diff --git "a/deduped/dedup_0575.jsonl" "b/deduped/dedup_0575.jsonl" new file mode 100644--- /dev/null +++ "b/deduped/dedup_0575.jsonl" @@ -0,0 +1,60 @@ +{"text": "Urinary polyamine (UPA) excretion patterns were measured in 39 patients with clinically evaluable epithelial ovarian cancer immediately before they were treated with a cycle of chemotherapy and 24-48 h after chemotherapy to ascertain if changes in UPA excretion patterns correlated with eventual response to treatment. Almost all of the 19 patients who responded to chemotherapy had a rise in the excretion of all UPA fractions after treatment while most patients with chemoresistant cancer showed only an increase in the excretion of the putrescine and spermine fractions. However, a two-fold increase in excretion of the spermidine fractions occurred exclusively in patients who would eventually respond to chemotherapy. This phenomenon was not seen in patients with chemoresistant cancer. If, 48 h after chemotherapy, a patient with epithelial ovarian cancer does not show at least a doubling of the urinary levels of spermidine, acetylspermidine or total polyamine excretion that chemotherapy should be stopped since it is unlikely to be effective."} +{"text": "To determine if the chemotherapy resistance of non-small cell lung cancer could be modified by oral verapamil, 72 patients were entered into a randomised trial of verapamil plus chemotherapy vs the same chemotherapy alone. Verapamil 480 mg day-1 was given for 3 days starting 24 h prior to chemotherapy which consisted of bolus vindesine 7 mg followed by ifosfamide/mesna 5 g m-2 over 24 h, followed by mesna alone for a further 8 h. Cycles were repeated every 3 weeks for up to six courses. Sixty-six patients were eligible for tumour response analysis and responses occurred in 41% of those randomised to chemotherapy plus verapamil and in 18% of those randomised to chemotherapy alone (P = 0.057). Median survival from start of treatment was significantly better in the verapamil arm (P = 0.02). Toxicity of the combination of chemotherapy plus verapamil was principally neurological and was manageable. Thus the addition of oral verapamil to vindesine/ifosfamide chemotherapy is feasible and in this study was associated with improved outcome. Further confirmation of these observations is required in non-small cell lung cancer, a tumour characterised by resistance to conventional chemotherapy."} +{"text": "An overview is presented of 23 trials of adjuvant chemotherapy in squamous cell carcinoma of the head and neck. These were reviewed from the point of view of design of the trial, analysis of survival, response rates, meta-analysis, site of failure, toxicity and cost. The minimal increase in survival that could be detected ranged from 11 to 51%, with a median of 25%. No trial was big enough to detect the likely increase of survival, which is 5%. Many trials excluded some eligible patients before randomisation, the proportion being 21% in those series with details. A further 9% of treated patients were excluded from analysis. A response rate in four induction studies of 47% equated with a 6% increase in cancer mortality. Meta-analysis showed an insignificant overall improvement in cancer mortality of 0.5%. Induction chemotherapy, synchronous chemotherapy and induction/maintenance chemotherapy did not affect cancer mortality whereas synchronous/maintenance therapy did. Cisplatinum, methotrexate, bleomycin, 5-FU and a variety of other regimens did not affect the death rate from cancer, but the combination of VBM significantly increased it. Neither single agent nor combination chemotherapy produced a significant reduction of cancer deaths. The rate of locoregional failure was significantly lower in the treated arms, whereas the metastatic rate was similar in both arms. Only three papers gave full details of toxicity with grading: these showed a high toxicity rate. The mortality rate from chemotherapy in nine series averaged 6.5%."} +{"text": "The value of chemotherapy in advanced non-small cell lung cancer (NSCLC) remains contentious. Because of this two separate but very similar trials were set up in Australia and Southampton (UK). Two hundred and one patients with stage IIIb or IV NSCLC were randomly assigned to cisplatin 120 mg m-2 on days 1 and 29 and vindesine 3 mg m-2 weekly x 6 or to no chemotherapy. Both groups were eligible to receive radiotherapy or other palliative treatment as required. Of 188 evaluable patients, 97 received chemotherapy and 91 were in the control arm. Response was assessed between days 42 and 49. Responders continued chemotherapy at the same doses though cisplatin being given 6 weekly x 4 and the vindesine 2 weekly x 12. The overall response rate to chemotherapy was 28%; there were no significant differences according to major prognostic criteria. Although the overall survival of the chemotherapy group (median 27 weeks) was longer than that of the no chemotherapy group (median 17 weeks) this was not statistically significant (log rank P = 0.33). For patients without dissemination (IIIb), median survival was 45 weeks in the chemotherapy arm and 26 weeks in the non-chemotherapy (log rank P = 0.075). Toxicity was universal and frequently severe: of 17 patients discontinuing chemotherapy after one cycle, 13 did so because of unacceptable toxicity. This chemotherapy cannot be recommended as routine treatment. Further phase III studies of chemotherapy in advanced NSCLC should continue to use a no chemotherapy control and should also attempt to measure quality of life, an issue not addressed effectively in this or other recent trials."} +{"text": "A total of 610 patients with small cell lung cancer were entered into a randomised trial designed to assess the effect of duration of initial chemotherapy on survival. Patients were randomised to receive either four or eight courses of cytotoxic chemotherapy with cyclophosphamide, vincristine and etoposide and also randomised to receive, on disease progression, either second line chemotherapy (methotrexate and doxorubicin) or symptomatic treatment only. In the whole study 196 (32.1%) had limited disease and 414 (67.9%) extensive disease. During initial chemotherapy the response rate after four courses of treatment was 61% with no significant increase in patients receiving eight courses (63%). In those randomised to receive relapse chemotherapy the response rate was improved slightly for those who had originally received four courses of chemotherapy (25.6%) over those receiving eight (18.7%). The overall results show that of the four possible treatment randomizations, four courses of chemotherapy alone is inferior in terms of overall survival to the other three treatment options . In patients responding to initial chemotherapy the disadvantage of four courses of chemotherapy alone was apparent but not if drug treatment was given on relapse. The study shows that limiting treatment to four courses of chemotherapy alone is associated with inferior survival, but this is not the case if chemotherapy is given at relapse."} +{"text": "Acinetobacter spp. pneumonia differs from hospital-acquired pneumonias (HAPs) caused by other agents with respect to therapeutic success and survival rate.The principal aim of the present study was to determine whether Acinetobacter spp. [n = 63] or non-Acinetobacter spp. [n = 77]). The groups were compared in terms of risk factors, therapeutic success and six-week survival rates.This study includes 140 adult patients diagnosed with HAPs caused by identified etiologic agents between March 2005 and February 2006. These patients were divided into two groups according to the agent responsible for their infection . We found that the use of the appropriate antibiotics for the treatment of Acinetobacter spp. pneumonia was an important factor in survival (P < 0.001).Previous antibiotic use and the risk of aspiration were independent factors responsible for the development of Acinetobacter spp. pneumonia do not differ from HAPs associated with non-Acinetobacter spp. in terms of therapeutic success and survival rates.The outcomes of Acinetobacter species are Gram-negative, nonfermentative, nonspore-forming, nonmotile, aerobic coccobacillary organisms. The prevalence of infections caused by Acinetobacter spp. has increased rapidly since the 1970s. and those with HAP caused by a non-Acinetobacter spp. .This study included 140 adult patients with HAP of known etiologic agent, admitted to the Trakya University Medical Faculty Hospital between March 2005 and February 2006. When the etiologic agent of their pneumonia could be identified, the patients were divided into two groups: those with HAP caused by an Hospital-acquired pneumonia: Hospital-acquired pneumonia was defined according to the standard definitions of the American Thoracic Society guidelines for the management of adults with hospital-acquired pneumonia.Ventilator-associated pneumonia: Pneumonia that developed 48 h after being connected to a ventilator was accepted as VAP.HAP developed in patients undergoing immunosuppressive therapy: HAP developed in patients undergoing immunosuppressive therapy for solid organ tumors, hematologic malignancy, or rheumatoid disease. The use of >20 mg corticosteroid for at least 3 weeks was assumed the required criteria for being considered as immunosuppressive therapy.Pneumonias that developed >4 days after hospitalization were considered late-onset pneumonias.Patients were considered to have severe HAP in the presence of one of the following criteria:2)/fractioned oxygen percentage (FiO2) < 250;arterial oxygen pressure was defined as resistance to more than one of the following five drug classes: antipseudomonal cephalosporins, antipseudomonal carbapenems, \u03b2-lactam/\u03b2-lactamase inhibitor combinations, antipseudomonal fluoroquinolones and aminoglycosides.Clinical success was marked by a decline or disappearance of symptoms in the patients receiving antibiotic therapy.Appropriate antibiotherapy: The patients were given at least three days of antibiotics appropriate to the antibiogram of the identified etiologic agent.Data obtained from the patients included in the study were collected prospectively. The approval of the local Ethical Committee was obtained during the planning phase of the study and each patient (or his/her caregivers) gave informed consent prior to participation in the study. The patients' demographic data, risk factors and the severity and the day of onset of the pneumonia were recorded. Chest X-rays, blood count, biochemical parameters, arterial blood gases and CRP were obtained from each patient prior to the initiation of therapy. Blood and sputum/tracheal aspirate cultures (if possible) were also obtained. Sputum/tracheal aspirate specimens containing >25 leukocytes per field and <10 epithelial cells per field were deemed acceptable for culture. Pleural fluid samples were obtained from patients with previously detected pleural effusions. Computed thoracic tomography was performed as required.The decisions pertaining to the diagnosis and treatment of HAP were managed multidisciplinarily by the clinician responsible for the care of the patient, the pulmonary disease specialist, and the infectious disease specialist. Clinically recovered patients were discharged after posttreatment evaluation. Discharged patients were called for follow-up at the sixth week.P < 0.1 were analysed using a multivariate Cox regression model.Descriptive statistics and frequency analyses were calculated for the different types of cases. Kaplan-Meier methods were used for the survival analysis. Univariate Cox regression analysis was used to assess factors that might independently affect mortality. After the univariate analysis, variables with Acinetobacter vs. non-Acinetobacter). Multivariate logistic regression analysis with a backward stepwise method was used to examine significant factors (P < 0.10) obtained from a univariate model.Univariate logistic regression analysis was used to examine independent risk factors on the outcome statistical software.A Acinetobacter spp. were isolated, 38 (60%) were male and 25 (40%) were female. The mean age was 64.43 \u00b1 13.89 years, with a range of 35 to 95 years. Thirty-eight of these patients were hospitalized in the internal medicine service, whereas 25 patients were hospitalized in the surgery service. The clinical services from which Acinetobacter spp. were most frequently grown were neurology and brain surgery . In patients in whom Acinetobacter spp. were isolated, 43 had HAP, 17 had VAP and 3 had pneumonia that developed during immunosuppressive therapy. In the group in which etiologic agents other than Acinetobacter spp. were isolated, 45 had HAP, 17 had VAP and 15 had pneumonia that developed during immunosuppressive therapy (P = 0.027).Of the 63 patients in whom Acinetobacter spp. infections were isolated from the 63 patients followed during the course of the study. Of these, 49 were isolated from tracheal aspirates, 5 from blood and tracheal aspirates, 1 from pleural fluid and 15 from blood cultures . Three different Acinetobacter spp. strains were isolated from 2 patients, whereas 2 different Acinetobacter spp. strains were isolated from 3 patients. When the demographic characteristics and risk factors of the patients were compared between the groups from which Acinetobacter spp. and other causative agents were isolated, the risk factors with a P- value of < 0.1 according to univariate analysis were examined by multivariate analysis [P = 0.02) and the risk for aspiration (P = 0.02) were determined to be significant risk factors in the group from which Acinetobacter spp. were isolated. Previous antibiotic use and aspiration risk increased the risk for Acinetobacter spp. infection nearly three-fold and nearly 2.5-fold , respectively [Seventy analysis . Previouectively . after the follow-up (sixth week). In the group from which an agent other than Acinetobacter spp. was isolated, clinical success rates were 43 and 32%, respectively, and no significant difference was determined between these rates (P = 0.8).Clinical success after treatment was achieved in 26 patients (41.3%) from whom rd, 7th, 14th and 42nd days were 87, 76, 65 and 35%, respectively. No significant difference was determined in terms of survival rates between the group in which Acinetobacter spp. were isolated and the groups in which agents other than Acinetobacter spp. were isolated [Acinetobacter spp. strains were evaluated for sensitivity and resistance to imipenem, no difference was demonstrated in terms of survival in patients with pneumonia in whom non-Acinetobacter spp. were grown (P = 0.77).Forty-one of 63 patients (65%) died during the six-week period. According to the Kaplan-Meier survival analysis, the survival rates at the 3isolated . When AcAcinetobacter spp. group, only Acinetobacter spp. were isolated from 34 patients, and in 29 patients, the isolated agents were polymicrobial. In the control group, a single agent was isolated in 62 patients, while polymicrobial agents were isolated from 15 patients. In neither group were the effects on mortality dependent upon the causative agent(s) being single or polymicrobial.In the Acinetobacter and non-Acinetobacter spp. groups, there were no significant differences among the patients who were exitus before receiving the appropriate antibiotics (P = 0.57). It was found that the appropriate antibiotic treatment for Acinetobacter spp. was significant in the survival rate in the Acinetobacter spp. group (P < 0.001), while it was nearly significant in the non-Acinetobacter spp. group (P = 0.054). However, among the patients who were appropriately treated with antibiotics in both groups, no significant differences in terms of survival were found (P = 0.20). For the Acinetobacter spp. group, mortality increased 5.01 times when the patient did not receive the appropriate antibiotics [In both the ibiotics .Acinetobacter spp. pneumonia was analysed by univariate Cox regression analysis [P-value of < 0.1, according to the univariate analysis, were evaluated with multivariate analysis. Hypoalbuminemia (P = 0.04), steroid use (P = 0.002), and the use of a mechanical ventilator (P = 0.036) were determined as factors that independently affected survival. The risk of mortality was increased 3.24-fold by hypoalbuminemia , 3.07-fold by steroid use and 2.19-fold by the use of a mechanical ventilator . We intended to determine whether Acinetobacter spp. pneumonia and non-Acinetobacter spp. pneumonia in English literature.[We found only two studies comparing terature.4 HoweverAcinetobacter spp. pneumonia were defined as neurologic problems and aspiration, previous antibiotic use and being connected to a ventilator.[Acinetobacter spp. pneumonia nearly 3-fold, and previous antibiotic use increased the risk for Acinetobacter spp. pneumonia nearly 2.5-fold. Similar to our study, another study which evaluated VAPs that grew Acinetobacter spp. (n = 41) versus non-Acinetobacter spp. (n = 40) found that previous antibiotic use was determined to be a risk factor for ventilator-associated Acinetobacter spp. pneumonia, according to multivariate analysis.[Acinetobacter spp. and 79 VAPs associated with other pathogens, previous ceftriaxone and ciprofloxacin use were determined to be significant risk factors.[Risk factors for ntilator.9\u201312 In tspp. n = 1 versus Acinetobacter spp. pneumonia was recently identified as an important cause of mortality, particularly among patients who acquire pneumonia in ICUs. We found the high proportion of Acinetobacter spp. pneumonia among HAP in our institution to be very significant. In 63 of the 140 patients with HAP included in the study, Acinetobacter spp. were the responsible agents. This situation shows that, in our hospital, there are problems with regard to infection control measures and antibiotic use.Acinetobacter spp. are difficult to treat and are associated with high mortality. Carbapenems are frequently used in such patients; however, resistance develops rapidly.[Acinetobacter spp. strains grown in the present study were susceptible to netilmicin (93%) and cefepime (69%). The susceptibility rate to imipenem was 39%. MDR Acinetobacter spp. strains were grown in 64 (91%) patients. In a study previously performed in our hospital, the susceptibility of imipenem in Acinetobacter spp. strains between 1994 and 1995 was 100%, which was then reduced to 35% between 2003 and 2004.[Acinetobacter spp. strains, resistance to ceftazidime, imipenem and ciprofloxacin was determined to be 60, 64 and 80%, respectively, and the most susceptible antibiotic was cefoperazone-sulbactam.[Acinetobacter spp. cases are resistant to most drugs, the use of these antibiotics could affect the results of Acinetobacter spp. pneumonia treatment.Infections caused by MDR rapidly. The Acinand 2004. In Turkeulbactam. Since tiAcinetobacter spp. was isolated, the clinical success rate after treatment was 41%, which was reduced to 35% after follow-up. No significant difference was shown between the groups in which Acinetobacter spp. and non-Acinetobacter spp. were isolated in terms of clinical success, after both treatment and follow-up. Although the number of patients in whom pneumonia developed while under immunosuppressive therapy was significantly higher in the non-Acinetobacter spp. agent group, no significant difference was found between the two groups in terms of survival rates. There was also no significant difference in terms of survival rates between the patients with pneumonia caused by imipenem-susceptible or -resistant Acinetobacter spp. strains and the patients with non-Acinetobacter spp. In a study performed in patients with VAP, survival was evaluated between groups in which Acinetobacter spp. (imipenem-susceptible - imipenem-resistant) and non-Acinetobacter spp. were isolated. Similar to the present study, no difference was found between the two groups in terms of survival.[3Acinetobacter spp. group.In patients in whom urvival.317 In theAcinetobacter spp., no study evaluating mortality-associated risk factors in patients with only HAP and with Acinetobacter spp. growth exists in the literature.[When the mortality-associated risk factors were evaluated, it was shown that hypoalbuminemia, steroid use and the use of a mechanical ventilator increased mortality. Although there are studies investigating the risk factors affecting in-hospital mortality in ventilator-associated pneumonias caused by terature.18Acinetobacter spp. pneumonia does not differ from HAPs caused by non-Acinetobacter spp. agents in terms of therapeutic success and survival rate. Patients with HAPs caused by Acinetobacter spp. have a high risk of aspiration, the incidence of which is gradually increasing in patients who have previously received antibiotic therapy.In conclusion,"} +{"text": "There is no information available on the relation between response to chemotherapy and the high-risk phenotype assessed by uPA and/or PAI-1. The clinical situation of neoadjuvant chemotherapy provides a means of rapidly assessing the sensitivity of the primary tumour to cytotoxic drug regimens. The goal of the study was to assess prospectively the predictive value of PAI-1 for response to first-line chemotherapy. PAI-1 concentration was measured on hypertonic cytosolic extracts (0.4 M potassium chloride) by ELISA before chemotherapy on a drill biopsy sample of the tumour in 69 T2 and T3 breast cancer patients (median age 46 years). Oestrogen receptor (ER) (51% ER+), progesterone receptor (PR) (58% PR+), S-phase (median 4.0%) and ploidy were also assessed in the majority of cases. The clinical response to treatment was evaluated after four cycles of FAC or FEC regimen (one cycle every 4th week). PAI-1 could be assayed in 29 post-chemotherapy surgical samples. The objective response rate was 59% (41 out of 69). PAI-1 expressed as gram of tissue (range 19-2370 ng g(-1) tissue) was highly correlated (r = 0.98) to PAI-1 expressed as mg protein (range 0.5-68 ng mg(-1) protein). No correlation between PAI-1 level and response could be observed, with any cut-off. The post- and pre-chemotherapy PAI-1 levels were correlated (r = 0.66). Of all biological parameters, only high S-phase (cut-off 5%) was slightly correlated to response. These data suggest that PAI-1 is not a predictive marker of response to chemotherapy in breast cancer and that its level is not altered by neoadjuvant chemotherapy."} +{"text": "Short-term fasting (48 hours) was shown to be effective in protecting normal cells and mice but not cancer cells against high dose chemotherapy, termed Differential Stress Resistance (DSR), but the feasibility and effect of fasting in cancer patients undergoing chemotherapy is unknown. Here we describe 10 cases in which patients diagnosed with a variety of malignancies had voluntarily fasted prior to (48-140 hours) and/or following (5-56 hours) chemotherapy. None of these patients, who received an average of 4 cycles of various chemotherapy drugs in combination with fasting, reported significant side effects caused by the fasting itself other than hunger and lightheadedness. Chemotherapy associated toxicity was graded according to the Common Terminology Criteria for Adverse Events (CTCAE) of the National Cancer Institute (NCI). The six patients who underwent chemotherapy with or without fasting reported a reduction in fatigue, weakness, and gastrointestinal side effects while fasting. In those patients whose cancer progression could be assessed, fasting did not prevent the chemotherapy-induced reduction of tumor volume or tumor markers. Although the 10 cases presented here suggest that fasting in combination with chemotherapy is feasible, safe, and has the potential to ameliorate side effects caused by chemotherapies, they are not meant to establish practice guidelines for patients undergoing chemotherapy. Only controlled-randomized clinical trials will determine the effect of fasting on clinical outcomes including quality of life and therapeutic index. Chemotherapy can extend survival in patients diagnosed with a wide range of malignancies. However, side effects caused by toxicity to normal cells and tissues limit chemotherapy dose density and intensity, which may compromise efficacy. For instance, the cardiotoxicity and nephrotoxicity associated with the widely prescribed anti-cancer drugs, doxorubicin and cisplatin respectively limit their full therapeutic potential ,4. Thus,ad libitum fed mice, fasting protected against the chemotoxicity without compromising the killing of neuroblastoma cells [Calorie restriction (CR) is an effective and reproducible intervention for increasing life span, reducing oxidative damage, enhancing stress resistance and delaying/preventing aging and age-associated diseases such as cancer in various species, including mammals -8. Recenma cells . Previous human studies have shown that alternate day dietary restriction and short-term fasting (5 days) are well tolerated and safe -12. In fHere, we report 10 cases of patients diagnosed with various types of cancer, who have voluntarily fasted prior to and following chemotherapy. The results presented here, which are based on self-assessed health outcomes , are presented in this case series report. Four suffered from breast cancer, two from prostate cancer, and one each from ovarian, uterine, non small cell carcinoma of the lung, and esophageal adenocarcinoma. All patientsvoluntarily fasted for a total of 48 to 140 hours prior to and/or 5 to 56 hours following chemotherapy administered by their treating oncologists Table , Table 3ad libitum diet) but did not drop during the first and forthcycles (fasting), and cyclophosphamide(CTX). She fasted prior to her first chemotherapy administration. The fasting regimen consisted of a complete caloric deprivation for 140 hours prior and 40 hours after chemotherapy , during which she consumed only water and vitamins. The patient completed this prolonged fasting without major inconvenience and lost 7 pounds, which were recovered by the end of the treatment Figure . After t, Figure . After t, Figure , C and Dad libitum diet (data not shown). Although a combination of three chemotherapeutic agents were used during this cycle, self-reported sideeffects were consistently less severe compared to cycles in which calories were consumed ad lib in the esophageal mass,the adrenal gland metastases, and the lung nodule. From the sixth to eight cycle, the patient fasted prior to and following chemotherapy treatments combined with cisplatin(CDDP) concurrent with radiation for the first two cycles. Throughout these first two cycles, the patient experienced multiple side effects including severe weakness, fatigue, mucositis, vomits and grade 2-3 peripheral neuropathy . Bevacizumab was added to the treatment and only then did the PSA drop significantly (data not shown). Throughout the cycles with chemotherapy the patient experienced significant side effects including fatigue, weakness, metallic taste, dizziness, forgetfulness, short-term memory impairment and peripheral neuropathy . Once again the patient suffered significant side effects she had experienced severe weakness and fatigue which limited any physical activity. No significant differences were observed in the patient's blood analysis . A staging PET scan documented a hypermetabolic lung mass, multiple mediastinal and left perihilar lymph nodes, and widespread metastatic disease to the bones, liver, spleen, and pancreas. The initial treatment commenced with the administration of TAX 75 mg/mt Figure . During t Figure . Cumulatt Figure . In the s Figure -G. The lThis is a 74 year-old woman diagnosed in 2008 with stage IV uterine papillary serous carcinoma. Surgery followed by adjuvant chemotherapy were recommended. Due to significant enlargement of the right ureter, a right nephrectomy was also performed. Post-operatively, six cycles of CBDCA (480mg) and paclitaxel (280mg) were administered every 21-days. During the first treatment the patient maintained her regular diet and experienced fatigue, weakness, hair loss, headache and gastrointestinal discomfort Figure . By cont2), the patient experienced prolonged neutropenia , but again developed prolonged neutropenia and thrombocytopenia, causing dose delays. For the third and subsequent cycles, the patient fasted for 62 hours prior to and 24 hours after chemotherapy. The patient not only did not find hardship on carrying out the fasting but also showed a faster recovery of her blood cell counts, allowing the completion of the chemotherapy regimen (gemcitabine 720mg/m2 on day 1 plus gemcitabine 720mg/m2 and TAX 80mg/m2 on day 8). During the fifth cycle, she fasted under the same regimen and received a full dose of gemcitabine (900mg/m2) and TAX (Table ad libitum diet) gemcitabinealone induced prolonged thrombocytopenia, which took 11 and 12 days to recover, respectively in July 2007. Surgery (TAH-BSO) revealed stage IA carcinosarcoma of the ovary with no lymph node involvement. Adjuvant treatment consisted of six cycles of ifosfamide and CDDP, administered from July to November of 2007. She remained free of disease until an MRI revealed multiple new pulmonary nodules in August 2008. Consequently chemotherapy with taxol, carboplatin and bevacizumab was initiated. By November, however, a CT scan showed progression of the cancer. Treatment was changed to gemcitabine plus TAX complemented with G-CSF (Neulasta) brachytherapy and external beam radiation with Intensity Modulated Radiation Therapy (IMRT) to the prostate and pelvis. In April 2008, a Combidex scan revealed a 3 x 5 cm pelvic mass and left hydronephrosis prompting initiation of TAX chemotherapy supplemented with G-CSF. The patient received 60-75 mg/mapyTable . The 2) and CTX (600mg/m2) every 21 days. For all 4 cycles the patient fasted 64 hours prior to and 24 hours post chemotherapy administration in 2008. After a lumpectomy procedure, she received 4 cycles of adjuvant chemotherapy with TAX combined with CTX (1100mg/dose) followed by weekly paclitaxel and trastuzumab for 12 weeks. Prior to her first chemotherapy treatment, the patient fasted for 48 hours and reported no adverse effects. During the second and subsequent cycles the patient fasted for 60 hours prior to the chemotherapy followed by 5 hours post drug administration (Table mg/dose c2) complemented with G-CSF (Neulasta), followed by 6 months of trastuzumab , TAX associated chemotherapy cycles cycles in which the patient received the same chemotherapy drugs at the same dose. There was a general and substantial reduction in the self-reported side effects in combination with fasting . We obtained self-reported assessments of toxicity from all 10 patients who incorporated fasting with their chemotherapy treatments. Since many of the chemotoxicities are cumulative, we evaluated serial data including all the combined fasting- and non-fasting (IGF-IR +/-) or its downstream elements have been shown to be more resistant against multiple chemotherapy agents and oxidative stress, respectively [Challenging conditions such as fasting or severe CR stimulate organisms to suppress growth and reproduction, and divert the energy towards cellular maintenance and repair to maximize the chance of survival ,19. In sectively ,27. ectively ,28. Altectively , which wIn summary, in this small and heterogeneous group of cancer patients, fasting was well-tolerated and was associated with a self-reported reduction in multiple chemotherapy-induced side effects. Although bias could affect the estimation of the side effects by the patients, the case reports presented here are in agreement with the results obtained in animal studies and provide preliminary data indicating that fasting is feasible, safe and has the potential to differentially protect normal and cancer cells against chemotherapy in humans. Nevertheless, only a clinical trial, such as the randomized controlled clinical trial currently carried out at the USC Norris Cancer Cen-ter, can establish whether fasting protects normal cells and increases the therapeutic index of chemotherapies. From April 2008 to August 2009, 10 unrelated patients diagnosed with a variety of cancer volunteered to incorporate fasting with their chemo-treatments. We invited these patients to complete a self-assessment survey based on the Common Terminology Criteria for Adverse Events of The National Cancer Institute version 3.0. For the purpose of this study only, we developed a questionnaire that contained 16 easy identifiable and commonly reported side effects; the seriousness of the symptoms was graded from 0 to 4 with each consecutive number corresponding to no side effect/mild/moderate/severe and life threatening. Adverse effects were further divided into 3 major categories including, general, gastrointestinal and central/peripheral nervous system side effects, (Table Supplementary Figure 1 Data represent average of CTCAE grade reported by all the patients in this study. 18 chemotherapy cycles under ad-lib diet were compared to 46 chemo-fasting cycles. Supplementary Table 1Supplementary Table 2TableS2.docx Supplementary material is found at"} +{"text": "To prospectively evaluate the prevalence of hepatitis B virus (HBV) positivity and study the evolution of HBV profile during cancer chemotherapy, serum HBV markers and liver biochemistry were determined in 1008 of 1402 (72%) cancer patients admitted in our Unit and in all 920 (91%) who received chemotherapy. We found that 54 (5.3%) were HBsAg carriers while 443 (44%) had at least one HBV marker positive. Of the latter, 405 (91%) were HBcAb+ve, 321 (72%) HBsAb+ve and 212 (48%) HBeAb+ve. No patient was HBeAg+ve. Among 920 chemotherapy receivers, 374 (41%) were HBcAb+ve, 280 (30%) HBsAb+ve and 178 (19%) HBeAb+ve. Fifty (5.4%) were HBsAg carriers (versus 0.6% in Greek blood donors). All 50 were systematically screened for HBsAg and HBsAb status throughout chemotherapy, during follow-up or until their death, and liver biochemistry was performed before each chemotherapy course. Stable antigenaemia was observed in 43/50 (86%) while 7/50 (14%) developed clinical and/or biochemical hepatitis. Six of these seven developed serum anti-HBs antibodies with an associated decrease of serum HBsAg titres. We conclude that reactivation of HBV infection during chemotherapy is not rare (14%), while disappearance of HBs antigenaemia is neither a frequent nor usually a permanent phenomenon. \u00a9 1999 Cancer Research Campaign"} +{"text": "Saccharomyces yeasts are an important model system in many areas of biological research. Very little is known about their ecology and evolution in the wild, but interest in this natural history is growing. Extensive work with lab strains in the last century uncovered the Saccharomyces life cycle. When nutrient limited, a diploid yeast cell will form four haploid spores encased in a protective outer layer called the ascus. Confinement within the ascus is thought to enforce mating between products of the same meiotic division, minimizing outcrossing in this stage of the life cycle.S. cerevisiae and S. paradoxus strains isolated from woodlands in North America, we set up trials in which pairs of asci were placed in contact with one another and allowed to germinate. We observed outcrossing in \u223c40% of the trials, and multiple outcrossing events in trials with three asci in contact with each other. When entire populations of densely crowded asci germinated, \u223c10\u201325% of the resulting colonies were outcrossed. There were differences between the species with S. cerevisiae having an increased tendency to outcross in mass mating conditions.Using a set of Our results highlight the potential for random mating between spores in natural strains, even in the presence of asci. If this type of mating does occur in nature and it is between close relatives, then a great deal of mating behavior may be undetectable from genome sequences. Therefore, when spores of the opposite mating type from one ascus mate with each other (forming a MATa/MAT\u03b1 diploid), heterozygosity is maintained only at loci linked to the MAT locus or to a centromere. Genomic observations such as an enrichment of essential genes linked to centromeres seem to support the idea that an advantage of heterozygosity despite intra-ascus mating could be an important force shaping genome organization Since the dawn of yeast research, the life cycle has surpS. cerevisiae is found in vineyards S. paradoxus in temperate, deciduous woodlands S. paradoxus suggest that both inbreeding and outcrossing occur, as signatures of both clonal and recombining population genetic structures have been detected S. paradoxus, Tsai et al. (2008) estimated that when mating occurs, 94% of the time it is intratetrad mating, 5% of the time it is mating type switching, and the remaining 1% of the time it is outcrossing.Genomic and population genetic studies of populations of S. cerevisiae have identified uncultivated genetic lineages, as well as domesticated lineages associated with humans; recombination between these lineages has been detected S. cerevisiae; in one clonality was observed S. cerevisiae in New Zealand, 20% of matings were estimated to be outcrossed Large-scale global studies of In both species, outcrossing has been detected within populations; however, the stage of the life cycle in which it occurs is unknown. Since direct observations of mating in the wild are not possible, we assayed the frequency of outcrossing in individual trials in which two or three asci were placed in contact with one another, and in mass mating assays of dense sporulated populations using natural strains.S. cerevisiae and six S. paradoxus from sympatric woodland populations in eastern North America ho::KANMX4ho::NATMX4, and ho::HYGMX4a and \u03b1 strains were isolated by tetrad dissection and subsequently mated to create diploids homozygous for the resistance. Due to the deletion of HO, these strains were unable to mating-type switch. In order to determine whether the loss of this ability had an effect on the rate of outcrossing, five of the six original S. cerevisiae strains were transformed again, but the antibiotic resistance gene was targeted to an intergenic region near the MAT locus . Once transformed, the strains were sporulated and dissected. All spores autodiploidized, confirming the ability to switch mating-type and allowing for the isolation of diploids homozygous for the antibiotic resistance. We analyzed six Growth occurred in YPD liquid and for the individual trials, sporulation was on solid medium S. cerevisiae and 1 S. paradoxus strains, and 16 containing 1 S. cerevisiae and 2 S. paradoxus strains.Using a micromanipulator and Zeiss Axioskop FS microscope, two asci from different strains with different antibiotic resistances were placed in pairs in contact with one another on agar plates; 32 pairs were set up on each plate. Once colonies formed, the mating plates were replica plated to single antibiotic plates to verify the viability of at least one spore in each ascus and then to double antibiotic plates to ascertain outcrossing. Only colonies with viable spores from both asci were included for analysis. At least 25 trials were performed for each pair-wise combination of the twelve heterothallic strains (average 37). All combinations of the five homothallic strains were assayed with at least 32 trials for each (average 56). The frequency of outcrossing for a strain combination was estimated from these multiple trials and considered to be one observation in the statistical analysis. For the three-way outcrossing trials, the same procedure was used, but mating plates were replica plated to three single antibiotic plates, then to three double antibiotic plates. Randomly chosen strain combinations were performed : fifteen containing 2 S. paradoxus strains grew to a slightly lower density; therefore, for interspecies combinations, 350 \u00b5l of S. paradoxus were combined with 300 \u00b5l of S. cerevisiae. 24 h later, 3 samples from each mating plate were plated on permissive medium and subsequently replica plated to double antibiotic plates to estimate outcrossing frequency. Mass mating assays were performed once for each of all the pair-wise combinations of the twelve heterothallic strains, as well as for all combinations of the five homothallic S. cerevisiae strains.Strains were grown in 3ml of YPD with vigorous shaking for 2\u20133 days, which led to high rates of sporulation, as measured using a haemocytometer. 300 \u00b5l of each of two cultures with different antibiotic resistances were combined, washed, resuspended in 500\u00b5l of water, and plated on 60mm SOE plates, which created a dense lawn of asci on the mating plate. Samples were taken to estimate the starting ratio of the strains. m, then 2aqamp double antibiotic colonies are expected, where ap and aq are the frequency of asci of each strain in the combined culture . The starting ratio of the strains, as well as the proportion of asci in a culture, were used to estimate ap and aq.If outcrossing occurs randomly with a rate of We performed a two-way ANOVA in JMP with species and assay as the main effects; both were considered fixed. For each strain combination, outcrossing frequency was measured once per assay and treated as one observation in the statistical analysis; therefore strain effects could not be tested. To test whether homothallism had an effect on the frequency of outcrossing, we performed a two-way ANOVA with planned comparisons and considered both mating ability and assay to be fixed effects.S. cerevisiae- 40%, within S. paradoxus- 43%, interspecies- 42%; see S. cerevisiae- 10%, S. paradoxus- 11%, and interspecies- 10.5%.In individual ascus-to-ascus trials, we found high frequencies of outcrossing and no significant differences between intra- and inter-species trials , significant variation among assay type and a significant assay*species interaction . Using a Tukey's Honestly Significant Difference test, we found that the outcrossing rate of S. cerevisiae in mass mating assays was significantly greater than all other assay and species combinations.Overall, we found a significant difference between the outcrossing rates of the species . As in the case with the heterothallic strains, there was more outcrossing in the mass mating assays, (p\u200a=\u200a0.004). Overall, there were no significant effects due to mating ability or the interaction between mating ability and assay .To be sure that the high rate of outcrossing we observed was not inflated due to the absence of the ability to switch mating-types, we constructed a second set of e assays . We founSaccharomyces yeasts, it is uncertain which of the two assays more closely mimics natural conditions. Because intact asci probably don't migrate, and therefore neighboring asci are likely to be closely related , it is unclear whether this form of mating would impact the frequency of random mating in a population and therefore have an effect on the population genetic structure. This may be a reason why inter-ascus mating has been overlooked in other studies investigating the frequency of intratetrad mating Our results clearly demonstrate that the ascus does not physically enforce inbreeding. When environmental conditions become favorable, free yeast spores germinate and then either bud or mate Saccharomyces paradoxus, respectively, to estimate the frequency of asexual and sexual reproduction by comparing the genetic diversity presumably contributed by mutation and recombination. They used their estimates of rho to calculate the frequency of each type of sexual event: mating-type switching, intra-ascus mating, and random mating. By comparing diversity surrounding the MAT locus to the rest of chromosome III, they estimated the frequency of intra-ascus mating . Once they estimated the frequency of intra-ascus mating to be 94%, they added 1% for outcrossing/random mating (using a previous estimate based on observed heterozygosity in a population survey) and presumed the last 5% of the time mating-type switching occurred. They did not consider the possibility of inter-ascus mating. If two asci were closely related (descendants from the same mother cell), inter-ascus mating would be another form of inbreeding that could have contributed to the decrease in diversity on chromosome III, and would not be differentiated from intra-ascus mating in their analysis. Conversely, if two asci were unrelated and inter-ascus mating occurred, then it would be counted as part of the estimate of random mating (outcrossing).Tsai et al. used genomic data from 8 and 12 strains from a Far Eastern and a European population of MAT locus, when intra-ascus mating occurs, heterozygosity is also preserved at sequences closely linked to centromeres . To assay intra-ascus mating, Taxis et al. constructed a yeast strain that was heterozygous (hphr/kanr) at a locus near a centromere, and heterozygous (+/natr) at a locus for an essential mitosis gene on a different chromosome. A culture of asci was exposed to growth medium and subsequently sampled to determine the antibiotic resistances of the sample colonies. The authors found that 75%\u201380% of the sampled colonies contained all three markers, which they interpreted as resulting from intra-ascus mating between non-sister spores; the remaining 20\u201325% of the diploid colonies did not contain all three antibiotic markers. Some of these remaining colonies had clonat resistance and had only one of the other markers (hphr/hphr or kanr/kanr). These colonies were interpreted as being the result of \u201cmating upon germination but not between sister spores\u201d. They also observed colonies that lacked clonat resistance (+/+) and had any combination of the other two markers. They interpreted these colonies as deriving from \u201cother types of mating\u201d. All of the matings they observed that did not have all three markers are consistent with inter-ascus mating . If one lists all the different mating combinations possible in the previously described experiment , there are 16 possibilities, four of which cannot grow and survive because they lack an essential mitotic gene. Another four of the sixteen should contain all three antibiotic markers. The final eight constitute the combinations lumped into the two \u201cother\u201d categories in their analysis. If inter-ascus mating did occur in their experiment, and when it did, it occurred randomly with respect to their antibiotic markers, then the 20\u201325% that they observed that did not contain all three markers could potentially represent half of the inter-ascus mating events. If that were true, then the estimate of inter-ascus mating would be similar to the frequency we observed in our experiments (up to 40%).In another study that investigated intra-ascus mating, Taxis et al. conducted a series of experiments to show that based on nutrient availability the number of spores produced in an ascus is a self-organizing system and may be optimized so that yeast can return to the diploid state without intervening mitotic divisions. One experiment in their study is particulary relevant to the discussion here. Since all centromeres are in effect linked to the Although some studies of yeast populations have found evidence for outcrossing and recombination, others have not. We see three ways to reconcile our observation of frequent mating between spores from different asci with the apparent rarity of outcrossing among the genome sequences of natural isolates. The first is that the estimates based on comparative genomics may either underestimate the frequency of inter-ascus mating (as explained above) or may not be relevant to within population dynamics. The estimate of 1 recombination event in 50,000 cell divisions provided by Ruderfer et al. is based on comparing strains from different global and ecological lineages and may accurately reflect inter-lineage dynamics; however, it may not reflect outcrossing and mating dynamics within lineages and populations in vineyards and woodlands. The second possibility is that although the ascus structure does not prevent matings between asci, due to ecological circumstances in some populations, ascus density is low enough that they are rarely in contact. The final possibility is that, because of intervening clonal growth between sexual events, neighboring asci are usually closely related, so mating between them has little or no detectable effect on population genetic structure. While much of the population and genomic data have supported yeast's reputation as an inbred organism, the ascus should no longer be considered the chief cause.Figure S1S. cerevisiae. A) 0 hours: intact asci that are being placed in permissive medium. B) 3 hours later, the asci appear flat and the spores begin to swell. C) 4 hours after being placed into permissive medium, the spores are germinating out of the ascus. D) 5 hours after initial exposure, budding cells are visible, as are masses of cells that were once asci. E\u2013H) In the center of each photo are examples of outcrossing between two asci, all were taken at 5 hours.Photos of the time course in a mass-mating assay with (0.27 MB TIF)Click here for additional data file.Text S1(0.05 MB DOC)Click here for additional data file."} +{"text": "Purpose. Original articles and abstracts published between January 1991 and January 1997were selected according to specified criteria and reviewed to provide answers to five interesting questions about thesystemic treatment of metastatic osteosarcoma. Results. (1) In patients with metastatic disease at presentation, what is the outcome after intensive multi-agent chemotherapy? Historically, survival has been poor, but may be improving with the use of ifosfamide-containing regimens. (2) Can response to new agents be evaluated better in patients who have received no previous chemotherapy? Based on limited data, this is probably true. (3) Is the response to neo-adjuvant chemotherapy, as determined by histopathology, similar for the primary tumor andsynchronous pulmonary metastases? With intensive multi-agent chemotherapy, good histological response rates are in the range 70\u201390% for both groups. (4) What is the outcome, after intensive combined modality treatment with chemotherapy and surgery, in patientsrelapsing with metastases after previous adjuvant chemotherapy, and what are the important prognostic factors? Outcome is highly variable, but 5-year survival ranges between 25 and 50% and a good outcome is more likely ifrecurrent disease is limited to resectable lung metastases. (5) Can a biological agent (L-MTP-PE) prolong the time to relapse in patients with resected metastatic osteosarcoma? Preliminary data suggest that this is possible, but more studies are required."} +{"text": "Intra-peritoneal (i.p.) chemotherapy is an encouraging treatment option for ovarian cancer with peritoneum involvement in addition with intravenous (i.v.) chemotherapy. Intra-operative i.p. chemotherapy is an interesting method of administration by enhancing the diffusion of chemotherapy. This study had assessed the feasibility of intra-operative i.p. chemotherapy in patients with peritoneal carcinoma of ovarian cancer.From January 2003 to February 2006, 47 patients with stage III ovarian cancer were treated with standard paclitaxel carboplatin intravenous chemotherapy and debulking surgery with intra-operative i.p. chemotherapy. After optimal cytoreductive surgery, defined by no unresectable residual disease > 1 cm, i.p. chemotherapy was performed during surgery. The peritoneal cavity was filled by 3 litres of isotonic saline pre-heated at 37 degrees and 90 mg of cisplatin. The sequence was repeated twice during 2 hours based on previous published studies which optimized the cisplatin dosage and exposure duration. Optimal diffusion was obtained by stirring by hands during the 2 hours.Median age was 59.6 years. No severe haematological or non-haematological toxicity induced by intra operative i.p. chemotherapy was reported. No patient died due to the complications of surgery or the i.p. chemotherapy. No neurotoxicity occurred, and one patients had renal impairment.This study demonstrates the feasibility of intra-operative i.p. chemotherapy with cisplatin after optimal resection of peritoneal tumor nodules. Further randomized trials are planned to investigate the clinical benefit of this therapeutic modality. Ovarian cancer is the leading cause of gynaecologic cancer-related death in most industrialized countries and the fifth cause of cancer death among women -3. Appro2) over 3 hours and area under the (AUC) curve targeted to 5 for carboplatin over 30 minutes on day 1, every 3 weeks. This chemotherapy was followed by debulking surgery with intra operative i.p. chemotherapy using cisplatin. Initial debulking surgery was performed when complete tumoral resection seemed feasible. In 31 cases this initial surgery seemed not possible and induction chemotherapy was administered. In 16 patients initial debulking surgery was performed and appeared to be suboptimal with major residual lesions in 7 cases. In all cases, complementary systemic chemotherapy with paclitaxel and carboplatin was administered. This chemotherapy was followed by a second look surgery with or without tumoral debulking and with the administration of intraperitoneal chemotherapy if residual disease was smaller than 10 mm. After debuloking surgery, 2 to 4 additional cycles of paclitaxel/carboplatin chemotherapy were administered. In 16 patients, treatment included initial debulking surgery followed by 6 to 8 cycles of i.v. paclitaxel/carboplatin chemotherapy. Then, second-look surgery with intra-operative i.p. ciplatin chemotherapy was performed. In all cases, an optimal cytoreductive surgery, defined by no unresectable residual disease larger than 10 mm, was achieved either at presentation or after completion of induction chemotherapy. Intraoperative i.p. chemotherapy was performed according to Royer et al description using the optimization suggested by pharmacokinetics analysis (Figure 2 cisplatin [2 during 2 hours i.p. chemotherapy resulted in an early dramatic decrease in i.p. drug concentration, below the targeted threshold for activity within 15 minutes. The author suggested that performing twice 1 hour i.p. cisplatin chemotherapy should increase the length of peritoneal exposure to a local cytotoxic dose [Intra-peritoneal administration of chemotherapy is commonly performed at a distance from surgery by an i.p. catheter with artificial ascites ,24. Womeisplatin . The dosxic dose . RelyingThe authors declare that they have no competing interests.EG conceived and participated to the design of the study, included patients, performed data analysis and interpretation, followed-up patients and write the manuscript DD included patients, performed surgery and intra-peritoneal chemotherapy, followed-up patients and participate to the data collection BH included patients, performed surgery and intra-peritoneal chemotherapy and followed-up patients MC performed intra-peritoneal chemotherapy and followed-up patients VL included patients, followed-up patients and participate to the data collection MD included patients, followed-up patients and participate to the data collection US included patients, followed-up patients and participate to the data collection BR conceived and participated to the design of the study, participated to interpretation and the writing of the manuscript BC conceived and participated to the design of the study, participated to data analysis, interpretation and the writing of the manuscript XP conceived and participated to the design of the study, participated to the writing of the manuscript, performed data analysis, statistical analysis and the interpretation All authors read and approved the final manuscript."} +{"text": "P = 0.032), further deterioration in the 3 months following chemotherapy (P = 0.009) and significant improvement between 3 and 12 months after chemotherapy (P = 0.038). Sural nerve sensory action potentials and conduction velocities were unhelpful.\u00a9 2001 Cancer Research Campaignhttp://www.bjcancer.com In order to ascertain the incidence and prognosis of cisplatin-induced neurotoxicity in testis cancer patients undergoing combination chemotherapy, 29 patients with metastatic disease were studied prospectively. Assessments included enquiry into neurological symptoms, measurement of sural nerve sensory action potential and conduction velocity, and vibration threshold in the left big toe. At the end of chemotherapy (3 to 4 cycles) only 3 out of 26 (11%) patients had paraesthesiae, but 3 months later the proportion rose to 65%. Resolution occurred in the majority over the ensuing 12 months so that only 17% had persistent symptoms. None of the 11 patients treated with 3 cycles of chemotherapy had persisting symptoms. Vibration thresholds showed a significant deterioration during chemotherapy ("} +{"text": "Consultation in hospital is an essential tool for acquiring subspecialty support when managing patients. There is limited knowledge on the utilization of subspecialty consultation from hospital based general internists. Consultation patterns to medical subspecialists and the patient factors that may influence consultation are reported for general medical services.Hospital discharge data were obtained for patients from medical services over a 2-year period. Consultations requested to medicine subspecialties were identified, and then reported by type and frequency. Information on demographic factors, clinical diagnoses, length of stay (LOS), time in critical care units, and disposition were compared for patients with and without consultation.3979 patients were hospitalized during the study and 2885 consultations occurred. Almost half of the patients received at least one consultation (48.3%). Gastroenterology (26.3%), infectious diseases (14.6%) and respirology (13.6%) were the most frequently consulted services. Patients with consultation had a greater number of total diagnoses , a greater mean LOS (15.9 vs. 6.8 days), were more likely to spend time in the ICU (11.5% vs. 3.5%) and CCU (4.3% vs. 1.2%), and to expire in hospital (10.7% vs. 4.9%).Consultation occurs frequently and its presence is an indicator of patient complexity and high use of health system resources. Analysis of consultation patterns for specific patient populations could assist in optimizing efficiency in health care delivery. Targeting quality improvement strategies toward optimizing consultation processes, engaging heavily utilized subspecialties in educational roles and assisting with resource planning are areas for future consideration. In hospital, general internists primarily oversee the care of adult patients with complex or chronic medical disease -4. ConsuThere have been a growing number of studies evaluating subspecialty referral patterns by general internists, general practitioners and family physicians in the outpatient setting ,7-11. AlInpatient hospital consultation is an important area for research as it impacts quality of care and resource utilization ,11. A beThe objective of this study was to examine consultation patterns to medical subspecialties and the patient factors that may influence consultation in a population of hospitalized patients under the care of general internal medicine services. We specifically sought to identify the frequency and type of subspecialty consultation conducted by the service and to determine if specific patient factors influence consultation to different subspecialties.Administrative hospital discharge data were obtained for all patients admitted and discharged from the general medical services in two academic tertiary care hospitals in Calgary, Alberta, Canada over a 2-year period . The medical services are comprised of an academic general internist, residents, and medical students. Acutely ill or complex patients with multi-system disease are admitted and cared for by the medical services at these hospitals . PatientThe two academic teaching hospitals have a hospitalist service for medical patients , as well as subspecialty admitting services for respirology, cardiology, and hematology. One center also has admitting services for oncology, neurology and nephrology. Separate from the general medical service, there is a consultation service provided by general internists to assist other providers in managing less complex or acute patients.The hospitals service both an urban and rural population with over a million people. Inpatients have access to all medical subspecialties through consultation, offering same day urgent service if needed. Consultations are generated through an unstructured, computer order entry system. On the general medical service, any member of the medical team is able to request consultations including staff, residents and students. As a rule, consultation is typically requested after discussion by team members.All formal consultation requests are registered in the hospital administrative database and coded by subspecialty. The subspecialty services include cardiology, dermatology, endocrinology, gastroenterology, geriatrics, haematology, infectious diseases, medical oncology, nephrology, neurology, respirology, and rheumatology.Demographic data (age and gender), information on hospital outcomes , and diagnoses using the ICD-10 coding system were obtained. The ICD-10 diagnostic codes were converted to clinical co-morbidity variables using previously validated algorithms -17. DiagClinical factors of patients with and without consultation were compared using the two sample t test for continuous variables, and Fisher's exact test for categorical variables. Logistic regression was used to quantify the associations between consultation and the outcomes of length of stay greater than 7 days (LOS > 7), critical care unit admission, and mortality while controlling for gender, age and clinical diagnoses.In order to develop the most parsimonious model of predicting consultation, all available demographic factors and clinical diagnoses (either pre-admission or post admission) were included in the initial model. For demographic factors we chose gender and a dichotomous age variable. We divided age at > 65 years given that it was the median value and it represents the accepted age for classification as a senior citizen in Canada. System utilization variables were not added to the model, as we were unable to determine if they occurred before or after the consultation. Therefore, it would be difficult to interpret their relationship. Beginning with a saturated model, we used a stepwise backward elimination, removing single variables one at a time in an iterative process to produce a parsimonious final model containing significant predictor variables. A p-value of < 0.01 was pre-selected to achieve the most succinct model.All statistical analyses were performed using Stata version 6.0 .A total of 3979 patients were hospitalized under the care of the general medical service during the two-year period. From this population, 2885 consultations were generated to subspecialty services of internal medicine. Table Consultation on the general medical service by medical subspecialty service is shown in Figure Patients with one or more consultations had a greater mean age (59 years) compared to patients without a consultation (56 years) (p < 0.001) Table . The proThe multivariable model for predicting subspecialty consultation for general medical service patients is provided in Additional file Evaluation of hospital outcome variables showed that length of stay was longer for patients with a consultation , with a population mean of 11 days. Furthermore, a greater percentage of patients with a consultation spent time in the ICU and CCU . Mortality was also greater in the group of patients receiving a consultation .Patients under the care of general internal medicine services have multiple co-morbidities, chronic disease and utilize critical care . They haNot all patient populations in hospital have the same need for services ,18. We hOur study has shown that patients under the care of the general medical service are high volume users of subspecialty services. Given that consultations generate considerable costs, are resource intensive and lead to prolonged admissions, efficient administration of these services may positively influence health care quality and resource utilization ,11,19. EGastroenterology, infectious disease and respirology were identified as heavily utilized subspecialty services for medical inpatients. Other studies have reported similar findings, in particular with gastroenterology -20. EngaOur study has a number of limitations. We were only able to capture formal consultations entered through the computer database. We may in fact be underreporting the full extent of subspecialty consultation by general internists as uncharted consultations would be missed. Furthermore, the database only documents the services consulted and are unable to provide specific information on the reasons for consultation, appropriateness of consult or whether the consult resulted in a change in management. Therefore, we are unable to draw conclusions regarding causality for the finding of increased length of stay and specific resource utilization. Nor can we comment on whether a reduction in consultations is feasible. Regardless, the magnitude of the findings suggests that consultation is an important area to focus future evaluations. Finally, although we believe that our hospital system is similar to other tertiary, academic centers, variation in consultation practices may occur if hospitals have different admitting subspecialty services or patients with less acuity .Despite these limitations, our study is informative in illustrating that general internal medicine services provide care for a group of patients with multiple co-morbidities and chronic disease. These patients require access to subspecialty services in large volumes. Patient acuity, longer LOS and expiring in hospital are all related to consultation. We have identified the hospital resources that are necessary for their care, making it possible to select targets for future research in evaluating and improving health care delivery.The authors declare that they have no competing interests.All authors participated in the research concept, design, data acquisition, analysis and interpretation. All authors were involved in the drafting of the manuscript and final revisions. All authors have read and approved the final manuscript.Odds ratios for patient demographics and clinical Elixhauser diagnoses that were significantly associated with consultation. This is a multivariable model for predicting subspecialty consultation for general medical service patients.Click here for file"} +{"text": "The purpose of this study was to examine the effect on survival of delaying the start of adjuvant chemotherapy for early breast cancer for up to 3 months after surgery. In the nation-wide clinical trials of the Danish Breast Cancer Cooperative Group, 7501 breast cancer patients received chemotherapy within 3 months of surgery between 1977 and 1999: 352 with classical cyclofosfamide, metotrexate and 5-fluorouracil (CMF); 6065 with CMF i.v. and 1084 with cyclofosfamide, epirubicin and 5-fluorouracil. For the analysis, the time between surgery and the start of chemotherapy was divided into four strata . The results show that within the three groups of chemotherapy, there was an even distribution of known prognostic factors across the four strata of initiation of chemotherapy. There was no pattern indicating a benefit from early start of chemotherapy. No significant interactions were found for subgroups of patients with a poorer prognosis . In conclusion, we have found no evidence for a survival benefit due to early initiation of adjuvant chemotherapy within the first 2\u20133 months after surgery. It is well established that adjuvant chemotherapy reduces mortality after early breast cancer . The conAnimal models have shown circulating growth factors and accelerated growth of metastases after removal of the primary tumour for patients starting chemotherapy within 4 and 5 weeks compared with the patients treated later , which has conducted randomised clinical trials of early breast cancer since 1977.As the number of patients requiring adjuvant chemotherapy is steadily increasing, often without a parallel increase in resources allocated to delivering chemotherapy, many oncology departments have to create waiting lists for starting chemotherapy. Such waiting lists cause anxiety among patients and health authorities. Since it will not be ethically acceptable to perform a trial of early Between January 1977 and December 1999, we identified from the database of the DBCG 7690 patients with early breast cancer who received adjuvant chemotherapy. Of these, 159 (2%) patients were excluded because the initiation of chemotherapy exceeded 89 days after surgery and 30 because of missing data on tumour size, leaving 7501 patients available for analysis.vs castration, whereas patients with receptor-negative tumours or with unknown receptor status were randomised to CMF i.v.\u00b1pamidronate vs cyclofosfamide, epirubicin and 5-fluorouracil (CEF)\u00b1pamidronate. In 1998, the eligibility criteria were changed to include patients with tumours measuring more than 20\u2009mm, and/or node positive, and/or grade II or III and/or receptor negative. In the protocols starting in 1999, pre- and perimenopausal patients were treated with CEF and if receptor positive, with tamoxifen afterwards. Postmenopausal receptor-negative patients were treated with CMF i.v. The chemotherapy regimens were classical CMF , CMF i.v. and CEF .The clinical trial programme of DBCG and the trials DBCG-77B, DBCG-82B and DBCG-82C have been described elsewhere . In the Data on prognostic factors and treatment were collected prospectively including age, tumour size, histological type, tumour grade, hormone receptor status, number of involved lymph nodes, adjuvant irradiation to chest wall and lymph nodes, adjuvant tamoxifen, and type of chemotherapy. Tumour grade was assessed according to the modified method of The date of definitive surgery was defined as the date of the most extensive procedure ordinarily including axillary lymph node dissection, and could thus be preceded by a biopsy. Delays of chemotherapy were defined as time from definitive surgery to start of chemotherapy and categorised into the following strata: \u201321 days, 22\u201328 days, 29\u201335 days and 36\u201389 days. These strata were chosen to divide the population into four equally sized groups with one group matching the studies of Colleoni and Shannon (1\u201321 days).The patients were followed by reports from the clinical departments to the DBCG at least once per year based on the civil personal registration number . This allows follow-up by record linkage to the Central Population Register, which keeps updated information on vital status (dates of death or emigration), and address (date of migration from the county) of all residents in Denmark. Follow-up to death is thus complete. Overall survival (OS) was defined as time from date of definitive surgery to date of death or last follow-up, which was 1 February 2003. Overall survival is reported as the best surrogate to \u2018cure\u2019.\u03c72 test. Survival curves were calculated using the Kaplan\u2013Meier method and differences assessed by the log-rank statistic. The three different chemotherapy groups were analysed separately. The Cox proportional hazards model was used to test for the independent effect of timing of chemotherapy after adjusting for known prognostic factors and hazard ratios estimated with 95% confidence limits. Tests were performed to study possible interaction between delay of chemotherapy and lymph node involvement, tumour grade and hormone receptor status.Baseline differences in prognostic factors between different treatment delay groups were performed by the start of chemotherapy 1\u201321,22\u201328, 29\u201335 and 36\u201389 days; age 45, 46\u201355 and 56\u201369 years; tumour size: 0\u201320, 21\u201350 and 51+\u2009mm; tumour type: invasive ductal carcinoma and others; malignancy grade: I, II and III; hormone receptor: positive and negative; involved axillary lymph nodes: 0, 1\u20133, 4\u20136 and 7+; and adjuvant irradiation: \u00b1.The variables in the Cox models were as follows: 7501 patients received adjuvant chemotherapy for early breast cancer within 89 days of surgery. Of these, 352 patients received classical CMF, 6065 CMF i.v. and 1084 CEF with median delays of 31, 28 and 30 days, respectively. The interval from definitive surgery to start of chemotherapy is shown in A total of P-values ranging from 0.2 to 0.7. This lack of an association between start of chemotherapy and OS was confirmed in multivariate analyses taking known prognostic factors into account. Kaplan\u2013Meier plots of OS are shown in The OS analyses have also been made according to total delay of chemotherapy . However, the substitution of delay of treatment from definitive surgery by this total delay made practically no difference (data not shown). The analyses have also been performed for DFS. As the DFS curves expressed the same pattern as the OS curves, we have only reported the OS.The proportion of patients receiving adjuvant tamoxifen was decreasing in relation to delay of chemotherapy, from 21% in the group treated within 21 days in comparison to 11% in the group treated after day 35. On the other hand, adjuvant tamoxifen did not seem to interact with chemotherapy delay and survival (data not shown).n=690) delay of chemotherapy seemed of no importance (P=0.91).In the three study groups 1020 patients were identified with oestrogen receptor absent tumours. For the major subgroup treated with CEF (The present study shows that 98% of Danish breast cancer patients started adjuvant chemotherapy within 3 months of definitive surgery. Within these 3 months, we found no relation between start of chemotherapy and OS, meaning that the prognosis was similar for patients starting chemotherapy within 3 weeks after surgery to those starting chemotherapy up to 13 weeks after surgery. This is in agreement with results of other studies (The idea that an early initiation of adjuvant chemotherapy could be beneficial originates from animal models demonstrating circulating growth factors and accelerated growth of metastases after removal of the primary tumour (Advancing the start of chemotherapy even further to preoperative or neoadjuvant treatment has also been explored. The NSABP-B18 trial demonstrated no difference in DFS in women treated with chemotherapy before surgery compared to women treated with the same chemotherapy after surgery, also indicating no benefit from early initiation of chemotherapy (vs 34% for early vs late treatment, respectively. We duplicated this subgroup analysis in our material, but found no difference in OS.Two small studies have reported improved survival when chemotherapy was given early. For a subgroup of 169 patients treated with adjuvant AC, DFS was higher among patients with 1\u20133 involved lymph nodes treated within 4 weeks than among patients treated later, but the trend was in the opposite direction for patients with more than four involved lymph nodes (The strength of the present study is that the analysis is based on a large number of patients, in particular, the group of patients treated with CMF i.v., thereby providing sufficient statistical power to detect even small differences in survival. Furthermore, the study is based on the entire Danish population for which the DBCG has issued national guidelines to ensure uniform procedures for surgery, pathology, chemotherapy, radiotherapy and follow-up. By virtue of civil personal registration numbers, there was a complete follow-up of all patients in the study.The main limitation of this study is that it is not randomised. The initiation of chemotherapy may have been influenced by the physicians allocating the patients to \u2018early\u2019 treatment if they had a poor prognosis and the physicians did not want to delay the start of chemotherapy. In our study, patients with no involved lymph nodes were more likely to be treated late with CMF i.v. , but on In conclusion, this large population-based study did not demonstrate any benefit in OS from an early start of adjuvant chemotherapy among Danish breast cancer patients treated within 3 months of definitive surgery, or for any subgroups with potentially fast growing tumours according to increasing number of involved axillary lymph nodes, increasing malignancy grade or negative hormone receptor status. This finding is reassuring for patients who have to delay their start of chemotherapy for health reasons, for example, postoperative complications such as infections, or for other reasons."} +{"text": "Photorhabdus species. Recognized as important insect pathogens, Photorhabdus spp. are bioluminescent gram-negative bacilli. Bacteria belonging to the genus are emerging as a cause of both localized soft tissue and disseminated infections in humans in the United States and Australia. The source of infection in humans remains unknown.We report two Australian patients with soft tissue infections due to Photorhabdus spp (family: Enterobacteriaceae) are the only terrestrial bacteria known to exhibit this property (1). The classification within the genus is complex with three currently recognized species: P. luminescens, P. temperate, and P. asymbiotica , where they form a symbiotic relationship. Nematode species of this type are able to invade the larvae of susceptible insects and release Photorhabdus spp. The bacteria proliferate and promote nematode reproduction by killing the insect larvae.Photorhabdus spp are used as biopesticides in a number of countries, including the United States and Australia. Agricultural scientists are also attempting to develop insect-resistant transgenic crops by using insecticidal toxin genes derived from Photorhabdus spp . The phenotypic characteristics that the isolates displayed were typical of the genus.Colonies were formed after 24\u201348 hours on tryptic soy agar containing either 5% sheep or horse blood at both 35\u00b0C and at room temperature, with a tendency to \u201cswarm\u201d . The isoThe defining characteristic was the presence of faint luminescence, which could be clearly seen with the naked eye when the colonies were examined under conditions of total darkness. It was critical to this examination that the observer\u2019s eyes be allowed to adjust to the darkness for 10 minutes.Photorhabdus spp. do not currently appear on the databases of either of these systems, which leads to misidentification and bioMerieux Vitek . fication .Photorhabdus spp. have been shown to form a heterogeneous group based on DNA-DNA hybridization studies, 16S rDNA sequencing and polymerase chain reaction ribotyping and the insects they parasitize . It seems likely therefore that Photorhabdus spp are transmitted to humans by a terrestrial invertebrate (nematode or arthropod), but that vector has not yet been identified."