis followed by OXPHOS generates up to 18 times more adenosine 5\u00b4-triphosphate (ATP) than glycolysis alone . The Warc-myc, k-Ras, mutant p53, cyclin D1 and the \u03b2-catenin/TCF signaling pathway augment the Warburg effect , as well as mitochondrial and oxygen sensing pathways . FurtherLDH-A, LDH-B), the hexokinase 2 isoform (HK2), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the pyruvate kinase (PK) isoform M2 (PKM2), each of which contribute to the Warburg effect , increases the LDH-A to LDH-B ratio  (via coactivator-associated arginine methyltransferase 1 (CARM1)-mediated methylation also enhances aerobic glycolysis , lactate dehydrogenase genes (g effect . DNA hyppression . Increaspression . DNA hyp-B ratio . Increas-B ratio . LDH-A acontinue . Aerobicpromoter  and hypoPK gene) . GAPDH uycolysis . The pyrycolysis \u201380. Bindycolysis .Mieap promoter reduces Mieap abundance, leading to ROS accumulation and mitochondrial destruction , the mitochondrial quality control protein Mieap, and pyruvate dehydrogenase (PDH) kinase 4 (PDK4), causes mitochondrial dysfunction in cancer cells, triggering the Warburg effect . Methylatruction \u201385.DNA methylation changes affect activity of nuclear factor erythroid 2-related factor 2 (NRF2), which in turn regulates expression of transketolase (TKT) like-1 gene (TKT L1), and the fructose-1,6-bisphosphate isoform 1 (FBP1) . MethylaFBP1 promoter methylation  gene  gene .via AMPK  , participate in breast cancer onset and progression and contribute to the TME metabolic ecosystem to enhance tumor growth. TAMs generally show increased aerobic glycolysis but may use OXPHOS to generate energy. Bidirectional metabolic feedback occurs between macrophages and breast cancer cells in which M2 like macrophages induce sodium/glucose cotransporter 1 (SGLT1) in breast cancer cells and SGLT1 enhances lactic acid secretion to promote M2 macrophage polarization  CCL5 actvia AMPK . Human ms (PDAC) . The pros (PDAC) .de novo\u00a0differentiation of MSCs to CAF. Thus, in PDAC, a tumor-mediated lactate flux is associated with widespread epigenomic reprogramming that is seen during CAF formation.Metabolic substrates from the tumor microenvironment in turn regulate methylation of stromal CAFs . The losin vivo  pathway. mTOR governs several important cellular functions including cellular growth, survival, protein translation and autophagy. mTOR upregulates glutaminase (GLS) thereby increasing the conversion of glutamine to glutamate. The consequent increased production of \u03b1-ketoglutarate is then used within the TCA cycle . Restraic-myc governs glutamine homeostasis, with direct effects and indirect actions on cellular uptake via transporters ASCT2 (SLC1AS) ((SLC1AS) . This en(SLC1AS)  and inco(SLC1AS) . The dep(SLC1AS) \u2013133.Continued tumor growth requires the development of mechanisms to enhance access to diverse intracellular and extracellular nutrients , 135. Tuvia cyclin D1-Cdk4/Cdk6 phosphorylation of LKB1, thereby inhibiting mitochondrial function and promoting glycolysis  biosynthesis  provides a rich source of distinct nutrients. Distinct cell types within the TME (cancer associated fibroblasts (CAFs), adipocytes, immune cells, tissue plasma/interstitial fluid) provide distinct nutrients to fuel tumor metabolism Figure\u00a03ynthesis , acetateynthesis , scavengogenesis , and macogenesis , 150. Maogenesis , 151 andogenesis ]. Althouogenesis . Desmoplogenesis .The concept of scavenging alternative substrates to fuel tumor growth is illustrated by the \u201cReverse Warburg Effect\u201d that was initially characterized in breast cancer cells , 47, 48.The molecular drivers governing the CAF metabolic phenotype may involve downregulation of caveolin-1 (Cav-1) . Low expAdditional substrates participating in tumor stroma metabolic cross talk have been described in pancreatic cancer for the use of branched-chain amino acids (BCAA) . PancreaTumor-associated macrophages (TAMs) and cancer cells co-exist in the context of a complex, bidirectional metabolic relationship. M1-like macrophages displaying enhanced glycolysis and reduced oxidative phosphorylation in contrast with more oxidative M2-like macrophages . TAMs exIn silico deconvolution estimates of cell type composition and molecular profiles of constituent cell types in the context of breast tumors applied to the TCGA data revealed metabolic coupling occurs between the epithelial and stroma cell types  activity is essential for breast cancer cell survival . Acetyl \u03b3), a key regulator of lipogenesis, is altered in breast cancer. PPAR\u03b3 expression is a positive prognostic factor in luminal and ductal breast cancer , a central transcription factor regulating lipid metabolism. SREBP1m targets include gene governing lipogenesis , gluconeogenesis and the pentose phosphate pathway . Consequences included reduced D loop transcriptional activity in mitochondrial DNA. Deletion of the function , 208. Sefunction . Thirdlyactivity , which iactivity . Collect3K/mTOR), or tumor suppressors (p53) (IDH1 and IDH2), fumarate hydrase (FH) and isoforms of succinate dehydrogenase (SDH) are found in a variety of human cancers  . Additiors (p53) \u2013215, and cancers . IDH1 an cancers Figure\u00a02 cancers .IDH1 and IDH2 mutations, there is reduced production of \u03b1KG from isocitrate. \u03b1KG is a rate-limiting substrate for \u03b1-ketoglutarate-dependent dioxygenases that catalyze demethylation of DNA, histones and mRNA, and regulate HIF1\u03b1 . 2HG can then suppress activity in \u03b1-ketoglutarate-dependent dioxygenases through competition with \u03b1KG. Inhibition of some dioxygenases by succinate or fumarate has also been rationalized as an effector pathway for loss of function of mutations in fumarate hydratase (FH), succinate dehydrogenase  had weak to non-significant associations with profiled metabolites. Thirdly, that DNA hypermethylation influence metabolite production via suppressing degradation pathways. For example, methylation of SLC25A20 (carnitine/acylcarnitine translocase) in breast cancer cell lines led to accumulation of long chain acylcarnitine species. Fourthly, DNA hypermethylation regulates metabolite levels by limiting components of biosynthetic pathways. For example, hypermethylation of the PYCR gene, an enzyme that converts pyrroline-5-carboxylate to proline, was associated with reduced proline levels.Recent studies of over 900 cell lines revealed diverse metabolic changes with associated potential therapeutic potential. Hypermethylation of the gene encoding asparagine synthetase showed sensitivity to L-asparaginase . A comprCarcinoma cells undergo an epithelial-to-mesenchymal transition (EMT) although the transition is considered a spectrum of changes, rather than a binary event . EMT-indMost BCa cells express both epithelial and mesenchymal traits. When epithelial cancer cells lose their epithelial features and acquire a mesenchymal phenotype this promotes motility and invasion through loss of cell polarity, disruption E-cadherin/\u03b2-catenin leading to loss of cell-cell adhesion involved in cancer invasion and metastasis . This E/CIP1  , consistvs. the trailing edge of an invasive tumors, more accurate mathematical predictive models are required to provide precise metabolic therapeutics.Mathematical modeling approaches have been developed to understand the metabolic impact of altered gene expression on tumor metabolism. Modeling analysis of epithelial-to-mesenchymal transition has been conducted, in which metabolic pathway signatures have been used to quantify the activities of glycolysis, and the citric acid cycle with corresponding analysis of enzymes governing the metabolic processes in tumor samples , 244. BeLinking the complex patterns of metabolic genetic alterations that occurs within a tumor to therapeutic co-extinction paradigms for individualized patient treatment remains a key challenge for future research.All authors listed have made a substantial, direct, and intellectual contribution to the work, and approved it for publication.This work was supported in part by NIH R01CA132115, R21CA235139-01 RP and a Breakthrough Breast Cancer Research Program grant award from Department of Defense (W81XWH1810605) RP.RGP holds ownership interests in the companies ProstaGene, CytoDyn, LightSeed, Inc., and EcoGenome. RGP holds ownership interests  of several patents and submitted patent applications.The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "B cells are central to the pathogenesis of multiple autoimmune diseases, through antigen presentation, cytokine secretion, and the production of autoantibodies. During development and differentiation, B cells undergo drastic changes in their physiology. It is emerging that these are accompanied by equally significant shifts in metabolic phenotype, which may themselves also drive and enforce the functional properties of the cell. The dysfunction of B cells during autoimmunity is characterised by the breaching of tolerogenic checkpoints, and there is developing evidence that the metabolic state of B cells may contribute to this. Determining the metabolic phenotype of B cells in autoimmunity is an area of active study, and is important because intervention by metabolism-altering therapeutic approaches may represent an attractive treatment target. Additphocytes .The causes of B cell dysfunction in autoimmunity remain incompletely defined. Metabolism, although a well\u2013established regulator of cellular activity, has only relatively recently been appreciated as a determinant of B cell function in health and disease. Physiologically, metabolism enables proper B cell development, differentiation and antibody secretion , 15. Unsregs where possible.In this review, we describe B cell metabolism and autophagy in health, highlighting their roles in immune homeostasis. We then discuss the metabolic and autophagic abnormalities seen in autoimmune B cells, and how these may promote self\u2013destructive responses. Finally, the potential of B cell metabolism and autophagy as therapeutic targets in autoimmunity will be explored. This review focuses primarily on conventional B2 cells, which are relatively well defined metabolically, although comparisons are made to B1 cells and BThe development of conventional B2 B cells must generate a vast and hugely diverse repertoire of cells capable of antibody secretion, whilst purging cells with self\u2013reactive antigen specificities. Moreover, rapid growth and proliferation must be achieved in the metabolically challenging environment of the bone marrow, requiring the careful balancing of anabolic and catabolic signalling. The former is largely mediated by c\u2013Myc and mitochondrial target of rapamycin complex (mTORC) signalling, which fuel protein synthesis and cell growth by upregulating glycolysis and oxidative phosphorylation (OXPHOS) , 27, 28.While mTORC signalling is important during B cell development, excessive anabolic activity is detrimental. Indeed, B cell development is compromised at the large pre\u2013B cell stage following the deletion of Fnip1 . Fnip1 iThe large pre\u2013B cell stage, during which the pre\u2013BCR is expressed on the cell surface and tested for affinity towards self\u2013antigens in the bone marrow, represents both an autoimmune checkpoint and a period of metabolic vulnerability . AlthougPAX5 and IKZF1 are commonly seen in acute lymphoblastic leukaemia, suggesting that their expression may confer a selective disadvantage  receptor, both of which activate PI3K  . Howeveriability . Excessiiability , 62.via the hexosamine pathway, although glycolysis can supplement ATP production  cells. B cells with high antigen affinities are more likely to receive sufficient T cell help, enabling them to migrate to the dark zone, where they undergo clonal expansion and somatic hypermutation. To fuel this proliferation, light zone B cells, known as centrocytes, adopt an anabolic phenotype mediated by mTORC1  of secondary lymphoid organs Figure 2y mTORC1 . Centrocogenesis . mTORC1 ogenesis . The actogenesis . Upstreatabolism . Recentltabolism . Despitetabolism , 69. Wittabolism , 69. Inttabolism . Over titabolism . Indeed,tabolism .Little is known about the metabolism of memory B cells themselves, although they are thought to be relatively quiescent metabolically. Unlike na\u00efve B cells and PCs, memory cells are capable of BAFF\u2013independent survival . AMPK apregs has been shown to depend on both cholesterol metabolism and HIF\u20131\u03b1  antigens, costimulation requires antigen presentation on class II major histocompatibility complexes (MHC\u2013II) to cognate T cells. Several early studies demonstrated that the ability of B cells to present antigens on MHC\u2013II was altered following pharmacological inhibition of autophagy or its induction through starvation \u201380. Of nFH cell\u2013derived costimulation \u2013\u03baB2 signalling , 96. In Another important mechanism underlying B cell anergy is the suppression of PI3K signalling by PTEN, Src homology region 2 domain\u2013containing phosphatase (SHP)\u20131 and Src homology 2 domain\u2013containing inositol polyphosphate 5\u2013phosphatase (SHIP)\u20131 , 98\u2013100.Downstream of PI3K, hyperactive B cell mTORC1 signalling is seen in autoimmunity. Given its roles in B cell development, GC reactions and PC function, an association between altered mTORC signalling and autoimmunity is perhaps unsurprising , 64. mTOregs and memory B cells in both health and disease. Given the different phenotypes and functions of different B cells, it is likely that they affected differently by metabolic disturbances. Finally, most research has focussed on B cells in SLE, with the dysfunction of B metabolism in other diseases mediated by autoantibodies and B cell cytokines warranting further investigation.The precise metabolic consequences of dysregulated B cell signalling networks in autoimmunity have not been well defined. However, there is clear evidence to suggest that the tight metabolic control of B cell function is lost in autoimmunity and that this has consequences for pathophysiology. More work is needed to directly investigate the nature and consequences of metabolic dysregulation seen in autoimmune B cells. Furthermore, a more complete characterisation of metabolism in different B cell subsets is needed. Comparatively little is known about the metabolism of B1 cells, BAtg5 gene and Prdm1\u2013Atg5 intergenic region to the development of SLE and, in a European population, to RA  presentation of myelin oligodendrocyte glycoprotein (MOG)\u2013derived peptides , 117\u2013119Tlr7 or Tlr9 generates autoreactive PCs and triggers lupus\u2013like disease in mice  all target broadly active metabolic processes. This observation suggests that tolerability of metabolic inhibition be better than supposed. As always when treating autoimmunity, excessive immunosuppression must be avoided, and the risk of infection will remain an important consideration. Finally, the extent to which specific metabolic pathways are disturbed in patients with autoimmune disease is likely to vary significantly between individuals. The use of metabolomic biomarkers may be needed to identify patients who are likely to respond to treatments targeting metabolism.Although metabolism has emerged relatively recently as a regulator of immunological function, it is clear that it has far\u2013reaching consequences in both the physiological state and autoimmunity. Arguably, efforts have been made to exploit B cell metabolism and autophagy therapeutically before these processes have been well characterised. Nevertheless, it appears that they do offer real translational potential. While much focus to date has been rightly placed on understanding the role of metabolic regulators such as mTORC1 and AMPK, metabolism itself, as well as its impact on B cell function, require greater investigation. Finally, it is imperative that metabolic interactions between B cells and other leukocyte populations are explored. While this review has focussed only on B cells, exploiting the full therapeutic potential of B cell metabolism in autoimmune diseases will require it to be understood within the context of wider immune dysfunction.IR wrote and edited the manuscript AC supervised and edited the manuscript. All authors contributed to the article and approved the submitted version.AC is supported by a Wellcome Trust award (211072/Z/18/Z).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Dear Editor,acAN). Moreover, this discriminability of food-vs-neutral representations in the recAN sample does not statistically differ from that of an age-matched sample of healthy controls (HCrecAN). The authors take these findings to suggest that cortical representations of food are altered in acAN compared to recAN, which may be indicative of altered attentional mechanisms in the presence of food in AN patients.In a recent article, Boehm et al. combine functional magnetic resonance imaging (fMRI) with classification-based multivariate pattern analysis  to invesSuch a pattern of results may also be useful as a prognostic marker, based on the authors\u2019 regression analysis after a one-year assessment following treatment, thereby offering fMRI and cognitive neuroscience methods an additional avenue to inform the clinical domain. As such, this study is a great example of investigating cognitive processes with functional neuroimaging in a patient population and should act as a stepping stone upon which future studies can build. To this end, there are three aspects of the article that merit further discussion: caveats in the statistical inference, complementing the classification analysis with representational similarity analysis , and theacAN, and that this difference in classification performance diminishes when contrasting recAN with HCrecAN. However, the contrast that warrants the most meaningful interpretation of the results (given the scope of the study) is the interaction of these two contrasts . Reporting evidence for a difference between one set of groups  and a lack of evidence for a difference between the other set of groups  merely compares their effect sizes but does not directly test for the difference between the group differences [acAN\u2009>\u2009HCrecAN] would help to rule out the between-groups age-confound mentioned in the limitations section, as the authors would demonstrate that age alone is insufficient to explain potential differences between acAN and recAN. Note that this criticism does not imply that the authors\u2019 interpretation is necessarily incorrect, but rather that the interpretation  is not directly warranted from the statistical tests performed; in the best case, the patient samples differ from one another, while the control samples do not , while in the worst case, the opposite pattern is observed .The authors\u2019 main finding from the multivariate analysis involves a difference in classification performance for food-vs-neutral representations when contrasting acAN patients with HCferences . InsteadRegardless, exploring differences in classification performance to infer altered information processing for prognostic purposes is a shrewd application of machine learning . HoweverThis strategy would be of particular interest, given the authors\u2019 supposition that altered attentional mechanisms towards food underlie the classifier\u2019s differential performance across groups. Previous work has shown that attention alters representational spaces to increase the categoricity of the attended feature . As suchThis correspondence aims to highlight the clever manner in which the authors combined machine learning with fMRI to investigate cognitive changes in patients with AN while simultaneously drawing attention to a few caveats/strategies in the analyses and interpretations that researchers and reviewers should take into account when designing and assessing functional neuroimaging experiments."}
