diff --git "a/deduped/dedup_0572.jsonl" "b/deduped/dedup_0572.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0572.jsonl"
@@ -0,0 +1,42 @@
+{"text": "Multicellular organisms contain a complete set of genes in nearly all of their cells, each cell harboring the potential to make nearly any protein in their genome. The same holds true for a single-celled bacterium or yeast. Yet a cell activates only a fraction of its genes at any given time, calling on a number of different mechanisms to activate the right genes at the right time. To metabolize sugar, for example, a cell needs to synthesize proteins involved in sugar metabolism, not protein repair, and vice versa. In a new study, Jason Brickner and Peter Walter report a mechanism for gene activation that depends on shuttling DNA to a particular location within the nucleus.In organisms whose cells have nuclei (eukaryotes), genomes lie within the nucleus  but also interact with the inner nuclear membrane. Transcription factors activate gene expression by binding to a promoter sequence in the gene's DNA. The physical structure of DNA\u2014which is packaged with proteins into chromatin\u2014affects gene expression by controlling access to DNA. Where chromatin exists in the nucleus also influences gene expression. Heterochromatin\u2014stretches of highly condensed chromatin\u2014typically lines the nuclear periphery, and genes bundled into heterochromatin are typically silent. Active transcription generally occurs in the less condensed euchromatic regions. But since euchromatic regions are also silenced when they associate with heterochromatin along the membrane, it is thought that delivering chromatin to the nuclear periphery regulates transcriptional repression. Brickner and Walter, however, found evidence of the opposite effect\u2014recruiting genes to the nuclear periphery can promote their activation\u2014suggesting that nuclear membrane recruitment plays a much broader role than previously suspected in gene regulation.INO1, which encodes inositol 1-phosphate synthase, an enzyme involved in phospholipid (fat) biosynthesis. INO1 is also a target gene of the \u201cunfolded protein response,\u201d which is triggered when unfolded proteins accumulate in the endoplasmic reticulum, a subcellular organelle where secreted proteins are folded. The INO1 gene contains a regulatory element  within its promoter region that responds to inositol availability. Genes under the control of this element are transcriptionally repressed by a repressor, Opi1, and activated by two transcription factors, Ino2 and Ino4. The presence of unfolded proteins sets off a chain of events to relieve Opi1 repression and allow activation of INO1.To explore the consequences of chromatin location, the authors focused on a yeast gene called INO1 promoter. Opi1 associates with the chromatin, restricting the INO1 locus to the nucleoplasm and repressing transcription. Induction of the unfolded protein response bumps Opi1 off the chromatin and, with Opi1 out of the way, INO1 travels to the membrane and transcription proceeds. Crucially, the authors show that artificial recruitment of INO1 to the nuclear membrane can be enough to activate the gene. There are several mechanistic aspects of this model to figure out still, but Brickner and Walter argue that for INO1, gene recruitment to the nuclear membrane promotes its activation. In light of other recent work, this phenomenon may be emerging as a more general mechanism for regulating eukaryotic gene expression.Through a series of genetic and biochemical studies, Bricker and Walter show that Ino2 and Ino4 are always bound to the"}
+{"text": "INO1 occurs at the nuclear membrane and requires the integral membrane protein Scs2. Scs2 antagonizes the action of the transcriptional repressor Opi1 under conditions that induce the unfolded protein response (UPR) and, in turn, activate INO1. Whereas repressed INO1 localizes throughout the nucleoplasm, the gene is recruited to the nuclear periphery upon transcriptional activation. Recruitment requires the transcriptional activator Hac1, which is produced upon induction of the UPR, and is constitutive in a strain lacking Opi1. Artificial recruitment of INO1 to the nuclear membrane permits activation in the absence of Scs2, indicating that the intranuclear localization of a gene can profoundly influence its mechanism of activation. Gene recruitment to the nuclear periphery, therefore, is a dynamic process and appears to play an important regulatory role.The spatial arrangement of chromatin within the nucleus can affect reactions that occur on the DNA and is likely to be regulated. Here we show that activation of  INO1 indicates that the recruitment of the gene to the nuclear membrane appears to play an important part in its regulationA study of the yeast gene  For over a hundred years, it has been recognized that chromatin is distributed non-randomly within the interphase nucleus . More reSaccharomyces cerevisiae, genes localized in proximity to telomeres are similarly transcriptionally silenced , which encodes inositol 1-phosphate synthase. The UPR is an intracellular signaling pathway that is activated by the accumulation of unfolded proteins in the endoplasmic reticulum (ER), which can be stimulated by treatment with drugs that block protein folding or modification or, in yeast, by starvation for inositol  in the promoters of most target genes to promote transcriptional activation . Howevernditions . Opi1 renditions . Positivromoters . Our preromoters .INO-controlled genes by the UPR, we have examined the molecular events leading to the activation of INO1. We find that Scs2, an integral protein of the nuclear and ER membrane that was recently shown to play a role in telomeric silencing -tagged Scs2. We observed specific recovery of Scs2-HA in Opi1-myc immunoprecipitates   . Consistnditions A. Real-ttutively B. AlthouINO1 promoter directly. Early gel-shift experiments using yeast lysates suggested that Opi1 might interact with DNA (INO1 promoter in vivo. We observed specific enrichment of the INO1 promoter by immunoprecipitation of Opi1 from cells grown in the presence of inositol (repressing condition) but no significant enrichment of the INO1 promoter by immunoprecipitation of Opi1 from cells starved for inositol  lacking the transmembrane domain, which was localized throughout the cell and was not excluded from the nucleus , which serves as a nuclear membrane\u2013targeting signal  as the baseline for subsequent comparisons \u2014did not improve the growth of the scs2\u0394 mutant in the absence of inositol. Consistent with the previous report that FFAT does not require Scs2 to promote nuclear membrane targeting, we observed approximately 50% membrane association of INO1 in the strain expressing the FFAT-Lac repressor . Thus, the defect in transcription of INO1 in the scs2\u0394 mutant could be rescued, at least partially, through artificial targeting of INO1 to the nuclear membrane. This result demonstrates that nuclear membrane association is functionally important for achieving INO1 transcriptional activation.The experiments described above indicate that there is a correlation between membrane association of analysis A or on the array C\u2014or if tINO1 occurs at the nuclear membrane and requires the integral membrane protein Scs2. Moreover, artificial recruitment of INO1 to the nuclear membrane permits activation in the absence of Scs2, indicating that the precise intranuclear localization of a gene can profoundly influence its activation. Most importantly, we have shown that the localization of INO1 depends on its activation state; gene recruitment therefore is a dynamic process and appears to play an important regulatory role.It is becoming increasingly clear that the spatial arrangement of chromosomes within the nucleus is important for controlling the reactions that occur on DNA and might be regulated : We propose that the environment of membrane-tethered INO1 promotes late steps in the transcription activation\u2014such as chromatin remodeling, discussed above\u2014permitting INO1 to be expressed upon transient Hac1-induced Opi1 dissociation. Therefore, we envision that dissociation of Opi1 from the INO1 promoter is coupled to the delivery of the gene to an environment near the nuclear membrane that is permissive for its activation.Both Hac1  and Scs2Ascaris suum sperm that forms a cytoskeletal structure and confers motility to sperm cells. It is thus tempting to speculate that Scs2 might similarly self-associate in the plane of the nuclear membrane, perhaps providing a two-dimensional matrix on which membrane-associated reactions could be organized. One suggestion from our data is that Scs2 may function as a local sink for Opi1. But it is also clear that other nuclear membrane components are likely to participate in the reaction. Opi1, for example, still localizes to nuclear membranes even in scs2\u0394 cells, indicating that another, yet-unidentified Opi1 binding partner must exist . Monoclonal anti-Pgk1, rabbit polyclonal anti-GFP, goat anti mouse IgG-Alexafluor 594, and goat anti-rabbit IgG Alexafluor 488 were from Molecular Probes .Monoclonal anti- HA antibody HA11 was obtained from Babco . Monoclonal anti-All restriction endonucleases and DNA modification enzymes were from New England Biolabs . Unless indicated otherwise, all other chemicals and reagents were from Sigma .. Tags and disruptions marked with either the rkan gene from E. coli or the His5 gene from S. pombe were introduced by recombination at the genomic loci as described (r),(OPI1\u201313myc::kan JBY350-r1 (scs2\u0394r),:: kan JBY359 r),(SCS2-HA:: kan JBY356\u20131A (opi1\u0394::LEU2), JBY356\u20131B (opi1\u0394::LEU2 scs2\u0394r ),:: kan JBY356\u20131C (scs2\u0394r),:: kan JBY356\u20131D (wild-type control), JBY361 (scs2\u0394r),TMD-HA:: kan JBY370(INO2-HA3::His5+), JBY371 (INO4-HA3::His5+), JBY393 (INO4-myc::His5+ MATa), JBY397 r INO1:LacO128:URA3 HIS3:LacI-GFP),(SEC63\u201313myc:: kan JBY399 (SEC63\u201313myc::Kan^r INO1:LacO128:URA3 HIS3:LacI-FFAT-GFP), JBY401 (ino4\u0394r INO1:LacO128:URA3 HIS3:LacI-GFP MAT\u03b1),::LEU2 SEC63\u201313myc::Kan JBY404 (opi1\u0394r INO1:LacO128:URA3 HIS3:LacI-GFP),::LEU2 SEC63\u201313myc::Kan JBY406 (opi1\u0394r INO1:LacO128:URA3 HIS3:LacI-FFAT-GFP),::LEU2 SEC63\u201313myc::Kan JBY409 r URA3:LacO128:URA3 HIS3:LacI-GFP),(SEC63\u201313myc::Kan JBY412 (INO2-myc::His5+), JBY 416 (hac1\u0394r LacO128:INO1 HIS3:LacI-GFP)::URA3 SEC63\u201313myc::Kan.All yeast strains used in this study were derived from wild-type strain CRY1 escribed . Strainsmyc was created by first amplifying the OPI1-myc coding sequence and 686 bp upstream from the translational start site from strain JBY345 using the following primers: OPI1 promoter Up (5\u2032-GGGAGATACAAACCATGAAG-3\u2032) and OPI1 down (5\u2032-ACTATACCTGAGAAAGCAACCTGACCTACAGG-3\u2032). The resulting fragment was cloned into pCR2.1 using the Invitrogen  TOPO TA cloning kit. The OPI1-myc locus was then cloned into pRS315 as a HindIII-NotI fragment. Plasmid pASF144 expressing GFP-lacI has been described (OPI1: LacI_FFAT1 (5\u2032-AATTGGACGATGAGGAGTTTTTTGATGCCTCAGAGG-3\u2032) and LacI_FFAT2 (5\u2032-AATTCCTCTGAGGCATCAAAAAACTCCTCATCGTCC-3\u2032). The orientation of the insert was confirmed by DNA sequencing. Both pAFS144 and pGFP-FFAT-LacI were digested with NheI, which cuts within the HIS3 gene, and transformed into yeast.Plasmid pRS315-Opi1-escribed . PlasmidINO1 coding sequence, with 437 bp upstream and 758 bp downstream, was amplified from yeast genomic DNA using the following primers: INO1_promoter_Up (5\u2032-GATGAGGCCGGTGCC-3\u2032) and INO1_3\u2032down (5\u2032-AAGATTTCCTTCTTGGGCGC-3\u2032), and cloned into pCR2.1 using the Invitrogen TOPO TA cloning kit, to produce pCR2.1-INO1. INO1 was moved from pCR2.1 into pRS306 as a KpnI fragment, to produce pRS306-INO1. The Lac operator array was then cloned from pAFS52 into pRS306-INO1 as a HindIII-XhoI fragment, to produce plasmid 10.2. Because the Lac operator fragment was smaller than had been reported (2.5 kb instead of 10 kb), presumably reflecting loss of Lac operator repeats by recombination, the Lac operator array was duplicated by digesting plasmid 10.2 with HindIII and SalI and introducing a second copy of the 2.5-kb HindIII-XhoI fragment, as described  or the microsomal fraction  and incubated for 30 min at 4 \u00b0C; detergent-insoluble material was then removed by centrifugation at 21,000 \u00d7 g, 10 min. Anti-myc agarose was added to the supernatant and incubated 4 h at 4 \u00b0C, while rotating. For the experiment in Cells were lysed using glass beads in IP buffer . The whole cell extract was used for coimmunoprecipitation of Ino2-.For immunoblot analysis, 25 \u03bcg of crude protein, prepared using urea denaturing lysis buffer , was sepmyc . After sonication, lysates were centrifuged 10 min at 21,000 \u00d7 g to remove insoluble material and incubated for 4 h with anti-HA agarose or anti-myc agarose. After elution of immunoprecipitated DNA and reversal of crosslinks by heating to 65 \u00b0C for 8 h, DNA was recovered using Qiaquick columns from Qiagen . Eluted samples were analyzed by PCR using the following primers against the INO1 promoter or the URA3 gene: INO1_proUp2 (5\u2032-GGAATCGAAAGTGTTGAATG-3\u2032), INO1_proDown (5\u2032-CCCGACAACAGAACAAGCC-3\u2032), URAup (5\u2032- GGGAGACGCATTGGGTCAAC-3\u2032), and URADown (5\u2032-GTTCTTTGGAGTTCAATGCGTCC-3\u2032).Chromatin immunoprecipitation was carried out on strains expressing endogenous levels of tagged Ino2, Ino4, and Opi1 as described , with thINO1 promoter and the URA3 gene were calculated using this standard curve. The ratio of INO1 promoter to URA3 was corrected for each sample to make the input ratio equal to 1.0.PCR reactions were carried out as described  using a INO1 (NP_012382), Trl1 (NP_012448), Opi1 (NP_011843), Hac1 (NP_011946), Ino2 (NP_010408), Ino4 (NP_014533), Scs2 (NP_009461), Rap1 (NP_014183), URA3 (NP_010893), SSS1 (NP_010371), Pgk1 (NP_009938) lacI (NP_414879), and Ikaros (Q03267).The GenBank accession numbers of the genes and proteins discussed in this paper are Ire1 (NP_116622),"}