} +{"text": "A significant rise in AI (P<0.001), and fall in Ki67 (P=0.002) was seen 24\u2009h following chemotherapy. No relationship was seen between pretreatment AI and clinical response, but higher Ki67 and growth index did correlate with clinical response . No correlation was seen between the change in AI or Ki67 at 24\u2009h and clinical response or survival. Significant changes in apoptosis and proliferation can be demonstrated 24\u2009h following chemotherapy, but these changes do not relate to clinical response or outcome in this study. Pretreatment proliferation and GI are however predictive of response to chemotherapy in breast cancer.Patients undergoing primary chemotherapy for invasive breast cancer consented to a core biopsy of the invasive breast primary pre- and 24\u2009h postchemotherapy. The resulting tissue was analysed for apoptosis, Ki67, ER and HER-2 using immunohistochemical techniques. These data were then used to evaluate the relationship between these biological markers and response to chemotherapy and overall survival. Response rate to chemotherapy in this group was 86%, 16 patients (25%) achieved a clinical complete response and 41 (63%) a partial response. Prechemotherapy there was a significant correlation between Ki67 and apoptotic index (AI), The use of primary or preoperative chemotherapy emerged as a result of the good response rates seen with the treatment of locally advanced breast cancers with chemotherapy .Response was assessed by bidimensional tumour measurements before each cycle of chemotherapy. Response was defined as per WHO criteria (\u03bcm) were cut onto charged slides and left at 37\u00b0C overnight. These were examined by a Consultant histopathologist (NN), for histological classification (in situ end-labelling (ISEL) techniques.Core biopsies were taken after local anaesthetic infiltration of the skin using a 14-gauge needle on a spring-loaded device. The material obtained was formalin-fixed and paraffin-embedded. Sections , normal rabbit serum at a dilution of 1:5 was applied. MIB1 primary antibody was used at a dilution of 1:50, and incubated for an hour at room temperature. All dilutions and washes were with phosphate-buffered saline (PBS). Rabbit anti-mouse serum was applied followed by avidin\u2013biotin complex (ABC) , which was developed by diaminobenzene (DAB) , and counterstained with haematoxylin.The sections were treated in a similar fashion as with the MIB1 antibody, except that antigen retrieval was not required. The primary antibody, ICR 12 (Oestrogen receptor (ER) The same staining procedure as for MIB1, with microwave antigen retrieval. The primary antibody used was ID5 (Dako) incubated at a dilution of 1:100 for 2\u2009h at room temperature, according to previously validated conditions (Apoptotic index In situ end labelling (ISEL) uses biotin-16-dUTP (Boehringer Mannheim) plus the Klenow fragment of Escherichia coli DNA polymerase 1 (Pharmacia) (H-score) or using a Quickscore that has been previously validated against H-score in breast cancer sections. Oestrogen receptor positive was defined as an H-score of >20 . A tumour was defined as HER-2 positive by the presence of the characteristic membrane staining in over 10% of the tumour cells. The AI was a percentage score of apoptotic cells from a total of 3000 malignant cells. Unstained apoptotic cells were included if they showed classical morphological features of apoptosis, cytoplasmic condensation and chromatin clumping , Figure 1P<0.001. Median AI prechemotherapy was 0.9 (interquartile range (IQ), 0.5\u20131.5) and at 24\u2009h postchemotherapy this had increased significantly to 1.60 , Figure 2AP=0.002), Prior to treatment there was a highly significant positive correlation between proliferation, as measured by Ki67 and AI samples , In addition to assessing the impact of chemotherapy on Ki67 and AI individually, the effect on the Ki67/AI ratio, a parameter which we have described as a growth index (GI) (P=0.006).The changes in AI and Ki67 are shown according to HER-2 and ER status in r=\u22120.04, but higher levels of proliferation pretreatment correlated with increased clinical response, r=\u22120.31, P<0.025. Tumour grade was not correlated with overall clinical response, but grade 3 tumours had a greater rate of cCR rate than grade 2, P=0.007. A significant relationship was also seen between the GI pretreatment and the clinical response to treatment, r=0.31, P<0.025. A significant correlation between both pretreatment proliferation and GI (P<0.025) with clinical response was also seen in the subgroup of patients treated with chemotherapy alone. These were defined as no concomitant tamoxifen or ER-negative patients who received tamoxifen, where the effects would have been expected to be negligible. No correlation was seen with pretreatment AI and clinical response in this subgroup.There was no relationship between pretreatment AI and overall clinical response, There was no significant relationship seen between clinical response and the biological changes 24\u2009h after chemotherapy for either AI, Ki67 or GI, Figure 3P=0.2, Figure 4On univariate analysis, no relationship was seen between pretreatment AI, Ki67 or GI with progression-free or overall survival. Similarly, there was no significant relationship between the changes in these parameters seen at 24\u2009h after chemotherapy with progression-free or overall survival. Although those patients with a lower pretreatment GI appeared to have an improved overall survival this was not significant, In this study, we have demonstrated a significant relationship between AI and Ki67 in breast tumours prior to the initiation of therapy. This is consistent with our previous work . One migPretreatment levels of proliferation positively correlated with clinical response. This is consistent with other studies, either using the MIB1 antibody or S-phase fraction . It is nThe data from this study confirm our earlier findings of a significant increase in apoptosis following chemotherapy and extend them with the observed significant fall in proliferation at 24\u2009h. Since changes in apoptosis and/or proliferation are requisites for changes in tumour growth rate, their early measurement during treatment has been investigated on the basis that this might enable the prediction of eventual clinical response and long-term benefit from treatment. A small pilot study of 15 patients by The timing of sampling post chemotherapy may be important in quantifying the increase in AI: the Chang study sampled at either 24 and/or 72\u2009h postchemotherapy, and used a mean of both measurements when more than one was available. A recent study, again with 15 patients took biopsies at 24 and 48\u2009h, and also failed to show a relationship between apoptosis at 24\u2009h following chemotherapy, but demonstrated a relationship at 48\u2009h. They noted marked variations though, with one tumour showing a rise in apoptosis at 24\u2009h, but not at 48\u2009h . Even in this subgroup no relationship between changes in AI or proliferation at 24\u2009h and clinical response was seen. A recent study, however, has shown no difference in the response rate to primary chemotherapy with the addition of tamoxifen having enough material for biological analysis. A 50\u201360% success rate also limits the widespread clinical utility of these tests.Given that there were significant changes in both proliferation and apoptosis after 24\u2009h, which are both likely to contribute to eventual tumour response, we assessed the relationship of GI with clinical response. It was notable that although there were 20 tumours that showed an increase in Ki67 and 10 that showed an decrease in AI, only five showed an increase in the growth index, indicating that the therapy had a beneficial overall effect on tumour growth in 90% of tumours. While the GI pretreatment correlated with response, changes in GI 24\u2009h after chemotherapy had no predictive value for response. Thus, while this index may be useful as a guide to overall changes in tumour dynamics, it does not appear to have utility for response prediction.One of the most significant predictors of relapse-free survival following primary chemotherapy has been shown to be a pCR (The lack of a correlation of these early markers with response to chemotherapy or with clinical outcome is disappointing in view of the clear biological rationale for such a relationship and possible reasons for this need to be considered. It should also be noted that a given reduction in proliferation or increase in cell death might lead to regression of a slowly growing tumour, but only slow the growth of a rapidly growing tumour. Thus it may be over simplistic to expect a close relationship between change in these parameters and response measured clinically. Other measurements of response were not performed in this study. Mammography has been shown to be a poorer than clinical measurement (Overall we believe this area merits further evaluation, and the study of noninvasive techniques, such as PET may eventually be applicable very early after starting chemotherapy. Also the use of newer techniques such as DNA microarray may improve the predictability of response by combining the change in expression of larger numbers of genes ("} +{"text": "Of 40 eligible patients, 22 agreed to participate (feasibility 55%) and all complied with the full treatment schedule. All symptomatic patients achieved either complete (50%) or partial (50%) relief of tumour-related symptoms with pre-operative chemotherapy. Fifty-five per cent achieved objective tumour response, and a further 27% minor tumour shrinkage; none had progressive disease. Partial pathological response was seen in 50%. No severe (WHO grade III\u2013IV) toxicities occurred. No significant deterioration in quality of life was detected during chemotherapy. Pre-operative MVP chemotherapy is feasible in early stage NSCLC, and this study has now been initiated as a UK-wide Medical Research Council phase III trial. \u00a9 1999 Cancer Research CampaignSurgical resection offers the best chance for cure for early stage non-small-cell lung cancer , but the 5-year survival rates are only moderate, with systemic relapse being the major cause of death. Pre-operative (neo-adjuvant) chemotherapy has shown promise in small trials restricted to stage IIIA patients. We believe similar trials are now appropriate in all stages of operable lung cancer. A feasibility study was performed in 22 patients with early stage resectable NSCLC; randomized to either three cycles of chemotherapy [mitomycin-C 8 mg m"} +{"text": "All tests were performed before (baseline) and after transient ovarian stimulation in the early follicular phase. Patients were recruited both before and after completion of chemotherapy, with some patients being followed up prospectively. Serum samples were analysed for follicle-stimulating hormone (FSH), luteinising hormone (LH), oestradiol (E2), inhibins A and B, and antimullerian hormone (AMH). Biophysical (ultrasound) tests included ovarian volume, antral follicle count (AFC), ovarian stromal blood flow and uterine dimensions. Significant differences were revealed (when compared with the controls) for basal FSH , basal AMH and basal inhibin B . Following transient ovarian stimulation, there were significant differences in the increment change (\u0394) for inhibin B and E2 . AFC was the only biophysical parameter that was significantly different between patients and the controls . Basal and stimulated biochemical and biophysical (AFC) tests may be potential markers of ovarian reserve in young women with breast cancer.Ovarian reserve can be diminished following treatment for breast cancer. This study evaluated biochemical and biophysical parameters of ovarian reserve in these patients. Biochemical and biophysical tests of ovarian reserve were performed simultaneously in young (age 22\u201342 years), regularly menstruating women with breast cancer ( As the incidence of breast cancer has progressively increased, survival rates have simultaneously improved, owing to improvements in early detection and adjuvant chemotherapy . Young wAt present, it is impossible to predict the lifespan of the chemotherapeutically damaged ovary. Ovarian reserve testing has become established in the fertility setting where it is used to predict outcome in assisted reproduction . These tThere is a need for such tests to be validated in patients with breast cancer, so that the information needs of these patients can be met, and appropriate measures taken to improve their fecundity and overall quality of life.The aim of this study was to evaluate ovarian function in young women treated by multi-agent, cyclophosphamide-based chemotherapy for breast cancer by using clinical, biochemical and biophysical parameters. This was based on the hypothesis that cytotoxic drugs used to treat premenopausal patients with breast cancer can cause ovarian damage resulting in diminished ovarian reserve.In this pilot study, pre-menopausal recipients of chemotherapy for breast cancer were analysed in two groups \u2013 a longitudinal arm (group 1) and a cross-sectional arm (group 2). As all patients were recruited from a single centre, the chemotherapy regimens employed were standardised. There were two predominant regimens, both cyclophosphamide-based. The first was E-CMF, which consisted of four cycles of epirubicin (E), followed by four cycles of Cyclophosphamide (C), methotrexate (M) and 5-fluorouracil (F). The second was FEC, which consisted of six cycles of 5-fluorouracil, epirubicin and cyclophosphamide. Some patients received taxanes (docetaxel or paclitaxel), usually as part of a therapeutic trial (TANGO). The cumulative dosages received by patients in the longitudinal analysis are displayed in In group 1, patients were offered ovarian reserve testing before receiving chemotherapy. The same patients were then followed up longitudinally by performing further testing immediately following chemotherapy. In group 2, patients were tested for ovarian reserve before chemotherapy and after chemotherapy . Patients with oestrogen-sensitive cancer were recruited provided they had not taken tamoxifen or gonadotrophin releasing hormone analogue (GnRHa) (goserelin or leuprolin) for at least the preceding 12 weeks.Controls were age matched, had no medical illness, had proven fertility (defined by virtue of having at least one childbirth previously) and had a normal menstrual history. Those on oral contraception were asked to discontinue it and use alternative (barrier) contraception for at least 8 weeks before testing.Informed consent was obtained from all participants. This study received ethical approval from the Joint UCL/UCLH Ethics Committee.2), inhibins A and B, activin A and antim\u00fcllerian hormone (AMH). Blood samples (15\u2009ml) were obtained from all subjects during the early follicular phase of the menstrual cycle (day 2\u20135). Four-timed samples were performed, 15\u2009min apart (to account for the pulsatile variation of FSH release). Following the last-timed sample, the gonadotrophin analogue stimulation test (G-test) was commenced , luteinising hormone (LH), oestradiol .Serum was separated and stored at \u221220\u00b0C before hormone measurements. Assaying each of the four samples and determining an average value then determined mean serum concentrations for FSH, LH and EFollicle-stimulating hormone and LH: all samples were assayed in duplicate using a commercial Coat a count solid phase Immunoradiometric assay . The sensitivity of the assay is 0.06\u2009mIU\u2009ml\u22121 and the intra- and interassay variation was <7%.Oestradiol: All samples were assayed in duplicate using a commercial ELISA kit according to the manufacturer's protocol. The sensitivity of the assay was 4.6\u2009pg\u2009ml\u22121 and the intra- and interassay variation was <6%.Inhibin A: Serum concentrations of dimeric inhibin A were measured in duplicate 50\u2009\u03bcl aliquots as described previously according to the manufacturer's protocol. The sensitivity of the assay is 10\u2009pg\u2009ml\u22121. The intra- and interassay variations were <10%.Activin A: This was measured using a two-site ELISA specific for \u2018total\u2019 activin A as described previously . The sensitivity of the assay was 0.098\u2009ng\u2009ml\u22121. The intra- and interassay variations were <15% using an in-house quality control pool.Ultrasound examination was performed on the same day that blood samples were taken (before ovarian stimulation). Inter-observer variability was minimised by having all ultrasound scans performed by a single investigator (AP). Additional support for performing scans was provided specifically by another investigator (BP) if required. An Acuson 128 XP4 (Acuson USA) with a 2.5\u20134\u2009mHz-vector probe and a 5\u20137.5\u2009mHz EC-7 probe were used to perform the scans.Round- or oval-shaped echo-free structures from 2 to 10\u2009mm within the ovaries were considered to be follicles. Total antral follicle count (AFC) was the sum of antral follicles measured from both ovaries.Ovarian volume was calculated for each ovary using the prolate ellipsoid formula:\u03c0/6, where D1, D2 and D3 are maximal perpendicular diameters of the ovary.Ovarian volume=D1 \u00d7 D2 \u00d7 D3 \u00d7 Ovarian stromal blood flow velocity waveforms were obtained by placing the Doppler gate over the ovarian stroma, which had the highest achievable signals, ensuring that no arteries near the surface of the ovary were measured. Peak systolic velocity and pulsatility indices from both ovaries were then combined to provide the mean pulsatility index and mean peak systolic velocity, respectively.2) and endometrial thickness (mm) were calculated by examining the uterus in the sagittal plane.Uterine cross-sectional area was used to compare differences between individual groups. For non-gaussian distribution, the Mann\u2013Whitney test was employed.A normality test was carried out to assess the distribution of data. Most variables in the cross-sectional data analysis had a gaussian distribution. As such, unpaired Student's t-test. Non-parametric variables were analysed using the Wilcoxon-signed rank test.Data in the longitudinal group, which had a normal distribution, were analysed using the paired Statistical analyses were performed using GraphPad Prism version 3.00 for Windows and Statistical Package for Social Sciences .All tests performed were well tolerated, with no adverse effects reported. Results are presented as mean values along with the standard error of the mean (s.e.m.).P>0. 05) in age among all the three groups. The mean age for patients in the pre-chemotherapy group was 35.2\u00b11.5, for patients in the post-chemotherapy group 36.7\u00b10.6 and in the controls 34.5\u00b10.9. Similarly, there was no statistically significant difference in body mass index (BMI) (kg\u2009m\u22122) among the three groups. The mean BMI for patients in the pre-chemotherapy group was 24.27\u00b10.84, for patients in the post-chemotherapy group 24.59\u00b10.53 and in the controls 26.04\u00b11.02 estimates as well as stimulated and delta results following administration of the G-test. There were no significant differences in biochemical parameters between patients in the pre-chemotherapy arm and the controls.vs 6.62\u00b10.42\u2009mIU\u2009ml\u22121, P<0.001), basal AMH and basal inhibin B . One-way ANOVA revealed significant differences in the mean values for all three groups for basal FSH, basal AMH and basal inhibin B (P<0.001). Basal E2 was significantly lower in the control group compared with patients in the pre-chemotherapy group (144.7\u00b126.13 vs 252.0\u00b1 49.1\u2009pg\u2009ml\u22121). Following administration of the G-test, there were significant differences between patients in the post-chemotherapy arm and the controls for stimulated FSH (but not \u00c4 FSH) ; stimulated and delta E2 (208.9\u00b137.5 vs 427.9\u00b155.87\u2009pg\u2009ml\u22121 (stimulated), P<0.01; 107.8\u00b123.9 vs 283.2\u00b140.34\u2009pg\u2009ml\u22121 (delta), P< 0.01) and finally stimulated and delta inhibin B (22.5\u00b16.04 vs 180.4\u00b122.8\u2009pg\u2009ml\u22121 (stimulated), P<0.001; 3.02\u00b12.3 vs 96.82\u00b116.38\u2009pg\u2009ml\u22121 (delta), P<0.001). One-way ANOVA revealed significant differences overall among the three groups for stimulated FSH (P<0.01), stimulated and delta E2 (P<0.01) and stimulated and delta inhibin B (P<0.001) .There were no significant differences in biophysical parameters between patients in the pre-chemotherapy arm and the controls.vs 17.1\u00b11.2, P<0.001; MAFC 4.4\u00b10.5 vs 8.5\u00b10.6, P<0.001). One-way ANOVA showed a highly significant difference in the mean TAFC among the three groups (P<0.0001). AFC was the only biophysical parameter that displayed a significant difference between patients in the post-chemotherapy arm and the controls (TAFC 7.8\u00b10.9 0.0001). .In this data set, patients were tested during the early follicular phase of the menstrual cycle preceding chemotherapy and immediately following completion of chemotherapy. It is important to note that patients tested immediately post-chemotherapy were universally amenorrhoeic, and as such were not offered the G-test. All parameters were tested for normality and most were found to have a gaussian distribution. Significant findings in this group are displayed in vs 46.7\u00b110.8\u2009mIU\u2009ml\u22121, P<0.01). In addition, basal AMH and basal inhibin B levels were much higher in patients tested pre-chemotherapy compared with post-chemotherapy, but these results were not statistically significant ; 62.5\u00b129.8 vs 6.0\u00b10.6, P>0.05 ).Basal FSH was significantly lower in patients' pre-chemotherapy compared with post-chemotherapy levels ; 7.5\u00b11.3 vs 2.7\u00b10.3, P<0.01 (MAFC). There were no other statistically significant differences between the pre-chemotherapy and post-chemotherapy biophysical markers, including total and mean ovarian volume (OV) ; 5.6\u00b10.5 vs 4.3\u00b10.7, P>0.05 .Both total and mean AFCs were significantly higher in patients tested pre-chemotherapy compared with post-chemotherapy or the 0.05 level (two-tailed).2 in patients and the controls , as well as basal inhibin B . Furthermore, AMH was the only parameter (in addition to bFSH) to correlate with chronological age in patients only .Antim\u00fcllerian hormone as a basal marker correlated with \u0394Er=0.494, P<0.05; r=0.509, P<0.05), whereas \u0394 E2 correlated positively with TAFC in the pre-chemotherapy group, but not the controls .\u0394 Inhibin B correlated best with biophysical markers of ovarian reserve. In controls, inhibin B correlated positively with TAFC and MAFC levels provided evidence that ovarian reserve was intact before chemotherapy.Our data suggest that ovarian reserve was intact before chemotherapy in a breast cancer cohort, implying that multi-agent chemotherapy was the main factor that led to diminished ovarian reserve. Alkylating agents such as cyclophosphamide, which are non cell-cycle specific, are more toxic to the ovaries than cell-cycle-specific agents, such as methotrexate and fluorouracil. It is unclear, however, what effect multi-agent chemotherapy has on ovarian reserve, especially, given the fact that newer agents are continually being developed (2 levels were significantly higher in patients (pre-chemotherapy) compared with the controls, there was no significant difference between stimulated and delta E2 levels. This may be explained by the fact that bE2 levels correlate more with the underlying disease, as it has been shown that high plasma E2 concentrations have been linked to breast cancer development regardless of menopausal status were not found to be discriminatory once cyclical activity resumed. This is in keeping with the generally accepted notion that clinical characteristics are not reliable estimates of reproductive age.2, inhibin B and AMH. The data relating to the use of FSH in estimating ovarian reserve in breast cancer are limited. Although widely used in a reproductive medicine setting, its main limitations arise from a lack of reproducibility (P=0.0006). Following the G-test, stimulated FSH levels were also significantly different (P=0.01). However, \u0394FSH levels did not confer any discriminatory capacity. Follicle-stimulating hormone is an indirect marker of ovarian reserve and depends on the presence of an intact hypothalamic-pituitary-ovarian (HPO) axis. Administration of the G-test causes a temporary increase in pituitary secretion of FSH and LH, to which the ovaries respond by releasing E2. It is the amount of E2 released (\u0394), which correlates with ovarian reserve, not \u0394FSH, which is in keeping with the results.Biochemical parameters, which appeared to discriminate between patients and the controls in the cross-sectional data set, were serum FSH, E2 were seen in the pre-chemotherapy group as opposed to the post-chemotherapy, which one would not expect, as higher levels of E2 are associated with diminished ovarian reserve. Both stimulated and delta E2 levels were significantly different, however, being much lower in the post-chemotherapy group compared with the pre-chemotherapy group and the controls, respectively. This supports the notion that the G-test confers discriminatory capacity.Basal oestradiol levels were significantly higher in the pre-chemotherapy group compared with the controls. This may have a role in the pathophysiological process of breast cancer as described earlier. No significant difference existed between the controls and the post-chemotherapy group. In fact, higher levels of bE2 is consistent with the theory that the pathophysiological processes taking place within the ovary are in fact dynamic \u2013 thus necessitating a dynamic form of assessment.Basal, stimulated and \u0394 inhibin B levels were all significantly different between patients and the controls. Although inhibin B is mainly secreted by pre-antral follicles .With regard to biophysical parameters, our data suggest that AFC is most useful. Although studies in cancer are limited, AFC and OV have been found to be useful in assessing ovarian reserve in childhood survivors of cancer and pati2 and AFC. It can be deduced that the multi-agent chemotherapy received by these patients suppressed ovarian function resulting in a hypoestrogenic state, with a corresponding high FSH and amenorrhoea. Reduced AFC reflects a reduction in the number of antral follicles and is consistent with our observation in the cross-sectional population (post-chemotherapy cycling women). Ovarian volume, as was the case in the cross-sectional data, was not significantly different between both groups. This may be a reflection of the fact that the induced hypoestrogenic state was temporary. It can be argued that in terms of reproductive ageing, a reduction in OV is a relatively late event that comes about after a protracted period of diminished ovarian reserve. It is plausible that despite these patients being amenorrhoeic, the unchanged OVs implied that resumption of ovarian function, albeit at a level lower than the pre-chemotherapy state, was likely to occur. In fact, all patients in the post-chemotherapy arm of the cross-sectional analysis had resumed normal menses, indicating that the effects of the multi-agent chemotherapy received were at least partially reversible.Longitudinal data analysis revealed that the parameters, which were discriminatory between these two groups, were FSH, E2 in response to the G-test. The only clearly discriminatory biophysical marker was the AFC. There was good correlation between AFC and other markers of ovarian reserve. These results taken together support the hypothesis that ovarian reserve is reduced in young, regularly cycling women following treatment with chemotherapeutic agents for breast cancer. The data also add to the understanding of the pathophysiological processes involved.In summary, this study confirms the use of biochemical and biophysical parameters of ovarian reserve in a breast cancer cohort. The methodology was robust and included elaborate methods of testing \u2013 all of which appeared to be well tolerated. The cohort was disease standardised and received cyclophosphamide-based chemotherapy. Biochemical markers, which appeared to be discriminatory, included FSH, AMH, inhibin B and EThese findings have major implications for breast cancer survivors, for whom reproductive issues are a major concern (In conclusion, this study confirms that ovarian reserve can be assessed in breast cancer patients using AFC, inhibin B and AMH to inform patients on their prospects of fertility treatment post chemotherapy."} +{"text": "Here we show rmr1 encodes a novel Snf2 protein that affects both small RNA accumulation and cytosine methylation of a proximal transposon fragment at the Pl1-Rhoades allele. However, these cytosine methylation differences do not define the various epigenetic states associated with paramutations. Pedigree analyses also show RMR1 does not mediate the allelic interactions that typically establish paramutations. Strikingly, our mutant analyses show that Pl1-Rhoades RNA transcript levels are altered independently of transcription rates, implicating a post-transcriptional level of RMR1 action. These results suggest the RNA component of maize paramutation maintains small heterochromatic-like domains that can affect, via the activity of a Snf2 protein, the stability of nascent transcripts from adjacent genes by way of a cotranscriptional repression process. These findings highlight a mechanism by which alleles of endogenous loci can acquire novel expression patterns that are meiotically transmissible.Paramutations represent heritable epigenetic alterations that cause departures from Mendelian inheritance. While the mechanism responsible is largely unknown, recent results in both mouse and maize suggest paramutations are correlated with RNA molecules capable of affecting changes in gene expression patterns. In maize, multiple purple plant1 (pl1) allele, and here we report that one of these genes encodes a protein (RMR1) with similarity to a protein previously implicated in facilitating genomic DNA modifications via small RNA molecules. Genetic and molecular experiments support a similar role for RMR1 acting at a repeated sequence found adjacent to this pl1 gene. Although loss of these DNA modifications leads to heritable changes in gene regulation, the data indicate these changes do not represent the heritable feature responsible for paramutation. These findings highlight an unusual but dynamic role for repeated genomic features and small RNA molecules in affecting heritable genetic changes independent of the DNA template.Genetics is founded on the principle that heritable changes in genes are caused by mutations and that the regulatory state of gene pairs is passed on to progeny unchanged. An exception to this rule, paramutations\u2014which reflect the outcome of interactions between alleles\u2014produce changes in gene control that are stably inherited without altering the DNA sequence. It is currently thought that these allelic interactions cause structural alterations to the chromatin surrounding the gene. Recent work in both maize and mice suggests that RNA molecules may be responsible for paramutations. Several genes are required to maintain the repressed paramutant state of a maize Paramutations are heritable epigenetic changes, which, in maize, are stabilized by multiple genes, one of which expresses a novel Snf2 protein. This protein affects the stability of transcripts from adjacent genes by a cotranscriptional repression process. This trans . Paramuttrans ,5. Whilepl1 locus encodes a Myb-like protein that acts as a transcriptional activator of genes required for anthocyanin pigment production [Pl1-Rhoades allele can exist in quantitatively distinct regulatory states, reflected by differences in plant color. When individuals with a highly expressed reference state of Pl1-Rhoades, termed Pl-Rh, are crossed with plants having a repressed state, referred to as Pl\u2032, only progeny with weak pigmentation are produced [Pl-Rh states invariably change to Pl\u2032 in Pl-Rh/Pl\u2032 heterozygotes [Pl-Rh, the Pl\u2032 state displays reductions in both Pl1-Rhoades RNA levels (\u223c10-fold) and transcription rate (\u223c3-fold) that are associated with a reduction in plant pigment [Pl\u2032 state is meiotically stable when maintained in a Pl1-Rhoades homozygote, with no reversion to Pl-Rh seen to date. Pl\u2032 can, however, revert to Pl-Rh when heterozygous with some pl1 alleles other than Pl1-Rhoades, when maintained in a hemizygous condition, or in the presence of specific recessive mutations [The oduction . Inheritproduced ,8. Pl-Rhozygotes ; this isutations \u201312.required to maintain repression1 (rmr1), rmr2, rmr6, and mediator of paramutation1 (mop1), whose normal functions maintain the repressed Pl\u2032 state \u2013induced recessive mutations identify at least ten loci, including \u2032 state accumulation and DNA methylation patterns at Pl1-Rhoades. These results support a model in which maintenance of paramutant states is dependent on a repression mechanism similar to the recently proposed cotranscriptional gene silencing mechanism in fission yeast [trans-generationally repressed states established by paramutation.In this report we identify on yeast ,18. To ormr1 locus is defined by four recessive mutations , a direct target of the PL1 transcriptional activator [rmr1\u20131 mutants (colored plant1 (b1)\u2014a locus encoding a basic helix-loop-helix factor genetically required for a1 transcription\u2014 remained unchanged. These results were recapitulated in comparisons between nuclei isolated from rmr1\u20133 mutants and heterozygous siblings in which in vitro transcription assays revealed no significant change in transcription rate of Pl1-Rhoades while RNase protection experiments showed a 5.7-fold increase in pl1 RNA for rmr1\u20133 mutants using RNA isolated from the same tissues of the same individuals. Similar comparisons from identical tissues but in a different genetic background again showed that transcription rates at pl1 remained unchanged while pl1 RNA levels increased 7.52-fold in rmr1\u20133 mutants compared to heterozygous siblings and npi252 , indicating rmr1 was tightly linked to those markers in bin 6.05 on Chromosome 6. We used the high degree of synteny between this region and rice Chromosome 5 to identify candidate rmr1 orthologs (To better understand markers . The darrthologs A and 2B.Os05g32610 (http://rice.tigr.org/), predicted to encode a Snf2 protein. The Snf2 protein family is composed of members similar to Saccharomyces cerevisiae Snf2p with a bipartite helicase domain containing Pfam SNF2_N and Helicase_C profiles, and includes many proteins involved in ATP-dependent chromatin remodeling [Os05g32610. Oligonucleotide primers were designed from these sequences and used to generate PCR amplicons spanning the maize Os05g32610 ortholog, which were sequenced from individuals homozygous for Rmr1 progenitor alleles and mutant derivatives patterns [Arabidopsis, RDR2, is required in this pathway to presumably generate double-stranded RNA from these transcripts and provide a substrate for siRNA biogenesis through activity of a Dicer-like enzyme [Arabidopsis [ysis see indicate by DRD1 . Arabidopatterns \u201326. In te enzyme . DRD1 ise enzyme \u201326,28. Tbidopsis .http://chromdb.org/), a partial protein predicted from maize expressed sequence tag sequences, or CHR156, a full-length protein predicted from maize genomic sequence with sequence similarity to the doppia element are detected in wild-type Pl\u2032 plants in both sense and antisense orientations to a T6\u20139 translocation breakpoint (T6\u20139). The T6\u20139 interchange can act as a dominant semi-sterility marker, allowing us to trace specific Pl1-Rhoades alleles through genetic crosses [rmr1 mutants heterozygous for the T6\u20139 interchange (T6\u20139 Pl-Rh/Pl\u2032) were crossed to a Pl-Rh/Pl-Rh tester . We observed that over half the progeny inheriting the interchange displayed a Pl\u2032/Pl\u2032-like phenotype (light anther pigmentation), indicating that paramutation was established in the rmr1 mutant parent. It should also be noted that Pl-Rh/Pl-Rh plants, and those of an intermediate phenotype of partial pigmentation [Pl\u2032 can revert to a Pl-Rh state in rmr1 mutants [Based on a reverse transcriptase PCR (RT-PCR) expression profile rmr1 app testers ,8. If RM crosses . rmr1 muh tester . If estaentation , were pr mutants .b1 locus generated similar results . This diversity likely represents great functional specialization amongst these proteins. We have placed RMR1 in an RdDM pathway based on its helicase domain similarity to DRD1 and the recent identification of MOP1 as an RDR2 ortholog [rmr1 mRNA expression profile [cis-elements is affected by mutations at trans-acting loci required for maintenance of repressed paramutant states. It appears that paramutations represent a type of emergent system wherein genomic context and maintenance of chromatin states interact to facilitate meiotically heritable epigenetic variation. In this view, it is possible that cis- and trans-elements necessary for maintenance of such variation might not interact in a direct and predictable manner. What remains to be seen is the extent to which this type of system acts throughout the genome. Genome-wide screens for paramutation-like behavior, in which expression states are affected by allele history, remain technologically and conceptually challenging. Recent work by Kasschau et al. [Arabidopsis, few endogenous genes are regulated by proximal presumed RdDM targets. However, it is tempting to speculate that examples of paramutation represent an exception to this trend, representing a mechanism by which populations can quickly, and heritably, change their transcriptome profile and regulation.Currently, well-characterized examples of paramutation are limited to loci where expression states have a clear phenotypic read-out, such as pigment synthesis. ed1 (r1) \u201359. To du et al. suggestsPl-Rh or Pl\u2032 states through visual inspection of anther pigmentation and assignment of an anther color score as previously described [Pl\u2032/Pl\u2032 (anther color score 1 to 4) anthers show little to no pigmentation while Pl-Rh/Pl-Rh (anther color score 7) anthers are dark red to purple. Mutants were scored in the same way, with rmr and mop mutants showing a Pl-Rh/Pl-Rh-like phenotype, except in the case of the F2 rmr1 mapping populations, in which mutants were chosen on the basis of a dark seedling leaf phenotype [Plants were scored as carrying escribed . Pl\u2032/Pl\u2032henotype .http://www.ars.usda.gov/main/site_main.htm?modecode=36-25-12\u201300). Color-converted versions of A619 and A632 inbred lines were created by introgressing the Pl1-Rhoades allele into each [rmr1\u20131, rmr1\u20132, mop1\u20131, and rmr6\u20131 alleles have been previously described [rmr1\u20133 allele was derived from identical materials used to isolate rmr1\u20131 and rmr1\u20132; rmr1\u20134 was derived from EMS-treated pollen from an A619 color-converted line applied to a color-converted A632 line [Pl1-Rhoades allele used in Pl\u2032 establishment tests has been described previously [Elite inbred lines were provided by the North Central Regional Plant Introduction Station /B-I; Pl1-Rhoades (Pl\u2032) Rmr1/Pl\u2032 rmr1\u20131 and B-I/B-I; Pl\u2032 rmr1\u20131/Pl\u2032 rmr1\u20131, or B-I/B-I; Pl\u2032 Rmr1/Pl\u2032 rmr1\u20133 and B-I/B-I; Pl\u2032 rmr1\u20133/Pl\u2032 rmr1\u20133. Identical procedures were applied to single ears from plants homozygous for Pl\u2032 and either homozygous or heterozygous for rmr1\u20133 following a single backcross into the KYS inbred line [In vitro transcription assays parents. DNA was isolated using the DNeasy 96 plant kit from F2 mutant seedlings, mapping parents, and F1 hybrid leaf tissue. These DNA samples were screened with SSLP markers developed from the Maize Mapping Project . Initial marker choice was restricted to Chromosomes 6 and 9 because of linkage of rmr1 to a T6\u20139 breakpoint. In addition to the rmr1\u20131 mapping population, a second F2 mapping population created with inbred (S7) rmr1\u20133/rmr1\u20133, Pl\u2032/Pl\u2032, and color-converted A632 parents showed similar cosegregation with marker bnlg1174a . CAPS [rmr1\u20131- and rmr1\u20133-associated lesions with the rmr1 mutant phenotype were found using either marker.A F2 mapping population was created from inbred (S9) M). CAPS markers Os05g32610 ORF as a query identified maize GSS and sorghum expressed sequence tag sequences that were used to generate a contig representing the putative maize gene were designed from these sequences and used in PCR amplification of genomic DNA from three separate individuals homozygous for each rmr1 mutant allele as well as functional reference alleles Rmr1-B73, Rmr1-A632, and Rmr1-A619. PCR amplicons were purified using QIAquick gel extraction kit (Qiagen) and dideoxy sequenced . To verify the intron/exon structure of rmr1, cDNA was generated from rmr1\u20131 mutants as well as non-mutant B73 plants as described [rmr1 was amplified via RT-PCR. The resulting products, which were the predicted size for spliced rmr1 transcript, were sequenced to validate the intron/exon structure shown in A BLAST search using the rice escribed , and rmrhttp://www.genecodes.com/) to create a contig representing rmr1. The N-terminal prediction is based on alignment of RMR1 with the protein model for Os05g32610. A search of the Pfam database (http://www.sanger.ac.uk/Software/Pfam/) with the predicted RMR1 protein sequence was used to identify the conserved SNF2_N and Helicase_C protein profiles of the Snf2 helicase domain. MUSCLE [Arabidopsis, rice, maize (CHR127 and CHR156), and budding yeast over the helicase domain (http://www.chromdb.org/). Additional sequence information for CHR156 was identified from BAC CH201-3L17 (GenBank accession AC194602), and gene model prediction was performed using FGENESH+ with RMR1 as similar protein support. A distance tree was created and bootstrap values were calculated using PAUP* 4.0 from the above alignment .Sequencing reads from genomic and cDNA were aligned and edited with Sequencher . The probes specific to pl1 are shown in Genomic DNA was isolated as described from theentation ,8,10,13.doppia sequence that hybridized with the riboprobe used to identify the small RNAs. The riboprobe was synthesized as described [doppia sequence.Small RNAs were prepared from 10-mm immature ear tissue and used to generate small RNA northern blots as previously described . In Figuescribed from a pPl\u2032 state in rmr1 mutants was assayed essentially as described previously [rmr1 mutants were crossed to Pl-Rh/Pl-Rh A619 or A632 inbreds Click here for additional data file.Figure S1pl1 transcription rates between rmr1 mutants and non-mutant heterozygotes.In vitro assays with isolated husk nuclei show no differences in .(A) In vitro radiolabeled RNAs corresponding to specific genes from isolated husk nuclei of sibling plants detected with slotblot hybridizations +/rmr1\u20131 (open) and rmr1\u20131/rmr1\u20131 (closed) siblings (\u00b1 standard error of the mean) showing no significant difference between pl1 transcription rates.(B) Quantification of relative mean transcription rates from five independent sets of rmr1\u20133 mutants and heterozygous siblings used to generate quantification in (C) In vitro radiolabeled RNAs from isolated husk nuclei of (708 KB TIF)Click here for additional data file.Figure S2Multiple species alignment of RMR1 helicase domain with other known and predicted Snf2 proteins.(101 KB TIF)Click here for additional data file.Figure S3Pl1-Rhoades upstream region in rmr1\u20131 mutants and heterozygous siblings.Additional Southern blots comparing the DNA methylation status of the rmr1\u20131 mutant (\u2212) and heterozygous sibling (+) using methylation-sensitive restriction enzymes in concert with BsrI, hybridized with probe A ((A) Genomic digests of an probe A A. These rmr1\u20131 mutants to heterozygous siblings with respect to methylation at a PspGI site.(B) Blot hybridized with probe A comparing (2.4 MB TIF)Click here for additional data file.Figure S4Pl1-Rhoades upstream region in rmr6\u20131 mutants and heterozygous siblings.Southern blots comparing the DNA methylation status of the Pl1-Rhoades locus hypomethylated (open circle) in a rmr6\u20131 mutant as compared to heterozygous siblings.(A) Methylation profile similar to that shown in rmr1 mutants in (B and C) Blots shown in (B) and (C) were used to generate this profile and are analogous to the blots shown for (2.2 MB TIF)Click here for additional data file.Figure S5Pl1-Rhoades upstream region in mop1\u20131 mutants and heterozygous siblings.Southern blots comparing the DNA methylation status of the Pl1-Rhoades locus hypomethylated (open circle) in a mop1\u20131 mutant as compared to heterozygous siblings.(A) Methylation profile similar to that shown in rmr1 mutants in (B and C) Blots shown in (B) and (C) were used to generate this profile and are analogous to the blots shown for (2.2 MB TIF)Click here for additional data file.Figure S6doppia small RNAs of both sense and antisense orientations are absent in rmr1 mutants. Small RNA northern blots were probed with probe B (doppia sequence similarity are present in sense and antisense orientation in rmr1\u20131 heterozygotes (+) and are lost in rmr1\u20131 mutants. DNA oligonucleotides (22 and 21 nt) used as sizing standards are also shown.Additional small RNA northern blots showing that probe B A in both(1.3 MB TIF)Click here for additional data file.Figure S7rmr1 mutations do not affect methylation levels at centromeric sequences and 45S ribosomal DNA repeats. Genomic DNA from four rmr1\u20133 mutants and non-mutant siblings digested with BstNI (\u201cB\u201d lanes) and a CNG methylation-sensitive enzyme, PspGI (\u201cP\u201d lanes), which has the same recognition site, probed with (A) radiolabeled centromere sequence and (B) 45S repeat sequence. The comparison between the PspGI digests in mutant and non-mutant individuals reveals no gross methylation differences.Southern blots show that (6.2 MB TIF)Click here for additional data file.Figure S8Pl1-Rhoades methylation status between the Pl-Rh and Pl\u2032 states.Additional Southern blots show no changes in Pl\u2032/Pl\u2032 and Pl-Rh/Pl-Rh plants with the Pl1-Rhoades allele introgressed (>98%) into distinct A619 and A632 backgrounds via hybridization with probe A. The blot reveals no methylation differences at this site between the two Pl1-Rhoades regulatory states. The \u201cC\u201d lanes indicate control lanes where the digest was carried out with BstNI, a methylation-insensitive restriction enzyme.(A) The methylation status of upstream PspGI sites is compared for (B) Analogous to blot shown in (1.9 MB TIF)Click here for additional data file.Figure S9rmr1 is expressed primarily in tissues with high mitotic index. Tissue samples represented in the analysis include seedling leaf, adult leaf, shoot apical meristem, immature tassel, and immature ear. RT-PCR was carried out using primers that span the first and second introns of rmr1.RT-PCR expression profile shows (358 KB TIF)Click here for additional data file.Protocol S1(47 KB DOC)Click here for additional data file.Table S1Pl-Rh in T Pl-Rh rmr1\u20132/+ Pl\u2032 rmr1\u20131 plants. Genetic assay used for this experiment is detailed in Results and Test cross results measuring acquisition of paramutagenicity by (127 KB DOC)Click here for additional data file.Table S2rmr1/rmr1; B-I/B\u2032 plants to Rmr1 b1 testers. Two different mutant rmr1 alleles are assayed. The B-I and B\u2032 plant phenotypes represent darkly pigmented and light or variegated pigment, respectively. With four exceptions, 206 test cross progeny had a B\u2032 phenotype.Table details individual progeny plant phenotypes from crosses of (38 KB DOC)Click here for additional data file.Table S3rmr mutations.Table details individual progeny anther phenotypes graded using a 1\u20137 anther color score from crosses designed to test genetic complementation of various (70 KB DOC)Click here for additional data file.Table S4(45 KB DOC)Click here for additional data file."} +{"text": "Symbiodinium are less documented. Here ecological and molecular evidence is presented demonstrating the existence of demersal free-living Symbiodinium populations in Caribbean reefs and the possible role of the stoplight parrotfish (Sparisoma viride) as Symbiodinium spp. dispersers. Communities of free-living Symbiodinium were found within macroalgal beds consisting of Halimeda spp., Lobophora variegata, Amphiroa spp., Caulerpa spp. and Dictyota spp. Viable Symbiodinium spp. cells were isolated and cultured from macroalgal beds and S. viride feces. Further identification of Symbiodinium spp. type was determined by length variation in the Internal Transcribed Spacer 2 and length variation in domain V of the chloroplast large subunit ribosomal DNA (cp23S-rDNA). Determination of free-living Symbiodinium and mechanisms of dispersal is important in understanding the life cycle of Symbiodinium spp.Coral-algal symbiosis has been a subject of great attention during the last two decades in response to global coral reef decline. However, the occurrence and dispersion of free-living dinoflagellates belonging to the genus Symbiodinium outside their hosts, documented from temperate waters of New Zealand Coral reefs maintain an incredible level of productivity considering the oligotrophic waters in which they are found. The high productivity and rapid growth exhibited by reef-building corals can be attributed to their association with symbiotic dinoflagellates referred to as zooxanthellae Symbiodinium spp., are not well understood Symbiodinium spp. within the host exhibits asexual reproduction through mitosis. However, genetic evidence including no linkage disequilibrium and high allelic diversity suggest the presence of recombination and sexual reproduction Symbiodinium) sister groups, exhibit nuclear cyclosis and meiosis according to nuclear and mitochondrial DNA The complete life stages and sexual reproduction of most dinoflagellates, including Symbiodinium spp. is important for understanding coral reefs and the coral-symbiont dynamics Symbiodinium spp. reservoir from where corals with horizontal symbionts acquisition mode will obtain Symbiodinium spp.Characterization of free-living Symbiodinium spp. carried on by Sparisoma viride. This is especially interesting considering their limited motility capacities Symbiodinium spp. live in other habitats such as macroalgal beds and turfs, herbivorous fishes should serve as a dispersing mechanism, disposing partially digested and viable free-living Symbiodinium in various habitats.The second part of this study addresses dispersion exhibited by Sparisoma viride, known as the stoplight parrotfish, belongs to a functional group of herbivorous that has a significant effect in Caribbean reefs due to their bioerosion, sediment removal and foraging behaviors S. viride feeds exclusively on algae; 95% of the bites registered were done on algae associated with dead coral, while only a 3.6% was done to live coral (\u201cspot biting\u201d), presumably a territorial behavior. It was noted that occasionally the fish spite out the food, particularly when they ingested live corals Coral reef scientists have started to appreciate the important role of parrotfishes as ecosystem engineers and keystone species, leading to cascade effects and positive feedbacks directly to coral reef health and resilience. Parrotfishes have record rates of bioerosion in some coral reef areas and their coral grazing effect promotes reef-building coral diversity Symbiodinium spp. populations in coral reefs and (ii) to examine the potential role of reef fishes (Sparisoma viride) as free-living Symbiodinium spp. dispersers.The aims of this paper were (i) to present both ecological and molecular evidence demonstrating the existence of macroalgal-associated demersal free-living Halimeda spp., Dictyota spp., Lobophora variegata, Caulerpa spp., and Amphiroa spp.) that where next to coral colonies, and withdrawing particles that were in suspension with a 60 ml syringe reefs, between 2005 and 2006. Sites (reefs), depths, and number of samples are summarized in the syringe . Water aSymbiodinium spp. \u22121) to avoid bacteria contamination. The cultures were started in sterilized test tubes, sealed with cotton, and exposed to a photoperiod 12 hrs light: 12 darkness at 27\u201330\u00b0C. Direct observations under microscope of the cultures were carried out to verify zooxanthellae presence. When zooxanthellae growth was noticed, a sample was taken out and DNA extracted.F/2 medium Symbiodinium spp. using polymerase chain reaction (PCR). The ITS2 region was amplified using the forward primer \u201cITSintfor2\u201d (5\u2032GAATTGCAGA ACTCCGTG-3\u2032) and a modified reverse primer \u2018ITS2CLAMP (5\u2032CGCCCGCCGC GCCCCGCGCC CGTCCCGCCG CCCCCGCCC GGGATCCATA TGCTTAAGTT CAGCGGGT-3\u2032) DNA from cultured cells and environmental samples were extracted using the CTAB phenol-chloroform-isoamyl alcohol protocol Symbiodinium spp. isolated from corals of the same reefs that the water and fecal samples were collected (unpublished) webpage database and from blished) . PhylogeHalimeda spp., Lobophora variegata, Amphiroa spp., and Caulerpa prolifera , B and C (ITS2) and Pseudopterogorgia acerosa (B184). The identity of isolated type of clade C is not precise, due to the large polytomy present in this group.Positive molecular identifications of free-living samples and in cociation . Overallomic DNA and 3. O samples . SequencC (ITS2) ; Table 2Symbiodinium spp. were successfully cultured of other dinoflagellates such as Amphidinium carterae and Gymnodinium spp., as well as a diatom consortium, were always negative for the targeted cp23S DNA regions, reassuring on the zooxanthellae specificity of the molecular method used.Free-living cultured . The culSymbiodinium spp. cells in demersal plankton habitats Symbiodinium spp. Positive identification was achieved by molecular analysis and viability by culturing of Symbiodium spp. as adults and recruits Cassiopea xamachana) Acropora longicyathus)Symbiodinium types inside the host are due to shifts in the densities of preexisting types and not from the acquisition of environmental \u201cnovel\u201d types Symbiodinium spp. uptake.There is evidence of zooxanthellae uptake from the environment in octocorals (Symbiodinium spp. are obtaining inorganic nutrients from host metabolism, including ammonium and phosphate Symbiodinium spp. because they can find some of the benefits that they obtain from the coral in other habitats such as macroalgal beds.The term holobiont has been used to describe the tight symbiotic relationship between coral and algae. The reported advantages of the symbiosis are mainly for the coral Symbiodinium spp. populations is also important for understanding the life history of Symbiodinium spp. As mentioned above sexual reproduction in Symbiodinium spp. is not well understood Characterization of free-living Symbiodinium spp. populations in coral reefs and that Sparisoma viride feces carry viable Symbiodinium cells. This information builds upon our limited understanding of the distribution and dispersion of demersal free-living Symbiodinium spp. More research on Symbiodinium life history and ecology is urgently needed.From this characterization study, we can conclude that there are macroalgal-associated demersal free-living"} +{"text": "After briefly reviewing theories of standard setting we analyzed the problems of the current cut scores. Then, we reported the results of need assessment on the standard setting among medical educators and psychometricians. Analyses of the standard setting methods of developed countries were reported as well. Based on these findings, we suggested the Bookmark and the modified Angoff methods as alternative methods for setting standard. Possible problems and challenges were discussed when these methods were applied to the National Medical Licensing Examination. Recently the need for reliable and valid licensing examinations for health personnel is increasing in importance in Korea. This is due to its direct relation to the quality of health personnel and subsequently the nation's health. The National Health Personnel Licensing Examination Board (NHPLEB) currently uses a cut score of 60-40% as a license requirement. These cut scores have been applied to various national examinations in Korea and are regarded as reasonable. From the perspective of psychometrics, however, it is not a valid way to set a cut score, especially for a licensing examination that is intended to discern those who acquire minimum competence from those who do not.In this review, we first examined theories of standard setting and analyzed problems of the current cut scores. Then, we reported the results of need assessment on the standard setting among medical educators and psychometricians. Analyses of the standard setting methods of developed countries were reported as well. Based on these findings, we suggested new methods of standard setting and discussed possible problems and challenges when applied to National Medical Licensing Examination (NMLE).A cut score indicates the minimum level of knowledge or skill that a candidate must have acquired to perform health professions. Cut scores are professionally expressed value on candidates' competency, which reflects educational philosophy and consensus among those related. This means that setting cut scores should be understood not as a mathematical technique but as a complex policy-making process.Setting cut scores usually progresses as follows: 1) Deciding on the type of standard (absolute vs. relative standards), 2) Deciding on the method for setting standards, 3) Selecting the judges, 4) Holding the standard setting meeting, 5) Calculating the standard, 6) Checking the results [There are several methods to set standards. Generally accepted methods are as follows; contrasting groups method, borderline group method, Nedelsky's method, Angoff's method, Ebel's method, and so on . Among The current 60-40% system was arbitrarily set under Japanese colonial rule, with no educational and philosophical basis. In addition, it can result in gross misclassification, such as the unfortunate failure of the competent and the fortunate pass of the non-competent depending on test difficulty.In principle, the difficulty of criterion-referenced test such as licensing examination is not adjusted before examination in consideration of optimal passing rate. In Korea, it is not practically possible to adjust the degree of difficulty in advance due to the drainage of test items. Instead, examiners are expected to make good questions asking basic knowledge and skill that are required to perform health professions. Since the current 60-40% criterion does not reflect this minimum level of competence, it should be changed.Surveys were conducted to gather input from psychometricians, medical educators, and examiners. There were 38 respondents for the survey, and it was carried out from Januray 7th to 12th in 2005. We asked whether and why they thought the current cut score was valid and their suggestions for improvement. The results are in The followings are suggestions for improvement. First, most of the respondents believed that absolute evaluation should be retained. To do so, transformed scores can be a viable alternative. Second, examination objectives should be developed. Third, investment in faculty training for the item development is required. Fourth, scientific and systematic methodology is needed to analyze test items, to control the degree of difficulty. Fifth, item bank should hold more realistic items. Sixth, there should be flexibility in setting the cut score. For example, the Angoff method provides such flexibility. Finally, the cut score should be set under the agreement among stakeholders such as NHPLEB, medical representatives, and so on.We analyzed the standard setting methods of several developed countries. The results are summarized in We reached the agreement that Bookmark and modiIn 2002, the Bookmark standard setting was applied to discern those who achieved basic competency from those who did not among 3rd year elementary school students. It was the first application of the Bookmark method in Korea. The method allows a standard setting panel to be accustomed to the characteristics of the test and provides the panel with the results of standard application. The panel consists of subject experts. For example, the panel for setting national basic performance level in reading consists of professors of Korean language education, experienced teachers and researchers, administrators, and parents. The Bookmark method proceeds as follows .a) The panel received an ordered item booklet (OIB), which lists items in order of difficulty, from the easiest to the hardest. To make the OIB, item response theory (IRT) was applied and 2/3 probability of correct response was used as a scale score to represent examinee ability.b) The panel was divided into small groups-typically groups of six to eight people. In small groups, the panel examined each item in the OIB and discussed knowledge and skills required to answer the item correctly.c) After the group discussion, each panelist determined a cut score by placing a bookmark in the OIB based on his or her own judgment of what students with basic performance level should know and be able to do. The scale score of the marked item was the first demarcation.d) The panel engaged in the small group discussion again to compromise differences in their opinions. The panelists then marked their choice on the OIB, which was the second demarcation.e) Two small groups were combined into a mid-sized group to prevent one specific individual from dominating the discussion in small groups. After the group discussion, the panel was given another opportunity to change their choice and placed the bookmark on the OIB.f) Finally, all panelists gathered in one place and discussed their choice of bookmarks. After the discussion, they were given a final opportunity to change their choice. They then placed the final bookmark on the OIB.g) All the bookmark placements in the final round were gathered and the median was calculated to set the panel's recommended cut score.h) Based on the cut score, the panel examined the items before the bookmark and wrote performance-level descriptors that represent a summary of the knowledge, skills, and abilities that students with the basic performance level must be able to demonstrate. The bookmark method compensates for the drawback of the Angoff's method, which is that the panel cannot correctly estimate item difficulty. In addition, people with little psychometric knowledge can understand the meaning and implication of the cut score because the bookmark method provides performance-level descriptors. Considering these theoretical merits, combined with the practical application of the method to the diagnostic assessment of the 3rd year elementary students, the bookmark method can be a viable alternative in setting the standard of national medical licensing examination.In the original Angoff method, there was no details of how to run an operational cut score study. Due to the lack of specificity in the original method, many modifications were suggested. The following is a general process of modified Angoff methods.a) The choice of a panel: Generally, the panel consists of subject experts, teachers, related administrators, and so on. In case of medical licensing examination, the panel may include doctors and professors of basic science and clinic, medical administrators, and so on. The panel should be content experts and know well the characteristics of examinees. There are diverse opinions on the appropriate number of the panel, but at least 10 panelists are required, while 15~20 panelists are ideal -9.b) Achievement Level Description (ALD): Conceptualizing achievement level starts from policy definition. Government agency such as the Ministry of Education & Human Resources Development or the Ministry of Health & Welfare provides a policy definition of achievement levels. Based on this policy definition, the panel discusses and describes performance of each level. This description specifies what students at each level should know and be able to do in terms of knowledge, skills, and behaviors and provides an operational definition. Exemplary items can be provided as well. To save time, the facilitator may provide preliminary ALD with the panel, so that the panel starts to set the standard with some consensus on the characteristics of a borderline group.c) Practice: The panel practices with exemplary items. In case different types of items are mixed, they practice with each type of item. Especially for performance item, actual performance data should be provided, so that the panel can get a sense of the level of examinees.d) The first round of estimation: The panel is divided into small groups of three or four people. The panel solves actual items on the exam. After solving the exam, they check their answers with correct ones. Then, they estimate the probability of correct answers of a borderline group of examinees for each item. After individual estimation, the results are collected and the cut score is set at the sum of medians of each item. The cut score is posted and the result of cut score application is provided, so that the panel has opportunity to check whether it is realistic and change it if necessary.e) The second round of estimation: The panel is divided into mid-sized groups. Based on ADL and their experiences at the first round, they exchange their opinions. Then, they estimate the probability of correct answer of a borderline group of examinees for each item.f) The third round of estimation: All the panelists gather at one place and discuss. The focus is on the items showing large deviations. After the discussion, they make third estimations. The results are collected and posted. If the third round is enough, the cut point obtained at the third round becomes the final cut score. The cut score is transformed into a scale score.g) Description of minimum competency: If required, the panel writes what students at each level are able to do by analyzing items and students' response to the items. The modified Angoff method is widely used in foreign counties. The method has been applied to National Assessment of Educational Achievement since 2003 by Korea Institute of Curriculum & Evaluation . Since The two methods are compared in terms of process, time and cost, and advantages and disadvantages. The results are shown in For the Bookmark and modified Angoff methods to be applied, there are a few practical issues to consider.Need for committee: In a test-centered approach in setting the standards, there should be a committee for each subject. Since there are three subjects in NMLE, three committees are required. If twenty members are set for each committee, 60 members are in need, which would incur considerable costs. Insufficient budgeting, and consequent insufficient committee size, can lead to the loss of validity in setting the standard.Need for psychometric analysis: Both methods recommended in the present paper are based on scientific analysis of psychometrics. Therefore, to apply the methods, classical item analysis and IRT should be applied in advance. For example, OIB in the Bookmark method requires pre-analysis based on IRT. The OIB costs extra time and cost, but it lessens the burden of the panel.Need for extra cost: To apply a scientific and valid method,extra cost is inevitable.No need for amendment of medical law: A question arises as to the need for amendment of medical law with a new standard setting method. However, the current law can be maintained even with a new method. One way to do so is to transform raw scores to scale scores. In Test equating method: In general, the cut score is not set every year. Instead, a statistical technique is applied to make different tests comparable. This is called test equating , 12. If In the present paper, we attempted to suggest a valid and reasonable way to set the cut score of the NMLE. Based on the review of various theories, the need assessment, and the results of the analyses of foreign countries' systems, we suggested the Bookmark and the modified Angoff methods as viable alternatives to the current system. To apply these new methods, several issues must be resolved beforehand. First, the philosophical meaning of licensing examination itself should be reconsidered. Under the current fixed cut score, test difficulty should be adjusted in advance in order to prevent a radical change in pass rates, which violates the concept of licensing or certifying examinations.Second, philosophical reconsideration of the standard setting is required. The current 60-40% was set without any philosophical or educational rationale. Therefore, we need to set the cut score based on the meaning and philosophy of license examination.Third, the issue of security and copyright of test items should be resolved. Currently, the NHPLEB as a rule does not release test items. However, examinees release the items to their peers after their examination, making it possible to almost restore the original test. This is obviously infringement of copyright. In Korea, however, this kind of act is not regarded as serious and those related show no moral remorse. This common practice of plagiarism should be controlled in the near future.We hope our research facilitates the discussion of the standard setting in Korea, and contributes to produce competent medical professionals."} +{"text": "The solubility and stability of \u03b3D-crystallin play a crucial role in maintaining the optical properties of the lens during the life span of an individual. Previous study has shown that the inherited mutation G61C results in autosomal dominant congenital cataract. In this research, we studied the effects of the G61C mutation on \u03b3D-crystallin structure, stability and aggregation via biophysical methods. CD, intrinsic and extrinsic fluorescence spectroscopy indicated that the G61C mutation did not affect the native structure of \u03b3D-crystallin. The stability of \u03b3D-crystallin against heat- or GdnHCl-induced denaturation was significantly decreased by the mutation, while no influence was observed on the acid-induced unfolding. The mutation mainly affected the transition from the native state to the intermediate but not that from the intermediate to the unfolded or aggregated states. At high temperatures, both proteins were able to form aggregates, and the aggregation of the mutant was much more serious than the wild type protein at the same temperature. At body temperature and acidic conditions, the mutant was more prone to form amyloid-like fibrils. The aggregation-prone property of the mutant was not altered by the addition of reductive reagent. These results suggested that the decrease in protein stability followed by aggregation-prone property might be the major cause in the hereditary cataract induced by the G61C mutation. The vertebrate ocular lens is an avascular tissue composed of ordered fiber cells, and the architecture of the fiber cells provides a structural basis of the optical properties of the lens at the cellular level The differentiation of the epithelial cells to fiber cells of vertebrates continues throughout the life by laying the young fiber cells surrounded the pre-existing cells, and the oldest interior cells are as old as the individual In human lens, \u03b3C- and \u03b3D-crystallins are expressed at the highest level among the \u03b3-crystallins (about 80%) Tris, sodium dodecylsulfate (SDS), ultra-pure guanidine hydrochloride (GdnHCl), 1-anilinonaphtalene-8-sulfonate (ANS), thioflavin T (ThT), insulin and bovine serum albumin (BSA) were Sigma products. Dithiothreitol (DTT) was from Promega. All other chemicals were local products of analytical grade.CRYGD) and the pET-28a expression vector used for site-directed mutagenesis were the same as those described previously E. coli BL21(DE3) Rossetta (Novagen), and a six-His Tag was fused to the N-terminus of the recombinant proteins to facilitate further purification. The expression of the recombinant proteins was induced by the addition of 0.1 mM IPTG. The proteins in the soluble fractions of the E. coli ells were collected by affinity chromatography using Ni-NTA resin (Qiagen), and the final products were purified by a Hiload 16/60 Superdex 200 prep grade column or a Superdex G-200 column equipped on an \u00c4KTA purification system. The protein samples were prepared by dissolving the proteins with a final protein concentration of 0.2 mg/ml in 10 mM phosphate buffered saline (PBS) buffer, pH 7, containing 1 mM EDTA. The protein concentration was determined according to the Bradford method The gene of the wild type (WT) human \u03b3D-crystallin (The far-UV circular dichroism (CD), intrinsic Trp fluorescence and extrinsic ANS fluorescence spectra were obtained following the procedures described elsewhere I365) by that at 320 nm (I320), is a sensitive probe to reflect the changes of the shape and position of the intrinsic Trp fluorescence. Phase diagram, which is a powerful tool to detect the potential protein folding intermediate I320 vesus I365. The fitting of the Trp fluorescence using the discrete states model of Trp fluorophores The analysis of the fluorescence data using Parameter A, phase diagram and curve fitting were the same as the procedures described elsewhere The equilibrium unfolding of the WT and mutated \u03b3D-crystallin was performed by incubating the proteins in 10 mM PBS buffer containing various concentrations of GdnHCl at 25\u00b0C overnight. The final protein concentration was 0.2 mg/ml. After incubation, the intrinsic fluorescence and turbidity at 400 nm were measured to obtain the unfolding transition curves. The experimental data were fitted to a three-state model using Prism 4.0, and the thermodynamic parameters were obtained by fitting using non-linear least squares regression.The protein solutions were heated at every given temperature ranging from 25\u00b0C to 85\u00b0C. The temperature was controlled by a water-bath. After 2 min equilibration, far-UV CD, turbidity, intrinsic and ANS fluorescence measurements were performed to monitor the structural changes of the proteins.The pH of the protein solutions was adjusted using HCl ranging from pH 2 to pH 8. The protein concentration was 0.2 mg/ml. After 45 min equilibration at room temperature, far-UV CD, intrinsic and ANS fluorescence were measured to reflect the secondary structure, tertiary structure and hydrophobic exposure of the proteins.The formation of the amyloid-like fibrils were performed according to the published procedures Protein aggregation was monitored by turbidity (absorbance at 400 nm) on an Ultraspec 4300 pro UV/Visible spectrophotometer. Heat-induced protein aggregation was examined by measuring the turbidity of a sample at various temperatures after 10 min equilibration. The time-course aggregation induced by heat was monitored by recording the turbidity data every 2 s for the sample heated at a given temperature. The time-course aggregation during refolding was recorded immediately after the refolding was initiated by diluting the fully denatured proteins into 10 mM PBS buffer in the presence or absence of DTT.The purified proteins were found to be homogenous as evaluated by SDS-PAGE and SEC analysis. In the SEC profile, both the WT and mutated proteins eluted as a single peak and the elusion volume was not significantly affected by mutation . This suT0.5) of the mutated protein was \u223c74\u00b0C when probed by far-UV CD, intrinsic fluorescence and light scattering. The T0.5 value of the WT protein was above 80\u00b0C, while the exact value could not be obtained for the data from intrinsic fluorescence and light scattering since the transition curves did not reach its equilibrium. ANS, a fluorescent molecule with the ability to specifically bind with the hydrophobic site T0.5 value from ANS fluorescence was \u223c4\u00b0C lower than that from the other three probes for both proteins. Thus the inconsistency of the transition curves suggested that the thermal denaturation of both the WT and mutated \u03b3D-crystallin might involve sequential events, and the exposure of the hydrophobic core was an early event during \u03b3D-crystallin thermal unfolding as revealed by the ANS fluorescence.The effect of the G61 C mutation on \u03b3D-crystallin thermal stability was investigated by increasing the incubation temperature every 2\u00b0C from 25\u00b0C to 85\u00b0C. The structural changes were monitored by far-UV CD, intrinsic fluorescence, ANS fluorescence and resonance Raleigh light scattering, which reflects the secondary structure, tertiary structure or microenvironment of the Trp residues, hydrophobic exposure and oligomeric state of proteins. As presented in To further investigate the sequential events occurred during \u03b3D-crystallin thermal denaturation, phase diagram was constructed to check whether there existed an unfolding intermediate. In the phase diagram, each linear part indicates a two-state process, and the joint-point of two adjacent lines indicates the appearance of a folding intermediate at this position \u03b3D-crystallin contains four Trp residues. When fitted by the discrete state model Thus the results in Equilibrium unfolding experiments were carried out to probe the effect of the mutation on the structural stability of \u03b3D-crystallin against chemical denaturants. Previous studies have shown that the unfolding of \u03b3D-crystallin undergoes a multi-state process with an intermediate populated under equilibrium unfolding conditions: native state (N)\u2192intermediate (I)\u2192unfolded state (U) Acidosis is a frequently encountered stress in bodies. The acid resistance of the WT and mutated \u03b3D-crystallin was evaluated by measuring the structural changes when decreasing the pH of the solutions. No significant changes in either the secondary or tertiary structures were observed for both proteins as reflected by the almost constant CD signal (data not shown) and intrinsic Trp fluorescence . An incrCataract is a disease caused by protein aggregation. To further study the effect of the mutation on \u03b3D-crystallin fibrilization, the WT and mutated proteins were incubated at a high protein concentration (5 mg/ml) at acidic conditions, and then ThT fluorescence was used to probe the existence of amyloid-like fibrils. As presented in A previous study has shown that one cataract-linked mutation R14C introduces an additional reactive thiol group, which contributes to the intermolecular cross-link of the \u03b3D-crystallin molecules and leads to aggregation therefore \u03b3D-crystallin is one of the major structural proteins in human eye lens. The solubility and stability of \u03b3D-crystallin play a crucial role in maintaining the optical properties of the lens during the life span of an individual. Up to now, 19 mutations in \u03b3D-crystallin have been reported to be associated with the occurrence of autosomal dominant congenital cataract E. coli . It seems that the inability to fold into soluble proteins is the dominant mechanism of congenital cataract caused by truncations. Among the cataract-linked \u03b3D-crystallin mutations, the most frequently occurred mutation is the substitution of a charged residue to non-charged residue or vice versa , which may decrease the solubility of \u03b3D-crystallin by simply modifying the surface charge distributions. Actually, the surface charge-altering mutation has also been frequently characterized in the other crystallins Previous studies revealed that these mutations may affect \u03b3D-crystallin via different molecular mechanisms. One specific group of mutations is nonsense and frame-shift mutations, which significantly altered the primary structure of the protein. Particularly, the truncation usually appears at the C-terminus of \u03b3D-crystallin, and the truncated mutants are not able to fold correctly to a native-like soluble form when overexpressed in In this research, we found that the inherited mutation G61C did not significantly modify the native structure of \u03b3D-crystallin as revealed by spectroscopic experiments. G61 is located at the last strand of the second Greek-key motif in the N-terminal domain, and the G61C mutation seems to have little impact on the fold of the motif. The little changes in the native structure with no additional hydrophobic exposure suggested that the mutation might not significantly interfere with the correct protein-protein interaction network in the normal conditions of the lens, unlike what has been observed for the E107A mutation in \u03b3D-crystallin The alteration of the number of Cys residues in a protein may affect its responses against redox disturbance in the cells. The WT \u03b3D-crystallin contains six Cys residues, and only one is exposed to the solvent The results herein suggest that the decreased stability of \u03b3D-crystallin by the G61C mutation was the major cause of the onset of hereditary cataract. We found that the mutation significantly decreased \u03b3D-crystallin stability against heat and chemical denaturants. The GdnHCl-induced unfolding of \u03b3D-crystallin has been well characterized to be a three-state process involved an intermediate with an unfolded N-terminal domain and a folded C-terminal domain in vitro system showed that the aggregation of the mutant required a relative high temperature (above 75\u00b0C), the proteins might be more prone to aggregate under relatively mild conditions when the lens cells suffered a combination of various stresses during development.Unlike the destabilization effect on heat- and GdnHCl-induced denaturation, the G61C mutation did not affect the acid-induced unfolding of \u03b3D-crystallin. However, the mutant was more prone to form amyloid-like fibrils than the WT when incubated at temperatures above 30\u00b0C. It is worth noting that the denaturation of proteins is temperature-dependent. Thus although the mutation had no effect on the acidosis resistance of \u03b3D-crystallin, a combination of both acidosis and heat stress could promote the unfolding and aggregation of the mutated protein. At a low concentration of 0.5 mg/ml, the mutant was found to successfully convert to mature fibrils after 72 h incubation, while the WT protein was still at the initial stage of fibrilization. These observations suggested that although the"} +{"text": "In the methyl\u00adsulfonyl substituent, the two S\u2014O bonds are of equal length [1.402\u2005(2)\u2005\u00c5]. In the crystal, adjacent mol\u00adecules inter\u00adact weakly through Cl\u22efN contacts [ca 3.197\u2005(2)\u2005\u00c5].The triazoloquinazole fused-ring system of the title compound, C For the synthesis of the precursor, see: Al-Salahi & Geffken 2011.10H7ClN4O2SCMr = 282.71Monoclinic, a = 12.6386 (3) \u00c5b = 10.7464 (3) \u00c5c = 8.6317 (3) \u00c5\u03b2 = 102.459 (3)\u00b0V = 1144.74 (6) \u00c53Z = 4K\u03b1 radiationCu \u22121\u03bc = 4.69 mmT = 294 K0.30 \u00d7 0.25 \u00d7 0.20 mmAgilent SuperNova Dual diffractometer with an Atlas detectorCrysAlis PRO; Agilent, 2012)Tmin = 0.334, Tmax = 0.454Absorption correction: multi-scan (10130 measured reflections2383 independent reflectionsI > 2\u03c3(I)2168 reflections with Rint = 0.025R[F2 > 2\u03c3(F2)] = 0.037wR(F2) = 0.113S = 1.032383 reflections165 parametersH-atom parameters constrainedmax = 0.27 e \u00c5\u22123\u0394\u03c1min = \u22120.40 e \u00c5\u22123\u0394\u03c1CrysAlis PRO used to solve structure: SHELXS97 global, I. DOI: 10.1107/S1600536812021770/bt5916Isup2.hklStructure factors: contains datablock(s) I. DOI: 10.1107/S1600536812021770/bt5916Isup3.cmlSupplementary material file. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"} +{"text": "Angelman syndrome (AS) is a neurodevelopmental disorder. AS patients concomitant with sSMC are rather rare events. It will provide more useful and proper information for genetic counseling to identify the sSMC origin.A 27-year-old woman was referred for genetic counseling and prenatal diagnosis at 26\u00a0weeks of gestation due to her elder daughter, diagnosed as Angelman syndrome (AS) with an interstitial deletion in one of the chromosomes 15, carrying a small supernumerary marker chromosome (sSMC). The G-banding results of the woman and her current fetus both were 47,XX,+mar. In this paper, fluorescence in situ hybridization (FISH) results showed that there was no deletion of chromosome 15 in the woman and fetus. We demonstrated that the proband\u2019s sSMC was maternally inherited and was an inv dup(22)(q11.1) , and that the deletion in 15q11.2-q13.1 was de novo.Taking into account above results and normal phenotypes of the proband\u2019s mother, in this case we suggest that the sSMC don\u2019t increase the recurrence risk of AS. After prenatal diagnosis, the woman chose to continue the pregnancy, and finally gave birth to a normal female infant. UBE3A (ubiquitin protein ligase E3A) [OMIM:105830] [Angelman syndrome (AS) is a neurodevelopmental disorder. Main clinical characteristics of AS include severe developmental delay, speech impairment, movement or balance disorder and apparent happy demeanor. Genetic mechanisms of AS involved the commonest, (micro) deletions in maternal chromosome 15q11-13, paternal uniparental disomy 15 (UPD), imprinting defects and/or mutation in the disease-causing gene Small supernumerary marker chromosomes (sSMC) are defined as structurally abnormal chromosomes that cannot be identified or characterized unambiguously by conventional banding cytogenetics alone. The size of sSMC is generally equal to or smaller than a chromosome 20 of the same metaphase spread . FurtherAs far as we know, there were rare nine AS cases reported in connection with sSMC. All AS cases with sSMC reported were related to chromosome 15. It is generally considered that the sSMC derived from chromosome 15 and contained the Prader\u2013Willi/Angelman syndrome critical region (PWACR) would cause clinical phenotypes. We reported a previous case of AS with sSMC derived not from chromosome 15 . At thatA 27-year-old woman was referred for genetic counseling and prenatal diagnosis at 26\u00a0weeks of gestation because her first daughter was diagnosed as Angelman syndrome (AS) due to a 5.058\u00a0Mb deletion in chromosome band 15q11.2-q13.1 and with a small supernumerary marker chromosome (sSMC). The proband was born by the woman and her former husband. Neither with her former husband nor with her current husband, they were in a non-consanguineous marriage. There was no family history of miscarriage or congenital malformations from either the two-term husbands or the woman. No abnormal symptoms were observed, and physical examination revealed that the couple was phenotypically normal.D15S10,UBE3A and centromere of chromosome 15 confirmed the deletion of chromosome 15q11-13 and the sSMC was unrelated with chromosome 15.The proband was diagnosed as AS at 3-year-old. G-banding revealed a karyotype 47,XX,+mar in all of the peripheral blood lymphocytes. Her paternal karyotype was normal and the information of her mother was unknown formerly. Silver staining for the nucleolus organizer regions (NOR staining) revealed two satellites in both ends of the sSMC. Fluorescence in situ hybridization (FISH) using the 15 dual color DNA probes , which hybridize to Peripheral blood from the woman and cord blood from the fetus were drawn for cytogenetic analysis including G-banding and fluorescence in situ hybridization (FISH). FISH using the 15 dual color DNA probes was performed according to standard procure. Centromeric FISH probes for chromosome 14 and 22, followed by sub-centromeric FISH probes for chromosome 14 or 22 were adopted to identify the the origin of sSMC in the proband. Centromere FISH and sub-centromere FISH were kindly performed by the laboratory of Professor Thomas Liehr .G-banding showed both of karyotypes in woman and her fetus were 47,XX,+mar\u00a0in 100 % of the analyzed cells.. This revealed the small supernumerary marker chromosome (sSMC) in the proband was maternally inherited. Fluorescence in situ hybridization confirmed that there was no deletion of chromosome 15q11-13 in the woman and her fetus, therefore Angelman syndrome was not considered. FISH analysis with centromeric probe of chromosome 15 also excluded the possibility of the origin from the chromosome 15 (q11.1) were contained. The microarrays analysis further characterized the region confirmed by FISH.Angelman syndrome (AS) has a prevalence of 1/10,000\u2009~\u20091/20,000 individuals [http://ssmc-tl.com/sSMC.html), the corresponding sSMC were derived from chromosome 15 in all nine cases. In five of them, the AS was due to a paternal UPD 15, in three due to a deletion in the AS-critical region [What\u2019s special about the AS proband we reported was accompanied by a small supernumerary marker chromosome (sSMC). AS patients concomitant with sSMC are rather rare events. Just nine AS cases with the sSMC were reported by now. As summarized in sSMC-homepage (q11.1) (Fig.\u00a0de novo large deletion in the chromosome 15q11-13 is reported\u2009<\u20091\u00a0% [6 living sSMC carriers in the world, almost 70\u00a0% of those are clinically normal [The risk to the sibs of an individual with AS who was identified a y normal . FurtherTaking into account the normal phenotype of the proband\u2019s mother, we thought that AS in the proband could be explained by the microdeletion on one of the chromosome 15q11-13, and not by the presence of the sSMC.After prenatal diagnosis and genetic counseling, the woman chose to continue the pregnancy, and finally gave birth to a normal female infant.In summary, the recurrence risk of AS depends on the genetic mechanism of AS in the proband. When AS accompanied by sSMC, it will provide more useful and proper information for genetic counseling to identify the sSMC origin.Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal."} +{"text": "Using classical and confocal fluorescent microscopy, the nuclear colocalization of chromosomes 15 and sSMC was analyzed. The molecular cytogenetic characteristics of sSMC delineated the karyotype as 47,XY,+der(15)(pter->p11.2::q11.1->q11.2::p11.2->pter)mat. Analysis of meiotic segregation showed a 1:1 ratio of sSMC+ to sSMC\u2212 spermatozoa, while evaluation of sperm aneuploidy status indicated an increased level of chromosome 13, 18, 21 and 22 disomy, up to 7\u2009\u00d7\u2009(2.7\u2009\u2212\u200915.1). Sperm chromatin integrity assessment did not reveal any increase in deprotamination in the patient\u2019s sperm chromatin. Importantly, we found significant repositioning of chromosomes X and Y towards the nuclear periphery, where both chromosomes were localized in close proximity to the sSMC. This suggests the possible influence of sSMC/XY colocalization on meiotic chromosome division, resulting in abnormal chromosome segregation, and leading to male infertility in the patient.Chromosomes occupy specific distinct areas in the nucleus of the sperm cell that may be altered in males with disrupted spermatogenesis. Here, we present alterations in the positioning of the human chromosomes 15, 18, X and Y between spermatozoa with the small supernumerary marker chromosome (sSMC; sSMC The sSMC frequency in newborns is 0.044% (0\u20130.219%), while in patients with fertility problems, the sSMC rate increases to 0.125%Supernumerary marker chromosomes (sSMC) are small, structurally abnormal chromosomes that occur in addition to the normal set of 46 chromosomes. Overall, 75% of sSMCs are 044% 0\u20130.19%, whil044% 0\u20130.19%, whil044% 0\u20130.19%, whilde novo sSMCs and in cases with repeated spontaneous abortions), and from some unknown epigenetic factors.In infertile carriers, up to 85% of sSMCs originate from acrocentric chromosomes, mostly from chromosome 15 (approximately 45%), and in more than 50% of cases, the sSMCs are parentally inherited2It is known, that in the nucleus of diploid cells, chromosomes are localized nonrandomly in chromosome territories (CT). Together with interchromatin compartments (ICs) and other elements of the nuclear matrix, CTs form the so-called intranuclear architecture791010111210141617111920111116192123241123242526+) and without (sSMC\u2212) the marker chromosome obtained from the same ejaculate of the sSMC carrier. We therefore compared the spatial localization of the centromeres of chromosomes 15, 18, X and Y in sSMC+ vs. sSMC\u2212 spermatozoa, also including the positioning of the marker chromosome. Moreover, molecular and cytogenetic methods were used to ascertain the karyotype of the carrier, followed by evaluations of meiotic segregation, sperm aneuploidy level, and chromatin deprotamination status.In the present study, we aimed to analyze the differences in chromosome topology in spermatozoa with .arr[hg19] 15q11.1q11.2\u00d73.The characteristics of the analyzed sSMC are presented in A6L1 see online. The analysis of sperm chromatin in the sSMC carrier showed 19.41% (AB staining) and 20.07% (CMA3) spermatozoa with deprotaminated chromatin. No statistical significance (P\u2009>\u20090.05) was observed when the patient\u2019s results were compared to the mean control values .SMAD6 gene signal. Thus, the mean frequency of spermatozoa without sSMC was estimated at 47.58%, while the frequency with one chromosome 15 and one sSMC as 51.20%. Further staining with centromere-specific probe for chromosome 15 allowed the estimation of frequencies for spermatozoa with the two 15cen signal . The frequencies obtained were similar to the wcp results or twice as low (18) (P\u2009<\u20090.05) than disomic sSMC\u2212 (+) or lower between sSMCic sSMC\u2212 . When th; sSMC\u2212) ; (ii) wh; sSMC\u2212) . When co; sSMC\u2212) .+ and sSMC\u2212 spermatozoa, statistically significant differences (P\u2009<\u20090.01) were found only in the case of sex chromosomes, according to the criterion of the nucleus depth . It was found that, in sSMC+ gametes, the X and Y centromeres were strongly repositioned towards the nucleus periphery when collating with sSMC\u2212 spermatozoa (X and Y: P\u2009<\u20090.0001) (+ vs. sSMC\u2212 spermatozoa (SMAD6 locus (15q22.31) show that the topology of the gene had unaltered positions (P\u2009>\u20090.01) both in sSMC+ and sSMC\u2212 spermatozoa of the centromeres of chromosomes 15, 18, X, Y and sSMC in the sperm cell nucleus are shown in \u20090.0001) . Moreove\u2009>\u20090.01) . In case\u20090.0001) , Fig. 2armatozoa , Fig. 2b+ spermatozoa, the centromeres were more dispersed than in the case of sSMC\u2212 gametes 2.003\u2009\u00b1\u20090.789\u2009\u03bcm vs. 15-X (sSMC\u2212) 1.783\u2009\u00b1\u20090.523\u2009\u03bcm (P\u2009=\u20090.0211) and 15-Y (sSMC+) 1.858\u2009\u00b1\u20090.789\u2009\u03bcm vs. 15-Y (sSMC\u2212) 1.505\u2009\u00b1\u20090.650\u2009\u03bcm (P\u2009=\u20090.0007). No statistical differences were noted when comparing the distances in sSMC+ spermatozoa for 15-X vs. sSMC/X (P\u2009=\u20090.1088) and 15-Y vs. sSMC/Y (P\u2009=\u20090.0883).The normalized distance measurements between the centromeres of normal chromosome 15 vs. sSMC revealed similar values in spermatozoa bearing X or Y chromosomes . No differences between X-bearing and Y-bearing gametes were observed between the centromeres of sSMC and the X/Y centromeres: sSMC-X 1.835\u2009\u00b1\u20090.682\u2009\u03bcm vs. sSMC-Y 1.679\u2009\u00b1\u20090.685\u2009\u03bcm (P\u2009=\u20090.1081). Statistically significant differences were found between the sSMC+ and sSMC\u2212 spermatozoa. In the sSMC+ sperm, the nucleus of almost all (92.5%) of the centromeres of chromosome 15 were localized centrally (shell no. 1 \u2018cen\u2019), followed by a small frequency in shell no. 2 (\u2018int\u2019 7.5%), and a lack of signals in a shell no. 3 (\u2018per\u2019 0%) . In the sSMC\u2212 spermatozoa, the highest frequency of chromosome 15 centromeres (87.5%) was noted for the \u2018int\u2019 shell no. 2, while for the remaining shells, the frequencies were lower . sSMC strongly preferred the intermediate \u2018int\u2019 position .The positioning results for the sSMC and chromosome 15 centromere using confocal analysis (3D) corresponded with the radial results. Representative imagery from confocal microscopy are presented in All these three-point positioning measurement approaches complement one another and give a broad insight into the topology of chromosomes in spermatozoa.In this study, a series of experiments showed that maternally inherited sSMC was composed of two p-arms and fragment of chromosome 15 (q11.1->q11.2). The carrier\u2019s karyotype was established as 47,XY,+der(15)(pter->p11.2::q11.1->q11.2::p11.2->pter)mat. The most probable model for the formation of the observed sSMC is an intrachromosomal or interchromosomal U-type exchange between low-copy repeats (LCRs) of homologous chromosomes, as a result of a cross-over error during meiosis2931+, is consistent with two studies38633343637635384041et al.4325So far, meiotic segregation of the marker chromosomes in sperm has been examined in only twelve cases, including six carriers of sSMC15), one of sSMC(14), one of sSMC20), two of sSMC(22), and two of unknown origin6333435363738390, two of5, one ofet al.202146In our study, we also observed an approximately 7 times (2.7\u2009\u2212\u200915.1\u00d7) higher level of autosomal disomy in the sSMC carrier\u2019s spermatozoa, suggesting the incidence of interchromosomal effect (ICE). It is well known that increased aneuploidy levels may result in reproductive failures or a decrease in fertility454663334363739+) and without (sSMC\u2212) the marker chromosome. We observed that in sSMC+ spermatozoa, the centromeres of the investigated chromosomes were more dispersed within the nuclear space carrier. The extremely close localization of about 30\u201340% of chromosome 15 bivalents to XY may be explained by the high homology found between regions of these chromosomes, such as: noncentromeric heterochromatin fragments of chromosome 15 and a part of the Xq/Yq subtelomeric sequences54The positioning of sSMC has been described previously in a study of spermatozoathe sSMC . It is wThus, we can conclude that, in the case of sSMC here considered, the presence of the marker chromosome may be not neutral for the the chromosome topology in the sperm nuclear space, leading in consequence to infertility of studied individual.6/ml) aged between 25 and 30 with normozoospermia (according to WHO criteriain situ hybridization (FISH) and array CGH (aCGH) experiments were prepared.Classical karyotyping using Giemsa staining showed sSMC presence in all (n\u2009=\u200930) spreads examined under the light microscope (Zeiss D1 AxioImager). For identification and characterization of the evaluated sSMC, fluorescence whole chromosome painting probes (wcp) for chromosomes 15 (green) and Y (red) , each 8.0\u2009\u03bcl;locus D15Z4; green, 2.5\u2009\u03bcl) and subtelomeric for 15q , filled with hybridization solution (HS) to a final volume of 10.0\u2009\u03bcl;\u03b1-satellite (centromere-specific) probes for chromosome 15 and SMAD6 gene-specific probe , filled with HS to 5.0\u2009\u03bcl;\u03b1-satellite for chromosome 15 , 10.0\u2009\u03bcl;mFISH (multicolor FISH) , 10.0\u2009\u03bcl.The following combinations of FISH probes were used:FISH results were scored using a fluorescent microscope (Zeiss D1 AxioImager) with an oil immersed objective 100\u00d7 and a proper filter set (FITC/Texas Red/SpO/Cy5/DEAC/DAPI). Images were acquired with a CCD camera and analyzed using Ikaros/ISIS software . Detailed observation of the sSMC was performed for 30 metaphase spreads in each FISH staining combination. Additionally, for each FISH combination, at least 1,000 interphase lymphocytes were counted to determine whether sSMC was present in 100% of the cells. The efficiency of FISH was estimated at 99%.2 ratio of the patient:reference signals. The resultant CNVs were checked against the DGV database (Toronto CNV database) to verify the frequency of these CNVs in the normal population.To test for potential genomic micro-aberrations and describe the detailed nature of genomic region amplification in the chromosome 15 involved in the sSMC, we performed a genome-wide analysis using the SurePrint G3 Human CGH 2\u2009\u00d7\u2009400\u2009k Oligo Microarrays . The analysis was performed according to the manufacturer\u2019s protocol , as described previouslyThe status of chromatin maturity was determined using two described previously staining methodslocus D18Z1; blue; 3.0\u2009\u03bcl) , filled with HS to a final volume of 20.0\u2009\u03bcl;wcp for chromosomes 13 and 15 and \u03b1-satellite for chromosome 18 ; filled with HS to 5.0\u2009\u03bcl;wcp for chromosome 15 and locus D15Z4; yellow\u2009=\u2009green\u2009+\u2009red), X and Y ; each probe 2.0\u2009\u03bcl, filled with HS to 10.0\u2009\u03bcl;\u03b1-satellite for chromosomes: 15 and band-specific for 21q22.13 (green) and 22q12 (red) ; filled with HS to 10.0\u2009\u03bcl;\u03b1-satellite for chromosome 15 and SMAD6 gene-specific probe , filled with HS to 5.0\u2009\u03bcl.\u03b1-satellite for chromosome 15 , and topology in the sperm cell nucleus :SMAD6 gene-specific probe was extended to 4\u2009min. in 78\u2009\u00b0C.Slide preparation was described previously23z-axis; an example of these stacks is presented in Staining results were scored using light (for AB) and fluorescent microscopes (for CMA3 and FISH) (Zeiss D1 AxioImager) with an oil immersed 100\u00d7 objective fitted with a proper filter set (FITC/SpO/DEAC/Triple/DAPI). The images were acquired using a CCD camera and analyzed with CellB (Olympus) or ISIS software. For meiotic segregation, 3,400 sperm cells of the sSMC carrier were evaluated. To investigate the aneuploidy level, at least 5,000 sperm cells were evaluated for each male and chromosome. When two FISH signals in one colour were observed in a sperm cell, the criterion of the space between them was applied. The efficiency of FISH was estimated at 99%. For confocal analysis, a Nikon A1Rsi microscope (Japan) equipped with an appropriate range of lasers (405\u2013641\u2009nm) was used, followed by further image analyzes with Imaris software . To obtain 3D images, a series of image stacks were acquired for each spermatozoa , was estimated with the radial evaluation technique, according to a method previously described+) for cells without the sSMC chromosome (sSMC\u2212). A hierarchal Ward cluster analysis was also performed to check the aggregated localization of the chromosomes in the sSMC+ spermatozoa, as compared to the sSMC\u2212 cells.The localization of centromeres of chromosomes 15, 18, X, Y and sSMC, as well as of + spermatozoa: sSMC vs. 15, X, Y and 15 vs. X, Y; in sSMC\u2212: 15 vs. X, Y) for 100 sperm cells, in each case using ISIS software with the measurement tool option probe was applied. The sperm cell nucleus was divided into three equally sized concentric shells by depth: from the innermost part of the nucleus , through an intermediate shell , to the peripheral shell . A FISH nucleus . The fre2 and one-sample t-tests. For comparison of the normalized distances between centromeres, an unpaired t-test was performed. To check the clustered localization of the evaluated centromeres, a hierarchal Ward cluster analysis was carried out. For confocal positioning, a Fisher exact test was applied. All these tests were determined at the significance level of \u03b1\u2009=\u20090.05 using OriginLab (v. 8.5) and GraphPad Prism (v.5) software. For statistical analysis of the radial topology results, one-way analysis of variance was used. The significance level of \u03b1\u2009=\u20090.01 for this test was more adequate for the biological significance of the observed alterations.The statistical significance between the mean values for the sperm aneuploidy level and sperm chromatin deprotamination was determined using \u03c7How to cite this article: Olszewska, M. et al. Genetic dosage and position effect of small supernumerary marker chromosome (sSMC) in human sperm nuclei in infertile male patient. Sci. Rep.5, 17408; doi: 10.1038/srep17408 (2015)."} +{"text": "Genotype-phenotype correlations in patients with small supernumerary marker chromosomes (sSMC) are still difficult to asses.http://www.fish.uniklinikum-jena.de/sSMC.html.The presently known influence of chromosomal imbalance induced by sSMC size and origin, mosaicism of sSMC in different cells of the body and uniparental disomy (UPD) of sSMC\u2019s sister chromosomes on the clinical outcome is summarized according to data on ~5,000 sSMC cases summarized on Two third of sSMC carriers are clinically normal. In the remainder 1/3 of sSMC patients, clinical symptoms may vary between slightly up to severely affected, including intrauterine death. Besides the known sSMC related syndromes Pallister-Killian-, isochromosome-15q12-, isochromosome-18p-, cat-eye- and Emanuel-syndrome there are numerous other yet unnamed and unidentified \u201csSMC-syndromes\u201d. Recently, derivative-8- and derivative-13/21 syndromes in complex sSMC were reported.The influence of chromosomal imbalance induced by sSMC size and its origin seems to have the largest impact on the phenotype of sSMC-patients. Besides UPD of sSMC\u2019s sister chromosomes and mosaicism of sSMC may be important for the clinical outcome. The latter is especially important to be predicted in prenatal cases."} +{"text": "Alloy PbxCdx1\u2212S QDs were found to substantially improve the photocurrent of the solar cells compared to the single CdS or PbS QDs. Moreover, it was found that the photocurrent increases and the photovoltage decreases when the ratio of Pb in PbxCd1\u2212xS is increased. Without surface protecting layer deposition, the highest short-circuit current density reaches 20 mA/cm2 under simulated AM 1.5 illumination (100 mW/cm2). After an additional CdS coating layer was deposited onto the PbxCdx1\u2212S electrode, the photovoltaic performance further improved, with a photocurrent of 22.6 mA/cm2 and an efficiency of 3.2%.Ternary alloy Pb Therefoion cost ,10,11. Hion cost ,13. To eion cost ,17,18,19ion cost ,21,22. T2S [So far, few types of QDs with absorption spectra stretching down to the NIR area have been proven to be effective for QDSCs. The broadening of the absorption spectrum has motivated the development of type-II core/shell-structured QDs, the bandgap of which is the difference between the conduction band (CB) edge of the component with deeper conduction band and the valence band (VB) edge of the component with a smaller VB ,24. QDs 2S ,27,28. P2S ,33,34,35PbS QDs have been successfully applied in heterojunction solar cells, showing remarkable conversion efficiency up to 10% ,39,40,41in-situ ion adsorption by the method of successive ionic-layer adsorption and reaction (SILAR) [3)2 as lead salts for alloy PbxCdx1\u2212S adsorption have been used; however, the device performance remains still low. It still remains unclear how the ratio of Pb:Cd of PbxCdx1\u2212S QDs can influence the photovoltaic performance of QDSCs [xCdx1\u2212S QDs may present a higher CB edge than PbS and a wider absorption spectrum than CdS. By tuning the Pb:Cd ratio of PbxCdx1\u2212S, the bandgap and CB level of the alloy QDs can be adjusted, which should affect the light-harvesting ability, carrier injection, and carrier recombination in the QDSCs. On the other hand, it has been shown that the addition of a certain amount of Cd in PbS QDs can significantly limit the carrier recombination by reducing the trap density without affecting the carrier extraction, which brings much improved device performance [2+ ion concentration in the cationic precursor solutions, which is used to prepare three kinds of PbxCdx1\u2212S QDs by the SILAR process.Solution phase (SILAR) ,44 has bof QDSCs . Since tof QDSCs , PbxCd1\u2212formance . Herein,xCdx1\u2212S QDs, termed PbCdS-1, was investigated as a photosensitizer compared to the CdS and PbS QDs. PbCdS-1 was prepared by a mixed precursor solution containing 0.004 M PbCl2 and 0.1 M Cd(NO3)2. More details are given in the experimental section. The CdS, PbS, and PbCdS-1 were deposited on the TiO2 electrodes by the SILAR process. The absorption spectra of the CdS, PbS, and PbCdS-1 QD-sensitized TiO2 electrodes after three SILAR cycles are shown in the inset of Firstly, a kind of Pb2 [2 . The nar2 . The pos2). The corresponding parameters of performance are shown in 2) was obtained, while the voltage is larger than that of PbS. The highest current stems mainly from the high IPCE of PbCdS-1 as discussed above. In addition to an efficient photon harvesting ability, there might be other reasons that contribute to the high current and voltage. According to recent publications, Hg- or Cu-doped PbS could push the CB position to a higher energy level, which further promotes the electron injection and leads to a high current [2, which contributes to a higher voltage. Another reason might be the reduced defects by alloying Cd into PbS that may decrease trap density and restrain the recombination between TiO2 and QDs. current ,49. In a current ,45. TherxCdx1\u2212S QDs, two more PbxCdx1\u2212S QDs\u2014PbCdS-2 and PbCdS-3\u2014were investigated as photosensitizers for QDSC applications. PbCdS-1, -2, and -3 were prepared with gradually decreased Pb2+ concentrations of precursor solution, as shown in xCdx1\u2212S QD electrodes prepared by five SILAR cycles, directly revealing the concentrations of Pb and Cd of PbxCdx1\u2212S QDs listed in 0.54Cd0.46S, Pb0.31Cd0.69S, and Pb0.24Cd0.76S, respectively. Although these formulas may not be quite exact for other cycles of PbxCdx1\u2212S QDs, the proportion of Pb in the PbxCdx1\u2212S QDs can be confirmed to be in the order: PbCdS-1 > PbCdS-2 > PbCdS-3.To study the effect of the proportions of Pb and Cd in the PbxCdx1\u2212S QD alloys on the optical properties is illustrated by comparing the absorption spectra of PbCdS-1, PbCdS-2, and PbCdS-3. It is clearly indicated that the absorbance intensity follows the order: PbCdS-1 > PbCdS-2 > PbCdS-3. Moreover, derived from the absorption spectra, the Tauc plots of (h\u03bd\u03b1)2vs. h\u03bd, drawn in \u03bd is light frequency, and \u03b1 is the absorption coefficient. Therefore, the bandgap is determined by the intersection of the base line and the tangent line.The absorption spectra of the five-SILAR-cycle QD-sensitized electrodes are shown in 2 electrodes (2 is shown in 2 was \u22124.21 eV (vs. vacuum) taken from the literature [vs. normal hydrogen electrode (NHE) obtained from the CV was converted to the vacuum level by the relation that 0 V vs. NHE is equal to \u22124.5 eV vs. vacuum [xCdx1\u2212S QDs is wider than for PbS and narrower than for CdS under the same SILAR cycles, and the higher proportion of Pb in PbxCdx1\u2212S presents a lower bandgap. In other words, increasing the proportion of Pb leads to a higher absorbance intensity and a concomitant shift of the absorption feature towards the higher wavelength because the larger proportion of Pb decreases the bandgap of the QDs. Moreover, it is confirmed that the CB positions of PbxCdx1\u2212S QDs are between PbS and CdS QDs, and PbS QDs have a low CB edge (\u22124.15 eV) close to the TiO2 CB edge. Therefore, a higher CB level causes a faster electron injection from QDs into TiO2.As discussed above, the CB energy level is an important factor affecting the performance of QDs solar cells. In this study, cyclic voltammogram (CV) was carried out in a 0.1 M KCl aqueous solution at pH 6.9, shown in ectrodes , the onsterature . The CB . vacuum . Clearly2 film and the slow hole transfer, the main consequence of which is a large carrier loss due to the recombination between the TiO2 film and electrolyte [2 CB edge and the redox level of the electrolyte [2 and electrolyte. As shown in xCdx1\u2212S occurred at a much higher bias-voltage than that of PbS, indicating that the recombination in PbxCdx1\u2212S-based QDSCs is remarkably reduced. It also suggests that the increase of Cd in PbxCd1\u2212xS can further reduce the recombination degree. The result proved that the utilization of PbxCd1\u2212xS can effectively decrease the trap density.Generally, the major factors limiting the conversion efficiency of QDSC are the relatively slow electron transportation within the TiOctrolyte . Moreovectrolyte , which axCdx1\u2212S under one sun illumination are depicted in xCdx1\u2212S and CdS are enhanced by increasing SILAR cycles until reaching a number of certain cycles. To further optimize the performance by increasing the cycle number, it was found that 7-cycle PbCdS-1, 7-cycle PbCdS-2, 9-cycle PbCdS-3, and 9-cycle CdS QDSCs provide the best photocurrent. Moreover, the trend of the efficiency is similar to that of the photocurrent. The comparison of the parameters between the different QD solar cells indicates that the QDs with the higher proportion of Pb show the higher short-circuit current and the lower open-circuit voltage.The optimization of the SILAR cycles is a key factor to boost the performance of the solar cells. Herein, we discuss the effect of SILAR cycles on the photovoltaic performance of the solar cells. The I\u2013V curves of the solar cells of PbS, CdS, and PbxCdx1\u2212S alloys will affect these parameters. In order to better understand the effect, the optimized performance of the solar cells based on PbxCdx1\u2212S QDs are re-illustrated and compared in xCdx1\u2212S alloys leads to a significant broadening of the IPCE features. This result is consistent with the absorption performance of the five cycles PbxCd1\u2212xS. Moreover, the IPCE trend also reflects the photocurrent in the I\u2013V curves of the QDSCs. It is clear that the photocurrent follows the trend: PbCdS-1 > PbCdS-2 > PbCdS-3, something that can be mainly attributed to the light-harvesting ability of the PbxCdx1\u2212S alloys. The highest photocurrent scJ obtained by the PbCdS-1 QDSCs reaches almost 20 mA/cm2. However, the voltage follows the reverse trend: PbCdS-1 < PbCdS-2 < PbCdS-3. Increasing the proportion of Pb leads to a lower voltage, which is caused by the effect of a lower CB level and higher trap density, as discussed above. PbCdS-2 QDSCs exhibit the efficiency of 2.8%, referring to their moderate photocurrent of 15.8 mA/cm2 and voltage of 0.4 V. Therefore, controlling the ratio between Pb and Cd in the PbxCdx1\u2212S QDs alloys is very important for the photovoltaic performance of the QDSCs, especially for controlling the photocurrent and voltage.After analyzing the optimization of solar cell parameters, some characteristic trends can be unraveled. In particular, the proportion of Pb and Cd in the PbxCdx1\u2212S, which will favor the electron injection of CdS to TiO2 via PbCdS-1. Therefore, it could be observed that the IPCE of seven-cycle PbCdS-1 QDSCs after coating three-cycle CdS QDs improve, especially at wavelengths larger than 500 nm. In addition, CdS coating could serve as a protection layer to prevent the inner layered QDs from the corrosion of electrolyte and reduce the charge recombination [2 and an efficiency of 3.2% for the QDSC.Furthermore, we also investigated the photovoltaic performance after an extra CdS coating layer was introduced onto the PbCdS-1 QDs, shown in bination . This im2 films with a triple-layer structure, containing the compact, transparent, and scattering layer, were prepared according to the procedure reported in [i.e., compact layer, onto the FTO substrate, a freshly aqueous TiCl4 solution (40 mM) was used to treat the cleaned FTO glass for 30 min at 70 \u00b0C. Subsequently, the transparent and scattering layers were successively deposited by screen printing with TiO2 pastes , followed by sintering at 500 \u00b0C for 30 min in a muffle furnace to remove organic components. The sintered film was post-treated with an aqueous TiCl4 solution. The produced TiO2 films provided a thickness of 11 \u00b5m (7 \u00b5m for transparent layer and 4 \u00b5m for scattering layer) and a working area of 5 mm \u00d7 5 mm.Mesoporous TiOorted in . First, 2 photoelectrodes were fabricated by growing QDs directly onto a TiO2 film according to the method of successive ionic layer adsorption and reaction (SILAR). In this work, PbS, CdS, and PbxCdx1\u2212S QD alloys were sensitized onto TiO2 films to produce the photoanode. In order to sensitize these QDs, several necessary precursor solutions containing different ions should be prepared: 0.1 M Cd(NO3)2 aqueous solution as a Cd2+ source, 0.004 M PbCl2 aqueous solution as a Pb2+ source, and 0.1 M Na2S solution in methanol/DI water (1:1 by volume) as a S2\u2212 source. The aqueous ionic solution of mixed Pb2+ and Cd2+ made by adding 1%\u20134% PbCl2 into 0.1 M Cd(NO3)2 solution was used as a cationic source to grow PbxCdx1\u2212S QDs upon reacting with an anionic S2\u2212 source. In this work, three kinds of PbxCdx1\u2212S QDs, termed as PbCdS-1, PbCdS-2, and PbCdS-3, were prepared by the mixed precursor solution containing Pb2+ of 0.004 M, 0.002 M, and 0.001 M, respectively. The typical SILAR procedure is described by using PbS QDs as an example. The TiO2 film was alternately immersed into the Pb2+ source for 2 min and the S2\u2212 source for another 2 min. The films were washed thoroughly with DI water and methanol to remove excess precursor between each immersion step. Such a single procedure is denoted as one growth cycle, and repeating the cycle to deposit more PbS onto the TiO2. The precursor solutions containing Pb2+ were replaced by a fresh identical solution for a further immersion process every two SILAR cycles. After QDs sensitization, the surface of the QDs was passivated by depositing a layer coating of ZnS in order to optimize the performance of solar cells. The ZnS coating was prepared by two SILAR cycles using a 0.1 M methanol solution of a Zn(NO3)2 as Zn2+ source.QD-sensitized TiO2S counter electrode is similar to that in the previous report [2S to generate a layer of fresh Cu2S onto the brass substrate. The sandwich structure of QDSCs was fabricated by assembling a QD-sensitized TiO2 film and Cu2S counter electrode with a 50-\u00b5m Surlyn film as the sealing thermoplastic material. Polysulfide electrolyte, containing Na2S (2 M) and S (3 M) in water/methanol (7:3 by volume), was injected to empty space between the two electrodes through a hole on the counter electrode.The preparation process of Cus report . Briefly2 films were measured by a Lambda 750 UV-Vis spectrometer . The current\u2013voltage (I\u2013V) characteristics of the solar cell were performed by using a Keithley source-meter under AM 1.5 illumination (100 mW\u00b7cm\u22122) from a Newport 300 W solar simulator . The I\u2013V measurement setup was calibrated by using an IR-filtered silicon solar cell . Incident photon-to-current conversion efficiencies (IPCEs) were determined using a measurement system including a 300 W xenon lamp, a 1/8 m monochromator, a Keithley source-meter, and a power meter with a 818-UV detector head. IPCEs were measured by monitoring photocurrent from low to high wavelength every 10 nm. The measured IPCE at higher wavelengths was lower than the actual value because PbS QDSCs are not stable and have slow photoelectric response. The cells with strong photoelectric response at above ~750 nm exhibit a similar fluctuation in IPCE. This should be an equipment problem, possibly resulting from the xenon lamp in the IPCE system. To weaken the light refection, a black mask (6 mm \u00d7 6 mm) was used for photovoltaic measurements. The inductively coupled plasma-atomic emission spectrometry (ICP-AES) was measured by a Perkin Elmer Model Optima 7300DV ICP AEOS . Under each condition, at least three samples were prepared for the measurements in order to obtain a medium value as the final data. Cyclic voltammogram (CV) was carried out at ambient temperature with a electrochemical workstation using a regular three-electrode electrochemical cell. The measured sample films were used as the working electrode, a Pt sheet as the counter electrode, and a Ag/AgCl electrode as the reference electrode. The potential conversion of reference from the Ag/AgCl electrode to normal hydrogen electrode by E (vs. NHE) = E (vs. Ag/AgCl) + 0.197 V [UV-Vis spectra of the QD-deposited TiO 0.197 V .xCdx1\u2212S photosensitizers for quantum-dot-sensitized solar cells (QDSCs) by the process of successive ionic layer adsorption and reaction (SILAR). The photovoltaic performance of the QDSCs based on three kinds of PbxCdx1\u2212S QDs were explored by the comparison with the corresponding PbS and CdS QDs. Firstly, we found that the three-SILAR-cycle PbCdS-1 (Pb0.54Cd0.46S) presents a much higher photocurrent compared to PbS and CdS. Then, by investigation of the absorption spectrum, cyclic voltammogram (CV), and dark I\u2013V current of five-SILAR-cycle QDs, it is suggested that PbxCdx1\u2212S QDs have a wider absorption range compared to the CdS QDs and a higher conduction band (CB) edge and reduced trap density compared to the PbS QDs. This indicates that the PbxCdx1\u2212S QD alloys can overcome the shortcomings of CdS and PbS for QDSC applications. Furthermore, by comparing the PbCdS-1, PbCdS-2 (Pb0.31Cd0.69S), and PbCdS-3 (Pb0.24Cd0.76S) QDSCs, we found that the solar cells based on the PbxCdx1\u2212S alloy with a higher proportion of Pb exhibit a larger photocurrent and a lower photovoltage. As a result, the PbCdS-1 solar cells present a significant short-circuit current density (scJ), up to 20 mA/cm2, by the optimization of the SILAR cycles. This indicates that the employment of PbxCdx1\u2212S QD alloys can be a strategy to improve the photocurrent for the PbS and CdS QDSCs. Indeed, the control of the ratio of Pb:Cd in the PbxCd1\u2212xS alloys is very critical for the photovoltaic performance of QDSCs based on PbxCdx1\u2212S QDs. A good proportion and balance of Pb and Cd is thus required for achieving an optimum current and voltage of the solar cells. Finally, a coating layer of CdS deposited onto PbxCdx1\u2212S photoelectrode gives enhancements in the photocurrent to 22.6 mA/cm2 and in the efficiency to 3.2%. It is reasonable to anticipate the remarkable enhancement of QDSCs by improving QD quality with less or even no defects and developing more effective passivation materials.This work was motivated by the fact that, while PbS quantum dots (QDs) have been successfully applied in heterojunction solar cells, showing remarkable conversion efficiency, corresponding PbS QD-sensitized solar cells (QDSCs) still have shown low device performance. One way to improve such QDSCs and utilize the high underlying quantum efficiency is alloying other metals to give a higher quality QDs. We have therefore fabricated ternary alloy Pb"} +{"text": "The capsules in periostin-knockout mice (PN-KO) were significantly thinner than those in WT mice. PN-KO mice showed significantly lower numbers of inflammatory cells than WT mice. Fibrous tissue formation markers were significantly reduced in PN-KO mice. We also confirmed that inflammatory reaction and angiogenesis indicators had lower expression in PN-KO mice. Inhibition of periostin could be important for suppressing capsule formation on silicone implants after in vivo implantation.Although silicone implants are widely used in breast and other reconstructive surgeries, the limited biocompatibility of these materials leads to severe complications, including capsular contracture. Here, we aimed to clarify the relationship between periostin and the process of capsule formation after in vivo implantation. Seven-week-old wild-type (WT) C57BL/6 mice and periostin-deficient mice were used. Round silicone implants were inserted into a subcutaneous pocket on the dorsum of the mice. After 8 weeks, the fibrous capsule around the implant was harvested and histologically examined to estimate capsular thickness and the number of inflammatory cells. Additionally, immunohistochemical analysis (periostin, The use of breast implants has gained attention due to the increased numbers of breast reconstructive and esthetic surgeries. Recently, almost 65% of women in the United States have chosen permanent implant-based reconstruction rather than autologous tissue for breast reconstruction after mastectomy . In addiHowever, complications may occur after silicone implant-based breast surgery, which include seroma, infection, bleeding, nipple sensory loss, scarring, and capsular contracture \u20136. AmongPeriostin, also known as osteoblast-specific factor 2, is a secreted extracellular matrix (ECM) protein encoded by the 13q13.3 POSTN gene . This prAlthough periostin has diverse functions, it is becoming increasingly clear that, in many cases, it is greatly involved in the progression of tissue fibrotic diseases such as scleroderma, which is a connective tissue disorder characterized by the excessive deposition of collagen and other ECM proteins that results in the fibrosis of skin and other visceral organs \u201324. MiceCapsular contracture is of particular interest in relation to the progression of tissue fibrosis.In this study, we aimed to clarify the relationship between periostin and the process of capsule formation after in vivo silicone implantation. Although periostin is known to have a significant effect on tissue fibrosis, to the best of our knowledge, the present study is the first to reveal a relationship between periostin and capsular contracture.This study was approved by the Institutional Animal Care and Use Committee (IACUC) of the Seoul National University Boramae Hospital (IACUC number 2016-0056).n = 6, each group). The PN-KO mice (Postn\u2212/\u2212) were purchased from the Jackson Laboratory . C57BL/6\u2009J mice were obtained from Orient-Bio . The mice were housed in an animal facility and treated in accordance with the Guide for the Care and Use of Laboratory Animals of Seoul National University Hospital. All mice were housed under ambient conditions (standard humidity and temperature) with a 12\u2009h light/dark cycle. The 7-week-old mice were used for experimentation after an adaptation period of 1 week. All mice were specific pathogen-free and were maintained under the same environmental conditions without differences in food intake.As experimental animals, we used 7-week-old male C57BL/6 and periostin-knockout (PN-KO) mice weighing 22\u2009g , and collagen type 1 \u03b12 for immunohistochemistry (IHC); connective tissue growth factor , transforming growth factor-beta , myeloperoxidase , vascular endothelial growth factor , and \u03b2-actin for western blotting. The following secondary antibodies were used: mouse anti-rabbit IgG-horseradish peroxidase , mouse anti-goat IgG-HRP , and rabbit anti-mouse IgG-HRP .The following primary antibodies were used in this study: periostin , alpha-smooth muscle actin (\u22121) was administered intramuscularly for prophylaxis of infection. The animals were anesthetized using an intraperitoneal injection of Zoletil and Rumpun . Two subcutaneous pockets for implant insertion were made on the back of each mouse through two separate 2-cm vertical incisions, which were started at a lateral position 1.5\u2009cm to the side of the midline and 1\u2009cm below the shoulder bone . The C57BL/6 and PN-KO mice were each divided into two groups of six mice. Both groups received smooth silicone implants. The surgical field was prepared using 10% povidone-iodine, and a single dose of cefazolin Guidelines for the Euthanasia of Animals. The capsular tissue around the silicone implant was retrieved through the previously made incision , and images were captured from three microscopic fields: right, center, and left. Capsular thickness was measured at the maximal point using National Institutes of Health Image J 1.36b imaging software . Thereafter, the cellularity was examined in each image. The number of cells per unit area was calculated automatically using the LAS Core Image Program .\u03b1-SMA (1\u2009:\u2009400), and rabbit polyclonal collagen I alpha (COL1A1) ] in blocking solution overnight at 4\u00b0C. After washing three times in PBS, sections were incubated with species-specific HRP-conjugated secondary antibodies for 1.5\u2009h at room temperature. Control sections were incubated with secondary antibody alone. Immunohistochemical staining was evaluated in three areas, as with H&E staining. \u03b1-SMA-positive cells that presented a brown color were manually counted in the unit area captured from three microscopic fields , and the results are presented as the number of cells/mm2. The expression of collagen type I was measured as the total pixel intensity using Leica Q win image program V 3.2.0 , and the results are expressed as optical densities.For IHC, tissue sections were blocked with phosphate-buffered saline (PBS) containing 0.15% Tween-20, 2% bovine serum albumin (BSA), and 5% normal donkey serum for 30\u2009min at room temperature. Sections were then incubated with primary antibodies , mouse monoclonal to TGF-\u03b2 (1\u2009:\u200950), goat MPO antibody , rabbit polyclonal VEGF , or mouse monoclonal \u03b2-actin, ] in a blocking solution of 5% BSA in Tris-buffered saline containing Tween-20 (5% BSA-TBST) overnight at 4\u00b0C and then incubated with peroxidase-conjugated secondary antibodies for 1\u2009h at room temperature. The immunolabeled proteins were detected by chemiluminescence using a SuperSignal ECL kit and ImageQuant LAS 4000 .Capsular tissues were solubilized by sonication in lysis buffer using PRO-PREP reagent , and the concentration of protein was measured using a BCA Protein Assay kit . After being denatured by boiling, the protein sample . Data analysis was performed using GraphPad Prism . For all data, significant differences were determined using an unpaired \u03bcm in the PN-KO group and 258.5 \u00b1 55.0\u2009\u03bcm in the control group showed a significantly lower cellularity per unit area than the normal control group (52.9 \u00b1 25.8) (< 0.001) . The pre\u03b1-SMA and collagen type I was performed on sections of capsules formed around the silicone implants. We found that the \u03b1-SMA-expressing cell number was considerably higher in the C57BL/6 control group than in the PN-KO group .IHC imaging for Figures . As show\u03b2, MPO, and VEGF , indicating that blocking periostin may reduce the inflammatory signal during capsule formation, particularly that needed for inflammatory cell recruitment. In addition, we examined the levels of VEGF expression. As shown in \u03b2-actin) was a significantly downregulated in the experimental (PN-KO) group compared with that in the C57BL/6 control group. These observations indicate that blocking periostin inhibits capsular tissue activity such as the inflammatory reaction or neoangiogenesis.To examine the function of periostin in the inflammatory reaction, collagen synthesis, and neoangiogenesis after silicone implant insertion, we monitored the expression of CTGF, TGF-and VEGF . CTGF [Although the cause of capsular contracture in breast implants is still controversial, there have been many attempts to explain the phenomenological mechanism . Host res: PMNs) . Followis: PMNs) . Fibrouss: PMNs) \u201333. Accos: PMNs) , the caps: PMNs) previouss: PMNs) \u201325. Treas: PMNs) , retromus: PMNs) , manual s: PMNs) , and locs: PMNs) . However\u03b1-SMA expression in granulation tissue.In recent years, studies on matricellular proteins related to capsular contracture have been conducted. Matricellular proteins are ECM proteins that modulate cell-matrix interactions as well as cellular functions. They are highly expressed in injured and remodeled tissues and have been implicated in the pathophysiology of various fibrotic conditions. Like other matricellular proteins, periostin is thought to play a fundamental role in tissue development and remodeling . Using PHowever, it has not been previously determined whether periostin is involved in the process of capsular contracture around biomaterials such as silicone breast implants. We hypothesized that regulation of the periostin associated with fibrosis is a key factor in mitigating capsular contracture. Based on our histological estimations, capsules around implants in the PN-KO group were significantly thinner than those around implants in the C57BL/6 group. Collagen type I expression was also significantly downregulated in the PN-KO group.Capsules comprise a collagenous layer and noncollagenous layer. The external layer of the capsule, the collagenous layer, is composed of tissue rich in collagen, whereas the internal noncollagenous layer comprises synovial-like materials and loose conjunctive tissue . Figure \u03b2 and MPO at the 8-week time point than the control group. MPO has been proposed to mirror the degree of neutrophil activation [\u03b2, an important factor in the early inflammatory cascade, is a major cytokine secreted by several different cell types, such as platelets, giant cells, and fibroblasts. It eventually activates fibroblasts to promote collagen synthesis and stimulates the differentiation of fibroblasts into myofibroblasts [\u03b2 levels after the implantation of silicone as a foreign body. In doing so, it can induce the activation of PMNs by controlling the process of the early inflammatory phase, via increasing the number of fibroblasts, which also increases the number of differentiated cells, that is, myofibroblasts in the 5th and final step of the host response.Our observations indicate that capsule formation is positively correlated with the degree of the inflammatory reactions. The PN-KO group clearly showed fewer inflammatory cells and inflammatory signals such as TGF-tivation . Moreovetivation . Additioroblasts . Based o\u03b2 to promote sustained fibrosis in vivo [\u03b2, in that it stimulates cell proliferation and ECM protein synthesis by fibroblasts.We further analyzed CTGF, which is a cysteine-rich proadhesive matricellular protein that plays an essential role in the formation of connective tissue. CTGF is profibrotic, as it is overexpressed in fibrotic disease and synergizes with TGF- in vivo . Mazaher in vivo previousOne consequence of the protein cascade in capsule formation is neoangiogenesis, although there is still controversy as to whether neoangiogenesis aggravates capsular contracture . VEGF is\u03b1-SMA-expressing myofibroblasts, which are induced by fibrogenic cytokines, play key roles in collagen synthesis. Therefore, to determine whether periostin is required for myofibroblast differentiation in this model, we performed IHC analysis of \u03b1-SMA. We observed that the expression of \u03b1-SMA was significantly decreased in the PN-KO group. According to Yang et al. [\u03b1-SMA expression in fibroblasts, but TGF-\u03b2-induced \u03b1-SMA expression could be enhanced by periostin. These results are consistent with our present findings. Taken together, periostin can indirectly control \u03b1-SMA expression through the activation of TGF-\u03b2 in 5th and final step of the host response.It is widely accepted that g et al. , periostIn the present study, we observed that PN-KO mice harboring silicone implants showed reduced in vivo peri-implant capsule formation. Periostin, an important protein in collagen synthesis and inflammatory processes, is considered to be essential for capsule formation. Accordingly, the inhibition of periostin could play an important role in suppressing capsule formation following the use of breast silicone implants in vivo."} +{"text": "This variant induces the expression of EMT-related genes, such as N-cadherin, vimentin, Snail1 and Twist1. Indeed, the induction of N-cadherin protein expression by this variant is essential for its pro-tumorigenic role. The presence of the FGFR4-388Arg variant correlates with higher N-cadherin expression levels in clinical NSCLC samples and with poorer outcome in patients with FGFR expression. These results support the prognostic role of this FGFR variant in lung cancer and show that these effects may be mediated by the induction of N-cadherin expression and an EMT phenotype.The FGFR4-388Arg variant has been related to poor prognosis in several types of cancer, including lung cancer. The mechanism underlying this association has not been addressed in detail in patients with this pathology. Here, we report that this FGFR4 variant induces MAPK and STAT3 activation and causes pro-oncogenic effects in NSCLC Lung cancer is a heterogeneous disease that can be classified into two major histologically distinct groups: small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), which accounts for 85% of primary lung carcinomas2. Among NSCLC cases, adenocarcinoma (ADC) and squamous cell cancer (SCC) are the most frequent histological subtypes. Currently, lung cancer accounts for the majority of cancer-related deaths; the dismal prognosis of patients with lung cancer is due to the common presentation with advanced stage disease at initial diagnosis and the relative inefficacy of available systemic treatment. Indeed, the expected 5-year survival rate is 18%3. Therefore, the identification of relevant diagnostic biomarkers and novel and druggable targets for this disease represents an unmet clinical need.The incidence and mortality of lung cancer are increasing worldwide4, which have proven therapeutic potential in a variety of cancer types. One such tyrosine kinase receptor is FGFR4, which has been associated with prognosis in several types of cancer, including lung cancer7. Several molecular alterations of FGFR4 leading to different gene variants have been identified8. One of these variants, FGFR4\u2013388Arg (rs351855 at the genotype level), harbors an amino acid substitution of an arginine for a glycine at codon 388. This FGFR4 variant correlates with disease progression and poorer prognosis in colon, prostate, head and neck, breast, and soft tissue tumors, among many others15. Nonetheless, the effects of this FGFR4 variant in NSCLC patient prognosis seem to be controversial. In a study involving Asian NSCLC patients, the FGFR4-388Arg variant correlated with poorer outcome in patients with lymph node involvement16. However, contradictory results have been reported in other studies. In a work involving advanced NSCLC Asian patients, the FGFR4-388Arg variant correlated with better outcome17, and in another study involving Caucasian NSCLC patients, no association between this FGFR4 variant and outcome was found18. In some retrospective studies of lung cancer cohorts analyzing each histological subtype independently, the FGFR4-388Arg variant was linked to lymph node involvement and poorer overall survival (OS) in ADC patients19. For SCC patients, however, association of this variant with prognosis has been described only in lymph node-involved patients20.In recent years, many molecular alterations with a significant role in tumor pathogenesis and the outcome of cancer patients have been identified. Many such alterations have involved tyrosine kinase receptors21. In addition, overexpression of FGFR4-388Arg was reported to induce MAPK activation and promote proliferation and invasion in in vitro models of prostate cancer22. Furthermore, this FGFR4 variant has been related to epithelial-to-mesenchymal transition (EMT) in prostate cancer cell lines23. In this work, we aimed to study the effect of the FGFR4-388Arg variant on lung cancer oncogenic behavior, its relationship with EMT in this setting, and its impact on patient prognosis.The FGFR4-388Arg variant has been reported to promote the activation of pathways related to cancer, such as the STAT3 signaling pathway in murine breast and lung cancer modelsTo ascertain the impact of the FGFR4-388Arg variant on the tumorigenic behavior of lung cell lines, we overexpressed the FGFR4-388Gly and FGFR4-388Arg alleles in three lung cell lines that lacked endogenous FGFR4 expression and performed surrogate assays of tumorigenic activity. We selected cell lines with different genetic backgrounds in the FGFR4-388Gly- and FGFR4-388Arg-overexpressing cell lines. FGFR4-388Gly overexpression in the five cell lines did not alter the mRNA levels of any of the studied EMT markers compared to their respective empty vector-expressing cell line. However, FGFR4-388Arg overexpression increased the mRNA and protein levels of N-cadherin, vimentin, Snail1 and Twist1 . We found that the FGFR4-388Arg variant correlated with poorer PFS and OS was assessed by RT-qPCR and western blot. We confirmed that this FGFR4 variant is potentially involved in inducing EMT, as every EMT marker tested showed increased expression exclusively in the cell lines overexpressing FGFR4-388Arg, which furthermore showed increased migration ability. N-cadherin has been extensively implicated in cancer progression31 and in anti-apoptotic mechanisms in NSCLC cell lines26. Thus, we hypothesized that N-cadherin could be mediating the pro-oncogenic effects observed in these cell lines, so we downregulated N-cadherin expression in the FGFR4-388Arg-overexpressing H2009 lung ADC cell line, and determined the effects on tumorigenesis by performing surrogate assays. Our data showed that in this cell line, N-cadherin silencing reduced MAPK and AKT signaling, and reversed the pro-oncogenic effects of FGFR4-388Arg overexpression in vitro and in vivo, supporting the hypothesis that N-cadherin upregulation in response to FGFR4-388Arg overexpression is involved in the increased pro-oncogenic activity caused by this FGFR4 variant. In accordance with our results, pro-tumorigenic effects accompanied by MAPK overactivation have been reported in the context of N-cadherin and FGFR co-expression32, and AKT activation by this adhesion molecule has been reported in several contexts34, which may explain the increase in oncogenic signaling and pro-tumorigenicity upon N-cadherin induction by the FGFR4-388Arg variant.It has been reported that FGFR4 silencing in FGFR4-388Arg-expressing prostate cancer cell lines leads to the induction of E-cadherin expression and to decreased N-cadherin expression37. In hepatocellular carcinoma, STAT3 binds to the Twist promoter and induces its expression, thus triggering EMT and N-cadherin expression37. Considering these data, we aimed to determine if STAT3 overactivation caused by FGFR4-388Arg overexpression is linked to N-cadherin upregulation. Therefore, we analyzed the effects of a STAT3 selective inhibitor on N-cadherin protein levels in FGFR4-388Arg-overexpressing cell lines. STAT3 inhibition decreased N-cadherin protein expression, supporting the idea that constitutive activation of the STAT3 signaling pathway is involved in upregulating N-cadherin. In the H2009 cell line, the STAT3 inhibitor abrogated STAT3 activation in both FGFR4-388Gly- and FGFR4-388Arg-overexpressing conditions but, interestingly, decreased AKT and MAPK activation, accompanied by N-cadherin downregulation, in only the FGFR4-388Arg-overexpressing cell line. Furthermore, N-cadherin silencing in the FGFR4-388Arg-overexpressing cell line decreased the activation of the AKT and MAPK signaling pathways. These results suggest that N-cadherin upregulation is linked to MAPK overactivation in response to FGFR4-388Arg overexpression, independent of STAT3 activation. All these data support a model wherein FGFR4-388Arg increases STAT3 activation, which consequently upregulates N-cadherin expression. Then, N-cadherin upregulation increases AKT and MAPK signaling, which may be ultimately responsible for the pro-oncogenic characteristics reported in these cell lines.Next, we wanted to elucidate the mechanism by which FGFR4-388Arg overexpression is pro-tumorigenic. Overexpression of this FGFR4 variant caused STAT3 overactivation. Constitutive STAT3 signaling has been related to EMT; this signaling pathway has been reported to be involved in downregulating epithelial phenotype-related genes and inducing a mesenchymal phenotypein vitro results, which showed that FGFR4-388Arg overexpression increased N-cadherin expression levels.We provide clinical evidence that FGFR4-388Arg is associated with higher N-cadherin mRNA expression in a cohort of NSCLC patients. We found a correlation between N-cadherin and FGFR4 mRNA expression in patients with the FGFR4-388Arg variant. These data are in accordance with our 19. Some of them independently analyzing NSCLC histological subtypes agreed on a potential prognostic role of this variant in ADC patients19, and in lymph node-affected squamous cell carcinoma patients20. In our patient cohort that included patients with ADC, SCC and a few other histologic types of lung cancer, we found that the FGFR4-388Arg variant correlated with poor OS and PFS in patients with high FGFR4 mRNA expression. Furthermore, when we independently analyzed the SCC or ADC patients, FGFR4-388Arg-expressing tumors correlated with worse OS and showed a correlation trend with PFS in both patient subsets, suggesting that FGFR4-388Arg expression may have a prognostic role in both histologic types. For all the prognosis analyses presented herein, we considered only patients with high FGFR4 mRNA expression; we discarded patients with low or absent FGFR4 gene expression. This criterion was formulated because expression of the variant is required for it to exert any effects. In contrast, previously published studies in the context of NSCLC considered only the FGFR4 allelic variant, not gene expression, in the tumor. This may explain why these previous results were not reproducible in the different cohorts. However, multivariate analysis of survival in these patients did not support the independent prognostic capacity of the FGFR4 variant, which may be explained by the relatively low number of patients included in our analysis. Our results should be further confirmed in independent cohorts including a higher number of patients, and considering not only the FGFR4 variant present in the tumor, but also its expression level.In previous retrospective studies, the association of the FGFR4-388Arg genotype to prognosis in lung cancer patients has remained controversialin vitro, in vivo, mechanistic and clinical data supporting the potential pro-oncogenic and prognostic role of the FGFR4-388Arg variant in NSCLC.In summary, we have shown here that the FGFR4-388Arg variant has an impact on the tumorigenic behavior of lung cancer cell lines by inducing an EMT expression profile through increased N-cadherin expression and overactivation of MAPK and AKT signaling. Furthermore, we report clinical evidence that this variant has a potential prognostic role in lung cancer patients with tumors that express high levels of FGFR4. We provide The NL20, H226, Calu-1, HCC827 and H2009 cell lines were purchased from American Type Culture Collection (ATCC) at the beginning of this study and were cultured according to instructions from ATCC. Cells were authenticated and regularly checked for mycoplasma contamination.Cell lines were transfected with overexpression plasmids carrying the FGFR4-388Gly or the FGFR4-388Arg alleles using TransIT-X2 transfection reagent (Mirus). The empty vector was transfected into the cell lines as a negative control. For N-cadherin silencing, shRNAs in the pB-RS plasmid were purchased from Origene (HC138304). Two different shRNAs successfully downregulating N-cadherin expression were used for further experiments to avoid off-target effects. The appropriate antibiotic (1\u2009mg/mL G418 or 1-4\u2009\u00b5g/mL blasticidin) was used to select positive clones, which were pooled in a monolayer culture to generate stable cell lines.Protein was extracted from cell lines using RIPA buffer (Sigma) supplemented with a protease inhibitor cocktail and a phosphatase inhibitor cocktail . A standard western blot protocol was utilized with a miniProtean electrophoretic system (BioRad) and a semi-dry electrotransfer system (BioRad). Primary antibodies against FGFR4 , AKT , pAKT , ERK1/2 , pERK1/2 , STAT3 , pSTAT3 , N-cadherin , Vimentin , Twist , Snail and \u03b1-tubulin were used. \u03b1-Tubulin protein expression was used as the loading control. Horseradish peroxidase-conjugated secondary antibodies were used for chemiluminescence-based detection of protein expression in the ChemiDoc detection system (BioRad). No grouping of gels/blots cropped from different parts of the same gel, or from different gels, fields, or exposures was performed.Cell lines were stimulated with fetal bovine serum (FBS) in culture media at a routine concentration: 10% FBS for H226 and H2009 cells and 4% for NL20 cells. Cells were incubated in FBS-free medium for five hours to achieve the basal phosphorylation state. Then, the cells were stimulated by the addition of growth medium for 15\u2009minutes, and protein extracts were obtained as indicated above.38 and applied to the cell line under assessment in complete growth medium. Culture medium with the inhibitor was renewed after 24\u2009hours. Protein was extracted at 4, 8, 16, 24 and 48\u2009hours.STAT3 inhibition experiments were performed using the SI3-201 inhibitor (Selleckchem). The IC20 (concentration at which growth is reduced at 20% in 48\u2009hours) was calculatedRNA was extracted from cell lines using Trizol Reagent (Life Technologies) and then reverse transcribed with the TaqMan Reverse Transcription Kit (Life Technologies). Gene expression analysis was performed using TaqMan probes from Life Technologies: Hs00983056_m1 FAM (N-cadherin), Hs00195591_m1 (SNAI1), Hs01675818_s1 (TWIST1), Hs00185584_m1 (VIM) and Hs99999905_m1 FAM (GAPDH). GAPDH was used as a reference gene to normalize expression data.A limited number of cells, typically 3000, corresponding to the clonogenic density was seeded in 10-cm cell culture plates. Each condition was seeded in triplicate per assay, and each assay was repeated a minimum of three times. Medium was renewed once a week during the assay, and after two or three weeks, depending on the cell line, the plates were fixed with 0.5% glutaraldehyde for 20-30\u2009minutes. Then, the cells were stained with a 1% crystal violet solution in water. The plates were washed and the colonies counted.A total of 3500 cells per well were seeded in 12-well culture plates (Nunc) in complete growth medium. Three replicates per condition were assayed in each growth curve, and a minimum of three replicate growth curves were generated for each experiment. The first point of the curve (day 0) was fixed with a 0.5% glutaraldehyde solution 24\u2009hours after seeding. In the 0.5% FBS growth curves, cells were washed twice with PBS, and medium containing 0.5% FBS was then added before the day 0 plate was fixed. Every two days, a point on the curve was fixed and stored in PBS at 4\u2009\u00b0C until the last point of the curve was fixed. Cells were then stained with a 1% crystal violet solution and washed. The crystal violet that attached to the cells was dissolved in a 20% acetic acid/water solution, and the absorbance of this solution at 595\u2009nm was measured. The intensity of the absorbance correlates with the quantity of cells, and the data were normalized to the absorbance on day 0. The normalized absorbance over time is presented.A total of 100,000 cells per well in 0.35% agarose growth medium were seeded in 6-well plates over a base of 0.7% agarose medium. The day after seeding, 3\u2009mL of complete growth medium was added to each well. The media was replaced twice a week until the end of the experiment, at which point the colonies had undergone sufficient growth. Then, photos were taken of each well with microscope with an installed camera , and colony number and size were determined.Cells were tripsinized, counted, and included in FBS-free medium. 150.000 cells in 1.5\u2009mL of FBS-free medium were added to 8\u2009\u00b5M pore size 6-well transwells (#3428. Cultek). Transwells were placed on 6-well plates including 2.5\u2009mL of 10% FBS medium. After 48\u2009hours of incubation, transwell were discarded and migrated cells attached to the well bottom were fixed and stained with a 1% crystal violet solution. The crystal violet that attached to the cells was dissolved in a 20% acetic acid/water solution, and the absorbance of this solution at 595\u2009nm was measured. The intensity of the absorbance correlates with the quantity of migrated cells.6 cells) of the mixture was injected into both flanks of female, 6-week-old athymic nude mice (nu+/nu+). 5 animals were included in each group to reach statistical significance, based on previous experiments in the laboratory, and reviewed and approved by the Animal Protection Comittee. Tumors were measured weekly after implantation, and the mice were sacrificed when the tumor volume exceeded 1000 mm3. Then, tumors were harvested and stored.Cell lines were trypsinized, counted and diluted in PBS. Then, the cell suspension was mixed with Matrigel (1:1), and 150\u2009\u00b5L . Patients had undergone surgical resection, and tumor samples were sent to the pathology laboratory for diagnosis and were prepared for storage by formalin fixation and paraffin embedding.Regarding human samples, written informed consent was provided by all the patients. The project was approved by the Research Ethics Committee of the Virgen del Roc\u00edo University Hospital, Sevilla, Spain .The procedures involving animals were approved by Animal Protection of the Comunidad Aut\u00f3noma de Madrid .39. And, for tumor marker prognostic study, the REMARK reporting guidelines were followed40.All experiments were performed in accordance with relevant guidelines and regulations. Biobanking and handling of the human samples followed the BRISQ guidelinesDNA was extracted from tissue sections of formalin-fixed, paraffin-embedded (FFPE) samples using the QIAamp DNA Mini Kit , and the DNA concentration was measured using a Nanodrop ND-1000 spectrophotometer (Nanodrop Tech). DNA samples were then preamplified using Preamplification Master Mix and the rs351855 TaqMan Genotyping probe , following the manufacturer\u2019s instructions, with an 18-cycle preamplification protocol; then, the samples were diluted 1:20. Genotyping was conducted using the 50-cycle genotyping protocol from TaqMan and the rs351855 probe, and the results were analyzed with TaqMan Genotyper software.RNA was extracted from paraffin-embedded tissue from patients using the RecoverAll Extraction Kit . RNA samples were then reverse transcribed with the TaqMan Reverse Transcription Kit (Life Technologies). Prior to the analysis of each gene, a preamplification step was performed with the TaqMan Preamp Master Mix Kit . Preamplification and gene expression analysis were conducted using TaqMan probes from Life Technologies: Hs01106908_m1 FAM (FGFR4), Hs00983056_m1 FAM (N-cadherin), and Hs99999905_m1 FAM (GAPDH). GAPDH was used as the reference gene to normalize the expression data.Statistical analysis was performed with the SPSS statistical package . Differences between experimental conditions were analyzed using Student\u2019s t-test. Spearman\u2019s Rho method was used for bivariate correlation analysis. Kaplan-Meier curves were generated to calculate overall survival (OS) and progression-free survival (PFS), and significant differences were assessed by log rank univariate and proportional hazards regression multivariate analysis. The Chi-Square test was used to assess differences in clinicopathological characteristics between the different patient subgroups.Supplementary table S1, Supplementary table S2, supplementary figure S1 and supplementary figure S2."} +{"text": "Routinely crossing international borders and/or persisting in populations across multiple countries, species are commonly subject to a patchwork of endangered species legislation. Canada and the United States share numerous endangered species; their respective acts, the Species at Risk Act (SARA) and the Endangered Species Act (ESA), require documents that outline requirements for species recovery. Although there are many priorities for improving endangered species legislation effectiveness, species recovery goals are a crucial component. We compared recovery goal quality, as measured by goal quantitativeness and ambition, for species listed under SARA and ESA. By comparing across ESA and SARA, the intent of the study was to identify differences and similarities that could support the development of stronger species\u2019 recovery goals under both legislations. Our results indicated that: (1) overall, only 38% of recovery goals were quantitative, 41% had high ambition, and 26% were both quantitative and with high ambition; (2) recovery goals had higher quantitativeness and ambition under ESA than SARA; (3) recovery goals for endangered species had higher ambition than threatened species under ESA and SARA, and; (4) no recovery goal aimed to restore populations to historic levels. Combined, these findings provide guidance to strengthen recovery goals and improve subsequent conservation outcomes. In particular, species at risk planners should seek to attain higher recovery goal ambition, particularly for SARA-listed species, and include quantitative recovery goals wherever possible. Biodiversity is eroding globally as species face unprecedented threats to their existence, including habitat loss and degradation ,2, exploCanada and the United States (US) share the longest international border in the world and are linked by prominent geographical features such as the Rocky Mountains, the Great Lakes, and countless additional marine, terrestrial, and freshwater ecosystems. In addition to growing lists of species at risk that are unique to each country, Canada and the US also share numerous at-risk species, including migratory (or otherwise mobile) species that traverse both countries and species represented by populations that occur in both countries . Two different national legislative acts, Canada\u2019s Species at Risk Act (SARA) and the US\u2019 Endangered Species Act (ESA), aim to identify and protect species at risk in their respective countries.Identifying and protecting at-risk species in Canada involves multiple steps. Formed in 1977, the Committee on the Status of Endangered Wildlife in Canada (COSEWIC) is an independent scientific body that assesses the status of species potentially at risk of extinction or extirpation within Canada . COSEWICThe US federal process for conserving at-risk species and the ecosystems on which they depend was established by ESA legislation enacted in 1973 . Under EPrevious studies have highlighted the many differences and similarities between ESA and SARA ,11,12. AOrcinus orca), one of the most intensively studied marine mammals on the planet, are quantitative and of relatively high ambition under ESA are qualitative with moderate ambition , another intensively studied species. ESA recovery goals published two decades ago are qualitative but of relatively high ambition . In conr year\u201d; ). As a seasing\u201d; ), whereaeasing\u201d; ). A thirlations; ). Althoulations; . Althouglations; .Regardless of the drivers , varyinInitially instigated over the unambiguous contrasts between ESA and SARA recovery goal quality, as measured by quantitativeness and ambition, for several high-profile species , this study\u2019s main objective is to compare and contrast recovery goal quality for species listed under SARA and ESA. Our focus on recovery goal quantitativeness and ambition was strategically identified for the potential to strengthen recovery goal objectives, with the ultimate intent being improved conservation outcomes for species at risk. By comparing across the two legislation types, our aim is to identify differences that could pinpoint areas for improvement as well as similarities that could identify weaknesses common to the development of quality recovery goals under both legislation types. Moreover, our analysis includes a subset of species that are cross-listed under both legislation types, the intent of which is to uncover cases that could benefit from increased cross-border sharing of information. Accordingly, study findings are intended to inform and provide guidance for the improvement of recovery goals in aid of species conservation.http://www.registrelep-sararegistry.gc.ca/sar/index/default_e.cfm; ESA: https://www.fws.gov/endangered/index.html; Acipenser transmontanus, Kootenay River population) with population-specific recovery documents under both legislation types or; (3) they were equivalent but spatially discrete populations , or Designatable Units or Distinct Population Segments with population-specific recovery documents under both legislation types. Hereafter, we refer to DUs, DPSs, species, subspecies, ecotypes, and subpopulations as \u201cspecies\u201d. Where available, finalized recovery documents were used; in the absence of a finalized document, draft documents were examined. Two species listed as extirpated in Canada where recovery was deemed either not technically or biologically feasible were included in the summary table and the karner blue (Lycaeides melissa samuelis) are also listed as extirpated in Canada, their recovery is currently considered feasible is stable or increasing\u201d was scorAmbition of recovery goals: recovery goals were assigned an ambition score modified from McCune et al. . AmbitioAdditionally, recovery goals in SARA recovery documents were often separated into short- and long-term objectives; typically these two time periods were based on the life history of the species in question, with several exceptions where time frames were not clarified . When present, the two time frames were assessed separately. The two time frames often received different scores for both recovery goal quantitativeness and ambition and thus, as a conservative approach for the direct comparison between SARA and ESA recovery documents, we used the \u201cbest case scenario\u201d from the two SARA goals by choosing quantitative over qualitative goals and using the higher ambition score. Once completed, 10% of recovery documents were randomly re-sampled and evaluated again by three trained individuals; on average, repeatability scoring for recovery goal ambition score and recovery goal quantitativeness was 90%.We used Fisher\u2019s Exact tests to examine similarities and differences in quantitativeness and ambition in relation to legislation type, species status, and natural taxonomic grouping. For simplicity, we compared goals with ambition scores of 4 to all lower ranked goals . For comparisons by status, we focused on species listed as threatened versus endangered due to the small number of species in our dataset (n = 2) listed as extirpated under SARA. All data were analyzed and graphed using R statistical software .Considering all recovery documents examined in this study, 38% (78/208) of recovery goals were quantitative and 41% (85/208) had high ambition . Only 26% (55/208) of recovery goals were both quantitative and had high ambition. Overall, quantitative goals were associated with higher ambition . SpecifiComparing between legislation types, ESA recovery goals were more quantitative and had higher ambition than SARA recovery goals ; Table 2Quantitativeness and ambition also differed by species status . OverallThe trend of ESA being more quantitative and having higher ambition than SARA was largely consistent across natural taxonomic groupings ; Table 2The majority of long- and short-term recovery goals for SARA-listed species were qualitative ; recOne of our main findings was that only 38% of recovery documents assessed had recovery goals that were quantitative. This finding is highly relevant, as recovery goal quality may affect conservation outcomes. As a key example, Gerber and Hatch found thRegarding ambition, only 41% of goals had high ambition . Although recovery goals with higher ambition were more likely to be quantitative, the two measures of goal quality differed for 25% of species examined have been previously identified for SARA-listed species , but dirhttp://www.biologicaldiversity.org) as compared to SARA . Fun. Funhttp compare(but see ). Finall\u201d refers to population(s) identified by the recovery documents.(DOCX)Click here for additional data file.S2 TableOdds ratios and confidence intervals were obtained from Fisher\u2019s Exact Tests. See (DOCX)Click here for additional data file.S1 FigBars show the percentage of recovery goals with ambition scores 1\u20134 for (A) qualitative goals under the ESA, (B) quantitative goals under the ESA, (C) qualitative goals under SARA, and (D) quantitative goals under SARA. Ambition of recovery goals within published recovery documents was scored on a scale from 1 to 5; however, no goals qualified for an ambition score of 5 see . The num(TIF)Click here for additional data file.S2 FigPercent of quantitative recovery goals (A) by species status , and (B) by natural grouping. Ambition of recovery goals listed under the ESA (denoted by a star) and SARA (denoted by a maple leaf) (C) by status and (D) natural grouping. Ambition of recovery goals within published recovery documents was scored on a scale from 1 to 5; however, no goals received an ambition score of 5 see . Sample (TIF)Click here for additional data file.S3 FigBars show the percent of recovery goals with ambition scores 1\u20134 for (A) long-term qualitative goals, (B) long-term quantitative goals, (C) short term qualitative goals, and (D) short-term quantitative goals. Ambition of recovery goals within published recovery documents was scored on a scale from 1 to 5; however, no goals received an ambition score of 5 see . The num(TIF)Click here for additional data file. 18 Sep 2019Attachmentresponse letter outline-7.docxSubmitted filename: Click here for additional data file. 4 Oct 2019Raising the Bar: Recovery Ambition for Species at Risk in Canada and the USPONE-D-19-26321Dear Dr. Pawluk,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.https://www.editorialmanager.com/pone/, click the \"Update My Information\" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact With kind regards,Stephanie S. Romanach, Ph.D.Academic EditorPLOS ONEJournal Requirements1. When submitting your revision, we need you to address these additional requirements.Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttp://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 8 Nov 2019PONE-D-19-26321 Raising the Bar: Recovery Ambition for Species at Risk in Canada and the US Dear Dr. Pawluk:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. For any other questions or concerns, please email Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofDr. Stephanie S. Romanach Academic EditorPLOS ONE"} +{"text": "An approach for molecular similarity/substructure searching based on structural hierarchy matching is proposed. In this approach, small molecules are divided into two categories, acyclic and cyclic forms. The latter are further divided into three structural hierarchies, namely, framework, complicated-, and mono-rings. During searching, the similarity coefficients of a structural query and each retrieved molecule are calculated using the hierarchy of the query as the reference. A total of 13,911 chemicals were involved in this work, from which the minimal cyclic and acyclic substructures are extracted, and further processed into fuzzy structural fingerprints. Subsequently, the fingerprints are used as the searching indices for molecular similarity or substructure searching. The tests show that this approach can give user options to choose between one-substructure and multi-substructure searching with sorted results. Moreover, this algorithm has the potential to be developed for molecular similarity searching and substructure analysis. Structural fragments are commonly used for structural and similarity searches. These searches are used for identifying molecules that possess the same or similar topological fragments for a given query from a chemical library, and also used to establish the property/activity and structure relationships (SPR or SAR) ,5,6,7,8.Defining the substructures and assigning them with surrounding chemical environment information are important to implement this idea. A sorted result is desirable. In this work, we refer to the minimal cyclic and acyclic fragments as substructures, endow each substructure with the information of its localization state, use the fuzzy fingerprints as searching indices to conduct similarity and substructure searching, and use the structural hierarchies of the query as the reference to rank the retrieved molecules. This approach is available online .A total of 19,741 cyclic substructures were derived from 13,911 chemicals. Among these, 3247, 7697, and 8797 substructures belong to the complicated, pure aromatic and mono-alicyclic ring groups, respectively. These complicated rings are further simplified into minimal rings that generate 12,522 mono-alicyclic and 3078 aromatic substructures. Therefore, 10,775 aromatic and 21,319 mono-alicyclic substructures are found. Non-ring molecules, side chains, and linkers are dissected into 131,911 minimal linear units. After the unification of one substructure corresponding to one expression and the treatment of fuzzy matching, 631 cyclic and 269 linear fuzzy fingerprints are generated from these substructures. The information of the fuzzy fingerprint and its surrounding chemical environment is stored in the fingerprint table for each molecule.When the query is a molecule, this algorithm executes a multi-point (multi-substructure) search. In this procedure, the fingerprints of the query molecule are compared against those of each molecule in the fingerprint table, and the retrieved molecules are ranked in descending order according to Tanimoto coefficients. Although the chemical environment information is limitedly given for the substructures, this approach offers an acceptable result on the matching precision tests, in which over 76% of the query molecules rank 1st, over 92% rank 3rd, over 98% rank 10th and all the others rank 11th to 42nd among the corresponding retrieved molecules . LimitinThis approach conducts the substructure searching in two stages: conducting one-point (one substructure and so forth), two-point, or multi-point searching and then ranking the retrieved molecules using the hierarchy of the query as reference. The first stage is to determine whether the other molecules contain the query substructure(s), as this process only places emphasis on specific substructure(s) and it greatly improves the searching speed. The second stage uses the chemical environment information to calculate the Tanimoto coefficient for each hierarchy of the query. We use some examples to explain the searching process. (1) In one-point searching, the canonical SMILES string of \u201cc1ccccc1\u201d represents the isolated substructure of the benzene ring. When this string is used as the entry, the algorithm screens all molecules containing benzene rings. The molecules possessing fused benzene rings are also searched. The current algorithm excludes the latter, so the molecules with only one isolated benzene ring are ranked at top positions; (2) In two-point searching, the SMILES string of \u201cc1ccccc1C\u201d refers to toluene in the chemistry field. However, this algorithm, which complies with the structure explanation of SMILES, treats this string as two substructures of one isolated benzene ring and one methyl group. Therefore, the molecules with one benzene ring and one methyl group are prioritized; (3) In multi-point searching, the SMILES string of \u201cc1ccccc1Cc1ccccc1\u201d is considered a framework that contains two isolated benzene rings and one linker of methylene. Therefore, the molecules with this framework are ranked at top positions.The lack of sufficient connection (or fusion) information between two substructures decreases the matching precision, but it provides a convenient way to investigate the structural diversity of the molecules with the same substructures. For example, the SMILES string of \u201cc1ccccc1c1ccccn1\u201d is structurally considered a framework that contains one isolated pyridine and one benzene ring, and thus the molecules comprising these two rings and a linker or ring(s) are retrieved. A total of 13,911 chemicals from the KEGG database (3 September 2010 update) are used as the dataset. These chemicals are classified into drugs, metabolites, and other chemical substances included in KEGG\u2019s biological systems [The canonical SMILES string of each chemical structure is converted from molecular connection table (in MOL format) with the OpenBabel 2.2.2 software ,13,14,15There are many ways to fragment molecular structures . Based oThe terms used in these hierarchies are interpreted as follows:Framework refers to the skeleton union of the rings and the Linker(s). The framework only exists in molecule with circular substructures. One molecule contains one framework at most.Complicated ring is a circular complex characterized by the following properties: (1) contains two rings or more; (2) has one alicyclic ring at least; (3) all component rings are fused or bridged together. This ring has two fundamental forms, namely, fusion occurs in the alicyclic and aromatic rings, in alicyclic rings. Therefore, any complicated ring can be disassembled into smaller rings having one alicyclic ring at least.Pure aromatic ring is any aromatic system in which the aromatic atoms are contiguous.Mono-alicyclic ring is an alicyclic system with only one ring.Side chain is an atom or a cluster of fragments with only one of its terminal ends directly attached to a ring, while a Linker is an atom or a chain that connects two isolated rings at both ends.Linear fragment, a union of the same kind of elements, directly comes from the side chain, linker, and any non-ring molecule that does not contain any circular substructure. In its preparation process, any non-carbon element, including saturated heteroatom, metallic element, and halogen element, among others, acts as the separator breaking the whole molecule into several fragments.Minimal linear unit is the maximal collection of the same elements without any branched substructure. Single atom or a single carbon chain is the minimal linear unit. However, a branched fragment is beyond this definition. Given that a branched fragment is made up of only carbon element and possible triple, double, and single bonds, we extract the minimal linear units following the rules generally applied in system nomenclature by the International Union of Pure and Applied Chemistry. Generally, the individual maximum numbers of triple, double, and single bonds are the criteria for determining the main chain in a fragment. After the main chain has been extracted, the remaining substitutes subsequently share the same extraction method until all contained minimal linear units are obtained.SET temp_list substructure_listREAD datasetFOR each_molecule IN dataset\tDETERMINE molecule_hierarchy\tIF\tFramework\tTHEN\t\t\tPUSH ring linker side_chain TO temp_list\tELSE IF\tComplicated_ring\tTHEN\t\t\tPUSH ring side_chain TO temp_list\tELSE IF\tUnit_ring\tTHEN\t\t\tPUSH ring TO substructure_list\t\t\tPUSH side_chain TO temp_list\tELSE\t\t\tPUSH Linear_fragment TO temp_list\tENDIFENDFORFOR each_ring IN temp_list\tDETERMINE Unit_ring\tIF\tTRUE\tTHEN\t\t\tPUSH TO substructure_list\t\tELSE\t\t\tGET Unit_ring\t\t\tPUSH Unit_ring TO substructure_list\tENDIFENDFORFOR each_non-ring IN temp_list\tDETERMINE Unit_line\tIF\tTRUE\tTHEN\t\t\tPUSH TO substructure_list\t\tELSE\t\t\tREPEAT\t\t\t\tGET longer_linear_fragment\t\t\tUNTIL Unit_line\t\t\tPUSH Line TO substructure_list\tENDIFENDFOR\t\tAll rings and line units are treated as substructures. The algorithm for deriving these substructures is described in the following pseudo-code:A cyclic substructure can be an isolated state or a fused state in a molecule. Similarly, a linear substructure can act as a side chain or a linker. This kind of chemical environment difference is assigned to the corresponding substructure during the substructure-deriving process.We use the symbol of contained element and its total number to encode each substructure. However, one fingerprint mapping may occur for several graphic substructures, and thus we call it fuzzy fingerprint (listed in READ query_molecule_hierarchyIF\tComplicated_ring\tTHEN\tRANK Complicated_ring AS first_level\tRANK side_chain AS second_level_or_third_levelELSE\tRANK\tFramework AS first_levelRANK side_chain AS second_level_or_third_levelENDIF\t\tThe Tanimoto coefficient is calculated for each hierarchy. The algorithm for ranking the retrieved molecules is described in the following pseudo-code:With each molecule in the dataset serving as the query molecule, similar molecules are screened from the dataset, and the rank position of query molecule in the retrieved molecules is counted separately.In this work, we propose an approach for similarity/substructure searching and implement it on Linux systems. The test results demonstrate that this algorithm combines the advantages of similarity and substructure searching, especially for substructure searching. It can perform one-point to multi-point searching with acceptable results in chemical big data process . However"} +{"text": "Verbal autopsy (VA) is a method for assessing causes of death by interviewing relatives of a diseased person and gathering as much information as possible on the diseases, signs, symptoms, treatments, and circumstances of the death. The gathering of such information can be made by informal interviews or through the use of a questionnaire, and is then treated either by knowledgeable persons or by a computer in order to obtain the probable causes of death . VA using a standardized questionnaire was first used on a small scale in the 1980s and became popular in the 1990s . From thThe first issue \u2013 the reliability of individual cause of death \u2013 is assessed by comparison with a \u2018gold standard\u2019. Several \u2018gold standards\u2019 have been used over the years, in particular \u2018clinical diagnosis\u2019 made by physicians in hospitals and based on clinical and biological examinations as well as \u2018formal autopsies\u2019 based on postmortem histopathological examination. The determination of the best method can be discussed at length. From a purely theoretical standpoint, comparison with a formal autopsy is the most robust but has serious limitations. Firstly, formal autopsies are rarely conducted except in the case of violent or suspicious deaths, which is not a representative sample of all causes of death in the population. Secondly, the precise assessment of all pathological processes leading to death is sometimes far from the \u2018underlying cause\u2019, the concept used in public health. From a practical standpoint, assessing the underlying cause, as done in developed countries, is based on a mixture of clinical and biological examination, knowing that those are not identical to formal autopsies , 4. TherThe paper presented by Jha et al. has an aHowever, their study still has some value given that it is based on large numbers, all ages, and a variety of causes. In particular, it shows that, in 83% of cases, the diagnosis for adults made by two independent physicians was identical, which is reassuring. Even if both could be wrong in some cases, this at least ensures consistency. The fact that automated algorithms were shown to be often inconsistent implies that they should be improved. In fact, they are based on the same type of evidence and should lead to the same, or at least a compatible, diagnosis. There is much work to be done to improve questionnaires, coding, and automated diagnoses in order to enable the use of VAs on a large scale in countries without proper cause of death registration. Of course, ultimately, one would like to have appropriate cause of death statistics worldwide."} +{"text": "Fusarium oxysporium Dzf17 isolated from the rhizomes of Dioscorea zingiberensis. The effects of the time of addition and polysaccharide concentration on the growth and diosgenin accumulation in cell suspension culture of D. zingiberensis were studied. Among them, WPS was found to be the most effective polysaccharide. When WPS was added to the medium at 20 mg/L on the 25th day of culture, the cell dry weight was increased 1.34-fold, diosgenin content 2.85-fold, and diosgenin yield 3.83-fold in comparison to those of control. EPS and SPS showed moderate and relatively weak enhancement effects on cell growth and diosgenin accumulation, respectively. The dynamics of cell growth and diosgenin accumulation when WPS was added to the medium at 20 mg/L on the 25th day of culture were investigated, and results showed that dry weight of cells reached a maximum value on day 30 but the maximum diosgenin content was achieved on day 31.Three polysaccharides, namely exopolysaccharide (EPS), water-extracted mycelial polysaccharide (WPS) and sodium hydroxide-extracted mycelial polysaccharide (SPS), were prepared from the endophytic fungus Dioscorea zingiberensis C. H. Wright (Dioscoreaceae) is a well known traditional Chinese medicinal herb, indigenous to the south of China [D. zingiberensis has led to a rapid decrease of this plant resource and an acute shortage of the intermediate (diosgenin) for pharmaceutical synthesis. Furthermore, agricultural production of D. zingiberensis requires 3\u20134 years from seedling to mature rhizome, during which time plant growth is highly susceptible to a number of environmental factors, as well as occupying large areas of cultivation land. Consequently D. zingiberensis cell culture has been regarded as an alternative means for efficient and controllable production of diosgenin [of China ,2. The rof China ,4. Howeviosgenin .Plant cell culture is a convenient and efficient culture system for plant science and biotechnology research and development. It has shown great advantages as an alternative to the whole plant system for producing bioactive products, which have been used produce valuable medicinal substances commercially ,7. HowevCatharanthus roseus cell culture for catharanthine production [Salvia miltiorrhiza cell culture for tanshinone production [Taxus sp. cell culture for paclitaxel produciton [Hyoscyamus muticus cell culture for sesquiterpene production [Panax ginseng cell culture for saponin production [Morinda elliptica cell culture for anthraquinone production [Dioscorea galesttiana cell culture for diosgenin production [i.e., mycelia and spores), crude extracts, as well as fungal peptides, proteins and carbohydrates [i.e., polysaccharides and oligosaccharides) prepared from fermentation cultures of fungi. The effects of carbohydrates on plant secondary metabolites depend on their composition, degree of polymerization, concentration and addition time [Lithospermum erythrorhizon cells was greatly enhanced by acidic polysaccharides from agar [Elicitation is the induction of secondary metabolite production by either biotic or abiotic treatments. Nowadays, the use of pathogenic and non-pathogenic fungal preparations and chemicals as elicitors has become one of the most important and successful strategies to improve secondary metabolite production in plant cell culture . Typicaloduction , Salvia oduction , Taxus soduciton , Hyoscyaoduction , Panax goduction , Morindaoduction , and Diooduction . The funhydrates ,14. Elicion time . Shikonirom agar . Polysacrom agar .Fusarium oxysporum Dzf17 is an endophytic fungus isolated from the rhizomes of D. zingiberensis. The crude oligosaccharide from this fungus was preliminarily observed in our previous study to have enhancement effects on diosgenin production in D. zingiberensis cell culture [D. zingiberensis.Research on plant endophytic fungi has become a hotspot of research activity in recent years, mainly because of the valuable metabolites with multiple biological activities as well as great potential applications in agriculture, medicine and food industry ,26,27,28 culture . The purD. zingiberensis without elicitation are shown in D. zingiberensis cultured cells to produce diosgenin.Time courses of cell growth and disogenin production in cell suspension culture of D. zingiberensis are shown in The effects of exopolysaccharide (EPS) as an elicitor on cell growth and diosgenin production in cell suspension culture of Cell growth was inhibited when EPS was added on the either 10th day or 15th day of culture at all tested concentrations, and the dry weight of the treated cell cultures was decreased to 65\u201391% of control (4.02 g dw/L) A. ObviouDiosgenin yield (mg/L) is the result of the synthesized cell dry weight (g dw/L) and diosgenin content (mg/g dw). The effects of EPS on diosgenin content and yield are shown in D. zingiberensis are shown in Effects of water-extracted mycelial polysaccharide (WPS) on cell growth and diosgenin production in cell suspension culture of The effects of WPS on diosgenin content and yield are shown in D. zingiberensis are shown in D. zingiberensis cells were cultured for 25 days, cell cultures entered into late log phase. As reported in Effects of sodium hydroxide-extracted mycelial polysaccharide (SPS) on cell growth and diosgenin production in cell suspension culture of D. zingiberensis suspension cultures treated with WPS elicitor (20 mg/L) on the 25th day were investigated as shown in D. zingiberensis cells to produce diosgenin by the addition of WPS elicitor to the medium at concentration of 20 mg/L on the 25th day after inoculation was set at 31 days.Based on the above elicitation results, among three polysaccharides WPS elicitor showed the best stimulating effects on cell growth and diosgenin production when it was added on the 25th day after inoculation at a concentration of 20 mg/L, so the time courses of cell growth, diosgenin content and diosgenin yield of Dioscorea floribunda cell aggregates treated with 2-chloroethylphosphonic acid (2-CEPA) [Alternaria tenuis at 1.3 g/L in medium were also found to increase diosgenin production in Dioscorea galeottiana cell suspension cultures [F. oxysporium Dzf17 stimulated diosgenin production in cell suspension culture of D. zingiberensis in this study. This indicated that the active components in the fungal mycelia of A. tenuis should be the polysaccharides or oligosaccharides which need to be further studied.Previous reports showed that diosgenin production was enhanced in (2-CEPA) . The autcultures . The polD. zingiberensis C. H. Wright as described previously [Calli were induced from the root explants of eviously , and werFusarium oxysporum Dzf17 was isolated from healthy rhizomes of D. zingiberensis as reported previously [2HPO4 (0.6 g/L), and MgSO4\u00b77H2O (0.2 g/L). All flasks were maintained on a rotary shaker at 150 rpm and 25 \u00b0C for 14 days. A total of 150 L of fermentation broth was obtained and centrifuged at 7,741 \u00d7 g for 20 min. The supernatant and mycelia were collected separately. Mycelia were washed twice with deionized water, then lyophilized. About 600 g of mycelia in dry weight (dw) was obtained.Endophytic fungus eviously . The mycg for 15 min, and the precipitate from ethanol dispersion was collected as crude EPS which was further subjected to deproteinization with Sevag reagent , decolorization with H2O2, and removal of small molecule impurities by dialysis. Polysaccharide mixture with molecular weight greater than 8,000\u201314,000 Da was kept in dialysis tube. The carbohydrate content of EPS was measured spectrophotometerically by the method of anthrone-sulfuric acid [Exopolysaccharide (EPS) was prepared from the supernatant (150 L) mentioned above. Briefly, the supernatant was concentrated under vacuum at 60 \u00b0C by a rotary evaporator to a suitable volume and mixed with three volumes of 95% ethanol, then kept at 4 \u00b0C for 48 h. After that, the solution was centrifuged at 17,418 \u00d7 ric acid , which ig, 20 min) and drying in an oven at 40 \u00b0C for 2 h, and then immersed in hot water at 90 \u00b0C for 2 h with the ratio of water (mL) to the material (g) set at 30:1 (v/w). After that, centrifugation was carried out at 7,741 \u00d7 g for 20 min to separate the residue and the supernatant. The supernatant was condensed to a certain volume under vacuum at 60 \u00b0C, and then mixed with three volumes of 95% ethanol, and then kept at 4 \u00b0C for 48 h. The following procedure for polysaccharide preparation and purification was the same as the treatments of exopolysaccharide (EPS). The gained polysaccharide (33.24 g) was named as water-extracted mycelial polysaccharide (WPS). The residue not containing WPS was further extracted with 10% sodium hydroxide (NaOH) solution at room temperature for 24 h. The remaining steps were the same described in the treatment of EPS. The obtained polysaccharide (35.89 g) was designated as sodium hydroxide-extracted mycelial polysaccharide (SPS).The lyophilized mycelia (600 g) were powdered in a high power disintegrator, and then subjected to heat circumfluence extraction at 50 \u00b0C by 95% ethanol-petroleum ether at 1:1 (v/v) as the refluxing solvent to remove monosaccharide, disaccharide and lipid. The ratio of mycelia powder (g) to refluxing solvent (mL) was 1:5 (w/v). Defatted mycelial powder was obtained by centrifugation . The sterilized polysaccharide solutions were stored at 4 \u00b0C in a refrigerator before use. Each polysaccharide was added to the medium at the concentrations of 10\u2013160 mg carbohydrate equivalent per liter, respectively. The addition time of each elicitor along with their different concentrations in the medium was studied on days 10, 15, 20 and 25, respectively. The harvest time was determined based on the time courses of cell growth and diosgenin production.The suspension cells were harvested, and separated from the liquid medium by filtration, washed with distilled water to remove residual medium, and then filtrated again under vacuum to obtain fresh cells, which were further lyophilized to a constant dry weight (dw) and expressed as gram dw per liter.Diosgenin extraction was carried out as previously described with some modifications . Briefly18 column was used for separation by using a mobile phase of acetonitrile-water at a flow rate of 1 mL/min at 30 \u00b0C, and an LCsolution multi-PDA workstation was employed to acquire and process chromatographic data. The injection volume was 20 \u03bcL. Changes in absorbance at 203 nm were recorded. The peak area was calibrated to diosgenin content with a chemical standard (Sigma). Diosgenin content in the culture medium was negligible and therefore not determined.A high performance liquid chromatography system , which consisted of two LC-20AT solvent delivery units, an SIL-20A autosampler, an SPD-M20A photodiode array detector, and CBM-20Alite system controller, was employed. A reversed-phase Agilent TC-Cp \u2264 0.05.All treatments were performed in triplicate, and the results were represented by their mean values and the standard deviations (SD). The data were submitted to analysis of variance to detect significant differences by PROC ANOVA of SAS version 8.2. The term significant has been used to denote the differences for which F. oxysoprium Dzf17 exhibited obvious effects on cell growth and diosgenin production in cell suspension culture of D. zingiberensis. The optimal addition time for the polysaccharide elicitors in D. zingiberensis cell suspension culture was suggested to be at late log phase. Among three polysaccharides, WPS showed the most stimulating effects on cell growth and diosgenin production. There is a need to characterize the chemical structures of these polysaccharides from the fungus Dzf17, and to investigate their structure-activity relationships. The crude oligosaccharide prepared by partial acid hydrolysis of F. oxysporium Dzf17 fungal cell wall fragments showed a stimulating effect on diosgenin production in D. zingiberensis cell culture in our previous study [D. zingiberensis which need to be further clarified [i.e., cell growth, secondary metabolite biosynthesis), as well as their preparation on a large scale also need to be further studied.In this work, all the polysaccharides prepared from endophytic fungus us study . This inlarified . Other i"} +{"text": "P = 0.043). The localization and detection of H4 and H4 acetylation were measured by immunocytochemistry which revealed that H4 and H4 acetylation were equally distributed in the sperm head of high and low fertility sires. Western blotting results confirmed the presence of the H4 and its acetylated form in the sperm. Bioinformatics studies demonstrated that H4 is highly conserved among mammalians, and have significant gene ontology on spermatogenesis, early embryo implantation, and sperm capacitation. The results are significant because it demonstrates the replacement of canonical histone H4 into modified H4 acetylation in sperm and regulate its dynamics which is crucial for bull fertility and reproductive biotechnology. These findings advance fundamental science of mammalian early development and reproductive biotechnology.Bull fertility, ability of the sperm to fertilize and activate the egg and support embryo development, is vital for cattle reproduction and production. Even though majority of histones are replaced by protamines, some histones are retained in sperm. It is known that chromatin remodeling during spermatogenesis results in dynamic changes in sperm chromatin structure through post-translational modifications (PTM) of sperm histones, which are important for regulation of gene expression. However, amounts of sperm Histone 4 (H4), its acetylated form (H4 acetyl), and to what extent these molecular attributes influence sperm chromatin structure and bull fertility are unknown. These gaps in the knowledge base are important because they are preventing advances in the fundamental science of bovine male gamete and improvement of bull fertility. The objective of this study was to test the hypothesis that expression dynamics as well as PTM of sperm H4 are associated with bull fertility. Flow cytometry was utilized to quantify H4 and H4 acetylated form in sperm from seven high and seven low fertility Holstein bulls. The results indicated that the average number of cells with H4 or H4 acetyl expression in high and low fertility bull sperm were 34.6 \u00b1 20.4, 1.88 \u00b1 1.8, 15.2 \u00b1 20.8, and 1.4 \u00b1 1.2, respectively. However, the sperm enriched in both H4 and H4 acetyl were different between high and low fertility groups (3.5 \u00b1 0.6; 1.8 \u00b1 0.8; Bull fertility is an economically important trait and is defined as the ability of the sperm to fertilize and activate the egg, and to sustain embryo development which is crucial for efficient reproduction of cattle. Fertility is a complex trait with numerous determinants including molecular genetics, epigenetics, cellular and physiological aspects of sperm. Traditional semen evaluation techniques include analyses of sperm motility, membrane integrity and morphology to estimate bull fertility. However, they are both tedious and unreliable. As such, fertility differences among males cannot be accurately determined by these conventional methods . IdentifIn mammals, chromatin of the sperm is highly compacted as compared to non-germinal cells. Sperm DNA is tightly coiled around the nucleohistone complex which includes histone H2A, histone H2B, histone 3 (H3), histone 4 (H4), and protamines (PRM) . FollowePrevious studies demonstrated that sperm chromatin damage reduces fertility in bulls , and abnThe objective of this study was to test the hypothesis that sperm H4 and its posttranslational modifications are associated with chromatin dynamics and bull fertility. Flow cytometry experiments were utilized to quantify H4 and acetylated H4 in bull sperm with different fertility scores. In addition, localization and presence of H4 and its acetylated form were determined using immunocytochemistry and Western blotting experiments, respectively. Moreover, computational biology and bioinformatic tools were applied to ascertain conservation of H4 across mammalian species and its interactomes and networks. The findings of the present study are significant because they help advance better understanding of how sperm histone H4 regulates fertility and mammalian development. The results also enhance fundamental science and technology of mammalian gamete and embryo development.Cryopreserved bull semen samples from mature Holstein bulls with reliable field fertility data were provided by Alta Genetics Inc. , a leading animal breeding company. Semen straws from 14 Holstein bulls were used for flow cytometry experiment, and these samples were divided into two groups as high fertility (HF) and low fertility (LF) based on their fertility scores . Bull spFlow cytometry experiments were performed according to method described by Dogan et al. and KutcImmunocytochemistry experiments were conducted according to protocols described by Lu et al. and de OSamples were incubated with primary antibodies against H4 and H4 acetylation at 4\u00b0C overnight. Next day, samples were washed twice in WB at RT for 15 min. Then, samples were incubated with secondary antibodies against H4 and H4 acetylation at RT for 1 h, and with 2.5 mg/ml of DAPI at RT for 10 min. The samples were examined under a confocal fluorescence microscope (Zeiss LSM 510) under 40X and 63X magnifications using immersion oil. Experiment was repeated to confirm the H4 and H4AC localization in bull sperm from high and low fertility bull three times.6 cells were washed twice with 400 ml of 1 mM phenylmethylsulphonyl fluoride (PMSF) in ddH2O to lyse the cells. Next, 100 ml of 20 mM EDTA, 1 mM PMSF, and 100 mM Tris (pH 8.0) were added to the pellets followed by the addition of 100 ml of 6 M guanidine hydrochloride, 575 mM DTT, and 200 ml of 552 mM sodium iodoacetate. Then, samples were incubated at 20\u00b0C for 30 min by protecting from light. Additionally, 1 ml of cold ethanol (\u221220\u00b0C) was added to each sample, and these samples were incubated at \u221220\u00b0C for 3 min and centrifuged at 12,000 \u00d7 g at 4\u00b0C for 10 min. Following one more wash with ethanol, pellet was resuspended in 1 mL of 0.5 M HCl and incubated at 37\u00b0C for 15 min and centrifuged at 10,000 \u00d7 g at 25\u00b0C for 10 min. After centrifugation, supernatant was kept, and 300 \u03bcL of 100% trichloroacetic acid (TCA) to a final concentration of 20% TCA was added to precipitate nuclear proteins. Following 5 min incubation at 4\u00b0C, the samples were centrifuged at 12,000 \u00d7 g for 10 min. The protein pellet was washed twice with 500 ml of 1% 2-mercaptoethanol in acetone, dried, and stored at \u221230\u00b0C.Sperm H4 was extracted according to the methods of de Oliveira et al. and KutcProtein concentration in samples was determined using Quick Start\u2122 Bradford Protein Assay Kit 2 . Sperm nuclear proteins were precipitated using cold acetone at \u221220\u00b0C for 3 h. After centrifugation, supernatant was removed, and pellet was resuspended in 50 \u03bcl of 1x Laemmli sample buffer with 5% 2- mercaptoethanol, and boiled at 95\u00b0C for 10 min. Ten microgram of aliquots from this sample were taken, and sperm nuclear proteins were separated using a vertical polyacrylamide gel electrophoresis . Next, protein bands were transferred from gels to Immobilon\u00ae-P polyvinylidene difluoride (PVDF) membrane using HEP-1 semi-dry electro blotting set at 46 mA for 2.5 h. To block binding sites, membrane was incubated in 5% BSA in PBS-0.1% Tween 20 (PBS-T) at RT overnight. Next day, membrane was washed with 0.1% Tween 20 in PBS for 10 min.For Histone 4, samples were incubated with primary antibody against H4 with 0.1% Tween 20 in PBS for 3 h at 37\u00b0C. Then membranes were washed three times for 10 min with 0.1% Tween 20 in PBS. The membranes were incubated with secondary antibody , Strep Tactin -HRP conjugate , and internal loading control for 90 min at 37\u00b0C. For H4 acetylation, primary antibody was Anti- Histone H4 (acetyl K5 + K8 + K12 + K16) , and secondary antibody was Donkey Anti-Rabbit DyLight . After incubation with secondary antibody, membranes were washed three times with 0.1% Tween 20 in PBS for 10 min. The bands were revealed using a chemiluminescence reagent and Image Laboratory software (Bio-Rad\u00ae) for 30 s.https://www.ebi.ac.uk) (http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml) (https://www.genome.jp) (https://www.uniprot.org) (https://string-db.org/) was used to investigate biological networks of sperm H4 was usedd.shtml) . Functionome.jp) and UniProt.org) . The STRsperm H4 .The intensity of H4 and H4 ACETYL were assessed using mixed model analysis using PROC MIXED with SAS for Windows 9.4 . Group was included as a fixed effect with bull as a random effect. Accordingly, separate models with fertility score as the fixed effect were fit for both the high and low fertility groups to better understand the relationship between fertility score and H4 intensity, H4 ACETYL intensity, and H4 and H4 ACETYL, respectively. Box plots and regression line plots were made using PROC SGPLOT for H4 intensity, H4 ACETYL intensity, and double positive (H4 and H4 ACETYL) intensity. The regression line was determined using the model-predicted intensity values for each of fertility score using the mixed effects model. A scatter plot of the raw, unadjusted data points was superimposed on the regression line plot. Conditional residual plots were used to assess model fit. An alpha level of 0.05 was used to determine statistical significance.p > 0.05). On the other hand, the percentage of sperm tagged by both H4 and H4 acetyl (double positive) among high and low fertility bulls when averaged were (p = 0.043).Total of 100,000 sperm per bull per repeat were analyzed to quantify H4 and H4 acetyl in sperm from seven high and seven low fertility Holstein bulls . The flo8 \u00b1 0.8) \u2013C and weImmunocytochemistry method was performed to find the localization and patterns of H4 and H4 aWestern blotting technique was used to detect the expression of H4 and H4 acetyl in the sperm from high and low fertility bulls. Results revealed that the H4 and acetylated H4 were detectable in sperm from all of bulls .Bos taurus sequence. Protein sequences of 20 mammalian were used for multiple sequence alignment. Clustal Omega research showed that H4 sequence were 100% conserved among Equus caballus, Leptonychotes weddellii, Odocoileus virginianus texanus, Pan troglodytes, Homo sapiens, Mus musculus, Chlorocebus sabaeus, and Bos taurus (in vivo.BLASTP online software , provides taurus GenomeNes taurus . The bioHistone-to-protamine exchange is one of the most crucial steps in sperm chromatin remodeling because this process determines the degree of chromatin condensation which is essential for fertilization. It is thought that hyperacetylation of core histones is important for correct histone-protamine exchange , 20. TheWe demonstrated that expression of sperm H4 and acetylated H4 were more abundant in high fertility bulls as compared to those of low fertility bulls, with 3.5 \u00b1 0.6 and 1.8 \u00b1 0.8 respectively. However, the average numbers of sperm cells counted with H4 or Acetylated H4 were not significantly different among high and low fertility bulls. Immunocytochemistry results demonstrated that sperm H4 and acetylated H4 localized in sperm head, and it distributed homogenously. Also, there were no differences between high and low fertility bulls in terms of signal intensities and localizations of H4 and acetylated H4. Bioinformatics analyses revealed that amino acid sequences of H4 were completely conserved across the 20-mammalian species indicating the evolutionary conservation of the propagation of species at the molecular and cellular levels. In addition, H4 has a significant gene ontology on spermatid development, oogenesis, sperm motility, embryonic placenta development, male germ-line stem cell asymmetric division, sperm capacitation, spermatid differentiation, chromatin remodeling, and nucleus organization.Previous studies demonstrated that histones and their posttranslational modifications play a significant role in sperm DNA packaging , moleculHowever, retained H4 makes sperm cells less compact and more susceptible disturbing factors through the movement of sperm from testis to female reproductive tract. Aoki et al. reportedIn conclusion, the results of this study are significant because they illuminate epigenetic changes in bull sperm that enhances both the fundamental science and technology of bull fertility and cattle reproduction. The molecular and cellular markers can be used to evaluate semen quality and predict bull fertility. Because of the similarities both in genetics and physiology between bulls and other mammalian males, the data and knowledge produced in this study are expected to contribute to the advancement of basic science and biotechnology of other mammals including humans and endangered species.All of the data generated and analyzed in this study are included in the manuscript as tables and figures. The corresponding author will respond to the queries regarding the raw data and reasonable accommodations will be provided.This study was conceptualized by NK, AK, AM, and EM. Data were curated by MU, NK, and EBM. Investigations were carried out by MU, NK, EBM, AU-H, AU, and BH under supervision of EM. Essential samples and phenotypic data were provided by AK and ET. Original draft was written by MU, NK, EBM, BH, and EM. Reviews and editing were completed by NK, MU, and EM.ET was employed by company URUS Group LP. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."} +{"text": "O-glycosylation where short arabinans or larger arabinogalactans are linked to hydroxyproline. The conversion of proline to 4-hydroxyproline is accomplished by prolyl-hydroxylases (P4Hs). Eleven putative Nicotiana benthamiana P4Hs, which fall in four homology groups, have been identified by homology searches using known Arabidopsis thaliana P4H sequences. One member of each of these groups has been expressed in insect cells using the baculovirus expression system and applied to synthetic peptides representing the O-glycosylated region of erythropoietin (EPO), IgA1, Art v 1 and the Arabidopsis thaliana glycoprotein STRUBBELIG. Unlike the situation in the moss Physcomitrella patens, where one particular P4H was mainly responsible for the oxidation of erythropoietin, the tobacco P4Hs exhibited rather similar activities, albeit with biased substrate preferences and preferred sites of oxidation. From a biotechnological viewpoint, this result means that silencing/knockout of a single P4H in N. benthamiana cannot be expected to result in the abolishment of the plant-specific oxidation of prolyl residues in a recombinant protein.Plant glycoproteins display a characteristic type of N-glycosylation pathway of certain plants is already in a very advanced stage. Abolishment of the immunogenic plant-specific \u03b21,2-xylose and \u03b11,3-fucose residues of the core N-glycan was achieved in different plant systems -oxo species and plant PTMs should be addressed. One of the most prominent modifications to deal with is glycosylation of proteins. Glycoengineering of the systems and prod systems . O-glycareported . In mammn plants . The fir lectins . Hyp res species . These pN. benthamiana or A. thaliana -P4Hs and collagen-P4Hs. Hydroxylation of collagen proline residues results in the formation of the stable triple helical structure of collagen . HIF-P4Hthaliana . In the thaliana . In a rathaliana . In BY-2thaliana . These eA. thaliana as well as in Solanum lycopersicum 13 different P4H paralogs were reported so far on soil at 24\u00b0C.Wild-type N. benthamiana, Arabidopsis thaliana DNA sequences of known P4H genes were used to perform BLAST searches against the gene models in the N. benthamiana database1. Protein sequence alignments were performed using the MAFFT algorithm L-INS-i and cDNA was prepared using the LunaScript RT SuperMix kit (New England Biolabs). Four selected candidates of each phylogenetically relevant groups were subcloned into NEB pMiniT 2.0 vectors provided with the NEB PCR mini kit (New England Biolabs). All primers are shown in MW524054 (Nb-P4H1), MW524055 (Nb-P4H4), MW524056 (Nb-P4H9) and MW524057 (Nb-P4H10). For expression in insect cells the catalytically active domain was amplified without the membrane anchor. The baculovirus expression system was used to multiply the pVT-Bac-His-1 vector .Total RNA was isolated from leaves of 5-week-old wild type 1 vector carrying4 for 16 h at 30\u00b0C. The exact amounts of the recombinant enzymes used were Nb-P4H1: 7.01 \u03bcg; Nb-P4H4: 8.25 \u03bcg; Nb-P4H9: 4.20 \u03bcg; Nb-P4H10: 7.26 \u03bcg as determined with the micro BCA protein assay kit . All the synthetic peptides were ordered from JPT and denatured by heating to 97\u00b0C for 10 min, followed by rapid cooling before using in the activity assays. The reaction mixtures were first passed through a 10mg Hypersep-96 C18 cartridge (Thermo Fisher Scientific) and eluted with 85% Acetonitrile in 80 mM Ammonium-formiate buffer (pH 3). The eluants were freeze-dried and taken up in starting buffer before being loaded onto a Biobasic capillary column using a Dionex Ultimate 3000 LC-system (Thermo Fisher Scientific) directly coupled to a Bruker maXis 4G Q-TOF MS instrument equipped with the standard ESI source . Spectra were recorded in positive ion data depended acquisition mode. The same setup was used for analyzing plant- and HEK293 cell expressed IgA1 samples that were transiently expressed in N. benthamiana and HEK293 cells as described in detail previously and digestion with sequencing grade trypsin . For the relative quantification of the different hydroxyprolineated structures, peak areas of Extracted Ion Chromatograms (EICs) of the first four isotopic peaks were summed. All observed charge states were considered. In case of overlapping ammonium adducts the relative quantification was done similarly by exclusively considering the monoisotopic peaks of all observed charge states.The enzymatic assays to verify peptide hydroxylation were performed in a total of 50 \u03bcL 100 mM MES buffer (pH 6.3) containing 10 \u03bcL of purified enzyme, 100 \u03bcM synthetic peptide; 300 \u03bcM 2-oxoglutarate; 2 mM ascorbate; 50 \u03bcM FeSOeviously . Purifiem and vmax values the activity assays were downscaled to a final volume of 20 \u03bcL maintaining the same concentrations and temperature. The recombinant enzymes used were Nb-P4H1: 3.51 \u03bcg; Nb-P4H4: 1.65 \u03bcg; Nb-P4H9: 0.42 \u03bcg; Nb-P4H10: 1.45 \u03bcg per reaction. To calculate a Km and a vmax value the concentration of the synthetic IgA1 peptide varied from 0.022 mM to 5.61 mM. For Nb-P4H1 and Nb-P4H4 a reaction time of 30 min was chosen, while for the other two enzymes the reaction was stopped after 20 min. The assays were immediately purified with 25 mg Hypersep-96 C18 cartridges (Thermo Fisher Scientific) using 85% Acetonitrile in 80 mM Ammonium-formiate buffer (pH 3) to elute the peptides. For MS measurements the peptides were either loaded onto a Biobasic capillary column or onto an Acclaim PepMap nano column using a Dionex Ultimate 3000 LC system (Thermo Fisher Scientific) coupled to a Bruker maXis 4G Q-TOF MS with the standard or the nano ESI source . To assist relative quantification, a fixed amount of another synthetic peptide (PTTTPITTTTTVTPTPTPTGTQTK) was added to each sample as internal standard. To quantify the hydroxylated products, it was assumed that the relation between the standard and the substrate is the same as the relation between the standard and the product.To determine the KNb-P4H1 and Nb-P4H10, a sense-intron-antisense construct was generated following a previously established procedure . Total RNA was reverse transcribed using the LunaScript RT SuperMix Kit (New England Biolabs). qPCR was performed in triplicate using the GoTaq qPCR Master Mix (Promega) and the CFX96 Touch Real-Time PCR System . Protein phosphatase 2A (PP2A) expression was used for normalization of qPCR data. Data analysis was done with the CFX-Manager software version 3.1 (Bio-Rad). Three independent biological replicates were used to calculate the mean values and standard deviation.For transient gene silencing, overnight cultures of agrobacteria carrying the expression vector for the IgA1 heavy chain (either pEAQ-IgA1-HC or pPT2M-IgA1-HC) were diluted to an optical density (OD600) of 0.15, bacteria carrying the IgA1 light chain (pEAQ-IgA1-LC or pPT2M-IgA1-LC) or the gene silencing constructs were diluted to an OD600 of 0.1. Equal volumes were mixed and the mixture was infiltrated into eviously . Two (pPeviously and subjNb-P4H1 coding region was amplified from the subcloned Nb-P4H1 pMiniT 2.0 clone with the primers listed in XbaI/BamHI digested and cloned into XbaI/BamHI digested expression vector p31 (XbaI/BglII digestion and ligation into XbaI/BamHI digested expression vector p47 (Nb-P4H9 and Nb-P4H10 were cloned in a similar manner into p47. All constructs were transformed into Agrobacterium tumefaciens strain UIA143 and used for syringe-mediated agroinfiltration (N. benthamiana plants were infiltrated with Agrobacterium suspensions carrying the protein(s) of interest with an OD600 of 0.1. Confocal images were acquired 2 days post infiltration (dpi) on a Leica SP5 confocal microscope . Samples were excited using 488- and 561-nm laser lines for GFP and RFP, respectively, and observed using a 63 \u00d7 /1.4 NA or 100 \u00d7 /1.4 NA CS2 STED white oil immersion objective, respectively. Signals were collected simultaneously from 500 to 530 nm for GFP and 600\u2013630 nm for RFP. Post-acquisition image processing was performed in Adobe Photoshop CS6 . For co-localization RFP/GFP-tagged P4Hs were co-expressed with the Cis/medial-Golgi marker AtGnTI-RFP or AtGnTI-GFP and agrobacteria carrying pEAQ-IgA1-LC (OD600 of 0.1). The mixture was infiltrated into leaves of 5-week old wild-type ltration . 4 days ltration and subjN. benthamiana, the nucleic acid sequences of Arabidopsis thaliana P4Hs were used to perform BLAST searches against the gene models in the Nicotiana benthamiana database (see text footnote 1) displayed very low sequence identity to N. benthamiana P4H candidates, therefore these sequences were omitted from the final alignment. The resulting tree depicted four clearly separating branches (N. benthamiana cDNA libraries. The candidates were chosen based on the expression levels in the leaf tissue (N. benthamiana database (see text footnote 1). The selected Nb-P4H candidate genes were the following: Nbv6.1TRP71678 (Nb-P4H1), Nbv6.1TRP32386 (Nb-P4H4), Nbv6.1TRP28223 (Nb-P4H9), and Nbv6.1TRP31841 (Nb-P4H10). Interestingly, aligning several biological replicates of amplified and cloned sequences of Nb-P4H4 and Nb-P4H10 with the sequences of the N. benthamiana database showed some discrepancies in sequence identities , and the lysine binding the C-5 carboxyl group of the 2-oxoglutarate are conserved for all Nb-P4H candidates.For the identification of P4H paralogs in tnote 1) . With thbranches . The catf tissue , these dentities . This pocessions . HoweverN. benthamiana leaves with a fluorescent protein fused to the C-terminus. Co-localization experiments with the Cis/medial-Golgi resident N-acetylglucosaminyltransferase I (GnTI) showed tI (GnTI) . In addiI (GnTI) .Nb-P4Hs were cloned into a baculovirus expression vector and expressed in insect cells. Prolyl 4-hydroxylase activity was assessed for each recombinant enzyme by mass spectrometry using synthetic peptides designed based on experiments conducted previously. These peptides had the following four sequences: VTVPVPSTPPTPSPSTPPTPSPS from IgA1 and AQKEAISPPDAASAA from EPO, representing the critical parts of two biotechnologically relevant naturally O-glycosylated human proteins, AAGGSPSPPADGGSPPPPADG from the arabinan and arabinogalactan carrying Artemisia vulgaris pollen allergen Art v 1 was oxidized by Nb-P4H1, Nb-P4H9, and Nb-P410. Nb-P4H1 was the most active enzyme on the extension-like sequence of Art v 1, while Nb-P4H9 and Nb-P4H10 preferred mainly the STRUBBELIG and IgA1 sequences. The cofactors 2-oxoglutarate, ascorbate and Fe2+ were all essential to the activity of these enzymes, concluded from inactivity in the absence of these substances (data not shown). A closer inspection by MS/MS, however, revealed clear differences of the four P4Hs in site and substrate preferences (PTPS in which the second proline gets oxidized (marked bold). Interestingly, this sequence occurs repeatedly in the IgA1 hinge-region peptide and while Nb-P4H1 mostly acts on P18, Nb-P4H10 preferably oxidizes P10. Furthermore, Nb-P4H4 displays activity on the same site as Nb-P4H1 but mostly prefers the sequence SPSTP. Nb-P4H9 on the other hand was most active at the site TPSPS. Surprisingly, the prolines at the sites VPVPS, VPSTP and the C terminal SPS harboring P4, P6, and P22 residues of the IgA1 sequence were seemingly untouched by any of the recombinant enzymes tested. A total of 7 Hyp residues could be identified as target substrates of the IgA1 peptide, indicating that only 70% of prolines are oxidized by these enzymes. Lastly, Nb-P4H activity was probed with HEK293-cell produced IgA1 substrates as well, however, no conversion of proline to hydroxyproline could be detected (data not shown) possibly caused by different folding or the occupancy of the nearby O-glycosylation sites.Using the IgA1 peptide, Ktrometry , 3, 4. Atrometry . At firscificity . Each enferences . The MS Nb-P4H1 and Nb-P4H10 RNAi silencing constructs for co-infiltration with IgA1 expression vectors in N. benthamiana. The used RNAi construct is based on a design that we successfully used previously in stable or transient silencing approaches and gives good expression 2 to 3 days after infiltration and Nb-P4H10 (Km = 66 \u03bcM) have the highest affinity to bind to the IgA1 hinge region peptide, which is in agreement with the overexpression results.Our selected method to evaluate P4H activity was LC-ESI-MS. Prolyl 4-hydroxylation is clearly detectable by searching the MS spectra for additional peaks with the mass increment of 16 Da. Four synthetically produced peptides, two from human proteins of biomedical interest and two from plant proteins were used as substrate for the recombinant enzymes. Differences in substrate preferences were observed, but in general all 4 enzymes were active on all four substrates with the exception of Nb-P4H4 on human erythropoietin peptide. Moreover, LC-ESI-MS/MS also revealed remarkable differences in the order of hydroxylation of different proline residues within a substrate. Eventually, although in different progression, all recombinant Nb-P4Hs oxidized the same target sequences on our substrates, showing no differences in specificity. Human IgA1 peptide was used as substrate for developing a new method to obtain the Michaelis-Menten constants and values of the reactions\u2019 maximum velocity. These values didn\u2019t show greater differences between the different rthologs . Based oL-proline was accepted as a general substrate . Our finN. benthamiana leaves, some candidates seemed to act on the IgA1 proline-rich peptide more, therefore silencing constructs were developed for transient co-expression with glycoproteins. Using this approach, the quantity of Hyp residues and the attached pentoses on the plant produced recombinant IgA1 were perceivably reduced. Pentoses, presumably arabinoses .Publicly available datasets were analyzed in this study. This data can be found here: RM was involved in most experiments, analysis, and interpretation of the data as well as drafting the manuscript. KG planned and executed plant expression and silencing experiments. DS did the enzyme kinetic experiments. DM provided insights and help with mass spectrometry and data quantification. FA and RS conceived and supervised the work. All authors have revised and approved the final version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."} +{"text": "Successful drug discovery is ultimately contingent on the availability of workable, relevant, predictive model systems. Conversely, for cardiac muscle, the lack of human preclinical models to inform target validation and compound development has likely contributed to the perennial problem of clinical trial failures, despite encouraging non-human results. By contrast, human cardiomyocytes produced from pluripotent stem cell models have recently been applied to safety pharmacology, phenotypic screening, target validation and high-throughput assays, facilitating cardiac drug discovery. Here, we review the impact of human pluripotent stem cell models in cardiac drug discovery, discussing the range of applications, readouts, and disease models employed, along with the challenges and prospects to advance this fruitful mode of research further. Ischemic heart disease remains, within this, the preponderant form2. From 2007 through 2017, the age-adjusted death rates from ischemic heart disease fell 9.7%, which is gratifying progress, yet to focus on this one metric would be quite misleading. Indeed, during this same period, the actual number of deaths from ischemic heart disease increased 22.3%, and years of life lost increased to the same degree2. Similar concerns arise from the adverse trends in \u201cdisability-adjusted life-years,\u201d a measure of healthy life expectancy1. In short, progress in allaying ischemic heart disease is stymied, at the epidemiological level, and the burden\u2014to patients, their families, care-givers, and health care systems\u2014remains stupefying. The pandemic continues, unabated.Notwithstanding decades of aggressive risk factor reduction, as well as transforming health care delivery systems to restore coronary flow urgently in myocardial infarction, the prevalence of heart disease remains predominant\u2014wholly unchanged in rank as the single leading cause of death and disability for both men and women worldwide4. From 2011 to 2019, the US Food and Drug Administration approved nearly 90 novel drugs for cancer but, astoundingly, a mere four that target cardiac muscle directly In this context, far from subsiding, the need remains paramount for novel, transformative therapies to mitigate heart muscle cell death and dysfunction. However, as measured by the number of new cardiac drugs that enter clinical practice, making innovation workable has shown dismaying lack of success15. But, there is a disturbing paucity even of new cardiac drug candidates put forward into early phase development, i.e., the number of New Molecular Entity (NME) applications seeking to initiate human trials3. In short, both ends of the cardiac drug pipeline are dry.Many drugs fail to reach approval for reasons of efficacy, and in the realm of cardioprotection\u2014seeking to rescue jeopardized human heart muscle beyond the benefits of reperfusion alone\u2014such failures have been rife. Time and again, proposed counter-measures, some with highly credible support from whole-animal studies of myocardial infarction, failed to show the anticipated efficacy16. The net result is, consequently, few novel \u201cfirst-in-class\u201d therapies. Expert think tank recommendations have focused on the trials eco-system but, appropriately, also call for strengthening \u201cnovel scientific methods to further define the pathophysiology\u201d3.What are the barriers to trying more often, more effectively? Which, if any, might be remediable? Among the myriad obstacles most cited are: the drug development costs to bring a new agent to market; regulatory uncertainties; discrepancies in philanthropy and research grant support; the lack of appealing biological targets; commercial viability; the length, size, and complexity of trials required; risks of reliance on surrogate endpoints; and, of course, poor return on investment, given the frequency and cost of clinical failures17. The abysmal track record for cardiac drug development speaks for itself. Drawing again on oncology as an instructive comparison, cancer drugs enter human trials having first, at a very early stage, been vetted in dozens to hundreds of well-characterized human cancer cell lines, available as turnkey resources in laboratories worldwide19. Highlighted by the National Cancer Institute\u2019s pioneering 60 human tumor cell line screen20 and by later, larger initiatives including the Cancer Cell Line Encyclopedia22, the role played by human cancer cells in cancer drug discovery is central, essential, and incontrovertible. In contrast, human heart muscle has never been available for equivalent proof-of-concept studies, other than sporadically\u2014through biopsies and explanted hearts\u2014never the routinized, scalable, renewable resource required for library screening, systematic compound development, and pull-through to translation. Apart from this want of starting material, even short-term expansion of adult human cardiomyocytes in primary culture is thwarted by the terminally differentiated myocytes\u2019 characteristic state of growth arrest.One key driver of failure in human cardiac trials is, likely, the recurring lack of systematic human preclinical data for target validation and compound development, i.e., a gap in the information available to de-risk the proposition before ever entering human trials. Model organisms, ranging from the traditional to bespoke genetic lines, are instructive, to be sure, but have, in the aggregate, failed thus far to show sufficient predictive power for efficient translation of targets and drugs to benefit human health32 are made instead from adult somatic cells reprogrammed with ESC transcription factors36, augmented or replaced by chemical reprogramming. Compared to hESCs, hiPSCs have similarly well-proven cardiogenic potential34 but pose fewer ethical or religious concerns, and make possible the interrogation of patient-specific genetic variants37, in addition to modeling the pandemic forms of acquired heart disease that have greatest public health significance. Here, except if otherwise noted, we refer to hPSCs, for ESCs and iPSCs collectively.By contrast, human cardiac muscle cells made in limitless quantities from human pluripotent stem cells (hPSC-CMs) now provide unprecedented access to \u201cheart disease in a dish,\u201d with encouraging potential to accelerate the present tepid pace of cardiac drug discovery32 Fig. . Culture38. In the USA, roughly one in seven approved compounds is later withdrawn from clinical use, 28% of these for adverse cardiac events, including potential lethal arrhythmias, muscle cell death, and heart failure39. Using microelectrode arrays (MEA), pioneering studies by Hoffman La-Roche40, GlaxoSmithKline41 and Johnson and Johnson42 profiled 10 to 30 compounds, for their pro-arrhythmic effects in hPSC-CMs. All three surveys concluded that the relevant pharmacology was captured in these human cardiomyocyte assays, with obvious inherent advantages over non-cardiac cells that are engineered to express a single human cardiac ion channel such as hERG (substrate for the ventricular arrhythmia Torsade de Pointes [TdP]). The hPSC-CMs enabled very high accuracy over the relevant range of concentrations, compared to standard lower throughput, higher cost ex vivo methods . Indeed, hPSC-CMs were superior to the routine preclinical models for detecting some key parameters of risk, such as effects on repolarization akin to human QTc prolongation41.Historically, the unmet scientific need to consider hPSC-CMs in the context of drug development begins with safety pharmacology: namely, the failure of conventional animal models to predict drug toxicities43. Explicitly, hPSC-CMs are viewed as \u201cmore complete \u2018biological integrators\u2019 that detect not only complex effects of drugs on multiple cardiac currents, but also modulatory effects on currents elicited through signaling pathways, channel-associated subunits, altered intracellular calcium handling, additional transporters and exchangers, and potential changes in channel densities in myocytes\u201d25. The potential utility of hPSC-CMs to predict drug-induced proarrhythmic effects was demonstrated most conclusively in a blinded, international, 10-site study of 28 drugs, using two commercially available lines and diverse electrophysiological platforms including MEAs and voltage-sensing potentiometric dyes32. The test compounds were first categorized by degree of known clinical risk for TdP, then were analyzed in blinded fashion for the prevalence of drug-induced repolarization abnormalities and arrhythmia-like events. These data, from 15 cell type\u2009\u00d7\u2009platform combinations, were then used to a construct a predictive model of TdP risk. Significant predictors in the hPSC-CMs were: arrhythmia-like event at any tested concentration, maximum prolongation at any tested concentration, and estimated prolongation at the clinical concentration of drug. These parameters in turn were fed into a composite model of TdP risk, with dichotomous outcomes . The receiver operating characteristic (ROC) area under the curve (AUC) was 0.87, regardless of the cell line used or any local differences in culture method. In short, blinded studies have made it clear that measurements in hPSC-CMs are a highly reliable preclinical classifier of clinical TdP risk. Given such evidence, hiPSC-CMs have gained acceptance by industry and regulatory authorities as predictive of drug safety in humans, at least with respect to arrhythmic risk 45.Building on these encouraging findings, more systematic use of hPSC-CMs has been promoted, together with in silico modeling and other prediction tools, by the Comprehensive In Vitro Proarrhthymia Assessment (CiPA) initiative47 and the CRACK IT InPulse Challenge50. Key lessons from JiCSA, which likewise is focused on arrhythmic risk, have included fidelity of the relationship between MEA-measured field potential duration and interspike interval in hPSC-CMs to the QT-RR relation deduced from clinical electrocardiograms in the Framingham Heart Study46. Human-relevant characteristics included repolarization delay at slow beating rates, reverse use-dependency, categorical analyses as potential indices of risk, and a threshold field potential duration that predicts early afterdepolarizations (EADs) and triggered activity, useful as a potential marker of risk for the onset of human Torsade de pointes46. A subsequent large-scale validation study of 60 compounds\u2019 torsadogenic risk markedly expanded the conclusions available from CiPA32, though not yet in blinded fashion. Findings were highly concordant in iCell and Cor.4U hPSC-CMs47, despite the lines\u2019 differences in ion channel and membrane transporter expression 51.Two further initiatives with hPSC-CMs for safety pharmacology are the Japan iPS Cardiac Safety Assessment (JiCSA)50. This project\u2019s discoveries include a synthetic polymer that promotes the maturity of hPSC-CMs (a co-polymer of isobornyl methacrylate and tert-butylamino-ethyl methacrylate), identified using combinatorial subtrate material microarrays48, novel open-source tools for quantifying cardiomyocyte contraction49, and proof that driving contractile work in hPSC-CMs induces mitochondrial biogenesis and recapitulates the normal post-natal shift to fatty acid oxidation 50.The InPulse academic-industry consortium, by contrast, has emphasized developing a robust in vitro platform to monitor cardiac contractility, with cells that are phenotypically mature54. Readily applicable assays include biochemical readouts , microscopy , and video imaging to assess contractility (edge detection or deformation maps). As was done for arrhythmic risk, these quantitative parameters of toxicity can be integrated as a composite cardiac safety index54. Interestingly, interpatient variations in heart tissue transcriptomics were largely recapitulated in patient-specific hPSC-CMs, including the NRF2-PPARGC1A pathway controlling oxidative stress, and correlated well with the patient-derived cells\u2019 functional difference in cardiotoxic responses31. In a related study, patient-specific hPSC-CMs reproduced the patients\u2019 respective vulnerability to trastuzumab55. More recently, a network-level comparison of cardiotoxicity in hPSC-CMs used RNA sequencing to distinguish differences in the pathways engaged by anthracyclines versus tyrosine kinase inhibitors56. Here, the principal finding was the categorically different transcriptomic signatures evoked by these anti-cancer agents in human cardiomyocytes. Specifically, whereas doxorubicin (DOX) induces pathways that initiate DNA damage, tyrosine kinase inhibitors disrupt mitochondrial energetics even at non-lethal concentrations, downregulating oxidative phosphorylation and upregulating glycolysis56, metabolic reprogramming that is a common feature of hypertrophied and failing hearts57. In agreement with DNA damage as the main target for DOX, genome editing to delete topoisomerase-II beta (TOP2B) markedly reduced the vulnerability of hPSC-CMs to DOX-induced DNA double strand breaks and cell death 53.Other cardinal features of potential cardiotoxicity\u2014notably, myocyte loss and ensuing heart failure\u2014are likewise amenable to profiling in hPSC-CMs, with the cardiotoxicity of anti-cancer drugs being an especially robust area of investigation58. By this means, cardiotoxicity was virtually abolished in hPSC-CMs58, and a Phase 1 clinical dose-escalation study confirmed the improvements expected on the basis of the pioneering human preclinical results59. No cardiac adverse events occurred in patients receiving this form of DOX alone, and the toxicity of combination therapy along with trastuzumab also was reduced59. Thus, human proof-of-principle was substantiated in hPSC-CMs , in advance of progression into human trials. Analogously, the cardiotoxicity of trastuzumab was found to be associated with defective energy metabolism in hPSC-CMs and was ameliorated by treatment with activators of AMP-activated protein kinase55, suggesting the potential for cardioprotection in this context by a current approved drug.As a potential step change beyond just safety assessment and risk prediction, might hPSC-CMs also be useful as human preclinical proof of efficacy, to guide and inform experimental therapeutics? In one early study of this kind, investigators sought to mitigate the known cardiotoxicity of DOX, a mainstay of cancer chemotherapy, as mentioned, targeting DOX selectively to breast cancer using liposomes conjugated with antibody against human epidermal growth factor receptor 2 (HER2)KCNH2 that disrupt intracellular trafficking of the hERG potassium channel Kv11.1 (LQT2). Lumacaftor (the protein chaperone VX-809) was evaluated in patient-specific hPSC-CMs, and shown to shorten the cell culture equivalent of QTc, as measured with multi-electrode arrays. This benefit was achieved solely in patients with Class 2 mutations (which affect channel trafficking) but not in patients with Class 1 mutations (which affect channel synthesis)60. A clinically approved drug, Orkambi, combines Lumacaftor and Ivacaftor (a CFTR potentiator), rescues the analogous defect in patients with a homozygous CFTR-F508del mutation, and was taken forward into two patients with Class 2 mutations of LQT2, shortening QTc in both, as had been hypothesized61. Concomitantly, however, this landmark first-in-human study also acknowledged several \u201cdifferences between the cellular model and clinical reality,\u201d which provide instructive caveats, including the magnitude of rescue achieved (much greater in hPSC-CMs than in the clinic) and expression of hERG (higher in hPSC-CMs than in native adult CMs) 61.A further success in translational relevance is the progress made using hPSC-CMs for drug repurposing, in particular thus far where based on the cells\u2019 fidelity to clinical phenotypes in certain hereditary heart disorders. This progress is perhaps most notable for personalized treatment of channelopathies such as long QT syndrome due to mutations in 62. Antiviral drugs including interferon-\u03b21 and ribavirin were shown to suppress virus production. In addition, mechanistic insights were captured in this human cardiomyocyte milieu: by microarray profiling, interferon-\u03b21 was shown to activate a network of downstream anti-viral genes including EIF2AK2, encoding protein kinase R, an inhibitor of viral mRNA translation 62.What about cardiac drug development, more broadly than just reformulation or repurposing? Miniaturization of phenotypic assays to a 384-well format makes it possible to implement high-throughput chemical or genetic screens (HTS) for target validation and drug discovery, more rooted in human cardiac biology than has been possible heretofore. In an early example of tool-building toward high-throughput studies, hPSC-CMs were implemented to model myocarditis due to coxsackievirus B3, using CVB3-luciferase as an easy bioluminescent readout of virus proliferation63. Its induction is triggered in hPSC-CMs by endothelin-1, much as in non-human models of pathological hypertrophy, and its detection by ELISA or high-content imaging can be multiplexed with other parameters such as increased cardiomyocyte size64. In an early pilot phenotypic screen, hPSC-CMs were provoked at a saturating concentration of endothelin-1, and were treated in quadruplicate at 10 concentrations with candidate inhibitors including the calcium channel blocker verapamil, a PI3K-mTOR inhibitor, BEZ-235, and a broad-spectrum histone deacetylase inhibitor64. A design feature worth noting was the use of serum-free fatty acid-supplemented media, to accelerate cardiomyocyte maturation64. More fundamentally, these experiments demonstrated that inhibitor profiling in this human platform was robust and workable at scale.For cardiac muscle hypertrophy, one readily assayable readout is the induction of brain natriuretic peptide, a highly dynamic protein with especially strong diagnostic and prognostic significance in the clinical setting15. While specific shortcomings in trial design or implementation are sometimes culpable, what these failed trials have in common uniformly is that none was based on proof of efficacy in human preclinical studies, before proceeding into the clinic. The use of hPSC-CMs toward drug discovery for cardioprotection was championed in our recent study creating novel inhibitors of the stress-activated kinase MAP4K4 (mitogen-activated protein kinase kinase kinase kinase-4)65, an upstream member of the MAPK superfamily with connections to Jun N-terminal kinase67 and NFkB68, as well as to several non-canonical effectors as substrates70. The scientific case for MAP4K4 as a druggable target in heart muscle cell death began with human tissue characterization, finding that myocardial MAP4K4 was activated in end-stage heart failure regardless of cause . MAP4K4 was likewise activated in a range of disease models in adult mouse myocardium and cultured rat cardiomyocytes, including ischemia/reperfusion injury and H2O2 as a surrogate oxidative stress. The causal role of MAP4K4 suggested by these observations was then corroborated using transgenic over-expression in mice, plus gain-of-function mutations, dominant-negative mutations, and gene silencing in rodent cardiomyocytes. Yet, even collectively, these methods\u2014typical of the toolkit for academic target validation\u2014leave altogether unanswered the question of whether MAP4K4 is a mechanistically sound therapeutic target in human heart muscle cell death.Many logical targets have failed in clinical trials for heart disease, perhaps especially those aiming to enhance cardiac muscle cell survival after myocardial infarction65. Throughout, several high-throughput platforms were utilized, including automated microscopy , ATP generation, and cardiac troponin release. Protection was conferred in three wholly independent human cardiomyocyte lines, suggesting not only the reliability of hPSC-CMs as a model but also the unvarying dependence on MAP4K4 in the tested forms of cardiac cell death. Beyond these key readouts of viability, protective effects of inhibiting MAP4K4 were also proven under sublethal stress, using the Seahorse extracellular flux (XF) method to study mitochondrial function and FLIPR assays to measure calcium cycling. Cardiomyocyte viability and function (auxotonic force) were even preserved in human 3D engineered heart tissue65, a model with further maturity of structure and physiological properties71. Importantly, the pathway and compounds developed in hPSC-CMs were substantiated further by proof-of-concept studies in mice, with the MAP4K4 inhibitor reducing infarct size by more than 55% in blinded studies, even given an hour after injury65. These MAP4K4 studies demonstrate the pivotal role played by hPSC-CMs in validating a suspected target by gene silencing, then building a small-molecule program upon efficacy proven in this human platform.Consequently, using hPSC-CMs as a human platform for target validation and proof-of-concept studies, the requirement for MAP4K4 in human cardiac cell death was affirmed by gene silencing, giving uniquely direct impetus to a small-molecule discovery program73) but not by inhibiting p38 MAPK (as was ultimately true in SOLSTICE14).Will treatments devised in human models be more likely to succeed than prior ones, upon eventual testing in the clinic? This overall hypothesis\u2014the crux of using hPSC-CMs as a model in drug discovery\u2014will require a decade or more to resolve empirically, as exemplars of this class progress into human trials. However, it is tantalizing to apply the \u201cretrospectoscope\u201d: examining the outcome, in human cardiomyocytes, of manipulating pathways whose success or failure is already known in reducing infarct size. Indeed, from this perspective, the potential predictive value of studies in hPSC-CMs is suggested by finding that human cardiac muscle cell death can be suppressed experimentally by \u03b2-adrenergic blockade , then were subjected to glucose excess, plus endothelin-1 and cortisol77, mimicking the systemic environment. The combined effect was marked induction of brain natriuretic peptide (BNP), other molecular markers of cardiac hypertrophy, and myocyte enlargement itself. Functional abnormalities included less frequent Ca2+ transients, decreased beat amplitude, and increased beat irregularity. Lipid accumulation and peroxidation were other associated findings. The cardiomyopathic phenotype was captured, too, in cardiomyocytes derived from diabetic patient-specific iPSCs, even in the absence of the diabetic milieu 77.The power of hPSC-CMs for drug discovery to alleviate heart failure was demonstrated in two studies using patient-specific iPSCs to model diabetic cardiomyopathy77. These compounds encompassed diverse modes of action, including regulators of Ca2+ homeostasis , Na+ and K+ channel blockers, phosphodiesterase inhibitors, and multiple protein kinase inhibitors . From this screen, in turn, compounds were found that rescued the reduction of Ca2+ transients in cardiomyocytes subjected to the diabetic milieu and improved the phenotype of cardiomyocytes from diabetic patients. Analogous improvement of diabetic phenotypes in hPSC-CMs were elicited by empagliflozin, an inhibitor of sodium-glucose co-transporters that are upregulated in diabetes, possibly explaining the unexpectedly improved cardiovascular mortality in trials of this compound for glycemic control78. Together, these findings support the utility of hPSC-CMs as models not merely for simple monogenic disorders, on the one hand, and for wild-type cardiomyocytes\u2019 responses to lethal stress, on the other, but even for diabetic cardiomyopathy, a highly complex polygenic disease.This model was then used as a phenotypic drug screening platform, determining the success of a therapeutic compound as monitored by BNP production, nuclear area, and sarcomere organization (\u03b1-actinin staining). From a library of 480 compounds, 47 were identified that improved all three of these disease parameters80, Recently, though, advances in understanding the fundamental biology of cardiac growth arrest have pointed to greater plasticity that was formerly evocable, with significant potential for restarting the cardiac cell cycle therapeutically, at least in model organisms82. Might induced proliferation as a route to heart repair also be amenable to exploration or triage in hPSC-CMs? As one starting point, functional screening of more than 10,000 hPSC-CM organoids was undertaken to optimize diverse aspects of the culture milieu, resulting in enhanced maturation and recapitulation of the adult heart\u2019s notorious resistance to cell cycling, driven by a shift to fatty acid oxidation83. Conversely, this successful model of implementing cardiac cell cycle arrest in hPSC-CMs was then subjected to a functional screen of 105 small molecules, resulting in the identification of novel cell cycle activators, working through the mevalonate pathway84. Thus, notwithstanding the potential immaturity of pluripotent cell-derived myocytes with respect to cell cycle control, a post-mitotic phenotype could be imposed experimentally, and means to override it discovered.Ultimately, myocardial infarction can be viewed as a \u201cmyocyte-deficiency disease\u201d whose phenotype is determined not just by the extent of myocyte death but also by the lack of functionally significant restorative growth. Indeed, the plausible clinical benefits of hPSC-CMs very clearly include therapeutic grafting, as cell therapy74\u2014accessible, scalable, faithful by a large number of clinically relevant parameters, amenable to genetic engineering, amenable to tissue engineering, able to capture patient variations, predictive of clinical success at least retrospectively, and predictive prospectively at least of success in whole-animal studies 51. As a consequence, some pharmacological and pathobiological responses can be deficient or anomalous. In some reports, hPSC-CMs do not mirror the TdP risk of drugs with late sodium current effects, like ranolazine32, and hiPSC-CMs were less sensitive to hypoxia/reoxygenation than to other death signals97. Such disparities must be taken into account, whether inherent short-comings or idiosyncratic.How might the predictive power of hPSC-CMs be augmented or ensured? Despite the predictive power shown even with routine 2D models, it is clear that existing lines\u2014or, more accurately, their current embodiment in tissue culture\u2014do not suffice to model all possible phenotypes of concern. The many acknowledged shortcomings, which have been mitigated to date only partially, include morphology , molecular profile (weak expression of maturation-associated genes and splicing isoforms), metabolism , contractility (lower maximum contractile force), and electrophysiology 86, thyroid hormone87, and inhibition of mTOR88. In another approach, transduction of the defectively expressed gene KCNJ2 has been applied to rescue the channel levels and promote aspects of fidelity directly98. More generally, however, the procedures of most proven value to enhance the maturity of hPSC-CMs include the use of 3D human engineered heart tissue (EHT), mechanical or electrical conditioning, and heart-on-chip technologies, advances discussed at length elsewhere95. The tissue engineering solutions to create more heart-like phenotypes in hPSC-CMs range in complexity from micropatterned 2D substrates to scaffolds, organoids, microfluidics, 3D bioprinting, and even the construction of hollow spheres. Apart from just geometry, key elements of these tissue engineering strategies notably include cyclic electrical or mechanical stimulation. Incorporation of other cell types can promote maturity or function, as well as the microvascularization required for oxygen delivery at larger scale than mere diffusion can confer. Indeed, 3D spheroids composed of hPSC-CMs plus hPDSC-derived endothelial cells showed progressive changes in gene expression typical of post-natal development99. Analogously, 3D culture of hPSC-CMs as engineered heart tissue in concert with cardiac fibroblasts, combined with long-term electrical stimulation, enables the development of physiological responses that are absent from the cardiomyocytes cultured routinely100. The reported adult-like properties included a positive force-frequency relationship, postrest potentiation of force, and inotropic beta-adrenergic responses to isoproterenol and dobutamine, as well as other compounds and pathways tested 100.Efforts to enhance (further) the stem cell-derived myocytes\u2019 predictive value center on manipulating chamber and cell sub-type specificity on the one hand, and on improving structural and functional maturity on the other. Purely pharmacological efforts at enhancing maturation in routine 2D culture include fatty acids104, even these simple advances are not yet exploited uniformly. Ultimately, it is plausible that the drivers of standardization will include the emergence of consensus best practice solutions, but also adherence within the scientific community to procedures validated by multi-site initiatives such as CiPA, JiCSA, and InPulse, functioning as exemplars.Although these collective efforts should be viewed with enthusiasm, progress toward standardization is confounded by the diversity of available hPSC lines, stem cell and differentiation media, physical substrata, timing, purification methods, presence or absence of serum, cell density , the heterogenous mixtures of cell types , and even lot-to-lot variation in ostensibly standardized cells. However, though procedures exist for the selective production of ventricular myocytes versus atrial myocytes or conduction system cellsALDH2 that predominates in East Asians and renders the carriers\u2019 myocytes much more vulnerable to ischemic heart damage105. Analogously, screening a single commercial line failed to capture the known cardiotoxicity of rosiglitazone, an anti-diabetic drug that enhances PPAR\u03b3 activity but can exacerbate heart failure106. Indeed, marked inter-patient variation was later found in the response of hPSC-CMs to rosiglitazone, including adverse effects on reactive oxygen and nitrogen species, associated with divergent transcriptomic signatures that relate to NRF2-mediated oxidative stress31. A third demographic axis, aging, may be resistant to capture in hPSC-derived models, given the rejuvenation signature imparted by reprogramming to a primitive, pluripotent state; this aspect might be addressable using directly induced cardiomyocytes, instead108, for which a precedent is the success using forward programming to model age-related neurodegeneration109. Much like trials in the real world, clinical trials in a dish may need to take patient recruitment into account\u2014along with their choices of compound, regimen, and readout\u2014in developing robust new counter-measures to combat human heart disease.A complementary approach\u2014obvious once the issue is raised\u2014is also to improve the breadth of human cardiomyocytes surveyed, including but not limited to demographic features like gender and ethnic background. To illustrate, genetic determinants of susceptibility include a polymorphism in"} +{"text": "From the time the notion \u201cembodied cognition\u201d has entered the field, researchers have been concerned about its meaning. Does the term refer to a coherent theoretical framework? Despite these concerns, use of the term \u201cembodied cognition\u201d has increased over the years to plateau in recent years. I will argue that the best way forward is not to search for evidence for or against some vague label but rather to systematically, in large-scale projects, address a series of questions that focus on well-defined cognitive tasks. Such projects ought involve preregistration, replication, and open materials, code, and data. For this enterprise to take off, it is important that incentives in the field be aligned with the goal to increase the reliability and validity of our research. There is reason to be optimistic that such an alignment will occur in the near future. Figure 1 is an informal analysis of the use of the term \u201cembodied cognition\u201d in the scientific literature during this period. The search was performed in the Scopus and Web of Science databases for the period bookended by the years 2001 and 2020. The Scopus search was restricted to the title, abstracts, and keywords of a given paper with the search string PUBYEAR > 2000 TITLE-ABS-KEY (\u201cembodied cognition\u201d). In Web of Science I used the following settings: ALL FIELDS: (\u201cembodied cognition\u201d) ANDDOCUMENT TYPES: (Article) Indexes=SCI-EXPANDED, SSCI, A&HCI, CPCI-S, CPCI-SSH, ESCI Timespan=2001\u20132020).The notion of \u201cembodied cognition\u201d has become commonplace in psychology over the past two decades. This analysis was performed on January 29, 2021. The left-hand panels show a very rapid increase in the number of mentions of \u201cembodied cognition\u201d and a leveling off in recent years.An obvious concern about this analysis is that it does not correct for the growth of the literature in general. If the literature grows, then it stands to reason that the number of papers on embodied cognition grows as well. The right-hand panels reflect an attempt to correct for the growth of the literature by calculating the percentage of \u201cembodied cognition\u201d papers out of the total number of \u201ccognition\u201d papers . Again, an initial increase in the number of \u201cembodied cognition\u201d papers is shown, followed by a leveling off in recent years.There are a few other caveats to this analysis. First, the records for 2020 are likely not complete yet, which means the actual number of hits for that year might be higher than what is represented in the figure, which would primarily be reflected in the absolute number of mentions in the left-hand panels. Second, the analysis only uses the search term \u201cembodied cognition\u201d and therefore misses studies on the topic that do not use this precise term. Third, as \u201cembodied cognition\u201d becomes more common, it might become less useful to certain researchers, as it has become less distinctive. Fourth, it could be that use of the term \u201cembodied cognition\u201d has spread from some areas to others, for example from more fundamental fields to more applied ones . A more fine-grained bibliometric analysis might uncover such a distribution over time.definitional challenge and the methodological challenge, the latter of which overlaps with one of the challenges discussed by Ostarek and Huettig, although their focus differs from mine. I also propose ways in which these challenges can be met and point out that there are reasons to be optimistic about the success of this endeavor.These caveats notwithstanding, there are as yet no (bibliometric) signs the interest in \u201cembodied cognition\u201d is waning. This makes it all the more relevant to address challenges facing research that occurs under the rubric of \u201cembodied cognition.