+{"text": "The processes for making self-cleaning textile fabrics have been extensively discussed in the literature. However, the exploration of the potential for self-cleaning by controlling the fabrication parameters of the fabric at the microscopic level has not been addressed. The current evolution in 3D printing technology provides an opportunity to control parameters during fabric manufacturing and generate self-cleaning features at the woven structural level. Fabrication of 3D printed textile fabrics using the low-cost fused filament fabrication (FFF) technique has been achieved. Printing parameters such as orientation angle, layer height, and extruder width were used to control self-cleaning microscopic features in the printed fabrics. Self-cleaning features such as surface roughness, wettability contact angle, and porosity were analyzed for different values of printing parameters. The combination of three printing parameters was adjusted to provide the best self-cleaning textile fabric surface: layer height (LH)  and extruder width (EW)  along with two different angular printing orientations (O) (45\u00b0 and 90\u00b0). Three different thermoplastic flexible filaments printing materials were used: thermoplastic polyurethane (TPU 98A), thermoplastic elastomers (TPE felaflex), and thermoplastic co-polyester (TPC flex45). Self-cleaning properties were quantified using a pre-set defined criterion. The optimization of printing parameters was modeled to achieve the best self-cleaning features for the printed specimens.  Textiles are considered one of the most used materials in daily life. These materials are known for their breathability, softness, and low cost of raw materials. They are widely used in the clothing industry, furnishings, and industrial fabrics . The tex2 and other nanoparticles have been successfully applied to the textile fabric\u2019s surface or incorporated into the fiber itself [In recent years, an effort has been made to introduce innovations in the fabrication of textile materials and the growth of conventional textiles. The development of self-cleaning textile fabrics using finishing methods is one of the most promising research areas in textile technology . It has r itself .Identifying the key structural features in textile fabric self-cleaning surfaces is essential for improving the liquid-resistant/repellent surface properties of the fabric. Critical microscopic features such as surface roughness, porosity, and wettability of a textile fabric are the primary influences on self-cleaning properties at the surface ,17,18,19The current state of 3D printing technology provides an opportunity to control fabrication parameters ,21 durinThis study focuses on three printing parameters (layer height (LH), extruder width (EW), and raster orientation angle (O)) and the possibility of developing a 3D printed self-cleaning textile fabric. It identifies the significance of the fabric\u2019s microscopic features, such as porosity, surface roughness, and wettability, along with the aesthetic look after optimizing these features. These microscopic features were obtained and controlled by using different sets of printing parameters, as shown in Further, the influence of these features on mechanical strength at the fabric woven-structure level was tested, along with their effect on self-cleaning ability. The fundamental definitions of printing parameters, the microscopic features, and their interrelationship are provided below to comprehend this influence and self-cleaning ability.Layer height (LH) mm: The height of each layer in the printed specimen. It influences the number of layers printed for a given thickness of specimen, as shown in A fixed number of layers with different values of layer height will provide different values of fabric thickness.Extruder width (EW) mm: The width of the printed material is dependent on the nozzle size of the selected printer. The influence of extruder width on self-cleaning features can only be evaluated if the overall fabric dimensions remain constant, as shown in Orientation angle (O)\u00b0: The path on which the nozzle moves on each layer of the (FFF) 3D printer part as in The mentioned printing parameters were adjusted in the 3D printer software in this research. Other parameters such as nozzle temperature (\u00b0C), print speed (mm/s), and infill density (%) were selected based on the recommendation of the printer OEM . These parameters mainly depend on hardware capacity and quality. In the presented research, printing parameters including (LH), (EW), and (O) are analyzed to develop fabrics with self-cleaning ability. Parameters, mainly dependent on hardware, are maintained on the values advised by the printer OEM manual.Commonly, as mentioned in previous studies, the self-cleaning ability can be attributed to material concerning many microscopic features such as porosity (%), surface roughness (\u03bcm), and wettability contact angle (\u00b0C). Surface roughness is a factor of surface texture. Any surface is made of three elements, roughness, waviness, and form with the wavelength of the surface particles . It refeWettability is described as the ability of a liquid to wet a surface; it is determined with the help of contact angle measurement. The three-phase contact point of solid\u2013liquid-air interface is defined as the contact angle . It is oThe porosity was defined as the ratio of void space within the boundaries of solid material to the total volume . The strNew 3D printing methods have extended the capability of 3D printers and offer a new area of usage. Many efforts have explored the possibility of fabricating textiles using a 3D printer. Different textures can be printed by controlling the nozzle\u2019s height and the amount of material extrusion . SurfaceThe specimens were designed and printed with three different parameters and three different materials. The chosen values provided an excellent printing quality and the other parameters remained constant for all the samples. The prepared samples were tested based on an experimental scheme to evaluate the self-cleaning ability.The microscopic features (porosity-roughness and wettability), which are mainly responsible for this ability, were measured and recorded to evaluate and compare the best values for self-cleaning between the three chosen materials.The data were analyzed to define the optimal self-cleaning number.The experiments were mainly divided into three parts:The experimental outputs were used in analytical calculations to find the relationship between changes in printing parameters and microscopic features. The detailed experimental scheme is shown in The structures were fabricated by using a (Raise3D pro-2) printer with different types of filaments for (FFF)-based such as flexible filaments (Thermoplastic Polyurethane (TPU 98A), Thermoplastic elastomer (TPE fila flex), Thermoplastic Co-Polyester (TPC flex 45), PA12 NYLON, and Polyethylene terephthalate Glycol-Modified (PETG). The mentioned filament materials in Two layers were printed in two orientation angles of 45The final samples for a self-cleaning textile were set and tested through specific measurement as in The main advantage of using digital image analysis to assess the porosity of the textile specimen is that there is greater accuracy and higher duplicability. Digital images of part of the specimens were taken by Dino-lite digital microscope. As the images taken were coloured, we transferred them to grayscale. The images of the fabrics with known magnifications were imported into a computer and converted into binary images. Then the porous area and the total area of the fabric were extracted. They were calculated by MATLAB software, as shown in In this study, the measurement was evaluated by the white-light interferometer. The surface roughness definition presented as the average of the standard deviation, which shows that a higher peak means higher roughness. If the peaks are higher, the water droplet will be moving on the surface and will not go inside the pores. Physical sample-surface-roughness parameters (Ra and Rq) were first obtained. The surface roughness Ra was measured quantitatively in \u03bcm from the filtered profiles as shown in The tools and techniques used to measure the contact angle of liquid drops with solid surfaces are also being developed from very basic to some advanced techniques. Direct Goniometric Method: The direct goniometric method is the most used method for measuring liquid contact angles on solid surfaces. The instrument consists of four essential components: (1) a horizontal surface to mount a liquid or solid sample; (2) a micropipette to form a liquid droplet on the surface; (3) an illuminating source; and (4) a telescope assembled with a protractor eyepiece as shown in The unit cell for the three filament TPU 98A\u2014TPE fila flex\u2014TPC 45 flex were measured under a Dino-lite digital microscope with 50\u00d7 magnification as shown in y\u02c6 is the microscopic feature , and 1x represents the layer height, 2x represents the extruder width, 3x represents the orientation angle, and 0\u22123b is the estimated regression coefficient that quantifies the association between the parameters X and the dependent variable y\u02c6.The porosity, surface roughness and wettability values were recorded and evaluated for the three different materials. A multiple linear regression (MLR) model was used to show the relationship between the printing parameters changes and the mentioned microscopic features. Therefore, their effect on the self-cleaning ability is shown in the equation.The printing parameters are converted from the original values in The most basic principle of self-cleaning ability is forming a spherical water droplet that can remove the dirt particles by affecting the surface properties . To expl ability .The self-cleaning number was evaluated based on the linear equation.1Y = 0), (2Y = 100), (1X = 90) and (2X =150).As Y = is the self-cleaning no, (X \u2212 90)Self-cleaning number = 1.6  on the microscopic features were evaluated by plotting them separately with respect to affecting self-cleaning ability.This study investigated the layer height effects for the three materials . Layer height is the difference between one layer and the next deposited layer. We hypothesized that the size of gaps (porosity) would change if the printing parameters changed. The result showed the changing of gap sizes (porosity) according to the layer height. Increasing the layer height can increase the porosity by about 5% to 10% for the three materials. The (TPU 98A) obtained porosity values between 54% and 65%, about a 10% increase for one layer height. The porosity number is almost the same regarding layer height as the range changed slightly when the layer height increased. The average value remained the same. For (TPC 45flex), it showed some variation in the layer height in porosity by about 10% to 15% at a higher layer height and a lower layer height, respectively. The porosity increased slightly when the layer height changed from 0.10 mm to 0.15 mm. The 0.15 mm layer height had the highest number range of 66%, and the 0.10 mm layer height had the lowest.3) for the (TPU and TPC) was 1.14, 1.16 g/m3 respectively, and the (TPE) was 1.09 g/m3. The results are represented in the diagram shown in The layer affected the porosity number in lower values, but when it went higher, the values became constant. Comparison between layer height influence (TPE) porosity values to the (TPU and TPC) showed a significant difference in porosity numbers by approximately 40% or more. It showed porosity values obtained between 9% and 18% for the chosen layer height. It slightly changed porosity by about 2% to 5% at higher and lower layers, respectively. Therefore, it can be found that the changes in porosity numbers were dependent on the material itself rather than on the layer height changes. The density , the extruder-width-influencing porosity number remained constant when it increased. For (TPU 98A), the values started from 54% to 64%, from the lowest extruder width value to the highest extruder width, about 10%. Similarly, for the (TPE) the extruder width did not change the porosity number for the same extruder width. When the extruder width increased, the range remained the same at 10%. Increasing the extruder width did not affect the porosity number, but it changed other parameters. The (TPE) porosity values were the lowest among the other materials. They was a significant change in the porosity number of almost 40%. The change we had from higher extruder width to lower extruder width was about 7%. It meant that the value did not change drastically for the same material. Individually, layer height and extruder width did not impact the porosity number, but when they were combined, they could affect the porosity numbers, as shown in Orientation had no impact on the porosity numbers for the three materials. The porosity numbers\u2019 change ranged from lower values to higher values but remained constant. For (TPU), the porosity number for 45 and 90 orientations had the same range, increasing from 58% to 65% and 59% to 66%, respectively. When the orientation changed, the range remained similar, about 7%. However, the (TPE) porosity values were the lowest of the other materials. They showed a considerable change in porosity of almost 40% in 45 and 90 orientation. As for this material, we had a change of about 10% in respect of orientation, as shown in The differences in the surface roughness behavior profiles of printed fabric at different layers of height for the three different materials  showed a variation of values as the range changed when the layer height increased. It is common in textiles to use Mean Absolute Deviation (MAD), calculated below along with Ra. It is the most valuable and standard parameter for analyzing the surface structure . We hypoFor extruder width, the (TPU 98A) shows that 0.30 mm of extruder width had the lowest surface roughness (0.06 \u03bcm), whereas the maximum roughness occurred at 0.50 mm of extruder width (0.48 \u03bcm). For (TPC 45flex), 0.30 mm of extruder width had the lowest surface roughness (0.04 \u03bcm), and the maximum roughness occurred at 0.50 mm of extruder width (0.53 \u03bcm). However, the (TPE) showed the highest roughness values of 0.50 mm of extruder width (0.65 \u03bcm), and the roughness occurred at 0.30 mm of extruder width (0.16 \u03bcm). It indicated that the increase in roughness was affected by extruder width. The increase was considerable for one extruder width, which has been affected by the other parameters. The average value of the increase remains the same. Therefore, the surface with the highest width has the highest roughness values for the three materials. The results are represented in the diagram in For the same material there was a significant change with the two different orientation angles (45\u201390). The surface roughness profile at a 45\u00b0 measuring direction with narrower peaks to valleys distribution increased in the measuring direction angle of 90\u00b0. Between the 45\u00b0 and 90\u00b0 measuring direction, the surface roughness change remained relatively constant, with a minor variation of approximately (0.06\u20130.45) \u03bcm. The three materials (TPU 98A), (TPC 45flex), and (TPE) showed the highest roughness values in a printing orientation of 90\u00b0, and the values decreased in a printing orientation of 45\u00b0, as shown in The connection between surface roughness and wettability indicates that a higher surface roughness improves the water repellence for hydrophobic materials, and the water contact angle is dependent on it. The angle measured through the droplet at the interference of the three phases, i.e., solid, liquid, and vapor, is referred to as the water contact angle (WCA). If the contact angle > 90\u00b0 the solid surface is referred to as a hydrophobic surface and the water droplet will roll off the surface, and if it is < 90\u00b0 the surface becomes hydrophilic, and the water droplet will stick at the surface. If the contact angle approaches = 150\u00b0 or more the surface is termed an ultra-hydrophobic/superhydrophobic surface. Similarly, as the contact angle approaches = 0\u00b0 the water completely wets the surface, then the surface is termed a super-hydrophilic surface. The experimental results showed that TPE has a better self-cleaning ability than the other two materials. Changing the print layer height and extruder width produced samples that spanned relatively RQ ranges between (0.04\u20130.65 \u03bcm), yet there were significant differences in the wetting ability. For (TPU 98A), increasing layer height could reduce the wettability. It was shown that 0.10 mm of layer height had the lowest wettability (116\u00b0), whereas the maximum angle accrued at 0.15 mm of layer height (136\u00b0). This indicated that layer height changes caused an increase in wettability. The increase was considerable for one layer height that had been affected by the other parameters. The average value of the increase remained the same. For (TPC 45flex), the result showed that the wettability of 0.10 mm of layer height had the lowest value of the three materials (112\u00b0), and the maximum wettability was at 0.15 mm of layer height (143\u00b0). However, the (TPE) showed the highest values of 0.15 mm of layer height (149\u00b0), and the wettability for 0.10 mm of layer height (135\u00b0) was the lowest. Therefore, due to the connection between the roughness and wettability, the highest roughness values influenced the wettability, causing a higher contact angle for the three materials. The results are represented in the diagram in Increasing the extruder width for (TPU 98A) increased the wettability values as 0.10 mm of layer height had the lowest wettability (116\u00b0), whereas the maximum angle accrued at 0.15 mm of layer height (136\u00b0). The increase was considerable for one extruder width, which had been affected by the other parameters. The average value of the increase remained the same. For (TPC 45flex), the result showed that the wettability of 0.10 mm of layer height had the lowest value of the three materials (112\u00b0), and the maximum wettability was at 0.15 mm of layer height (143\u00b0). However, the (TPE) showed the highest values of 0.15 mm of layer height (149\u00b0), and the wettability for 0.10 mm of layer height (135\u00b0) was the lowest, as shown in the diagram There is a change for the same material with the two different orientation angles (45\u201390). Between 45\u00b0 and 90\u00b0, the wettability changes according to the surface roughness changes. The three materials (TPU 98A), (TPC 45flex), and (TPE) showed that the highest wettability values were in a printing orientation of 90\u00b0, and the values decreased at a printing orientation of 45\u00b0, as shown in The fabrication of the porous surface required a combination of the printing parameters. The pore size can influence the liquids in porous textiles behaviours and control the flow pattern of that liquid moving through a porous material. In this study, the flow of the water droplet through the printed textiles is caused by the surface movement, as the person wearing the fabric will be moving most of the time. This should provide the floating action as soon as the droplet comes to the surface. If the droplet is maintained on the fabric surface, it will absorb with time.There is an absorption principle, but we believe that, having a self-cleaning wettability angle and the surface position keeps changing, there will be no time for absorption. Wettability will be a crucial parameter to describe how it is supposed to be self-cleaned. Additional experiments have been performed to determine the behaviour of wettability with time as shown in the figures below, (TPU 98A).(TPE filaflex).(TPC 45flex).The microscopic features  values were determined for different printing parameters experimentally along with the three materials: Thermoplastic Polyurethane (TPU 98A), Thermoplastic elastomer (TPE Filaflex), Thermoplastic Co-Polyester (TPC flex45). The regression equations were fitted by MATLAB.(TPU 98A).The regression measurements of the three parameters are the positive values for the three features. The porosity (0.02), roughness (0.001) and wettability (0.172) are positive values. This proves that when building orientation changes from 45\u00b0 to 90\u00b0 the feature values increase. Similarly for the layer height and extruder regression measurements for porosity (44.03 and 8.19), roughness (1.20 and 0.63), and wettability , which mean that the porosity and roughness values increase when the parameters also increase.(TPE filaflex).The regression measurements of building orientation are positive values  for porosity, roughness, and wettability. This implies that, when building orientation changes from 45\u00b0 to 90\u00b0 it increases the feature values. The layer height regression coefficients are positive values  for porosity, roughness and wettability which imply that increasing the parameter will increase the value. The regression coefficient of the extruder width is a positive value for roughness, porosity, and wettability .(TPC 45flex).The regression measurements of building orientation are positive values (0.017 and 0.001) for porosity and roughness. This implies that, when building orientation increases from 45\u00b0 to 90\u00b0 the feature values increase. Similarly, the layer height regression coefficients are positive values (25.033 and 3.51) for porosity and roughness. The regression coefficient of the extruder width is a positive value only for surface roughness (8.24 and 1.65) it indicates that increasing the extruder width increases the value.The self-cleaning number was evaluated based on the linear Equation (3).Based on this equation if the wettability value (TPU 98A) showed that several scale values varied between 44.11, which is the lowest value with wettability of , and 73.49, which is the highest value of  for a self-cleaning number.(TPE filaflex) showed that several scale values varied between 55.22, which is the lowest value with wettability of , and 94.90, which is the highest value of  for a self-cleaning number.