+{"text": "When James Watson and Francis Crick reported the structure of DNA in 1953, the mechanism of inheritance was instantly apparent. The complementary pairing of the DNA bases in the double helix, the pair famously wrote, \u201cimmediately suggests a possible copying mechanism for the genetic material.\u201d The structure helped explain one of the central problems of modern biology: how does genetic material get faithfully replicated and then passed on from generation to generation? It was long thought that DNA is the only unit of inheritance.Since then, it's become clear that molecules of DNA are packaged into highly organized superstructures that themselves are inherited. These structures play a significant role in the regulation of genes by preventing or facilitating protein\u2013DNA interactions. In the eukaryotic cell (a cell with a nucleus), DNA exists as long threadlike molecules\u2014a typical human cell contains some 6.5 feet (2 meters) of DNA\u2014that associate with a variety of proteins to form a network called chromatin. Genomic DNA wraps around specialized DNA-packing proteins called histones to form nucleosomes, which condense chromatin into chromosomes and thereby influence chromosome behavior. Chromosomes are in turn packaged in increasingly higher levels of organization, with some parts being dispersed and others condensed. The most condensed region is called heterochromatin, or silent chromatin. Gene expression is largely silent in these regions, since the proteins required for transcription can't access DNA to transcribe genes when chromosomes are so tightly packed. Other regions of chromosomes exist in an extended state, called euchromatin. This is the most genetically active state; with genes exposed, transcription can easily occur.PLoS Biology, Jasper Rine, Hiten Madhani, and colleagues identify and characterize the function of a protein complex that helps deposit the variant H2A.Z onto euchromatin in yeast.As chromatin shifts between these states, it influences gene expression, largely through the interactions of histones and large protein complexes that together assemble, remodel, and modify chromatin. Since proper cell function depends largely on activating the right gene at the right time, mechanisms have evolved that protect active genes from the intrusions of silencing structures like heterochromatin. Both euchromatin and heterochromatin respond to mechanisms that resist encroachments of the opposite state. One mechanism involves replacing \u201ccanonical\u201d  histones with a histone variant. Previous work on yeast from Hiten Madhani and colleagues had shown that one histone variant, called H2A.Z, is found specifically in euchromatin and prevents silent chromatin from spreading into adjacent euchromatic regions. While researchers have characterized some of the mechanisms that deposit canonical histones onto euchromatin, they knew little about the mechanisms that deposit variant histones. In this issue of To investigate which proteins help direct H2A.Z to specific chromosomal locations, the authors isolated H2A.Z, along with whatever proteins were associated with it, from yeast cell extracts. They determined that 15 proteins were true binding partners of H2A.Z and that 13 of them form a complex called SWR1-Com. The largest subunit of this complex, called Swr1p, belongs to a well-known family of adenosine triphosphate (ATP)-dependent chromatin remodeling enzymes (they use the energy of ATP to power remodeling) that provide access to DNA in chromatin. Rine, Madhani, and colleagues show that protein subunits of SWR1-Com associate specifically with the histone variant H2A.Z. By comparing the gene expression profiles of yeast mutants lacking the H2A.Z-encoding gene with mutants lacking the Swr1p-encoding gene, the authors show that H2A.Z depends on the SWR1-Com protein complex to function. Most importantly, they show that SWR1-Com is required in living cells to deposit H2A.Z onto euchromatin. Interestingly, the authors note, SWR1-Com shares subunits with a histone-acetylating enzyme involved in the regulation of transcription  and with another chromatin remodeler, which suggests that biochemical modifications of the subunits on histone \u201ctails\u201d may play a role in replacing H2A with H2A.Z.This histone\u2013protein complex, the authors conclude, represents a chromatin remodeling machine with a novel function, revealing a new role for Swr1p-type enzymes and a novel mechanism of genome regulation. By preventing the spread of silent chromatin into transcriptionally active chromosomal regions\u2014the result of the interaction described here\u2014this mechanism allows the cell's gene expression program to operate with precision and on schedule. Since chromosomes can be inherited by daughter cells in this active state, such mechanisms ensure that gene expression programs essential for ongoing fundamental processes like embryogenesis and cellular differentiation proceed without interference."}
+{"text": "On this, theologians, philosophers, and biologists can agree: we are more than the sum of our genes. Biological complexity arises not from gene number but from patterns of gene expression, which change under the direction of both genetic and so-called epigenetic mechanisms. Epigenetics, broadly defined, concerns heritable changes in gene function that don't involve changes in DNA sequence. Until recently, studies of heritable traits have focused largely on mutations in DNA. But it's become increasingly clear that how DNA is packaged in the nucleus also impacts heritability.Epigenetic changes are mediated largely by proteins that shape and remodel chromatin\u2014the association of DNA and histone proteins that condenses the genome into compact bundles inside the nucleus. Different cell types have different chromatin arrangements during development and cell differentiation that appear to regulate gene expression, which possibly accounts for the unique gene expression patterns associated with specific cell types. Such phenomena have been well-studied for specific genes or chromosomal regions, but to understand the full impact of epigenetic mechanisms on gene regulation, we need a more panoramic view of gene organization within the nucleus.In a new study, Thomas Cremer together with Andreas Bolzer and an interdisciplinary team of German physicists, bioinformaticians, and geneticists created 3D positional maps of each human chromosome simultaneously in a single nucleus to investigate the link between chromatin structure and cell-specific gene expression. Working with human fibroblasts, cultured from a skin biopsy from a two-year-old boy, the authors were able to visualize and study the order of the full genetic complement within a human nucleus.Cremer and colleagues first produced a 3D topological map of all 46 chromosomes in different cell types at key points in the cell cycle\u2014a landmark achievement\u2014using a fluorescent staining technique that preserves chromosome shape during visual inspection under the microscope. Next, they established that small chromosomes in quiescent (nondividing) fibroblasts hewed close to the center of the nucleus while the large chromosomes were preferentially found at the nuclear rim, regardless of their gene density. Nuclei from cells entering the prometaphase stage of the cell cycle\u2014just before chromosomes are aligned along the center of the nucleus prior to segregation\u2014revealed a size-correlated chromosomal distribution akin to that seen in the quiescent nuclei. Statistical modeling analyses indicated that these size correlations do not simply reflect the geometric constraints of fitting into the nucleus, but likely hint at some degree of functional order within the nucleus.Because previous studies of cells with sphere-like nuclei correlated chromosomal arrangements with gene density, the authors investigated how shape affects chromosome position along the nuclear radius. Fibroblast nuclei are somewhat flat and ellipsoidal. Chromosomes in similarly shaped amniotic fluid cells assumed the same size-related positions taken by chromosomes in fibroblast nuclei. But when the authors examined the higher-order chromatin arrangements in fibroblasts and lymphocytes, they found that, even though the cell types differ in nuclear shape and radial chromosomal arrangements, they both show a nonrandom higher-order chromatin architecture correlated with gene density. Many questions remain concerning the functional and physiological significance of these observations: Do shape changes produce changes in chromosomal arrangements and vice versa? Do shape changes produce changes in gene expression patterns?Cremer and colleagues conclude that, although nonrandom chromosome positions occur, these appear to be governed by a degree of uncertainty and more likely reflect probabilistic preferences inside the nucleus. Still, deterministic mechanisms in higher-order chromatin structure may exist\u2014sequestering gene-rich chromatin areas in the nuclear interior, for example, protected from malevolent agents entering the nucleus. And given the coexistence of size-correlated features with gene-density-correlated features seen in this study, it may well be that both random and deterministic factors combine to create the nuclear landscape."}
+{"text": "INO1 and GAL1 genes to the nuclear periphery is rapid and independent of transcription. Surprisingly, these genes remain at the periphery for generations after they are repressed. Localization at the nuclear periphery serves as a form of memory of recent transcriptional activation, promoting reactivation. Previously expressed GAL1 at the nuclear periphery is activated much more rapidly than long-term repressed GAL1 in the nucleoplasm, even after six generations of repression. Localization of INO1 at the nuclear periphery is necessary and sufficient to promote more rapid activation. This form of transcriptional memory is chromatin based; the histone variant H2A.Z is incorporated into nucleosomes within the recently repressed INO1 promoter and is specifically required for rapid reactivation of both INO1 and GAL1. Furthermore, H2A.Z is required to retain INO1 at the nuclear periphery after repression. Therefore, H2A.Z-mediated localization of recently repressed genes at the nuclear periphery represents an epigenetic state that confers memory of transcriptional activation and promotes reactivation.Many genes are recruited to the nuclear periphery upon transcriptional activation. The mechanism and functional significance of this recruitment is unclear. We find that recruitment of the yeast  Eukaryotic cells control the spatial arrangement of chromosomes; the localization of genes can both reflect and contribute to their transcriptional state. A number of genes in the simple eukaryote brewer's yeast are \u201crecruited\u201d to the nuclear periphery through interactions with the nuclear pore complex when they are expressed. The functional significance of peripheral recruitment is unclear.Here, we show that recruited genes are actively retained at the periphery for generations after transcription is repressed. This suggests that localization at the nuclear periphery represents a novel inherited state that might allow simple eukaryotic organisms to \u201cremember\u201d previous transcriptional activation. This type of memory allows for more robust reactivation of genes, suggesting that it is adaptive. Finally, both retention at the nuclear periphery and rapid reactivation require a variant form of histone H2A.Adaptive memory is distinct from other types of transcriptional memory. In developmental memory, transcriptional states established by transcriptional regulators early in embryogenesis are propagated long after these regulators have disappeared. Adaptive memory does not propagate a state, but represents a novel state that serves as a source of information. In this way, it resembles a rudimentary form of cellular learning that allows cells to benefit from recent experience. Recruitment of active genes to the periphery of the yeast nucleus does not require concurrent transcription.  INO1 and GAL1 distribute randomly within the nucleoplasm under repressing conditions, but become co-localized with the nuclear periphery upon activation [The subnuclear localization of DNA has important roles in regulating transcription ,2. In pativation ,7. Live-tivation ,14. ChroGAL1 with the nucleoporin Nup2 requires the Gal4 activator, but does not require the SAGA histone acetylase complex, and is not affected by inactivation of RNA polymerase II [INO1 gene [HXK1 gene [The mechanism and functional significance of peripheral localization is unclear. Interaction of erase II . Thus, tNO1 gene  and the XK1 gene , and is XK1 gene . Thus, rHXK1 and GAL1 to the nuclear periphery is affected by sequences in the 3\u2032 UTR [GAL1 requires proteins that have been implicated in mRNA export [In contrast, recruitment of genes to the nuclear periphery has also been suggested to reflect coupling between transcription and mRNA export. Chromatin immunoprecipitation studies suggest that the interaction of mating pheromone\u2013induced genes with the NPC is mediated by the mRNA . Likewise 3\u2032 UTR ,15, and A export . These rINO1 and GAL1 genes in yeast is biphasic, with the mRNA levels increasing dramatically after gene recruitment is complete. RNA polymerase II activity was not required for peripheral recruitment of INO1. Furthermore, when cells were shifted from activating to repressing conditions, INO1 and GAL1 remained localized at the nuclear periphery for generations. We find that localization at the periphery defines a distinct, heritable state that marks recently repressed genes and promotes reactivation. The reactivation of GAL1 was more rapid in cells that had previously activated the gene, even after six generations of repression. The rate of activation of INO1 was accelerated when the gene was artificially tethered to the nuclear envelope and was delayed in a mutant blocked for gene recruitment.Using a quantitative chromatin localization assay , we findINO1 and GAL1, but had no role in the activation of the long-term repressed states of these genes. H2A.Z associated with nucleosomes in the promoter of the recently repressed INO1 gene, but not in the promoter of either activated or long-term repressed INO1. Finally, we find that H2A.Z is essential for retention of recently repressed INO1 at the nuclear periphery. These results identify a new form of chromatin-based transcriptional memory and highlight an important role for H2A.Z in regulating subnuclear localization to mark recently repressed genes and promote their reactivation.Epigenetic mechanisms of transcriptional memory are employed extensively during metazoan development to stably propagate transcriptional states . Such meURA3 gene, which distributes randomly within the nucleus, co-localizes with Sec63-myc in 27%\u201330% of cells [INO1 gene is artificially tethered to the nuclear envelope, we observe peripheral localization in 81% \u00b1 7% of cells [INO1 gene distributes randomly, co-localizing with the nuclear envelope in 31% \u00b1 1% of cells in the population . After shifting cells into medium lacking inositol, INO1 mRNA levels increased