\u201d Recently, Ostarek and Huettig discusseEven though I used \u201cembodied cognition\u201d as part of a search string, it is legitimate to wonder what is actually meant by \u201cembodied cognition.\u201d One might even wonder, what is \u201cembodied\u201d and what is \u201ccognition\u201d? Under the rubric of embodied cognition, we can find research inspired by theories that originated in the 1980s and 1990s, such as linguistic theories about the role of metaphors in language and cognition , neuroscIt is not my goal here to review these theories or the associated empirical studies. I merely want to point out that when one looks under the hood of \u201cembodied cognition,\u201d what one finds is not a purring scientific engine. Rather, what unfolds itself before our eyes is a large collection of parts, many of which do not seem to be interconnected, and a good many of which may not even belong in the vehicle in question. That \u201cembodied cognition\u201d is anything but a coherent field, is not an original observation. An early review article on the topic is titled \u201cSix views of embodied cognition\u201d . The autTo bring about such a change, it is useful to first consider how we arrived at this situation. Setting aside intra-scientific issues for the moment, we must consider what I will call para-scientific issues. A key para-scientific issue is that there is systemic pressure on researchers to frame their research in the most general terms. This is true for communications to grant review panels, in which researchers are told they have to make a convincing case to a panel with a broad set of interests, or even to society at large, and scientific journals, which ask authors to provide \u201chighlights\u201d of their articles. It is also true for communications to university press offices or the press itself, which cares mostly about attracting readers or at least clicks. And of course it is also true for authors who wish to publish in the most prestigious (though not necessarily the most rigorous) journals. They know that, to avoid the dreaded editorial buzz kill that \u201cyour article is more suited to a specialty journal,\u201d they have to frame their studies in the broadest manner possible. This systemic pressure might explain why the term \u201cembodied cognition\u201d is featured so prominently in many articles that do not seem to have a common theoretical framework and why as a search term it still retrieves a considerable number of research articles each year.It is perhaps no exaggeration to state that the field of cognitive psychology has made the most progress when researchers study relatively well-specified tasks, such as visual search, spoken word recognition recognition, anaphoric resolution, episodic memory retrieval, syllogistic reasoning, mental arithmetic, text recall, and so on. Embodied cognition is not a task, nor can it even be considered to be a field. It is best thought of as a diverse collection of studies and theories in various fields on which the same label is slapped.I will limit myself to the field of language processing here, for two reasons. First, it is the area I am the most familiar with. Second, if even in this subdomain of cognitive psychology there does exist a unified theoretical framework of \u201cembodied language processing,\u201d this does not bode well for the field of cognition in general. As such, it is a useful testcase.Some studies in embodied language processing are motivated by conceptual metaphor theory, others by perceptual symbol theory, and yet others under mirror neuron theory, just to focus on the most prominent ones. It does, therefore, not make sense to ask: \u201cis language processing embodied?\u201d in a general sense. After all, what is meant by \u201cembodied\u201d and, now that we\u2019re asking, what is meant by \u201clanguage processing\u201d? Does a finding that applies to words also apply to sentences and connected text? And can we extrapolate from a lab experiment across communicative situations? I wrote about communicative situations and the degree to which they are embedded in the environment and how this might have implications for the use of perceptual symbols before and willA key question concerning the level of linguistic analysis is: to what extent can findings obtained with regard to one level of analysis be extrapolated to other levels? In what follows, I only provide abstract examples. I am fully aware that there is a vast literature that may be or appear to be relevant to the issues I am addressing but, as I already mentioned, this article is not intended as a review of that literature and mentioning specific findings would only detract from the points I am trying to make.Suppose one obtains evidence that the visual presentation of action words is reliably associated with corresponding brain activation of the motor system. Suppose even that studies find that processing the word is impeded by concurrent activation for the (pre)motor cortex . Suppose further that item analyses show the effect generalizes across verbs. Can we now safely conclude that motor activation occurs during language processing?We cannot. The first obvious objection is that we cannot generalize across languages from a study in a single language, but my focus here is on the simple fact that words rarely occur in isolation . Thus, the role of the motor system could be an artifact of the fact that the word is presented without context. Perhaps participants, upon reading or hearing the word, interpret it as a command: \u201cpinch\u201d which then primes them for the action.Furthermore, even if (1) such action verbs were shown to reliably involve the motor system across contexts and languages and (2) inhibition or stimulation of areas in the motor system corresponding to the actions denoted by the verbs affects the processing of these verbs, then it is still difficult to maintain that the motor system is centrally involved in language comprehension. Suppose we are interested in the comprehension of simple narratives, a reasonably well-specified real-world task on which there exists a great deal of research. If one considers the distribution of simple action verbs in a corpus of narratives or expository texts, one would find that they are rarely of central importance to the story. Most texts are not about simple actions such as picking and kicking. Even children\u2019s stories are about more abstract topics. \u201cThe Ugly Little Duckling,\u201d for example, is about social exclusion and personal transformation rather than about swimming, quacking, and flapping one\u2019s wings.stir, knead, chop, whisk) or manuals for household implements. It is difficult to envision what motor action would be relevant to slightly more complex actions that are described in a such as ordering a beer, paying a bill, or parking a car, let alone such complex actions as building a house, driving to Spain, or baking a cake, or abstract actions such as developing a theory or pondering the meaning of life , the type or genre , the language and the task at hand and use these to define as best as possible the constraints on generalizability of our findings . To be sThe second challenge I want to address concerns methodology, and more specifically the reliability of results and the validity of measures. So far in this article I have conveniently assumed that all of the findings that have been published under the rubric of \u201cembodied cognition\u201d are reliable and valid. Reality is different, as it no doubt is for most areas in psychology and surrounding fields.Let us first consider reliability, which is the likelihood that a measure consistently produces similar results. It has become clear in recent years that psychology has a replicability problem e.g., . AlthougPerhaps the most-cited empirical cognitive psychological study that falls under the rubric of \u201cembodied cognition\u201d is Glenberg & Kaschak . This stA large group of researchers, admirably spearheaded in part by the authors of the original article, recently performed a direct replication of these findings in a registered report . None ofAnd here we have run up against a limitation of direct replications. One cannot make inferences beyond the paradigm that is being used. When an original finding is replicated, one can say that one has a procedure in hand that reliably produces an effect, which is crucially important . SimilarA measure is valid if the results obtained with it reflect the construct under consideration. Even if a finding is highly reliable, there may still exist questions concerning its validity. It could be that, yes, a procedure reliably produces an effect but that effect is an artifact of the specific method being used; it does not reflect the construct under study or does not do so to a sufficient degree. Suppose, for example, that someone would claim that there is a better way to test the ACE than was done in the original study. Researchers might, for example, claim the task is too indirect and therefore too noisy to find effects. Or researchers might claim that the effect is too short-lived to manifest in a post-comprehension task, which the ACE task might be considered to be.The ACE replication project could fairly be criticized by the observation that it was hamstrung in that all participating labs used the exact same task and stimuli motor activation, a different approach is needed. It requires the use of extensions to the method, which are often called conceptual replications. Such replications would involve a variation on the original experiment. It would, for example, involve an extension to a different task , to different parameters , to a different subject population, to a different set of stimuli, and so on, conceptual rather than direct repplications, in other words.Why not perform exclusively conceptual replications then? Detractors of direct replications have argued for precisely this e.g., . HoweverThe problem with this reasoning is that none or few of the conceptual replications might survive a direct replication . Does thA recent attempt in this direction crowdsourced ways to test a set of existing hypotheses and then performed meta-analyses across the different tests . This isConsider again the question of whether sentence comprehension involves motor activation. Admittedly, the question might need further specification but it suffices for our current expository purposes. A group of labs interested in testing the idea would assemble. Following the approach of Landy et al. , each laSeveral outcomes are possible. At one extreme, all experiments show the predicted effect. This would strongly support the hypothesis. There is a set of paradigms that reliably show the effect. At the other extreme, none of the experiments shows an effect. This would count as very strong evidence against the hypothesis and might be sufficient reason to abandon it altogether. All other outcomes would fall somewhere in the middle. An interesting case would be if a certain category of operationalizations shows the effect while another does not, as this might give rise to further theoretical and empirical work.I started out with a small bibliometric analysis, which suggests that the popularity of the term \u201cembodied cognition,\u201d after an initial sharp rise seems to have leveled off and thus is not on the wane. I noted that this makes it all the more important to address two major challenges that research on embodied cognition faces and I proposed ways to do so. The first challenge is the definitional challenge, which has bedeviled the field from the first time the phrase occurred in the literature . I have argued that there exists systemic pressure on researchers to define their study as broadly as possible but that this works against the need for a precise framing of the scope of the study and the implications of the results. I have pointed to greater precision about the theoretical framework and specifying the constraints on generalizability of the study as ways to overcome this challenge.The second challenge concerns questions about the reliability and generalizability of studies. These questions can and ought to be raised about any area in psychology. Therefore, they are not meant as a criticisms of specific research projects. Rather they reflect an attempt to show how research can benefit from new developments in the field, such as open science, preregistration, and team science.These conclusions point to the biggest challenge of all: to change the cognitive biases and incentives that drive the field. As Munaf\u00f2, Chambers, Collins, Fortunato, and Macleod recentlyCan these incentives be changed? There are reasons to be optimistic . For exahttps://openscience-utrecht.com/code-of-conduct/). To bring about such fundamental changes, it is important that the scientific community finds ways to best conduct team science such that each contributor to a project receives the credit they deserve (e.g., Also important is the push toward transparency in research methods and the use of data repositories, which seems to be gaining strength e.g., . Severalve e.g., .Another relevant development is the movement toward team science, as most clearly exeplified by the Psychological Science Accelerator . In factI started out with a bibliometric analysis of \u201cembodied cognition.\u201d If the large-scale and smaller scale changes that I have described and proposed here take place, it is likely that a bibliometric analysis using that search term conducted one or two decades from now will show decreasing numbers of studies over the years. Far more importantly, we may at that time have obtained a far better understanding of the role of the body in specific cognitive tasks than we currently do."} +{"text": "Jawbone differs from other bones in many aspects, including its developmental origin and the occurrence of jawbone-specific diseases like MRONJ (medication-related osteonecrosis of the jaw). Although there is a strong need, adequate in vitro models of this unique environment are sparse to date. While previous approaches are reliant e.g. on scaffolds or spheroid culture, 3D bioprinting enables free-form fabrication of complex living tissue structures. In the present work, production of human jawbone models was realised via projection-based stereolithography. Constructs were bioprinted containing primary jawbone-derived osteoblasts and vasculature-like channel structures optionally harbouring primary endothelial cells. After 28\u00a0days of cultivation in growth medium or osteogenic medium, expression of cell type-specific markers was confirmed on both the RNA and protein level, while prints maintained their overall structure. Survival of endothelial cells in the printed channels, co-cultured with osteoblasts in medium without supplementation of endothelial growth factors, was demonstrated. Constructs showed not only mineralisation, being one of the characteristics of osteoblasts, but also hinted at differentiation to an osteocyte phenotype. These results indicate the successful biofabrication of an in vitro model of the human jawbone, which presents key features of this special bone entity and hence appears promising for application in jawbone-specific research. Over the past decades, tissue engineering has made astounding progress in developing physiological models of human tissues with ever-growing sophistication and complexity. Particularly 3D bioprinting, the adaptation of 3D printing to the requirements for direct fabrication of living biological constructs, represents one of the latest achievements on the path to more physiological and therefore adequate models of the human body and manufacturing of customised tissue implants.5. This allows for the implementation of vascularisation in fabricated tissue models, which is a mandatory element of tissue structure due to the biological requirement for nutrient and oxygen supply as well as waste product removal8.The emergence of this versatile technology has opened new possibilities for site-specific arrangement of multiple cell types combined with the production of delicate features embedded within structures of any possible geometry12. In contrast to bone grafting, which aims at replacing or restoring functional bone in patients, bone models can be used to generate deeper insights into physiological and pathological processes. They are important for the development of novel therapeutic strategies and for reducing or replacing animal experiments. As an example, in vitro models for bone remodelling and associated disorders like osteoporosis have been previously established, as has been reviewed by Owen and Reilly13. These models naturally are simplified versions of the in vivo situation and therefore mimic only certain aspects.The fabrication of bone-like tissue has been one of the most prominent research fields of tissue engineering in recent years; this is only partly accounted for by the striking clinical relevance15, but they also arise from a distinct germ layer, originating in the neural crest in contrast to other bones emerging from the mesoderm16. In maxillofacial research, there is a strong need for jawbone models resembling key features of this unique bone entity to advance investigation of jawbone-specific diseases like MRONJ, a condition for which molecular details of pathogenesis as well as optimal treatment have yet to be unravelled19.While bone models are constantly being improved, it must be considered that craniofacial bones differ from other bones. Not only, jawbones show a higher turnover compared to other bone entities22. Penolazzi et al. established a three-dimensional co-culture system of osteoclasts and jawbone-derived osteoblasts based on aggregates, using cells from native and necrotic human bone tissue23. Similarly, a scaffold-based system combining alveolar bone and gingival tissue was developed by Almela et al. and employed as a model for oral cancer25. Other human jawbone models are also dependent on devices like scaffolds and microchip technologies28. To our knowledge, there have been no studies so far using 3D bioprinting for direct fabrication of human jawbone models.Models of the human jawbone in healthy and pathological condition are currently sparse, as most of the studies are performed using animal models, raising difficulties in transfer due to interspecies differencesIn the present study, we demonstrate bioprinting of human jawbone models containing primary human jawbone-derived osteoblasts using projection-based stereolithography, which display key characteristics of jawbone. Optionally, fabricated channel structures within the constructs comprised primary endothelial cells to demonstrate the possibility to implement another cell type, potentially generating an even more sophisticated model. Bioprinted constructs were cultivated for 4\u00a0weeks and exhibited mineralisation of the matrix, while also showing expression of osteogenic marker genes and proteins, hinting at osteocyte differentiation.6 cells mL\u22121 were printed and cultivated in growth medium for 28\u00a0days. Utilisation of 6% GelMA resulted in quick and distinct contraction of the hydrogel, while supplementation with PEGDA3400 (0.5% and 1%) led to improved stability and therefore less contraction Fig.\u00a0. For sta.8. To assure biocompatibility of this system, originally established with HUVECs only, with JHOBs used in the present study, monolayer cultures were incubated with hyaluronidase and viability was assessed after 20\u00a0h. Supplementation of medium with hyaluronidase did not affect cell viability of osteoblasts . Runt-related transcription factor (RUNX2) and transcription factor Sp7 are two key regulators of osteogenic differentiation, while Sp7 is acting downstream of RUNX2, which is counted as one of the first osteoblast differentiation markers31. ALPL encodes for the membrane-bound enzyme alkaline phosphatase associated with bone mineralisation by hydrolysing pyrophosphate and providing inorganic phosphate32. Collagen I makes up the vast majority of organic compounds of the bone matrix and is, like ALPL, considered an early bone differentiation marker, with collagen type I alpha 1 chain (COL1A1) being the predominant collagen33. SPARC encodes for the ubiquitously expressed protein osteonectin involved in bone mineralisation, and is regarded as a late differentiation marker26. DMP1 (dentin matrix acidic phosphoprotein 1), one of the SIBLING proteins, is often employed as an early osteocyte marker35.Gene expression of the bioprinted constructs was analysed using quantitative real-time PCR to assess osteogenic differentiation of the printed osteoblasts. Relative mRNA expression was normalised to the housekeeping gene ubiquitin-conjugating enzyme E2 D2 , whereas prints additionally containing HUVECs did not. An upregulation of ALPL expression was observed for all conditions over the course of the experiment, where prints cultivated in osteogenic medium showed slightly lower expression levels compared to their counterparts in growth medium on day 28. COL1A1 and SPARC exhibited similar expression patterns with a slight decrease on day 7 followed by an increase on day 28, again showing slightly reduced expression of osteogenic media samples compared to growth media conditions. COL1A1 was expressed at a high level comparable to the native bone control for all samples, while SPARC mRNA levels differed significantly to the native jawbone control on day 7 for all conditions and on day 28 for osteogenic conditions only . Similar to SP7, expression of DMP1 was only detected after 28\u00a0days of cultivation, independent of the cell type composition and cultivation media, although a signal was detectable only for one of three replicates in each growth media condition.y 7 Fig.\u00a0. DiffereTo check for apoptotic cells, bioprinted jawbone models were cryosectioned and stained for cleaved caspase-3 after 28\u00a0days of cultivation Fig.\u00a0. A few cImmunohistological staining was also performed to confirm osteoblast and endothelial cell marker expression on the protein level and to visualise their localisation Fig.\u00a0. All cel37. In this study, osteocalcin was detected after 28\u00a0days throughout constructs cultivated in osteogenic medium, while no expression was observed in the growth medium conditions. Presence of CD31-positive cells after cultivation for 28\u00a0days was shown in both JHOBs\u2009+\u2009HUVECs conditions, indicating endothelial cell phenotype being supported by osteoblasts. CD31 staining was not exhibited by constructs containing only JHOBs, as anticipated were tested. Addition of PEGDA resulted in enhanced resistance to shrinkage, but seemingly compromised cell spreading at higher concentrations as it was less pronounced in hydrogels consisting of 6% GelMA\u2009+\u20091% PEGDA3400. These findings both point towards increased stiffness of mixed hydrogels44. Da Branco et al. proposed the existence of a certain threshold of matrix stiffness for fibroblasts embedded in alginate/collagen mixtures to be able to spread within and contract the hydrogel42. If such a threshold exists for our system, stiffness of the tested conditions was below this as contraction still occurred to some degree. 6% GelMA\u2009+\u20090.5% PEGDA combined both improved hydrogel stability and support of cell spreading, and was therefore chosen as the bioink for printing jawbone models. Contraction of these models was hardly observable, possibly due to their shape, since simple discs were used for material testing, whereas jawbone models possessed a more complex architecture and a higher aspect ratio , as used in this study, facilitated occurrence of this process. This might be due to the composition of FCS including, amongst other components, proteins acting as calcification factors or featuring an endogenous ALP activity. They also reported earlier detection of mineralisation in cell-laden constructs compared to cell-free hydrogels, coinciding with our observations49.Calcification of the surrounding matrix by osteoblasts is crucial for the generation of hard bone tissue. Here, mineralisation of printed jawbone models cultivated in osteogenic medium was demonstrated, whereas prints cultivated in growth medium did not display any mineralisation. This was already macroscopically observable as a white staining of the prints in osteogenic medium, while the constructs in growth medium remained transparent after 28\u00a0days in culture Fig.\u00a0. Both os52. Its expression in prints cultivated in osteogenic medium was demonstrated by immunohistological staining , thus putatively having only a small impact on overall expression levels. Furthermore, osteoblasts have been shown to present a heterogenous phenotype56. Due to the small sample size, the native bone samples used for quantitative gene expression analysis were not taken from the same donor used for the bioprinting experiments. The three tested donors showed high variability in all osteogenic markers, resembling the natural interindividual differences. As a result, statistically significant differences were only determined for some samples.RNA samples were taken from the whole construct, resulting in measurement of the expression levels of both cell types in conditions containing both JHOBs and HUVECs. Gene expression was normalised to 35. In contrast, they express DMP1, which is considered one of the early osteocyte markers57. Expression of DMP1 was detected only after 28\u00a0days of cultivation in all conditions. In osteogenic medium, all replicates were positive for DMP1, while in growth medium only one replicate in each condition was positive. This points towards differentiation of printed osteoblasts to osteocytes, although expression levels are still low compared to native jawbone. Osteogenic medium promoted this tendency. In addition, the 3D environment itself already seemed to be osteoinductive since DMP1 was also detected for growth medium conditions without osteogenic supplements from porcine skin was dissolved at 10% w/v in phosphate-buffered saline (PBS) and heated to 50\u00a0\u00b0C. Methacrylic anhydride was added dropwise at 0.1\u00a0mL\u00a0g\u22121 gelatine used, reaction was allowed for three hours under stirring and pH was adjusted to 7.4. GelMA was dialysed against distilled water through a 12\u201314\u00a0kDa cut-off membrane for four days to remove remaining salts and methacrylate. Afterwards, GelMA was lyophilised at \u2212 60\u00a0\u00b0C and 1\u00a0mbar before being stored at \u2212 20\u00a0\u00b0C until further usage.Methacrylated gelatine (GelMA) was synthesised as described previously.67 To reduce chain length, hyaluronic acid from Streptococcus equi was autoclaved. Following this, hyaluronic acid (2.5\u00a0g) was dissolved in Milli-Q water (250\u00a0mL) and the solution was adjusted to pH 9.0 with NaOH (1\u00a0N). Methacrylic anhydride (5\u00a0mL) dissolved in dimethyl sulphoxide (5\u00a0mL) was added at 2\u00a0mL\u00a0g\u22121 hyaluronic acid used and reaction was allowed for 24\u00a0h at room temperature under stirring. Following dialysis against Milli-Q water, HAMA was lyophilised and stored at \u2212 20\u00a0\u00b0C until further usage. Methacrylation of synthesised GelMA and HAMA was verified by 1H-NMR using a Bruker Avance III at 500\u00a0MHz .Methacrylated hyaluronic acid (HAMA) was synthesised according to a modified protocol by Poldervaart et al69 and used as photoinitiator for polymerisation. Poly(ethylene glycol) diacrylate was purchased from Alfa Aesar . All synthesis reagents were purchased from Sigma-Aldrich unless stated otherwise.Lithium phenyl-2,4,6-trimethylbenzoyl phosphinate (LAP) was synthesised as described previously55. Briefly, small bone pieces (approximately 8 mm3) of human mandibular jawbone were obtained from healthy donors during surgery and stored in growth medium at 4\u00a0\u00b0C until isolation. Jawbone pieces were rinsed thoroughly with PBS and soft tissue was removed using a scalpel. To reduce the germ load, samples were incubated in Betaisodona iodide solution for 60\u00a0s followed by repeated rinsing with PBS. Bone pieces were put in a 60\u00a0mm tissue culture-treated petri dish covered with growth medium. Cells were expanded upon confluency around the bone pieces and used at passage 5. Human umbilical vein endothelial cells (HUVECs) were cultured in Endothelial Cell Growth Medium 2 and used at passage 3. All consumables were obtained from Corning Inc. unless stated otherwise.Primary jawbone-derived human osteoblasts (JHOBs) were isolated following slightly modified protocols6 cells mL\u22121 into the respective ink directly before printing. Bioprinting was performed using our proprietary stereolithographic printing platform as described previously8. Briefly, hydrogels were precisely solidified by photopolymerisation as photomasks were projected onto the printing dishes, and three-dimensional constructs were built by subsequent illumination of consecutive layers.Three-dimensional models were designed using Rhinoceros 6 and photomasks were generated using the bioprinter\u2019s software. Photoinks were prepared by dissolution and subsequent dilution of the lyophilised material in PBS. To fabricate cell-laden constructs, JHOBs and HUVECs were mixed at 20\u00a0\u00d7\u00a010For material testing, inks were prepared according to Table \u22121 hyaluronidase in growth medium for 260\u00a0min to allow for enzymatical digestion of the printed channel structure and subsequent attachment of released HUVECs to the channel walls, adapted from Thomas et al.8For jawbone models, 1.5% HAMA and 0.05% LAP were used as the channel ink, while the bulk material was printed using 6% GelMA, 0.5% PEGDA3400 and 0.1% LAP. Dimensions of the constructs were 2.6\u00a0mm\u2009\u00d7\u20092.4\u00a0mm\u2009\u00d7\u20091\u00a0mm. After completion of the printing process, constructs were incubated in 150 U mLFor material testing, bioprints were cultivated in growth medium for 28\u00a0days in 24-well ultra-low attachment multiple well plates, while medium was exchanged three times a week.For jawbone models, constructs were cultivated in growth medium or mineralisation medium for up to 28\u00a0days in 24-well ultra-low attachment multiple well plates. Medium was exchanged three times a week.Live imaging was performed throughout the cultivation periods using the BIOREVO BZ-9000 microscope .4 cells cm\u22122 and cultured in growth medium. The next day, medium was switched to growth medium supplemented with 150 U mL\u22121 hyaluronidase, or without as a control . After further 20\u00a0h of cultivation, samples were stained with 5\u00a0\u00b5g\u00a0mL\u22121 Hoechst33342 and 5\u00a0\u00b5g\u00a0mL\u22121 propidium iodide in growth medium for 10\u00a0min at 37\u00a0\u00b0C and 5% CO2. Scans of each well were recorded using the Keyence BZ-9000 microscope, followed by digital stitching and analysis for numbers of Hoechst33342 and propidium iodide positive cells using the BZ-Analyzer II image analysis software .To assess the biocompatibility of the bioprinting system regarding the effect of hyaluronidase on osteoblast cell viability, JHOBs were seeded into 96-well multiple well plates at a cell density of 1.25\u00a0\u00d7\u00a010Printed constructs were washed in PBS, fixated with 4% paraformaldehyde for 15\u00a0min at room temperature, washed in PBS, embedded in Tissue-Tek O.C.T. Compound , and incubated for 35\u00a0min at 37\u00a0\u00b0C. Following shock-freezing in liquid nitrogen, samples were stored at \u2212 80\u00a0\u00b0C until further usage. 10\u00a0\u00b5m sections were produced using the CM1950 cryostat . Immunofluorescence staining was performed to evaluate expression of marker proteins. Following permeabilisation with acetone at \u2212 20\u00a0\u00b0C for 10\u00a0min, samples were washed with PBS three times and blocked with 10% goat serum in PBS for 30\u00a0min at room temperature. Primary antibodies were diluted 1:100 in blocking buffer and incubated over night at 4\u00a0\u00b0C ; mouse anti-collagen I ; mouse anti-vimentin ; and mouse anti-CD31 ). For antibody controls, samples were incubated with blocking buffer only. After washing three times with PBS, samples were incubated with secondary antibodies ) at a dilution of 1:200 in blocking buffer for 45\u00a0min at room temperature, and simultaneously counterstaining with 4\u2032,6-diamidin-2-phenylindol . Slides were washed three times with PBS and mounted using Imsol Mount . Images were taken using the BIOREVO BZ-9000 microscope .To analyse mineralisation of printed constructs, OsteoImage Mineralization Assay was performed according to the manufacturer\u2019s protocol. Samples were sectioned and permeabilised as described above. After 2\u2009\u00d7\u2009washing with PBS and 1\u2009\u00d7\u2009with wash buffer, sections were incubated with staining reagent for 30\u00a0min at room temperature. Slides were washed three times with wash buffer and mounted using Imsol Mount . Images were taken using the BIOREVO BZ-9000 microscope .Relative expression of bone-specific marker genes was assessed by semi-quantitative real-time PCR (see Table 3) were shortly rinsed with PBS and incubated with lysis buffer for 10\u00a0min followed by the usual isolation protocol of the same kit . mRNA was quantified using the NanoDrop 2000c spectrophotometer and cDNA was synthesised using the TaqMan Reverse Transcription kit according to the manufacturer\u2019s protocol. Real-time PCR was performed using the Mx3005P Real-Time PCR system . For this, 10\u00a0\u00b5M of the respective primers, cDNA equivalent to 10\u00a0ng total mRNA and SensiFAST SYBR No-ROX qPCR master mix were mixed in a total volume of 20 \u00b5L. Melting curve analysis was performed after each PCR run to exclude non-specific amplification. Relative mRNA expression of marker genes was normalised to the house-keeping gene ubiquitin-conjugating enzyme E2 D2 (UBE2D2).Total mRNA of printed jawbone models was isolated after 0, 7 and 28\u00a0days using the NucleoSpin RNA XS kit following the manufacturer\u2019s protocol. For every condition and sampling time, three bioprinted constructs were analysed . For isolation of mRNA from native jawbone tissue, small bone pieces . All values are given as mean\u2009\u00b1\u2009standard deviation. Two-way ANOVA with Tukey\u2019s multiple comparison test was applied to real-time PCR data Supplementary Information"} +{"text": "Radiation-induced lung injury (RILI), including acute radiation pneumonitis and chronic radiation-induced lung fibrosis, is the most common side effect of radiation therapy. RILI is a complicated process that causes the accumulation, proliferation, and differentiation of fibroblasts and, finally, results in excessive extracellular matrix deposition. Currently, there are no approved treatment options for patients with radiation-induced pulmonary fibrosis (RIPF) partly due to the absence of effective targets. Current research advances include the development of small animal models reflecting modern radiotherapy, an understanding of the molecular basis of RIPF, and the identification of candidate drugs for prevention and treatment. Insights provided by this research have resulted in increased interest in disease progression and prognosis, the development of novel anti-fibrotic agents, and a more targeted approach to the treatment of RIPF. Radiation therapy (RT) is performed in about 50% of all cancer patients at least once during their treatment course. Recently, with the development of computer and mechanical engineering, it has become increasingly important through effective treatment. Clinical RT involves irradiation with high radiation doses to remove tumors. Surrounding normal tissue adjacent to the tumor is prone to side-effects. The most common side effects after ionizing radiation (IR) treatment of thoracic tumors are pneumonitis and pulmonary fibrosis (PF). While pneumonitis occurs early following treatment and may be reversible, PF is considered to be irreversible delayed toxicity . PneumonWhen IR passes through the lung tissue, energy not only directly induces double-strand break (DSBs) of the DNA molecule, but also has sufficient strength to hydrolyze water and other molecules. This hydrolysis produces reactive oxygen species (ROS), which can interact with DNA and other cellular components of extracellular matrix (ECM) . Most DNRadiation pneumonitis as an acute reaction occurs within 4\u201312 weeks after RT. The acute pneumonitis stage is characterized by recruiting various immune cells into the alveolar space, thickening the alveolar septum, and destroying the integrity of the alveoli. At this time, infiltration of myeloid and lymphoid cells occurs, which results in lung inflammation and edema of alveolar interstitium and the air space . In the RIPF occurs at an irreversible stage more than six months after irradiation. The characteristic RIPF is the accumulation of fibroblasts and myofibroblasts, causing extensive production of collagen, infiltration of inflammatory cells, and remodeling of ECM. This is followed by fibrosis of the alveolar septum, which, in turn, leads to extensive occlusion of the alveoli. RIPF is characterized by the accumulation of the ECM protein, which lowers the ability of the lungs to exchange oxygen. In response to IR, resident lung fibroblasts can differentiate into myofibroblasts, which can secrete ECM proteins. Activated myofibroblasts contribute to fibrogenesis. Therefore, inhibiting IR-induced myofibroblast differentiation is an important therapeutic strategy for preventing fibrosis ,15. IR aClassical studies using whole thorax irradiation have provided important information about the pulmonary IR responses of different rodent strains and defined dose thresholds for lung toxicities. Susceptibility to fibrosis to IR is genetically based in mice, and, most notably, C3H/HeJ and CBA/J mice are resistant to IR-induced fibrosis in comparison with the more susceptible C57BL/6 strain . C3H/He More sophisticated conformal RT techniques such as intensity-modulated RT (IMRT), volumetric arc RT (VMAT), stereotactic body radiation therapy (SBRT), and stereotactic radiosurgery (SRS) have a lower RILI incidence than standard 3D conformal RT. This can be due to the increased precision of IR delivery to the tumor, which, thereby, protects the surrounding normal tissue. Moreover, due to the diversity of the technology, it is possible to guide the intensity and direction of the radiation beam by taking into account the anatomy, breathing pattern, and organ motion of the patient. All of these modalities are expected to lower the volume of lung irradiation and the irradiation dose while maintaining millimeter-range accuracy. Moreover, SBRT is the standard of care for patients with medically inoperable stage I NSCLC . The steThe pathological mechanism of RIPF is complex and involves numerous cell types. Thorax IR induces delayed damage to resident lung cells, which, primarily, leads to apoptosis of bronchial epithelial cells and loss of barrier function . Recent Since various cytokines affect the particular processes of RIPF , cytokinIR induced a series of complex injuries mediated by oxidative stress, cell death, senescence, and loss of normal lung barrier functions . Some alThe therapeutic strategy for treating lung injury after IR is restoring the immunological balance. With this treatment strategy, corticosteroids play a major role in managing acute IR pneumonitis, but its role in advanced lung fibrosis remains unclear. Inhibition of neutrophil elastase (NE) prevents the development of lung fibrosis after acute lung injury . IrradiaThe thiophosphate, amifostine, is the only agent approved by the FDA as a clinical IR protector and its active metabolite acts as a radical scavenger to proteToll-like receptor (TLR) activation requires a number of intracellular adaptor proteins proximal to TLR and the most prominent one is a myeloid differentiation primary response factor 88 (MyD88). MyD88 contains two prominent domains, a TLR/IL1 receptor domain, and a death domain. MyD88 is a key control factor for innate immune signaling by pathogenic and environmental stresses. MyD88 regulates innate immunity, reduces long-term RILI, and alleviates fibrosis development by preventing chronic lung damage ,88. ActiActivation of the TGF-\u03b2/Smad signaling pathway, which is an important step for fibrosis development, has been explored as a potential intervention strategy. SM16, a small molecule inhibitor of the TGF-\u03b2 receptor I, reduced the degree of RILI in a rat model . Rats thThe platelet-derived growth factor (PDGF) receptor tyrosine kinase inhibitors significantly attenuate the development of fibroblast foci, characteristics of PF, and subsequent remodeling of the pulmonary structure. SU9518 is a highly selective inhibitor of the PDGF receptors \u03b1 and \u03b2, which blocks PDGF receptor kinase activity and PDGF receptor-induced cell proliferation . SU9518,Connective tissue growth factor (CTGF) is known as a molecule for TGF-\u03b2-mediated fibrosis. However, CTGF, once activated, has been reported to promote and maintain PF by exerting a direct fibrosis effect out of control by TGF-\u03b2. This hypothesis is supported by data demonstrating that CTGF activates collagen type 1 and promotes ECM synthesis. CTGF depletion in fibroblasts and smooth muscle cells significantly reduced fibrosis . PamrevlThe renin-angiotensin system is known to regulate blood pressure and fluid balance and has also been reported to be involved in the development of RILI. Some angiotensin-converting enzyme (ACE) inhibitors have proven to protect the lungs from fibrosis after IR exposure . TreatmeTolerance of lung tissue to IR and subsequent development of IR pneumonitis and fibrosis limit the effectiveness of RT. However, despite the urgent need for improved treatment of RIPF, there are no clinically used methods for RIPF treatment. In addition to drug development, it is important to identify the predictive biomarker that can help identify patients susceptible to RIPF, so that a lower IR dose can be administered to these patients. Future research efforts should focus on identifying novel RIPF inhibitors to improve the treatment of patients with RIPF. Combining small animal irradiators with appropriate animal models and preclinical molecular and functional imaging studies has great potential to further enhance our understanding of the IR response of lung tissue. This approach may help address long-standing questions about the inter-relationships of acute and late effects of IR. This will further promote the development of effective novel treatments that can preserve lung function and quality of life after RT.In this review, we emphasized the importance of small animal models that can mimic SBRT in terms of delivering high-dose focal irradiation. Regarding the level of vascular dysfunction in the lung tissue, it may occur after high-dose IR. Additional mechanisms are significantly affected in normal tissues after SBRT when compared to conventional RT. However, due to the limited understanding of basic mechanisms and the quantitative impact of clinical outcomes, many questions and investigations are needed to alleviate the effects of high-dose radiation on lung injury. Therefore, more examination using additional animal models are needed. In conclusion, recent advances have led to the development of more persistent experimental RIPF models and have allowed investigation of targeted epithelial damage, fibroblast-specific alterations, regulation of inflammatory cells during fibrosis, and epithelial-mesenchymal crosstalk. Although these models are still unable to replicate all the features of human RIPF pathology, specific analysis of signal pathways and interaction analysis among various cell types may be possible. More persistent models can enhance our ability to study mechanisms that are operative during the fibrogenic stage, which will increase the likelihood of translating the animal model findings to human disease and facilitate the assessment of therapeutic efficacy on fibrotic remodeling. This may enable a more precise prediction of which compounds have the ability to improve results after fibrosis is established."} +{"text": "The method relies on designing probes to target small RNAs that combine DNA oligonucleotides (oligos) for PAINT with LNA-containing oligos for hybridization; therefore, we developed an online tool called \u2018Vetting & Analysis of RNA for in situ Hybridization probes\u2019 (VARNISH) for probe design. Our method utilizes advances in DNA-PAINT methodologies, including qPAINT for quantification, and Exchange-PAINT for multiplexing. We demonstrated these capabilities of sRNA-PAINT by detecting and quantifying small RNAs in different cell layers of early developmental stage maize anthers that are important for male sexual reproduction.Small RNAs are non-coding RNAs that play important roles in the lives of both animals and plants. They are 21- to 24-nt in length and \u223c10 nm in size. Their small size and high diversity have made it challenging to develop detection methods that have sufficient resolution and specificity to multiplex and quantify. We created a method, sRNA-PAINT, for the detection of small RNAs with 20 nm resolution by combining the super-resolution method, DNA-based points accumulation in nanoscale topography (DNA-PAINT), and the specificity of locked nucleic acid (LNA) probes for the In plants, 21- to 24-nucleotide (nt), non-coding small RNAs (sRNAs) regulate many important biological processes . Plant strans-species sRNAs, and vice versa oligonucleotide probes has shown specificity and high fidelity . Plants were grown in Palo Alto, CA under greenhouse conditions. Anther dissection and measurements were performed as previously described . LNA-modin situ hybridization was performed as previously described (4 at pH 7). Samples were then processed in a vacuum chamber (0.08 MPa) three times, 15 min each. After fixation, samples were embedded in paraffin at the Histochemistry and Tissue Processing Core Lab at Nemours/Alfred I. duPont Hospital for Children . Paraffin samples were sectioned at 6 \u03bcm thickness using a paraffin microtome and dried on a Wide Spectral Band 600\u00a0\u00b1\u00a0100 nm Gold Fiducials coverglass at 37\u00b0C on a slider warmer.Sample preparation for escribed . Brieflyin situ hybridization step was performed following our previously-published protocol (N-(3-dimethylaminopropyl)-N\u2019-ethylcarbodiimide hydrochloride (EDC) solution. Slides then were washed twice in TBS solution, 10 min each wash. Hybridized samples were kept in 1\u00d7\u00a0TBS at 4\u00b0C until imaging. smFISH was carried out as previously described . Drift correction was done using fiducial-based algorithm. For image rendering, pixel resolution was set to 16 nm/pixel and 2 nm/pixel for zoomed in images with 1\u00d7 and 0.5\u00d7 PSF (point spread function) expansion factor. The number of photons was selected between 420 and 10,000 to eliminate non-specific background.Super-resolution imaging was carried out on an inverted Zeiss Elyra PS.1 super-resolution microscope . TIRF illumination was done using a 100% 642 nm laser and \u03b1-Plan-Apochromat 100\u00d7/1.46 oil objective. For each imager strand, as well as control imager strand, images were taken with an exposure time of 100 ms, an EMCCD Gain 30\u00a0and 20 000 frames in total. Each image was analyzed and rendered in Zen software . The images were processed using the following identical parameters: Ignore overlapping molecules; Peak Mask Size (6.0); Peak Intensity to Noise (6.0); Fit model and a quick release magnetic chamber for 25 mm low profile, round coverglasss were assembled and used as the perfusion chamber. A ValveLink8.2 Perfusion System was used for perfusing buffer and imager strand solutions and washing solution into the chamber. ValveLink 8.2 perfusion system is a gravity force-driven perfusion system. We used a working height about 15 cm above the imaging chamber. All imager strands were diluted to 0.5-2 nM in buffer C . Images were taken with constant flow of imager strand solution. A Masterflex C/L peristaltic pump was used to constantly collect the waste buffer flow at maximum speed.in situ hybridization procedure as described earlier, each probe was denatured in an individual tube. After chilling on ice, all the probes were mixed together and hybridized to the tissue simultaneously overnight at 53.3\u00b0C in a hybridization oven. The probes were washed off with 0.2\u00d7\u00a0SSC buffer the next morning, and stored in 1\u00d7 PBS buffer till imaging. DAPI stained nuclei images were taken after Exchange-PAINT. Alignment of channels were done using TrakEM2 package of ImageJ \u22121), and c represented the concentration of the imager strand. The dark time under \u2018View: Show info\u2019 and the calculated influx rate were used to calculate binding sites. A total of 150 sample areas across three biological replicates were used to determine the background binding number. We observed 5.12 background binding sites for scrambled control LNA probe. As a result, the 5.12 background binding sites were subtracted from all other qPAINT quantifications. For each sample, 10 locations for each cell layer were used to calculate the binding sites.qPAINT data analysis was performed following the protocol by Schnitzbauer et\u00a0al. and usinSmall RNA colocalization analyses were carried out using Clus-DoC colocalization software, which is designed for single-molecule localization microscopy data . Five thThe details of the library are as follows: it is a maize small RNA library with GEO accession number GSM1262527 that includes 24,145,201 genome-matched reads between the sizes of 18 and 34 nt. After removing adapters and low-quality reads, small RNA reads length between 18 and 34 nt were mapped back to the reference genome of maize, version AGPv4 . AbundanAll small RNA probe sequences and imager strands used are listed in in situ Hybridization probes) for automated design of sRNA-PAINT probes (https://wasabi.ddpsc.org/\u223capps/varnish/). The tool requires the input of a target sRNA sequence and the hybridization parameters (defaults provided), including sodium (50 mM), magnesium (0 mM) and temperature (25\u00b0C). VARNISH first will reverse complement the sRNA sequence and will then choose between 19 and 22 nt of the sequence such that the melting point temperature (Tm) is lower than 60\u00b0C, with preference for lower Tm values for the longest sequence length. The melting temperature is calculated by using the \u2018Analyze\u2019 function from the IDT web application program interface (API) . The final sequence is the probe backbone . The gold fiducials were used as alignment landmarks for image registration over time and after buffer exchanges. We highly recommend that no additional coatings are added, such as poly-l-lysine, since they resulted in non-specific binding. Next, during the hybridization process, probes are applied to fixed and sectioned samples . First, AF647 emits far-red fluorescence that is distinct from tissue autofluorescence; second, its photophysical property made it a dye suitable for generating quality super-resolution images . The sRNqPAINT can count molecules by analyzing the predictable and programmable binding kinetics of the imager strand to the docking strand . This quNext, we tested the specificity of the VARNISH probes and the essentiality of LNA bases. First, we tested the specificity of the probe backbone by mutating two nucleotides in the 24-nt phasiRNA probe backbone. As shown in Figure After the first round of imaging, buffer was perfused into the imaging chamber, and the signal was diminished rapidly within 1 min, suggesting that stripping off the imager strand is very efficient. Next, sRNA-PAINT signal was re-achieved by re-applying the imager strands Figure . We usedPHAS\u00a0precursor (a lncRNA) of the same 24-nt phasiRNA studied in Figure PHAS\u00a0lncRNA appear to accumulate at low levels relative to their small RNA products in plants , perhaps via miRNA-loaded AGO1 protein . smFISH showed a similar localization pattern with the sRNA-PAINT method . smFISH fluorescence was diffuse in the cytosol, while sRNA-PAINT fluorescence appeared as discrete spots. We hypothesize that we are detecting persistent 5\u2019 degradation products that appear as diffuse signal by smFISH due to a lack of multiple probes to this smaller RNA degradation product . We also included a fifth candidate, miR166, which regulates flower development but does not belong to the 24-nt phasiRNA biogenesis pathway premeiotic maize anthers Figure . We aime pathway . Each of pathway . We obse pathway ; DAPI wa pathway . Single- pathway zoom demsRNA-PAINT provides a robust method that quantitatively detects small RNAs with single-molecule resolution. It greatly improves the resolution and precision of sRNA localization compared to other FISH methods, namely those that are limited by the diffraction limit of light. The small size of sRNAs are generally only detected by one probe per sRNA, as a result, each probe plays an important role with respect to quantification. Our online VARNISH tool assists with the critical probe design step to generate LNA probes with docking strands. Quantification of binding sites then can be deduced from the known binding kinetics of the imager strands to the docking strands with sRNA-PAINT . A clearTo develop a quantitative, super-resolution method for sRNA, we chose to design a PAINT-based method over a dSTORM-based method for several reasons. The predictable binding of imager strands to docking strands with PAINT-based method is preferred over the stochastic blinking of dye molecules in dSTORM . Furtherin situ hybridization methods. sRNA-PAINT samples are directly imaged after hybridization and washing, bringing the sample preparation time down from 4 days to overnight . The development of LNA technology increased the specificity and efficiency of sRNA-FISH methods making the development of sRNA-PAINT possible. Future improvements in probes, such as the use of next-gen bridged nucleic acids (BNAs) may provs (BNAs) ; howevergkaa623_Supplemental_FilesClick here for additional data file."} +{"text": "Study of mating-induced trade-offs between reproduction and survival is conducive to provide evolutionary insights into reproductive strategies and aging. Using RNA sequencing and bioinformatics, we found that mating induced changes of genes and pathways related to reproduction and survival in females of a pine sawfly. Mating induced substantial downregulation on genes associated to immunity, stress response, and longevity. However, mating induced divergent reproductive response, with downregulation on genes related to egg production while upregulation on genes related to egg fertilization. Considering the nature of limited resources in adults, low fecundity and egg protection behavior in this sawfly, we suggest that mating triggers trade-offs between reproduction and survival in this insect and females of this species have evolved specific strategies to adapt to the living conditions, e.g., restrict whole fecundity to ensure higher fertilization and offspring\u2019s survival. Cephalcia chuxiongica, a pine defoliator with facultative parthenogenesis and long larval dormancy. Results showed that mating induced substantial downregulation on genes and pathways associated to immunity, stress response, and longevity. However, mating induced divergent reproductive response, with downregulation on genes and pathways related to egg production while upregulation on genes and pathways related to egg fertilization. Considering the nature of limited resources in adults, low fecundity, and egg protection behavior in C. chuxiongica, we suggest that mating triggers trade-offs between reproduction and survival in this insect and females of this species may have evolved specific strategies to adapt to the environmental and hosts\u2019 conditions, e.g., restrict whole fecundity to ensure higher fertilization and offspring\u2019s survival. Moreover, mating induced significant responses on genes and pathways that play important roles in vertebrate reproduction while their function in insects are unclear, such as the progesterone-mediated oocyte maturation pathway; the significant regulation after mating suggests that their function may be evolutionarily conserved in animal kingdom.Investigation of mating-induced trade-offs between reproduction and survival is conducive to provide evolutionary insights into reproductive strategies and aging. Here, we used RNAseq and bioinformatics to reveal mating-induced changes of genes and pathways related to reproduction and survival in female Trade-offs between reproduction and survivorship is the central theme in evolutionary biology of senescence. Negative relationships between reproduction and survivorship are often observed in organisms, in which increased fecundity may cause costs on somatic maintenance (such as immunity and stress responses) and longevity ,2,3,4. TDrosophila melanogaster [In insects, the endocrine network plays vital roles in reproduction and maintenance regulation, which mainly involves insulin-like/IGF-1 signaling (IIS), juvenile hormone (JH), 20-Hydroxyecdysone (20E), yolk precursor vitellogenin (Vg), and yolk proteins (YPs) . In contnogaster ,9. ThereC. elegans, the heat shock response was inhibited at the onset of reproduction, probably due to competing requirements of the germline and soma [Female insects are likely to face a limited protein supply during reproductive period because many of them do not feed on a protein source as adults while elevated egg production process requires higher protein supplies at this stage ,11,12. Fand soma . In honeand soma . Therefoand soma . TherefoSpodoptera litura female moths showed a divergent response in DEGs in relation to reproduction and immunity [Cephalcia chuxiongica. This insect has a facultative parthenogenesis reproductive system and a long (19 months) larval dormancy stage [Recent progress on high-throughput sequencing and bioinformatics has revolutionized our understanding of life and organism. Previous transcriptome analysis in a number of insect species have shown that mating can induce expression changes in genes related to reproduction, immunity, stress response, and longevity ,19,20. Aimmunity . These rcy stage . Study oCephalcia chuxiongica Xiao (Hymenoptera: Pamphiliidae) is a serious pest of pines in China [Cephalcia species have been found all over the world, with most of them being important forest pests [Cephalcia chuxiongica larvae feed on pine needles and pupate in the soil under the trees. The life cycle of this species is long (about 22 months) due to a 19-month larval diapause in the soil [C. chuxiongica females perform sexual reproduction under normal conditions, while in the absence of males, they can perform parthenogenesis [C. chuxiongica can mate a few hours after eclosion; unmated females (virgin) may start to lay unfertilized eggs through parthenogenesis a few days (>3 d) after eclosion [C. chuxiongica; adults even did not feed on the provided honey solution, suggesting that this species do not feed during the adult stage [The sawfly in China ,23. Almost pests ,25. Cephng about months dng about months declosion . Sawflieeclosion . So far,lt stage .Cephalcia chuxiongica adults were collected in August 2019 under infested pine trees in the Pinus yunnanensis forest, located on a small mountain near Xundian town in Yunnan Province, China. Cephalcia chuxiongica pupate and eclose underground during July to Sept. Eclosed adults crawl out from the soil for reproduction in the forest. To confirm adults virginity and age, newly eclosed adults were directly dug out from the soil below the pine trees in the morning [C. chuxiongica adults can mate soon after emergence and mating mostly happen at noon. Therefore, mating was allowed in the same day after collection during 12:00\u201314:00 by pairing males and females on the pine needles covered by bags with one pair per bag. Mating events [ morning . Males a morning and rear 20 min) were recTotal RNA was extracted from samples using Trizol reagent and then was treated with the RNase-free DNase I to eliminate genomic DNA. The purity and concentration of RNA was assessed by using Qubit RNA Assay Kit and the NanoPhotemeter spectrophotometer . The RNA integrity was checked by the Agilent Bioanalyzer 2100 system . One microgram RNA per sample was used for the preparation of the sequencing libraries by using NEBnext Ultra RNA Library Prep Kit for Illumina following the manufacturer\u2019s instructions and index codes were added to attribute sequences to each sample. The quality of each sample library was assessed using the Agilent Bioanalyzer 2100 system. Ultimately the library per sample was sequenced by Illumina Hiseq4000 platform and the paired-end reads were generated.The raw reads obtained were initially processed by trimming the adapter and low quality reads to produce clean reads. The clean reads were assembled using the Trinity software (version 2.5.1) to generate transcripts . Then trp-value was adjusted using q-value [q < 0.05 and |log2(foldchange)| > 1 was set as the threshold for significantly differential expression.Gene expression levels were determined as transcripts per million (TPM). The differential expression analysis between samples was performed using the edgeR R package (3.0.8). q-value . q < 0.0q < 0.05 were significantly enriched in DEGs.Using the BLAST software\u03b2-Tubulin (GeneBank ID: MZ028603) was used as a reference gene. Total RNA was extracted from above samples by using RNAiso plus and cDNA was synthesized using PrimeScript RT reagent Kit . The PCR was performed by QuantStudio 7 Flex with gene specific primers was shared by the three groups , M6 h-vs.-V6 h and M24 h-vs.-V24 h groups, respectively . There w.-V24 h) .To better understand their functions, all these DEGs were annotated based on NR, Swiss-Prot, GO, KO, COG, and Pfam databases and thenMating-induced regulation on genes and pathways related to reproduction and survivorship were then studied in detail as follows based on the above annotation and enrichment analysis.At 1 h after mating, 68 genes were downregulated and 81 genes were upregulated in mated females compared to virgin females a. The loTwo reproduction-related genes were found within these DEGs, with one encoding follicle cell protein (downregulated) and one encoding cytochrome P450 (upregulated) . KEGG enTwo immunity related genes were found within these DEGs . Both ofNo longevity and heat shock-related genes and pathways were found within these DEGs of M1 h-vs.-V1 h.Within the 320 DEGs of M6 h-vs.-V6 h, 206 were downregulated and 114 were upregulated in mated females compared to virgin ones b. The LCSixteen reproductive-related genes were found within these DEGs , includiOne immunity-related gene was found within these DEGs , which iStill no longevity and heat shock related genes and pathways were found within these DEGs.Within the 1068 DEGs of M24 h-vs.