(TPC 45flex) showed that several scale values varied between 34.91, which is the lowest value with wettability of , and 72.33 which is the highest value of  for a self-cleaning number.Comparing between the three materials the (TPE filaflex) showed the best self-cleaning result that provided the highest value of 94.90 with the combination of wettability .The optimization of printing parameters was modelled to achieve the best self-cleaning ability of the printed specimens. The devised method and optimization model can be used to estimate the self-cleaning ability of printed fabric if the inputs of the printing parameters are known. It was found that we can attain even better self-cleaning behaviour if we provide various combinations of these parameters and establish high wettability with low porosity and high roughness hence a high self-cleaning number. The possible combinations of the printing parameters for optimal self-cleaning ability of all the three materials are discussed below.TPU 98AEquations (4) \u2013 (6) were used to find out the optimal self-cleaning ability for the TPU fabrics. Printing parameters were plotted with self-cleaning attributes as shown in TPE filaflexThe Equations (7)\u2013(9) were used to find out the optimal self-cleaning ability for the TPU fabrics. Printing parameters were plotted with self-cleaning attributes as shown in TPC 45flexThe Equations (10)\u2013(12) were used to find out the optimal self-cleaning ability for the TPU fabrics. Printing parameters were plotted with self-cleaning attributes as shown in To validate the results, we printed two specimens for the three materials with different printing parameter that had not been tested in the experimental scheme as shown in the As we clarified that the wettability was the most important parameter to justify the self-cleaning number, we measured the contact angle to the water\u2019s droplet on the textile fabric surface experimentally to evaluate the self-cleaning number as shown in For the three martials the porosity values experimentally and based on Equations (4), (7) and (10) as shown in For the three martials the surface roughness values experimentally and based on Equations (5), (8) and (11) as shown in The self-cleaning number evaluated based on the linear Equation (3) as shown in In the present work, an experimental study was performed on (FFF) using three different thermoplastic flexible filaments printing materials: thermoplastic polyurethane (TPU 98A), thermoplastic elastomers (TPE felaflex), and thermoplastic co-polyester (TPC flex45) to fabricate 3D printed polymeric textile fabrics.It was found that the printing parameters have a very significant effect on the self-cleaning properties when optimizing the selection of the process parameter combination of layer height, extruder width, and printing orientation. The results showed that changing layer height and extruder width combined can affect the porosity, surface roughness, and wettability. The highest layer height has a rougher impact on the surface texture.The changes in porosity numbers are dependent on the material itself rather than the layer height changes. They show porosity values obtained between 9% and 18% for the chosen layer height. They slightly change by about 2% to 5% at higher and lower layer height, respectively.The lowest surface roughness occurs on 0.10 mm of layer height for TPC with (112\u00b0) wettability contact angle, whereas the highest occurs on the 0.15 mm of layer height for TPE with (149\u00b0) wettability contact angle. Changing the print layer height and extruder width produces samples that span relative roughness ranges between (0.04\u20130.65 \u03bcm).The experimental results showed that TPE has a better self-cleaning ability than the other two materials. It showed that several scale values varied between 55.22, which was the lowest value with wettability of , and 94.90, which was the highest value of  for self-cleaning number.Printing different layer heights can affect the printing time and divide a 3D model into more layers affecting the quality of the printed fabric. Extruder width was found to be much more critical for surface printed quality, as lowering the width deteriorated the printed surface, causing more threads to be printed to cover the surface. A desirable structural geometry and fiber orientation are achievable with reasonable and accurate control of printing parameters.The future of polymeric self-cleaning textile with its aesthetic look can be used and fabricated by controlling the printing parameters as the discussed model describes. The devised method and model can be used to estimate the self-cleaning ability of printed fabric if the inputs of the printing parameters are known."}
+{"text": "Chronic cerebral hypoperfusion (CCH) is one of the main pathophysiological markers of cognitive impairment in central nervous system diseases. Mitochondria are cores of energy generation and information process. Mitochondrial dysfunction is the key upstream factors of CCH induced neurovascular pathology. Increasing studies explored the molecular mechanisms of mitochondrial dysfunction and self-repair for effective targets to improve CCH-related cognitive impairment. The clinical efficacy of Chinese herbal medicine in the treatment of CCH induced cognitive impairment is definite. Existed evidences from pharmacological studies have further proved that, Chinese herbal medicine could improve mitochondrial dysfunction and neurovascular pathology after CCH by preventing calcium overload, reducing oxidative stress damage, enhancing antioxidant capacity, inhibiting mitochondria-related apoptosis pathway, promoting mitochondrial biogenesis and preventing excessive activation of mitophagy. Besides, CCH mediated mitochondrial dysfunction is one of the fundamental causes for neurodegeneration pathology aggravation. Chinese herbal medicine also has great potential therapeutic value in combating neurodegenerative diseases by targeting mitochondrial dysfunction. Cognitive impairment encompasses the entire process from mild cognitive impairment (MCI) to dementia . The curChronic cerebral hypoperfusion (CCH) caused by poor control of vascular risk factors and aging is one of the main pathophysiological markers of cognitive dysfunction in Alzheimer\u2019s disease (AD), vascular cognitive impairment and dementia (VCID), Parkinson\u2019s disease (PD), and other central nervous system diseases . The undShennong Bencao Jing (Shennong\u2019s Classic of Materia Medica), a variety of herbs (including Panax ginseng C.A.Mey. And Acorus spurius Schott) which make people \u201cintelligence\u201d and \u201cunforgettable\u201d were recorded. Many single herb and classical herbal compounds were proved to have good clinical effects on cognitive impairment caused by different causes  has a long history of treating cognitive impairment. In the first monograph of Chinese materia medica, t causes . Animal t causes . The curExcitotoxicity is a form of neuronal death caused by hyperactivity of excitatory amino acids (mainly glutamate) . ChronicInhibition of continuous activation of NMDAR is efficient to alleviate excitotoxicity induced mitochondrial calcium overload. Specific glutamate antagonists were used to improve ischemia-related neurovascular excitotoxic death, but there is no evidence of their clinical effectiveness . The nonUnder normal circumstances, reactive oxygen species (ROS) are by-products of mitochondrial aerobic respiration and play important roles in multiple signaling pathways and maintenance of cellular homeostasis . Normall90% of intracellular ROS under CCH conditions originates from electron transport chain (ETC). Even though transient increased mitochondrial calcium could further elevate energy production , excessiMitochondrial oxidative stress disrupts extensive neurovascular coupling, which aggravates hemodynamic disturbances overall cerebral hypoperfusion . The tigMitochondrial-targeted antioxidants might be an effective treatment for cognitive impairment. Butylphthalide, a commonly used clinical mitochondrial protective agent and oxidative stress inhibitor, could significantly reduce the hippocampal mitochondrial ROS level, enhance SOD activity, and improve the learning and memory ability of bilateral common carotid artery occlusion (BCCAO) rats, and also showed good cognitive improvement effects in clinical trials of VCID patients . EdaravoMitochondrial calcium overload and oxidative stress can ultimately rupture mitochondrial outer membrane, which leads to mitochondrial residing proapoptotic factors releasing: cytochrome C (Cyt C) and apoptosis-inducing factor (AIF) . Once CyBcl-2 family proteins are major regulators of mitochondrial apoptotic factors releasing: Anti-apoptotic proteins, such as Bcl-2, exist on the mitochondrial outer membrane; pro-apoptotic protein, such as Bax, generally present in the cytoplasm. After receiving the apoptotic signal of calcium influx or ROS, Bax relocates to the mitochondrial outer surface and forms a hole that across both membranes, leading to increase of membrane permeability, thus releasing apoptotic factors . BesidesMitochondrial dysfunction and structural disruption, an amplified signal of apoptosis/cell death, play a key role in survival and death of nerve cells after CCH . InhibitTransient hypoxia, calcium influx, and ROS can moderately activate mitochondrial dynamics and mitophagy to maintain partial normal function . MitochoMitochondrial biogenesis refers to a series of molecular processes that trigger mitochondrial replication and subsequent regeneration of fully functional mitochondria. CCH can activate multiple pathways of mitochondrial biogenesis and induce mitochondrial DNA replication, as well as the subsequent synthesis and assemble of lipid/protein molecules for new mitochondria . The traRegulating mitochondrial dynamics, moderately activating mitophagy, and promoting mitochondrial biogenesis are key targets for restoring neurovascular structure and delaying further cognitive decline . RapamycPanax ginseng C.A.Mey., significantly attenuated the glutamate-induced NMDA receptors activation and calcium influx, which effectively stabilizes mitochondrial membrane potential and reduces mitochondrial rupture  is the initiator in mitochondrial membrane disruption. Antagonism of glutamate excitotoxicity is a potential target for protecting mitochondrial structural integrity and stabilizing mitochondrial membrane potential . Yang e found th rupture .Under CCH conditions, 90% of intracellular ROS is derived from mitochondria, which are also the key sites of oxidative stress damage . EnhanciArnebia euchroma (Royle) Johnst. Recent studies showed that Shikonin was a promising antioxidant.  ratio and oxidative phosphorylation rate (OPR) were used to assess the overall antioxidant function of mitochondria. Reduce of ADP/O and OPR represents impaired mitochondrial oxidative phosphorylation, reduced energy production and dysfunctional energy transfer . Baicalecavenger .  effectively prevented the damage of Complex II-IV and accumulation of MDA. found thtamin C,  found thPueraria lobata (Willd.) Ohwi. (Gegen). (Ligusticum chuanxiong Hort.) inhibited the mitochondrial apoptotic pathway by reducing the Bax/Bcl-2 ratio and Caspase-3 in OGD-PC12 cells. The study of  can not only reduce the Bax/Bcl-2 ratio of BCCAO model rats, but also the release of mitochondrial Cyt C. (Rehmannia glutinosa (Gaertn.) DC., increased the level of Bcl-2, p-Akt and p-CREB in oligodendrocytes, which directly reduced white matter damage. In animal models of CCH, Naomaitai capsule increased intracellular Bcl-2 expression while decreased Caspase-3 and Bax .  found th(Gegen).  found th(Gegen). , a Chine(Gegen).  also indstudy of  showed tl Cyt C.  found thl Cyt C. , anotherl Cyt C.  proved t and Bax   Ohwi) can activate SIRT 3/PGC-1\u03b1 and reduce the number of apoptotic cells in BCCAO rats.Chinese herbal medicine has shown promising potential in activating PGC-1\u03b1 upstream pathway to promote mitochondrial biogenesis  see Fig. AdenosiInhibiting the overactivation of mitophagy is also essential for promoting mitochondrial self-repair . In animCCH is an independent exacerbating reason for impairment in learning and memory of PD and AD . CCH medRecent study  found thMitochondrial oxidative stress also showed close correlation to production and aggregation of disordered proteins . High level of mitochondrial-generated ROS created deleterious modifications environment for normal proteins, lipids, RNA and DNA which exacerbated AD and PD pathology . In AD mOn the other hand, mitochondrial depletion due to calcium dysregulation and hyperactive mitophagy following glutamate excitotoxicity induced dendritic atrophy in AD and PD models, which is an early sign of neurodegeneration . MitochoMitochondria are the energy center and information processor of cells. Their dysfunction plays a key role in CCH-mediated neurovascular pathology and cognitive impairment. Protecting the integrity of mitochondrial structure/function and restoring mitochondrial self-regulation are effective targets for alleviating CCH-induced cognitive impairment. Modern clinical research and experiments have confirmed the precise role of Chinese herbal medicine in improving CCH status and cognitive impairment. In recent years, modern TCM researchers have further clarified the therapeutic mechanism of Chinese herbal medicine targeting mitochondrial dysfunction to improve CCH-induced cognitive impairment in animal and cellular models using modern technology. Current evidence showed that Chinese herbal compounds and monomers can protect the structural and functional integrity of mitochondria for energy metabolism reconstruction by reducing calcium overload after excitotoxicity, enhancing ETC complex activity, restoring mitochondrial self-regulation. Monomers of Chinese herbs showed good effect in antioxidant and anti-excitotoxicity (discussed in Significantly, Chinese herbal compounds produced under the guidance of TCM \u201csyndrome differentiation and treatment\u201d theory showed clear efficacy in improving mitochondrial dysfunction and treating cognitive impairment after CCH, which provide new ideas for mitochondrial targeted therapy for neurodegenerative diseases. As mentioned above, conducted"}
+{"text": "While the psychological reality of deliberate metaphors remains in ongoing doubt, this study attests to their psychological reality in the Chinese language. Based upon the definition and main tenets of deliberate metaphor, we propose three hypotheses: Compared with non-deliberate metaphors, addressees pay more attention to deliberate metaphors\u2019 source domains, display a greater tendency to adopt the source domain\u2019s perspective, and spend more time on processing deliberate metaphors. Using Chinese deliberate metaphors as testing materials, we conducted an experiment with 70 Chinese university students whose native language was Chinese. The results confirmed our hypotheses. Compared with non-deliberate metaphors, Chinese deliberate metaphors drew more attention and brought about more perspective changes. Additionally, processing deliberate novel metaphors consumed more time than processing non-deliberate metaphors, thus providing supportive evidence for the psychological reality of Chinese deliberate metaphors. However, less time taken on deliberate conventional metaphors than non-deliberate metaphors might have been caused by our experiment\u2019s task design. In a nutshell, our study statistically proves the psychological reality of Chinese deliberate metaphors from the reception side. Future studies may check our findings with a similar experimental paradigm in other languages. With a fruitful 40-year history ,2, ConceAccordingly, deliberate metaphor adds a third dimension to metaphor study, the communication dimension . It inviHowever, the concept of deliberate metaphor has received severe criticism. On the one hand, because knowing metaphor producers\u2019 deliberateness from outside their minds is impossible, ensuring whether they use the metaphor deliberately or not is also impossible . On the to attend to the source domain as a domain that lies outside the current domain of discourse, and to view the target domain from that perspective\u201d [Therefore, this study attests to the psychological reality of Chinese deliberate metaphors from the reception side. Essentially, \u201cwhen a speaker or writer uses a metaphor deliberately, that is, as a metaphor in order to make the addressee deliberately understand one thing in terms of something else, the sender forces the addressee pective\u201d ,14,15,16pective\u201d  (p. 152)Metaphors We Live By, coauthored by Lakoff and Johnson [attacked every weak point in my argument\u201d activates the conceptual metaphor \u201cARGUMENT IS WAR\u201d in people\u2019s minds [The deliberate metaphor was put forward in response to the paradox in conceptual metaphor processing. Conceptual Metaphor Theory came into view with the publication of  Johnson , and it  Johnson ,19,20. T Johnson  p. 3). . MetaphoNevertheless, these tenets have encountered attacks in subsequent studies. Large-scale analysis showed that only 14% of corpus expressions were metaphorical . This raIn view of this paradox, Steen advanced the term \u201cdeliberate metaphor\u201d ,6, definThe initial round ,24,25,26The second round began with a report of Gibbs\u2019s failed experiment . He desifailed test of the Deliberate Metaphor Theory.In response, Steen indicated the following three inadequacies in the experiment\u2019s conceptualization and operationalization . (1) TheAs a follow-up, Gibbs  commenteAlthough opponents\u2019 views of the experiment as failed and proponents\u2019 refusal to accept the experiment as failed complicated the entire picture, this second round did provide some insights that became guidelines for our experimental design in the present study: (1) Valid instances for deliberate metaphors are needed for experimental design. (2) An experiment should be designed that confirms the essential attribute of deliberate metaphor: whether the addressees pay more attention to deliberate metaphors and display a higher tendency of perspective change. (3) An experiment is expected to include a variety of deliberate metaphors.Next, the third round of debate began with Gibbs and Chen\u2019s (2017) contradiction of Xu, Zhang, and Wu\u2019s  article In a nutshell, although the three rounds of debates intended to verify the reality of deliberate metaphor and the necessity to research the phenomenon, no consensus has been reached. The essential issue is that no supportive evidence has been offered for the psychological reality of deliberate metaphor, and this makes all the relevant discussion groundless. Thus, the present study attempts to design an experiment to attest to the psychological reality of deliberate metaphors, aiming at furthering the investigation into this phenomenon.As previously explained, the only \u201cfailed\u201d empirical experiment on deliberate metaphor was criticized for inadequate conceptualization and operationalization ,27. We tResearch\u00a0Question\u00a01:Compared with non-deliberate metaphors, does the addressee pay more attention to deliberate metaphors\u2019 source domain and spend more time on this process?Research\u00a0Question\u00a02:Compared with non-deliberate metaphors, does the addressee display a greater tendency to adopt the source domain\u2019s perspective and spend more time on this process?From a university in northwest China, 75 native Chinese speakers participated in this study. Their Chinese scores on the National College Entrance Examination (similar to the SAT in the US or A-levels in the UK) were collected to check whether they were homogeneous in language proficiency. Five outliers were dropped because their scores fell outside the mean score range plus or minus three standard divisions. The final participants were seventy  whose ages ranged from 18.2 to 21.7 years . The gender imbalance was accepted because no significant difference was detected between males and females in metaphor processing . The stuAs concluded from the second-round debate, a variety of valid deliberate metaphors should be included in the experimental design. However, only one Chinese article investigated the cognitive function of deliberate metaphors in Chinese news reports about COVID-19 , discussp < 0.05; r = 0.93, p < 0.05), which confirmed the reliability of the metaphors we identified. For deliberateness testing, we selected metaphors both of us recognized. Another doctoral student in cognitive metaphorology was invited to grade the deliberateness of these metaphors on a scale from 1 for \u201cleast deliberate\u201d to 5 for \u201cextremely deliberate\u201d. The results indicated two typical types of Chinese deliberate metaphors: novel metaphors and conventional metaphors in quotation marks, as in the two following sentences.Together with the first author, a doctoral student in cognitive metaphorology was invited to identify both deliberate and non-deliberate metaphors. After identifying all metaphors, we checked our inter-rater reliability using Pearson\u2019s correlation analysis. The results showed a significant level \u706b\u70ed\u8f6e\u756a\u4e0a\u6f14\u3002tu\u014dp\u00edn g\u00f9sh\u00ec za\u00ec qu\u00e1ngu\u00f3 g\u00e8d\u00ec d\u014dupoverty alleviation stories in country everywhere whole hu\u014fr\u00e8 l\u00fanf\u0101n sh\u00e0ngy\u0103n.burning hot repeatedly perform.Burning hot poverty alleviation stories are being performed repeatedly everywhere in the whole country.