slowly for the first 2.5 h  recruitment of INO1 to the nuclear periphery correlated with this early increase, and (3) the maximal rate of INO1 mRNA accumulation occurred after relocalization was complete.We used the chromatin localization assay to compare the change in the peripheral localization of GAL1 gene, which is repressed in cells grown in glucose and expressed in cells grown in galactose. We integrated the lac repressor\u2013binding site array downstream of the GAL1 gene and quantified its co-localization with the nuclear envelope as in GAL1 localized at the nuclear periphery in 35% \u00b1 1% (five replicates of 30\u201350 cells) of cells, and activated GAL1 localized at the nuclear periphery in 70% \u00b1 2.5% (three replicates of 30\u201350 cells) of cells (unpublished data). When cells were shifted from glucose to galactose, GAL1 mRNA levels increased slowly for the first 60 min and then more rapidly, reaching steady state after approximately 2 h  was much more rapid than in cells grown continuously in glucose . In contrast to GAL1, the reactivation of the INO1 gene after 3 h of repression was delayed compared with activation of the long-term repressed gene  or a modified version possessing an FFAT motif to target the protein to the nuclear envelope . Expnditions . Howeverred INO1 D. TherefINO1 slower than the rate of activation of long-term repressed INO1? This difference is likely due to differences in the physiology of cells grown continuously in the presence of inositol and cells to which inositol has recently been added. Activation of INO1 is regulated by the concentration of phosphatidic acid, a lipid precursor of phosphatidylinositol [INO1 transcription, the Ino1 enzyme in the cells will continue to produce inositol, driving a higher flux through the pathway and depleting phosphatidic acid. We think this may explain the longer lag phase in the reactivation experiment, which represents the time required for phosphatidic acid to accumulate to levels that activate transcription. This feedback, combined with the shorter duration of the memory phenomenon for the INO1 gene, complicates a direct comparison between the rate of activation between the short- and long-term repressed states of INO1.If so, then why is the rate of reactivation of recently repressed inositol . Phosphainositol . After rINO1, we asked if remaining at the nuclear periphery after repression affects the chromatin state of the gene. Because nucleosome remodeling is important for both INO1 activation and repression [INO1 promoter. Permeablized cells were treated with micrococcal nuclease for various times to digest unprotected DNA . As an internal control for nucleosome protection, we used a known, well-positioned nucleosome within the GAL1 promoter  there are two distinct states of repressed INO1 and GAL1, distinguishable by their localization, their transcriptional histories, and the molecular requirements for activation, (2) localization of INO1 at the nuclear periphery is necessary and sufficient to promote more rapid activation, and (3) incorporation of H2A.Z is the molecular mechanism of transcriptional memory, retaining INO1 at the nuclear periphery and promoting reactivation of both INO1 and GAL1.What is the functional significance of this epigenetic memory? In the case of the INO1 and GAL1 and for retention of recently repressed INO1 at the nuclear periphery. It is possible that these results represent an indirect effect of loss of H2A.Z. However, we think H2A.Z most likely plays a direct role in promoting the reactivation of INO1 and GAL1 because (1) loss of H2A.Z (and SWR1) affects reactivation of recently repressed INO1 and GAL1, but not the activation of long-term repressed INO1 and GAL,1 and (2) H2A.Z physically associates with the recently repressed INO1 promoter. Therefore, we have identified a new and novel role for this histone variant: H2A.Z can serve as a molecular identifier of recently repressed genes to promote their retention at the nuclear periphery and their rapid reactivation.Histone variant H2A.Z is enriched in pairs of nucleosomes within the promoters of repressed genes \u201338. The INO1 and GAL1 is remembered through retention in this optimal environment. Localization at the nuclear periphery is epigenetically inherited and requires incorporation of histone variant H2A.Z. Finally, the reactivation of INO1 and GAL1 is optimized by both localization at the periphery and through more rapid loss of H2A.Z nucleosomes [Our current model for the mechanism of gene recruitment and transcriptional memory is shown in leosomes .What is the role of DNA localization in promoting transcriptional memory? Our data suggest two possible models for how peripheral localization affects H2A.Z-mediated transcriptional memory. In the first model, H2A.Z incorporation into promoter nucleosomes is promoted by Nup2-mediated gene recruitment to the nuclear periphery, and functions to promote reactivation by altering the rate of nucleosome loss or local histone modifications. This model is consistent with several observations in the literature. Tethering of Nup2 to DNA promotes \u201cboundary activity,\u201d insulating euchromatin from the spread of heterochromatin ,44. IntrDrosophila, Hox gene expression throughout development is determined early in embryogenesis by transcriptional regulators that control segmentation [Transcriptional memory is employed extensively during development in multi-cellular organisms. In entation . The inientation . Similarentation ,48. LikeGAL1 can alter the degree of methylation of histone H3, marking the chromatin for hours after repressing transcription [GAL1 gene, after exposure to galactose, logarithmically growing cells appeared to undergo an indefinite switch to the recently repressed state. It will be fascinating to determine if there are conditions or stimuli that can reset the GAL1 gene to the long-term repressed state. In contrast, the transcriptional memory of INO1 activation was relatively short lived. The previous transcriptional state of INO1 is imprinted in its chromatin and its subnuclear localization for 6 h or more (two to three cell doublings), but this information is eventually lost.Previous work has hinted that transcriptional activity of cription . HoweverINO1 or genes involved in metabolizing non-glucose hexose sugars. Also, epigenetic mechanisms may be useful in allowing cells to alter their transcriptional output rapidly under highly variable environmental conditions or under physiological circumstances in which they rapidly undergo reversible changes in physiology [Why do cells optimize reactivation of genes? We speculate that rapid reactivation of certain genes confers an adaptive, and therefore an evolutionary, advantage to cells. This might be particularly important in the case of stress-responsive genes such as ysiology . It willUnless stated otherwise, chemicals were from Sigma , oligonucleotides were from Operon , restriction enzymes were from New England Biolabs , yeast media components were from Q-Biogene , antibodies against GFP and myc were from Invitrogen/Molecular Probes , and antiserum against Htz1 was from Abcam .htz1,\u0394 and BY4741 swr1\u0394 [ade2\u20131 can1\u2013100 his3\u201311,15 leu2\u20133,112 trp1\u20131 ura3\u20131 MATa) [ade2\u20131 can1\u2013100 his3\u201311,15 leu2\u20133,112 trp1\u20131 ura3\u20131 INO1:LacO128:URA3 HIS3:LacI-GFP MATa) and BY4742 nup2\u0394 mutant strain (his3\u03941 leu2\u03940 lys2\u03940 ura3\u03940 nup2\u0394::Kan^r MAT\u03b1) from the genome-wide null mutant collection [ura3 allele was confirmed to be ura3\u20131 by transforming JBY451-r7 with StuI-digested pRS306 [nup2\u0394 by PCR from genomic DNA. Strain JBY461 is the product of a cross between JBY397 [+ Trp+ His+ and temperature sensitive for growth (JBY461-r2). These were then visually scored for expression of Lac I-GFP. Strain DBY50 is the product of a cross between DBY49  and JBY397. The resulting diploid was sporulated, and tetrads were dissected to generate DBY50.Yeast strains used in this study are listed in 41 swr1\u0394 , all str1 MATa) . Strain llection . Random d pRS306 . Strain n JBY397 . Random GAL1 gene with the lac repressor\u2013binding site array, the 3\u2032 end of the GAL1 gene, and downstream sequences were amplified by PCR using the following primers (5\u2032 to 3\u2032): GAL1up, GTTCAAACCGCAGTTGAAGG and GAL1down, CCGAAAGATCTTCTCTATGGGG. The resulting PCR product was cloned into the TOPO4 vector (Invitrogen). This was then cloned into p6LacO128 as a SpeI fragment. The plasmid was integrated downstream of GAL1 by digestion with NruI.Plasmids p6LacO128 , and pAFSEC63-13myc from JBY397 genomic DNA using the following primers (5\u2032 to 3\u2032): SEC63up: GTATTTCGGAGAGGGGGC; Pringledown: ACTATACCTGAGAAAGCAACCTGACCTACA. The resulting PCR product was TOPO cloned into pCR2.1 (Invitrogen). The insert was then cloned into pRS304 [SEC63.Plasmid pRS304-Sec63-myc was created by amplifying o pRS304  as a NotINO1, cells were grown in medium lacking inositol or supplemented with 100 \u03bcM myo-inositol. For experiments involving GAL1, cells were grown in media with either 2% glucose or 2% galactose.Unless noted otherwise, all experiments were performed on cells grown in synthetic complete medium at 30 \u00b0C. For experiments involving (INO1 or GAL1) and the control gene (ACT1) were calculated for each sample using standard curves for each primer set that were defined by linear regression analysis of Ct values using a series of 5-fold dilutions of yeast genomic DNA covering a 3,125-fold range.RNA was prepared as described . A total600) of 0.8\u20131.0 from 1 l of SDC + inositol. Short-term repressed cells were grown in 1 l of SDC \u2212 inositol to an OD600 of 0.7, and inositol was added to 100 \u03bcM. After 1 h of repression, cells were harvested by filtration. Cell permeablization and micrococcal nuclease digestion were performed as described, except that DNA was not size selected [INO1 promoter, we used the experimentally determined transcriptional start site and initiation codon [Long-term repressed cells were harvested at an optical density  as described , with thFigure S1INO1 shown in GAL1 shown in (A) shows an extended time course of the localization of (124 KB TIF)Click here for additional data file.Figure S2rpb1\u20131 mutant. RNA was isolated from rpb1\u20131 strain JBY461-r2 grown in the absence of inositol at 25 \u00b0C and then shifted to 37 \u00b0C for the indicated times.(A) Transcription is blocked in the INO1 activation is prevented in the rpb1\u20131 mutant. RPB1 and rpb1\u20131 cells were grown in the presence of inositol at 25 \u00b0C, shifted to 37 \u00b0C for 15 min, and then shifted into medium lacking inositol at 37 \u00b0C for 180 min. In both experiments, RNA was reverse transcribed using primers complementary to the 3\u2032 ends of either the INO1 mRNA (INO1 RT primer: 5\u2032 CAACAATCTCTCTTC) or the RNA polymerase I transcript RDN18\u20131 (RDN18\u20131 RT primer: 5\u2032 CTTAAAATCTCGACC). The resulting cDNA was quantified by Q-PCR using the INO1 CDS primers  or RDN18\u20131 primers (RDN18\u20131 P1: 5\u2032 TTGTTGCAGTTAAAAAGCTCG and RDN18\u20131 P2: 5\u2032 TAAAAGTCCTGGTTCGCCAA).(B) (192 KB TIF)Click here for additional data file.Figure S3GAL1 gene was quantified at the indicated times after repression. The hatched blue line indicates the baseline level of peripheral localization of the URA3 gene.Strain DBY32 was shifted from galactose to glucose medium, and the peripheral localization of the (58 KB TIF)Click here for additional data file.Figure S4INO1 mRNA was quantified relative to ACT1 mRNA by RT Q-PCR.Tethered (JBY399) and untethered (JBY397) strains were grown either in the presence or absence of inositol, and the (82 KB TIF)Click here for additional data file.Figure S5GAL1 and ACT1 mRNA levels were quantified by RT Q-PCR.Strains CRY1 and BY4741 were grown in glucose medium overnight and shifted to galactose medium. Cells were collected at the indicated times, and (137 KB TIF)Click here for additional data file.Table S1(55 KB PDF)Click here for additional data file."}
+{"text": "It is widely recognized that alcoholism and relationship violence often have serious consequences for adults; however, children living with alcoholic parents are susceptible to the deleterious familial environments these caregivers frequently create. Given the prevalence of IPV among patients entering substance abuse treatment, coupled with the negative familial consequences associated with these types of behavior, this review explores what have been, to this point, two divergent lines of research: (a) the effects of parental alcoholism on children, and (b) the effects of children\u2019s exposure to intimate partner violence. In this article, the interrelationship between alcoholism and IPV is examined, with an emphasis on the developmental impact of these behaviors  on children living in the home and offers recommendations for future research directions. According to data gathered as part of the National Crime Victimization Survey, in 2005, there were approximately 3.5 million reports of family violence and nearly 1 million female victims of intimate partner violence \u20136.IPV often has serious public health consequences. According to the Department of Justice (DOJ) estimates, over 400 men and 1,200 women are killed by an intimate partner each year . In addii.e., comorbidity model). Although both substance use and partner violence are viewed as observable manifestations of a common set of problems, neither is believed to be a cause of the other )Although, in general, the literature supports an elevated risk for negative psychosocial development among children with a family history of alcoholism , many cUndoubtedly, characteristics of the family environment contribute to the adjustment of COAs. Thus, the challenge for researchers is to refine the definition of risk by identifying specific mechanisms that lead to diverse outcomes among children raised by alcoholic parents. Although alcohol misuse during gestation has well-documented risk for physical and central nervous system insults that may result in cognitive, affective, growth, and morphologic sequelae , our the2.1.et al. [The Department of Justice estimates that 3.3 to 10 million children are exposed to domestic violence annually [et al.  found thet al. . AlthougWitnessing severe interparental conflict has been linked to children\u2019s feelings of terror and helplessness, fears for their own and their parents\u2019 safety , and chiIn addition to the harmful effects that IPV may have on children\u2019s emotional adjustment, exposure to IPV, and the victimization that children experience from their exposure