-V24 h, 104 genes were downregulated and 964 genes were upregulated in mated females compared to virgin ones c. The LCVitellogenin and Vitellogenin-like , one Vitellogenin-receptor (upregulated), 26 Zona pellucida protein-like , seven Cyclin-like , and ten other reproductive-related genes. Three reproductive related KEGG pathways were significantly enriched (Xenopus (KEGG id: map04914) Estenriched were mapap04914) . Resultsunigenes .Three immunity related genes were found within these DEGs with all of them being downregulated . ThirteeThere are thirteen Hsps-encoding genes found within these DEGs , includiOne longevity-related pathway was significantly enriched, which was related to four downregulated DEGs . DN64818_c0_g6, DN52313_c1_g5, DN65191_c2_g1, DN66978_c2_g1, DN78694_c0_g1, and DN71364_c1_g1), three immunity-related genes , and one heat shock response gene (DN70765_c7_g9) were used to verify the accuracy of RNAseq, which include six reproduction-related genes (5_c7_g9) . The expFollicle cell protein, Haemolymph juvenile hormone binding protein, UDP-glucosyltransferase, Apolipophorin III, and Matrix metalloproteinase, were also downregulated significantly (Insulinase (which destroys or inactivates insulin) in mated females may also negatively affect female fecundity. These results suggested that mating downregulated reproduction in terms of fecundity (number of eggs) in C. chuxiongica.Previous studies generally found that mating induces the upregulation of egg production (fecundity)-related genes, such as YPs and Vg ,18,19. Ificantly . In addiCyclins, which play roles in the process of oocyte maturation and the onset of embryogenesis [Zygote arrest protein, which are ovary-specific maternal factors that play essential roles during the oocyte-to-embryo transition [C. chuxiongica Sevogenesis ,48,49; (ansition . Moreoveansition . At the ansition : (1) Resansition . Therefoxiongica are likeXenopus laevis is the most intensively studied model system for meiotic maturation [Xenopus (KEGG id: map04914) and found that about half of the genes on map04914 were present in the unigenes of C. chuxiongica and Xkid [C. chuxiongica, then the upregulation of Cyclin-B1 and Xkid may be triggered by mating factors or fertilization, which then will promote the transition of eggs from meiosis I to meiosis II. This warrants further studies.The progesterone-mediated oocyte maturation pathway of the African clawed frog turation . Therefoxiongica . Furtherxiongica . These r, KIF22) in the eKO id: K068 and XkZona pellucida protein and Ovastacin/Astacin-like was significantly upregulated in mated females shortly after mating (1 h post-mating) and four P450 genes were downregulated in mated females at 6 h post-mating were found in C. chuxiongica and all of them were downregulated considerably in mated females may start to lay unfertilized eggs through parthenogenesis a few days (>3 d) after eclosion [C. chuxiongica females, in which females may downregulate oogenesis and egg production to restrict fecundity but upregulate meiotic maturation in fully grown oocytes and fertilization-related pathways to favor the following egg fertilization. C. chuxiongica mostly occurs in pine forests at high altitude and barren soil, its larvae are obligate pine defoliator, which mainly feed on Pinus yunnanensis [C. chuxiongica has a long (19 months) larval dormancy stage and adults do not feed [C. chuxiongica females lay eggs on the surface of pine needles [C. chuxiongica females may thus have evolved egg protection behavior. The fecundity of C. chuxiongica is about 50 eggs per female [S. litura that lay more than one thousand eggs per female [C. chuxiongica may have evolved a different reproductive strategy, i.e., restrict whole fecundity while ensuring higher egg fertilization and offspring survival. Future studies to clarify the hypotheses established in this study by using other techniques, such as RNAi and 2D electrophoresis/MS, will help to provide deeper insights in this field.Above results and discussion have suggested that mating is also an essential switch in eclosion . Therefonanensis . C. chuxnot feed , which m needles , which wr female . Therefor female and showr female , C. chuxC. chuxiongica suggest that this species has evolved multiple physiological and behavioral strategies to adapt to its living environment.The present study and previous studies ,22,23 on"} +{"text": "Hox genes that specify the patterning of the mammalian skeleton during embryogenesis are upregulated during the diaphyseal healing. Hox genes positively regulate the differentiation of osteoblasts from SSCs in vitro. During bone grafting, the SSCs in the donor\u2019s bone express Hox with adaptability in the heterologous bone. These novel functions of the Hox genes are discussed herein with reference to the site-specificity of fracture healing.The process of fracture healing varies depending upon internal and external factors, such as the fracture site, mode of injury, and mechanical environment. This review focuses on site-specific fracture healing, particularly diaphyseal and metaphyseal healing in mouse long bones. Diaphyseal fractures heal by forming the periosteal and medullary callus, whereas metaphyseal fractures heal by forming the medullary callus. Bone healing in ovariectomized mice is accompanied by a decrease in the medullary callus formation both in the diaphysis and metaphysis. Administration of estrogen after fracture significantly recovers the decrease in diaphyseal healing but fails to recover the metaphyseal healing. Thus, the two bones show different osteogenic potentials after fracture in ovariectomized mice. This difference may be attributed to the heterogeneity of the skeletal stem cells (SSCs)/osteoblast progenitors of the two bones. The Bone is a mineralized connective tissue with multiple functions such as supporting the skeleton structure; producing new blood cells; shielding the internal organs, providing a scaffold for the muscles, ligaments, and tendons; and acting as a reservoir for minerals . The bonBone injury damages the bone and interrupts the remodeling cycle. Fracture healing is a regenerative process that fills the discontinuity of the broken bone and returns the remodeling cycle. Incomplete healing, such as fracture nonunion, malunion, and delayed healing, has been a clinical problem . IdentifA long bone consists of the epiphysis at both ends, diaphysis at the center, and metaphysis at the boundary of both sites Figure A. The diSince the pattern of fracture healing varies with age, sex, fracture site, and fracture severity, a suitable fracture model should be adopted to evaluate the mechanism of the specific healing process. The characteristics of various models devised so far have been reviewed elsewhere ,26. In sIn the open-fracture model, the skin is incised, and bone injury is produced by various methods. The injured site is often stabilized by the external fixators ,26. RigiDiaphysis healing involves complex spatio-temporal processes with different mechanisms at specific locations. On the periosteal side, the cartilaginous and bony callus appear during fracture healing , whereasSox9 and type 2 and type 10 collagen mRNAs in mice and rats [VEGF mRNA at the ossification site in mice [Fracture healing is divided into four histological stages on the periosteal side: inflammation, cartilaginous callus formation, bony callus formation, and remodeling Figure A. The fiand rats ,37. Periand rats ,37. Otheand rats , vessel and rats , surrounand rats , and cirand rats . SSCs wiand rats . Notablyand rats . The skeand rats . The bon in mice . On day in mice . Sox9 and type 2 collagen) is weakly upregulated in the periosteal cells [Notably, the metaphyseal healing in a stable model (drill hole model) does not involve periosteal callus formation, as described below, although the mRNA expression of the chondrogenic markers at day 7 in mice . In contThe endosteum is a subcompartment of the bone marrow that lines the inner surface of the cortical bone B. The apAlthough fractures may occur at various ages, osteoporotic patients are at a high risk of fracture ,23. In posteocalcin, type 1 collagen, and P1NP in mice [Previous studies have shown profound effects on diaphysis healing in mice ,60,61,62 in mice . Substan in mice . Ovariec in mice . In the in mice ,65.Ovariectomy also deteriorates the metaphyseal healing in rats ,67 and mThe effects of estrogen on fracture healing in the OVX animals are summarized in In the late stage of fracture healing, osteoclasts resorb the bony callus and reshape the regenerated bone. The increased number of osteoclasts in the OVX animal bone is expected to shorten the duration of the remodeling stage. Consistent with this, preponderant osteoclasts appear at the periosteum region and persist longer in the OVX mice than in the controls . In the The comparison of fracture healing between the diaphysis and metaphysis indicates that the former is more severely affected by ovariectomy . Here, wFracture healing is an outcome of the complex actions of multiple cells at distinct stages. Both endochondral and intramembranous ossification processes involve stages of inflammation, bony callus formation, and remodeling. Here, we have summarized the roles of macrophages, osteoblasts, and osteoclasts at the respective stages.Macrophages play a pivotal role in bone maintenance in the physiological state . The LysIn the inflammatory stage, many cells assemble at the injured site and secrete pro-inflammatory and anti-inflammatory cytokines and growth factors, leading to complicated pharmacological interventions for fracture healing . AntibioA medullary callus appears in both diaphyseal and metaphyseal healing processes in a mouse drill hole model. Although the dynamics of the periosteal callus in endochondral ossification have been well elucidated, the dynamics of medullary callus have been elusive. Here, we summarize the current knowledge on the formation and disappearance of medullary callus.high/endomucinhigh-positive vessels that contain abundant osteoprogenitor cells than those in the diaphysis [The differentiation of SSCs into osteoblasts is the main mechanism of medullary callus formation. The lineage specification of SSCs is regulated by the specific transcription factors in response to the chemical, physical, and biological cues ,79. Althiaphysis . The difiaphysis . The impiaphysis . When thiaphysis . Future Parathyroid hormone (PTH), approved for osteoporosis therapy, is expected to improve fracture healing. Abaloparatide, a PTH receptor agonist, increases callus size and callus bridging in a rat diaphysis femoral fracture model . TeriparAs described in The nature of osteoclasts in the diaphysis and metaphysis during fracture healing has not been explored. The site-specific heterogeneity of osteoclasts has been reported from the progenitors to the phenotypes of mature osteoclasts . Future The arguments so far raise the question of whether the difference in fracture healing between the diaphysis and metaphysis can be explained by the properties of cortical and cancellous bone. The cortical bone differs from the cancellous bone in many ways. First, the cortical bone has a higher BMD than cancellous bone in the radius and tibial diaphysis and lumbHox gene, a subset of homeobox-domain-containing transcription factors, originally found in the fruit fly Drosophila [Hox gene causes homeotic transformation, formation of a given organ in an incorrect place. Hox genes are arranged collinearly in a cluster, and their expression spatiotemporally coincides with the formation of body segments along the anterior-posterior axis during Drosophila embryogenesis. Thus, Hox genes provide positional information of the body plan of an embryo but do not form a specific segment or organ.Apart from the issues on cortical versus cancellous bones, it is clear that the genetic code somehow specifies the formation of a given bone at a specified location during development. One such code is the osophila . The mutHOX genes are found and arranged in four gene clusters: HOXA, HOXB, HOXC, and HOXD [Hox genes work in specifying the skeleton of the vertebrate embryos during development. In mice, the axial vertebrae from cervical to caudal are patterned by Hox4 to Hox11. The limb is divided into three segments: stylopod , zeugopod , and an autopod . These segments are specified by Hox9, Hox10, Hox11, Hox12, and Hox13, respectively [Hox genes pattern the sternum in a non-linear manner. These results suggest that Hox genes are indispensable for the normal patterning of the mouse skeleton during development. Interestingly, Hox genes are expressed in the adult skeleton in the same pattern established during development [Hox genes also function in the adult skeleton. This notion is demonstrated by examining the phenotypes of mice with conditionally deleted Hox11 gene at the adult stage [Hox11 deletion at the adult stage causes a transformation of the normal lamellar bone into an abnormal woven bone-like matrix of disorganized collagens in the cortical bone of the ulna, whereas it induces no change in the cortical bone of the humerus. The results suggest that Hox genes specify the global pattern of the mammalian skeleton during embryogenesis and also act as a factor in bone remodeling at a specific site in adults.In humans, 39 and HOXD . Becauseectively . In the ectively . In contelopment , raisinglt stage . The HoxHox genes are also involved in fracture healing. The Hoxa2 and Hoxd9 mRNAs were upregulated throughout fracture healing (day 2 to day 21) in a rat femur-controlled fixed model [Hox genes during mouse femur diaphysis healing was studied using global transcriptional analysis [Hoxa3, Hoxa4, Hoxa10, Hoxb1, Hoxb13, Hoxc6, Hoxc10, Hoxd3, and Hoxd13 showed a biphasic peak at day 3 and day 14 or 21 after a fracture. Hoxa1, Hoxa2, Hoxa4, Hoxa5, Hoxb3, Hoxb6, Hoxb9, Hoxc5, Hoxd3, and Hoxd9 were upregulated at the late stage (days 14 and 21 after fracture), whereas Hoxa4, Hoxa11, Hoxb2, Hoxb8, and Hoxc8 are upregulated during healing. Surprisingly, many Hox genes are upregulated during diaphysis healing. Since the results appear to contradict the concept of region-specific expression of Hox genes in the skeleton, the significance of diverse expression of Hox genes in this study needs further examination.ed model . Both thanalysis . The expHox11-deficient mice ulna shows reduced chondrogenesis and delayed ossification, resulting in the delayed bone union in an unstabilized model [Hox11-deficient mouse femurs showed no abnormalities. Hox11 is specifically expressed in SSCs at the periosteum of the adult ulna. The conditional deletion of Hox11 in adult mice prevents the terminal differentiation of osteoblasts at the endosteal surface of the cortical bone of the ulna [Hox11-deleted mice. These results suggest that Hox11 functions in the adult bone in a region-specific manner. Hox11 positively regulates the differentiation of chondrocytes and osteoblasts but not the maintenance and proliferation of SSCs. Hox11-deficient SSCs show defects in chondrocyte and osteoblast differentiation in vitro [The diaphysis healing in ed model . In contthe ulna . Furtherin vitro . Finallyin vitro .Hox-negative. The transplanted tibial cells maintained their Hoxa11-positive status in the Hox-negative mandibular environment. In contrast, the Hox-negative mandibular cells transplanted into the tibia began to express Hoxa11 7 days after transplantation, suggesting a change in the Hox status in response to the environment. The relationship between Hox expression and the fate of SSCs was examined among four different origins of SSCs [Hox-negative, mesoderm-derived Hox-negative, neural crest-derived Hox-positive, and mesoderm-derived Hox-positive SSCs, respectively. SSCs isolated from adult bones retain the embryonic Hox status. Hierarchical cluster analysis of the transcriptome indicated that transcriptional profiles of four SSCs were well separated into two clusters defined by the Hox expression status. In an in vivo scratch injury assay, the Hox-positive (hyoid and tibia) periosteum produces osteoblasts, whereas the Hox-negative periosteum forms the chondrocytes and osteoblasts. In the in vitro differentiation assay, the Hox-negative periosteum showed higher potential for osteogenic differentiation, whereas the Hox-positive cells exhibited higher capability for chondrogenic and adipogenic differentiation. FACS analysis showed that the Hox-positive cells expressed more markers for primitive stem cells than the Hox-negative cells. These results suggest that Hox status, rather than developmental cell lineage, determines the fate of the SSCs. Do region-specific SSCs also work in the heterologous place? Leucht et al. challenged this question . All bon of SSCs . The perHox genes has not yet been elucidated. In in vitro osteoblastogenesis, the HoxA cluster expression is regulated by epigenetic mechanisms, such as promoter methylation [HoxA cluster expression at various stages of osteoblast differentiation [Hox genes regulate the activity of genes such as Myb, Sox4 [Hox genes are also involved in hematopoiesis [Hox code in the skeleton has prospects for understanding the principle of regeneration of bone fractures.The regulatory mechanism of osteoblastogenesis by hylation . The micntiation . In contntiation . Interesyb, Sox4 , \u03b23 inteyb, Sox4 , TGF-\u03b22 yb, Sox4 , and FGFyb, Sox4 . The proopoiesis and angiopoiesis . TherefoHox genes with the heterogeneity of SSCs. Although the significance of Hox genes in skeletogenesis is widely recognized, the role of Hox expression in the adult bone has been elusive until recently. Because fracture healing is a process of tissue regeneration, it is not surprising that the stimulus of fracture changes the expression of Hox genes and provides positional information to the fractured bone during regeneration. The positional cue specified by the Hox gene is effective on one bone or more during development. Such long-range effects cannot explain the heterogeneity of SSCs in the periosteum, endosteum, and bone marrow of the fracture site. In the future, a detailed analysis of the transcriptome of these SSCs will provide insights into the novel role of the Hox genes in fracture healing. Because the differentiation of SSCs is regulated by various physical and biochemical factors, it would be interesting to know the relationship between these factors and Hox expression. Moreover, elucidation of the mechanism of regulation of stemness of SSCs in vitro will be instrumental for the future clinical use of SSCs in cell therapy and regenerative medicine.In this review, we summarized the differences in fracture repair between the diaphysis and metaphysis, and these differences may have clinical importance. In diaphyseal healing, a bony callus in the periosteal region is a clinical criterion , whereas"} +{"text": "The effect of crump rubber on the dry sliding wear behavior of epoxy composites is investigated in the present study. Wear tests are carried out for three levels of crump rubber , normal applied load , and sliding distance . The wear behavior of crump rubber\u2013epoxy composites is investigated against EN31 steel discs. The hybrid mathematical approach of Taguchi-coupled Grey Relational Analysis (GRA)\u2014Principal Component Analysis (PCA) is used to examine the influence of crump rubber on the tribological response of composites. Mathematical and experimental results reveal that increasing crump rubber content reduces the wear rate of composites. Composites also show a significant decrease in specific wear values at higher applied loads. Furthermore, the coefficient of friction also shows a decreasing trend with an increase in crump rubber content, indicating the effectiveness of reinforcing crump rubber in a widely used epoxy matrix. Analysis of Variance (ANOVA) results also reveal that the crump rubber content in the composite is a significant parameter to influence the wear characteristic. The post-test temperature of discs increases with an increase in the applied load, while decreasing with an increase in filler loading. Worn surfaces are analyzed using scanning electron microscopy to understand structure\u2013property correlations. Finally, existing studies available in the literature are compared with the wear data of the present study in the form of a property map. Polymeric composite materials have gained significant importance in contemporary manufacturing scenarios, due to a number of advantages offered in terms of low density, high strength-to-weight ratio, and higher specific properties . ComposiThe present study aims to understand the effect of crump rubber on the wear behavior of particulate-filled polymer composites and demonstrate the important parameters that help to develop good friction materials. In this regard, a pin-on-disc setup was utilized to test the composites under dry conditions. Although a pin-on-disc setup does not reproduce every aspect of an envisaged application, pin-on-disc tests are widely utilized to examine the wear response of materials designed for braking systems in many transportation sectors, such as trains and automobiles under steady-state surroundings. Additionally, pin-on-disc tests help to correlate the structure\u2013property relations of materials, and are useful in modelling wear and lubricant response in braking pads with linear relative velocity .The development of crump rubber/epoxy composites serves the twin purpose of effectively utilizing environmental pollutant crump rubber and lowering component costs. In the present investigation, the leverage of crump rubber content on applied load and sliding distance on the rate of wear and frictional coefficient are extensively studied with the help of the Taguchi-coupled GRA-PCA technique. Furthermore, the morphology of worn-out surfaces and post-wear debris is analyzed using a scanning electron microscope. Finally, results from the current study are compared with the available studies, and are depicted as a property map to act as a guide for industrial practitioners and researchers.In the present investigation, LAPOX L-12 epoxy resin with K6 hardener was used as a matrix, procured from Atul Industries Ltd., Valsad, Gujarat, India. Crump rubber particles of 180 \u03bcm size were used as reinforcement, supplied by Arihant Chemicals Ltd., Delhi, India. Particle size analysis and a micrograph of crump rubber are shown in Composites were manufactured with varying crump rubber contents of 10, 20, and 30 vol.%. Crump rubber of 10, 20, and 30 vol.% was dispersed in the epoxy matrix to acquire homogeneous and consistent slurry. Then, 10 wt.% of K6 hardener was added to the slurry and de-aerated for 5 min prior to pouring into aluminum molds with dimensions of 90 \u00d7 90 \u00d7 12 mm, coated with a silicone-releasing agent. Cast slabs were cured for 24 h under ambient conditions, and samples were trimmed to a uniform size as per the ASTM G99-17 standard (12 \u00d7 12 \u00d7 25.4 mm thick). Coding of samples was carried out as per EC-XX convention, where E, C, and XX represent epoxy, crump rubber, and filler content by vol.%, respectively.Wear tests were performed in ambient settings using a pin-on-disc tribometer procured from DUCOM, Bengaluru, India . To testHeight loss and frictional forces of the tests were recorded using a data acquisition system connected to the wear setup. The cross-sectional area of the pin was used to calculate the volume loss.Wear rate (s), and is given as:The load-carrying capacity of samples is determined by the specific wear rate (WThe coefficient of friction (COF) . Surfaces of specimens subjected to wear were analyzed using a scanning electron microscope . Specimens were sputter-coated to give them a conducting layer .It is essential to address the combination of experiments by considering the number of dependent and independent variables at their levels. The number of experiments can be minimized with the implementation of this technique ,24. The GRA is a useful technique that was advocated by Professor Deng (1989) to deal The data are normalized from 0 to 1 by utilizing the following equation:The grey relational coefficients are determined with the following equation by incorporating the appropriate quality loss and ix(l), and \u03c3 ix(j), \u03c3 ix(l) are the standard deviations of the sequence ix(j) and ix(l), respectively.The coefficient of the correlation array can be determined as:k = 1,2,3\u2026n\u2014and the entity Then, the eigenvectors and eigenvalues are determined by using a coefficient correlation array with the help of the equation shown below:The principal component of each response value can be determined as follows:The principal component value of each response for an individual experimental run is shown in ith experiment, n is the number of responses, jth response in the ith experiment. The computed GRGs and their rankings are plotted in After arriving at the weightage value of the principal component of each response as shown in The optimal combination of wear test parameters and the percentage composition of crump rubber to yield a low wear loss and friction coefficient can be estimated through GRG analysis. The grey relational grade acts as an index, which is arrived through grey relational coefficient and principal component weightage, used to imply the degree of quality characteristics. A ranking was assigned to each experimental run subject to the GRG values.Analysis of variance is carried out with the first principal component, which has the most prominent weightage. The principal component with the largest eigenvalues always retains the highest variance ,39.2 and R2 (adj) values arrived at for the analysis were nearly 90%, which indicates that the proposed mathematical model is good [The ANOVA analysis explores the role of parameters on the effects of performance characteristics. The R is good . The reswhere x1, x2, and x3 are the percentage of crump rubber at levels 1, 2, and 3, respectively.where y1, y2, and y3 are the sliding distances at levels 1, 2, and 3, respectively.where z1, z2, and z3 are the normal load at levels 1, 2, and 3, respectively.The developed mathematical employed the following regression equation to study the relationship between wear test parameters and responses:Tests were performed at a constant sliding velocity because load and sliding distance significantly affect the wear of samples compared with other parameters. The wear rates of crump-rubber-reinforced epoxy samples are depicted in 3/km was observed in the V5D5F30 condition for EC-10, whereas EC-30 showed minimum wear of 0.9 mm3/km in the V5D1F50 condition. Epoxy is brittle by nature and reveals a higher wear rate, as reported in [The wear rate of samples reveals decreasing trends with the increase in crump rubber content and applied normal load. The same phenomenon is acknowledged by the statistical analysis. ANOVA results show that the crump rubber content has the maximum contribution (52.60%) to influence the wear rate. Similarly, the normal load has a secondary contribution (42.00%) over the wear rate. However, the effect of sliding distance seems to be the least significant (5.40%) in the mathematical model. Maximum wear of 7.6 mmorted in . TherefoThe load-bearing capacity of the samples is measured by the specific wear rate. The specific wear rate of the samples is presented in 3/N-km is observed with EC-30 in the V5D1F50 condition.A decrease in the specific wear rate of all of the samples is seen with the increase in load. A substantial decrease is observed at EC-30, showing higher wear resistance at higher loads. A minimum specific wear rate of 0.02 mmThe The temperature of the disc recorded after each test for different crump rubber loadings and test conditions is reported in Analysis of wear debris found on the disc surface after each test can lead to better understanding of the wear mechanisms. The morphology of wear debris as seen from the scanning electron microscope is depicted in Worn-out surfaces of specimens subjected to different loads, analyzed using a scanning electron microscope, are presented in Quantifying the observed results with available studies in the form of a property map acts as a guideline for researchers and industries in selecting a specific configuration based on the envisaged applications. Wear rate results recorded at a velocity of 5 m/s and an applied load of 50 N are compared with the extracted data from the literature and are plotted against density in Wear rate decreases with an increase in crump rubber content from 10 to 30 vol.%; the reduction is in the range of 100\u2013122%.The specific wear rate of samples also shows a decreasing trend in line with wear rate. In addition, a significant reduction in the coefficient of friction is also observed with higher applied loading, which is attributed to the formation of a film between the contact interfaces.EC-30 composites reveal the highest wear resistance and are well suited for dry sliding wear conditions. In addition, an increase in applied loading and filler content shows lower values of coefficient of friction attributed to the formation of a film between the interfaces.The main effects plot drawn for GRGs acknowledges that the higher content of crump rubber and a higher level of normal load contributed significantly to reducing the specific wear rate and coefficient of friction.ANOVA analysis also shows the importance of increased crump rubber content to yield an efficient wear rate and coefficient of friction.The outlier and normal probability plots confirm the satisfactory execution of the proposed model through the non-scattered distribution of points.The post-test temperature of discs reveals increasing trends with an increase in the applied load and decreasing trends with an increase in crump rubber content.In the present study, the dry sliding wear behavior of crump-rubber-reinforced epoxy composites was investigated for varying applied loadings, sliding distances, and filler contents by using GRA-coupled PCA analysis. The following conclusions can be drawn:"} +{"text": "In eukaryotic organisms, transfer RNA (tRNA)-derived fragments have diverse biological functions. Considering the conserved sequences of tRNAs, it is not surprising that endogenous tRNA fragments in bacteria also play important regulatory roles. Recent studies have shown that microbes secrete extracellular vesicles (EVs) containing tRNA fragments and that the EVs deliver tRNA fragments to eukaryotic hosts where they regulate gene expression. Here, we review the literature describing microbial tRNA fragment biogenesis and how the fragments secreted in microbial EVs suppress the host immune response, thereby facilitating chronic infection. Also, we discuss knowledge gaps and research challenges for understanding the pathogenic roles of microbial tRNA fragments in regulating the host response to infection. To thrive in harsh conditions, micro-organisms must respond to changes in the environment, including iron deprivation, nutrient starvation, and host immune responses. The transcriptional and post-transcriptional regulation by small RNAs (sRNAs) is a highly efficient mechanism to reshape microbial transcriptomes and metabolism in response to changes in the environment. Conventional microbial sRNAs are heterogeneous in size, ranging from 50 to 500 nt, and regulate gene expression by base-pairing with the translation initiation region or coding sequence of target mRNAs or by acting as sRNA sponges . In the Advancements in sRNA sequencing technologies and bioinformatics tools have led to the discovery of transfer RNA (tRNA)-derived fragments, leading to functional studies that have elucidated the regulatory roles of these fragments . In eukaExtracellular vesicles secreted by microbes serve various functions, including intra-kingdom and inter-kingdom transfer of toxins, virulence factors, DNA, sRNAs, and tRNA fragments . There aThis article summarizes the current stage of knowledge regarding the biogenesis of microbial tRNA fragments and their regulatory roles in pathogens and host cells. In addition, important knowledge gaps and research challenges regarding their roles in microbial pathogenesis will be discussed.Escherichia coli in response to bacteriophage infection (Transfer RNAs are 70\u2013100 nucleotides (nt) long molecules with highly conserved sequences that form secondary cloverleaf and L-shaped three-dimensional structures . Besidesnfection . Over thnfection . This arnfection \u2013C. They The first category of tRNA fragments is the spacer RNAs arising from the tRNA maturation process . tRNA prE. coli, T4 phage infection activates PrrC, a tRNALys-specific ACNase, as one of the suicidal events to protect the population from infection is an sRNA sponge that inhibits the activity of target sRNAs, RyhB, and RybB. RyhB and RybB regulate iron homeostasis and outer membrane integrity, respectively. To demonstrate the physiological role of 3' ETSleuZ in E. coli, the authors reported that it prevents cells from using succinate as the sole carbon source and decreases antibiotic colicin sensitivity. Importantly, they demonstrated that Hfq, a conserved bacterial RNA-binding protein, is required to form the tRNA fragment-sRNA target complex.Haloferax volcanii, a halophilic archaeon, and identified multiple 5' tRFs. They found that cells grown under elevated pH have abundant 5' tRNAVal fragment, which binds to small ribosomal subunits to inhibit translation globally. In addition, the 5' tRNAVal fragment of H. volcanii also attenuates protein synthesis by S. cerevisiae and E. coli\u2019s ribosomes cells to deliver sRNAs has published a suggested set of standards to increase rigor and reproducibility in EV research .In conclusion, despite numerous publications demonstrating the existence of tRNA fragments in microbes and in secreted EVs, many details on the immunoregulatory role of tRNA fragments in regulating the host are unknown. We postulate that tRNA fragments are underappreciated molecules in microbial physiology and host-pathogen interactions . We antiZL and BS conceived and contributed to the writing of the manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."} +{"text": "Cardio-oncology requires a good knowledge of the cardiotoxicity of anticancer drugs, their mechanisms, and their diagnosis for better management. Anthracyclines, anti-vascular endothelial growth factor (VEGF), alkylating agents, antimetabolites, anti-human epidermal growth factor receptor (HER), and receptor tyrosine kinase inhibitors (RTKi) are therapeutics whose cardiotoxicity involves several mechanisms at the cellular and subcellular levels. Current guidelines for anticancer drugs cardiotoxicity are essentially based on monitoring left ventricle ejection fraction (LVEF). However, knowledge of microvascular and metabolic dysfunction allows for better imaging assessment before overt LVEF impairment. Early detection of anticancer drug-related cardiotoxicity would therefore advance the prevention and patient care. In this review, we provide a comprehensive overview of the cardiotoxic effects of anticancer drugs and describe myocardial perfusion, metabolic, and mitochondrial function imaging approaches to detect them before over LVEF impairment. Cancer therapy significantly improves patient survival but is sometimes accompanied by cardiotoxic effects. Cardiotoxic complications can range from myocardial abnormalities, valvular abnormalities, pericardial diseases, coronary artery disease (CAD), and alteration in left ventricle ejection fraction (LVEF).Anthracyclines, one of the most used and oldest chemotherapies, are the archetypal cardiotoxic anticancer drug, ultimately leading to the heart failure . In addiInitial evaluation of LVEF and subsequent evaluation under anticancer therapy is paramount as the most guidelines for cardiotoxicity are based on LVEF impairment . To dateThese modalities have been able to detect impaired cardiac function in the later stages of cardiac side effects . MyocardThere is a close relationship between myocardial blood circulation, which delivers oxygen and nutrients, tissue metabolism, and oxidative stress. The heart has a very high energy demand to sustain contractile function and synthesizes adenosine triphosphate (ATP) through oxidative metabolism of free fatty acids (FFA), glucose, ketones, and lactate .The adult heart normally obtains 50\u201370% of its ATP from fatty acid \u03b2-oxidation in the presence of oxygen. However, it must adapt, switching from one substrate to another, to sustain demand depending upon the metabolic state and physical conditions at the time . ROS are reactive intermediates of the molecular oxygen that are essentially generated during mitochondrial oxidative phosphorylation . Cellulal matrix . An imbal matrix . The heal matrix \u201313. One l matrix , ultimatl matrix , which al matrix . Endothel matrix . Major cl matrix .Interestingly, initial vascular injury also results in the production of ROSs species derived from NAD(P)H . OxidatiIt is important to bear in mind that impaired myocardial perfusion and/or subsequent alteration of metabolic pathways, substrate preferences, and bioenergetics might contribute to the development of several common cardiovascular diseases . For theThe vascular and metabolic cardiotoxic effects of the various anticancer drugs are given in Anthracyclines are a group of chemotherapy broadly used in cancer treatment, with doxorubicin (DOX) being one of the most widely used. Its cardiotoxicity is well-known with cumulative toxicity ultimately leading to permanent cardiac alteration . The iniExcessive production of ROS by DOX leads to apoptosis, cardiac function impairment, inflammation, and vascular injury , 26. BotCurrent guidelines suggest monitoring of patients with cancer undergoing chemotherapy by echocardiography since most definitions of cardiotoxicity are based on LVEF decline , but the5-Fluorouracil (5-FU) is a part of antimetabolite agents and is commonly used in the treatment of malignancies. One of the major cardiotoxicities of 5-FU is coronary vasospasm that can lead to ischemia. Its mechanism remains uncertain, with some suggesting an endothelial-dependent mechanism through endothelial dysfunction, but others an endothelium-independent with vasoconstriction of dysfunctional smooth muscle cells . StudiesOne of the main alkylating agents, mostly used in hematologic cancers, is cyclophosphamide, for which dose-mediated cardiotoxicity is one of the notable toxic effects. The metabolites of cyclophosphamide reported to be involved in cardiotoxicity are acrolein and 4-hydroxy-cyclophosphamide. These metabolites are involved in ROS generation , 42 thatTaxanes are antimicrotubules whose main cardiotoxicity is disruption of cardiac rhythm and conduction. Heart failure (possibly in combination with DOX), ischemia, and microvascular rarefaction because of the endothelial damage might also occur .Receptor tyrosine kinase inhibitors (RTKi) include sorafenib, pazopanib, and sunitinib. As a part of antiangiogenic therapy, RTKi inhibits the tyrosine kinase activity of the vascular endothelial growth factor (VEGF) receptor, thereby blocking the VEGF pathway, but also platelet-derived growth factor receptors and c-kit . OxidatiCarbohydrate metabolism is altered in the myocardium of sunitinib-treated mice, which exhibits higher glucose uptake, higher gene expression of pyruvate dehydrogenase kinase, and of the pyruvate kinase isoform 2 , a signaIn a comparative study, only sorafenib among others RTKi directly impaired mitochondrial function and oxidative metabolism at clinically concentrations , but ROSAnother antiangiogenic approach consists of blocking VEGF with a humanized monoclonal antibody, which traps endogenous VEGF and inhibits its binding with the receptor. Bevacizumab was the first anti-VEGF antibody with a rate of sytemic hypertension as high as 70%, probably because of the vascular resistance, endothelial dysfunction, and capillary rarefection . BevacizHuman epidermal growth factor receptor 2 is a receptor that promotes cell growth, proliferation, and repair in the body. Tumors can hijack these functions to proliferate. Therefore, one treatment option is to specifically target this receptor, with anti-HER2 therapy, led by Trastuzumab, which has revolutionized the treatment and prognostic of patients with HER2 positive breast cancer . Trastuzvia endothelial cells of the altered coronary microvasculature , and its ligand. By reactivating the immune response against the tumor, ICIs can lead to immune-related cardiovascular adverse events that, although rare, present a case-fatality rate as high as 50% . The mosar level .Imaging modalities in cardio-oncology and their assessment of anticancer-drug-related cardiotoxicity are given in Perfusion imaging involves assessing the delivery of oxygen and nutrients to tissues through blood flow. It aims to describe microvasculature that can be altered under the effect of anticancer drugs. Since 1997, Hasdai et al. reported that coronary endothelial dysfunction may be associated with myocardial perfusion defects . Both raSymptomatic oxygen supply-demand mismatch can be evaluated invasively by invasive coronary angiography (ICA), but myocardial microcirculation disturbance can occur before any visible epicardial coronary on ICA , requiriAnother interesting measure to evaluate coronary microvascular dysfunction is the index of microcirculatory resistance (IMR) which isNuclear imaging techniques include single-photon emission computerized tomography (SPECT) and PET. These techniques are based on the detection of radioactive gamma rays and photons (after positrons annihilation) from an injected radioactive compound, respectively.201Tl-chloride, 99mTc- sestamibi, and 99mTc- tetrofosmin, is obtained by myocardial perfusion SPECT. SPECT is performed at rest and under stress, which can be achieved by exercise or pharmacologically with vasodilators reserve (MPR) . MPR is ve (MPR) .11C-acetate rest stress PET. Using the latter, a decrease in myocardial perfusion and oxygen consumption reserve in DOX-treated rats compared with the control animals has been reported such as creatine or lipids; containing carbon (13C) such as glucose, and containing phosphorus (31P) such as PCr or ATP can be assessed by CMRS. In addition, the development of 31P saturation magnetic resonance spectroscopy allows the measurement of the metabolic rate of ATP production via the enzyme creatine kinase (= CK flux) , 107.13C]glucose into isolated perfused hearts treated for 10 weeks with anthracyclines highlighted altered glycolytic metabolism complex and TCA flux, respectively for the assessment of cardiac glucose uptake. Because myocardial metabolism is tightly regulated, the heart switches from FFA metabolism to glycolysis in high-insulin/glucose levels and low oxygen by increasing its glucose transporter protein translocation to the plasma membrane for the assessment of myocardial FFA uptake and 2'-deoxy-2'-. The latter 99mTc-NOET would, therefore, be able to detect DOX cardiotoxicity through its mitochondrial damage.In SPECT imaging, in the same perspective, the usual cyclines . They prWe are convinced that the assessment of the mechanisms of anticancer drug cardiotoxicity by imaging is a cornerstone in the new era of cardio-oncology. We have seen throughout this review that most studies have been conducted in animal models. We are confident that this research has been and will be of great importance for the development of a standardized protocol to predict drug-related cardiotoxicity and to test preventive interventions.18F-FDG uptake on PET could be found in myocarditis, including in ICI myocarditis .The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."} +{"text": "Resveratrol is a phytoalexin present in plant-derived foods, including grape\u2019s skin, cocoa, and peanuts. Evidence suggests that it has beneficial effects on human health because of its antioxidant properties. However, there is limited knowledge about the part played by resveratrol in ovarian function. In this paper, the influence of resveratrol on granulosa cells (GC) was evaluated. In addition to being the main estradiol producers, GC are in direct contact with the oocyte, playing a fundamental role in its growth and development. The cell line COV434 and human granulosa cells (hGC), obtained from women undergoing assisted reproductive technology (ART), were used. GC were treated with resveratrol (0.001\u201320 \u03bcM) at different times (24\u201372 h). Low concentrations of this compound suggest a protective role, as they tend to reduce ROS/RNS formation after inducement of stress. On the contrary, high concentrations of resveratrol affect GC viability and steroidogenic function. As it may act as a direct modulator of GC oxidative balance, this work may help to clarify the impact of resveratrol on GC and the usefulness of this antioxidant as adjunct to infertility treatments. Resveratrol is a plant-derived polyphenol stilbene synthesized in response to mechanical injury, ionizing radiation, and fungal attacks . RES is Extensive clinical investigations indicate that dietary and lifestyle preferences can be associated with follicle growth and ovulation rates in women undergoing assisted reproduction technology (ART) ,12. SeveGranulosa cells (GC) play a major role in ovarian follicle and oocyte growth and maturation due to two essential functions: Cell proliferation and steroidogenesis . Thus, GDulbecco\u2019s modified eagle medium/F12 (DMEM/F12), resveratrol (R5010), H\u00f6echst 33342, methylthiazolyldiphenyl-tetrazolium bromide (MTT), dimethyl sulfoxide (DMSO), carbonyl cyanide m-chlorophenylhydrazone (CCCP), tert-butyl hydroperoxide (TBHP), and dichlorodihydrofluorescein diacetate (DCFH-DA) were bought from Sigma\u2013Aldrich Co., St. Louis, MO, USA. Antibiotic-antimycotic (AB-AM) was from Grisp. Trypsin (2.5%) and 3,3\u2032- dihexyloxacarbocyanine iodide (DiOC6) was from Gibco/Invitrogen Corporation, Carlsbad, CA, USA. Fetal bovine serum (FBS) came from Biochlome. The Pierce Lactate Dehydrogenase (LDH) cytotoxicity assay kit was from Thermo Fisher, Life Technologies. Dibutylphthalate Polystyrene Xylene (DPX) was from VWR-Prolabo. Percoll came from GE Healthcare, Buckinghamshire, UK). The adenosine triphosphate (ATP) assay kit (ab83355) was from Abcam, Cambridge, UK.Follicular fluid (FF) samples containing GC obtained from women undergoing assisted reproductive technology (ART) were collected, with their informed consent, at Unidade de Medicina da Reprodu\u00e7\u00e3o Dra. Ingeborg Chaves-Centro Hospitalar de Vila Nova de Gaia/Espinho. A total of 34 patients were involved in this study with a mean of age of 34 years old. The inclusion criteria were women with tubal factor infertility and couples with male factor-associated fertility undergoing ART. Women with endometriosis, tumor, or ovarian cysts, as well as women with hormonal factor-associated infertility were excluded. RES supplementation was not prescribed to the patients who took part in this study. All the procedures were carried out in conformity with the Declaration of Helsinki, endorsed by the local ethical committee and approved by Comiss\u00e3o de Prote\u00e7\u00e3o de Dados (Proc. no.764/2017).g, at 4 \u00b0C for 10 min, and the pellet was resuspended in DMEM/F12 medium and added to a Percoll:PBS density gradient in a ratio 1:1. Then, the tubes were centrifugated at 900\u00d7 g for 15 min at 4 \u00b0C. hGC were obtained at the interface of the FF and Percoll, washed, and resuspended in cell culture medium.Ovarian stimulation was performed accordingly to medical evaluation. When the follicles reached the adequate number and size, final maturation was induced, and oocyte retrieval was performed. For these reasons, a higher variability, acquired from the donors and ART procedures, may have occurred on these cells. Throughout oocyte aspiration FF was collected, the oocytes were isolated, and then removed for ART. The remaining FF was transferred to 50-mL polypropylene tubes. The GC were isolated and purified in accordance with a previously published protocol by Sluss et al. and individually cultured . In summSince a human granulosa cell line is a more robust and homogeneous model, the human granulosa cell line (COV434), which is derived from a primary ovarian solid tumor , was als4 cell/well and 7.5 \u00d7 104 cell/well, respectively, in 96-well plates . After 24 h, the cells were treated with RES (0.001\u201320 \u03bcM) and incubated for another 24, 48, or 72 h, depending on the experiment. The concentrations were chosen based on the lowest RES concentration found in the circulating plasma of human studies on the absorption and bioavailability of this compound [COV434 and hGC were plated at a density of 5 \u00d7 10compound . The hig4 cell/well for COV434 and 70 \u00d7 104 cell/well for hGC. After 24 h, RES (1\u20135 \u03bcM) was added to the cells. Forty-eight hours later, GC were observed under a phase contrast microscope and prepared for Giemsa staining. Cells were fixed with methanol, stained with Giemsa staining solution for 30 min and observed under a bright field microscope equipped with image analysis software LeicaQWin. For H\u00f6echst staining, cells were fixed, subjected to 0.5 \u03bcg/mL H\u00f6echst 33342 for 30 min, and further examined under a fluorescence microscope fitted with an excitation filter with maximum transmission at 360/400 nm.In order to evaluate morphological changes at the cellular level resulting from RES exposure, Giemsa staining was performed . Moreovem) study, RES was added (5\u201320 \u03bcM) and the cells incubated for another 24 or 48 h. The mitochondrial membrane-depolarizing agent CCCP (10 \u03bcM) was used as a positive control [6 probe for 30 min at 37 \u00b0C [COV434 and primary GC were seeded in 96-well plates and treated with different concentrations of RES. After 24 h, for the mitochondrial membrane potential . After 24, 48, or 72 h, we used the ATP colorimetric/fluorometric assay kit in agreement with the guidelines given by the manufacturer.2O2 (200 \u03bcM) for 20 min, with H2O2 considered as a positive control for this experiment [For the purpose of quantification of intracellular reactive oxygen and nitrogen species (ROS/RNS) generated, GC were seeded and 24 h later, RES (0.001\u20135 \u03bcM) was added. After 48 or 72 h, cells were incubated with Hperiment . Then, tperiment . The MicTo explore long-term antioxidant potential, cells were treated with different concentrations of RES for 72 h and incubated for 1 h with the DCFH-DA probe, prior to treatment with TBHP (5 \u03bcM). The protocol was adapted from Kim et al. . Finally4 cell/well and 70 \u00d7 104 cell/well, respectively. On the next day, RES was added at a final concentration of 0.01 and 5 \u03bcM. In addition, 1 unit of follicle-stimulating hormone (FSH) and 4-androstenedione , dissolved in DMSO, were added. After 72 h of incubation, cell culture media were collected, centrifuged, and stored at \u201380 \u00b0C. VIDAS\u00ae Estradiol II kits were used to study the estradiol secretion by resorting to the enzyme-linked fluorescent assay (ELFA). DNA isolation was performed using TripleXtractor reagent, , and quantified in the NanoDrop ND-1000 Spectrophotometer . Hormone levels were normalized to cell DNA.In order to study their steroidogenic function, COV434 and hGC were cultivated in 24-well plates at a density of 30 \u00d7 10\u00ae FAST qPCR Master Mix 2 \u00d7 kit in the MiniOpticon Real-Time PCR Detection System , as per the kit\u2019s protocol. Primer sequences and RT-PCR conditions for 16rRNA and GAPDH were as follows: 16S rRNA forward primer ACTTTGCAAGGAGAGCCAAA and reverse primer TGGACAACCAGCTATCACCA; annealing temperature (AT):59 \u00b0C; and GAPDH forward primer GGATGATGTTCTGGAAGAGCC and reverse primer AACAGCCTCAAGATCATCAGC; AT: 60 \u00b0C. Relative fold expression was analyzed by the 2\u2013\u0394\u0394Ct method.To ascertain the amount of mtDNA relative to nDNA, RT-PCR was carried out by measuring the proportion of the mitochondrial 16S rRNA gene and the nuclear GAPDH gene. In line with this, GC were plated in 24-well plates and different concentrations of RES (0.001\u201310 \u03bcM) were added. DNA was extracted with TripleXtractor reagent, and amplified with specific primers using the KAPA SYBRp-value < 0.05 was considered as statistically significant, although other p-values were also reported. Statistical analysis was conducted using GraphPad Prism software 7.0 .Statistical analysis was carried out using the one- or two-way analysis of variance (ANOVA) test followed by the post-hoc Tuckey\u2019s and Bonferroni test, respectively. In this line, one-way ANOVA was used for the quantification of ROS after stress induction, estradiol, and gene expression (16RNA/GAPDH) and two-way ANOVA for cell viability (MTT), LDH release, mitochondrial membrane potential, and ROS after 48 and 72 h. Means under comparison were obtained from at least three (maximum seven) independent experiments performed in triplicate. The results shown graphically are expressed as means \u00b1 SEM (standard error mean). A After 48 h of treatment, RES 0.001\u20130.01 \u00b5M promotes a significant increase in COV434 cell viability a. On theRegarding hGC, we found that RES also had an effect on cell variability at different concentrations and times when compared to the control. However, in contrast to COV434, no clear pattern to these findings was observed. In hGC, RES promoted a significant increase in cell viability c. In addThe concentrations of 1\u20135 \u00b5M of RES were chosen for morphological studies since COm at 48 or 72 h a,b. NeveGC estradiol secretion was evaluated by the ELFA technique. To understand the possible impact on estradiol production after long periods of RES intake, a 72-h treatment and two different RES concentrations, one lower and one higher, were chosen a,b. CellResveratrol is often used in nutritional supplements and it is known as a potent antioxidant and anti-inflammatory compound . Our datNevertheless, in our studies, we failed to notice COV434 apoptotic cell death as no suggestive nuclei alterations were observed; nor were target differences in ROS production and mitochondrial membrane potential analysis. Interestingly, Ortega et al. showed that RES in rat ovarian GC induced a biphasic effect on DNA synthesis, inhibiting it at higher concentrations (10\u201330 \u03bcM) . HoweverSince mitochondria are important for energy production and steroidogenesis , in addiAlthough RES does not induce ROS/RNS generation after 72 h, this natural compound protects both GC models from stress induction. Accordingly, a study conducted by Kolesarova and collaborators, using porcine GC, suggests that toxicity induced by deoxynivalenol is inhibited by RES, proposing a protective effect by this natural compound . In addiRegarding steroidogenic function, previous reports of RES reveal that it has a similar affinity with estrogen receptors ER\u03b1 or ER\u03b2 and interferes with the functions of E2 . It has Finally, RES supplementation may be of interest for women who have fertility complications, since lower doses of this natural antioxidant represent a decrease on oxidative stress that is highly associated with several reproductive pathologies ,51. BaseOur work suggests that low doses of RES may promote follicle quality and reduce oxidative stress in the ovarian microenvironment. Lower concentrations of RES have a protective effect against induced-oxidative stress on COV434 and primary GC. The primary GC were more resistant to this natural compound than COV434. In fact, higher concentrations of RES resulted in decreased viability of COV434. Although some evidence points to the beneficial effects of RES on different follicle models ,58, more"} +{"text": "EV), we evaluated their potential as surrogate markers for disease progression or eligibility criteria for PD-1 immune checkpoint inhibition (ICI) approaches in early triple-negative breast cancer (TNBC).Based on the tumor-promoting features of extracellular vesicles (EV) and PD-L1/2-bearing EV subpopulations subpopulations.After enrichment of EV from plasma samples of 56 patients before and 50 after chemotherapy (CT), we determined levels of EV particle number and PD-L1/2EV but not PD L1EV levels. The most important clinical implications were found for PD-L2EV. High PD-L2EV levels were associated with a significantly reduced 3-year progression-free and overall survival (PFS and OS). A loss of PD-L2EV after CT was significantly more prominent in patients achieving pathological complete response (pCR). Increased pre-CT PD-L2EV levels were found in patients having NOTCH1-positive or ERBB3-positive CTC. The presence of ERBB3-positive CTC combined with high pre-CT PD-L2EV resulted in a shorter PFS.Compared to healthy controls, patients had a tenfold higher EV concentration and significantly elevated PD L2EV as a promising biomarker for risk assessment of TNBC patients and represents the basic for additional studies introducing PD-L2EV as an eligibility criterion for PD-1 ICI approaches.This study highlights PD L2The online version contains supplementary material available at 10.1007/s00432-022-03980-9. Breast cancer (BC) is the most common cancer in women worldwide with almost 2.1 million new diagnoses in 2018 , a surrogate marker for improved progression-free survival (PFS) and OS, about 5\u201320% of patients eventually experience relapse derived from BC has the capacity to transfer functional active PD-L1 to other cells and to interact with PD-1 receptor, which results in the inhibition of T cell activation as well as T cell killing of BC cells have attracted less interest as a biomarker in BC or other tumor entities.Since access to tumor tissue is limited, the use of blood as a liquid biopsy, comprising circulating tumor cells (CTC) and extracellular vesicles (EV) with their subpopulations represents a promising platform to establish surrogate markers in TNBC. The molecular characterization of CTC mRNA profiling has already identified certain combinations of CTC subpopulations being associated with outcome in primary TNBC or after (n\u2009=\u200950) chemotherapy (CT) from 64 primary TNBC patients. EV particle concentrations and levels of PD-L1/2EV subpopulations were analyzed in association with (i) routinely determined clinical parameters, (ii) the presence of distinct CTC subpopulations, and (iii) their prognostic importance in terms of PFS and OS.Despite the established tumor-promoting role of EV within the tumor microenvironment, it has not been clarified at all, whether EVs derived from liquid biopsies of the blood and/or their subpopulations of PD-L1 and PD-L2 are meaningful surrogate marker(s) for disease progression or potential meaningful selection element(s) for PD-1 ICI therapy approaches in TNBC. To address these issues, we enriched circulating EV from 106 plasma samples procured before diagnosed between January 2013 and August 2018, were enrolled in this study (Table https://www.ago-online.de) including NACT and ACT (adjuvant chemotherapy) and radiotherapy. Four patients received the PARP-inhibitor Olaparib in a clinical trial ; 59 patients received chemotherapy in the neoadjuvant setting; four patients were in the adjuvant setting; one patient received no chemotherapy. The tumor type, TNM-staging, grading and Ki67 were assessed at the Institute of Pathology, at the University Hospital Essen as part of the West German Comprehensive Cancer Centre for each of the 64 patients. Pathological response to chemotherapy was defined according to the grading system of Sinn et al. . Informed consent was obtained from all subjects involved in the study.g for 10\u00a0min. Subsequently, the upper phase was stored at\u2009\u2212\u200980\u00a0\u00b0C until usage.Ethylene-diamine-tetra-acetic acid (EDTA) blood was collected for the isolation of CTC before the application of therapeutic substances with an S-Monovette (Sarstedt AG & Co.) and stored at 4\u00a0\u00b0C until further examination. The samples were processed within 4\u00a0h after blood collection. EDTA samples from 16 age-matched healthy females [median (range): 47 (35\u201362) years] served as control panel. Plasma samples of each patient were generated from EDTA blood and centrifuged at 1500\u2009\u00d7\u20096 per ml . Before EV precipitation by ExoQuick\u2122, all samples were spun down at 3000\u00a0g for 15\u00a0min. Subsequently, 250\u00a0\u03bcl of plasma supernatant was added to 63\u00a0\u03bcl ExoQuick\u2122 reagent and incubated over night at 4\u00a0\u00b0C. Thereafter, the samples were centrifuged at 1500\u00a0g for 30\u00a0min in the cold (4\u00a0\u00b0C), supernatants were discarded from the samples and again centrifuged at 1500\u00a0g for 5\u00a0min in the cold. The remaining pellets containing the EV were re-suspended in 250\u00a0\u03bcl 0.9% NaCl and stored at -20\u00a0\u00b0C. Characterization of EV preparations was performed by nano-tracking analysis using ZetaView Laser Scattering Video Microscope and its corresponding software (version 8.03.08.02). To this end, EV preparations were regularly diluted 1:50,000 in PBS to obtain particle concentrations of approx. 1\u2009\u00d7\u200910EV and PD-L2EV) were quantified in the EV-enriched preparations undiluted by commercial ELISA kits , as previously described as recently described were used for 46 TNBC patients pre- and for 44 post-CT. The methods require transcript-specific pre-amplification of 6.25\u00a0\u00b5l cDNA using Multiplex PCR Master Mixes with 18 PCR cycles. Pre-amplified cDNA was used in duplicates for one of the 18 transcripts in a reaction volume with SYBR Green-based components in total of\u00a010\u00a0\u00b5l. RT-qPCR was performed with the StepOnePlus\u2122 real-time system. CTC expression data were normalized to matched expression data of healthy donor controls. CTC isolation was performed in duplicate for each patient and cDNA was analyzed separately from these duplicates. After binary evaluation of the qPCR data, signals per patient were regarded positive if at least one of the sample duplicates showed a positive \u2206(\u2206)Cq value. Establishment of the method including data evaluation has been described in detail recently analysis was performed to calculate optimal cut-off values concerning sensitivity and specificity for stratifying continuous parameters into dichotomous variables, using the BIAS 11.10 software program (http://www.bias-online.de/). Probabilities of OS and PFS were analyzed using the Kaplan\u2013Meier method in combination with the Mantel\u2013Cox log-rank test implemented in the R package survminer . For patients, groups\u2009>\u20092 multiple comparison of OS and PFS probabilities among groups were performed using the Peto-Pike log-rank test (BIAS 11.10 software program: http://www.bias-online.de). Starting points were time point of diagnosis (blood collection) and endpoints were death from BC and relapse of BC. Differences with a p value\u2009<\u20090.05 were considered statistically significant.All statistical analyses were performed using IBM SPSS Statistics Version 23 and GraphPad Prism V8.43 software . With the exception of the size of EV, which is presented as mean\u2009\u00b1\u2009SD, all metric parameters are given as median and range. After testing for distribution, continuous and categorical variables were compared using Mann\u2013Whitney n\u2009=\u200955]- and post-CT were more than tenfold (p\u2009<\u20090.0001) increased compared to those of HC were similar to the ones of HC as compared to patients with a negative nodal one pg/ml). Levels of pre ). However, pre- and post-CT PD-L2EV levels did not substantially vary - and post-CT PD-L2EV levels did not correlate with levels of EV particles. Of note, PD-L2EV could only be detected in one out of 16 EV preparations derived from plasma samples of HC, whereas with one exception, all EV preparations derived from pre- and post-CT plasma samples did contain PD-L2EV (p\u2009<\u20090.0001).In contrast to PD-L1EV levels, the differences between PD-L2EV levels of pre- and post-CT PD-L2EV levels (\u0394 PD-L2EV) were defined in paired plasma samples of TNBC patients (n\u2009=\u200942). A clear reduction of PD-L2EV levels post CT was observed for 13 out of the 42 TNBC patients more prominent in patients with pCR compared to patients with pPR and compared to patients with pathological non-response . Regarding EV levels [median (range) pg/ml], patients with pCR had a significant lower level than patients with pPR or patients with pNR . The multiple comparison by Dunns test revealed that the median of \u2206PD-L2EV obtained from patients with pCR was significantly reduced compared to median of patients with pNR (p\u2009=\u20090.011) but not reduced compared to median of patients with pPR (p\u2009=\u20090.171). At contrast to PD-L2EV, a reduction of EV particle concentration or PD-L1EV levels post CT was less frequent and not associated with pCR (data not shown).Stratification of patients according to their therapy response Fig.\u00a0b evidencEV/PD-L2EV provide tumor-supporting characteristics within the tumor microenvironment [2\u20135], their pre- and post-CT levels were analyzed with respect to presence or absence of specific CTC subpopulations including AKT2, ALK, AR, AURKA, BRCA1, KIT, MET, EGFR, ERCC1, ERBB2, ERBB3, KRT4, mTOR, NOTCH 1, PARP1, PIK3CA, SRC. CTC subpopulations pre-CT were not associated with increased EV particle levels (data not shown). However, pre-CT median levels of PD-L1EV and PD-L2EV were more than eightfold elevated in patients with NOTCH1-positive CTC (n\u2009=\u20094) compared to the ones (n\u2009=\u200942) with CTC not expressing NOTCH1 in patients with ERBB3-positive CTC compared to patients without ERBB3-positive CTC compared to patients without SRC-positive CTC , and PD-L2EV levels were higher in patients harboring ERBB3 -positive CTC compared to corresponding NOTCH1-negative or with BRCA1-positive CTC than in patients with CTC not expressing ERBB3 or BRCA1- , n\u2009=\u200916] could be identified for SRC CTC-positive patients versus to the SRC CTC-negative patients subpopulation [75 (21\u20131970), n\u2009=\u200926, Fig.\u00a0For the post-CT situation Fig.\u00a0, an asso [12.0 3.\u201320, n\u2009=\u2009 [12.0 3.\u201320, n\u2009=\u2009 [12.0 3.\u201320, n\u2009=\u2009 [12.0 3.\u201320, n\u2009=\u2009 [12.0 3.\u201320, n\u2009=\u2009 [12.0 3.\u201320, n\u2009=\u2009EV levels, ROC analyses were performed to define the best threshold value regarding the prediction of PFS and OS of TNBC patients after CT. A pre-CT PD-L2EV cut-off level of 157\u00a0pg/ml was related to the probability of PFS and OS , whereas no relevant cut-offs could be identified for the other pre- or post-CT markers (data not shown). Using the pre-CT PD-L2EV threshold, the Kaplan\u2013Meier 3-year probabilities of PFS : 8.98, 95% confidence interval (CI): 1.80\u201344.83, respectively).For pre- and post-EV particle concentration and PD-L1/L2EV were associated with the presence of ERBB3-positive CTC, patients were stratified by having PD-L2EV\u2009<\u2009157\u00a0pg/ml and no ERBB3-positive CTC (group 1), having either PDL-2EV\u2009>\u2009157\u00a0pg/ml or ERBB3-positive CTC (group 2), and having PD-L2EV\u2009>\u2009157\u00a0pg/ml and ERBB3-positive CTC (group 3) pre-CT. These patients\u2019 groups presented different PFS probabilities displayed with a median PFS time of 19\u00a0months a shortened PFS probability compared to the patients\u2019 group 1 . However, these two groups were not significantly different concerning OS probabilities (data not shown). Even more, the stratification according to PD-L2EV and ERBB3 status post CT as well as the stratification of PD-L2EV and NOTCH1 CTC status pre/post-CT did not identify patients with high risk of early progression or a reduced OS (data not shown).As high PD-L2In early TNBC, the choice of immunotherapy in combination with chemotherapy is a promising therapeutic option to significantly improve pCR and EFS .Interestingly, the most important clinical implications could be demonstrated for PD-L2Higher EV concentrations in our patients\u2019 cohort are in line with our recently published data for advanced, non-metastatic BC patients . Comparable data were shown in head and neck squamous cell carcinoma with both, PD-L1 and PD-L2 positivity in tumor, stromal and immune cells significantly predicting clinical response to pembrolizumab Below is the link to the electronic supplementary material."} +{"text": "LFSMP is based on plasmonic scatteringimaging and thus can directly image the surface-captured moleculeswithout labels and quantify the binding kinetics. In this paper, wedemonstrate the detection principle for LFSMP, study the phosphorylationof protein complexes involved in a signaling pathway, and investigatehow kinetic analysis can be used to improve the pulldown specificity.We wish our technique can contribute to uncovering the molecular mechanismsin cells with single-molecule resolution.Precise and sensitive detection of intracellular proteinsand complexesis key to the understanding of signaling pathways and cell functions.Here, we present a label-free single-molecule pulldown (LFSMP) techniquefor the imaging of released cellular protein and protein complexeswith single-molecule sensitivity and low sample consumption down toa few cells per mm A plasmonic imaging technique for quantifying intracellularprotein complexes at the single-molecule level using only dozens ofcells is demonstrated. This taskis often accomplished by polyacrylamide gel electrophoresis (PAGE)and Western blot, which separate the proteins and probe the proteinof interest using antibodies.8 Nevertheless, conventional PAGE and Western blotrequire a substantial number of cells (at least thousands)10 to reach a sufficient signal-to-noise ratio, which limits the detectionof rare cells or low-abundance proteins. Recently, a technique calledsingle-cell Western blot (scWB) has been developed to probe proteinswith single-cell resolution.12 Although scWB has improveddetection sensitivity, it denatures protein complexes , making it difficult to interpret their native compositionand function in cells.In cells, proteins transduce signals andcarry out their functionsvia phosphorylation and assembly into protein complexes.13 such as single-moleculepulldown (SiMPull),16 single-molecule coimmunoprecipitation,17 and single-molecule fluorescence resonance energytransfer (FRET),18 have emerged as sensitiveand nondestructivetools for measuring intracellular protein complexes and their composition.However, apart from being time-consuming, the genetically encodedor chemically attached fluorescent tags may introduce a complicationby interacting with off-target proteins or altering the interactionaffinity.20 In addition, fluorescence is not applicablefor long-term and continuous imaging due to photobleaching, whichaffects measuring the binding kinetics of proteins.21To address these problems, single-moleculefluorescence techniques,23 a single-molecule platform that measures the scattering light fromeach individual molecule. The scattered light intensity is proportionalto the molecular weight, with a dynamic range from \u223c100 kDato several MDa, making LFSMP particularly suitable for protein complexdetection. The label-free feature also enables kinetics analysis ofthe captured complexes. Compared to Western blot technologies, LFSMPmeasurements can be performed using as few as several cells. And mostimportantly, LFSMP does not denature the native structure of proteincomplexes; thus, the composition and function of the complexes areretained.Here, we present a label-free imaging approach tomeasure intracellularproteins and protein complexes. The principle resembles SiMPull, exceptthat the proteins are imaged without labels, so we call it label-freesingle-molecule pulldown (LFSMP). In LFSMP, the molecules releasedfrom cells are imaged using plasmonic scattering microscopy (PSM),25 To collectthe released molecules rapidly and efficiently after cell lysis, wefabricated a thin flow channel (51 \u03bcm in height) with adherentlive cells cultured on the top glass surface and the associated evanescent field on the surface. The scatteredlight by the molecules as well as by the surface roughness withinthe field are collected by an objective on top of the flow channeland imaged by a CMOS camera ranging from 66 kDato 2.3 MDa to establish a relationship between MW and scattering intensity.The single molecules landing on the surface generated bright spots,immunoglobulin A (IgA), thyroglobulin (Tg), immunoglobulin M (IgM),and low-density lipoprotein (LDL) could be readily imaged with single-moleculeresolution . However, bovineserum albumin (BSA) did not have enough signal-to-noise ratio (SNR)due to its small size and insufficient scattered photons. A blanksample containing only phosphate-buffered saline was used to determine the system noise level.The mean + 3 \u00d7 standard deviation (s.d.) of the blank was definedas the detection limit, which was 385 kDa in MW. We use this numberas a threshold to exclude small proteins or low-SNR spots for thefollowing protein complex measurements.The capability of PSM for imaging single moleculeshas been demonstratedpreviously.4 \u03bcm2, and the bottom surface was blockedwith BSA. Live cell imaging buffer was flowed in the channel at aconstant flow rate of 50 \u03bcL/min to maintain cell viability.Before cell lysis, only a few secreted molecules were imaged on thebottom surface with a hitting rate of <1 hit/min, which was dueto the low level of macromolecule secretion. In contrast, upon introducingcell lysis buffer, a sudden increase of released molecules was observedwith \u223c1000 hits/min, indicating immediate lysis of the cells.Some extremely strong scattering signals could be occasionally observed,which was likely due to cell debris and organelles (Supplementary Movie 1) because the detergent we used was mild.14 The hit rate is proportional to the proteinconcentration, as confirmed by a calibration measurement , and 1000 hits/min is equivalent to550 nM according to the calibration. Supplementary Movie 2). The MW of each single molecule is determined usingthe curve in 24We next studied thecell lysis process with PSM. The cells werecultured on the top surface at a confluence of 10% or 1.25 cells/10surement S3, and 1surement S3, and 1surement S3, and 1Supplementary Movie 3). Therefore, we adopted this method for our measurements to increasethe reaction efficiency. Another important factor that affects thehitting rate is cell confluence. By measuring three sensor chips withdifferent confluences, we found substantial variations in the hittingrate to demonstrate specific pulldownof single molecules from lysed cells. mTOR is an intracellular proteinthat plays a central role in regulating metabolism, growth, and proliferation,by forming two structurally and functionally distinct complexes, mTORcomplex 1 (mTORC1) and mTOR complex 2 (mTORC2). Malfunction of mTORChas been linked to diseases such as cancer and diabetes.Non) or leaving(Noff) events over a period of time, thenet counts of captured molecules is obtained by Ncap = Non \u2013 Noff. To check whether the captured moleculeswere caused by specific binding, we compared the Ncap of the anti-mTOR coated surface and that of a BSAcoated surface. Molecules bound to BSA should be nonspecific; thus,the BSA surface serves as a negative control. As an illustration, Ncap from >25 measurementsand found anti-mTOR did not show a higher Ncap statistically . The specific capture of mTORC was also confirmedwith a fluorescence measurement . Taken together,the above results suggest our method can pull down cellular moleculeswith good specificity.To capture mTORC, we functionalizedthe channel bottom surface with anti-mTOR and blocked the nonspecificsites with BSA, which is a common blocker in immunoassays 2a. We destically 2d. This ts (Non) 2e. As suolecules 2g. The MSupplementary Movie 4). The counts and mass distribution are shown in Protein complexes are involved in many signaling pathways. Probingsuch protein complexes usually requires denaturation, separation,and detection by SDS-PAGE and Western blot, which totally breaks thenative structure of the complexes 3a. LFSMP30 Under low-glucose conditions, AMPK is activated via phosphorylation,which reduces the activity of mTORC1 by phosphorylating one of itscomponents, Raptor. We used an anti-Raptor coated chip to capturethe released mTORC1 from normal cells and glucose-starved cells. Anti-Raptorcan bind to both phosphorylated and unphosphorylated Raptor, thusreflecting the total Raptor level. A markedly higher level of Raptor(P = 0.0042) was found for the starved group to stimulateAMPK phosphorylation.32 As expected, thep-Raptor level was elevated compared with the normal cells (P = 0.041) but still much lower than the starved group (P = 4.2 \u00d7 10\u20134). The results wereconfirmed by Western blot using cell lysates for the pulldown measurement. A higher level of phosphorylatedRaptor (p-Raptor) was observed in starved cells compared with normalcells ( \u00d7 10\u20136) 3f, consi lysates 3g. TogetNon and Noff for the mTORC\u2013anti-mTOR interactionas a function of time , dissociation rateconstant (kd), and dissociation constant(KD) are found to be 1.9 \u00d7 102 M\u20131 s\u20131, 1.0 \u00d7 10\u20136 s\u20131, and 5.2 nM, respectively,which are indicative of strong binding. Note that the beginning ofassociation is mass transfer limited due to cell lysis, but we neglectthis effect considering the lysis was rapid (\u223c1 min) comparedwith the whole association phase (\u223c30 min).The label-free feature of LFSMP allowsus to analyze the single-molecule binding in detail. Like the traditionalensemble SPR technique, we measured the binding between anti-mTORand released mTORC in three phases, i.e., baseline, association, anddissociation 4a. In th of time 4b. Theircscurve 4c.By fix, y),image intensity (or MW), and the timestamp (t) . After comparing the x, y, MW, and t pairwise, we identifiedthe binding event and unbinding event from the same single molecule.The criteria for assigning two events (1 and 2) to the same moleculeare (1) the distance between and is smaller than the diffraction limit; (2)the difference of MW should fall within the measurement error; and(3) binding always occurs before unbinding (t1 < t2). These analyses arefeasible only if the imaging system is stable enough; otherwise, theimaging region would drift away, and the molecule is lost. Our prismbased PSM system owns excellent stability with negligible or correctabledrift even after 1 h of continuous image recording , which allows us to precisely locate the same molecule.The curve in ton) and unbinding (toff) are linked with a line, and the length tcap = ton \u2013 toff represents the capture time. Most moleculesonly stayed on the surface for a short time, so the ton and toff are almost overlapped.We only plot molecules with tcap >3 minin tcap, weobtained the lifetime distribution of binding events (ton and toff identified areincluded in the histogram. Those that only have ton but did not come off after the dissociation processare plotted separately aside the histogram (blue bar). These moleculesare the same ones left at the end of dissociation in Rcap) shown in the abovesections are obtained using the irreversibly bound molecules, whichcontain massive nonspecific components. A reasonable way to filterout the irreversible nonspecific binding signal would be to examinethe data in the reversible binding domain. To test our hypothesis,we performed a control experiment using a BSA coated surface, whichonly contributed to nonspecific signals . Theseresults confirm the validity of using the reversible domain to improvedetection specificity.g events 4e, with signals 4g,i. The0.52min 4h compartcap ranges from zero to severalminutes, and the short tcap is from unboundor weakly bound molecules, which is unlikely because of the strongspecific binding between antibody and protein. Thus, the short tcap should be rejected. To find out the connectionbetween tcap and specific binding, wefirst arbitrarily set a threshold to tcap at 3 min, which separates tcap intoa weak binding region and a strong binding region and BSA surfaces (RBSA) /RAnti-mTOR, is a measure of the abundance of specific binding, which increaseswith the threshold and approaches \u223c1 at threshold = 6 min 4j. The r = 6 min 4k. This Figure S2). This peak broadening effect can be mitigated by functionalizingthe surface with antibodies to capture the molecule. Although thisstrategy has been used in our previous PSM studies for pure samplemeasurements,22 it is not applicable formeasuring multiple types of proteins simultaneously in a mixture,such as cell lysate. This is simply because one cannot modify thousandsof different antibodies to the surface at the same time, not to mentionif they are available. Yet, the specific pulldown of one complex fromlysate should report an accurate MW. The calibration curve in 23In PSM, the MW is determined by the number of scattered photonsby molecules within the evanescent field. Considering the exponentialdecay of the field, the same molecule scatters less photons when itis away from the surface. The same issue applies for a molecule thatdoes not stay in the field for enough time. Consequently, the measuredMW shows a wide distribution S2. This f, can becalculated using f \u2248 4Drc,34 where D is the diffusioncoefficient of protein (5 \u00d7 10\u201311 m2/s),35r is the radiusof the imaging area (\u223c6 \u03bcm), and c isthe protein concentration. The number of hitting events recorded byPSM (or effective hitting rate) is found to be proportional to thesample concentration, given by feff = kc, as determined by measuring different concentrationsof IgM . Thus, the hitting event imaging efficiencyis E = feff/f = 4.0 \u00d7 10\u20135. This number implies that thecollisions of most unbound molecules are not recorded. For bound molecules,however, they do not leave the surface after hitting, so all the hittingevents should be recorded.The collision process of an unbound molecule to the surface includesa hitting event and a leaving event, which generate a bright spotand a dark spot on PSM image, respectively 2b. If th4 \u03bcm2 density is about feff = 1000hits/min, which is 590 nM in concentration. Using 104 \u03bcm2 as the surface area and 51 \u03bcm as channel height, thetotal number of molecules released by the single cell is 1.8 \u00d7108. Note that this number measured by PSM represents largecomplexes with MW > 385 kDa but not the total number of intracellularproteins. According to an estimation by Milo,36 the total number of proteins in a HeLa cell is about 1 \u00d7 1010. Thus, our result implies that the number of large complexmolecules constitutes \u223c2% of the total protein in HeLa cell.Using the hitting rate, we can estimate the total number of proteincomplexes in the cell. Figure S5). A feasible solution is usingmicrowell arrays that can trap the released molecules. An additionalbenefit of using microwells is that the small volume 37 concentratesthe molecules and increases the hitting frequency. Assuming an adherentsingle cell in a microwell corresponds to 60% confluence, feff = 104 hits/min can be readilyachieved with the central wavelengthat 660 nm. The light was first conditioned by a lens group and thenfocused onto the back focal plane of a 100\u00d7 objective. The focusedGaussian beam from the objective was then projected to the prism surfaceusing another group of lenses with an incident angle of 71\u00b0 forSPR excitation. The reflected light from the gold film was collectedby a CMOS camera to assist finding the correctSPR angle. The scattered light from the gold film surface was collectedby a 60\u00d7 objective and imagedby another CMOS camera . See l-lysine, N-hydroxysulfosuccinimidesodium salt (NHS), N-(3-(dimethylamino)propyl)-N\u2032-ethylcarbodiimide hydrochloride (EDC), and O-(2-carboxyethyl)-O\u2032-(2-mercaptoethyl)heptaethyleneglycol (SH-PEG8-COOH) were purchased from Sigma-Aldrich. Methyl-PEG4-thiol(MT(PEG)4) was purchased from Thermo Fisher Scientific.PEG2k was obtained from Nanocs. The materials and chemicals for SDS-PAGEwere purchased from Bio-Rad if not stated specifically.Human colostrum immunoglobulin A (IgA), humanplasma immunoglobulin M (IgM), and human low-density lipoproteins(LDL) were purchased from Athens Research and Technology. Rabbit Raptorantibody and rabbit phospho-Raptor antibody were purchased from CellSignaling Technology. DyLight 488 goat anti-rabbit IgG was purchasedfrom MyBiosource. Mouse mTOR antibody was purchased from Invitrogen.Phosphate-buffered saline (PBS) was purchased from Corning. Bovineserum albumin (BSA), human thyroglobulin (Tg), 5-aminoimidazole-4-carboxamide(AICAR), poly-2. To active the phosphorylation of Raptor,the cells were cultured in either glucose-free DMEM for 24 h or innormal DMEM with 1 mM AICAR for 1 h before the experiment. All theDMEM was supplied with 10% fetal bovine serum (Invitrogen) and 1%penicillin and streptomycin (BioWhittaker). For PSM imaging, the cellswere harvested at 75% confluence, diluted, and transferred to thesurface of a preassembled, poly-l-lysine treated flow channeltop piece .HeLa cells were obtained from the AmericanType Culture Collection. The cells were cultured in Dulbecco\u2019sModified Eagle Medium in a humidified incubator at 37\u00b0C with 5% COg at 4 \u00b0C. The supernatant was collected, and the protein concentrationwas measured with BCA assay . Theproteins were resolved by SDS-PAGE and transferred to a PVDF membranefor Western blotting. The detection signal was amplified by enhancedchemiluminescence Cells were removedfrom the flask using trypsin-EDTA and suspended in PBS followed by incubating in ice-cold 1\u00d7 lysisbuffer with protease inhibitor for 10 min. The lysate was sonicated for30 s and then centrifuged for 10 min at 14\u202f0002, and annealing witha H2 flame, the gold film was soaked in a solution containing0.2 mM SH-PEG8-COOH and 0.2 mM MT(PEG)4 overnight. Then,the COOH groups were activated by incubating the film with 50 mM NHSand 200 mM EDC for 20 min. Next, 300 nM antibody in PBS was immediatelyadded to the gold surface and incubated for 1 h to allow immobilizationof the protein. Note that prior to protein immobilization, the bufferwas transferred to PBS using Zeba desalting columns (Thermo Scientific)if the original buffer was not pure PBS. Ethanolamine (20 mM) wasused to quench the remaining active sites for 10 min. Finally, thefunctionalized gold film was blocked with 0.1% BSA for 10 min. TheBSA blocked chips were made by incubating the NHS/EDC activated surfacewith 0.1% BSA for 1 h. The PEG2k blocked chips were fabricated byincubating clean gold film in 100 \u03bcM PEG2k overnight.The gold film was fabricatedby coating a No. 1 cover glass with 1.5 nm Cr and then 43 nm goldusing an e-beam evaporator. After rinsing with ethanol and DI watereach for three times, drying with NThe flow channel consists ofthree parts: an antibody-functionalized gold film on the bottom, acover glass on the top, and a spacer in between. The top cover glass was drilled with two holes ,which served as the inlet and the outlet. Plastic tubing was connected to the holes via a small PDMS block. The flowchannel spacer was made by laser-cutting a 51 \u03bcm thick double-sidedtape , which sticked the top and bottom pieces together.The image sequence was recorded usingXIMEACamTool and processed using Fiji. After recording the raw image sequence,a differential image sequence was obtained by subtracting the previousframe from each frame. The common background was removed in the differentialimages, and single-molecule spots were revealed. After smoothing theimages with the smooth function in Fiji, the single-molecule spotswere counted, and the intensity was measured using TrackMate, a pluginintegrated in Fiji. The intensity was measured by selecting an Airydisc sized region, which was about 1 \u03bcm in diameter."} +{"text": "Sphingolipidoses are defined as a group of rare hereditary diseases resulting from mutations in the genes encoding lysosomal enzymes. This group of lysosomal storage diseases includes more than 10 genetic disorders, including GM1-gangliosidosis, Tay\u2013Sachs disease, Sandhoff disease, the AB variant of GM2-gangliosidosis, Fabry disease, Gaucher disease, metachromatic leukodystrophy, Krabbe disease, Niemann\u2013Pick disease, Farber disease, etc. Enzyme deficiency results in accumulation of sphingolipids in various cell types, and the nervous system is also usually affected. There are currently no known effective methods for the treatment of sphingolipidoses; however, gene therapy seems to be a promising therapeutic variant for this group of diseases. In this review, we discuss gene therapy approaches for sphingolipidoses that are currently being investigated in clinical trials, among which adeno-associated viral vector-based approaches and transplantation of hematopoietic stem cells genetically modified with lentiviral vectors seem to be the most effective. Sphingolipidoses are defined as rare hereditary diseases belonging to the group of lysosomal storage diseases (LSD). LSDs are a group of approximately 50 genetic disorders caused by mutations in the genes encoding enzymes that are involved in cellular degradation and transport of lipids and other macromolecules. Abnormal accumulation of lipids and other macromolecules in lysosomes results in death of affected cells. Although clinical manifestations of different LSDs vary greatly, over half of LSDs are associated with nervous system degeneration symptoms ,2,3,4,5.Sphingolipidoses include more than 10 diseases, such as GM1-gangliosidosis, Tay\u2013Sachs disease, Sandhoff disease, the AB variant of GM2-gangliosidosis, Fabry disease, Gaucher disease, metachromatic leukodystrophy, Krabbe disease, Niemann\u2013Pick disease type A and B, Farber disease, combined saposin (Sap) deficiency, SapA deficiency , SapB deficiency , and SapC deficiency . To date, sphingolipidoses disorders remain incurable, with extremely limited therapeutic variants. However, in recent decades, there has been an active search to find new effective therapeutic approaches for this type of disease. Currently used approaches include bone marrow transplantation (BMT) ,39,40,41BMT is believed to be able to correct metabolic defects and lead to improved metabolism in most patients. Hematopoietic stem cells (HSCs) are known to be a source of lysosomal enzymes, but their expression level in native HSCs is sometimes insufficient. However, genetically modified HSCs have shown more promising outcomes , which wERT is considered the current standard of care for sphingolipidoses, and most currently approved drugs are based on this type of treatment. However, most sphingolipidoses affect the central (CNS) and peripheral nervous systems, which is a limiting factor for the use of ERT ,60. Gene+ HSCs (CD34+) genetically modified with a retroviral vector. This clinical trial is the only one to use a retroviral vector in sphingolipidoses. In 1996, C. Dunbar and D. Kohn published a detailed protocol for a clinical study involving 24 patients with Gaucher disease who were treated with a retroviral vector encoding the \u03b2-glucocerebrosidase 1 (GBA1) gene [The first clinical trial of a gene therapy approach was registered in 1988 (NCT00001234). The study included 120 patients with Gaucher and Fabry diseases with the aim of investigating the therapeutic effect of transplantation of autologous CD34A1) gene . Later iA1) gene .