\u8131\u8d2b\u6545\u4e8b\u5728\u5168\u56fd\u5404\u5730\u90fd(2)r\u00e9nm\u00ednde p\u012bngb\u00f3 tu\u012bd\u00f2ng zh\u014fnggu\u00f3h\u00e0o li\u00e8ch\u0113 ji\u0101s\u00f9people\u2019s strive push No. China train acceleratedqi\u00e1nx\u00edngmove forwardPeople\u2019s strive accelerates the \u201ctrain\u201d No. China to move forward.\u4eba\u6c11\u7684\u62fc\u640f\u63a8\u52a8\u4e2d\u56fd\u53f7\u201c\u5217\u8f66\u201d\u52a0\u901f\u524d\u884c\u3002Sentence (1) used \u201c\u706b\u70ed \u201d to describe poverty alleviation stories, which was novel for Chinese people. In this way, the writer indicated his deliberateness in drawing people\u2019s attention to this metaphor. Sentence (2) used \u201c\u5217\u8f66 \u201d to refer to the country of China, which was conventional for Chinese people. Therefore, the writer added quotation marks to draw people\u2019s attention to this metaphor. We decided to include these two types of Chinese deliberate metaphors in the experiment .The final testing materials included 20 sentences with deliberate novel metaphors, 20 with deliberate conventional metaphors (top sentences in deliberateness testing), 20 with non-deliberate metaphors (bottom sentences in deliberateness testing), and 20 literal expressions as baselines . All 80 sentences were edited to a length of 16 words. The source domains were located in the 11th and 12th words in sentences and underlined (as in example sentences (1) and (2)). Similarly, the 11th and 12th words in the literal expressions were also underlined. After that, all sentences were programmed into E-Prime 2.0.The experiment was conducted in a language laboratory, with each participant using a solo computer. Three experienced experiment assistants were present in case of technical issues. Before the test, participants were familiarized with the rubric and the keyboard operation. During the experiment, the computer first displayed \u201c+\u201d in the center of the screen for 500 ms, followed by a blank screen for 500 ms, and then displayed the 80 sentences randomly for 3000 ms. Participants performed the following two tasks on each sentence: grade their attention to the underlined part on a 1\u20135 scale , and judge whether they consciously adopted the perspective of the underlined parts . For each sentence, the attention task appeared first without time control. After participants pressed a number to rank their attention to the source domain, the second task also appeared without time control. Participants pressed the corresponding letter according to their adopted understanding perspectives as soon as possible once they had made their decision. When the two tasks for one sentence were completed, the next sentence appeared at the screen\u2019s center  and deliberate conventional metaphors  than to non-deliberate metaphors. Moreover, the difference between the response time required by deliberate novel metaphors and non-deliberate metaphors also reached a significant level . These results further confirm our findings from t = \u22124.84, p < 0.01, d = 0.29). This might be caused by the experiment\u2019s specific tasks. Generally, non-deliberate metaphors would be processed (categorized) as non-metaphorical expressions [We also noticed two unexpected findings. First, deliberate conventional metaphors displayed significantly less response time than non-deliberate metaphors  and deliberate conventional metaphors  displayed a significantly greater tendency to adopt the source domain perspective than non-deliberate metaphors. This further confirms the finding from t = 0.02, p > 0.05, d = 0.00). This reminds us of the first unexpected finding from Research Question 1. Asking participants to consider their perspective change when processing non-deliberate metaphors might make them rethink the understanding process, resulting in a longer response time. Further experiments are expected to verify this. In addition, significant differences between deliberate novel metaphors and deliberate conventional metaphors in both perspective adoption  and respective response time , also suggest a detailed classification of metaphors in experimental design and results analysis.Based on the deliberate metaphor\u2019s definition and main tenets, the present study proposed two hypotheses about its processing procedure: In comparison to non-deliberate metaphors, deliberate metaphors would draw more attention from addressees and bring about more perspective change, both of which require more processing time. Our results confirmed these hypotheses except for the longer response time for non-deliberate metaphors. Specifically, participants paid significantly more attention to deliberate metaphors\u2019 source domains and demonstrated greater percentages of adopting these source domains\u2019 perspectives. Compared with non-deliberate metaphors, deliberate novel metaphors cost participants more processing time, while deliberate conventional metaphors cost less time. The task\u2019s possible effect on non-deliberate metaphors\u2019 longer response time will be checked in further studies. Implications of the confirmed hypotheses are listed below.The significantly greater attention to deliberate metaphors\u2019 source domain and the higher percentage of adopting their understanding perspectives suggest that a distinct mechanism might be involved in processing deliberate metaphors and that deliberate metaphors and non-deliberate metaphors activate different mental processes in receivers\u2019 minds. In other words, they can be classified into different types of metaphors. As such, this offers supportive statistical evidence for the psychological reality of deliberate metaphors and should resolve the debate about their existence.In the first round, opponents inquired how we could verify receivers\u2019 attention to deliberate metaphors and subsequent cross-domain mappings . HoweverIn the second round, Gibbs  failed tIn the third round, two stands turned to the value of deliberate metaphors for general metaphor study . If deliMoreover, deliberate novel metaphors and deliberate conventional metaphors showed significant differences in receivers\u2019 attention, perspective change, and respective response times. This suggests that they involve a distinct processing mechanism. Deliberate novel metaphors resort to novelty to indicate deliberateness in use. Novelty is an intrinsic property of unfamiliar (novel) metaphors . UnfamilThis study has its limitations. First, all our findings were based on data from the Chinese language. As a different language typology from English, Chinese may display specific traits in deliberate metaphor processing ,39. The The deliberate metaphor was proposed to tackle the paradox in general metaphor studies that not all metaphors are processed in a metaphorical manner. Nevertheless, deliberate metaphor has been under constant debate about its psychological reality since its debut. Although proponents presented a theoretical account of its psychological reality according to certain aspects, they did not provide supportive statistical data to demonstrate that psychological reality. In contrast, although opponents resorted to empirical experiments to evidence its psychological reality, they reported a failed test. Therefore, verification of its psychological reality became an urgent issue for further development of deliberate metaphor research.In view of this situation, the present study employed a behavioral experiment to test the psychological reality of Chinese deliberate metaphors. In our experiment, 70 native Chinese university students were required to grade their attention to the underlined parts of presented sentences and to judge whether they had adopted the understanding perspectives of these underlined parts. Results confirmed that receivers paid more attention to source domains of deliberate metaphors and were more likely to adopt their understanding perspectives. At the same time, receivers spent more time processing deliberate novel metaphors. These results suggest a distinct mechanism involved in deliberate metaphor processing, thus proving its psychological reality. Whether non-deliberate metaphors\u2019 longer response time compared with deliberate conventional metaphors was caused by our experiment\u2019s specific tasks needs to be re-tested in further studies.This is the first successful verification of the psychological reality of deliberate metaphors from the reception side. As far as we know, this is one of the few studies adopting an experimental approach to help the research move forward. If it is the case, deliberate metaphors should involve distinct mechanisms from non-deliberate metaphors. In this way, the doubt and debate on the necessity and value to investigate deliberate metaphors will be dispersed. As such, we need to construct a more comprehensive framework with both deliberate and non-deliberate metaphors . This reFuture studies should check whether this finding can be generalized to other languages. In addition, deliberate metaphor implies two subjectivities: the producers who intend to use the metaphor and the receivers who attend to the metaphor. As such, the psychological reality of producers also emerges as an important issue to be investigated in future studies. Moreover, if possible, some advanced technologies such as eye-tracking, ERP , and fNIRS could be employed to offer more direct evidence from the brain."}
+{"text": "Piper methysticum) has been widely consumed for many years in the South Pacific Islands and displays psychoactive properties, especially soothing and calming effects. This plant has been used in Western countries as a natural anxiolytic in recent decades. Kava has also been used to treat symptoms associated with depression, menopause, insomnia, and convulsions, among others. Along with its putative beneficial health effects, kava has been associated with liver injury and other toxic effects, including skin toxicity in heavy consumers, possibly related to its metabolic profile or interference in the metabolism of other xenobiotics. Kava extracts and kavalactones generally displayed negative results in genetic toxicology assays although there is sufficient evidence for carcinogenicity in experimental animals, most likely through a non-genotoxic mode of action. Nevertheless, the chemotherapeutic/chemopreventive potential of kava against cancer has also been suggested. Both in vitro and in vivo studies have evaluated the effects of flavokavains, kavalactones and/or kava extracts in different cancer models, showing the induction of apoptosis, cell cycle arrest and other antiproliferative effects in several types of cancer, including breast, prostate, bladder, and lung. Overall, in this scoping review, several aspects of kava efficacy and safety are discussed and some pertinent issues related to kava consumption are identified.Kava ( Piper methysticum Forst and can be translated as \u201cintoxicating pepper\u201d [Kava is a shrub plant with psychoactive properties commonly used in the South Pacific islands that has recently awakened the interest of the scientific community for its potential in cancer treatment. Kava is obtained from the pulverized dried roots of different species of  pepper\u201d . The ter pepper\u201d  in the l pepper\u201d . As desc pepper\u201d , there a pepper\u201d  and at t pepper\u201d .The beverage kava had a strong ceremonial connotation, although it is now mainly used as a social beverage. Nevertheless, there are some countries and regions in the Pacific, namely Tonga, Fiji, and Pohnpei, where kava ceremonies are practiced as a vital part of local culture . Why kavThe usage of herbal and natural medicines is quite often erroneously associated with the absence of adverse side effects. In the context of kava ingestion, there are several reports indicating its potential for the development of hepatotoxicity , skin raThis review aims at integrating safety and efficacy issues of kava, providing some historical background, and reviewing a number of chemical aspects involved. Additionally, the absorption, distribution, metabolism and excretion (ADME) of kava constituents as well as their pharmacodynamics and potential clinical beneficial effects, particularly in the scope of cancer, will be further reviewed and updated.A comprehensive literature search of studies in English was conducted between January 2021 and May 2022 to identify articles  to be included in the present work. The search was carried out in PubMed  without a limiting period, although particularly focusing on reports published in the last decade. The keywords used were \u201ckava\u201d, \u201ctoxic\u201d, \u201cgenotoxic\u201d, \u201ctoxicokinetics/pharmacokinetics\u201d \u201chepatotoxic\u201d, \u201cpsychotropic\u201d and \u201ccancer\u201d. Specific kava constituents were also searched. In addition, the abovementioned articles, as well as textbooks and technical reports on kava, were further reviewed to identify additional relevant publications.The kava plant is native to Vanuatu, domesticated for the first time approximately 3000 years ago and brought to Oceania by Austronesian colonists , this plThe consumption of kava consisted of mixing kava root in different ways , depending on the region of the Pacific where the ritual was performed, and mixing it with water or coconut milk. The greyish and turbid beverage obtained might discouraged foreign people to drink it . TraditiDespite its current usage in different disorders and diseases, kava became popular in the 1990s, as an attractive recreational drug, reaching peak popularity in 1998 . This leToday, in the Pacific islands, kava still has traditional importance, used in ceremonies and rituals. However, there are some differences compared to its former use. Previously, as aforementioned, kava ceremonies were only performed and attended by men, while now women are also progressively drinking kava in informal rituals . MoreoveThe chemical composition of kava can be affected by several factors. The most important include the type of cultivars, which can present different chemicals, the parts of the plant used, and solvents for extraction. The main constituents responsible for the biological activity of kava are lipophilic lactones called kavalactones (or kavapyrones) that possess a \u03b1-pyrone skeleton with aromatic stiryl or phenylethyl substituents at the 6th position . NineteeMinor constituents consist of chalcones  B, amino The part of the plant used is important for the chemical composition. Kava extracts can be prepared using different parts of the plant, i.e., roots and rhizomes, stems and leaves, which results in different outcomes and side effects. The content of kavalactones and flavokavains is higher in the roots, being almost absent in the aerial parts of the plant, which are in turn rich in toxic alkaloids, such as pipermethystine . The roon = 28), two day , medicinal (n = 79) and wichmannii (n = 12) [The chemical composition of kava, especially the concentration of kavalactones and flavokavains, and consequent biological properties, are directly related to the cultivar. In 2002, the Kava act nr.7 was issued, which classified the existing cultivars and fit them into four categories: noble n = , two day(n = 12) . This tyThe two-day cultivar presents high levels of dihydromethysticin and dihydrokavain, which causes a \u201changover\u201d effect, characterized by the presence of nausea and headaches . This cuFinally, the solvents used for extraction and the methods used to characterize kava extracts are of utmost importance to obtain a detailed fingerprint of each extract used and is needed to conduct future investigations.The World Health Organization (WHO) published a monograph recommending the use of high-performance liquid chromatography (HPLC)\u2014electrospray mass spectrometry to obtain qualitative analytical profiles and HPLC as the standard method for quantitative analysis . ReverseCurrently, kava has two different modes of oral consumption. The semi-traditional method of ingesting kava as a beverage is still used. In this way, kava is extracted using mostly water and served in a coconut shell, resembling the traditional way in the Pacific Islands, which involves high doses and a lack of control of the dosages used. This beverage can only be found in bars dedicated to this drink, known as kava bars. The second method of consumption is focused on the nutraceutical and medicinal properties of kava, with tablets being the most common pharmaceutical form. It is used with the specific aim to treat a certain disease, particularly anxiety disorders .Since few studies have been published regarding toxicokinetics, a full compilation of data is provided in this review, also exploring the potential of interaction with other co-administered compounds to clarify the risk of kava-induced liver injury ,36,37,38p-hydroxybenzoic acid; 4-hydroxy-6-phenyl-5-hexen-2-one, hippuric acid, 4-hydroxy-6-hydroxyphenyl-5-hexen-2-one, p-hydroxykavain, p-hydroxydihydrokavain, hydroxykavain, and p-hydroxy-5,6-dehydrokavain. In addition, there were two unidentified metabolites. Large amounts of unchanged kavain were identified in the feces. The metabolism of methysticin produced only two urinary metabolites, m,p-dihydroxykavain and m,p-dihydroxydihydrokavain, both in small amounts. Apparently, these metabolites were formed by demethylenation of the methylenedioxyphenyl moiety. Unchanged methysticin was also identified in feces [O-demethylation and no ring-opening products were detected. Specifically, three urinary metabolites, p-hydroxy-5,6-dehydro-7,8-dihydrokavain and two dihydroxy-5,6-dehydro-7,8-dihydrokavains, were identified from the metabolism of 7,8-dihydroxyyangonin. The p-hydroxy-5,6-dehydro-7,8-dihydrokawain was the major urinary metabolite. Regarding yangonin, three urinary metabolites were found, with the structures of dihydroxy-5,6-dehydro-7,8-dihydrokavain and p-hydroxy-5,6-dehydrokavain (the predominant) being fully clarified [The metabolism of the three 5,6-dihydro-\u03b1-pyrones , kavain, and methysticin) and the two \u03b1-pyrones  in male albino rats was studied by Rasmussen et al. . Regardiin feces . Regardilarified .o-quinone and 11,12-dihydroxykavain-o-quinone, were described as glutathione conjugates [o-quinones [Nine kavalactones  were identified in urine following kava ingestion . The autnjugates . These pnjugates . It was quinones .Kava extract can significantly modulate drug-metabolizing enzymes, particularly the cytochrome P450 isozymes, a fact that has been suggested to predispose to drug-induced liver injury (DILI) ,45. PartCYP1A1, CYP1A2, CYP2C2, CYP3A1, and CYP3A3, while gene expression of CYP2C23 and CYP2C40 decreased, all in a dose-dependent manner. Clayton et al. [CYP2D1 (human CYP2D6 homolog) in females and an increased expression of CYP1A2, CYP2B1, and CYP13A1 of both sexes of Fischer 344 rats. Although these results might add further insights on the kava involvement in liver injury as hepatic hypertrophy was registered, the mechanisms remain largely unknown and several hypotheses have been proposed as described below.At least seven genes of the cytochrome P450 isozymes were changed after kava extract exposure by gavage for 14 weeks . Particun et al.  also repThe effects of the six major kavalactones on cDNA-derived CYP450 isoenzymes were evaluated by Zou et al.  who demoRussmann et al.  also demSince kava could be administered in conjunction with alcoholic drinks, this mixture can have important clinical, forensic, and social consequences in comparison to traditional kava consumption. Foo and Lemon  evaluateAs stated before, many people who use herbal supplements somehow perceive them as devoid of adverse side effects due to their natural origin. In this sense, these supplements might be used even when not needed, at higher doses than recommended and for long periods of time. It is well known that different types of toxic effects can be induced by herbal medicines, especially liver injury.From the different types of toxic effects attributed to kava, hepatotoxicity is indeed considered the most dangerous and debated one. Cases of hepatotoxicity associated with kava intake started in the 1990s and by 2001\u2014as mentioned above, BfArM announced the decision to ban kava, making it official in 2002, supported by 41 reports of liver injury in Germany and 73 cases worldwide  had a siSeveral putative causes for liver toxicity have been pointed out, ranging from the potential low-quality cultivars