to IPV, increase children\u2019s proneness to bullying, aggressive, violent, and delinquent behavior ,45\u201349. F2.2.Alcoholism and IPV often occur together; however the relationship between the two issues is complex and not well understood . As a reIt is important to note that these diverse conceptualizations of mechanisms of action underlying child risk are not mutually exclusive; simply stated, each of these theories includes elements of one or more of the others in its overall model of the manner in which children\u2019s emotional and behavioral problems evolve. However, differences exist in the way each paradigm explains the various destructive factors that may operate to influence negative child outcomes. For example, while there is much agreement that parental alcoholism and intimate partner violence are serious destructive influences in children\u2019s development across the various theories, the role of each is different depending on the manner in which each of these behaviors are conceptualized.2.3.i.e., drinking and violence) through modeling dysfunctional behavior exhibited in the family of origin. Social learning theories may be helpful in explaining patterns of intergenerational violence.According to social learning theory, problematic drinking and violent behavior are learned primarily through social interactions, which are passed down from one generation to the next. In particular, exposure to violence between parents may teach children that violence is an acceptable means of conflict resolution . Thus, a2.4.A developmental ecological framework would argue that the contexts created by parental alcohol use may expose COAs to greater developmental risk. For instance, both legal problems ,65 and ui.e., microsystem; e.g., family, intimate partner), (3) institutions and social structures that comprise the microsystem , and 4) macrosystem; the general views and attitudes that permeate the culture at large [It is now widely accepted that the occurrence of violence between intimate partners is the culmination of multiple interacting contextual, social, biological, psychological, and personality factors that exert their influence at different times, under different circumstances, acting in a probabilistic fashion . Consequat large . In addiat large  also conEcological theories have been used to explain how youth who experience parental alcohol abuse and IPV may be more likely to live in high-crime neighborhoods which may adversely impact the quality of schools and increase exposure to neighborhood violence. These parents may not be able to protect their children from neighborhood influences by moving to a safer area. The developmental ecological approach emphasizes both the social ecology in which the child develops, particularly for youth and families in high-risk settings , and ri2.5.Viewed from a family-couple vantage, witnessing paternal alcoholism and intimate partner violence has been linked to children\u2019s fears  and inte2.6.In recent years, researchers have recognized that interparental conflict is intrinsically and empirically linked to family processes and parenting \u201362. AlthIn these couples, poor communication is hypothesized as the mode by which partners communicate and work through everyday disagreements that \u2018spill over\u2019 into parent-child interactions and parenting behaviors . In a meEach of the theories outlined above may provide a conceptual framework from which to test the effects of IPV and parental alcoholism on youth development. It is important to recognize that a single model may not account for all aspects of child risk.3.Results from epidemiological surveys indicate a significant proportion of school-aged children live in homes in which one or both parents abuse alcohol. More importantly, in addition to the damage caused by parental alcoholism, it appears that these home environments are often marked by high levels of violence and general interparental conflict. Given the prevalence of partner violence among married or cohabiting alcoholic patients, coupled with the number of children living in these homes, future investigations are needed to examine not only the link between alcoholism and partner violence, but also the individual and collective impact these behaviors have on these children.Unfortunately, alcoholism treatment providers and programs have not raised IPV and its impact on children\u2019s adjustment as an issue, in part because it has gone undetected. Given that the majority of custodial parents who enter treatment for alcoholism are reluctant to allow their children to be involved in any type of mental health treatment, regardless of whether it is individual treatment or as part of family therapy , the psyvice versa)?\u201d have yet to be explored. Further research is also needed to examine the specific mechanisms and how intervention programs might serve to mitigate harm among children from homes with an alcohol-abusing parent and where IPV is present. The results of these investigations will have important implications for the development of treatments necessary to address these complex issues.While addressing issues as complex and sensitive as the individual and combined effects of alcohol and IPV , appears overwhelming, given the seriousness and harmful short- and long-term effects of these behaviors, it is critical that the research community begin to examine these issues. For example, important questions such as \u201cWhat are the interactive effects of these phenomena on children\u2019s adjustment?\u201d and \u201cWhat is the impact of a reduction in IPV, but not in alcohol use  that may contribute to these home environments, our ability to develop and evaluate treatments with these high-risk families will be greatly impaired. Whether parental alcohol use, coupled with interparental violence may provide unique, interactive, or cumulative risk for children in these homes is not well-understood. While these behaviors are unlikely to be the only risks children in these homes encounter, we strongly believe that each of these behaviors may result in both short-term and potentially longer lasting effects on their development. Ultimately, the knowledge gleaned from these types of investigations will lead to the greatest level of safety for patients, their partners, and their children and aid in developing better policies and treatments ."}
+{"text": "Mycoplasma mycoides subsp. mycoides (Mmm). In the absence of classical virulence determinants, the pathogenicity of Mmm is thought to rely on intrinsic metabolic functions and specific components of the outer cell surface. One of these latter, the capsular polysaccharide galactan has been notably demonstrated to play a role in Mmm persistence and dissemination. The free exopolysaccharides (EPS), also produced by Mmm and shown to circulate in the blood stream of infected cattle, have received little attention so far. Indeed, their characterization has been hindered by the presence of polysaccharide contaminants in the complex mycoplasma culture medium. In this study, we developed a method to produce large quantities of EPS by transfer of mycoplasma cells from their complex broth to a chemically defined medium and subsequent purification. NMR analyses revealed that the purified, free EPS had an identical \u03b2(1\u2212>6)-galactofuranosyl structure to that of capsular galactan. We then analyzed intraclonal Mmm variants that produce opaque/translucent colonies on agar. First, we demonstrated that colony opacity was related to the production of a capsule, as observed by electron microscopy. We then compared the EPS extracts and showed that the non-capsulated, translucent colony variants produced higher amounts of free EPS than the capsulated, opaque colony variants. This phenotypic variation was associated with an antigenic variation of a specific glucose phosphotransferase permease. Finally, we conducted in silico analyses of candidate polysaccharide biosynthetic pathways in order to decipher the potential link between glucose phosphotransferase permease activity and attachment/release of galactan. The co-existence of variants producing alternative forms of galactan  and associated with an antigenic switch constitutes a finely tuned mechanism that may be involved in virulence.Contagious bovine pleuropneumonia is a severe respiratory disease of cattle that is caused by a bacterium of the Mycoplasma genus, namely  Mycoplasma mycoides cluster are particularly deleterious for ruminants and are responsible for severe economic losses worldwide. Mycoplasma (M.) mycoides subsp. mycoides (Mmm) is the causal agent of contagious bovine pleuropneumonia (CBPP), a highly contagious respiratory disease notifiable to the World Organization for Animal Health . CBPP was formerly one of the major cattle diseases worldwide and has now been eradicated from many countries, although it persists in Africa. Under natural conditions, CBPP affects only the Bos genus, producing pathognomonic clinical lesions confined to the thoracic cavity M. bovisMmm is not considered an agent of co-infection and is often isolated on its own. This clinical picture contrasts with that observed in infections by M. mycoides subsp. capri, its closest phylogenetic neighbor and one of the agents of contagious agalactia, a small-ruminant syndrome affecting diverse organs .Bacteria of the Mycoplasma genus have evolved from their Gram-positive ancestors by massive reduction of their genome size. They are considered the smallest and simplest self-replicating organisms, with many missing biosynthetic pathways and the notable absence of a cell wall Mmm genomes Mmm pathogenicity such as adherence to the host tissues, immune evasion, persistence, dissemination, inflammation and cytotoxicity Mmm virulence factor. Mmm has been shown to produce two types of polysaccharides: a capsular one, namely galactan, identified Mmm product unassociated with cells, both in culture supernatants and in the blood of infected cattle Mmm strains able to produce large amounts of capsular polysaccharide proved less sensitive to growth inhibition by bovine antisera Mmm persistence and dissemination. Antigenic cross-reactivity between Mmm capsular galactan and the pneumogalactan isolated from bovine lung was proposed to be at the origin of autoimmune reactions Mmm strain None of the usual virulence determinants described for other bacteria, such as toxins, invasins or cytolysins, has been identified in the currently sequenced Mmm and to compare it with the capsular galactan. We developed a purification method consisting of transferring mycoplasma cells from their complex growth medium to a chemically defined medium to minimize polysaccharide contamination. Two strains were used: (i) the type strain PG1T, for which the complete genome sequence is available Mmm strain Afad\u00e9 proved to have the same composition and structure as capsular galactan and was also recognized by CBPP-convalescent bovine serum. Furthermore, the production of capsular versus free galactan was associated with variations in colony opacity related to an antigenic switch of a specific glucose permease. In silico analyses were conducted in order to decipher the metabolic pathways that might account for the production of either capsular galactan or free EPS by the corresponding opaque and translucent variants.The present study was conducted to elucidate the composition and structure of the EPS produced by Mmm Afad\u00e9 , used for EPS purification and for selection of opaque (OP) and translucent (TR) colony variants and PG1T , used for electron microscopy and for in silico analysis of galactan biosynthetic pathways. Both strains were grown at 37\u00b0C under 5% CO2 in PPLO-based medium (DIFCO) supplemented as described previously Two strains were used in this study: 2. Mycoplasma cell density was estimated by cell enumeration using the most probable number method 8\u20131010 mycoplasmas/mL. The cultures were further incubated for 72 h to 96 h. Aliquots were sampled at 24 h intervals to measure pH and cell density and to purify EPS.Fifty mL of PPLO-based medium were inoculated with 500 \u00b5L of mycoplasma culture in stationary phase and incubated for 2 days at 37\u00b0C in 5% COEPS were purified as described by De Vuyst et al. The effect of carbon sources on EPS production by strain Afad\u00e9 was studied by adding to CMRL-1066 medium, which already contains 1 g/L glucose, either (i) 4 g/L glucose, mannitol, galactose, sorbitol or sucrose before seeding or (ii) 1 g/L glucose at 24, 48 and 72 hours after seeding. Carbohydrates were prepared as 200 g/L stock solutions and sterilized by filtration (0.22 \u00b5m filter units) before addition to CMRL-1066.The concentration of total sugars was estimated by phenol/sulfuric acid method EPS was detected with a polysaccharide detection kit and immunodetected by dot blotting using a CBPP positive serum. In brief, 2\u00b5L of the EPS extract were spotted onto a nitrocellulose membrane that was either stained with the glycoprotein detection kit from Sigma-Aldrich or treated as previously described for dot immunobinding Mmm strain PG1T grown on solid PPLO-based medium. Samples were examined under a Philips CM120 transmission electron microscope operating at an accelerating voltage of 75 kV.Electron microscopy was performed as previously described 3CO2H , aliquots of the extract were passed through a 4\u00d750 mm Propac PA1 pre-column (Dionex) before separation of anionic compounds on a 4\u00d7250 mm Propac PA1 column (Dionex) at 30\u00b0C. Gradient elution was performed with a multi-step gradient as follows: 0\u201325 min, 90% H2O and 10% NaOH 160 mM; 25\u201334 min, 100% NaOH 200 mM; 35\u201350 min 90% H2O and 10% NaOH 160 mM at a flow rate of 1 mL/min. Peak analysis was performed using Chromeleon software, version 7.0.The monosaccharide components were determined by high-performance anion exchange chromatography (HPAEC) on a CarboPak PA 1 with a pulsed amperometric detector (Dionex ICS 3000 system). After hydrolysis of EPS (1 mg) with 4 M CF2O (Euriso-top), dried under vacuum, and dissolved in 99.96% D2O (<1 mg/0.5 mL). 1H NMR spectra were recorded, at 80\u00b0C, on a Bruker Avance 500 spectrometer equipped with a 5 mm BBI probe and Topspin 1.3 software. 1H NMR spectra were accumulated using a 30\u00b0 pulse angle, a recycle time of 1 s and an acquisition time of 2 s for a spectral width of 3 000 Hz for 32 K data points with presaturation of the HOD signal using a presaturation sequence provided by Bruker. 