+ cells transduced with lentiviral vectors (LV). Due to their good safety profile and successful recent clinical trials that have led to the registration of several gene drugs, these strategies have been broadly developed.Further gene therapy approaches for sphingolipidoses have developed mainly in two directions, leading to the registration of clinical trials using either vectors based on adeno-associated viruses (AAV) or transplantation of CD34According to the clinicaltrials.gov database, a total of 29 clinical trials aimed at studying gene therapy for sphingolipidoses have been registered to date , among wRPE65 gene [AAVs are well known to be the safest vectors for gene therapy, and many studies have shown their efficacy both in various animal models and human patients. To date, five AAV-based drugs have been approved. In 2012, the European Medicines Agency (EMA) approved the first AAV-based gene drug, Glybera, which is an AAV serotype 1 (AAV1). The drug was developed for the treatment of hereditary lipoprotein lipase deficiency. However, it turned out to be commercially unprofitable due to the rarity of the disease (1\u20132 cases per 1 million people), and its production was therefore discontinued ,100,101.aurosis) ,102. Zolaurosis) ,104. In aurosis) , while HGLB1 gene are undergoing clinical trials: AAV9, AAVhu68, and AAVrh10. These serotypes were chosen for their ability to cross the blood\u2013brain barrier (BBB) and effectively transduce nerve cells, as patients with GM1-gangliosidosis primarily suffer from progressive degeneration of neural tissue. AAV9 [GM1-gangliosidosis results from mutations in the \u03b2-galactosidase 1 (GLB1) gene, which, in turn, cause enzyme deficiency and accumulation of GM1-ganglioside in various tissues of patients, predominantly affecting the nervous system . Currentue. AAV9 ,109,110,ue. AAV9 ,111,112 ue. AAV9 ,113. AAVue. AAV9 ,115,116.GLB1 gene are not available yet, but results of their preclinical studies have been published. In preclinical studies, AAV9 encoding GLB1 was administered intravenously to 4-week-old GM1-ganliosidosis model mice, resulting in widespread and sustained expression of GLB1 up to 32 weeks, which led to a reduction in GM1-ganglioside accumulation, myelin deficiency, and damage of neurons in the area of the cerebral cortex. The decrease in GM1-ganglioside was also accompanied by a decrease in activated microglia [Unfortunately, results of clinical studies of AAV9 (NCT03952637), AAVhu68 (NCT04713475) and AAVrh10 (NCT04273269) encoding the icroglia .GLB1 driven by cytomegalovirus (CMV) enhancer fused to a chicken \u03b2-actin promoter/rabbit \u03b2-globin intron was developed for clinical studies. The efficacy of analogs of this vector containing wild-type mouse or feline GLB1 genes was studied in mouse and cat models of GM1-gangliosidosis. Various delivery routes to the CNS have been investigated. Mice were injected bilaterally into the thalamus /animal) or unilaterally into the lateral ventricle . Direct intrathalamic injection resulted in dose-dependent toxicity at the two highest doses of 3.5 \u00d7 1010 and 1.0 \u00d7 1011 vg/animal, while unilateral injection into the lateral ventricle showed no toxicity and a wide distribution, along with a significant dose-dependent increase in GLB1 levels and a decrease in GM1-ganglioside in the brain after injections. Cats were administered 1.0 \u00d7 1012 vg/kg through different routes providing widespread delivery of GLB1 to the CNS. However, intracisternal magna and intracerebroventricular routes of administration were preferable, as intrathecal lumbar administration did not lead to an increase in GLB1 activity in the brain. Toxicity and biodistribution of two doses following administration in the cisternal magna space were analyzed in nonhuman primates. A wide distribution of GLB1 was detected without serious side effects [An AAVrh10 vector encoding the wild-type human gene effects .GLB1 genes was developed. Interestingly, researchers compared the efficiency of several promoter types for this vector in vivo: (1) chicken beta actin with a CMV enhancer, (2) elongation factor 1 alpha, and (3) ubiquitin C (UbC). Remarkably, only the UbC vector resulted in a statistically significant increase in GLB1 enzymatic activity both in the brain and cerebrospinal fluid. Intracerebroventricular mice were injected with varying doses . An almost full correction of the disease phenotype was achieved at a dose of 4.4 \u00d7 1010 vg (corresponding to 1.1 \u00d7 1011 vg/g brain mass). An increase in the enzyme activity was detected in the brain, along with a reduction in neuronal damage, prevention of neurological symptoms, and increased survival [Preclinical studies of AAVhu68 were performed in a mouse model of GM1-gangliosidosis. An AAVhu68 vector encoding codon-optimized human HEXA and HEXB, the products of which are \u03b1 and \u03b2 subunits of HEXA, respectively. Mutations in the HEXA gene lead to Tay\u2013Sachs disease, while mutations in the HEXB gene lead to Sandhoff disease. Both diseases lead to accumulation of GM2-gangliosides, resulting in severe neurodegeneration and neuroinflammation [HEXA and HEXB genes separated by a 2A self-cleaving peptide derived from porcine teschovirus-1 [GM2-gangliosidoses result from deficiency of \u03b2-hexosaminidase A (HEXA). This enzyme is encoded by two genes, i.e., ammation . In ordeammation containiovirus-1 were administered via bilateral thalamic and dual intracisternal magna/intrathecal administration into the cerebrospinal fluid. Prior to clinical trial registration, this strategy has been extensively studied in animal models of GM2-gangliosidosis, the results of which have been reported in a number of scientific publications. For example, several studies have demonstrated the safety and widespread distribution of HEXA in the CNS following intracranial infusion of AAVrh8 encoding HEXA and HEXB in cats with Sandhoff disease [In the second study, two AAVrh8-based monocistronic vectors encoding disease ,121,122. disease . Intracr disease .HEXA and HEXB genes resulted in reduced accumulation of glycosaminoglycans in the cerebral cortex and liver of experimental cats [Sandhoff disease cats show some signs of mucopolysaccharidosis, including accumulation of glycosaminoglycans in bones, connective tissue, heart valves, etc., causing the disease to primarily affect these organs . Simultaneous intracranial injection of two AAVrh8-encoding feline tal cats . The efftal cats .GLA gene are currently ongoing. AAV6 (NCT04046224 and NCT05039866) and novel modified AAV serotypes have been investigated. One of these novel serotypes is AAVS3, which, judging by the publications of preclinical studies, is most likely a modified version of AAV8 (NCT04040049 and NCT04455230). The second modified AAV serotype has not yet been disclosed by copyright holders; however, the name 4D-C102 (NCT04519749 and NCT05629559) was used in clinical trials. As Fabry disease is a multisystemic disease, vectors in all studies were administered intravenously.Fabry disease results from mutations in the \u03b1-galactosidase A (GLA) gene, leading to enzyme deficiency and accumulation of globotriaosylceramide in cells of various systems. For Fabry disease, six clinical trials of AAVs encoding the GLA gene were conducted in mice with Fabry disease. Intravenous administration of the vector led to a significant increase in GLA activity in plasma and tissues, along with normalization of globotriaosylceramide and lyso-globotriaosylceramide levels in mainly affected areas [Preclinical studies of AAV6 encoding the human ed areas . For cli11 vg/animal) encoding human GLA in Fabry mice resulted in a higher level of enzyme production compared to AAV2. At the same time, globotriaosylceramide accumulation was completely prevented in the liver, spleen, heart, kidney, and plasma of animals, and a decrease in peripheral neuropathy was noted [Intravenous administration of AAV8 gene, which cause enzyme deficiency, leading to the accumulation of its substrate, glucosylceramide, in macrophages. Gaucher disease is characterized by damage to many internal organs, especially bone marrow, the spleen, and liver, due to infiltration by Gaucher cells (enlarged macrophages containing uncleaved glucocerebroside). Gaucher disease type 1, unlike types 2 and 3, is not associated with neurological impairment ,129.GBA1 gene . Results of in vivo studies in a mouse model of Gaucher disease showed that intravenous administration of AAV9 carrying the mouse GBA1 gene controlled by human cytomegalovirus enhancer and promoter restores the activity of GBA1 in many organs, prolongs lifespan, and improves neuropathological changes in mice [Currently, there are four ongoing AAV-based gene therapy clinical trials for Gaucher disease. In all four studies, AAVs were administered intravenously, three using AAV9 encoding the in mice .GBA1 gene are also associated with risk of Parkinson\u2019s disease [GBA1 gene (NCT04127578). In vivo studies support the hypothesis that restoring normal levels of GBA1 activity can slow the progression of Parkinson\u2019s disease in patients with mutations in the GBA1 gene [Mutations in the disease ,132,133.Another clinical study involves the use of a modified AAVS3 capsid, as discussed above for the treatment of Fabry disease .ARSA) gene. Low levels or a lack of enzyme activity lead to accumulation of sulfatides, mainly in the CNS. MLD is a severe progressive neurodegenerative disease that affects the myelin sheath of cells in the nervous system [Metachromatic leukodystrophy (MLD) develops as a result of mutations in the arylsulfatase A led to an inflammatory process in the brain; however, this effect was absent following the administration of a onefold dose (1.1 \u00d7 1011 vg/hemisphere). Arylsulfatase A enzymatic activity also exceeded the normal level of endogenous activity by 14\u201331% following the administration of a onefold dose [One of the highly effective AAV serotypes for gene delivery to the nervous system is AAVrh10. In a clinical study, AAVrh10-ARSA was delivered intracerebrally to five patients (NCT01801709). The efficacy and safety of this approach were investigated in MLD mice and nonhransport . Furtherold dose .GALC gene.Similar to MLD, Krabbe disease is a progressive demyelinating disease characterized by accumulation of galactosylceramides, predominantly in the nervous system. This disease is caused by decreased activity of galactosylceramidase (GALC) resulting from mutations in its coding gene ,136,137.GALC controlled by ubiquitous promoter CB7 was injected into the lateral ventricle (5.0 \u00d7 1011 vg/g brain). According to researchers, AAVhu68 serotype is characterized by broad diffusion and neurotropism after injection into the cerebrospinal fluid. Therefore, the authors showed a significant difference in therapeutic effects achieved by various methods of gene drug delivery. Vector administration into the lateral ventricle led to an increase in lifespan by over 2.5 times compared to intravenous administration of the same number of genomic copies. Dogs received intracisternal magna injections (6.0 \u00d7 1011 vg/g brain) prior to symptom onset, which resulted in preservation of peripheral nerve myelination and motor function and decreased neuroinflammation and brain demyelination, although some areas remained abnormal. Researchers also investigated the safety of the administration of three doses of the vector into the cisterna magna in nonhuman primates. No dose-limiting toxicity was observed [In preclinical research, AAVhu68 (a close serotype to AAV9) has been studied in mice, dogs, and nonhuman primates with Krabbe disease. In newborn mice, AAVhu68 encoding codon-optimized human observed . Based oGALC was studied for both the peripheral and central nervous systems. Dogs were administered AAVrh10 encoding the canine GALC gene controlled by CMV-enhancer/chicken \u03b2-actin hybrid promoter at two doses . This total number of vectors was divided equally; one part was administered intravenously, and the other was administered intravenously. A combination of intravenous and intracerebroventricular gene therapies resulted in a clear dose-dependent response and a delay in the onset of clinical signs, as well as increased survival, correction of biochemical defects, and attenuation of neuropathology in animals [In dogs with Krabbe disease, the effect of combined intravenous and intracerebroventricular administration of AAVrh10 encoding animals .GALC gene controlled by human CMV-enhancer/chicken \u03b2-actin hybrid promoter at different times after BMT. The dosage had a significant effect on survival in animals. Importantly, delaying transplantation or virus administration resulted in a shortened lifespan of the mice [Studies on a mouse model of Krabbe disease have shown that the combination of bone marrow transplantation and gene therapy with AAVrh10 significantly increases the lifespan of animals (approximately 10-fold). Mouse models were injected with five doses of AAVrh10 encoding the murine the mice . Based othe mice ,81, a cl+ genetically modified with LVs encoding therapeutic genes has been widely used in the treatment of various diseases. To date, eight LV-based drugs have been approved by the FDA, six of which were developed for CAR T-cell therapy for blood malignancies. The other two drugs (Zynteglo and Skysona), which were developed for the treatment of rare hereditary diseases, were approved in 2022, both of which, in addition to CAR T-therapy drugs, are HSCs (CD34+ cells) genetically modified with LVs and have successfully passed clinical trials for the treatment of cerebral adenoleukodystrophy and \u03b2-thalassemia . Regarding sphingolipidoses, 9 out of 10 LV clinical trials registered to date are also aimed at cell-mediated gene therapy , with only one study aimed at intracerebral injection of LV. Moreover, Libmeldy, an autologous CD34+ genetically modified by LVs encoding the ARSA gene, was approved by the EMA in 2020. Although LV is an integrating type of vector, many studies have established the safety of using third-generation LV.Transplantation of CD34+ genetically modified with LVs . The first results of one of these studies were published in 2021 by A. Khan et al. (NCT02800070) [+ genetically modified with LVs encoding GLA in a does of 3.1\u201313.8 \u00d7 106/kg. The number of vector copies in cells varied from 0.68 to 1.43 copies/genome. Following transplantation, a decrease in plasma levels of lyso-globotriaosylceramide was observed in four of five patients, and globotriaosylceramide plasma levels were generally stable in all patients, except for a later increase in two patients. In three patients, IgG antibodies against the enzyme were detected as a result of previously received ERT, which was carried out before gene therapy. Interestingly, the patients showed almost complete elimination or a decrease in IgG antibody titers against the enzyme after gene therapy intervention, without a resurgence in levels, despite continued exposure to the enzyme from the transduced cells. The authors suggested that gene therapy may reduce pre-existing immunity resulting from ERT [Three LV clinical trials have been registered for Fabry disease, all involving transplantation of CD342800070) . Study rfrom ERT .+ transplantation (NCT04145037), with a long-term follow-up study of these subjects ongoing (NCT04836377). For this study, a vector containing a codon-optimized GBA1 sequence controlled by elongation factor 1\u03b1 short (EFS) promoter was developed. Preclinical studies of this vector have shown only a small number of integrated LV vectors; however, a good therapeutic effect has been reported in a mouse model. Researchers note that this approach can improve patients\u2019 bone condition, which is a significant outcome, considering that ERT often does not affect the patient\u2019s skeletal system [Only one LV clinical study has been conducted to date, in which patients with Gaucher disease received genetically modified CD34l system . Resultsl system .+ has been studied in animals model [+ cells encoding the ARSA gene, for the treatment of MLD. Nonetheless, possible risks of using this drug were noted, among which are possible problems with transplant engraftment, the possibility of malignant transformation due to insertional mutagenesis, the formation of antibodies against ARSA, etc. [Using LV in MLD therapy can be considered a successful example of developing a gene therapy approach for sphingolipidoses. Unlike other diseases, there are many published results of gene therapy clinical trials for MLD. Transplantation of LV-modified CD34ls model ,88,89 anls model ,87,91, aSA, etc. .+ expressing ARSA at a rate of 4.2\u201325.9 \u00d7 106/kg, with a transduction efficiency of 61\u2013100%.The latest published report from a clinical study (NCT01560182) included data from 29 children with presymptomatic or early symptomatic MLD who received transplantation of genetically modified CD34Two years after transplantation, motor function had improved by more than 10% compared to the control group . An average increase of 18.7 times in the enzymatic activity of ARSA was also detected in mononuclear cells of peripheral blood compared to the primary level. Moreover, most subjects showed normal cognitive development, along with prevented or delayed demyelination and brain atrophy throughout the follow-up period. The treatment efficacy was particularly evident in patients treated prior to the onset of symptoms. However, a transient increase in anti-ARSA antibodies as a result of gene cell therapy was found in four patients .ARSA (NCT03725670) has also been registered. However, no results have been published from preclinical or clinical studies of this approach.Other studies have been conducted that included a collective analysis of this approach in patients with both MLD and adrenoleukodystrophy was used) (NCT02559830). A study of intracerebral administration of LV encoding the + cells are able to overcome biological barriers and differentiate into microglial cells (resident macrophages of the CNS). Unfortunately, results of many clinical studies are not available yet. Gene therapy methods for sphingolipidoses described in this review are promising; nevertheless, these innovative methods require further research and thorough safety assessments. Another important aspect is the cost of such drugs. The latest approved gene drugs are among the most expensive in the drug market worldwide [Although the first officially registered gene therapy clinical trial in 1988 was conducted for a type of sphingolipidosis, active work in this area did not continue until 2014\u20132016. Although the results of many years of work are available, widespread clinical use of gene therapy methods for sphingolipidoses has not been achieved to date, and these rare severe hereditary diseases remain incurable. Nevertheless, currently available knowledge cannot be overestimated. Gene therapy approaches for sphingolipidoses have developed in two main directions so far, the first of which is based on various AAV serotypes encoding genes for deficient proteins, which are then administered intravenously, intracerebrally, intrathecally, etc., even using combined administration methods in some cases to achieve the best results. The second approach is a combination of gene and cell therapy. In many cases, bone marrow transplantation eased the disease course in sphingolipidoses patients, but levels of endogenous expression of the deficient protein by donor cells were insufficient. As a result of genetic modification, autologous hematopoietic cells began to synthesize a sufficient amount of the therapeutic enzyme. This led to the restoration of sphingolipid metabolism in many affected parts of the body, including the nervous system, as CD34orldwide ,141. The"} +{"text": "S100a8 and S100a9 genes, however, are only barely understood. Using an unbiased genome-wide CRISPR/Cas9 knockout (KO)-based screening approach in immortalized murine monocytes, we identified the transcription factor C/EBP\u03b4 as a central regulator of S100a8 and S100a9 expression. We showed that S100A8/A9 expression and thereby neutrophil recruitment and cytokine release were decreased in C/EBP\u03b4 KO mice in a mouse model of acute lung inflammation. S100a8 and S100a9 expression was further controlled by the C/EBP\u03b4 antagonists ATF3 and FBXW7. We confirmed the clinical relevance of this regulatory network in subpopulations of human monocytes in a clinical cohort of cardiovascular patients. Moreover, we identified specific C/EBP\u03b4-binding sites within S100a8 and S100a9 promoter regions, and demonstrated that C/EBP\u03b4-dependent JMJD3-mediated demethylation of H3K27me3 is indispensable for their expression. Overall, our work uncovered C/EBP\u03b4 as a novel regulator of S100a8 and S100a9 expression. Therefore, C/EBP\u03b4 represents a promising target for modulation of inflammatory conditions that are characterized by S100a8 and S100a9 overexpression.The proinflammatory alarmins S100A8 and S100A9 are among the most abundant proteins in neutrophils and monocytes but are completely silenced after differentiation to macrophages. The molecular mechanisms of the extraordinarily dynamic transcriptional regulation of As the first line of immune defence, both monocytes and neutrophils are important for the modulation of the innate immune response. To amplify the immune response at sites of inflammation, the activation of further immune cells is required, mediated by the release of signaling molecules such as chemokines and DAMPs (damage-associated molecular patterns). The two members of the S100 family, S100A8 and S100A9, also termed myeloid-related proteins 8 and 14 (MRP8 and MRP14), respectively, belong to the group of DAMPs or so-called alarmins. Their primary expression is referred to myeloid lineage-derived cells, particularly neutrophils and monocytes, where S100A8 and S100A9 are predominantly present as a heterodimeric complex, also called calprotectin .S100A8 and S100A9 is controlled by the most dynamic promoters in myeloid cells. The S100A8/A9 complex interacts with the cytoskeleton in a calcium-dependent manner. Calcium-induced (S100A8/A9)2 tetramer promotes tubulin polymerization and microtubule bundling, thereby affecting transendothelial migration of phagocytes , inflammatory bowel disease, sepsis, cardiovascular diseases, multiple sclerosis, acute lung injury (ALI) and psoriasis . AlteredS100a8 and S100a9 expression have been described library and screened for monocytes with reduced or absent S100A9 expression. We thereby identified the CCAAT/enhancer-binding protein-family member C/EBP\u03b4 as a direct transcriptional regulator of S100a8 and S100a9. Furthermore, we found that the epigenetic factor JMJD3 contributes to S100a8 and S100a9 expression in monocytes by erasure of the repressive histone mark H3K27me3 at S100a8 and S100a9 promoter regions. Moreover, we confirmed the biomedical relevance of this network a murine model of ALI and in specific monocyte subpopulations in a clinical cohort of patients with cardiovascular disease.To overcome difficulties of artificial expression and malignant cell lines we used ER (estrogen-regulated) Hoxb8 cells, estrogen dependent transiently immortalized myeloid precursor cells that can be differentiated to primary monocytes and granulocytes upon estrogen-withdrawal , and shoS100a8 and S100a9 expression, we established the mouse GeCKO lentiviral pooled library designed in Cas9-expressing ER-Hoxb8 cells. The used library contained a large mixture of CRISPR sgRNA constructs, where six gRNAs per target gene increase efficiency and enable the analysis of the molecular effects of many thousand genes in one experiment. After infection of Cas9-expressing ER-Hoxb8 precursor cells with CRISPR library lentiviral particles, the cells were differentiated for 3 days in the presence of GM-CSF to induce S100A8 and S100A9 expression. Because we hypothesized that the parallel S100A8 and S100A9 expression is based on a common regulatory mechanism, we assumed that screening of one of the two alarmins was sufficient in the first step. Therefore, cells with no or low S100A9 expression were selected by sorting and considered as hits, whereas the remaining cells functioned as reference cells. To exclude phenotypes that were S100A9low/neg due to general differentiation defects, we pre-gated for CD11b+Ly-6C+ monocytes. DNA of sorted cell pools was purified and analysed by NGS nor of ER-Hoxb8 cells cases, compared against controls and monocyte subpopulations of a subset of participants in the BioNRW Study . Here, wcontrols , togethese cells . Moreovese cells . A strononocytes .S100a8 and S100a9 promoter regions just before or within the predicted enhancers or its backbone lacking the 3xFlag-C/EBP\u03b4 construct (TRE_ctrl), was performed to further examine specific C/EBP\u03b4 binding revealed 3xFlag-C/EBP\u03b4 binding on nhancers . Co-tran binding . Doxycyc binding . Transfeonstruct or S100aonstruct togetherd site 3 , and ones site 4 , caused by ChIP .S100a8- and S100a9-expressing monocytes, we performed ATAC-seq of precursor and differentiated WT and C/EBP\u03b4 KO ER-Hoxb8 cells. This revealed over 1000 regions with differential peaks in all comparisons , a marker for active transcription, was increased at differentiation day 3 in monocytes over precursor cells at S100a8 (S100a9 loci (3), associated with gene silencing, was overrepresented in precursor cells over differentiated cells at the same loci in WT cells, whereas H3K27me3 marks did not decrease over the course of differentiation in C/EBP\u03b4 KO cells. Accordingly, tri-methylated H3K27 was increased in C/EBP\u03b4 KO monocytes, compared to the WT counterparts . We founme stage . Furtherme stage to blockWT cells . These mgligible . These e, S100a8 and S100 scores and showed the highest numbers of guide RNAs with efficient effects on S100A9 expression in our screening. This redundancy of independent parameters helped to distinguish true positive from false positive hits. Furthermore, a robust phenotype-of-interest, such as a clear S100A9 protein signal at day 3 of monocyte differentiation, allowed reliable negative selection in Cas9-library monocytes. Selection of remaining cells served as a reference control to distinguish true from false positives. The specificity of our selection procedure was confirmed at the protein level by western blot analysis of sorted cell populations. CRISPR/Cas9-based functional genomic screening has been reported to be highly specific, thereby causing fewer cases of false positives in direct comparison with knockdown analysis by RNA interference , compared to non-classical (CD14+CD16++) and intermediate (CD14++CD16+) monocytes. The endogenous antagonists of C/EBP\u03b4, ATF3 and especially FBXW7, showed a negative correlation of their expression pattern in these monocyte subpopulations. Interestingly, inflammatory monocytes with phagocytic and proteolytic activities have been reported to show an early peak at infarct sites, which are followed by infiltration of non-classical, anti-inflammatory monocytes in saline or saline (NaCl) only for 45 min inside a cylindrical Pyrex chamber which was connected to a nebulizer. After a 4 hr resting period, mice were anesthetized, blood was collected from heart and BALF was collected for S100A8/A9 measurements by flushing the lungs five times with 0.8 ml NaCl through the trachea. Serum and BALF were saved for later analyses of alarmins and cytokines at \u201380\u00b0C. Migrated polymorphonuclear leukocytes were analysed via Kimura and following Ly-6B.2/Gr-1-antibody (Bio-Rad) staining. Mouse experiments were in accordance with German Animal Welfare Legislation and performed as approved by the North Rhine-Westphalia Office of Nature, Environment and Consumer Protection (LANUV), and the District Government and District Veterinary Office Muenster under the reference number 81-02.04.2019.A445.WT and C/EBP\u03b4 KO mice wer2, and routinely screened and found negative for mycoplasma contamination in a PCR-based assay (PromoCell).ER-Hoxb8 cells were generated as described earlier and growS100a8 reporter or S100a9 reporter using the Lipofectamine 3000 Transfection Reagent (Thermo Scientific) according to the manufacturer\u2019s manual. For inhibition of JMJD3 activities, cells were treated using 5 \u00b5M GSK-J4 HCl (SellekChem) for 3 days. To induce cebpd in TRE_3xFlag-C/EBP\u03b4 ER-Hoxb8 cells or transfected HEK293T cells, cells were treated using 2 \u00b5g/ml doxycycline (Sigma-Aldrich) for 24 hr.WT, C/EBP\u03b4 KO and Cas90) were generated by culturing for 3 days in DMEM containing with 10% FBS (Biowest) and 1% penicillin/streptomycin solution (Sigma-Aldrich), 1% glutamine solution (Thermo Fisher Scientific), and 15% of L929 supernatant as a source of macrophage colony-stimulating factor. Stimulation of cells with 50 ng/ml IFN-\u03b3 (ImmunoTools) and 10 ng/ml LPS (Sigma-Aldrich) for 24 hr was used for M1-polarization, whereas a 24 hr stimulation with 20 ng/ml IL-4 (Peprotech) led to M2-polarization of BMDMs.BMDMs were obtained by flushing the femurs from WT and C/EBP\u03b4 KO mice. Erythrocytes were depleted by osmotic shock. Cells were washed and separated using a Ficoll gradient (PAN-Biotech). Primary monocytes (MAmplification of mouse CRISPR Knockout pooled library (GeCKO v2) in lentiGuide-Puro plasmid, purchased from AddGene (#1000000053) , was perXbaI and EcoRI and then ligated. Using primers carrying restriction enzyme recognition sites ends using DNA Polymerase I, Large (Klenow) Fragment (NEB) prior to ligation.The pcDNA 3.1 (-) mouse C/EBP\u03b4 expression vector and annealed oligonucleotides were digon sites , the 3xFon sites were digS100 reporter vectors, 1500 bp upstream of S100a8 and 1800 bp upstream of S100a9 TSS were amplified from genomic mouse DNA. Using primers carrying restriction enzyme recognition sites by digesrch tool , and werRNA was isolated using a NucleoSpin Extract II Isolation Kit (Macherey Nagel). The mRNA expression of selected genes was measured by qRT-PCR as described earlier . The pri3 , normal Rabbit IgG or Mouse IgG1, \u03ba Isotype control (BioLegend) was conjugated to 900 \u00b5g magnetic Dynabeads-Protein G (Thermo Scientific) at 4\u00b0C overnight. Sonicated chromatin was added to AB-conjugated Dynabeads and incubated at 4\u00b0C overnight. The Dynabeads were washed as described earlier at 65\u00b0C for 15 min. DNA from eluates was isolated using phenol-chloroform extraction as with input samples. Values were taken into account only when the amount of DNA pulled down by using the antibody of interest was more than 5-fold increased over DNA pulled down by using IgG antibodies. The primers used for ChIP-PCR are listed in For chromatin preparation, progenitor and differentiated ER-Hoxb8 cells were fixed using 1% formaldehyde for 5 min and reaction was stopped by adding 125 mM glycine. Chromatin was extracted as previously described . Approxi earlier . For eluPrecursor and day 3 differentiated WT and C/EBP\u03b4 KO ER-Hoxb8 cells were harvested, washed, and cryopreserved in 50% FBS/40% growth media/10% DMSO using a freezing container at \u201380\u00b0C overnight. Cells were shipped to Active Motif to perform ATAC-seq as previously described .The S100A8/A9 protein concentrations were measured using an in-house S100A8/A9 enzyme-linked immunosorbent assay (ELISA), as previously described .p70, IL-1\u03b2, IL-10, IL-6, IL-27, IL-17A, IFN-\u03b2, and TNF-\u03b1 were analysed using the bead-based immunoassay LEGENDplex mouse inflammation panel according to manufacturer\u2019s instructions (BioLegend). Analytes were measured by flow cytometry using Navios (Beckmann Coulter).IL-1\u03b1, IFN-\u03b3, GM-CSF, MCP-1, IL-12Cells were lysed in M-PER Mammalian Protein Extraction Reagent (Thermo Scientific) containing a protease inhibitor mixture (Sigma-Aldrich). Protein concentration was determined, and equal amounts (15\u201330 \u00b5g) were run on an SDS-PAGE. After blotting on a nitrocellulose membrane, the membrane was incubated overnight with primary antibodies against: polyclonal rabbit S100A8 and S100A9 antibodies were added to 5 \u00d7 105 differentiated cells at a ratio 1:10 for 2 hr at 37\u00b0C. The rate of phagocytosis was measured by flow cytometry using Navios (Beckmann Coulter).FluoSpheres polystrene microspheres (Thermo Scientific) that were shortly sonicated in a bath sonicator (Latex Beads) or pHrodo Red Cells were stimulated using 10 nM PMA (Abcam) for 15 min or left untreated. After incubation, 15 \u03bcM DHR123 (Sigma-Aldrich) were added for another 15 min. The fluorescence signal was analysed using flow cytometry .BMCs and ER-Hoxb8 cells were differentiated using 40 ng/ml rmGM-CSF (ImmunoTools), harvested, stained for CD11b, Ly-6C, and appropriate Isotype control antibodies and measured using flow cytometry to determine cell population purity and differentiation kinetics.For this study, we used bulk mRNA-sequencing (RNA-seq) data of PBMCs and monocytes from two subsets of participants in the German BioNRW Study . BioNRW The BioNRW Study is conducted in accordance with the guidelines of the Declaration of Helsinki. The research protocol, including the case report forms, was approved by the local ethics committee (#245-12). Written informed consent was obtained from all study participants.In case of MI, blood samples were collected during the first 4 days following the event. EDTA blood was drawn from each subject by venipuncture. Sample processing followed within 2 hr. PBMCs were obtained from 40 ml blood by density gradient centrifugation . Lymphocytes were collected and washed twice with PBS. The pellet was re-suspended in freezing medium Cryo-SFM (PromoCell) and cryopreserved.After washing, PBMCs were stained with anti-human antibodies specific for CD2 , CD14 , CD15 , CD16 , CD19 , CD56 , CD335 , HLA-DR , as reported by For mRNA profiling of PBMCs and monocyte subpopulations using RNA-seq, mRNA was enriched using the NEBNext Poly(A) Magnetic Isolation Module (NEB), followed by cDNA NGS library preparation . The size of the resulting libraries was controlled by the use of a Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies) and quantified using the KAPA Library Quantification Kit for Illumina (Roche). Equimolar, appropriately pooled libraries were sequenced in a single read mode (75 cycles) on a NextSeq500 System (Illumina) using v2 chemistry, yielding in an average QScore distribution of 92%\u2265Q30 score. They were subsequently demultiplexed and converted to FASTQ files using bcl2fastq v2.20 Conversion software (Illumina). Data was quality controlled using FASTQC software and trimmed for adapter sequences using Trimmomatic .The statistical significance of the data was determined using Prism 5.0 software . Analyses between two groups were performed using an unpaired two-tailed Student\u2019s t test. Comparisons among three or more groups were performed by using one-way ANOVA, followed by Bonferroni\u2019s multiple means tests for comparing all pairs of columns. Differences were considered statistically significant at a probability of <0.05.Analysis of counting the reads for each gRNA and differential analysis was performed using MaGeCK 0.5.9.3, a computational tool to identify important genes from GeCKO-based screens . A modifSequence analysis was performed by mapping the paired-end 42 bp sequencing reads (PE42) generated by Illumina sequencing (using NextSeq500) to the genome using the BWA algorithm with default settings (\u2018bwa mem\u2019). Only reads that passed Illumina\u2019s purity filter, aligned with no more than two mismatches, and mapped uniquely to the genome were used in the subsequent analysis. In addition, duplicate reads (\u2018PCR duplicates\u2019) were removed. BAM files provided by Active Motif were used to perform peak calling with MACS2, using paired-end mode with a bandwidth of 200 and q-value cutoff of 0.01. BedGraph files were converted to BigWig format for visualization with the Integrative Genomics Viewer (IGV) using beThe resulting reads were mapped to the human reference genome builds hg19 (monocytes) or hg38 (PBMCs) using Tophat2 or HISATS100a8 and S100a9 promoter regions also induced changes in chromatin accessibility via JMJD3-mediated demethylation of H3K27me3 marks, which includes a so far unknown link. Due to the high relevance of S100A8/A9 alarmin expression in many inflammatory diseases, our findings may point to novel molecular targets for innovative anti-inflammatory therapeutic approaches.We found that the transcription factor C/EBP\u03b4 drives expression of the abundant alarmins S100A8 and S100A9, and demonstrated that C/EBP\u03b4 binding to specific sites on The study uses an elegant CRISPR/Cas9 screening approach in a myeloid cell line to identify the underlying regulators of the alarmins S100A8 and S100A9, which amplify inflammation. This approach identified the transcription factor C/EBP-\u03b4 as a regulator of S100A8 and S100A9 expression in the myeloid cell line and also showed a correlation between the expression levels of C/EBP-\u03b4 and the alarmins in patient samples of peripheral blood mononuclear cells. Furthermore, the authors also validate their findings in primary monocytes using mice with genetic C/EBP-\u03b4 deletion. This work will be of significant interest to researchers studying the regulation of immune responses and inflammation, and it also highlights how unbiased CRISPR/Cas9 screening can lead to novel mechanistic insights in myeloid cells. public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.Our editorial process produces two outputs: (i) Decision letter after peer review:eLife. Your article has been reviewed by 3 peer reviewers, including Jalees Rehman as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by a Reviewing Editor and Carla Rothlin as the Senior Editor.Thank you for submitting your article \"C/EBP\u03b4-induced epigenetic changes control the dynamic gene transcription of S100A8 and S100A9\" for consideration by The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.Essential revisions:1) Mechanistic validation of the effects of C/EBP-\u03b4 deletion or knockdown in primary human and/or mouse monocytes as outlined in the comments by the reviewers 1 and 2 below. Demonstrating how C/EBP-\u03b4 deletion affects the phenotypes and differentiation of primary human or primary mouse monocytes in vivo and in vitro, will validate the conclusions derived from the myeloid cell line.2) Expanded analysis of the CRISPR/Cas9 screen such as addressing potential false positives (see comments of reviewer 3).3) Rigorous presentation of the ATAC-seq data including showing all the differential peak analyses and ATAC-seq of the C/EBP\u03b4 KO cells (see comments of reviewer 2).Reviewer #1 (Recommendations for the authors):The manuscript could be strengthened with the following revisions:1. The authors highlight the importance of alarmins in disease but there are no experiments showing that deletion of C/EBP-\u03b4 affects disease processes in vivo. Experiments showing that C/EBP-\u03b4 deletion in vivo changes disease and inflammatory injury severity would be important to highlight the pathophysiological relevance of the C/EBP-\u03b4 link to alarmins. The authors can choose an in vivo LPS model as they also use LPS ex vivo and then assess various parameters of in vivo tissue injury and inflammation in C/EBP-\u03b4 knockout versus control mice.2. The phenotyping of the myeloid cells in the absence of C/EBP-\u03b4 is very limited and needs to be more rigorous as well as more comprehensive.a) In Figure 2D, n-fold change in serum levels should be changed to actual alarmin concentrations in the serum but other circulating cytokine levels should also be shown, both at baseline and with stimulation conditions (such as in vivo LPS exposure)b) How does the C/EBP-\u03b4 deletion affect monocyte differentiation and polarization? Flow cytometry of monocyte and macrophage phenotypes with and without C/EBP-\u03b4 as well as with and without stimuli that promote monocyte activation, monocyte to macrophage differentiation and macrophage polarization would be more impactful. Ideally, this can be combined with the in vivo studies proposed in comment #1 which addresses C/EBP-\u03b4 deletion affecting disease severity because int he same in vivo study, the authors can isolate various cell types and perform flow cytometry characterization.c) The phagocytosis and ROS assays in Supplement Figure 2 are very interesting because they suggest that alarmin reduction increases phagocytosis capacity. In some ways, this may seem counter-intuitive because it suggests that C/EBP-\u03b4 activates inflammatory signaling but suppresses phagocytosis, an important function of immune cells. This is a very important finding and should be moved to the main figures but needs to be studied more robustly showing phagocytosis kinetics and some analysis of how C/EBP-\u03b4 would increase phagocytosis. Does C/EBP-\u03b4 inhibit the expression of phagocytosis genes? Does C/EBP-\u03b4 deletion impact phagocytosis of bacteria (this can be easily assessed using fluorescent bacteria)?Reviewer #2 (Recommendations for the authors):The data in the cell line show a direct relationship between C/EBP\u03b4 and S100A8/A9, however the data in primary cells is only a correlation. It would be important to show, in either human or mouse primary monocytes, that knockdown of C/EBP\u03b4 directly affects S100A8/A9.Regarding the composition of the cell culture, flow cytometry can be performed on each day of differentiation to validate the purity of monocytes and determine whether macrophages or other cells are present, which could affect the analyses.The ATAC-seq experiments in Figure 6 should be accompanied by a full list of differential peaks between day 0 and day 3 for the reader to browse as a supplementary file. Furthermore, the peaks in day 3 versus day 0 do not seem dramatically different to the eye, which should be quantified. Moreover, the y-axes are not shown for the tracks in 6C. Finally, it would have been interesting to see how C/EBP\u03b4 KO monocytes compared to WT in the ATAC-seq data, as well as where day 5 of differentiation would sit in this dataset. From Figure 2A-B, s100a8 and s100a9 expression at day 5 are downregulated in both WT and KO cells. At this time, would the WT and KO cells become more similar to each other, and/or to day 0 cells?Reviewer #3 (Recommendations for the authors):1) The current study did not identify any previously reported gene regulators. Further work is needed to address this discrepancy. It is well known that CRISPR screens could generate many false negatives, largely due to the design of ineffective gRNAs. The authors should carefully evaluate these discrepant results by experimental validation.2) I'd like to suggest reanalyzing Figure 1B by focusing on a smaller number (but more significant) of cells. The reduction of screening noise could potentially identify other candidates of interest.3) I'd like to suggest validating several other candidates to (1) confirm their impact on S100A9 expression, and (2) further demonstrate the robustness of the CRISPR screening system. Although the focus of the current study is on C/EBPD, the inclusion of other candidates would expand the study scope and warrant future studies.4) The legend for Figure 6A is too small to read and should be enlarged. Essential revisions:1) Mechanistic validation of the effects of C/EBP-\u03b4 deletion or knockdown in primary human and/or mouse monocytes as outlined in the comments by the reviewers 1 and 2 below. Demonstrating how C/EBP-\u03b4 deletion affects the phenotypes and differentiation of primary human or primary mouse monocytes in vivo and in vitro, will validate the conclusions derived from the myeloid cell line.We now added data obtained from primary cells as requested by the reviewers . For details see our point-by-point response to the individual reviewers #1 at points \u201c1 and \u201c2 and #2 at point \u201c2.2) Expanded analysis of the CRISPR/Cas9 screen such as addressing potential false positives (see comments of reviewer 3).We addressed this comment in our revised manuscript .3) Rigorous presentation of the ATAC-seq data including showing all the differential peak analyses and ATAC-seq of the C/EBP\u03b4 KO cells (see comments of reviewer 2).S100a8 and S100a9. However, we now performed and added an additional genome-wide ATAC-seq analysis of C/EBP\u03b4 KO monocytes and present all data in the Figure 7, A \u2013 C, Figure 7 \u2014figure supplement 1 and Figure 7 \u2013 source data 1 as supplemental material as requested by reviewer #2 (see lines 278 \u2013 287 in the manuscript and our point \u201c3 in response to reviewer #2).The primary goal of our study was not the effect of C/EBP\u03b4 on the genome wide genome structure but its role in the expression of Reviewer #1 (Recommendations for the authors):The manuscript could be strengthened with the following revisions:1. The authors highlight the importance of alarmins in disease but there are no experiments showing that deletion of C/EBP-\u03b4 affects disease processes in vivo. Experiments showing that C/EBP-\u03b4 deletion in vivo changes disease and inflammatory injury severity would be important to highlight the pathophysiological relevance of the C/EBP-\u03b4 link to alarmins. The authors can choose an in vivo LPS model as they also use LPS ex vivo and then assess various parameters of in vivo tissue injury and inflammation in C/EBP-\u03b4 knockout versus control mice.We agree with this objection. Therefore, we analysed the role of the C/EBP\u03b4-S100A8/A9 axis in a mouse model for acute lung inflammation, which is characterized by high S100A8/A9-level. We could show that LPS-exposed C/EBP\u03b4 deficient mice secrete less S100A8/A9 systemically (serum) and locally . Lower S100A8/A9-levels are accompanied by lower disease activity reflected by decreased local cytokine production , highlighting the influence of C/EBP\u03b4-deficiency on alarmin expression and inflammatory injury in vivo.2. The phenotyping of the myeloid cells in the absence of C/EBP-\u03b4 is very limited and needs to be more rigorous as well as more comprehensive.+Ly-6C+ cells reveals no differences between WT and C/EBP\u03b4 KO cells during differentiation, which is a prerequisite for C/EBP\u03b4 KO cells to pass the pre-gating on CD11b+Ly-6C+ within the GeCKO library screen to exclude phenotypes that are S100A9low/neg due to differentiation defects. In addition, we compared differentiation to M1 and M2 macrophages between wild type and C/EBP\u03b4 KO mice .To go more in depth on the phenotype of C/EBP\u03b4-deficient myeloid cells, we examined monocyte-to-macrophage differentiation of WT and C/EBP\u03b4 KO bone marrow-derived cells and ER-Hobx8 cells using flow cytometric analysis . Analysis of the proportion of CD11ba) In Figure 2D, n-fold change in serum levels should be changed to actual alarmin concentrations in the serum but other circulating cytokine levels should also be shown, both at baseline and with stimulation conditions (such as in vivo LPS exposure)To examine alarmin secretion at baseline (NaCl) and after LPS-exposure we now added new data obtained from a mouse model of acute lung inflammation. We analysed serum and bronchoalveolar lavage fluid (BALF) for S100A8/A9 using our in-house ELISA as described. In addition, we analysed inflammatory cytokines, such as IL-1\u03b1, IL-6 and TNF-\u03b1 in BALF , and various further cytokines in WT and C/EBP\u03b4 KO sera at both conditions, using a bead based immunoassay .b) How does the C/EBP-\u03b4 deletion affect monocyte differentiation and polarization? Flow cytometry of monocyte and macrophage phenotypes with and without C/EBP-\u03b4 as well as with and without stimuli that promote monocyte activation, monocyte to macrophage differentiation and macrophage polarization would be more impactful. Ideally, this can be combined with the in vivo studies proposed in comment #1 which addresses C/EBP-\u03b4 deletion affecting disease severity because int he same in vivo study, the authors can isolate various cell types and perform flow cytometry characterization.1) or IL-4 (M2) for 24 hours. We found that expression of M1-monocyte associated markers, such as Tnfa, Il6, Inos, Cd86 and Il1b, was only slightly decreased in LPS and IFN-\u03b3 treated C/EBP\u03b4 KO monocytes , whereas expression of Il10 was diminished, but M2-associated Cd163 expression showed no significant reduction after IL-4-stimulation in C/EBP\u03b4 KO cells . As mentioned above, the new data set of genome-wide ATAC-seq maybe a useful source for analysis of C/EBP\u03b4 effects on chromatin remodelling during macrophage differentiation .We analysed whether C/EBP\u03b4 deletion affects polarization of bone-marrow derived monocytes stimulated either with IFN-\u03b3 + LPS (Mc) The phagocytosis and ROS assays in Supplement Figure 2 are very interesting because they suggest that alarmin reduction increases phagocytosis capacity. In some ways, this may seem counter-intuitive because it suggests that C/EBP-\u03b4 activates inflammatory signaling but suppresses phagocytosis, an important function of immune cells. This is a very important finding and should be moved to the main figures but needs to be studied more robustly showing phagocytosis kinetics and some analysis of how C/EBP-\u03b4 would increase phagocytosis. Does C/EBP-\u03b4 inhibit the expression of phagocytosis genes? Does C/EBP-\u03b4 deletion impact phagocytosis of bacteria (this can be easily assessed using fluorescent bacteria)?Staphylococcus aureus as well. Analysis of Pattern Recognition Receptors-gene expression revealed that Ptx3, Dc-sign or Cd14 are up-regulated in C/EBP\u03b4 KO cells, which may explain higher phagocytosis rates due to increased pathogen-recognition . C/EBP\u03b4 could act as a suppressor/regulator of phagocytosis, but these mechanisms need further investigation which is behind the scope of our study on regulatory mechanisms of S100 expression. For our question, the most important observation was that C/EBP\u03b4-deficiency does not dampen inflammatory responses in general but that its impact on S100A8 and S100A9 expression is rather specific. However, we agree with the comment of the reviewer that the phagocytosis and ROS assays reveal very interesting facts, which is why we moved these findings to the main manuscript as suggested.We thank the reviewer for pointing to the importance of the effect of C/EBP\u03b4-deficiency on phagocytosis-rates. We added data on phagocytosis of bacteria and found higher phagocytosis capacities of fluorescent Reviewer #2 (Recommendations for the authors):The data in the cell line show a direct relationship between C/EBP\u03b4 and S100A8/A9, however the data in primary cells is only a correlation. It would be important to show, in either human or mouse primary monocytes, that knockdown of C/EBP\u03b4 directly affects S100A8/A9.Please see our response to point \u201c2.Regarding the composition of the cell culture, flow cytometry can be performed on each day of differentiation to validate the purity of monocytes and determine whether macrophages or other cells are present, which could affect the analyses.+Ly-6C+ cells nor of differentiation kinetics , which is a prerequisite to compare time-point dependent S100A8 and S100A9 level of WT and C/EBP\u03b4 KO cells as we did.We agree that validation of monocyte purity is very important at this point, because altered differentiation kinetics would influence S100A8 and S100A9 expression. Flow cytometric analysis of WT and C/EBP\u03b4 KO cells reveals neither differences in the purity of CD11bThe ATAC-seq experiments in Figure 6 should be accompanied by a full list of differential peaks between day 0 and day 3 for the reader to browse as a supplementary file. Furthermore, the peaks in day 3 versus day 0 do not seem dramatically different to the eye, which should be quantified. Moreover, the y-axes are not shown for the tracks in 6C. Finally, it would have been interesting to see how C/EBP\u03b4 KO monocytes compared to WT in the ATAC-seq data, as well as where day 5 of differentiation would sit in this dataset. From Figure 2A-B, s100a8 and s100a9 expression at day 5 are downregulated in both WT and KO cells. At this time, would the WT and KO cells become more similar to each other, and/or to day 0 cells?We are thankful and agree for this comment. Indeed, we completed our ATAC-seq data by adding C/EBP\u03b4 KO cells on day 0 and day 3 (n = 3) to the analysis and a comprehensive list of all regions with differential peaks between all four conditions (WT and C/EBP\u03b4 KO cells on day 0 and day 3) . In our revised manuscript, we also now statistically analysed differential chromatin accessibility between all conditions by specifying the adjusted p-values (padj) < 0.05 and log2 fold changes . We agree with the comment of the reviewer raised above that adding data of C/EBP\u03b4 KO cells fills a gap between ATAC-seq and ChIP data.Reviewer #3 (Recommendations for the authors):1) The current study did not identify any previously reported gene regulators. Further work is needed to address this discrepancy. It is well known that CRISPR screens could generate many false negatives, largely due to the design of ineffective gRNAs. The authors should carefully evaluate these discrepant results by experimental validation.S100a8 and S100a9 expression was examined in our study by creating specific KO cell lines of these candidates. None of these suggested genes caused a relevant reduction of S100a8 and S100a9 expression upon deletion , thus confirming their absence in the CRISPR screen. In addition, our screening approach intentionally excluded factors which induce a general block of monocyte differentiation to exclude indirect effects not related to direct transcriptional regulation of these two S100 genes. However, transcription factors which show both, effects on general differentiation and S100 expression, will not be detected in our screen. We discuss this point in our manuscript . Taken together, in our opinion CRISPR screens have major limitations which do not allow reliable identification of a network of factors regulating gene expression but can be very useful for unbiased screening for individual factors. The latter has to be confirmed by independent validation experiments as done here for C/EBP\u03b4.This point is a very important and justifiable note. The impact of previously reported gene regulators, such as ATF3, STAT3, KLF5, IRF7 or C/EBP\u03b2 on 2) I'd like to suggest reanalyzing Figure 1B by focusing on a smaller number (but more significant) of cells. The reduction of screening noise could potentially identify other candidates of interest.We agree that one might retrospectively argue that a different gating strategy may have improved our screening approach, but reanalysis of the existing data is not feasible since cells were already sorted, processed and analysed in the CRISPR screen. However, analysis of our actual sorted cell populations (hits negative and reference positive) by immunoblotting for S100A9 clearly validates our gating strategy and excludes gating as a major bias of our results.3) I'd like to suggest validating several other candidates to (1) confirm their impact on S100A9 expression, and (2) further demonstrate the robustness of the CRISPR screening system. Although the focus of the current study is on C/EBPD, the inclusion of other candidates would expand the study scope and warrant future studies.S100a8 and S100a9 expression extensively, especially in comparison to C/EBP\u03b4 KO cells .We agree with this point and present now additional data showing that single knock-out cell lines for further hits as PHF8, CSRP1 or HAND1 do not dampen 4) The legend for Figure 6A is too small to read and should be enlarged.Thank you for this annotation."} +{"text": "Driven by the Silk Road Economic Belt idea, Xinjiang Uygur Autonomous Region can fully play its regional advantages and innovate the open economic system. It can transform and upgrade industrial structures with strong regional characteristics and advantages in Shihezi. The purpose is to explore the impact of knowledge-based employee incentive mechanism (EIM) on innovation performance. It is hoped to innovate the knowledge-based worker (KBW) management in Shihezi enterprises. Based on the psychological theory, the actual production, and living conditions in Shihezi, a questionnaire survey is conducted on the KBWs of typical enterprises in Shihezi. The questionnaire is designed by considering the characteristics of KBWs in Shihezi City under the Development Strategy of Western Chinese Cities. In addition, relevant structural equation models and hypotheses are proposed to comprehensively explain the relationship between psychological capital (PsyCap), EIM, and employee innovation performance (EIP). Among the KBWs of Shihezi enterprises surveyed, the proportion of male and female employees is basically balanced, and both groups have bachelor's degrees or above. They are mostly young, with a relatively short working year. Most employees are in the rising stage of career development. The overall scores of KBWs on the PsyCap, EWM, and EIP scales are all above 3.5, a high overall score. Model analysis and hypothesis verification show that Shihezi knowledge-based EIM significantly affects EIP and PsyCap. The PsyCap has a positive impact on EIP. The KBWs' PsyCap plays an intermediary role in EIP. The research results provide an objective reference for Shihezi enterprises to improve the innovation performance of KBWs. It enriches the theoretical research of Shihezi enterprise innovation and provides a theoretical basis to improve collaborative innovation performance. A new round of global scientific and technological revolution and industrial reform is accelerating, and scientific exploration is expanding from the micro to the full-scale universe. The collective intelligence and green technological revolution will trigger a major adjustment of the international industrial division. Disruptive technologies continue to emerge, such as human-computer interaction (HCI) technology in artificial intelligence (AI) \u20133. MeanwEnterprise development has also brought challenges. For example, KBWs in Xinjiang also face many difficulties with intensified enterprise competition, bearing more work pressure than ever before. These pressures have adversely affected employees' lives and work, reducing work efficiency and leading to resignation. The local enterprises complain about the impact of these difficulties on employees' personal development and enterprise stability . TherefoShihezi, in the border area of northwestern China, has a distinct economic and social development from inland cities. With the orderly advancement of China's Great Western Development Strategy and the Belt and Road Initiative (BRI) in recent years, the development of all sectors of society in Shihezi has ushered in tremendous changes . ShiheziAccording to the concepts of psychology and management, KBWs in border areas are sampled. The PsyCap of employees and the influence of EIM on EIP are explored, considering the actual situation in Shihezi. Based on previous research, the relationships among the three variables of employees' PsyCap, EIM, and EIP are investigated through case analysis. It is hoped to provide a practical reference for enterprises to improve the innovation performance of employees.PsyCap is generally considered to be a positive psychological state shown by an individual during growth and development. It is an organic combination of an individual's self, social relationships, professional development, moral concepts, life goals, and beliefs . StudiesInnovation performance is an essential indicator that describes the innovation achievements of enterprises. In the meantime, innovation performance is also a core component of employees' performance and plays a key role in providing enterprises with sustained competitive advantages . InnovatEmployee incentive is the psychological process of continuously stimulating individuals through internal or external stimuli to maintain an excited state . AccordiKBWs possess some knowledge, symbols, or concepts and use the information they have for work. With the development of society and the diversified labor divisions, the definition of KBW is also being extended. KBWs have the following three basic elements: (1) they can master knowledge or skills and use them proficiently in work; (2) they have strong learning and innovation ability and can integrate relevant resources for innovative research in their work; and (3) they use the learned knowledge to bring benefits and value to the organization . AdditioDefinitions of PsyCap are inclusive. Youssef-Morgan believedThe influencing factors of PsyCap and their impact on job performance are also the focus of researchers. Paek et al. surveyedEIP can be explained from multiple dimensions. Abbas and Raja considerAt this stage, the development of KBWs in Shihezi has achieved remarkable results. The distribution of KBWs in various industries is becoming reasonable and scientific. All kinds of talents have been transferred to key economic and social construction areas in an orderly manner, and the scale of KBWs in the secondary and tertiary industries has continued to expand. At the same time, the talent quality has been gradually improved, and the training scale has been expanded. Shihezi local government actively develops key fields and industrial positioning, adjusts talent introduction ideas, innovates talent introduction methods, and constantly introduces innovative, high-level, urgently needed, skilled, and practical talents. With the support of policies, the environment for talent development is also optimized. The investment in talents has increased year by year, and the incentive and guarantee mechanism for talent distribution has been improved. The scientific and legal level of talent management has been significantly improved. Shihezi's talent plan has been implemented and accelerated. The importance of introducing scarce professionals and local training talents has been emphasized. Grassroots KBWs and talents in short supply are cultivated purposefully for social development. KBWs are the main factor of social innovation. Therefore, improving the innovation performance of KBWs plays a vital role in promoting social and economic development.The method and effect of EIM have always been the key to business management. Besides, as the KBW becomes prominent in enterprise innovation, research on the effect of knowledge-based EIM has attracted widespread attention worldwide. The results of Wang and Tsai on 586 qWith the continuous and effective promotion of China's Western Region Development Strategy and the BRI, Shihezi's socioeconomic scale and gross domestic product (GDP) have significantly increased. In this context, all sectors of Shihezi society have turned their attention to KBWs. Shihezi's colleges and universities, corps, enterprises, and institutions have launched a series of talent attraction measures to absorb more knowledge-based talents. Through policy support and the impact on the overall environment, Shihezi enterprises have flourished, and the comprehensive strength and overall business environment have been effectively improved. The successful implementation of the talent introduction project has attracted outstanding talents worldwide, improved the EIM, and expanded the KBWs of the Shihezi enterprise.X enterprise engaged in textile, B enterprise engaged in food processing, and T enterprise in the chemical industry. Overall, 300 questionnaires are distributed, recovering 280 valid ones, with a recovery rate of 93%.KBWs generally work in high-tech enterprises or emerging industries with certain patents. Here, employees of high-tech enterprises or emerging industries in Shihezi are surveyed to extend the sample range. The samples are employees of three enterprises in Shihezi: The three variables involved are PsyCap, EIM, and EIP. The PsyCap measurement questionnaire refers to the PsyCap scale developed by Hou et al. The original scale includes 4 dimensions and 49 questions involving task-based PsyCap associated with completing work tasks, relational PsyCap associated with peripheral relationship processing, learning PsyCap associated with knowledge learning, and the innovative PsyCap. Regarding the actual situation in Shihezi, two dimensions of task-based PsyCap and innovative PsyCap in the scale are selected, totaling 8 questions. The innovation performance scale developed by Yao and Heng is adopt\u2009 H1: Knowledge-based EIM influences EIP significantly and positively\u2009 H2: Knowledge-based EIM influences employees' PsyCap significantly and positively\u2009 H3: PsyCap influences EIP significantly and positively\u2009 H4: PsyCap plays a mediating role between EIP and EIMBased on the above theoretical data, the following hypotheses are put forward:At the same time, based on the above hypotheses, the research model of the relationships among knowledge-based employees' PsyCap, EIM, and EIP is shown in First, the basic situation of the research samples is analyzed, including the statistical analysis of gender, education, working years, and age. The results are summarized in As shown in Statistical analysis is performed on the results of the questionnaire survey. The results of the PsyCap, EIP, and EIM are shown in Figures As shown in The above results show that KBWs in Shihezi have high scores on the PsyCap, EIP, and EIM, with scores above 3.5 in all dimensions. The score of the innovation effect is 4.01, ranking the highest, while that of the employee salary is 3.53, ranking the lowest.\u03b1 coefficient are considered. The PsyCap scale is set to Q1; the EIP scale is set to Q2; and the EIM scale is set to Q3. Besides, each question in the scale is labeled in turn. The specific scores of the three scales are shown in Figures The reliability and validity of the survey results are analyzed using the SPSS21.0 software. In the category of reliability analysis, the CITC value and Cronbach's \u03b1 coefficient value is greater than 0.7. As shown in \u03b1 coefficient of each dimension is greater than 0.8, indicating that the scale's reliability is very good, meeting the reliability requirements.The CITC value is generally required to be greater than 0.5, and Cronbach's The scale's validity is tested through the Kaiser\u2013Meyer\u2013Olkin (KMO) and Bartlett sphere tests. The results are provided in P values are 0.000, less than the given significance level of 0.01, indicating a correlation between the variables. Hence, the scale has passed the validity test.The variables' dimensions undergo correlation analysis, and the results are summarized in A structural equation model is constructed referring to Giorgi's approach . The AMO\u03c72/df\u2009=\u20092.230, indicating that the model fits well. The GFI value is 0.958, which meets the expected requirements. The RMSEA value is 0.802, which indicates a moderate fit. The values of CFI, NFI, TLI, and IFI are all greater than 0.8, indicating that the model fits well. The values of PGF, IPNF, and IPCFI are all greater than 0.5, indicating that the model has achieved the expected ideal standard. In summary, the model's absolute, incremental, and reduced fit are all within the acceptable range. Thus, the model fits well. At the same time, the principal effects test is performed; that is, the relationship between the independent and dependent variables is tested when the mediating variable is not added to the model. In other words, the influence of EIM on EIP is explored. The specific results are as follows:As shown in According to data in After the mediating model is added, the overall test is performed. The specific results are summarized in P < 0.001, indicating that EIM has a significant positive impact on PsyCap. Hence, hypothesis 2 holds. In the third path, the estimate is 0.886, P < 0.01, indicating that PsyCap has a significant positive impact on EIP. Therefore, hypothesis 3 is established. Moreover, the corresponding coefficient is found to decrease in this model, indicating that PsyCap plays a mediating role; that is, hypothesis 4 is valid.As shown in The KBW of different enterprises in Shihezi is sampled by considering their basic situations, and relevant models and hypotheses are proposed to investigate the relationships among PsyCap, EIP, and EIM. The key conclusions are as follows. The proportion of men and women in KBWs of Shihezi enterprises is basically balanced, which are 56.07% and 43.93%, respectively. KBWs generally have high academic qualifications, with a bachelor's degree or above. Most KBWs are young and in the career development stage. The KBWs in Shihezi enterprises have scored high on the three scales of PsyCap, EIP, and EIM. The EIP is the highest, with 4.01 points. Moreover, the research scales have passed the reliability and validity tests. The model and relevant hypotheses are proposed. Testing and verification reveal that the model fits well and meets the expected standard, and the research hypotheses hold. Compared with previous research, the proposed model fully integrates the basic situation of Shihezi. A targeted survey of enterprises in Shihezi is conducted. In view of the research limitations, which used cross-sectional data, future studies can use multitemporal longitudinal studies to reduce endogeneity problems. Besides, the enterprises in different industries are investigated to generalize the survey results and make the survey more practical [This research provides the following clues to the innovative development of Shihezi enterprises. (1) Talents guarantee enterprise innovation. Therefore, supplementing and cultivating talents must be carried out in Shihezi enterprises. For this reason, collaborative innovation in Shihezi enterprises must change the employment strategy to cultivate KBWs with a comprehensive and reasonable view, construct cultural ideas, and encourage open management. Meanwhile, they should actively cultivate leaders in collaborative innovation projects, encourage employees to refine themselves, and offer platforms for employees to innovate. (2) Because of the geological conditions, Shihezi enterprises should improve employee salaries and education for their children to attract more KBWs. Favorable policies must be followed to enhance KBWs' PsyCap, allowing them more extensive development. The main contribution is to provide a theoretical basis for the performance innovation of Shihezi enterprises. In addition, the research has certain limitations. The potential limitation lies in the insufficient consideration of employees' psychological factors in modeling the performance evaluation and talent attraction mechanisms. The theoretical research results of Shihezi KBWs as innovation subjects are relatively few from the current research field of employee and enterprise innovation. Improving employees' professional skills and reducing ineffective activities can further improve the innovation performance of enterprises. Examining the EIP factors can enrich the research on Shihezi enterprise innovation. It is expected to provide a theoretical basis for improving Shihezi enterprise collaborative innovation performance."} +{"text": "The dietary role of meat is under scrutiny for health and environmental reasons, yet a growing body of evidence proposes that advice to limit red meat consumption is unnecessarily restrictive. The aim of this study was to investigate the role of \u2018fresh beef and lamb\u2019 in the diet of the population (5\u201390 years) in Ireland and its association with markers of nutrition and health status. Analyses are based on data from three nationally representative dietary surveys in the Republic of Ireland. Dietary intake data were estimated using food records, and nutrient intakes were estimated based on UK and Irish food composition tables. Biochemical samples were collected and analysed using standard procedures. \u2018Fresh beef and lamb\u2019 (defined as beef/lamb that had not undergone any preserving process other than chilling/freezing/quick-freezing) was consumed by 68\u201384% of the population and intakes ranged from 19 to 43 g/d across age groups. It made important contributions to intakes of protein, monounsaturated fat, vitamins D, B12, niacin, iron and zinc while also contributing relatively small proportions of total fat, saturated fat and salt. Higher consumption of \u2018fresh beef and lamb\u2019 was associated with higher intakes of protein, niacin, vitamins B6, B12, zinc and potassium and lower intakes of carbohydrate and total sugars . In adults, older adults and WCBA, higher consumption of \u2018fresh beef and lamb\u2019 was not associated with increased risk factors of cardio-metabolic diseases nor was it associated with better or poorer nutritional status for vitamins D, B12 or iron. This study adds to the evidence base on the contribution of \u2018fresh beef and lamb\u2019 in the diet and may be useful to policymakers updating guidance for healthy diets from sustainable food systems. The role of meat in the diet is currently under scrutiny for both health and environmental reasons, amplified by the recent report of the EAT-Lancet commission recommending an extreme reduction in the consumption of processed and red meat as part of a healthy diet from sustainable food systems . Food-baHowever, a growing body of evidence proposes that dietary advice to limit red meat for health benefits is unnecessarily restrictive, with some literature suggesting that the causal relationships between red meat and mortality are not supported by the evidence and that the negative health outcomes previously linked to red meat consumption are associated with the wider dietary patterns associated with being a red meat consumer ,11,12,13Globally, national dietary surveys report that fresh red meat including beef and lamb (and their dishes) make important contributions to intakes of protein, vitamin B12, vitamin D, iron, zinc and selenium ,22,23,24National Children\u2019s Food Survey (NCFS) (5\u201312 years) (2003-04), the National Teens\u2019 Food Survey (NTFS) (13\u201317 years) (2005-06) and the National Adult Nutrition Survey (NANS) (18\u201390 years) (2008-10) (www.iuna.net [accessed on 1 August 2022]). All studies were conducted according to the guidelines laid down in the Declaration of Helsinki and ethical approval was obtained from St James\u2019 Hospital and Federated Dublin Voluntary Hospitals Joint Research Ethics Committee for the NCFS and the University College Cork Clinical Research Ethics Committee of the Cork Teaching Hospitals for the NTFS and the NANS. Written informed consent was obtained from the participants themselves for those aged \u226518 years and from the participants and their parents/guardians for those aged \u226417 years. Analyses for the present study are based on food consumption data for children, teenagers and adults in the Republic of Ireland (ROI) available through three nationally representative dietary surveys: the A sample of 594 children aged 5\u201312 years and 441 teenagers aged 13\u201317 years were selected from databases of primary and secondary schools provided by the Department of Education and Science for the NCFS and NTFS, respectively. For the NANS, a sample of 1500 adults , who were free-living and not pregnant or breastfeeding, were randomly selected from a database of names and addresses held by Data Ireland (A Post). Each survey was shown to be representative of the intended population group with respect to age group, sex, social class and geographical location when compared to the most recent census at the time of each survey [The Composition of Foods sixth [Food and beverage consumption data were collected at brand level using a 7-day weighed food record for the NCFS, a 7-day semi-weighed food record for the NTFS and a 4-day semi-weighed food record for the NANS. A hierarchal method was used to quantify the amount of each food/beverage consumed and included direct weighing of the food by participants, weights provided on product labels or from manufacturers, use of a photographic food atlas , standards sixth and fiftds sixth editionsds sixth ,41,42,43ds sixth ,45,46,47n 1138) provided a blood sample (79% fasting) and 75% provided a morning first void urine sample (n 1121). Serum total cholesterol (mmol/L), serum TAG (mmol/L), serum direct HDL cholesterol (mmol/L), serum 25-hydroxyvitamin D (nmol/L), serum vitamin B12 (pmol/L), haemoglobin (g/dL) serum ferritin (ng/mL), urinary sodium (mmol/L), and urinary potassium (mmol/L) were measured using standard methodologies, as described in detail elsewhere [In the NANS only, participants were also asked to provide a blood and urine sample, of which 76% of participants was excluded from these analyses. Intakes of \u2018fresh beef and lamb\u2019 were estimated from discrete cuts and also from composite dishes . Previous analysis has shown that failure to disaggregate composite foods substantially overestimates meat intakes by approximately 74% for beef and 51% for lamb . The mean daily intake (MDI) (g/d) of \u2018fresh beef and lamb\u2019 was calculated for individuals by summing their total intake of \u2018fresh beef and lamb\u2019 over the survey period and dividing by the number of survey days for all population groups of interest . Consumers were defined as those who consumed any amount of \u2018fresh beef or lamb\u2019 on any day during the survey period. The contribution of \u2018fresh beef and lamb\u2019 to intake of energy and selected nutrients was estimated including the non-meat components of composite dishes using the mean proportion method for \u2018fresh beef and lamb\u2019 consumers only. This method provides information about the sources that are contributing to the nutrient intake \u2018per person\u2019 and is the preferred method when determining important food sources of a nutrient for individuals in the population group as opposed to investigating the sources of a nutrient within the food supply . To identify any associations between \u2018fresh beef and lamb\u2019 consumption and energy and nutrient intakes or markers of nutrition and health status (for adults only), each population group was split into three equal tertiles (groups) based on their MDI of \u2018fresh beef and lamb\u2019 (stratified by sex and age group); non/low, medium and high consumers of \u2018fresh beef and lamb\u2019. Mean intakes of energy and nutrients , biochemical markers and systolic and diastolic BP were then compared between the non/low and high consumer groups. The proportion of the population with systolic BP \u2265 140 mmHg , diastolp < 0.001.Statistical analysis was carried out using SPSS\u00a9 for Windows\u2122 Version 26.0. Differences in intakes of \u2018fresh beef and lamb\u2019, \u2018beef\u2019, \u2018lamb\u2019 and nutrient intakes between sexes, age groups and between consumer groups were assessed using independent sample t-tests for normally distributed data or for large sample sizes and Mann\u2018Fresh beef and lamb\u2019 was consumed by 84% of children (5\u201312 years) and teenagers (13\u201317 years), 76% of adults (18\u201364 years), 73% of older adults (65\u201390 years) and 68% of WCBA . Beef waIn consumers of \u2018fresh beef and lamb\u2019, this food group contributed 5% of the MDI of energy in children and 7% in teenagers . RelativFor \u2018fresh beef and lamb\u2019 consumers, this food group contributed 8% of the MDI of energy for adults and 10% for older adults, respectively . RelativFor \u2018fresh beef and lamb\u2019 consumers, this food group contributed 7% of the MDI of energy for WCBA . RelativThe MDI of energy was higher among high consumers of \u2018fresh beef and lamb\u2019 compared to non/low consumers for teenagers , adults and WCBA while there was no difference in the intake of energy between high and non/low consumer groups for children or older adults . The MDIFor micronutrients, the MDI of niacin was higher among high consumers compared to non/low consumers for children (42.2 vs. 39.0 mg/10 MJ) with no difference in niacin intake between consumer groups for any other population group examined . The MDIFor all population groups examined , there were no differences observed in mean systolic or diastolic BP, cholesterol, lipoprotein or triglyceride values between high consumers and non/low consumers of \u2018fresh beef and lamb\u2019 or in the proportion of the population with values outside generally accepted cut-offs indicating high BP or cholesterol . FurtherThis study provides information on the role of \u2018fresh beef and lamb\u2019 in the diets of the Irish population (5\u201390 years) and its association with markers of nutrition and health status. This study found that a large proportion of people living in Ireland, including vulnerable groups such as the elderly and WCBA, consumed \u2018fresh beef and lamb\u2019 and that \u2018fresh beef and lamb contributed to intakes of a number of important nutrients including protein, MUFA, vitamin D, niacin, vitamin B6, vitamin B12, iron and zinc. For nutrients for which excess may have potential adverse health effects such as total fat, saturated fat and salt, \u2018fresh beef and lamb\u2019 contributed relatively small proportions to overall intakes of these nutrients. While higher consumption of \u2018fresh beef and lamb\u2019 was associated with higher intakes of total fat and lower intakes of carbohydrate and dietary fibre in some age groups, it was also associated with higher intakes of protein, niacin, vitamin B6, vitamin B12, zinc and potassium and lower intakes of total sugars. Furthermore, in adults, higher consumption of \u2018fresh beef and lamb\u2019 was not associated with an increased risk of cardio-metabolic diseases or better nutritional status . In the current study, \u2018fresh beef and lamb\u2019 was consumed by 68\u201384% of the population aged 5\u201390 years in Ireland with \u2018beef\u2019 more commonly consumed (63\u201383% consumers) than \u2018lamb\u2019 (11\u201330% consumers). These findings are similar to those reported in national dietary surveys in Italy, where 80\u201384% of children and teenagers and 75% of adults (younger and older) consumed \u2018beef and veal\u2019 . HoweverThe recent EAT-Lancet commission report recommended an extreme reduction in red and processed meat consumption as part of a healthy diet from sustainable food systems and suggested a daily intake of 0\u201328 g for \u2018beef, lamb and pork\u2019 . This stIt is well documented that relative to its energy profile, the nutritional quality that red meat provides is often under-valued ,67. ThisFresh red meat was also shown to be a key contributor to key micronutrients such as vitamin B12, iron and zinc ,67,68 anPrevious research from the US and Australia has shown a positive contribution of beef consumption to essential macronutrient and micronutrient intakes, such as protein, zinc, iron, and B vitamins with groups who choose to consume leaner cuts of beef with the lowest fat content having higher intakes of protein as well as vitamins B3, B6, B12, iron, phosphorus, and zinc and lower intakes of total energy, fat and carbohydrates ,22,23. IThis study also investigated the association of \u2018fresh beef and lamb\u2019 consumption with markers of nutrition and health status in adults and found that higher consumption of \u2018fresh beef and lamb\u2019 was not associated with increased risk factors of cardio-metabolic diseases . This study also found that higher consumption of \u2018fresh beef and lamb\u2019 was not associated with better nutritional status . Similarly, a study investigating the association between red meat intakes and micronutrient status of UK females did not find any significant difference for blood biomarkers of micronutrient status between groups with varying levels of red meat intake . FurtherWhile the effects of red meat consumption compared to processed meat are well documented, a recent study also found that levels of atherogenic lipids and lipoproteins did not differ following consumption of diets with red meat compared to similar amounts of white meat concluding that the trial did not support evidence for choosing white over red meat for reducing CVD risk based on lipid and lipoprotein effects . AnotherOverall, the findings of this study add to the evidence base of the existing literature supporting the role of \u2018fresh beef and lamb\u2019 (or fresh red meat) as part of a healthy diet particularly with respect to micronutrient intakes/status and as a source of high-quality protein which is particularly important for vulnerable populations including older adults ,71. CurrThe main strengths of this study include the nationally representative samples of the population aged 5\u201390 years included in this study and the detailed dietary intake data (including brand level detail and customised recipes). Furthermore, the disaggregation of meat from composite foods is an important attribute of the present study as previous analysis has shown that failure to disaggregate composite foods substantially overestimates meat intakes by approximately 40% which may have important implications for epidemiological studies and for food safety . HoweverIn summary, this study has investigated the nutritional role of \u2018fresh beef and lamb\u2019 in the diet of the population aged 5\u201390 years in Ireland using data from three nationally representative dietary surveys. The findings of this study add to the evidence base of the existing literature supporting the role of \u2018fresh beef and lamb\u2019 (or fresh red meat) as part of a healthy diet, particularly with respect to micronutrient intakes. Overall, this study found that a large proportion of people living in Ireland, including vulnerable groups such as children, older adults and WCBA, consumed \u2018fresh beef and lamb\u2019 (68\u201384% consumers across age groups) and highlighted the important contribution of \u2018fresh beef and lamb\u2019 consumption to intakes of key nutrients such as protein, monounsaturated fat, vitamins D, B12, niacin, iron and zinc while contributing relatively small proportions of nutrients of public health concern including total fat, saturated fat and salt.This study also found that (within certain age groups) those who had higher intakes of fresh \u2018beef and lamb\u2019 had higher intakes of protein, niacin, vitamin B6, vitamin B12, zinc and potassium and lower intakes of carbohydrate and total sugars . In adults, older adults and WCBA, higher consumption of \u2018fresh beef and lamb\u2019 was not associated with increased risk factors of cardio-metabolic diseases nor was it associated with better or poorer nutritional status for vitamin D, B12 or iron. These findings show the important role of \u2018fresh beef and lamb\u2019 in the diet and may be useful for policymakers incorporating health and sustainability in updated FBDG."