and inadequate extraction solvents to possible interactions with other drugs. Kava overdose can be associated with necrotic hepatitis and cholestatic hepatitis . In suchAmong the different chemicals/classes of chemicals claimed to be responsible for kava hepatotoxicity, pipermethystine, flavokavain B and mold hepatotoxins have been pointed out in the literature. Pipermethystine is a piperidine alkaloid, present mainly in aerial parts of kava, such as leaves and peelings of the lower stem . In vitrAnother possible compound responsible for hepatotoxicity is flavokavain B. In vitro studies demonstrated cytotoxic activity in HepG2 cells and human liver cells L-02, leading to cell death, and demonstrated in in vivo studies that flavokavain B is responsible for the potentiation of kava hepatotoxicity upon herb\u2013drug interaction in C57BL/6 mice. ,66. NeveIn addition to the abovementioned factors possibly responsible for kava-induced hepatotoxicity, i.e., extraction solvents used, misuse of other kava parts and possible toxic constituents, there are other aspects that should be considered for the liver injury observed, including the depletion of the reduced glutathione (GSH). In fact, the decrease in GSH contributes to the sensitization of liver to hepatotoxic agents . It has The differences in the metabolism between Pacific islanders and Caucasians may also play a pivotal role, since it was suggested a possible correlation between kava-induced hepatotoxicity and CYP2D6 deficiency . As apprWhile hepatotoxicity can be considered the main health concern, there are other side effects associated with kava ingestion that should be mentioned, with most of them being reversible. An example is kava dermopathy, also known as kavaism. It is a systemic dermatitis and erythema that can be observed first in the head, spreading down to the body , and resulting in a dry, scaly, and yellow discoloration ,60,70. IOther common side effects are gastrointestinal discomfort, nausea, and headaches. These effects have been described as reversible upon interruption of the kava treatment ,71,72. TSince kava might be an alternative treatment option for different diseases, it has been evaluated its potential impairment in terms of driving capacity. Some studies indicate that it may improve memory and attention, as mentioned in a clinical trial assessing driving ability . AnotherSalmonella typhimurium TA97, TA98, TA100 and TA 1535 and Escherichia coli strain WP2 uvrA pKM101), either in the presence or absence of external metabolic activation (rat S9-mix), as reported by the NTP [Drosophila melanogaster model [Studies addressing the genotoxicity and carcinogenicity of kava extracts have been reported in the literature, with most of them being recently compiled and discussed by the IARC . Kava ex the NTP . Whittak the NTP  also rep the NTP , in whic the NTP . NTP alser model . In the In what concerns the carcinogenicity potential of kava extracts, positive results for kava extracts delivered by oral gavage were reported in long-term studies carried out by NTP . ParticuAs previously mentioned, several compounds of kava, such as kavain, dihydrokavain, methysticin, desmethoxyyangonin and yangonin are able to cross the blood\u2013brain barrier in in vivo studies . Kava geThe clinical and experimental data on kava psychopharmacology were also recently reviewed by Volgin et al. , highligIn some clinical trials performed, the participants in the kava group showed improvement in terms of stress and anxiety, when compared to the placebo group, with no serious side effects reported ,83. NeveKava has been compared to standard anxiolytic drugs, such as oxazepam, to determine if it may have any withdrawal or addiction issues ,84. AccoAs aforesaid, although the focus of kava is to treat anxiety disorders, it has been also used to mitigate disorders such as menopause symptoms and associative depression ,87 and iwww.clinicaltrials.gov, accessed on 22 February 2022).As previously mentioned, kava has shown an effect in the CNS, mainly due to kavain, dihydrokavain, methysticin, desmethoxyyangonin and yangonin. These kavalactones were able to cross the blood\u2013brain barrier in in vivo studies . DespiteThe carcinogenic potential of kava and its constituents was addressed in previous In the late 1990s, three studies first reported low cancer rates, especially lung cancer, in the Pacific islands inhabitants, linking this interesting data with chemopreventive elements in diet ,94,95. BIn this section, the main compounds suggested to be implicated in these beneficial effects in cancer are addressed in more detail. The usefulness of kava in the context of cancer can be regarded by two complementary perspectives: chemoprevention or, alternatively, as a therapeutic agent. It is well known that chemotherapeutic drugs can also arise from natural sources, nearly representing half of the anticancer agents according to Newman and Cragg . MoreoveDifferent types of kava extracts and the impact of extraction solvents in their chemical composition and cytotoxic effects have been evaluated either in in vitro or in vivo models. It has been shown that it is important to examine the activity of the plants in the traditional form, for example using water instead of ethanol or acetone to extract components . EinbondDespite some studies showing anticancer or chemopreventive proprieties of kava extracts in the context of lung cancer ,101, theKava extracts tend to be more often studied in vivo than in vitro to assess the synergistic effect of different kavalactones with flavokavains in cancer endpoints, and to evaluate whether they can induce liver toxicity or injury. It is frequent to separate kava extracts into fractions to determine which one is more effective. By separating it into polar and non-polar fractions, Triolet et al. were able to successfully reduce morphological markers, aberrant crypt, and foci in carcinogen-treated rats for twelve days, specifically with the non-polar fraction . LeitzmaIn addition, a long-term study in which kava extracts were administered for 22 weeks to A/J mice  did not find significant effects on liver integrity enzymes or liver weight . TobaccoA recent pilot clinical trial  evaluateAmong the different types of chemicals present in kava, flavokavains have been evaluated both in in vitro and in in vivo models for their possible anticancer proprieties. Flavokavain A, B and C are at a minor percentage in kava, constituting up to 0.46%, 0.015% and 0.012%, respectively . Althoug50 values varied between 12.3 and 33.8 \u03bcM, for the MDA-MB-231 and MCF-7 cell lines, respectively [The beneficial effects of flavokavain B are still controversial. In fact, although it has shown promising results, it has also been pointed out as responsible for some adverse effects, especially hepatotoxicity. Regarding the main in vitro effects of flavokavain B, its ability to induce cell cycle arrest in G2/M and apoptosis is generally reported ,119,120.ectively .Although the mechanisms are yet to be fully understood, most of the proposed mechanisms involve extrinsic and intrinsic apoptotic pathways, where DR5, PUMA and Bim are upregulated and the expression of antiapoptotic proteins, such as survivin and Bcl-2 is diminished ,120. FlaThe research on the impact of flavokavain C on cancer cells is still recent, being the least studied flavokavain. Cell cycle arrest was observed in the S phase in HCT 116 cells and in the G1 and G2/M phases in HT-29 cells ,122. EveThere are only a few reports on the effects of kavalactones alone in cancer. From these studies, it is possible to conclude that dihydromethysticin can be considered the most effective and promising chemopreventive kavalactone , as wellThe impact of dihydromethysticin on the formation of NNK-induced lung adenomas and adenocarcinomas in A/J mice has been reported. This animal model has predisposed pulmonary adenoma susceptibility gene (Pas1) and develop lung adenomas with high incidence . DihydroDespite being studied more in the scope of lung cancer, dihydromethysticin has also shown inhibitory effects in colorectal cancer, mainly in terms of proliferation, migration, and invasion. It was also shown to induce apoptosis and cell cycle arrest in the G0/G1 phase, via the NLRC3/PI3K pathway, where it activates nucleotide oligomerization domain-like receptor subfamily C3 (NLRC3) and inhibits PI3K and cyclin D1-CDK4, leading to G0/G1 arrest .Kava is undoubtedly a topic of great scientific interest and relevance that can be analyzed under different perspectives and contexts, as depicted in Overall, adverse toxic effects, particularly kava-induced hepatotoxicity, have been a concern regarding the use of kava as an anxiolytic or as a chemotherapeutic/chemopreventive agent against cancer. The highly complex roles of kava in the cancer field should be mentioned. Albeit not mutagenic, kava extracts are considered possibly carcinogenic to humans due to sufficient evidence obtained in experimental animals . Nonethe"}
+{"text": "Psoriasis is a chronic, incurable condition with an erratic course of symptoms and triggers by nature. Psoriasis patients need medical attention that extends beyond only treating skin conditions and joint issues. Because psoriasis is so complex, treating it with medication alone does not work well; comprehensive, whole-person treatment is required. Screening for concomitant diseases including hypertension, dyslipidemia, diabetes mellitus, cardiovascular issues, and their adverse effects like myocardial infarction and stroke is a part of treating psoriasis. Regular screening for these linked illnesses should be done. Essential elements of psoriasis care include co-medication to avoid drug interactions or drug-induced psoriasis, as well as the identification and management of trigger factors. The lack of widely used and established diagnostic criteria restricts these studies. Essential elements of psoriasis management include routine screening for these associated disorders, co-medication to avoid drug interactions or psoriasis caused by drugs, as well as the identification of trigger factors and their management. This short review highlights the effectiveness of dialysis in people with psoriasis and the fact that the benefit is more pronounced with peritoneal dialysis than with hemodialysis. Psoriasis is a chronic, non-communicable illness that affects sufferers' quality of life (QoL) significantly and is unpleasant, disfiguring, and crippling. Although it can happen at any age, the 50 to 69 age range has the highest prevalence -3. PsoriPsoriasis prevalence estimates on a global scale are being provided by an increasing number of population-based research -35. The According to their treatment preferences, 136,529 persons with mild psoriasis and 7,354 people with severe psoriasis were matched with 689,702 unaffected people in a population-based cohort analysis and nested cross-sectional study carried out in the UK. In spite of the absence of the typical risk variables, these analyses found that moderate to severe psoriasis increased the likelihood of chronic renal failure. Regardless of known risk variables, they arrived at the conclusion that moderate to severe psoriasis is linked to moderate to advanced chronic renal disease .Additionally, it has been established that adults with psoriasis are more likely to experience end-stage renal failure and chronic kidney disease. Psoriasis and renal disorders have frequently been documented to coexist in recent years, resulting in the term \u201cpsoriatic nephropathy\u2019\u2019 . Men andThis review article highlights the effects of dialysis in patients with kidney disease and with normal kidney functions having psoriasis.MethodologyThe following is being explored in this review: dialysis in psoriasis and its role to halt the progression of psoriasis with and without kidney disease. A literature search in English was conducted using the electronic databases PubMed, Medline, Embase, and Google Scholar. The search terms were psoriasis and CKD or Renal Disease or Dialysis or Haemodialysis or Peritoneal Dialysis. The archiving of relevant papers was supported by the writers' personal knowledge and experience in the field. Articles that matched the following criteria were included in this review: studies in English; studies from previous years; and studies devoted entirely to the treatment of psoriasis with haemodialysis in patients with and without kidney diseases. The research methodology by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) method is shown in Figure PathophysiologyAccording to a population-based cohort study, moderate to severe psoriasis increases the risk of chronic renal illness without being connected to any known risk factors . T lymphDiscussionMen\u00a0are twice as likely to develop psoriasis as women, and the prevalence of the condition ranges from 0.44% to 2.8% in India. The lack of widely used and established diagnostic criteria restricts these studies. Furthermore, there is virtually no accurate data on the disease's historical trends. There is a link between renal illness and psoriasis as elaborated in Table A study at Penn State University titled 'Moderate to severe psoriasis linked to chronic kidney disease\"  found thThe research team compared 689,702 unaffected people to 7,354 patients with severe psoriasis and 136,529 patients were recorded with intermediate psoriasis. Additionally, they looked at the prevalence of chronic renal illness in 9,000 psoriasis patients who were being monitored prospectively through the electronic medical record. Following a seven-year period of observation, the chance of developing chronic renal illness was greater in people with psoriasis than in the control group. Patients with severe psoriasis were twice as likely to develop CKD and four times more likely to experience renal failure and a need for dialysis. One can still get CKD if only 3% of their skin is damaged by psoriasis. A person is even more likely to develop kidney disease if 10% of their skin is afflicted. Many people with moderate to severe psoriasis undergo treatment with drugs like methotrexate or cyclosporine. However, these drugs can have kidney-related adverse effects . FurtherReduced immunoglobulin G (IgG) levels, theorised elimination of chemicals that promote development from the bloodstream, factors connected to psoriasis, polymorphonuclear leukocyte activation, obstruction of neutrophil migration, and increased levels of fibronectin are some of the factors which may have connections with CKD.On the other hand, several pieces of research link the onset of psoriasis to dialysis-induced growth factors, cytokines, and chemokines. Chronic renal disease is independently predicted by severe psoriasis. Studies that concentrate on elements that both illnesses have in common may be instructive -22.Dialysis\u2019s Effects on Patients With and Without Kidney Disease Who Have PsoriasisThree psoriasis patients who had failed every form of conventional therapy endured 32 hours of peritoneal dialysis per week for 10 weeks. Eighty percent of the psoriatic lesions in two patients disappeared following the course of treatment. The lesions returned in one of these patients two months later, whereas the other patient is still in relative remission a year later. In the third patient, 50% of the lesions cleared up, but two months after the end of the treatment, the lesions returned. This experience and a literature review suggest that dialysis may benefit people with psoriasis and that the benefit is more pronounced with peritoneal dialysis than with haemodialysis -25.One hundred and fifty of the 944 dialysis facilities in Europe reported dealing with psoriasis patients. Ninety-three centres responded to specialised questionnaires on 97 patients with end-stage renal failure (ESRF) and 49 dialyzed for psoriasis patients with normal renal function (NRF patients). Both the patients and \"objective criteria\" subjective perceptions indicated that 17 out of 27 NRF patients had improvements in their skin conditions. However, the majority of these patients had just been on dialysis for 9.9 +/- 11.1 months, which is too little time for psoriasis to spontaneously recur. Those with ESRF, on the other hand, had been receiving dialysis for an average of 45 +/- 3.1 months. After starting dialysis, 20% of these individuals' skin conditions significantly improved. This percentage exceeds the anticipated rate of spontaneous long-term psoriasis remission ,36.Continuous ambulatory peritoneal dialysis (CAPD) was used to treat four psoriasis patients. While the other two were only having treatment for their psoriasis and had normal renal function, the other two were receiving treatment for renal failure. Three to four daily exchanges throughout prolonged therapy  may be necessary to achieve an initial full remission. To prevent relapse, ongoing counselling could also be required. As a result, CAPD offers hope for the research of psoriasis and may serve as a last-ditch remedy for very debilitating cases. Because there is a greater chance of infection, psoriasis therapies have been deemed by experts to be too risky for use in individuals with kidney disease. However, three individuals were given ustekinumab treatment by Japanese experts -43. All Our findings need to be verified, the processes causing renal insufficiency in psoriasis need to be discovered, and further research is needed to determine how treating psoriasis affects the risk of developing chronic kidney disease. Another investigation into how psoriasis and CKD are related is being carried out in a tertiary medical centre in Kerala, India. According to a study, psoriatic people have a higher chance of developing CKD the more severe and persistent their psoriasis is. In this study, there was a positive correlation between the duration of psoriasis and the beginning of CKD .Similar results, i.e., causally attributable renal involvement in patients with psoriasis and factors affecting the same, were seen in an Indian case-control study. After ruling out any secondary causes of renal disease, fifty individuals with verified psoriasis were included, and they came to the following conclusion: The inflammatory milieu was implicated by the positive connection between renal involvement and high-sensitivity CRP (hs-CRP) . AccordiFollowing a report on the accidental disappearance of psoriasis lesions after haemodialysis in 1976, numerous minor investigations followed, each claiming a different outcome. Twardowski additionally treated a non-uremic patient with haemodialysis for psoriasis . IgG depReason to Change From Conventional Psoriasis TreatmentPsoriasis is a chronic, incurable condition with an erratic course of symptoms and triggers by nature. Since the result is frequently lifelong treatment, all treatments must adhere to strict standards and be both highly effective and long-term safe. Treatment for psoriasis is only available to manage symptoms because the cause is still unknown. Treatment options include a wide range of topical and systemic medications as well as phototherapy. Treatment is also necessary to minimise the pain and disability brought on by arthritis. Psoriasis patients need medical attention that extends beyond only treating skin conditions and joint issues. Because psoriasis is so complex, treating it with medication alone does not work well; comprehensive, whole-person treatment is required. Screening for concomitant diseases including hypertension, dyslipidaemia, diabetes mellitus, cardiovascular issues, and their adverse effects like myocardial infarction and stroke is a part of treating psoriasis. Sadness, anxiety issues, and suicidal thoughts are more prevalent among psoriasis patients.In this review article, the relationship between psoriasis and kidney illness was investigated. It has been suggested that psoriasis is a systemic condition rather than only a skin condition. In comparison to controls, patients with psoriasis frequently have hyperlipidaemia, hypertension, coronary artery disease, type 2 diabetes, and increased body mass.Psoriasis's pathophysiology is not entirely known. Previously, it was thought that it was solely brought on by keratinocyte hyperproliferation, but the positive therapeutic effects of immune system-targeting medications today show that there may be an immunoregulation problem. An elevated risk for chronic renal disease is brought on by moderate-to-severe psoriasis and is a separate risk factor. The persistent inflammatory condition that steadily damages all organs, including the kidneys, appears to be linked to the onset of chronic renal failure in psoriasis. Psoriasis and end-stage renal disease are believed to share a number of pathogenetic pathways. Various cytokines, including IL-17, and reactive oxygen species are among them, and psoriasis medications. All of these pathways appear to lead to kidney damage by injuring podocytes. So far, this review article's explanation of the connection between psoriasis and kidney illness has focused on cytokines and reactive oxygen species. There have to be further investigations before a conclusive meta-analysis can be made about the relationship between psoriasis and kidney damage."}