13C NMR experiments were conducted on the same spectrometer operating at 125.48 MHz with 2 s as relaxation delay.Prior to NMR analysis, samples were exchanged twice with 99.9% D1H/1H COSY, 1H/1H TOCSY, 1H/1H NOESY, 1H/13C HSQC and 1H/13C HMBC spectra were acquired with standard pulse sequences delivered by Bruker.The 2D Genes potentially involved in EPS biosynthetic pathways were retrieved from the molligen database Mmm cultures Mmm strain Afad\u00e9, while no polysaccharides were detected in non-inoculated CMRL-1066 used as negative control  was also tested to measure the effect of the sugar source on EPS synthesis. None of these sugars modified the viability of strain Afad\u00e9 after 72 h of incubation  and glucose (3.3\u00b11.0%). This composition is similar to that described by Plackett et al. for the galactan Mmm capsule Mmm EPS was carried out by 1H and 13C NMR spectroscopy. The 7 resonances observed on the 1H NMR spectrum  was connected to two signals at \u03b4 3.864 and 3.648 belonging to H-6 and H-6\u2032 of galactose. This correlation was confirmed on the 1H/13C HMBC spectrum. Thus, these connectivities and 1H and 13C chemical shifts are consistent with the literature values for a \u03b2(1\u2212>6)-galactofuranose polymer spectrum  and corrspectrum  led us tspectrum , the conMmm strain Afad\u00e9 presented the same monomeric composition and structure as the capsular polysaccharide previously described, which was associated with Mmm strain V5 cells i.e. M. pulmonisM. hyorhinisMmm. However, Minga reported the existence of rough and smooth morphotypes of Mmm colonies and showed that they were related both to the capacity to produce a capsule and to pathogenicity Mmm strains PG1T and Afad\u00e9 produced a mixture of opaque (OP) and translucent (TR) colonies on agar  cells in 3F3NEG (OP colony variant) cultures at the time of transfer into CMRL-1066 medium. This may account for the weak EPS production obtained from the OP (3F3NEG) colony variant. We then attempted to minimize the proportion of TR (3F3POS) cells in OP (3F3NEG) cultures in order to assess EPS production by the OP colony (3F3NEG) variant cells. Several cultures were tested and the one with the lowest titer of 3F3POS (TR colony variant) cells (i.e. 0.5%) was used to inoculate CMRL-1066 medium. Under these conditions, EPS production was very low, whatever the sugar source (The frequency of reversion from 3F3-negative (3F3NEG) to 3F3-positive (3F3POS) variants of strain Afad\u00e9 was shown to vary from 10r source . HoweverWe showed that TR colony variants, which were detected by 3F3 monoclonal antibody, produced free, extracellular galactan. In contrast, OP colony variants, which did not display any reaction with the 3F3 antibody, because of a premature termination of their glucose PTS permease, produced capsular galactan. Polysaccharide biosynthesis by OP colony variants was intriguing, since truncation of the glucose PTS permease would be expected to result in an overall less efficient glucose transport and therefore hampering notably of polysaccharide synthesis.in silico all potentially involved Mmm genes. The genomes of the 2 currently sequenced Mmm strains, namely PG1T (accession number NC_005364.2) We tried to decipher the biochemical links between glucose intake, polysaccharide chain elongation and attachment/release of the galactan by retrieving glf gene identified in Mmm strain PG1TMmm, indicating that galactose is not a source for galactan synthesis. This is concordant with our experiment showing that galactose was unable to enhance galactan synthesis  glucose PTS permeases (MSC_0054 and MSC_0860/873) that have been identified in strain PG1TTMmm , cps (MSC_0109), EpsG (MSC_0108) and MSC_0771 previously identified in the variants .Rhodobacter sphaeroideshttp://www.cazy.org, Mycobacterium turberculosisFunctional prediction of EpsG using HHPred The third predicted GT, MSC_0771, was not related to any of the 90 GT families described so far. Structural analysis revealed two domains of which only the N-terminal one (1\u2013199) was similar to diverse bacterial and eukaryotic glycosyltransferases. Its role in galactan biosynthesis remains hypothetical.in silico analysis points toward i) a synthase-dependent pathway for galactan synthesis, ii) a putative role of MSC_0109 in attachment of galactan to the membrane and iii) a potential regulation of this attachment by glucose PTS permease. However detailed functional studies are now needed to unravel the precise roles of each GT and the genetic basis and triggering conditions underlying the switch between capsule production (OP colony variants) and EPS secretion (TR colony variants).In conclusion, this Mmm EPS. The incubation of washed mycoplasma cells in a completely defined medium, able to support cellular metabolism, allowed EPS synthesis for at least 72 hours, while preventing contamination with polysaccharides from the culture medium. Preliminary results in our laboratory indicate that this method is suitable for use in other mycoplasmas.We have developed a simple method for the purification of Mmm. Purified EPS had an identical \u03b2(1\u2212>6)-galactofuranosyl structure to that of Mmm capsular galactan. The presence of OP and TR colony variants in Mmm cultures, which varied greatly in their capacity to produce free EPS, was observed. Both variants appeared to be able to synthesize polysaccharides. However, these polysaccharides either remained attached to the cells, constituting a capsule (opaque colony variants), or were released into the culture medium as free EPS (translucent colony variants). We finally conducted in silico analyses of Mmm genes potentially involved in polysaccharide biosynthesis and proposed candidate pathways that might account for the alternative production of capsular versus free galactan by the corresponding opaque and translucent colony variants.This method was applied to characterize the free EPS secreted by Streptococcus pneumoniae spontaneous phase variation between opaque and translucent colony variants has been associated with diverse levels of virulence at different stages of the disease, from invasion to transmission Mmm pathogenicity and how. Although free galactan has been found in the body fluids and urine of infected animals in vivo has yet to be determined. This would constitute a key step in the understanding of Mmm pathogenicity, since the emergence of sub-populations in a given ecological niche is known to lead to bacterial persistence.In Figure S1Mmm strain Afad\u00e9 with a cps (MSC_0109) or rDNA 16S probe. Total RNA extraction and northern blot hybridization was performed as previously described cps gene probe was obtained by PCR with specific primers (5\u2032 TGATGGATCAACAGATAACACCA 3\u2032 and 5\u2032 TTTGGGCGTGAGTATCAATAAG 3\u2032).Northern blot hybridization of total RNA of the opaque (OP) and translucent (TR) colony variants of (DOC)Click here for additional data file.Figure S2Mmm EpsG (MSC_0108) glycosyltransferase. Numbers indicate the localization of transmembrane helices. DxD (red) and RxxQW (blue) motifs are showed.Schematic representation of the predicted membrane topology of (TIF)Click here for additional data file."}
+{"text": "We present the management and postoperative course of a persistent fetal vasculature (PFV) case. A four-year-old girl visited the Eye Department of Hippokration, General Hospital of Thessaloniki due to reduced visual acuity of her left eye. She was diagnosed with PFV and underwent surgery  in order to dissect the PFV. Along with the postoperative medical care, she underwent intensive treatment for amblyopia. The postoperative course was uncomplicated, and the visual acuity of her left eye improved from hand movement to 20/25 with proper correction. Patients with unilateral PFV and gradually deteriorating visual acuity could be good candidates for a combined surgical procedure, as the one described above, with a good prognosis. Persistent fetal vasculature (PFV) is a congenital disease that usually appears unilaterally in otherwise normal children and can be associated with a smaller eye or a smaller cornea . It is tIt is characterised by persistence and secondary fibrovascular proliferation of the primary fetal vasculature. The hyaloid system is prominent in the development of the eye. As the hyaloid artery regresses in normal development, the tissue reabsorbs. When a portion of retrolental posterior vasculosa lentis fails to resorb, it persists as an insignificant opacity on the posterior surface of lens (Mittendorf dot), and the disc shows an attached ghost artery. The vascular net can form a retrolental mass into which elongated ciliary processes are inserted. If the mass contracts the ciliary processes and the pupil is pulled centrally, the depth of the anterior chamber can be decreased causing secondary glaucoma. Contraction of the mass can also cause tractional retinal detachment , 4. An aA 4-year-old girl was referred to the ophthalmology department due to gradual reduction of the visual acuity of her left eye to hand movement. Her right eye visual acuity was 20/20 with proper correction . Physical and mental development was within normal range. Her mother had an uncomplicated pregnancy and labour. On slit lamp examination, traction of the ciliary processes to the centre of the posterior capsule of the lens in her left eye and a retrolental mass were identified .Biomicroscopy of her left eye with a 90-diopter lens revealed the presence of a posterior persistent fetal vasculature . No significant anatomical abnormalities in the vitreous base and peripapillary area were identified.The eye was not microphthalmic  while intraocular pressure, measured with Perkins tonometer, was 14\u2009mm\u2009Hg in both eyes. Right eye examination was unremarkable. It was decided that she should undergo surgery in order to remove the cataractous lens and the PFV. Under general anaesthesia, we performed aspiration of the crystalloid lens through a clear cornea incision, capsulorhexis of the posterior capsule, and removal of the retrolental mass and the ciliary processes with a vitreotome and insertion of an acrylic intraocular lens (IOL) at the sulcus. Then we proceeded to a pars plicata posterior vitrectomy and dissection of the posterior persistent fetal vasculature. On the first day after surgery, the patient's left eye had a clear cornea, the anterior chamber had no signs of inflammation, IOL was in situ, and retina was normal. Her left eye visual acuity was 20/200 without correction. She was advised to follow a treatment for amblyopia of her left eye (six-hour occlusion of her right eye daily). In addition she was prescribed topical antibiotic-steroid drops as well as drops of nonsteroid anti inflammatory eye drops for two months. Administration of the antibiotic-steroid drops was tapered appropriately. Three months after operation, visual acuity of her left eye was 20/50 with correction (\u22121.25\u2009sph. \u22120.75\u2009cyl. \u00d7 180\u00b0). She was advised to continue the treatment for amblyopia. Eight months later, visual acuity of her left eye further improved to 20/25 with correction (\u22120.75\u2009sph. \u22120.75\u2009cyl. \u00d7 180\u00b0).Once the retrolental mass  does not cover the visual axis during the first year of life, the prognosis for patient's vision is excellent, provided that surgery and treatment for amblyopia of the affected eye will take place as soon as possible \u20137.The anterior limbal approach selected for the cataract removal procedure, while pars plicata vitrectomy is preferred for the dissection of the fibrovascular tissue due to some degree of tractional stretching of ciliary processes and vitreous base. The combination of pars plicata vitrectomy, extraction of the cataractous lens, and insertion of an IOL at the same time had a satisfactory result for the patient's rehabilitation and showed no disadvantage compared with a vitrectomy and an IOL insertion in two separate surgeries , 9.We used intraocular lens of hydrophobic acrylic material , and no severe postoperative inflammation is expected. However, we recommended topical steroid for almost two months in order to avoid postoperative complications as peripapillary membranes and posterior capsular opacification. Prognosis is poor for neglected cases or for patients who develop secondary glaucoma or tractional retinal detachment due to contraction of the persistent fibrovascular net ."}
+{"text": "Background: Acceptance of acupuncture as an efficacious integrative modality for oncology-related side-effect management is rapidly expanding. It is imperative that guidelines regarding safe treatment supported by clinical experience are established. Oncology patients frequently experience thrombocytopenia as a side-effect of chemotherapy or radiation. However, safety data for acupuncture in adult patients with cancer who are thrombocytopenic is lacking.Materials and Methods: The medical records of 684 patients who received acupuncture treatments in an established acupuncture program at a private cancer treatment hospital were reviewed for adverse events occurring within the context of thrombocytopenia.Results: Of 2135 visits eligible for evaluation, 98 individual acupuncture visits occurred in patients with platelet counts <100,000/\u03bcL, including nine visits in which platelet counts were <50,000/\u03bcL. No adverse events of increased bruising or bleeding were noted. Medications and nutritional supplements or botanicals that may influence coagulation were also tabulated, with no apparent adverse events in this patient population.Conclusions: Discrepancies in the literature highlight the need to create cohesive safety guidelines backed by clinical research, specifically for groups at higher risk for adverse events. The preliminary evidence put forth in this study lays the foundation that supports the notion that acupuncture can be used safely with a high-need oncology population within an integrated model of care. In this descriptive retrospective case series of adult oncology patients with thrombocytopenia, no adverse events of increased bruising or bleeding were documented. Prospective trials are needed to confirm these initial observations. While the active mechanism(s) of acupuncture have yet to be defined fully, studies suggest that many of acupuncture's biomedical effects can be attributed to influences on the connective tissue, cytokine stimulation, adenosine modulation, neuromodulation, opioid production, and endorphin production.1A2 physicians often withhold referrals citing the desire for larger scale studies on safety and efficacy. Acupuncture has been shown to be safe and effective across a variety of international clinical settings. A cumulative review summarized the results of 12 studies which examined >1 million acupuncture treatments, and concluded that the risk of a serious adverse reaction