} +{"text": "SD = 4.0; 47.7% female). PA was measured using accelerometry, and demographic and psychosocial variables were collected using questionnaires. Of the 55 children with MM and the 85 with PI with valid accelerometer data, 38.1% and 41.2%, respectively, met average daily PA guidelines. Correlates of moderate-to-physical PA (MVPA) among children with MM were age, \u03c1(53) = \u22120.45, p = .001, body mass index (BMI), \u03c1(48) = \u22120.28, p = .04, self-perceived behavioral conduct, \u03c1(24) = \u22120.45, p = .02, physical health-related quality of life, \u03c1(51) = 0.56, p < .001, and peer support, \u03c1(52) = 0.27, p = .04. Correlates of MVPA among children with PI were age, \u03c1(83) = \u22120.40, p < .001, sex, \u03c1(83) = \u22120.26, p = .01, self-perceived social competence, \u03c1(31) = 0.42, p = .02, self-perceived athletic competence, \u03c1(31) = 0.48, p = .005, physical health-related quality of life, \u03c1(83) = 0.34, p = .001, participation in community sport, \u03c1(31) = 0.41, p = .02, and family functioning, \u03c1(83) = 0.26, p = .02. These results demonstrate that children with PI and MM are insufficiently active and their PA is correlated with demographic and psychosocial factors.This study measured physical activity (PA) and explored its correlates among children with multimorbidity versus those with chronic physical illness only (PI). This study used baseline data from the Multimorbidity in Children and Youth Across the Life Course (MY LIFE) study, an on-going cohort study following 263 children with a PI 2 to 16 years of age (mean age: 9.8 years, Approximately, 25% of children and adolescents have a chronic physical illnesses such as asthma, juvenile arthritis, diabetes, epilepsy, or cerebral palsy, which increases their risk of experiencing physical, psychosocial, and emotional health challenges . EstimatWhile evidence of the complex health care needs of children with multimorbidity is growing, there remains important gaps in our understanding, particularly surrounding their engagement in physical activity (PA). Engagement in PA among children with chronic physical illnesses can improve aerobic capacity and internalizing symptoms and has Relevant correlates of PA among children with multimorbidity are also unknown. Systematic reviews demonstrate that PA engagement is influenced by demographic, health, psychosocial, behavioral, and environmental factors . PA in tTherefore, the objectives of this study were to:Estimate levels of PA in children with multimorbidity (MM) and those with a physical illness only (PI); andIdentify demographic, health, psychological/cognitive/emotional, behavioral, familial, and environmental correlates of PA among children with PI and children with MM.This study used baseline data from the Multimorbidity in Children and Youth Across the Life Course (MY LIFE) study. MY LIFE is an on-going prospective study following 263 children ages 2 to 16 years attending outpatient clinics at an academic pediatric hospital in Canada to evaluate the trajectories of mental health in children with physical illness . EligibiParticipants were recruited from dermatology, endocrinology, gastroenterology, hematology, immunology, neurology, respiratory, and rheumatology subspecialty clinics. Descriptive statistics of key variables are provided in Parents and youth \u226510 years of age completed computer-assisted self-report questionnaires, research assistants collected biological samples, and accelerometers were fitted to participants. Baseline study appointments were scheduled between August 2017 and November 2019 with follow-up appointments at 6, 12, and 24 months (data collection on-going). All participants \u22657 years provided written informed assent, and written informed consent was obtained from the parents of all enrolled participants and youth \u226516 years of age. MY LIFE received ethical approval from the Hamilton Integration Research Ethics Board.Diagnostic and Statistical Manual of Mental Disorders . Among parents of youth ages 9 to 18 years from both general and clinical populations, the test\u2013retest (K = 0.71) and convergent validity (\u03b2 = 0.67) were similar to other standardized diagnostic interviews was used to identify children with multimorbidity. The MINI-KID is a diagnostic interview tool that aligns with the diagnostic criteria of both the terviews . Eight MAccelerometry is a device-based method of assessing free-living PA. Participants were fitted with an ActiGraph GT3X activity monitor secured by a belt worn around the waist, to be worn over their right hip for 7 days . Raw datParents were asked to report information about age, sex, immigration status (relating to both themselves and their child), race, as well as their relationship status and household income.The World Health Organization Disability Assessment Schedule (WHODAS) 2.0 was used to assess health disability . The 12--2) percentiles were calculated based on the World Health Organization growth reference data for children (Standing height and weight were measured and BMI (kg\u00b7mchildren .The Strengths and Difficulties Questionnaire (SDQ) was used to assess emotional and behavioral problems for children ages 3 to 16 years . The SDQThe Self-Perception Profile for Children (SPPC) was administered to participants \u226510 years to assess their perceived scholastic competence, social competence, athletic competence, physical appearance, behavioral conduct, and global self-worth . SubscalT-scores (mean of 50 and standard deviation of 10) for each subscale; higher scores indicate better health-related quality of life. It has robust evidence of reliability, validity, and sensitivity among children as young as 2 years of age with typical development and those with physical or mental illness in over 30 countries that asked participants (youth \u226510 years of age) how often they participated in organized and unorganized sport or PA outside of school in the past 12 months; response options range from \u201cmost days\u201d to \u201calmost never\u201d . Items sFamily functioning was assessed using the General Functioning subscale of the McMaster Family Assessment Device FAD; . Twelve Seasonality was a categorical variable defined according to the National Research Council Canada and based on the first day the participant wore the accelerometer .Of the 263 children participating in the study, 140 provided valid accelerometer data (\u226510 hours of wear time on \u2265 3 days). Missing accelerometer data were not associated with a positive screen on the MINI-KID, nor with any other independent variable explored in the study. However, children \u226510 years of age were slightly more likely than children <10 years to have missing accelerometer data, with 50.4% and 43.8% missing data, respectively.p < .05. Sample size calculations were completed for the planned longitudinal analyses of the MY LIFE study suggesting 80% power to detect non-linear trajectories of mental health over four waves of data collection.The proportion of children meeting PA guidelines was determined by age group. Children ages 5 to 16 years with an average daily MVPA of \u226560 minutes as defined using the Evenson cut points were conSD = 4.2), and the majority were male (51.4%) and within the \u201cnormal\u201d BMI range (66.4%). Most parents reported that both themselves (86.4%) and their child (95.0%) were born in Canada, they were White (87.1%), they were either married or in a common law relationship (86.4%), and their annual household income was below CAD$119,000 (52.1%) (Children were on average 9.4 years old ( (52.1%) .Among children ages \u2265 5 years, 41.2% of the children with MM and 46.5% with PI met PA guidelines see . Among cdf = 3, p = .318), or when stratified by age . Among children with PI, age, sex, child-rated perceived social competence, child-rated perceived athletic competence, parent-rated physical health-related quality of life, frequency of participation in community sport, and family functioning were significantly correlated with MVPA. MVPA also differed by season for children with PI for all ages , with the highest MVPA in the spring and lowest in the fall but not when stratified by age .This study aimed to quantify the average level of PA of both children with PI and MM and identify demographic, health, psychological/cognitive/emotional, behavioral, familial, and environmental variables that correlate with their PA. Approximately half of children in MY LIFE met the Canadian PA Guidelines. Compared with a nationally representative sample from the Canadian Health Measures Survey in 2012 and 2013, children in the MY LIFE study are engaging in approximately 5 to 13 fewer average minutes of daily MVPA across all age groups . SimilarResearch among children with typical development consistently finds age, sex, and BMI correlated with MVPA ; howeverMVPA and parent-rated physical health-related quality of life were positively correlated among both groups, which is congruent with the research of Similar to children with typical development, community sport, family functioning, and season were correlates among children with PI . These rTo our knowledge, this is the first study to objectively describe PA and its correlates among children with MM. The use of accelerometry to capture PA volume, the application of reliable and valid assessments of MM, and the generalizability of the sample across a range of physical illnesses provide considerable strength to our study. However, existing limitations must be acknowledged. First, just over half of the sample provided valid accelerometer data; therefore, analyses are likely underpowered and may be biased toward more physically active children. Second, the patterns of missing accelerometer data suggest that data may not be missing at random. Third, we are unable to qualify the type or context of PA in which children are engaging. Fourth, this study was designed primarily to answer questions relating to development of multimorbidity over time and did not include all potential correlates of PA nor a comparison sample of healthy children.Overall, this study demonstrates that children with a physical illness, with or without multimorbidity, are insufficiently active and their PA engagement is correlated with variables at multiple levels of development. Future PA interventions for children with chronic illnesses may consider targeting older children through community sport/athletic programming to foster peer support and social competence. Programs should also consider constructing mastery motivational climates to promo"} +{"text": "Multiple LDLR class A (LA) repeats around LA3 promote synergistic binding to Semliki Forest virus (SFV) E1\u2010DIII near the 2\u2010fold and 5\u2010fold symmetry axes. Meanwhile, the multiple consecutive LAs concatemer shows approximately 1000 times higher binding affinity than that of LA3s, which can help to effectively and synergistically bind with E1\u2010DIII of viral envelope protein. Mutants E117A, P129A, W132A, D135A, E137A, and D139A completely lost the ability to bind E1\u2010DIII, indicating that these residues have an important role in the binding between LAs and SFV VLPs. In addition, H116 and Q126 are not conserved in the other seven LAs, impairing the hydrogen bond mediated by these two residues reduced the binding affinity between LAs and SFV E1\u2010DIII, which implies that they may be unique residues contributing to the high binding affinity of LA3 with E1\u2010DIII. Moreover, the EF\u2010like motif of LA3 is associated with calcium\u2010binding, and the calcium ions could be chelated by residues W132, D135, E137, D139, D145, and E146. LA3 completely loses its binding affinity with SFV E1\u2010DIII after ethylene diamine tetraacetic acid (EDTA) treatment, indicating that these calcium\u2010binding\u2010related residues in LA3 are required for SFV VLPs binding. Besides, sequence comparison of LAs shows that residues W132, D135, and D139 are highly conserved in all LAs. And the binding of LAs with E1\u2010DIII cannot be detected when these three key residues are not coexisting on the right site of the repeats.Interestingly, the binding surface of LA3 to E1\u2010DIII is only 1/3 to 1/2 of counterpart in the LDLRAD3\u2010D1\u2010VEEV and MXRA8\u2010CHIKV complexes. As mentioned before, the binding of LA1\u20108 to SFV is not fixed, suggesting there may be a combination pattern of multiple consecutive LA repeats. And the binding of LA1\u20102\u2010Fc, LA2\u20103\u2010Fc, LA1\u20103\u2010Fc, LA2\u20104\u2010Fc, LA3\u20105\u2010Fc, LA1\u20104\u2010Fc, LA1\u20105\u2010Fc, LA2\u20106\u2010Fc, and LA1\u20106\u2010Fc to E1\u2010DIII was further investigated. Compared with single LAs, the simultaneous binding of multiple consecutive LAs to E1\u2010DIII significantly increases the binding affinity of the concatemers. Concatemers with several consecutive LA repeats, such as LA1\u20106, LA1\u20105, and LA1\u20108, have approximately 1000 times higher binding affinity than that of LA3 Figure\u00a0. MeanwhiWhat is more, different bound LAs at the 5f positions show similar binding patterns. Different from the single LA3 binding mode, consecutive LAs bound to E1\u2010DIII in the LAs concatemer all rotate about 16\u00b0 around the pivot axis of the calcium\u2010binding site to avoid mutual spatial blockage, and thus to facilitate synergistic binding of E1\u2010DIII. Although most interactions between LAs concatemers and E1\u2010DIII are disrupted during rotation, the key sites, such as W132, D135, E137, and D139, still maintain good interactions with E1\u2010DIII. And the synergistic interaction among LAs allows multiple consecutive LA repeats to bind E1\u2010DIII simultaneously, compensating for the loss of noncritical interactions on individual LAs and greatly enhancing the viral binding to the receptor Figure\u00a0.1Although most amino acid sequences of VLDLR LAs in different species are not consistent, their key residues W132, E137, and D139 responsible for binding remain highly conserved.H.F. designed the research; H.F., R.H., and M.L. read the papers and analyzed the data; R.H. and H.F. wrote and revised the manuscript. All authors have read and approved the final manuscript.All the authors declare no conflict of interest.Not applicable."} +{"text": "Postoperative discal pseudocyst (PDP) is a rare complication after discectomy. This study aimed to summarize the characteristics, pathological mechanisms and management of PDPs.Nine patients with PDP who received surgical treatment at our institution from January 2014 to December 2021 were retrospectively reviewed. A systematic review of the literature on PDP was performed. The demographic data, clinical and imaging features, surgical options and patient prognosis were analyzed.Among the nine patients treated at our center, seven were male and two were female. The mean patient age (\u00b1 standard deviation) at the time of surgery was 28.3\u2009\u00b1\u20095.7\u2009years (range 18\u201337\u2009years). The first operation performed on seven patients was percutaneous endoscopic transforaminal discectomy (PETD) and two patients underwent microdiscectomy. The time to conservative treatment before surgical intervention was 20\u2009\u00b1\u20099.2\u2009days. In three cases, the disc cysts were located in L4/5 and in six cases the lesions were located in L5/S1. Intervertebral disc cyst interventions included foraminal scope (three cases), open discectomy (three cases), conservative treatment with a quadrant channel (one case) and CT\u2010guided puncture (one case). All patients fully recovered after surgery and the mean follow\u2010up time was 3.5\u2009\u00b1\u20092.1\u2009years. A literature review identified 14 relevant articles that reported 43 PDP cases of PDP.PDP occurs in Asian males with mild intervertebral disc degeneration and occurs 1\u2009month after discectomy. Treatment should be based on specific patient scenarios. Conservative treatment is necessary and surgery should be performed with caution. A systematic literature review been performed about Postoperative Discal Pseudocyst (PDP). Demographic data, clinical features, imaging features, surgical options and prognosis were analyzed. Lumbar disc herniation (LDH) is a common condition that usually requires surgery with the aim to improve physical function.et al.In addition, postoperative discal pseudocyst (PDP) is a rare complication associated with endoscopic discectomy that was first reported by Young Here, we report nine cases of symptomatic PDP and conducted a systematic literature review to summarize the characteristics of PDP and current treatment strategies. We present a summary of our clinical experiences of PDP to improve the understanding of the disease based on reported evidence.Data from nine patients with PDP who underwent surgical treatment at our center from January 2014 to December 2021 were retrospectively analyzed. All of these patients had recurrent symptoms including lumbar and leg pain after minimally invasive discectomy and had the general characteristics of intervertebral disc cysts proposed by Chiba.A systematic review of PDP was undertaken according to the PRISMA 2020 statement Preferred Reporting Items.All patient information was systematically reviewed and analyzed. All data were provided as the mean\u2009\u00b1\u2009standard deviation. Statistical analysis was performed using a z\u2010test.Data from nine patients were included in this study and are summarized in Table\u00a0Of the nine patients treated at our unit, seven were male and two were female and the mean age at the time of surgery was 28.3\u2009\u00b1\u20095.7\u2009years (range 18\u201337\u2009years). Percutaneous endoscopic transforaminal discectomy (PETD) was the first operation performed on seven patients and microdiscectomy was first performed on two patients. The duration of postoperative intervertebral disc cyst\u2010related symptoms was 20.3\u2009\u00b1\u20099.3 (range 8\u201342) days. Four cases reported limb pain on the affected side and five cases reported limb pain accompanied with back pain. In three cases, the PDP was located in L4/5 and in six cases the lesion was located in L5/S1. The lesions were mainly concentrated on the left side in six cases and on the right side in three cases.A retrospective analysis of the literature identified 38 male and five female patients with a mean age of 26.3\u2009\u00b1\u20099.4\u2009years (14\u201360\u2009years). All of these patients underwent surgery for lumbar disc herniation prior to the development of PDP in MD 15 (34.9%), PETD 12 (28%) and PEID16 (37.2%). The duration of postoperative intervertebral disc cyst\u2010related symptoms was 35.1\u2009\u00b1\u200934.8 (range 7\u2013240) days. There is no unified evaluation standard for the description of symptoms and signs of PDP and so these were not evaluated from the literature. Three cases had lesions in L3/4, 23 cases had lesions in L4/5, and 27 cases had lesions in L5/S1 . In patients with mild or asymptomatic PDP that had not been diagnosed and in patients with symptomatic PDP treated at other hospitals, some PDP spontaneously decreased or disappeared.Our data showed that most of the PDP patients were young which agrees with previously reported cases of the disease in which patients between 14\u201360\u2009years.It remains unclear if the disc segments of PDP are biased. In this study, we found three cases of PDP in L4/5 segment and six cases of PDP in L4/5 segment. From the literature review, we found 23 cases in L4/L5, 17 cases in L5/S1 and three cases in L3/4. However, the number of LDH cases in each segment was not compared as different surgical approaches may bias the results. Also, we found that PDP could exist on one side of the disc or across the midline, generally on one side. These findings were related to the position of the disc herniation and may not be significant in the formation of PDP.Current reports of PDP have mainly focused on Asian populations with the largest studies in South Korea and China. In this study, 28 cases (65.1%) were reported in South Korea and eight cases (18.6%) were reported in China. Four cases (9.3%) were reported in Japan, two cases (4.7%) in the United States and one case (2.3%) in India. These data suggest regional differences in the occurrence of PDP.et al.et al.PDP usually appears during the early stage of lumbar discectomy but the exact timing of PDP remains controversial. Chung We analyzed the time of postoperative symptoms in 43 patients from a review of the literature and found that the time to postoperative symptoms related to disc cysts was 38.1\u2009\u00b1\u200937.3 (7240) days and 20.3\u2009\u00b1\u20099.3 (range 8\u201342) days in the nine patients in our unit. The onset time of symptoms in patients can more accurately reflect the formation time of PDP compared to the time of symptomatic PDP confirmed by MRI. However, some PDP patients may be asymptomatic in the early stages and so the formation time of PDP may be earlier.PDP has very similar characteristics to discal cysts except for the history of operative treatment for LDH.et al.et al.The pathogenesis of PDP remains unclear and several potential mechanisms have been proposed. Young A further hypothesis involves the emergence of the nucleus pulposus after the formation of membrane structures connected by a fibrous ring. During the operation, the emergence of the nucleus pulposus in front of the rear area is retained. The nucleus pulposus form in the cystic cavity formation resulting in postoperative bleeding and so liquid accumulates in the cavity to form a pseudocyst.et al.Other studies have suggested that PDP and disc cysts are homologous diseases with a conserved pathological mechanism. PDP is caused by delayed bleeding at the discectomy site, and TCM\u2010derived annular injury in discectomy may accelerate the pathological progress of DC.et al. and that mild degeneration of the intervertebral disc may be a risk factor for PDP. However, this hypothesis requires further investigation.Intervertebral disc cysts are mostly found in young people with mild intervertebral disc degeneration. MRI shows a high signal on T2\u2010weighted images and a low signal on T1\u2010weighted images.Conservative treatment should be considered in patients with less severe symptoms as smaller cysts may disappear over time.The long\u2010term use of medication can negatively impact liver and kidney function, and prolonged bed rest may cause muscle atrophy. For patients who do not want to be treated again, interventional therapy under the guidance of DR or CT can be used.After conservative OR interventional treatments, some patients had poor responses and required surgery.Studies have reported no significant differences in treatment outcomes following surgery or conservative treatment for symptomatic PDP.PDP is a rare complication that can occur after lumbar discectomy. PDP occurs in Asian males with mild intervertebral disc degeneration 1\u2009month after discectomy. The pathogenesis of this disease is unclear and it may be related to infections. Treatment should be selected according to the specific situation of patients. In cases where conservative treatment is necessary, surgical treatment should be carried out with caution.Zhenlu Cao wrote the manuscript. Yanan Cong collected the data and reviewed the manuscript. Chuqiang Yin, Yuelei Wang, Zhichao Wang and XiaoWei Liu participated in the surgery and revised the manuscript. Ting Wang was the lead surgeon and revised the manuscript.The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."} +{"text": "Chorea can have a wide variety of causes including neurodegenerative, pharmacological, structural, metabolic, infectious, immunologic and paraneoplastic processes.We reviewed the clinical records of patients with apparently sporadic choreic movements and no relevant family history, who presented to our neurology department between 1991 and 2022.We detected 38 cases of apparent sporadic chorea (ASC); Our analysis revealed 5 cases of genetic chorea (including 3 cases with Huntington\u2019s disease) while 6 cases were autoimmune/hematological; 6 drug-related chorea, 5 metabolic-vascular, 5 due to miscellaneous conditions and 4 were of mixed etiology. No clear etiology was identified in 8 cases. The differential diagnosis of ASC is extensive and challenging.Chorea can have a wide variety of genetic and sporadic causesWe reviewed the clinical records of patients with apparently sporadic chorea (ASC), who presented to our neurology department over the last 30 yearsWe detected 38 cases of apparent ASC; Our analysis revealed a wide array of different sporadic conditions and 5 cases of genetic choreaThe differential diagnosis of ASC is extensive and challenging Chorea is characterized by the presence of fluctuating, brief, and unpredictable involuntary movements 23. The d21234567812345678947We carried out a retrospective chart review of patients with ASC and no relevant family history, who presented to our neurology department from 1991 to 2022. We excluded patients with a positive family history. All patients underwent neuroimaging studies (brain CT or MRI scan). Laboratory tests included routine blood and urine analysis as well as blood tests for thyroid hormones, creatine phosphokinase, copper, ceruloplasmin and acanthocytes. Depending on the clinical context of each patient, autoimmune tests, coagulation studies, muscular biopsy and molecular analyses to exclude HD, chorea-acanthocythosis, hereditary ataxias, hereditary frontotemporal dementia or ADCY5-related dyskinesias were carried out. This study was approved by the Research Ethics Committee of our center.Below we present the results of our research grouped by diagnosis.Genetic chorea was diagnosed in 5 patients including 3 patients with late onset HD (cases 1\u20133), all presented mild late-onset chorea with typical oculomotor disturbances (CAG expansions 29-39-39 respectively). Also included in this group was a typical case of chorea-acanthocytosis (case 4) with progressive chorea and oral lesions, as well as a carrier of an ADCY5 mutation (case 5), who exhibited chorea-dystonia associated with ataxia. The patient had been initially referred to our department with a diagnosis of cerebral palsy (CP).We detected several autoimmune/hematological cases (cases 6\u201310) including one female patient with juvenile Sydenham chorea (SC); a typical clear-cut case in a young female with asymmetric presentation (case 6). We studied 2 cases of lupus-related chorea, both with mild generalized chorea. The first patient (case 7) had a positive antiphospholipid antibodies; the second patient (case 8) presented nephrotic syndrome, arthritis, leukopenia and was positive for antinuclear antibodies. We also studied a patient with systemic vasculitis related with rheumatoid arthritis (case 9).Finally, a patient with late onset chorea was diagnosed with JAK-mutation- positive- polycythemia vera (case 10). This patient presented with moderate generalized chorea and over time, she developed laboratory and clinical signs of polycythemia.This group (cases 11\u201316) comprised 6 patients, treated with antidopaminergic drugs , opiates, antidepressants, or a combination of drugs (4 patients). One of these patients had chorea associated to other more typical aspects of tardive dyskinesia such as cranial dystonia. After drug withdrawal, four patients improved and no change was noted in the other two.Two patients had chorea related to metabolic conditions , both had uncontrolled diabetes and both improved with metabolic correction. Of note, chorea was the presenting symptom in case 18. Three other patients presented subacute asymmetric chorea following a vascular event (cases 19\u201321).We identified a case with classical mitochondrial disease presenting seizures, neurosensorial hearing loss, poor visual acuity, episodes of sudden hemiparesis and myopathy. Muscle biopsy disclosed typical ragged red fibers. We suspected the presence of mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS), although a molecular analysis of mtDNA ruled out MELAS, as well as myoclonic epilepsy with ragged red fibers, chronic progressive external ophthalmoplegia, and Kearns-Sayre syndrome; with the passage of time, this patient developed generalized chorea and cognitive decline (case 22).We studied an intriguing case of a woman with renal failure who presented metformin-related severe chorea (case 23). The literature contains several reports of this etiology with similar clinical findings, probably due to severe metabolic acidosis (see discussion).We also detected 2 cases of early onset chorea in patients with motor and cognitive static deficiency since early childhood . CP-related chorea seems the best explanation.Post-traumatic chorea was identified in one patient (case 26) who had a history of severe cranial trauma with extensive frontal lesions and presented with chorea and cognitive decline.Four patients (case 27\u201330) had several etiologies in combination, such as vascular chorea associated with neuroleptic drug therapy; severe uncontrolled diabetes in addition to B12 deficit; vascular etiology combined with hepatic cirrhosis and chronic neuroleptic therapy in addition to long term depression and frontotemporal cognitive decline.We were unable to establish a definite cause of chorea in 8 cases (cases 31\u201338), despite an extensive work-up. We suspected frontotemporal dementia in 4 cases and hereditary ataxia in 2 patient (case 32 and 36) although the findings of genetic analyses were negative for hexanucleotide expansion (C9ORF72), progranulin mutation and/or common dominant hereditary/recessive ataxias . We also suspected PMM2 mutation as a cause of adult-onset chorea plus ataxia and congenital cognitive decline (case 35), the most common congenital disorder of N-glycosylation, but genetic analyses did not permit such confirmation (only one confirmed PMM2 mutation). We also found the common haemochromatosis mutation in one case (case 38) in which the routine work-up disclosed elevated ferritin levels, the patient has been treated with periodic phlebotomy, although to date the chorea has not improved.Five patients were diagnosed with hereditary chorea. This finding is hardly surprising since the absence of a family history does not rule out the presence of a genetic cause, including late-onset HD 23681113141516.1314151213141512131415We also detected a typical case of chorea-acanthocytosis case 4) with progressive chorea and typical oral lesions. Oral lesions are critical red-flag for any patient presenting with chorea with pro678. This67We evaluated a patient with an ADCY5 mutation presenting early-onset chorea associated with severe ataxia and dystonia. The patient was first studied many years before the mutation was described, and presented typical features of ADCY 5 mutation including chorea, axial hypotonia, and nocturnal bouts of severe dyskinesia 7818.78Regarding the immune and hematological cases included in this series, we diagnosed a typical case of SC in a young woman who abruptly presented asymmetric chorea, in this particular case the presence of a hung-up knee jerk prompted20Three patients were diagnosed with lupus-related and vasculitis-related chorea. Chorea may be a classic, albeit rare, manifestation of lupus 1022, but10810232425Polycythemic chorea should be considered in the differential diagnosis of late-onset chorea 1027. Cho10Chorea may be a side effect of many drugs especially neuroleptics, but also, less commonly, anticonvulsants, anticholinergics, antidepressants and opioids 828293031.282930Chorea may be observed in many systemic and metabolic conditions such as uncontrolled diabetes, liver and renal disease, hyperthyroidism, electrolyte disturbances and vitamin B12 deficiency 810323335363738.353637881036363736Vascular conditions such as ischemic and hemorrhagic strokes can be associated with most movement disorders including chorea. Acute occurrence of subthalamic-related hemichorea or hemiballismus is rarely overlooked in emergency settings, but many other brain areas may be also involved including the putamen, pallidum, thalamus, caudate nucleus, corona radiata and even cortical areas 3941424344.414243The subset covering miscellaneous cases and those with mixed etiology comprises 9 patients in this series. We had the opportunity to follow a patient with typical mitochondrial symptoms such as seizures, neurosensorial hearing loss, poor visual acuity, episodes of sudden hemiparesis, and myopathy; muscle biopsy confirmed the presence of ragged red fibers, but genetic analyses ruled out MELAS, MERF and KSS. Over time, the patient developed progressive chorea. Mitochondrial diseases may manifest a plethora of movement disorders including chorea 945.9Dyskinetic cerebral palsy is the second most common type of CP after spastic forms . Chorea 46678We also studied a very rare case of a patient with chronic renal insufficiency who developed severe chorea associated with metformin intake. There are several reports of metformin-induced chorea , likely 34A man who had a severe traumatic head injury following a 10-meter fall with frontal lesion presented frontal lobe disorder and chorea. Post-traumatic movement disorders are well known, and chorea is a rare complication of head injury 515253.5152We were unable to establish a definitive diagnosis for 8 patients, although we suspected degenerative ataxias in 2 and frontotemporal dementia in 4 patients. Frontotemporal dementia may be associated with chorea 55565758,555657Finally, movements disorders associated with haemochromatosis, including chorea, have been described , but thiTo date, two interesting case series of sporadic chorea have been published 9, both fIn summary, the differential diagnosis of ASC is extensive and challenging, even though the etiology of acute or subacute chorea may be suspected rapidly. In such cases, structural, infectious, metabolic, or drug-induced chorea are the main candidates. However a proportion of genetic choreas may appear with no known family history, including HD , recessive choreas such as chorea-acanthocytosis, and/or recently described choreas such as those due to an ADCY5 mutation 24567. In245612345678"} +{"text": "For our system, this corresponds to a temperature decrease in approximately 15\u2009K between upstream and downstream positions of the flowing leaf. Making reasonable assumptions on the absorption of the thermal background radiation in the flatjet, we can extend our analysis to infer a thickness map. For a reference system, our value for the thickness is in good agreement with the one reported from white light interferometry.We present spatially resolved measurements of the temperature of a flat liquid water microjet for varying ambient pressures, from vacuum to 100% relative humidity. The entire jet surface is probed in a single shot by a high-resolution infrared camera. Obtained 2D images are substantially influenced by the temperature of the apparatus on the opposite side of the infrared camera; a protocol to correct for the thermal background radiation is presented. In vacuum, we observe cooling rates due to water evaporation on the order of 10 Fast-flowing liquid microjets (LJ) in vacuum are excellently suited for the study of the bulk and surface properties of aqueous and organic solutions using electronTemperature measurements from LJ in vacuum have not been routinely performed and this has prohibited to accurately access temperature-dependent properties from (aqueous) solutions, in particular, in conjunction with electron spectroscopy. One desirable goal would be the determination of enthalpies or entropies, associated with interfacial (as opposed to bulk solution) chemical equilibria. Another challenge is the quantitative determination of metastable (supercooled) solution phases. Somewhat related, several studies and simulations already demonstrated a significant effect of the temperature on the hydration shell and on the solvent\u2013solvent as well as solvent\u2013solute interactions in aqueous solutions.5 K/s, based on the analysis of measured mass loss (\u223c5%).et al. was based on the measured velocity distribution of evaporating water molecules.5 K/s.et al. measured the respective velocity distributions to characterize the evaporation and molecular beam scattering from dodecane and neon-doped dodecane flat liquid jets.et al. applied static diffraction to determine the temperature of water FJs and reported cooling rates of up to 106 K/s.et al. investigated the effect of the nozzle geometry and solvent on the temperature of the FJ, also by Raman spectroscopy.LJs in vacuum effectively cool by molecular evaporation, leading to a temperature gradient along the propagation direction.\u03bcm-range spatial resolution. Previously, IR cameras have been applied to monitor, e.g., the surface temperature of small freezing water droplets.d and temperature T, and associated evaporation rates, for different pressures of the atmosphere surrounding the jet, based on IR camera images. In the present study, we describe an approach, using an infrared (IR) camera, to monitor the temperature as well as the thickness of a water FJ with a precision of \u00b11\u2009K, simultaneously over the entire surface, with tens of \u03bcm and a combined flow rate of 6.2\u2009ml/min (2 \u00d7 3.1\u2009ml/min), colliding at an angle of 45\u00b0, to create an FJ; compare \u22121. At the point of injection, the jets are at room temperature. For details on the sample delivery system we refer to Refs. \u22121;2. This information enables to estimate cooling rates.We use two cylindrical water LJs, each with a diameter of 64\u2009\u22122 mbar range. We do report though on measurements at higher pressures as well, maintained when operating the mechanical pumps at reduced power or completely switched off. In the latter case, an open 500-ml water reservoir was placed in the chamber, which was backfilled with nitrogen to 1000 mbar . To achieve slightly reduced RH, pumps are switched on for a few seconds until the desired pressure is reached and then switched off. Note, when pumps are operating, vapor is constantly removed (steady state), while this is not the case when then pumps are switched off.The vacuum chamber is equipped with two roughing pumps and two turbomolecular pumps as well as two liquid-nitrogen cold traps. Under FJ operation conditions and with all pumps in operation, the pressure in the vacuum chamber is in the low-10\u03bcm/pixel spatial resolution) in a single snapshot, acquired in less than a second, enabling the determination of thickness and temperature of the FJ with high spatial resolution. Conversely of the leaf, i.e., facing away from the camera, a polyethylene film-covered copper plate is placed inside the vacuum chamber. Confirmed by calibration of the camera-determined plate temperature with the one measured using a thermocouple, the background (plate) has an emission coefficient very similar to water (0.95 \u2248 \u03b5bg \u2248 \u03b5FJ).Tbg, and temperature of the FJ, TFJ, are simultaneously recorded, as described in Ref. Tcam, must be corrected at each surface point by a factor to account for the respective local thickness. We note that an approximately 100-\u03bcm thick water film would absorb the infrared radiation completely.P) within its sensitive wavelength region, 8\u201314\u2009\u03bcm, and calculates from P, using the Stefan\u2013Boltzmann equation , the temperature T of an object. For the micrometer-thin leaf, the thermal diffusivity of water (0.143\u2009mm2/s) is high enough to not cause a significant temperature gradient in the direction perpendicular to the leaf surface;Pcam is the sum of the two contributions,Tcam will be in between the actual temperature of the FJ, TFJ, and the temperature of the background, Tbg, and can generally be expressed asTFJ and Tbg. Here, \u03b2 is a correction matrix [with 0 \u2264 \u03b2\u2009\u2264\u20091]. Equation T4-dependence resulting from the Stefan\u2013Boltzmann law, can be inferred from an exponential power law for attenuation of radiation traveling through matter and is detailed in the Ref. The IR camera records the integrated radiative power for each pixel of the leaf and necessitates recording Tcam for a series of Tbg values. Rewriting Eq. The correction matrix can be determined from linear regression when plotting \u03b2 for the FJ at 100% relative humidity as to turn off evaporative cooling in order to solely detect the effect of background temperature. In Tbg, for measurements at 19\u2009\u00b0C, 26\u2009\u00b0C (room temperature), and 40\u2009\u00b0C, on the recorded apparent temperature of the FJ, Tcam. The leaf appears to be warmer if the background is warmer. This effect is the largest at the bottom of the leaf, which is known to be the thinnest part. We then calculated the correction matrix of the FJ \u03b2 using Eq. In a first step, we evaluated the correction matrix \u03b2 associated with water evaporative cooling (absent at 100% RH), we next consider analogous measurements under vacuum conditions. In this case, the effect of the background temperature on the measured temperature is not directly revealed due to the partial cancelation associated with water cooling and the transmittance of the background temperature. Nevertheless, the correction matrix for both cases is almost identical within the error bars; for minor differences, see Ref. Tcam using Eq. \u03b2. Tcam-image recorded at 100% RH , we can extract information on the absolute thickness of the FJ, d, by applying Lambert-Beer's law (c is the molar concentration of water (55.5\u2009mol/l). The molar absorption coefficient does depend on the wavelength, \u03b1(\u03bb). In the case of our IR camera, we have to consider the wavelength range of 8\u201314\u2009\u03bcm over which the signal intensity is integrated. This implies that we need to determine an average coefficient, \u03b1*, valid for that interval. As detailed in Ref. \u03bcm and then stays rather flat within our region of interest, and importantly, this spectral region is free of any sharp water features. Rather than determining \u03b1* directly from the gray-shaded region of Fig. S10, we consider the ideal Planck spectrum of black-body emission at 300\u2009K, reproduced in the inset of Fig. S11. Although, strictly speaking, this spectrum may not exactly correspond to the actual (unknown) spectrum from room-temperature water, it will be a very good approximation, and in addition, potential small energy shifts would be irrelevant due to the signal integration over the wavelength detection window. We can then convolve the black-body emission spectrum with \u03b1(\u03bb) to obtain the modified blue curve in Fig. S11, which yields \u03b1*\u2009=\u200910.2 M\u22121\u2009cm\u22121. Considering the various molar absorption spectra reported in the literature, we determine an error of the \u03b1* value of less than 5%.\u03b2 \u2248 \u03c4 and inserting the known value of c, we can calculate the 2D image of the thickness of the FJ.\u03bcm, marked in \u22121 flow rate) comparable to Ref. \u03bcm in the center of the leaf Eq. primarilsee Ref. , which it\u2009=\u2009C1/z + C2, blue line, with C1\u2009=\u20091.91 and C2\u2009=\u20092.29),The position-dependent thickness along the z-axis of the leaf can be fitted based on the Hasson\u2013Peck model (T\u223c15\u2009K across the length of the leaf under vacuum conditions (1.0 mbar or lower). We can then estimate which fraction of the liquid f (average mass loss) has to be evaporated by comparing the enthalpy of evaporation Hv and the drop of temperature \u0394T. A similar balance equation was also used to calculate the fraction of ice initially formed from the supercooled liquid,cp is the molar heat capacity and Hv is the enthalpy of evaporation.f and using literature values for the heat capacity and enthalpy of evaporation results inIn the last part of this communication, we consider the theoretical dependence of the thickness of the leaf as a function of evaporative cooling. The bulk of the liquid is cooled by evaporation of the surface molecules. Above we have determined a temperature drop of \u0394In conclusion, we have demonstrated that it is viable to measure and map the temperature and thickness profiles of partially transmissive thin liquid water sheets using an IR camera. Our main accomplishment is that this mapping is done in a single-shot measurement, providing a 2D temperature image of the entire FJ surface, with a spatial resolution of a few tens of micrometers. For water FJs in vacuum, the inferred cooling rates are in very good agreement with measurements by Raman spectroscopy. As expected, no cooling is observed for the flatjet at atmospheric conditions. Our results also show that for the comparison of data from various laboratories, the exact knowledge of background pressure is not important as long as it is in the sub-mbar regime. On the other hand, flow rate, surface point of measurement, and temperature of the liquid upon injection should be known. Our experimental setup and protocol are applicable to flatjets of sizes different than in the present study as long as the resolution of the IR camera used is sufficient to resolve the dimensions of the jet. For future experiments on liquid jets requiring an accurate knowledge of the local temperature, we recommend to use FJ instead of cylindrical LJ. Most important for future works is the ability to monitor temperature distributions, by an instantaneous 2D image, during chemical reactions occurring at the (aqueous) solution surface. This includes gas\u2013liquid phase chemical reactions or access of thermodynamic quantities associated with, e.g., temperature and/or pH-dependent solute molecular dissociation at the solution\u2013vacuum interface."} +{"text": "ObjectiveOpioid use disorder (OUD) continues to be a leading cause of maternal death in the United States. The impact of OUD on pregnancy has dramatically grown in recent years, with OUD-related maternal deaths between 2007 and 2016 nearly doubling. However, the characteristics of pregnancy-associated-not-related (PANR) deaths from opioid overdose are not well understood. Specifically, the timing of OUD-related maternal deaths relative to the partum periods has not been fully described. In this study, we aimed to better characterize high-risk time periods for people with OUD, with the goal of elucidating factors that may contribute to opioid-related PANR deaths.MethodsIn this retrospective cohort study, we analyzed the Michigan Department of Health and Human Services Maternal Mortality Surveillance Program database from 2007 to 2015 to investigate the temporal trends in opioid-related PANR deaths.ResultsThere was an over fourfold increase in opioid-related PANR from 2007 to 2015 and a maternal mortality ratio of 23.0 per 100,000 births attributable to opioid-related PANR deaths. Ante- and postpartum opioid-related PANR deaths shared similar demographic distribution, were associated with polysubstance use, and had low rates of medication-assisted treatment (MAT). Most opioid-related PANR deaths occurred at a steady rate during the postpartum period. Only 3.6% of people who died in the postpartum period were uninsured, compared to 42.1% of people who died in the antepartum period.ConclusionThough ante and postpartum deaths share many characteristics, our study revealed key distinctions that can help better inform the care of pregnant patients with OUD. Opioid use disorder (OUD) continues to be a major concern in pregnancy and is increasingly seen during delivery hospitalization . People Understanding the characteristics and timing of maternal death in cases of OUD may help inform health interventions and resource allocation to reduce maternal mortality . PreviouThe objectives of our study were to characterize high-risk time periods of opioid-related PANR deaths. Using the Michigan Department of Health and Human Services Maternal Mortality Surveillance Program database from 2007 to 2015, we compared the characteristics of opioid-related PANR deaths in antepartum and postpartum periods. By investigating the temporal trends of opioid-related PANR, we aim to further inform programs for the treatment and prevention of maternal mortality due to OUD.We conducted a retrospective cohort study of all PANR deaths using the\u00a0Michigan Department of Health and Human Services\u00a0Maternal Mortality Surveillance Program database from 2007-2015. This program was established to improve the quality of maternal death data in Michigan and to bring awareness to the importance of preventing death among women during or within one year of pregnancy. The state mandates reporting of all records associated with maternal death, and subsequently, a multidisciplinary team reviewed the process to determine causes of death and to make policy recommendations to prevent future deaths. This study was considered exempt from full review by the Institutional Review Board .We identified all PANR deaths within the database, which were defined as\u00a0death\u00a0occurring during pregnancy or within one year of the end of pregnancy, but not related to pregnancy.\u00a0Inclusion criteria for the study\u00a0are\u00a0all PANR deaths\u00a0in the state of Michigan from 2007 to 2015, deemed\u00a0by the surveillance program to be related to OUD.\u00a0The\u00a0available records of each case of death, including prenatal and delivery records, birth certificates, death certificates, and police reports, were systematically reviewed. We collected information on the year of death, region of death, manner of death, patient demographics, delivery outcomes, comorbidities, and urine and post-mortem toxicology studies. Descriptive statistics were used to characterize baseline demographic data and temporal trends for opioid-related PANR deaths. Univariate analyses were performed to compare each variable characteristic of antepartum vs. postpartum opioid-related PANR deaths, with the Mann-Whitney U test for continuous variables and the Chi-squared test for categorical variables. A multivariable logistic regression model was built using maternal age, race/ethnicity, insurance status, and exposure to medication-assisted treatment (MAT) to determine which baseline characteristics were most correlated to opioid-related PANR deaths in the antepartum vs. postpartum period (postpartum period was used as the reference group).\u00a0Differences in the timing of death between\u00a0individuals with and without MAT\u00a0was assessed by Kaplan-Meir curves and the log-rank test.From January 2007 to December 2015, 424 PANR deaths were identified in the state of Michigan. A total of 102/424 (24.1%) PANR deaths were related to OUD, of which 19/102 (19.6%) occurred during the antepartum period, and 83/102 (81.4%) occurred during the postpartum period. During the study period, the overall opioid-related PANR and non-opioid-related PANR mortality ratios were 9.7 and 30.8 deaths per 100,000 live births, respectively. There was a steady increase in opioid-related PANR deaths throughout the study years, with the maternal mortality ratio peaking at 23.0 per 100,000 live births in 2015 deaths were determined to be accidental deaths, 2/102 (2.0%) were suicides, and 23/102 (22.5%) were indeterminate. There was no difference in the distribution of manner of death between antepartum and postpartum deaths (p=0.514). An autopsy was performed in 100/102 (98.0%) of deaths, and toxicology was performed in 98/102 96.0%) of the cases. Benzodiazepine was found in 53/98 (54.0%) of autopsy toxicology studies, followed by cocaine in 23/98 (23.5%) studies. A comparison of non-opioid drugs detected from autopsy toxicology in antepartum opioid-related PANR deaths relative to postpartum opioid-related PANR deaths is shown in Figure .0% of thIn terms of geographic area, most opioid-related PANR deaths occurred in region 10, which includes the three most populous counties in Michigan. The proportion of opioid-related PANR deaths in region 10 was higher than the proportion of live births in this region .\u00a0Our study showed a steady increase in opioid-related PANR deaths in the state of Michigan from 2007-2015, with an over four-fold increase over the study period. At the end of the study period, there was a maternal mortality ratio of 23.0 per 100,000 births attributable to opioid-related PANR deaths. This finding echoes previous studies that demonstrate increasing opioid-related PANR deaths in the United States over this time period .\u00a0Ante- and postpartum opioid-related PANR deaths shared largely similar demographic distribution. We also see a low rate of MAT in both time frame of deaths, similar to previous reports ,6. This Most antepartum and postpartum opioid-related PANR deaths were associated with polysubstance use. These results reflect previous research, which suggests that most people with OUD use one or more additional substances. The most commonly found substance on toxicology was benzodiazepine, which dramatically increases overdose risk when combined with opiates Figure . Thus, tThe majority of opioid-related PANR deaths in this study occurred during the postpartum period, adding to an extensive body of literature that suggests that increased intervention for OUD is needed during this time period ,6,8. WhiAs opposed to in the postpartum period, 42.1% of antepartum opioid-related PANR deaths occurred in uninsured patients. The association between insurance status and antepartum death remained even after controlling for race/ethnicity, maternal age, and exposure to MAT. Furthermore, all the antepartum deaths occurred among people who did not have prenatal care. Although causation cannot be assumed, this relationship may indicate that obstetric-specific care could reduce opioid-related PANR deaths during ante- and postpartum periods. Unfortunately, previous studies have shown a low rate of postpartum care, even among people with pregnancy complications -16. WhilClassically, the opioid epidemic has mostly been attributed to White, middle-class, suburban, and rural communities ,18. WhilOur study is subject to several limitations. Because our data is limited to mortality data, we are unable to measure the impact of MAT in reducing opioid-associated PANR deaths. Additionally, despite the Michigan mandate to report OUD-related PANR deaths, it is possible that some healthcare encounters were not reported. Finally, repeating this study with a multi-state data set could illuminate additional trends by increasing sample size, especially in the antepartum period.\u00a0In conclusion, ante- and postpartum opioid-related PANR deaths share demographic similarities, as well as associations with polysubstance use and low rates of MAT. However, key differences remain. Notably, a large proportion of antepartum opioid-related PANR deaths occur in uninsured patients. Additionally, the majority of opioid-related PANR happen at a steady rate during the postpartum period. These trends may help to tailor comprehensive programs for people with OUD during the pregnancy and postpartum periods globally.Our study supports the following: 1) access to initiate prenatal care is essential in the antepartum period, 2) along with improvement in access to insurance during the postpartum period, efforts to increase visits and healthcare interface needs to be performed, 3) MAT needs to be made accessible throughout pregnancy periods, and 4) while traditionally seen as majority White issue, equitable programs including campaign and effort in marginalized communities is of utmost importance."} +{"text": "Gynecologic cancer, including ovarian cancer and endometrial cancer, is characterized by morphological and molecular heterogeneity. Germline and somatic testing are available for patients to screen for pathogenic variants in genes such as BRCA1/2. Tissue expression levels of immunogenomic markers such as PD-L1 are also being used in clinical research. The basic therapeutic approach to gynecologic cancer combines surgery with chemotherapy. Immunotherapy, while not yet a mainstream treatment for gynecologic cancers, is advancing, with Dostarlimab recently receiving approval as a treatment for endometrial cancer. The goal remains to harness stimulated immune cells in the bloodstream to eradicate multiple metastases, a feat currently deemed challenging in a typical clinical setting. For the discovery of novel immunotherapy-based tumor targets, tumor-infiltrating lymphocytes (TILs) give a key insight on tumor-related immune activities by providing T cell receptor (TCR) sequences. Understanding the TCR repertoires of TILs in metastatic tissues and the circulation is important from an immunotherapy standpoint, as a subset of T cells in the blood have the potential to help kill tumor cells. To explore the relationship between distant tissue biopsy regions and blood circulation, we investigated the TCR beta chain (TCR\u03b2) in bulk tumor and matched blood samples from 39 patients with gynecologic cancer. We found that the TCR clones of TILs at different tumor sites were globally shared within patients and had high overlap with the TCR clones in peripheral blood. Morphological and molecular heterogeneity in gynecologic cancers has been shown to affect patient survival4. Pathologic assessment of genomic and immunogenomic (e.g. PD-1 and PD-L1) features to distinguish diverse subtypes of gynecologic cancer is important to determine optimal treatment strategies13. In this context, the approval of Dostarlimab is noteworthy, as it specifically targets patients with mismatch repair deficiency (dMMR) or microsatellite instability-high (MSI-H) markers14. The US Food and Drug Administration (FDA) granted accelerated approval to Dostarlimab for monotherapy use in patients with mismatch repair deficiency (dMMR) in 202115. The approval was further extended in 2023, allowing the use of Dostarlimab for recurrent or advanced endometrial cancer patients with either mismatch repair deficiency (dMMR) or microsatellite instability-high (MSI-H), both in combination with chemotherapy and as monotherapy17. Additionally, the FDA granted approval to Pembrolizumab for patients with persistent, recurrent or metastatic cervical cancer whose tissue expresses PD-L1 (CPS\u2009\u2265\u20091) in 202119. This regulatory endorsement underscores the importance of genomic and immunogenomic profiling in tailoring treatment approaches for gynecologic cancers.Gynecologic cancers, including ovarian cancer and endometrial cancer, cause widespread mortality among women22. Investigation of TCR repertoire which is expressed by heterogeneous lymphocyte populations is important for understanding the immune activities surrounding tumors. Previous studies have shown evidence of T cell expansion with TCR repertoire or flow cytometry data of TILs in gynecologic cancers depending on the subtype of the tumor tissue24 and T cells25. However, the number of tissue samples per patient was not high enough in these studies to assert that the TCRs found in tissues are highly individual-specific. Also, an explanation of the TCR found in multiple tissues and its overlap with blood was insufficient.The success of immune checkpoint inhibitors has led to heightened interest in the tumor immune microenvironment as a factor in the diagnosis and treatment of gynecologic cancersIn this study, we sought to find patterns in inter-sample TCR repertoire overlap which consists of overlap between tissue-tissue and tissue-blood. We performed sequencing of the TCR\u03b2 from both tumor and peripheral blood samples of 31 patients with ovarian cancer and 8 patients with endometrial cancer. We also examined multiple metastatic tumor sites in 8 patients and compared to the primary tumor. Experiments were performed in duplicate to focus on clones that were twice-observed in both replicates of each sample. The overall scheme is shown in Fig.\u00a0Thirty-nine patients who underwent surgery in 2020 or 2021 in the Department of Obstetrics and Gynecology at Yonsei University, Korea, participated in the study. Institutional Review Board (IRB) approval was obtained from Yonsei University Health System (IRB number 4-2018-0342). All methods were performed in accordance with relevant guidelines and regulations. All patients gave informed consent to participate in the study. Tissue samples were collected from 31 patients with ovarian cancer and 8 patients with endometrial cancer. The 33 cases from 31 ovarian cancer patients included borderline ovarian tumor and peritoneal cancer . Whole blood samples were collected from each patient prior to tumor resection. The patient labeled \u201cOV30\u201d and \u201cOV31\u201d had serial samples. The first series of samples were obtained for the purpose of pathologic confirmation and the second series of samples were obtained while reducing the size of the tumor.\u00ae . DNA was extracted from tissue and PBMC samples using DNeasy Blood & Tissue Kits\u00ae (Qiagen). The concentration of DNA was measured using a Qubit dsDNA BR Assay Kit\u00ae (Invitrogen). Twenty microliters of extracted DNA were used for each experimental replicate, with input DNA ranging from 94 to 4240\u00a0ng.Peripheral blood mononuclear cells (PBMCs) were isolated from whole blood samples by a density gradient method using Ficoll-Paque PLUS\u00ae (Qiagen). The first PCR was performed with the following conditions: 95\u00a0\u00b0C for 10\u00a0min, 25 cycles of 95\u00a0\u00b0C for 30\u00a0s, 58\u00a0\u00b0C for 90\u00a0s, and 72\u00a0\u00b0C for 90\u00a0s, and a final extension at 72\u00a0\u00b0C for 3\u00a0min. The PCR products were purified using 1.5X AMPure XP beads (Beckman Coulter) and eluted in 12\u00a0\u03bcL nuclease-free water.Genomic DNA from tissues and PBMCs was amplified by three steps of multiplex PCR. Before library preparation, primer rebalancing with an oligo pool containing primer binding sites and random barcodes was conducted to prevent amplification bias. In the first PCR, the forward primer targeted the V region upstream of complementarity-determining region 3 (CDR3) in TCR\u03b2, and the reverse primer targeted the J region of TCR\u03b2. The primer sequences used in the first PCR contained shared flanking sequences, which enabled the second PCR to attach Illumina sequencing adapters (Supplementary Table \u00ae (Qiagen). The second PCR was performed with the following conditions: 95\u00a0\u00b0C for 15\u00a0min, 6 cycles of 95\u00a0\u00b0C for 30\u00a0s, 60\u00a0\u00b0C for 40\u00a0s, and 72\u00a0\u00b0C for 1\u00a0min, and a final extension at 72\u00a0\u00b0C for 10\u00a0min. The PCR products were purified using 1.5X AMPure XP beads and eluted in 22\u00a0\u03bcL nuclease-free water.The second PCR was performed with 12\u00a0\u03bcL of the first PCR product, 2.5\u00a0\u03bcL each of the forward and reverse primer mix (10\u00a0\u03bcM), 10\u00a0\u03bcL 5X Q solution, and 25\u00a0\u03bcL 2X Qiagen Multiplex PCR Master Mix\u00ae solution (KAPA Biosystems). The third PCR was performed with the following conditions: 98\u00a0\u00b0C for 3\u00a0min, 6 cycles of 98\u00a0\u00b0C for 10\u00a0s, 65\u00a0\u00b0C for 30\u00a0s, and 72\u00a0\u00b0C for 30\u00a0s, and a final extension at 72\u00a0\u00b0C for 5\u00a0min. The PCR products were purified using 1.2X AMPure XP beads and eluted in 22\u00a0\u03bcL nuclease-free water. The concentration of the final PCR product was measured using a Qubit dsDNA BR Assay Kit\u00ae (Invitrogen).The third PCR was performed with 22\u00a0\u03bcL of the second PCR product, 2.5\u00a0\u03bcL each of the forward and reverse primer mix (10\u00a0\u03bcM), and 25\u00a0\u03bcL 2X KAPA Hifi PCR\u00ae (illumina). The fastq files were randomly subsampled to a size of 1\u00a0Gb using Seqtk (version 1.3-r106). CDR3 sequences were called by MiXCR (version 3.0.13)26 using the following options: -s Homosapiens \u2013starting-material dna \u2013adapters adapters-present \u2013impute-germline-on-export \u20135-end v-primers \u20133-end j-primers \u2013receptor-type trb \u2013region-of-interest CDR3 \u2013only-productive \u2013align \"-OvParameters.geneFeatureToAlign\u2009=\u2009VRegion\" \u2013assemble \"-OaddReadsCountOnClustering\u2009=\u2009true\" \u2013verbose.The library was sequenced as 2\u2009\u00d7\u2009150\u00a0bp paired-end readout with NovaSeq 6000 System27, McPAS-TCR28, PIRD29, TCR3d30, and VDJdb32. Some clones were excluded if junction sequence of the clone does not contain proper conserved residues . The average number of unique CDR3 amino acid sequences for each replicate in patients was 12,917.4, ranging from 2984.3 to 82,681.7.Clones with non-human epitopes were filtered out by a screen against 7,276,705 CDR3 amino acid sequences downloaded from TCRdbThe term \u201csegment\u201d was used to refer to functionally annotated sequences in TCR\u03b2. Unique CDR3 segments were defined as unique CDR3 amino acid sequences. The frequency of each clone was calculated as the number of reads spanning a unique CDR3 segment over the total number of reads spanning all CDR3 segments. The abundance of each group was calculated as the total number of reads within a group divided by the total number of reads in the sample, which is equal to the sum of the frequencies of all clones in the group. Unique CDR3 segments observed in both replicates were considered as twice-observed CDR3 segments, while those observed in only one replicate were considered once-observed CDR3 segments. Only twice-observed CDR3 segments were used for the calculation of inter-sample overlap Figs. A,B. Merg33. Graphs were generated using base R (https://www.r-project.org/) and the ggplot2 package34. The ggsignif package was used to annotate the plots with statistical significance levels. The reshape2 package was used to format data to generate heatmaps35. The viridis package was used to assign colors in the plots.The sample-wise TCR repertoire overlap was determined by the \u201crepOverlap\u201d function in the R immunarch package using the \u201cjaccard\u201d and \u201cmorisita\u201d arguments36 using CD8 reference sequences and the default parameters. Replicates were merged to capture more clusters with CDR3 sequence similarity. Because each patient\u2019s HLA type is unknown, tissue samples from different patients were clustered separately. If separate clusters of CDR3 sequences within a patient contained overlapping motifs, the cluster with the lowest Fisher score was retained, and the other clusters were removed. The motif frequency was calculated by dividing the total number of reads spanning an individual motif by the total number of reads in the sample.The term \u201cmotif\u201d was used to refer to a unit of local or global similarity in CDR3 amino acid sequences observed as a k-mer. TCR\u03b2 CDR3 clustering was performed with GLIPH2 (version 0.01)Shannon\u2019s entropy was gauged by following equation:p-value in Supplementary Table All statistical tests were performed in R. Wilcoxon rank-sum test and Wilcoxon signed-rank test were performed to assess significance in comparisons between groups. The Bonferroni method was applied to correct errors due to multiple comparisons. The Chi-squared test was used to calculate the \u00ae 100 target-capture panel, which consists of 106 cancer-related genes37. Target-enriched DNA libraries were sequenced using an Illumina NovaSeq 6000 System\u00ae to create 150\u00a0bp paired-end reads.Genomic DNA from tumor tissues and PBMCs were sheared using covaris (Covaris), and 50\u2013100\u00a0ng sheared genomic DNA was used for tumor variant analysis. End repair and A-tailing of sheared genomic DNA were performed using 5\u2009\u00d7\u2009ER/A-Tailing Enzyme Mix (Enzymatics), and adaptor ligation was performed using WGS Ligase (Enzymatics). Adaptor-ligated genomic DNA was purified with 1.2\u2009\u00d7\u2009AMPure XP beads and eluted in 20\u00a0\u03bcL nuclease-free water. PCR amplification was performed with the following steps: 3\u00a0min at 98\u00a0\u00b0C; 10 cycles of 15\u00a0s at 98\u00a0\u00b0C, 30\u00a0s at 60\u00a0\u00b0C, and 30\u00a0s at 72\u00a0\u00b0C; followed by 10\u00a0min at 72\u00a0\u00b0C. The PCR amplicons were purified using 1.2\u2009\u00d7\u2009AMPure XP beads and analyzed using the 4150 Tapestation system (Agilent). Target enrichment was performed using the AlphaLiquid38. The trimmed reads were aligned to the human reference genome (hg38) using the BWA \u201cmem\u201d algorithm39. Then, duplicate reads were removed, and variants were called using VarDict40. Variants of tumor tissues from the same patient were combined, and germline variants were removed. For each patient, variants with allele frequency\u2009>\u20091% in at least one tumor tissue were retained, and other variants were removed.Adaptor sequences and reads with low quality (<\u2009Q20) were trimmed using FASTPThe median age of the study population was 57\u00a0years (range 17\u201386\u00a0years). Nine patients (23.1%) had a history of hypertension, and four patients (10.3%) had diabetes mellitus. One of the patients with endometrial cancer had a history of colon cancer, and another had a history of thyroid cancer. Among the patients with epithelial ovarian cancer (n\u2009=\u200927), most presented with high-grade serous carcinoma and stage III\u2013IV disease , and eight (29.6%) had BRCA1/2 mutation.27, McPAS-TCR28, PIRD29, TCR3d30, and VDJdb32. Precisely, clones were excluded based on an exact match with sequences from these databases. Non-human epitope CDR3 was removed to rule out the TCR repertoire that are unrelated to tumor antigen, such as TCR repertoires that are expanded by pathogens. Consequently, an average of 6,130.6 clonotypes, which cumulatively constituted about 29.6% frequency, were removed per sample. Among the CDR3 segments that passed the filtering process, twice-observed CDR3s showed higher frequencies compared to once-observed CDR3s . We assumed that unique CDR3 segment represents TCR clone since CDR3 of TCR\u03b2 is highly diverse due to VDJ recombination. In the process of filtering, clones associated with non-human epitopes were screened against a database consisting of 7,276,705 CDR3 amino acid sequences sourced from TCRdb41 to see if there were shared clones. The Jaccard indices were zero in most cases which means no overlap is observed between different patients from same patient were consistently high in many patients Fig.\u00a0C. SpecifInterestingly, a particular patient labeled \u201cOV30\u201d, who underwent surgery twice so that two timepoints were investigated, showed similarity between samples at two different timepoints Fig.\u00a0C. Specif48. Both metrics in PBMC samples tended to be greater than that in tumor samples (Fig. 51.In patients with ovarian cancer, we compared the number of unique CDR3 segments and Shannon\u2019s entropy to assess the level of diversity within TCR repertoires. A high value of Shannon\u2019s entropy corresponds to a high diversity in the distribution of TCR clones, which means that the TCR repertoire is likely to contain high proportion of low frequency TCR clonesles Fig. . This isThe data in Fig.\u00a0We next focused on TCR clones overlapping in multiple organs. Since the similarity between samples Figs. A,B is a 36 to cluster the CDR3 motifs by frequency and sequence similarity within eight patients with metastatic cancer. All eight patients had unique CDR3 motifs that were shared among multiple tissues with metastasis (Fig.\u00a0Because TCR clones can have extensive diversity due to the complexity of combinations in their variable domains, we next focused on motifs or decomposed structural units of amino acid sequence. We used GLIPH2sis Fig.\u00a0. The samsis Fig.\u00a0.Figure 4To indirectly determine whether tumor antigens from multiple tissue sites within the same patient were shared, we profiled variants in tumor tissues using a target-enrichment method Fig. . We obse53. Recently, various types of cancer immunotherapy have been developed, improving treatment outcomes56. However, the current response rate for immunotherapy in patients with gynecologic cancer is only\u2009~\u200920%58, and predictive biomarkers have been explored to improve immunotherapy efficacy and enable personalized targeted therapy. The presence of TILs in the tumor microenvironment is associated with improved patient survival. In this study, we observed TCR clones that were highly conserved among multiple sites of metastasis, suggesting the presence of tumor-specific T cells that might be harnessed for immunotherapy in patients with gynecologic cancer.Gynecologic cancer is difficult to treat, because most patients are diagnosed at an advanced stage and experience recurrence despite surgery and chemotherapy59 and tissues60. Our data suggest that tumor samples from distant tissues share TCR clones, which might have expanded from similarly structured antigens.We profiled the CDR3 sequences of patients with gynecologic cancer to measure inter-sample similarity in TCR repertoires. The elucidation of the TIL CDR3 sequences and the extent to which it is shared in multiple metastatic tissues may lead to finding the novel TCR-based therapeutics. High clonal similarity between TIL TCR repertoires is supported by other studies that showed homogeneity of TCR repertoires within organs62, and computationally predicted neoantigens were highly shared across metastatic sites63. Similarity of neoantigen pools between sites that are located closely together has not been explicitly shown, however. Hence, further study is needed to elucidate the neoantigens that are shared in tumor tissues.Neoantigens shared among tumor tissues with high immunogenic potential may drive the clonal evolution of immune cells. Studies have shown that metastatic clones with the same origin share antigen variants64; however, that study contrasts with ours in that it compared TCR repertoires of tumor and non-tumor tissues with inflammation. In our understanding, recirculation of T cells is responsible for the high proportion of tissue-shared clones in blood65. However, we cannot exclude the possibility that the high proportion of tissue-shared clones might include bystander T cells66, which could potentially lessen the anti-tumorigenic potential, as we did not confirm whether the TCR sequences originated from tumor-specific T cells. Whether these clones function in tumor surveillance has not yet been studied.We found that the TCR repertoire of PBMCs is relatively rich with clones that are shared by multiple metastases rather than clones that appear only at a single tumor site Fig.\u00a0A,B. The 67, tumor-specific TCR clones were verified by the RNA expression of proliferation-related markers. Furthermore, the fact that we did not perform experiments from Liangtao et al.67 is a weakness of our study. We believe that our analysis of the TCR repertoire overlap between tissues can be supplemented with sequencing data obtained through other experimental methods.We did not attempt to identify the sites where TCR repertoire expansion occurred. There remains a possibility that high-frequency TCR clones might have moved from the blood to tissues, which opposes our assumption that TIL TCR clones are generated from neoantigens in tumor tissues. In the work of Liangtao et al.69. Our research distinctly stands on the data derived from Korean patients, shedding light on the TCR repertoire in gynecologic cancers such as ovarian and endometrial cancer. This unique ethnic dimension adds a novel premise to the existing body of knowledge, as different genetic backgrounds can significantly impact the immune response and, consequently, the TCR repertoire. Moreover, unlike some studies that did not utilize replicates72, our approach of employing only the clones common between replicates aimed to enhance the reliability of our findings. This approach brings a higher degree of confidence in the observed TCR repertoire similarities (Fig. In recent years, several studies have aimed to understand the TCR repertoire similarities among patients with different types of cancers, with some delving into multi-omics approaches to provide a broader perspective, though not placing a primary focus on TCR similarity as our study didies Fig. , therebyIn summary, we found TCR clones that were highly conserved between tissue sites, which may be a result of shared neoantigens expressed in the tissue environment. These tissue-shared clones were enriched in the TCR repertoire of PBMCs. Further collection of data is necessary to uncover the underlying biology of the immune microenvironment of gynecologic cancer.Supplementary Information 1.Supplementary Information 2.Supplementary Information 3." \ No newline at end of file