+{"text": "Guyinjian (GYJ) is an ancient classic formula of traditional Chinese medicine used for the treatment of liver and kidney yin deficiency; it was derived from the book \u201cJing Yue Quan Shu\u201d in the Ming Dynasty. Modern clinical observation experiments have shown that GYJ has a definite therapeutic effect on the treatment of gynecological diseases such as kidney deficiency type oligomenorrhea, climacteric syndrome, intermenstrual bleeding, pubertal metrorrhagia, etc. However, the lack of GYJ quality control studies has greatly limited the development of its wider clinical application. In this study, a validated UPLC-MS/MS method was developed successfully for the first time and used to quantify fourteen compounds in GYJ samples with good specificity, linearity (r = 0.9960\u22120.9999), precision (RSD% \u2264 3.18%), stability (RSD% \u2264 2.22%) and accuracy . Simultaneously, the determination results of 15 batches of GYJ samples were analyzed by multivariate statistical methods, and it was found that the compounds have a greater influence on batch-to-batch stability, mainly Rehmannioside D, Loganin, Morroniside, Ginsenoside Re, and 3\u2032,6-Disinapoylsucrose. The proposed new method has the advantages of high sensitivity, high selectivity, and rapid analysis, which provides a reference for the GYJ quality control study. Guyinjian (GYJ), a classical Chinese medicine formula, is derived from the book \u201cJing Yue Quan Shu\u201d, Volume 51, written by Zhang Jingyue in the Ming Dynasty 1640 A.D.). The original book stated that \u201cThis recipe is composed of Ginseng Radix et Rhizoma, Rehmanniae Radix Praeparata, Dioscoreae Rhizoma, Corni Fructus, Polygalae Radix Praeparata, Glycyrrhizae Radix et Rhizoma Praeparata Cum Melle, Schisandrae Chinensis Fructus, and Cuscutae Semen, and it is effective in tonifying the liver and kidney, nourishing Yin and strengthening essence\u201d . Further0 A.D.. TThe index compounds were selected via a literature review, to find the main components of each medicine that exert pharmacological activities; these refer to the quality control components in the \u201cPharmacopoeia of the People\u2019s Republic of China\u201d (2020 edition). Those ultimately selected to be the index components of the GYJ samples were Ginsenoside Re, Ginsenoside Rg1, Ginsenoside Rb1 from Ginseng Radix et Rhizoma; Rehmannioside D and Verbascoside from Rehmanniae Radix Praeparata; Morroniside and Loganin from Corni Fructus; 3\u2032,6-Disinapoylsucrose, Polygalaxanthone III and Tenuifolin from Polygalae Radix Praeparata; Hyperoside from Cuscutae Semen; Schisandrin from Schisandrae Chinensis Fructus; Liquiritin and Glycyrrhizic acid from Glycyrrhizae Radix et Rhizoma Praeparata Cum Melle. The structures of the fourteen constituents are shown in The development and application of mass spectrometry provides a quick and convenient method for the identification and quantification of contents in complex natural medicine extracts, with its superior sensitivity and resolution . Triple To obtain the optimal quantitative extraction, the extraction methods including reflux extraction and ultrasonic extraction were investigated; it was found that there was no significant difference in extraction efficiency between the two methods, so the more convenient ultrasonic extraction method was selected. The preliminary experiment  in GYJ based on HPLC (UV detector)) investigated pure water, 25% methanol, 50% methanol, 75% methanol, 100% methanol, 25% ethanol, 50% ethanol, 75% ethanol, and 100% ethanol, and found that 75% methanol was the best. Therefore, in the process of this experiment, only 50% methanol, 75% methanol, and 100% methanol were investigated when designing the extraction solvent. However, due to the increase of the determining components, the factors to determine the optimal conditions also increased. The results were analyzed comprehensively, and it was discovered that the content of most of the components does not have much variation under the conditions of 50% methanol and 75% methanol; however, Rehmangoside D has better water solubility and is an important index component of the monarch drug Rehmanniae Radix Praeparata. Therefore, the more suitable 50% methanol was selected as the best extraction solvent. The extraction time was investigated for 15 min, 30 min, 45 min, and 60 min, correspondingly, and the results have proven that 45 min of ultrasonic extraction could achieve full extraction. The solid\u2013liquid ratio of 2 mg/mL, 4 mg/mL, 8 mg/mL, and 16 mg/mL was respectivel investigated, and the experimental results show that 8 mg/mL was more suitable. In summary, the final sample extraction conditions were a precise sampling of 0.4 g, precise addition of 50 mL of 50% methanol, and ultrasonic extraction for 45 min.The sample solution was firstly subjected to full scan analysis in MS Scan mode. It was found that among the fourteen interest monitoring components, only Schisandrin did not respond in the negative ion mode, so Schisandrin was selected to be monitored in the positive ion mode, and the remaining thirteen compounds had good response values in the negative ion mode. The SIR parameters of the fourteen compounds were individually optimized to achieve the highest sensitivity and resolution. The optimum cone voltage was determined by comparing the peak areas of each compound at different cone voltages. Taking Schisandrin as an example, the cone voltages were set to 20 v, 25 v, 30 v, 35 v, 40 v, and 45 v, individually. It was found that the peak area of the compound first increased and then decreased with the increase of cone voltage, and when the cone voltage of Schisandrin was 30 v, the peak area was the largest. The summary results of the optimum cone voltages are shown in The results of the specificity experiment showed that the method used for the determination of the fourteen components had no interference from other compounds, and the specificity was excellent. All chromatogram comparison results are shown in The newly established method was used to calculate the content of the above-mentioned fourteen key compounds in 15 batches of GYJ samples by the method of accompanying mixed standard products. Two parallel samples were prepared for each batch, and each sample was acquired twice and accompanied by two needles of the standard. The content results were calculated by applying the ratio of the peak area to the ratio of the concentration and are shown in The results of cluster heatmap analysis are shown in 2 (multidrug resistance-associated protein 2) [2O2-induced damage; further studies suggested that treatment with Morroniside decreased apoptosis, autophagy, and oxidative stress in rat ovarian granulosa cells through the PI3K (phosphatidylinositol 3-kinase)/AKT (serine/threonine-specific protein kinase)/mTOR (mechanistic target of rapamycin) pathway [2 (Janus Kinase 2)/STAT3  and NF-\u03baB (Nuclear factor-\u03baB) signaling pathways and might be a novel effective agent for the treatment of cardiac hypertrophy and heart failure [Owing to the multi-component and multi-target action characteristics of TCM, quality control research has always been a bottleneck on the road to modernization, limiting the benefit to all mankind. The selection of the index components in this study was, as far as possible, made to determine the active compounds related to the formula\u2019s clinical efficacy. In the study exploring the compatibility mechanism of ShengDiHuang Decoction (SDHD) based on the in situ single-pass intestinal perfusion model; by analysing the effects of different concentrations, different pH, intestinal segments, protein inhibitors, and tight junction regulators on SDHD absorption, it was found that Rehmannioside D may undergo active transport, and may be a substrate of BCRP (breast cancer resistance protein) and MRPotein 2) . Recentl pathway . Accordi failure . A quant failure . Liquiri failure . Hyperos failure . Ginseno failure . Researc failure . To sum In this study, an analytical method for the simultaneous quantitative analysis of fourteen components in GYJ samples based on the UPLC-MS/MS technique was developed for the first time. The method has the advantages of high sensitivity, high selectivity, and rapid analysis, which provides a reference for the quality control study and the Ancient Classical Formula research of GYJ granules\u2019 development. In the meantime, through multivariate statistical analysis of the content determination results of 15 batches of GYJ samples in the three production areas, it was found that due to differences in the origins and batches of some medicinal materials, the dispersion degree of each batch was large. Therefore, in order to ensure the stability of subsequent preparation production, quality control research concerning the source of medicinal materials should be strengthened, such as the origin of the medicinal materials, collection period, traits, and specifications. Furthermore, the range standards for the upper and lower limits of content determination for key components should be fixed. Moreover, in the actual production process, manufacturers can also try to design a reasonably mixed batch inputting, so as to make better use of the medicinal materials and ensure the safety and effectiveness of the preparations.Chemical standards of Loganin, Polygalaxanthone III, Liquiritin, Hyperoside, Ginsenoside Re, Ginsenoside Rg1, Ginsenoside Rb1, Tenuifolin, Schisandrin were purchased from the National Institutes for Food and Drug Control ; Morroniside, Verbascoside, 3\u2032,6-Disinapoylsucrose were offered by Chengdu Refensi Biotechnology Co., Ltd. ; Rehmannioside D was obtained from Chengdu Purfield Biotechnology Co., Ltd. ; Glycyrrhizic acid was acquired from Sichuan Vikki Biotechnology Co., Ltd. . The purity and batch number refer to A mixed standard stock solution (in 50% methanol) containing Rehmannioside D (1), Morroniside (2), Loganin (3), Polygalaxanthone III (4), Liquiritin (5), Hyperoside (6), Verbascoside (7), 3\u2032,6-Disinapoylsucrose (8), Ginsenoside Re (9), Ginsenoside Rg1 (10), Ginsenoside Rb1 (11), Tenuifolin (12), Glycyrrhizic acid (13), Schisandrin (14) at concentrations of 20.410 \u00b5g/mL (1), 98.450 \u00b5g/mL (2), 52.975 \u00b5g/mL (3), 1.9650 \u00b5g/mL (4), 24.063 \u00b5g/mL (5), 29.888 \u00b5g/mL (6), 4.7850 \u00b5g/mL (7), 33.575 \u00b5g/mL (8), 5.3675 \u00b5g/mL (9), 2.9850 \u00b5g/mL (10), 6.7000 \u00b5g/mL (11), 3.5380 \u00b5g/mL (12), 37.300 \u00b5g/mL (13), and 8.9600 \u00b5g/mL (14) was prepared. The working standard solutions of different concentrations (0.4082\u201310.205 \u00b5g/mL (1); 1.9690\u201349.225 \u00b5g/mL (2); 1.0595\u201326.488 \u00b5g/mL (3); 0.0393\u20130.9825 \u00b5g/mL (4); 0.4813\u201312.031 \u00b5g/mL (5); 0.5978\u201314.944 \u00b5g/mL (6); 0.0957\u20132.3925 \u00b5g/mL (7); 0.6715\u201316.788 \u00b5g/mL (8); 0.1074\u20132.6838 \u00b5g/mL (9); 0.0597\u20131.4925 \u00b5g/mL (10); 0.1340\u20133.3500 \u00b5g/mL (11); 0.0708\u20131.7690 \u00b5g/mL (12); 0.7460\u201318.650 \u00b5g/mL (13); and 0.1792\u20134.4800 \u00b5g/mL (14)) were prepared by diluting the mixed standard solution with 50% methanol solution. All standard solutions were stored at 4 \u00b0C and filtered by a 0.22 \u00b5m membrane prior to injection.The daily dose of GYJ: 7.46 g of Ginseng Radix et Rhizoma, 14.92 g of Rehmanniae Radix Praeparata, 7.46 g of Dioscoreae Rhizoma, 5.60 g of Corni Fructus, 2.61 g of Polygalae Radix Praeparata (glycyrrhizae radix et rhizoma decoction processed), 5.60 g of Glycyrrhizae Radix et Rhizoma Praeparata Cum Melle, 2.00 g of Schisandrae Chinensis Fructus, 9.33 g of Cuscutae Semen (fried), was taken and placed in a Supor Decoction Casserole. A total of 400 mL of water was added, before soaking it for 60 min, then heating it using a Joyoung electric pottery stove, boiling on a strong fire for 10 min (1800 W), and then using a slow fire (400 W) for 75 min. The medicinal liquid was filtered while still warm (using a 120 mesh filter cloth) to obtain about 140 mL of decoction. Then, the decoction was frozen and rotated in a low-temperature absolute ethanol bath (\u221260 \u00b0C), so that the liquid evenly covered the inner wall of the freeze-dried bottle until it was completely solid. The freeze-dried bottle was stored at \u221280 \u00b0C for 24 h, and dried in a freeze dryer for 18 h to obtain the freeze-dried powder (yellow brown loose powder). Then, 0.4 g of freeze-dried powder was precisely weighed and placed in a 50 mL conical flask with a stopper. A total of 50 mL of 50% methanol solution was accurately added, the sample was then weighed and extracted ultrasonically for 45 min . After ultrasonication, it was placed at room temperature, weighed again, and the lost weight was supplemented with 50% methanol solution. An appropriate amount of extract was then taken and passed through a 0.22 \u00b5m microporous membrane for UPLC-MS analysis.TM UPLC, Milford, MA, USA) with a Triple Quadrupole Mass Spectrometry System  (QQQ-MS). The separation was performed using the ACQUITY UPLC HSS T3 Column  . The mobile phase was composed of acetonitrile + 0.1% formic acid (A) and water + 0.1% formic acid (B) at the flow rate of 0.4 mL/min. The column temperature was 35 \u00b0C, and the injection volume was 1 \u00b5L. The gradient elution of positive ion mode was as follows: 55\u201355% A at 0\u20133 min, 55\u201399% A at 3\u20135 min, and the re-equilibration time was 4 min; The gradient elution of negative ion mode was as follows: 5\u201315% A at 0\u20132 min, 15\u201315% A at 2\u20136 min, 15\u201350% A at 6\u201315 min, 50\u201399% A at 15\u201318 min, and the re-equilibration time was 5 min.All samples were analyzed using UPLC . XSE105 Dual Range Analytical Balance ; MODULYO freeze dryer ; Pipettes ; KQ-250DB Ultrasonic Cleaner ; TB18A1 Supor Decoction Casserole ; H22-X1 Joyoung electric ceramic stove .Specificity, instrumental precision, linearity, repeatability, intermediate precision, stability, and accuracy were investigated during the method validation. Each negative control solution was prepared according to the method of preparation of the sample solutions for specificity investigation. After the instrument was acquired, they were compared and analyzed with the chromatogram of the standard and GYJ sample, which shows whether there were other chromatographic peaks and other interferences in the determination of the specific components in the sample using this method. The relative standard deviations (RSDs) were used to measure precision, stability, and repeatability. Instrument precision was calculated by collecting the mixed standard solution six times continuously and calculating the RSD% of the peak area of each component. For the calibration curves, six different concentrations of working standard solutions were analyzed in triplicate. The calibration curves were calculated by plotting the peak areas of each compound versus its concentration. To confirm the repeatability, six replicates of the same sample were extracted and analyzed. The operation of the intermediate precision experiment was the same as that of the repeatability, the operator and the operation date were changed. The intermediate precision experimental results and the repeatability results were combined to calculate the RSD%, indicating whether the precision of the method met the content determination requirements. For the stability test, the same sample was stored in the sample room and acquired by replicate analysis at 0, 2, 4, 6, 8, 10 and 12 h. The recovery test was performed to evaluate the accuracy of the method. One known amount  of standards was added into a certain number of samples and then these samples were extracted and analyzed using the established method. The recovery of each compound was calculated using the equation: Recovery = /Spiked amount \u00d7 100%.https://cloud.metware.cn/#/tools/tool-form?toolId=169 (accessed on 19 March 2022)) for advanced cluster analysis, advanced PCA, and OPLS-DA analysis.Cluster analysis is often used in the preliminary exploratory analysis of data, which can make data conclusions more concise and intuitive. Principal Component Analysis (PCA) is an algorithm for simplifying datasets and is often used to visualize similarities or differences in multivariate data, which is an unsupervised pattern recognition technique. Orthogonal Partial Least Squares-Discriminant Analysis (OPLS-DA) is a supervised mode, which reduces the dimensionality of the data and facilitates the screening of differential variables that contribute significantly to the grouping. The content results of fourteen key components in fifteen batches of GYJ samples (S1\u2013S15) determined by the method established above were imported into Metware Cloud (One online data analysis platform,"}
+{"text": "The association of serum triglycerides plus waist circumference seems to be a good marker of cardiovascular risk and has been named the \u201chypertriglyceridemic waist\u201d phenotype. The aim of our study was to investigate the association between the hypertriglyceridemic waist phenotype and HDL-cholesterol among patients with heart failure. Cross-sectional study in a tertiary-level hospital in southern Brazil. We included patients with heart failure aged > 40 years. Anthropometric assessment  was performed; body mass index (BMI) and waist-hip ratio were calculated and lipid measurements  were collected. In men and women, respectively, waist circumference \u2265 94 cm and \u2265 80 cm, and triglycerides \u2265 150 mg/dl were considered abnormal and were used to identify the hypertriglyceridemic waist phenotype. Analyses of covariance were used to evaluate possible associations between levels of HDL-cholesterol and the hypertriglyceridemic waist phenotype, according to sex. 112 participants were included, of whom 62.5% were men. The mean age was 61.8 \u00b1 12.3 years and the mean ejection fraction was 40.1 \u00b1 14.7%. Men and woman presented mean HDL-cholesterol of 40.5 \u00b1 14.6 and 40.9 \u00b1 12.7 mg/dl, respectively. The prevalence of the hypertriglyceridemic waist phenotype was 25%. There was a significant difference in mean HDL-cholesterol between men with and without the hypertriglyceridemic waist phenotype , even after adjustment for age, body mass index, type 2 diabetes mellitus, use of statins and heart failure etiology. The hypertriglyceridemic waist phenotype is significantly associated with lower HDL-cholesterol levels in men with heart failure. Heart failure is a complex systemic clinical syndromeAn obesity paradox is commonly reported among patients with heart failure, in which patients with high adiposity have a better prognosis than do individuals who are normal or underweight.,,,,,In addition to abdominal obesity, there has been increasing interest in the role of the atherogenic lipid triad, i.e. hyperinsulinemia, elevated apolipoprotein B and small, dense low density lipoprotein (LDL) particles, in the genesis of coronary artery disease.,,Low high-density lipoprotein-cholesterol (HDL-c) levels are negatively associated with cardiovascular events in individuals with cardiovascular diseases.Lower levels of HDL-c and higher levels of serum triglycerides may lead to a worse prognosis for ischemic heart disease patients.To evaluate a possible association between HDL-cholesterol and hypertriglyceridemic waist in men and women with heart failure.We performed a cross-sectional analysis among patients who had previously been diagnosed with heart failure and who were enrolled at the baseline of a cohort study conducted in a public tertiary hospital. Between 2011 and 2012, these patients were consecutively enrolled if they met the following inclusion criteria: history of New York Heart Association class I-IV heart failure defined by cardiologists in accordance with the American College of Cardiology Foundation/American Heart Association (ACCF/AHA) criteria;Dietitians, medical students and nutrition students administered a questionnaire that asked for clinical data  and sociodemographic data . A field coordinator  was responsible for quality control in relation to the interviews. Patients were also asked about alcohol consumption  and smoking habits, in which they were classified as current smokers, ex-smokers or never smokers.2 for the diagnosis of obesity.An anthropometric assessment was performed at the first clinical evaluation. Weight and height were measured with the patient wearing lightweight clothing and standing barefoot on a flat surface, in accordance with the method proposed by Lohman.Waist and hip circumferences were measured in cm, using an inelastic measuring tape. Waist circumference was measured at the midpoint between the lowest rib and the upper border of iliac crest,The ejection fraction (%) was determined during a transthoracic echocardiogram, using color Doppler and tissue Doppler imaging .For lipid measurements , 10 ml of venous blood was collected from