is \u223c0.05 per every 10,000 treatments.3 Side-effects most frequently associated with acupuncture treatments include\u2014but are not limited to\u2014hematoma, soreness at insertion site, localized skin irritation, or faintness. As patients with cancer have demonstrated a growing interest in utilizing acupuncture to manage oncology-related side-effects,4 a need exists to solidify clear evidence-based safety guidelines specific to this population.Despite acupuncture's growing acceptance and application since its endorsement by the National Institutes of Health in 1997,5 Acupuncture is commonly contraindicated in thrombocytopenic patients because of the concern regarding increased bleeding. Many academic institutions and community hospitals have identified 50,000/\u03bcL as the threshold at which acupuncture is contraindicated, based on the clinical practice guidelines of the American Society of Clinical Oncology.6 However, a 2010 retrospective review in pediatric oncology patients suggests that acupuncture may be safe at lower platelet counts.7 While caution in this situation is certainly warranted, appropriate guidelines based on a larger sample size will help clinicians identify patients confidently who could benefit safely from this emerging modality.Thrombocytopenia is commonly encountered in the oncology population. It is generally defined as a patient having <150,000 platelets per\u2009\u03bcL . Thrombocytopenia in patients with cancer often results from either the myelosuppressive effects of radiation and chemotherapy, or infiltration of the patient's bone marrow by the malignancy.5 No serious adverse events were reported after a total of 237 acupuncture sessions, 112 of which occurred in patients with platelets <100,000/\u03bcL. Of note, 48 sessions occurred in patients with platelet counts <20,000/\u03bcL. The authors of the study noted that their results have been owing to the experience of the practitioners, the depth of penetration, the method of manipulation, or the type of needle used. The study justifies the need for a larger, more-conclusive investigation.The largest study to date is a retrospective review that evaluated the safety of acupuncture in 32 children and adolescents with oncology-related thrombocytopenia.Because of the lack of comparative data in adult patients with cancer, the present study was conducted to establish the baseline assessment for the safe application of acupuncture in adult oncology patients with thrombocytopenia.After acquiring institutional review board approval, medical charts were reviewed from patients who received treatment with acupuncture at Cancer Treatment Centers of America at the Eastern Regional Medical Center (ERMC), during the period from March 2012 to August 2013. ERMC is a private cancer-treatment hospital with an established acupuncture program. Policies and procedures require a physician's order prior to initiating acupuncture therapy. All treatments were performed by 1 of 3 licensed acupuncturists at ERMC. Prior to treatment, the acupuncturist conducted a chart review and a thorough TCM intake, which included a combination of tongue and pulse diagnosis, channel palpation, chief-complaint assessment, and a review of systems. Acupuncture points, depths , applied needle manipulation, and retention time were chosen at the practitioner's discretion in accordance with TCM theory and ERMC guidelines. Acupuncture points were primarily located on the extremities, face, and scalp, with depths not exceeding >\u00bd\u2033. Needles were retained for 15\u201330 minutes dependent upon patient needs. All patients were treated with Serin type #1, #2, and #3 disposable needles  and 15-, 30-, or 50-mm length .The details of TCM assessment and treatment were documented in the medical charts, including\u2014but not limited to\u2014chief complaint(s), TCM diagnosis (pulse and tongue assessment), acupuncture-point selection, and number of needles used per acupuncture treatment. The occurrence of acute adverse effects  during or immediately after needle removal were recorded by the acupuncturist at the time of treatment.For each individual acupuncture treatment session, the patient chart was evaluated to determine if a platelet count was documented within 48 hours prior to or after the session. If data on platelet levels were available for visits in which patients had platelet levels <100,000/\u03bcL, the data collected for the purposes of this study included patient demographics , date of acupuncture visit(s), cancer type, date of oncology diagnosis, oncology treatment at time of acupuncture visit(s), location of acupuncture treatment (inpatient or outpatient), and platelet levels.8 Therefore, concurrent use of medications and/or nutraceuticals/botanicals that can affect clotting or platelet counts were also recorded to capture additional factors influencing the potential for adverse events , vitamin E, and vitamin K were taken at 34%, 11%, and 11% of visits, respectively. The maximum number of concurrent nutraceuticals/botanicals at a single visit was five. For visits in which patients took both coagulation-affecting medications and nutraceuticals/botanicals, the maximum combined number was five . No adverse events were reported in any of the visits.Data regarding concurrent use of medications and/or dietary supplements/botanicals that can affect coagulation were also collected. 9 Minor adverse events occurred at a rate of 1.3 per 1000 treatments , which included severe nausea and actual fainting (n=12), unexpected, severe and prolonged aggravation of symptoms (n=7), and prolonged and unacceptable pain and bruising (n=5).9 Patients undergoing cancer treatment are at an increased risk of developing adverse events because of having pancytopenias and compromised immune function, making these patients more susceptible to bruising or bleeding, hematoma, and possible infection.Several large prospective studies evaluated the safety of acupuncture treatments. In 2001, MacPherson and colleagues reported no serious adverse events that required hospital admission in 34,407 acupuncture treatments.10 completed a review of acupuncture practices in 2010. They noted that the rate of adverse events can be decreased significantly by adhering to the following requirements: \u201cusing a specific type of thin needle, mild manual stimulation administered at a shallow depth, by an experienced acupuncturist at an academic cancer center with an established acupuncture program.\u201d As such, these researchers suggested that oncology patients with an absolute neutrophil count of <500/\u03bcL or a platelet count <25,000/\u03bcL are not suitable candidates for acupuncture treatment.Wedong et al.11 and those proposed by Wedong's review10 highlight the need to create cohesive safety guidelines backed by clinical research, particularly with regard to patients who are at increased risk for adverse events. The current study, despite its small sample size and retrospective nature, demonstrated that acupuncture can be administered safely and successfully to adult oncology patients with moderate thrombocytopenia. In the current study, 9 oncology patients being treated at an integrated medical facility received acupuncture safely with platelet levels below the 50,000/\u03bcL guidelines set by ASCO.11 These results, in conjunction with the findings of Ladas et al.'s pediatric study7 and Wedong et al.'s review,10 suggest that the threshold at which patients should be denied acupuncture may be lowered safely. It is imperative to set these guidelines accurately so that patients are granted care that will potentially increase their ability to tolerate the side-effects of conventional cancer therapies while avoiding unnecessary risks. For many patients in the metastatic setting, relief of subjective complaints is a top priority.The discrepancies between the ASCO guidelines10 and Ladas, et al.7 all practitioners who participated in the care of patients included in the current analysis had undergone additional training with regard to safety, acupuncture technique, and management of patients with cancer. Similar to the pediatric retrospective case series,7 the acupuncture described in the current report utilized Japanese J-type Seirin needles. The needles were not inserted past \u00bd\u2033 in depth. If manipulation of the needle was required, it was performed gently to obtain the De Qi sensation. The unique design of Seirin needles may facilitate a decreased risk of adverse events.It should be noted that, similar to the review by Wedong et al.The inclusion of nutraceuticals/botanicals is unique to this study. Integrative health care facilities have gained favor with the public and momentum within the field of oncology; however, the safety data on this combined model of care is limited. As multiple nutraceuticals/botanicals may affect bleeding, included these were in the current study's data set. To the current authors' knowledge, this is the first study to assess whether nutraceuticals/botanicals, in combination with conventional care, have synergistic impacts on increasing acupuncture's rate of adverse events. The preliminary evidence in this study lays the foundation to support the notion that acupuncture can be used safely with this high-need patient population within an integrative model of care.To the best of the current authors' knowledge, this is the first retrospective review to assess the incidence of side-effects of acupuncture in thrombocytopenic adult oncology patients within an integrative medical facility. In this analysis, no adverse events specifically referable to acupuncture  were observed.11 which allow acupuncture in patients with platelets of \u226550,000/\u03bcL may be further reduced to the levels proposed by Wedong et al.10 Prospective studies are needed to confirm that this guideline can be lowered safely to permit greater access to acupuncture therapy.Limitations of this study include the retrospective nature of the case series. Based on these data, further prospective studies are planned to assess side-effects resulting from the use of acupuncture in adult oncology patients. The lack of adverse events noted in both this study involving adult oncology patients and the prior pediatric study suggests that the ASCO Clinical Practice Guidelines,"}
+{"text": "Sigmoria whiteheadi Shelley, 1986 to the genus Apheloria Chamberlin, 1921\u2014a relationship not readily apparent based on morphology alone. We show that while gonopod differences are a premier source of taxonomic characters to diagnose species pairwise, the traits should be viewed critically as taxonomic features uniting higher levels.For the past several centuries, millipede taxonomists have used the morphology of male copulatory structures , which are strongly variable and suggestive of species-level differences, as a source to understand taxon relationships. Millipedes in the family Xystodesmidae are blind, dispersal-limited and have narrow habitat requirements. Therefore, geographical proximity may instead be a better predictor of evolutionary relationship than morphology, especially since gonopodal anatomy is extremely divergent and similarities may be masked by evolutionary convergence. Here we provide a phylogenetics-based test of the power of morphological versus geographical character sets for resolving phylogenetic relationships in xystodesmid millipedes. Molecular data from 90 species-group taxa in the family were included in a six-gene phylogenetic analysis to provide the basis for comparing trees generated from these alternative character sets. The molecular phylogeny was compared to topologies representing three hypotheses: (1) a prior classification formulated using morphological and geographical data, (2) hierarchical groupings derived from Euclidean geographical distance, and (3) one based solely on morphological data. Euclidean geographical distance was not found to be a better predictor of evolutionary relationship than the prior classification, the latter of which was the most similar to the molecular topology. However, all three of the alternative topologies were highly divergent (Bayes factor >10) from the molecular topology, with the tree inferred exclusively from morphology being the most divergent. The results of this analysis show that a high degree of morphological convergence from substantial gonopod shape divergence generated spurious phylogenetic relationships. These results indicate the impact that a high degree of morphological homoplasy may have had on prior treatments of the family. Using the results of our phylogenetic analysis, we make several changes to the classification of the family, including transferring the rare state-threatened species  The Appalachian Mountains have ancient origins and hold a considerable diversity of endemic species. Among the biodiversity encompassed by these mountains, wingless and low-mobility animals such as millipedes, harvestmen, snails, and salamanders are tightly coupled to their habitat. As a result of its complex topography, varied edaphic qualities, and ancient origins, the Appalachian Mountains have fostered the isolation and diversification of these low-mobility groups resulting in high species diversity in relatively small geographic areas . This isNannaria, there are 22 nominal species and ca. 60\u2013200 are estimated in the Appalachian Mountains alone , we tested the hypothesis that genitalic characters are not better than geographical distance in recovering an accurate phylogeny. To test this question, we inferred the largest molecular phylogeny of Diplopoda to date with 90 species-group taxa within the family Xystodesmidae and nucleotide data from six gene regions . We inferred trees based on: (1) a matrix assembled from published morphological characters and (2) geographic proximity (Euclidean distance) of species. These two trees were then the basis of several topology-based comparisons against the molecular phylogeny. This paper accomplishes three objectives: (1) an estimation of the molecular phylogeny of the Xystodesmidae, (2) a test of whether geography is an accurate predictor of phylogeny within the family, and (3) a determination of the phylogenetic placement and geographic distribution of the Laurel Creek Millipede, S. whiteheadi.Based on the relevance of S. whiteheadi, and two other closely related tribes of xystodesmid millipedes based on the phylogeny from Boraria, Cherokia, Gyalostethus, Pleuroloma and Stenodesmus) and Rhysodesmini (Dicellarius and Pachydesmus) as a diverse outgroup selection. Species were represented by male specimens since the male gonopods are almost exclusively used as identification resources to the species level. These species represent 61% of the 116 described species in Apheloriini, along with six undescribed species.Molecular partition. Exemplar specimens of all species used in this study were collected from 2003 to 2015, of which ca. 51% were from original type localities . We targMorphological partition. Specimens that were used for the molecular partition were scored for morphological characters . We usedhttp://collection.ento.vt.edu/). Legs posterior to the gonopods (#10\u201322) were removed from the left side of each specimen and stored in RNAlater at \u221280\u00a0\u00b0C for archival preservation of RNA and DNA . DNA was extracted using a Qiagen DNeasy tissue kit. In the rare case where legs were removed from specimens stored in 100% EtOH, the appendages were air-dried prior to DNA extraction. Typically three legs were used for large millipedes (most Xystodesmidae), while 4\u20136 legs were used for smaller millipedes . Extracted and purified DNA was stored at \u221220\u00a0\u00b0C.Specimen collection and processing techniques are those described in Six gene fragments in the following regions were amplified for each specimen: large subunit ribosomal RNA gene including the tRNA-Val gene (16S), small subunit ribosomal RNA gene (12S), 28S ribosomal RNA gene (28S), cytochrome c oxidase subunit I gene (COI), and elongation factor-1 alpha gene (EF1-a). Amplification procedures can be found in Sequence chromatograms were edited in the Mesquite module Chromaseq (Version 1.2) implementing phred and phrap for nucleotide base-calling, trimming, and quality control . SequencNinety xystodesmid millipede species-group taxa were examined for 68 qualitative morphological characters . Morpholk\u00a0=\u00a031) for binary characters and an empirical prior for multistate characters . To measure homoplasy, the number of transformations per character were estimated using SIMMAP and then used to calculate the consistency index (CI) for each character, calculated: CI = expected number of state changes/observed number of state changes. The degree of homoplasy for a morphological character (HI = 1\u2013CI) decreases as the CI approaches one. SIMMAP was also used to calculate the dwell time for each character state, which is the proportion of time that a character spent in a specific state  remain distinguishable. We divided the gonopod into these three regions and summed the CI in each region  to assess if CI, and convergence, is evenly spread among the podomeres.symbiota4.acis.ufl.edu/scan). Many of the taxonomic collection localities in the literature were narrative in nature and did not include precise geographical coordinates. For these, collection localities were manually georeferenced in Google Earth . These data are available for download from VTechData (https://data.lib.vt.edu/files/qz20ss52b). Geographical coordinates were plotted in ArcGIS , converted into individual shapefiles according to species, and species centroids calculated. Species whose distribution centroids fell within the same Level III Ecoregion  the ecoregion distance tree, (2) the prior phylogeny of S. whiteheadi, collections were carried out every 0.5 km in linear transects radiating from the four cardinal directions from the type locality, for a total of 32 sample locations . Sampling protocols followed In order to determine the distribution of A\u00a0=\u00a00.21579, C\u00a0=\u00a00.171, G\u00a0=\u00a00.26965, T\u00a0=\u00a00.34355. Nucleotide frequency was homogenous across taxa for each gene region .Sequences of the gene regions were separately aligned in PRANK using the HKY substitution model with empirical base frequencies and a kappa =2, which resulted in a total aligned length of 3,975 bp for the concatenated supermatrix as follows: COI (1\u2013600), 12S (601\u2013749), tRNA-Valine (750\u2013830), 16S , 28S  and EF1a . The alignment was made up of six gene regions subdivided in PartitionFinder into seven partitions . Of the Brachoria, Cherokia, Dicellarius, Falloria, Pachydesmus, and Pleuroloma were recovered as monophyletic , and that clade in turn renders Rudiloria paraphyletic (pp\u00a0=\u00a00.98). Appalachioria is a monophyletic clade with the exception of A. s. separanda that occurs sister to Rudiloria + Apheloria. Boraria infesta and B.\u00a0deturkiana are sister species (B. profuga was not included in this study); in contrast Boraria stricta is recovered as a sister group to the Pachydesmini (pp\u00a0=\u00a00.89). Brevigonus is paraphyletic due to the placement of Furcillaria aequalis as sister to Brevigonus shelfordi (pp\u00a0=\u00a01). The two subspecies of Deltotaria brimleii are a paraphyletic grade at the base of the Apheloriini (pp\u00a0=\u00a01). Dixioria is recovered as polyphyletic with Dixioria wrighti and D. watauga forming a monophyletic clade within the greater sigmoid-gonopod clade (pp\u00a0=\u00a00.75) and D. coronata and D. dactylifera representing a monophyletic clade sister to Brachoria (pp\u00a0=\u00a01). Furcillaria is polyphyletic with F. aequalis sister to Brevigonus shelfordi and Furcillaria laminata sister to Dynoria medialis (pp\u00a0=\u00a01). Rudiloria is polyphyletic and includes a clade of northern species: Rudiloria guyandotta, Rudiloria mohicana, Rudiloria rigida, including an undescribed species from Ohio. The species Rudiloria kleinpeteri, Rudiloria trimaculata trimaculata and a newly discovered unnamed species of Rudiloria from Monongahela National Forest are separate from the northern species and paraphyletic with respect to the genus Apheloria. Sigmoria is recovered as polyphyletic, with Sigmoria nantahalae as sister to the monophyletic Falloria (pp\u00a0=\u00a00.97). The representatives of the Sigmoria latior complex are monophyletic and are sister to Dixioria wrighti and D. watauga (pp\u00a0=\u00a01). Sigmoria austrimontis is sister to Prionogonus divergens (pp\u00a0=\u00a01), and Sigmoria australis is sister to the Brevigonus species (pp\u00a0=\u00a01).MCMC chains were run for 1\u00a0M generations and likelihood values converged after 315,000 generations. Of the trees generated, after one-quarter were discarded as burnin, 15,000 in the posterior distribution were summed for the consensus tree . The molphyletic . In contPachydesmus, Pleuroloma, Cherokia, and Brachoria; a paraphyletic Boraria, Appalachioria, Dixioria, and Brevigonus; and a polyphyletic Sigmoria, Rudiloria and Apheloria  are monophyletic and sister to Dixioria. Pleuroloma, Falloria, Sigmoria and Apheloria are all polyphyletic in the MRT. Sigmoria whiteheadi is recovered as a sister species to a large clade of apheloriine species, and not close to Apheloria.Of the 68 characters used in the morphological analysis, 67 were parsimony-informative. We implemented the Mk\u00a0+\u00a0\u0393 model of character change due to \u201cvery strong (BF >\u00a010)\u201d evidence against the simpler Mk model  was the closest to the molecular tree (MOT), with a Bayes Factor (BF) score of 874.11. The EDT tree based on ecoregions had a BF score of 4,841.18, versus the MRT (morphology tree) that was the most divergent from the MOT with a BF score of 4,941.06. For all four stepping-stone analyses, 50 steps were performed and the first step was discarded as burn-in, with each step acting as the burn-in for the subsequent step. The molecular and morphological constraint analyses both converged during the second step in the stepping stone analysis  and had 19,600 generations per step. The SW86 analysis converged after 43 steps and had 1,254,900 generations per step, while the EDT analysis converged after 44 steps and had 1,254,900 generations per step.Homoplasy index values ranged from 0.338 to 0.991. S. whiteheadi as a single locality where the type series was collected in 1983 is now expanded and includes eight additional sites\u2014for a total of nine\u2014all of which occur within a slender, linear area of 0.95 km2. All individuals of S. whiteheadi were found within a thin 2-km long linear rhododendron and hardwood dominated riparian border of Laurel Creek, extending 1 km north and 1 km south from the type locality. Adult individuals were predominantly found under fallen oak (Quercus spp.), maple (Acer spp.) and tulip poplar (Liriodendron tulipifera) leaves in small broadleaf forests bordered by rhododendron. In contrast, immatures were found predominantly beneath rhododendron leaves within the rhododendron corridor of the stream.After 30 years, the Laurel Creek Millipede was rediscovered near its historical type locality in Virginia . The hisSigmoria and monophyly of several apheloriine genera. While the MOT is consistent with a widespread morphologically complex (in terms of gonopods) Sigmoria, as Falloria\u2014Sigmoria nantahalae had since been removed from the genus Falloria and placed in Sigmoria There was very strong evidence that the alternative topologies  were all highly distinct from the molecular tree, MOT BF \u226510; , indicatSigmoria .  is unlikely due to the small difference in number of constraints and instead indicative of the varying power of the phylogenetic signal in each dataset.The approach to use geographical proximity alone to assemble clades did not significantly improve upon the prior phylogeny of Brachoria and Appalachioria is now known to occur in three different parts of the tree. As shown here, 95% of the gonopodal characters used in traditional xystodesmid systematics are homoplasious (HI >\u00a00.5). Not surprisingly, the most homoplasious characters were relatively subjective characters, such as the overall shape of the gonopophyses  and presence of lateral flanges, which are variously located on different regions of the gonopod . The tibiotarsus, the indistinguishable fusion of the walking leg podomeres distal to the prefemur, which includes the basal zone, acropodite, apex and distal zone, is the most homoplasious region on the gonopods examined (Riukiaria) and appears to act in tandem with it  is not. Convergence of male genitalic features can complicate the understanding of species-level systematics in the Xystodesmidae. For example, the cingulum of  gonopod . One of examined . This isexamined . Whetherexamined . These aexamined . Conversexamined . Such coexamined . This do with it .Sigmoria, Rudiloria, Apheloria, and Appalachioria. For example, albeit not included in this analysis, the eastern US xystodesmid genus Nannaria, which is composed of 22 described species  of lineages with respect to the Apheloriini. A paraphyletic Rhysodesmini agrees with a previous molecular study . Pachydesmini is monophyletic and within the paraphyletic Rhysodesmini. Pachydesmini is known only from the eastern US with two genera just west of the Mississippi, Pachydesmus and Thrinaxoria , as well as Cheiropus, Cleptoria, Lyrranea, Rudiloria and Stelgipus, as subgenera of Sigmoria. This classification was recast by Dixioria), and others for the simple reason of avoiding the \u201cnomenclatorial complication\u201d which subgenera presents  . This makes Rudiloria the fourth xystodesmid genus that contains a species with a cingulum; the others are Appalachioria, Brachoria, Gonoessa, and an undescribed species of Nannaria. The cingulum is a highly variable character and evolved a number of times independently across the xystodesmid tree. Use of the feature as a diagnostic character in Xystodesmidae higher-level taxonomy, and in other polydesmidan taxa might be critically reexamined and tempered with other morphological aspects. Brachoria and Appalachioria and more likely evolved independently in both Appalachioria and Brachoria lineages. Gonoessa and Nannaria (tribes Rhysodesmini and Nannariini) were not included in this study, but it would seem even more unlikely that the cingulum evolved in the common ancestor of the Rhysodesmini, Nannariini and Apheloriini. What would drive such a feature to develop independently in four different lineages of xystodesmid millipedes remains to be determined. Perhaps the cingulum serves as a point of articulation, which eases the coupling of the gonopods and cyphopods. The function of this character deserves a greater level of attention and it has been found in additional polydesmidan genera including AponedyopusAtlantodesmusChamberliniusGeniculodesmusHaplogonosomaTylopusRiukiupeltisSimplogonomorphaIn our phylogeny, the genus teheadi) . AppalacAppalachioria and Brachoria were once a single genus and have been recently examined using molecular phylogenetics (pp\u00a0=\u00a01). The separanda and eutypa species groups of Appalachioria are not monophyletic, and their species may require elevation to species level pending a revision of the genus . Appalachioria separanda calcaria and A. separanda versicolor form a monophyletic clade (pp\u00a0=\u00a01) that may constitute one species. The evidence for this combination is threefold: (1) genetically they are only slightly distinct (consensus tree uncorrected p-distance =0.55), (2) geographically they form a continuum with overlapping distributions along the Brush Mountain range in southwest Virginia, and (3) morphologically the tip of the acropodite varies from a slight, smooth curve in A. separanda calcaria in Blacksburg, Virginia (at the northwest end of the parapatric species) to a characteristic A. separanda versicolor \u201chook\u201d as one moves southwest to Marion, Virginia (at the southwest end of the species ranges). Both A. separanda versicolor and A. separanda calcaria are extremely variable in color, and some populations have four distinct color morphs. Appalachioria eutypa eutypa forms a monophyletic clade with A. turneri (pp\u00a0=\u00a00.74), and is distinct from A. eutypa ethotela. The changes to the prior Brachoria phylogeny, driven by the inclusion of additional gene regions in this study, are as follows: B. mendota is moved to sister of B. evides, B. cedra is moved to sister of a clade composed of B. hansonia, B. glendalea, B. initialis, B. guntermountainensis, and B. ochra .A.