each participant. Lipid concentrations were determined using a standard colorimetric enzymatic method. HDL-c levels (dependent variable) were treated as continuous values for statistical analysis. The lipid profile was considered to be altered if the HDL-c level was below 40 mg/dl in men and 50 mg/dl in women, and if serum triglycerides were above 150 mg/dl in men and women,,Patients were deemed to present hypertriglyceridemic waist (main independent variable) if they had waist circumference \u2265 94 cm (men) or \u2265 80 cm (women) + serum triglycerides \u2265 150 mg/dl.Sample size was calculated using the WinPepi software, version 11.18. The total sample size required for the study was calculated as 76 individuals, by making the assumptions that the prevalence of hypertriglyceridemic waist phenotype would be at least 20% in the sample, with a difference of at least 7 mg/dl in HDL-c levels between patients with and without the hypertriglyceridemic waist phenotype ,Analyses were performed using the Statistical Package for the Social Sciences (SPSS) software, version 17.0 . Continuous variables were expressed as means and standard deviations and categorical variables as absolute values and percentages. Student\u2019s t test (continuous variables) and Pearson\u2019s chi-square or Fisher\u2019s exact test  were used for comparisons. Analyses of covariance (ANCOVA) were used to evaluate possible associations between mean HDL-c and hypertriglyceridemic waist after adjustment for potential confounding factors , separately according to gender. For each analysis, an \u03b1-level = 0.05 was considered significant, and 95% confidence intervals (CI) were shown.The study was approved by the local Research Ethics Committee (CEP-GHC number 10-118), and all patients signed an informed consent statement. There was no external funding for the study.Between July 2011 and January 2012, 112 patients were included, of whom 70 (62.5%) were men. Eighty-five patients (approximately 76%) were classified as New York Heart Association grade III-IV. The patients had a mean age of 61.8 \u00b1 12.3 years, and a mean of 5 \u00b1 3.3 years of educational attainment. Thirteen patients (12%) were smokers, 55 (49%) ex-smokers, and 44 (39%) never smoked; 10 patients (9%) were identified as alcohol abusers. Thirty-seven patients (33%) were diagnosed with type 2 diabetes mellitus, 86 (77%) had hypertension and 38 (34%) had dyslipidemia. The mean ejection fraction was 40.1 \u00b1 14.7%, and 19 patients (17%) were diagnosed with ischemic heart failure. The prevalence of hypertriglyceridemic waist phenotype was 25% (95% CI: 16.8-35.6).2, and 36 patients (32%) were considered obese (BMI \u2265 30 kg/m2). BMI was higher among women (29.7 \u00b1 7.6 kg/m2) than among men (27.6 \u00b1 5.8 kg/m2), but with no statistical difference. Elevated waist-hip ratio was identified in 91 patients (81%), and the waist-hip ratio values were higher among men (0.99 \u00b1 0.11) than among women (0.93 \u00b1 0.07), but with no statistical difference. Regarding the prevalence of enlarged waist circumference according to different cutoff points for detecting higher cardiovascular risk, for \u2265 102 cm among men and \u2265 88 cm among women, there were 26 cases (23.2%) and 32 cases (28.6%), respectively; for \u2265 94 among men and \u2265 80 among women, there were 37 cases (33%) and 46 cases (41.1%). Triglyceride levels \u2265 150 mg/dl were detected in 32 individuals (28.6%).The mean BMI was 28.4 \u00b1 6.5 kg/mNo differences between men and women were observed regarding HDL-c levels (40.5 \u00b1 14.6 mg/dl in men and 40.9 \u00b1 12.7 mg/dl in women), systolic arterial pressure (120.1 \u00b1 17.6 mmHg in men and 124.5 \u00b1 18.7 mmHg in women) or diastolic arterial pressure (74.1 \u00b1 11.8 mmHg in men and 75.1 \u00b1 10.9 mmHg in women).Regarding patients diagnosed with ischemic heart failure, 17 were using statins, of whom three were classified as New York Heart Association grades I and II, and 14 as New York Heart Association grades III and IV, with no statistical difference (P = 0.3) between them. Among the patients with nonischemic heart failure, 36 were using these medications, of whom nine were classified as New York Heart Association grades I and II, and 27 as New York Heart Association grades III and IV, also with no statistical difference (P = 0.9).Mean HDL-c levels in men and women according to presence or absence of the hypertriglyceridemic waist phenotype are shown in To our knowledge, this is the first study to evaluate the presence of the hypertriglyceridemic waist phenotype among individuals with heart failure, and also the association of this phenotype with HDL-c levels. We observed high prevalence of the hypertriglyceridemic waist phenotype in the study group (higher among women than among men), which was associated with HDL-c levels in men after adjusting for age, BMI, diagnosis of type 2 diabetes mellitus, statin use and heart failure etiology. Few studies have investigated the hypertriglyceridemic waist phenotype in Brazil; prevalence of 4.5% was reported among young adultsThe prevalence of the hypertriglyceridemic waist phenotype varies according to the population studied. Gasevic et al.Body fat distribution differs between men and women in the general population,However, an increased waist-hip ratio may also result from loss of muscle and fat mass from the lower limbs, which is usually associated with the aging process and the pathophysiology of heart failure, particularly the more severe forms. In a study by F\u00fclster et al.Hypertrophied visceral adipocytes increase the release of fatty acids via lipolysis and may also contribute towards activation of adipokines involved in inflammation.In our study, no patients who were identified as alcohol abusers had the hypertriglyceridemic waist phenotype. HDL-c plays a key role in reverse cholesterol transport and attenuates the levels of serum triglycerides. Additionally, ethanol seems to increase HDL apolipoprotein A-I and A-II transport rates by increasing hepatic production.We found no significant differences in statin use, heart failure functional class and heart failure etiology between patients with and without the hypertriglyceridemic waist phenotype. According to the American Heart Association,per se leads to reduction of HDL-c, which plays a significant anti-inflammatory role in the etiology of the disease. HDL-c inhibits expression of cell adhesion molecules that promote monocyte infiltration through the endothelium, and decreases the inflammatory process that precedes development of heart failure.A significant association between the hypertriglyceridemic waist phenotype and HDL-c levels was found among men but not among women, even after adjusting for some confounding variables. This finding may be explained by several factors: first, the markedly higher visceral fat accumulation in men in comparison with women, which is accompanied by elevated serum triglycerides and reduced HDL-cSome of the limitations of our study include the facts that this was an exploratory analysis and that the cross-sectional design of the study might point to reverse causality; the small sample size, which may have conferred higher variability and may have lacked power to detect some associations, especially among women; and the fact that the study was carried out in a public tertiary-level hospital that deals with patients with higher prevalence of more severe forms of heart failure, which may limit the generalization of these results.The prevalence of the hypertriglyceridemic waist phenotype among our patients with heart failure was high. Reduced HDL-c levels were observed in men with the hypertriglyceridemic waist phenotype, even after adjusting for age, general adiposity, statin use and diagnosis of type 2 diabetes mellitus. Further studies are still needed to identify better anthropometric indicators for altered metabolic profiles and better predictors of the risk of cardiovascular events in heart failure patients. Also, further studies on other populations would enable discussion and comparison of our findings."}
+{"text": "In genetic association analysis of complex traits, permutation testing can be a valuable tool for assessing significance when the distribution of the test statistic is unknown or not well-approximated. This commonly arises, e.g, in tests of gene-set, pathway or genome-wide significance, or when the statistic is formed by machine learning or data adaptive methods. Existing applications include eQTL mapping, association testing with rare variants, inclusion of admixed individuals in genetic association analysis, and epistasis detection among many others. For genetic association testing in samples with population structure and/or relatedness, use of naive permutation can lead to inflated type 1 error. To address this in quantitative traits, the MVNpermute method was developed. However, for association mapping of a binary trait, the relationship between the mean and variance makes both naive permutation and the MVNpermute method invalid. We propose BRASS, a permutation method for binary traits, for use in association mapping in structured samples. In addition to modeling structure in the sample, BRASS allows for covariates, ascertainment and simultaneous testing of multiple markers, and it accommodates a wide range of test statistics. In simulation studies, we compare BRASS to other permutation and resampling-based methods in a range of scenarios that include population structure, familial relatedness, ascertainment and phenotype model misspecification. In these settings, we demonstrate the superior control of type 1 error by BRASS compared to the other 6 methods considered. We apply BRASS to assess genome-wide significance for association analyses in domestic dog for elbow dysplasia (ED) and idiopathic epilepsy (IE). For both traits we detect previously identified associations, and in addition, for ED, we detect significant association with a SNP on chromosome 35 that was not detected by previous analyses, demonstrating the potential of the method. To determine whether genetic association with a trait is significant, permutation methods are an attractive and popular approach when analytic methods based on distributional assumptions are not available, e.g., when applying machine learning or data adaptive methods, or when performing a multiple testing correction, e.g., to assess region-wide or genome-wide significance in association mapping studies. Existing applications include eQTL mapping, association testing with rare variants, inclusion of admixed individuals in genetic association analysis, and detection of genetic interaction among many others. However, when there is population structure in the sample, naive permutation of the data can lead to inflated significance of the association results. For continuous traits, linear mixed-model based approaches have been proposed for permutation-based tests that can also adjust for sample structure; however, these do not remain valid when applied to binary traits, as key features of binary data are not well accounted for. We propose BRASS, a permutation-based testing method for binary data that incorporates important characteristics of binary data in the trait model, can accommodate relevant covariates and ascertainment, and adjusts for the presence of structure in the sample. In simulations, we demonstrate the superior control of type 1 error by BRASS compared to other methods, and we apply BRASS in the context of correcting for multiple testing in two genome-wide association studies in domestic dog: one for elbow dysplasia and one for idiopathic epilepsy. In genome-wide association studies (GWAS), the primary objective is generally to identify associations between a phenotype of interest and genetic variants. This involves assessing the p-values of certain test statistics by deriving the appropriate null distribution or an asymptotic approximation to it. However, this is not always feasible as the distribution may be intractable. This can arise when the test statistics result from black-box machine learning methods , 2, or iTo overcome these limitations, a common approach is to perform permutation testing so as to obtain replicates of the data under the null hypothesis from which an empirical distribution can be derived , 7. A fuWe propose BRASS (for \u201cbinary trait resampling method adjusting for sample structure\u201d), a permutation procedure for a binary trait which incorporates both covariates and the correlation structure present in the sample. In contrast to the LMM-based approach, it accommodates the binary nature of the trait through a quasi-likelihood framework that considers the effect of covariates on a logit scale in the mean structure as well as the relationship between the trait mean and its variance, both of which are important features of binary data T denotes the phenotype vector for n subjects, X is the n \u00d7 k matrix of k covariates (including an intercept term), which is assumed to be of rank k, G = T is the vector of genotypes at the marker of interest, where iG denotes the minor allele count for the ith individual, \u03b2 is a k-length vector representing the unknown effects of covariates, \u03b3 represents the unknown effect of the genetic marker, \u0393 is an n \u00d7 n diagonal matrix with ith diagonal entry \u03bci(1 \u2212 \u03bci) where \u03bci is the ith element of \u03bc, the n \u00d7 n matrix \u03a3 is given by\u03be \u2208  can be viewed as a heritability parameter, and the n \u00d7 n matrix \u03a6 is generally a kinship or genetic relatedness matrix (GRM).We consider the problem of resampling a binary trait variable that is correlated across individuals, where the correlation can arise from, e.g., population structure or related individuals. Our aim is to derive replicates of the trait under the null hypothesis of no association while accounting for the correlation that is present in the sample but whose structure is unknown. To obtain these replicates, we start by modeling the response using a previously described quasi-likelihood framework for correlated binary traits , 18,\u03bc:=\u03a6 in (\u0393 in (The framework characterized by  and 2)  2) allow\u03a6 in . FurtherH0 : \u03b3 = 0, the remaining unknown parameters are \u03b2 and \u03be, which need to be estimated from the data. The null estimate \u03b3 = 0,\u03b2. In our model with a logit link function, D\u03b2 = \u0393 X.Since we wish to simulate replicates of the binary trait under the null hypothesis of no association, quations  under thThe justification underlying an ordinary permutation test is an assumption of exchangeability under the null hypothesis, which does not generally hold in most situations of correlated data. Instead, we develop and apply an approximate permutation test based on second-order exchangeability, in which we permute a vector, ous work , 11 that\u03b3 = 0, and we let We start by fitting the null model given by Eqs \u03be and let \u03b2. Under the null hypothesis of \u03b3 = 0, let \u03b20 denote the true value of \u03b2, and let \u03bc0, \u03930, D0 and \u03a90 correspond to \u03bc, \u0393, D\u03b2 and \u03a9, respectively, evaluated at \u03b20 and \u03b3 = 0. Similarly, let \u03b3 = 0. We apply a Taylor series expansion to U(\u03b2) around \u03b20, evaluated at To obtain the approximate covariance matrix, we first fix Using the fact that obian in  by its e\u03bc around \u03b20, and evaluated at As Combining  and 8),,8), we gAs a result, we can approximate the covariance matrix of the residuals as\u03a6 through \u03a90 and that introduced from using the estimated mean \u03bc0. We use a factorization C of \u03a90, with \u03a90 = CTC, to remove the correlation due to \u03a6 and obtain,W = CT\u2212\u03930X. The matrix \u03a80 in , independently across i = 1, \u2026, n, where mi is the ith component of the vector\u03a6, Y, X, G, \u03b2 and \u03b3 are as before; u is a multivariate normal random effects vector of length n with u \u223c MVN where \u03c32 is an unknown scalar, and where \u03b3 will be set to zero because the model will be fitted under the null hypothesis of no effect.A logistic mixed model (LogMM) is a natural modeling choice for correlated binary data, and an alternative approach to BRASS for generating replicates of correlated binary data could be to fit a LogMM under the null hypothesis and then generate binary replicates from the fitted model. We have developed such an approach, which we call LogMM-PQL. The model underlying LogMM-PQL is that, conditional on \u03b3 set to zero, we use GMMAT to obtain estimates Y from the LogMM specified by \u03b2, \u03b3, \u03c32) set equal to The major difficulty with use of LogMMs in the GWAS context is that they are computationally challenging to fit as they involve high-dimensional integrals. Therefore, their use can involve a trade-off between computational feasibility and accuracy of the results. For the parameter estimation part of LogMM-PQL, we use a fast penalized quasi-likelihood (PQL) approach, as implemented in GMMAT . With \u03b3 Y = X\u03b2 + e, with In addition to BRASS and LogMM-PQL, the other resampling methods we compare in simulations include the previously proposed MVNpermute , 11, as mod, MVNpermutemod and Naivemod, respectively, where the subscript \u201cmod\u201d indicates that the trait replicate has been modified to convert it to binary. To convert a continuous trait replicate Y\u03c0 to binary, a threshold is set and the values of Y\u03c0 above and below that threshold are converted to 1 and 0, respectively, with the threshold chosen so that the original trait Y and the binary replicate Y\u03c0 have the same case/control proportions.While the LogMM-PQL replicates are binary, those from BRASS, MVNpermute and Naive are not. However, we consider alternative approaches based on converting these replicates to binary, referred to as BRASSThe features of the various methods are summarized and compared in All 7 resampling strategies described above involve fitting a trait model that incorporates the structure present in the sample. A common approach to modeling trait correlation due to additive polygenic effects is to include a GRM in a LMM for the trait so as to model the structure using random effects . AlternaWhen generating replicates, it is of course important to accurately model the structure present in the sample, but in addition, it is also important to avoid creating new structure (not present in the data) as an artifact of the replication procedure. To do this, we recommend the use of leave-one-chromosome-out (LOCO) GRMs , 24 in tm markers and the aim is to assess the significance of the smallest p-value out of the m association tests. This context would arise in testing significance of a genomic region or in assessing genome-wide significance. We simulate non-causal markers that are tested for association with a binary trait and estimate the significance threshold for the top signal amongst them using the empirical distribution from trait replicates generated under the null hypothesis of no association. Genotype, trait and covariates are generated under multiple simulation settings. In real data applications, the true trait model is usually not known a priori, and it can be important to assess the impact of model misspecification on type 1 error [We perform simulation studies to compare the effectiveness of the 7 proposed permutation-based methods for generating binary trait replicates in the context of correcting for multiple testing, with both population structure and pedigree structure present in the sample. We consider a setting in which a binary trait is tested for association with each of  1 error . We consi, j) of simulated data set i and permutation method j, for 1 \u2264 i \u2264 20, 000 and 1 \u2264 j \u2264 7, and for each of these, 10,000 permutation replicates are drawn for data set i using permutation method j; (3) analysis of permutation replicates, where for each trio  of simulated data set i, permutation method j, and permutation replicate k, 1 \u2264 k \u2264 10, 000, the trait in permutation replicate k is tested for association with each of the m non-causal markers in data set i, the smallest p-value is recorded in each case, and then the resulting 10,000 p-values for each pair  are used to estimate a genomewide significance threshold (at level \u03b1 = 10\u22123) for data set i based on permutation method j; and (4) evaluation of the type 1 error rate of the genomewide threshold for each permutation method j by comparing the smallest p-value for each data set i to the threshold determined in (3) for pair  and assessing whether the overall proportion of rejections among the 20,000 data sets is significantly different from \u03b1 for method j. We now describe each of these stages.For each setting, we perform a simulation study consisting of 4 stages: (1) data set creation, i.e., simulation of genotype and trait data under the null hypothesis of no association, with 20,000 data sets per setting; (2) generation of permutation replicates, in which we consider every possible pair . We simulate multiple pedigrees of the same configuration  due to covariate effects and additive polygenic random effects, the fraction of this variance due to covariates is fixed at 20%, 40%, 60% or 80% (while the remaining fraction is due to additive polygenic random effects), and so that Bernoulli error explains on average either (a) about 20% of the total phenotypic variability, resulting in a prevalence of 30% or (b) about 55% of the total phenotypic variability, resulting in a prevalence of 5%. In addition, the effect size of the standard normal covariate is set so that the p-value for its significance in a LMM Wald test is on average 0.05. (This is the covariate that is set to be missing in the settings in which an important covariate is missing from the observed data set.) The second generative model we use is a liability threshold model:iL is the latent liability for individual i, and \u03b2, \u03f5 is constrained to be about 20% of the total phenotypic variability, and the prevalence is set to either 30% or 5%. In both Mc causal SNPs, m = 100 non-causal SNPs are generated as above and used for testing under the null hypothesis of no association. (Further details on the stage (1) simulations can be found in For stage (1) data set creation, we simulate genotypes using a 2 sub-population Balding-Nichols model  with F =guration , with eqXi\u03b2+Wi\u03b1,where Xi+Wi\u03b1+\u03f5i,where LiXi\u03b2+Wi\u03b1,where Xi+Wi\u03b1+\u03f5i,where Limod, MVNpermutemod, and Naivemod). For a given data set, the same covariate and GRM information is input to each of the 7 permutation methods. The GRM \u03a6 is calculated using the Mc causal markers, and then D = 1 top PC is removed from \u03a6 using equation 4 of a previous work [We now describe stage (2) generation of permutation replicates for each data set and for each of the 7 permutation methods  of data set and permutation method, the 104 permutation replicates from method j are each tested for association against the panel of m SNPs in data set i, and the smallest p-value among the m SNPs is recorded for each permutation replicate, resulting in 104 p-values for pair . The genome-wide threshold value, corresponding to significance level \u03b1, for pair  is estimated by the 100\u03b1th percentile of the p-values observed for that pair. In principle, any association testing method could be used for the stage (3) association tests, provided that the same method is also used in stage (4). One consideration is that only four of the permutation methods we examine create binary replicates, while the other three create non-binary, real-valued replicates. Whether having non-binary replicates is problematic or not depends on the method of analysis. For example, it is not a problem if the data are analyzed using a linear mixed model or using the CARAT [G in the data. Our modification is to replace this with D is the number of PCs removed from the GRM, and Z is the n \u00d7 (D + 1) matrix whose columns are the D eigenvectors that are removed as well as a columns of ones. , for each pair  for the pair  and assessing whether the overall proportion of rejections out of 20,000 data sets is significantly different from the nominal level \u03b1 for method j. To make our massive simulation project more computationally efficient, we actually used an adaptive procedure so that, e.g., if a dataset is sufficiently far from the significance threshold based on analysis of the first 103 permutation replicates, it would not be necessary to analyze the remainder of the 104 permutation replicates , we evaluate the type 1 error of the genomewide threshold for each permutation method mod and MVNpermutemod, control of the type 1 error is improved compared to the corresponding original methods when covariates strongly influence the phenotypic mean, and for BRASSmod, type 1 error control is worse compared to BRASS. All of the methods except BRASS show inflated type 1 error in at least one setting, whereas BRASS maintains the correct type 1 error rate in all settings.We assess and compare the performance of the 7 proposed resampling methods in the context of correcting for multiple testing, with both population and pedigree structure present in the sample in addition to important covariates. As the true model for the trait is generally unknown in an association study, we are interested in assessing robustness of the type 1 error results to model misspecification. Thus, we also perform simulations in which the phenotype is simulated from a liability threshold model, which is more dissimilar to the models fit by BRASS and LogMM-PQL than logistic is. The type 1 error results for the liability threshold model are shown in We assess the robustness of the type 1 error results when an important covariate is omitted from both the fitted model and the model used for generating replicates. As it is usually not known a priori which variables should be kept in the analysis, one would commonly try including different combinations of covariates to finally determine the ones to include in the final model. It may occur that one of the covariates has a moderate effect on the trait and leads to a p-value close to the significance threshold (e.g. 0.05). Hence, a judgment call would be required for whether to keep the covariate in the model and one may decide to exclude it. It is thus of interest to see how the proposed methods would fare in such a scenario as the replicates generated would come from a more misspecified model.The simulation results are displayed in We determine the robustness of the proposed methods when trait-based ascertainment has been applied to the sample. This is commonly used in case-control studies where individuals are included in the sample based on their disease affection status, such as if the prevalence of the trait in the population is too low to obtain sufficient power.mod show significantly inflated type 1 error in every setting, while both MVNpermute and Naive give excessively conservative results when covariates have a major impact on the trait and tend to give significantly inflated results when the effect of covariates is low.The results are shown in Figs Finally, we consider a scenario that simultaneously combines multiple features of the previous settings: (1) ascertainment from a prevalence of 5% to a case-control ratio of 3:7; (2) model misspecification in which the true model is a liability-threshold model, which is more dissimilar to the models fit by BRASS and LogMM-PQL than logistic is; and (3) model misspecification due to an important covariate being missing. The results are shown in From the results across all the simulation settings, with and without ascertainment or model misspecification, it can be seen that BRASS provides the best type 1 error control and is the only method that does not have significantly inflated type 1 error in any setting.We apply BRASS to the problem of determining genome-wide significance for GWAS of two different traits in domestic dog. Unlike with humans, a genome-wide threshold for significance in domestic dog GWAS has not been well established. We analyze data from a large domestic dog study , with 4,\u22128 corresponding to a genomewide p-value of .0008 obtained from BRASS. For ED, we detect 3 loci, summarized in Manhattan plots of the p-values of the single-SNP tests for the observed data are presented in \u03b3 = 0 needs to be fitted, which includes specifying covariates and a GRM \u03a6. If not provided, obtaining the eigen decomposition of \u03a6 is the main computationally intensive step involved in fitting the null model [\u03a6, and hence \u03a80 in (O(n3). By using the singular value decomposition of the matrix W in (O(nk2) (assuming the number of covariates k < n), we are able to obtain the eigenvectors of L replicates is O(n2L); this computation can easily be parallelized to generate sets of traits replicates independently.In order to generate replicates from BRASS, the null model given by Eqs ll model . HoweverC^TV^ in  need to or \u03a80 in ), which rix W in , which ihttps://github.com/joellesophya/BRASS. We report run times for BRASS in simulated data. Using a single processor on a machine with 6 core Intel Xeon 3.50 GHz CPUs and 32 GB RAM, on simulated data with 1,000, 5,000 and 10,000 individuals, it takes 1.6 s, 1 min and 4.6 min (275 s), respectively, to generate 1,000 trait replicates. As the use of BRASS will vary based on the context , the computational burden involved in comparing the statistic between the observed trait and its replicates will vary based on what statistic is being considered.BRASS is implemented in a freely downloadable software package at https://doi.org/10.5061/dryad.266k4 [ad.266k4 In genetic studies of binary traits, it may often be of interest to assess significance of a test statistic whose distribution is unknown or not well-approximated, or to assess significance of the maximum of many correlated tests. Examples could include test statistics based on machine learning methods , rare vaWe propose BRASS, a novel permutation-based resampling procedure for generating binary trait replicates in samples with population structure, cryptic relatedness and/or family structure. BRASS allows for covariates and ascertainment, and it accommodates a wide range of test statistics. It uses an estimating equation approach that can be viewed as a hybrid of logistic regression and linear mixed-effects model methods, which allows for use of a GRM and/or principal components or other ancestry-informative covariates to account for sample structure. BRASS relies on obtaining an invertible transformation of phenotypic residuals to achieve approximate second-order exchangeability. After permutation, new trait replicates are obtained by inverting the transformation, in order to preserve structure present in the original sample. BRASS differs from existing methods such as Naive and MVNpermute  in that In simulations, we demonstrate the superior type 1 error control of BRASS compared to other methods. Across simulation settings, we find that BRASS maintains control of the type 1 error under varying amounts of population structure, familial relatedness, ascertainment and sources of trait model misspecification. In contrast, all 6 of the other methods we consider show significant inflation of type 1 error in multiple settings. In addition, the Naive and MVNpermute methods, which are two of the 4 methods that are based on an LMM, are excessively conservative when covariate effects are substantial. Taken together, the results show that simply accounting for the sample structure with an LMM, without incorporating key features associated with the binary nature of the trait such as nonlinear scale for covariate effects and the dependence of the variance on the mean, is not sufficient to obtain replicates that correctly estimate the null distribution of the statistic. Secondarily, we find that when polygenic effects are important, adjusting for the correlation in the residuals prior to permutation, as is done in BRASS and MVNpermute leads to better control of the type 1 error compared to ignoring it, as is done when permuting the raw residuals from a LMM (Naive method). Furthermore, we find that the additional step of binarizing the quantitative replicates results in improvement in the accuracy of the type 1 error rate for the LMM-based methods when the polygenic component has a low impact on the trait distribution relative to covariates, but does not control the type 1 error when more structure is present in the sample.In principle, use of a logistic mixed model would seem to be a natural and promising alternative to BRASS for fitting the binary trait data and generating appropriate replicates that preserve the correlation structure. However, for LogMM-PQL, we observe significant inflation in the type 1 error rate, with the amount of inflation increasing as the confounding due to structure present in the sample increases. This is likely explained by the use of PQL to fit the LogMM, as PQL is known to be fast but to give biased estimates in binary data . HoweverWe applied BRASS in the context of multiple testing correction in association mapping studies of ED and IE in domestic dogs. In the analysis of ED, we detected genomewide significant association with 3 loci, 2 of which were previously reported , with thBRASS is designed as a very flexible tool that can be used in a range of situations in which replicates of correlated binary data are needed. Because BRASS generates replicates of the phenotype, it can be used with a variety of genetic predictors. For example, it could be directly applied to association testing of haplotypes, to association testing of variants on sex chromosomes, or to tests of GxE or GxG interaction. Although imbalanced case-control ratio can have an impact on some association testing methods, it would not be expected to have any particular impact on generation of BRASS replicates, because 1) the appropriate modeling of the connection between the mean and the variance for binary data means the method does not break down for small or large probabilities, in contrast to an LMM, and 2) the asymptotic approximations used for inference in logistic regression are not needed in BRASS. In our simulation results, for the settings with imbalanced case-control ratio Click here for additional data file.S1 Fig(PDF)Click here for additional data file.S2 Fig(PDF)Click here for additional data file.S1 Table(PDF)Click here for additional data file. 28 May 2023Dear Dr McPeek,Thank you very much for submitting your Methods entitled 'BRASS: Permutation methods for binary traits in genetic association studies with structured samples' to PLOS Genetics.Both reviewers have evaluated the manuscript and found the study interesting\u00a0and valuable. They made however consistent comments in terms of challenging the simulations studies: more complex population structure and a simulation that combines all the complications that were considered separately in your initial set of simulations. We do not see the addition of more complex population structure as essential, though it may be interesting and relatively straightforward\u00a0to investigate that point. However, the point about combining ascertainment, imbalanced case-control ration,\u00a0missing covariates and phenotype misspecification is an interesting one, and should be relatively easy to implement given that most of these features have been considered separately. No analytical strategy is perfect and this combination may break the permutation scheme, but that would be interesting to report.Should you decide to revise the manuscript for further consideration here, your revisions should address the specific points made by each reviewer. We will also require a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript.plosgenetics@plos.org.If you decide to revise the manuscript for further consideration at PLOS Genetics, please aim to resubmit within the next 60 days, unless it will take extra time to address the concerns of the reviewers, in which case we would appreciate an expected resubmission date by email to Submission Checklist.If present, accompanying reviewer attachments are included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our\u00a0https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocolsTo enhance the reproducibility of your results, we recommend that you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option to publish peer-reviewed clinical study protocols. Read more information on sharing protocols at data availability policy\u00a0requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as \"data not shown\" or \"unpublished results\" in manuscripts. All points should be backed up by data provided with the submission.Please be aware that our\u00a0Preflight Analysis and Conversion Engine\u00a0(PACE) digital diagnostic tool.\u00a0 PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org.While revising your submission, please upload your figure files to the\u00a0Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process.PLOS has incorporated\u00a0To resubmit, use the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder.We are sorry that we cannot be more positive about your manuscript at this stage. Please do not hesitate to contact us if you have any concerns or questions.Yours sincerely,Vincent PlagnolAcademic EditorPLOS GeneticsDavid BaldingSection EditorPLOS GeneticsComments to the Authors:Reviewer's Reviewer #1:\u00a0This paper described novel permutation methods to assess genome-wide significance in structured population. This is a timely topic that has not been well addressed in the literature. The authors have described relevant work in background and proposed a new residual-based permutation method in binary trait association mapping. Simulation studies were performed to compare their methods with other permutation methods and demonstrated well controlled type I error. The proposed method was applied to the dog GWAS study and identified a new association. My specific comments are as follows:1. In the simulation study, the genotype data were generated using 2 sub-population model. How does BRASS perform with more complex population structure, such as more sub-populations and admixture?2. In the real data analysis with dog GWAS, the original paper described more than two phenotypes. What is the motivation that this study focused on ED and IE? It would be beneficial for readers to see the performance of BRASS across more phenotypes in this dataset. Another option could be the demonstration of BRASS in multiple studies.Reviewer #2:\u00a0The review report is uploaded as an attachment.**********Have all data underlying the figures and results presented in the manuscript been provided?PLOS Geneticsdata availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Large-scale datasets should be made available via a public repository as described in the Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article , and click on the Fetch/Validate link next to the ORCID field.\u00a0 This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager.In the meantime, please log into Editorial Manager at If you have a press-related query, or would like to know about making your underlying data available , please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date.Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics!Yours sincerely,Vincent PlagnolAcademic EditorPLOS GeneticsDavid BaldingSection EditorPLOS Geneticswww.plosgenetics.orgTwitter: @PLOSGenetics----------------------------------------------------Comments to the Authors:Reviewer's Reviewer #1:\u00a0Although the authors did not consider more sub-populations, they expanded their simulations to address ascertainment, imbalanced, case-control ratio, missing covariates and phenotype misspecification. For data analysis, the authors justified their choices of two phenotypes in the dog GWAS, which I'm fine with.Reviewer #2:\u00a0Thank you to the authors for addressing my previous comments. I have no further comments on the revised paper.**********Have all data underlying the figures and results presented in the manuscript been provided?PLOS Geneticsdata availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information.Large-scale datasets should be made available via a public repository as described in the Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes**********what does this mean?). If published, this will include your full peer review and any attached files.PLOS authors have the option to publish the peer review history of their article , one way to make that data available is to deposit it in the\u00a0The following link will take you to the Dryad record for your article, so you won't have to re\u2010enter its bibliographic information, and can upload your files directly:\u00a0http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-23-00252R1http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support.More information about depositing data in Dryad is available at data availability policy\u00a0requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present.Additionally, please be aware that our\u00a0----------------------------------------------------Press Queriesplosgenetics@plos.org.If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via  30 Oct 2023PGENETICS-D-23-00252R1 BRASS: Permutation methods for binary traits in genetic association studies with structured samples Dear Dr McPeek, We are pleased to inform you that your manuscript entitled \"BRASS: Permutation methods for binary traits in genetic association studies with structured samples\" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course.The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers.Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards,Lilla HorvathPLOS GeneticsOn behalf of:The PLOS Genetics TeamCarlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdomplosgenetics@plos.org | +44 (0) 1223-442823plosgenetics.org | Twitter: @PLOSGenetics"
\ No newline at end of file