\u00a0whiteheadi has an extremely restricted area (\u223c0.95 km2) and therefore may represent a relict or paleoendemic species that has significantly diverged from the rest of Apheloria. Whether A. whiteheadi was once more widespread and its range has contracted remains uncertain, but it certainly represents one of most geographically isolated species in the Apheloriini. Low vagility in combination with a strict reliance on stable mesic environments and a likely early evolutionary divergence has given rise to a number of short-range endemic species within the Xystodesmidae. A short-range endemic species (SRE) is defined as having a range of less than 10,000\u00a0km2  qualify as SREs, and 40 (44%) have distributions less than 1,000 km2, a threshold which 2 proposed by 2.Extreme short-range endemics such as ibutions  and the A consideration when designating a species as an SRE or MRE is the method by which the distributional area is measured, especially if these distribution data are used for conservation efforts or governmental regulation . For theBrachoria and Sigmoria, form a contiguous mosaic-like patchwork across the Appalachians, and the protection of each one of these small habitats may be challenging. Additionally, SRE and especially MRE species are highly sensitive to environmental alteration, and the legal protection of habitat itself (thereby reducing direct threats via land-use change) may not be sufficient to mitigate the broader effects of air and water pollution and global climate change. Rather than be discouraging, these challenges should inspire conservation groups to work creatively to protect these unique, and highly threatened species.SRE and MRE taxa present complex challenges for conservation efforts . In the The homoplasy found in our morphological tree was high, and raises concerns about the utility of analyses reconstructing relationships above the species level in millipedes based solely on morphological data. Our comparison of phylogenetic hypotheses demonstrated a high level of discordance between the various methods that taxonomists used to assess evolutionary relationships in the millipede family Xystodesmidae. While the historical phylogeny (SW86) was the most consistent with our multi-gene molecular phylogeny, the tree was still highly divergent. Morphology and geography appear to be useful in combination for taxon delimitation at the genus level, but when considered separately as in the independent EDT and MRT trees there is a substantial reduction in accuracy. We showed that the majority of gonopodal features have high homoplasy as a result of convergence and are not useful for taxon delimitation above the genus-level, but when used at the species level are effective as species-characteristic features. In the field, geography with morphology is a good combination for quick taxa identification. While molecular phylogenetics is also affected by rampant convergence, negative effects are mitigated through the presence of several orders of magnitude more characters than morphological analyses and by combining loci and assessing concordance among gene trees.Nannaria in the eastern US and ca. 10 new species of Xystodesmidae have been described from the mountains of southwest China and Vietnam over the past several years. Future taxonomic treatments should include an increased taxon sampling to enhance accuracy and to not miss cryptic systematic relationships as shown with A.\u00a0whiteheadi and Apheloria. The family has a high diversity in Appalachia within small geographical areas, indicating an unparalleled and irreplaceable diversity that is threatened by any level of habitat loss. We hope that this study will spur future work on Xystodesmidae, and will provide an introductory basis for those interested in exploring this fascinating group of organisms.The molecular phylogeny presented here re-examines some of the relationships within the Xystodesmidae. More detailed examination of the genera and tribes within the Xystodesmidae is warranted. While our study included 90 species in 20 genera, there are 393 species and 62 genera in Xystodesmidae. This includes unsampled members from the Russian Far East, the Mediterranean Basin, and Ethiopia. Moreover, there are ca. 70 new species of the genus 10.7717/peerj.3854/supp-1Appendix AList of taxa used in both the morphological and molecular analyses, organized alphabetically by genus and then species. *Taxa that were represented by separate specimens in the morphological and molecular analyses, molecular specimen code shown, morphological specimen as in Click here for additional data file.10.7717/peerj.3854/supp-2Appendix BDT: dwell time spent in each character state; HI: homoplasy index. Due to the lack of female specimens and heads in some taxa the female (41\u201345) and cephalic (46\u201347) characters were not included in the stochastic character state analysis.Click here for additional data file.10.7717/peerj.3854/supp-3Appendix CDNA amplification procedures for the six genes used in this study: COI; EF1a; tRNA-VAL, 12S and 16S (denoted as 12S\u201316S in text); and 28S.Click here for additional data file.10.7717/peerj.3854/supp-4Appendix DIndependent gene trees for the six genes used in this study. Turquoise bars indicate sit substitution rates and asterisks indicate posterior probability node support >0.70.Click here for additional data file.10.7717/peerj.3854/supp-5Supplemental Information 1Click here for additional data file.10.7717/peerj.3854/supp-6Supplemental Information 2Click here for additional data file."}
+{"text": "In this work, we propose strategies that can suppress incoherent phonon transport in the above random multilayer (RML) structure to further reduce \u03bal. Molecular dynamics simulations are conducted to investigate phonon heat conduction in SLs and RMLs with lattice imperfections. We found that interfacial species mixing enhances thermal transport across single interfaces and few-period SLs through the phonon \u201cbridge\u201d mechanism, while it substantially reduces the \u03bal of many-period SLs by breaking the phonon coherence. This is a clear manifestation of the transition from incoherent-phonon-dominated to coherent-phonon-dominated heat conduction in SLs when the number of interface increases. In contrast, interfacial species mixing always increases the \u03bal of RMLs owing to the dominance of incoherent phonons. Moreover, we found that doping a binary RML with impurities can reduce \u03bal significantly, especially when the impurity atom has an atomic mass lower or higher than both of the two base elements. This work reveals the critical effect of lattice imperfections on thermal transport in SLs and RMLs, and provides a unique strategy to hierachically suppress coherent and incoherent phonon transport concurrently.Randomizing the layer thickness of superlattices (SL) can lead to localization of coherent phonons and thereby reduces the lattice thermal conductivity  Since \u03c3 and \u03bae are usually strongly coupled via the Wiedemann-Franz\u2019s law, tuning \u03bal has been a widely adopted scheme to increase the ZT of TE materials2.The quest for waste heat recovery technologies has raised continued interest in thermoelectric (TE) materials, which can convert waste heat into reusable electricity directly. TE devices can also work in the reversed mode, in which electricity can be used to move heat and thus achieve solid-state cooling. This is advantageous over conventional air-conditioners with moving pumps and condensers. The figure of merit ZT of TE materials is\u03bal compared to their bulk counterparts, for example, nanowires4, nanocomposites6, superlattices (SL)8, nanomeshes10, and pillared thin films13. Typically, the low \u03bal of the above structures partially or completely stems from the extensive surface and interface scatterings in the nanostructures, which can be understood by the Casimir picture14, i.e., classical size effect. For SLs, nanomeshes, and pillared thin films, their phonon dispersion relations can be significantly different from their bulk counterparts, which also contribute to the low \u03bal found in these structures. Semiconductor alloys, for example, Si/Ge and Bi2Te3/Sb2Te317, have also received substantial attention owing to their low \u03bal and relatively lower cost for manufacturing. Furthermore, considerable efforts have been devoted to combining different phonon scattering mechanisms to hierarchically scatter phonons of different wavelength to achieve a \u03bal below the random-alloy limit. For example, Kim et al. embedded ErAs nanoparticles in In0.53Ga0.47As alloys, so that short-wavelength phonons are scattered by point defects and mid-to-long-wavelength phonons are scattered by the embedded nanoparticles18. Biswas et al. extended this strategy even further by creating an all-scale hierarchical architecture, in which atomic-scale point defects, nanoscale inclusions, and mesoscale grain boundaries scatter short-, mid-, and long-wavelength phonons, respectively19. This has led to one of the highest ZTs for TE materials so far. In addition, Hu et al. found ultralow \u03bal of Si/Ge superlattice nanowires, which arises from the combined effects of interface scattering and lateral surface scattering20.Various nanostructures have been theoretically proposed or experimentally demonstrated to have a substantially reduced 24, of which the structure will be referred to as random multilayer (RML) in this manuscript. It has been reported that perfect RMLs with short average layer thickness can have remarkably lower \u03bal than binary alloys22 and superlattices with rough interfaces of the same composition24, suggesting their promising application as TE materials. Coherent phonons are often the major heat carriers in structurally perfect SLs at low to moderate temperatures21. In RMLs, however, \u03bal is substantially reduced owing to the localization of coherent phonons21. Mu et al. have demonstrated substantial reduction in the \u03bal contributed by coherent phonons through hierarchical scattering or localization of coherent phonons with amorphous or rough surfaces, multiple interfaces, and randomly positioned Si layers25. On the other hand, as demonstrated in ref. \u03bal of RMLs by nanostructuring to minimize incoherent phonon transport, for example, by introducing interfacial species mixing or lattice impurities, which have been demonstrated to reduce the \u03bal of materials effectively. In particular, incoherent phonons, which typically have short wavelength, dominate thermal transport in RMLs. Since the atomic mass difference induced by alloying or impurity doping preferably scatters short-wavelength phonons26, it can possibly be utilized to further reduce the \u03bal of RMLs. This motivates us to study doped RMLs in this work, which can provide us with new strategies for hierarchically manipulating both coherent and incoherent phonon transport in materials. Moreover, there are almost always various degrees of structural imperfections in multilayered structures fabricated in lab using any deposition technique28. It is thereby of practical importance to fully understand their influence on phonon transport, transmission, and localization.Recently, phonon localization has been found to suppress coherent phonon transport in multilayers with random layer thickness31 and that of sandwiched amorphous layers32, while many other groups have reported remarkably increased TBR or reduced \u03bal of SLs by interface disorder34. The reduction in the TBR of single interfaces has been attributed to the phonon \u201cbridge\u201d effect, in which the mixed interfacial region serves as a \u201cbridge\u201d for the phonon spectra of the two sides of the interface. On the other hand, the reduction in the \u03bal of SLs is attributed to the breaking of phonon coherence by the interface disorder. It can be expected that coherent phonon transport should play a major role in such discrepancy, while a direct evidence has not been reported yet. In this work, we strive to understand the effect of structural disorders, namely, random layer thickness, interfacial species mixing, and impurities on phonon transport in SLs and RMLs. We conduct molecular dynamics simulations to systematically investigate the above issues and provide strategies on further reducing the \u03bal of RMLs.In addition to the issues discussed above, understanding phonon transport across single interfaces and multiple parallel interfaces is essential for understanding the overall heat transfer behavior in RMLs and SLs. However, contradictory results exist in literature regarding the effect of interface disorder on phonon transport across single interfaces or multiple interfaces. For instance, interface roughness has been found to reduce the thermal boundary resistance (TBR) of single interfacesm\u2009=\u200940.0\u2009g/mol or m\u2009=\u200990.0\u2009g/mol, which we will refer to as m40 and m90 atoms. For doped RML, as shown in Fig.\u00a0m\u2009=\u200922.5\u2009g/mol, m\u2009=\u200960.0\u2009g/mol, or m\u2009=\u2009160\u2009g/mol, which will be referred to as m22.5, m60, and m160 atoms, respectively. The RML structures are created by replicating the conventional fcc unit cell (UC) with a lattice constant of 5.278\u2009\u00c5 in all three dimensions. The m40 and m90 layers are stacked along the [100] lattice direction to form the SLs or RMLs. We adopt the algorithm that is described in ref. \u03d5ij is the pairwise interaction potential energy, rij is the distance between atom i and atom j, \u03b5 is the potential well depth, and \u03c3 is the zero-potential-energy pair separation. We set the value of the parameters for the Lennard-Jones potential to be \u03b5\u2009=\u20090.1664\u2009eV and \u03c3\u2009=\u20090.34\u2009nm. The cutoff radius for truncating interatomic interactions in the molecular dynamics simulation is chosen as rc\u2009=\u20092.5\u03c3. Our rationale for using the Lennard-Jones potential rather than a more realistic one, e.g., the Tersoff potential, is that it can capture the key physics of coherent phonon effects in multilayered structures21 with substantially lower computational cost.We conduct non-equilibrium molecular dynamics (NEMD) simulations to investigate phonon heat conduction in the structures shown in Fig.\u00a0\u00c5-long heat baths. It has been found in ref. \u03ba for the Lennard-Jones system studied here. The heat baths are maintained at a temperature of Th\u2009=\u200933\u2009K (hot bath) and Tc\u2009=\u200927\u2009K (cold bath), respectively. The simulation time step is chosen as \u0394t\u2009=\u20091\u2009fs. We use the LAMMPS Molecular Dynamics Simulator35 to conduct NEMD simulations. At the beginning of the simulation, the periodic boundary condition is applied to all three dimensions and each atom is assigned a random velocity following the Gaussian distribution. The average kinetic energy of the atoms corresponds to a temperature of 5\u2009K. Subsequently, the entire simulation domain is relaxed in the NPT ensemble at zero pressure and a temperature of 30\u2009K for 200\u2009ps. After the NPT structural relaxation process, we apply the fixed boundary condition to the heat flow direction by freezing an 11-\u00c5-thick layer of atoms at both ends of the simulation domain. A length of 11\u2009\u00c5 guarantees that there is no cross-boundary energy transfer between the two ends of the simulation domain. Finally, atoms in the hot bath are rescaled to a temperature of 33\u2009K and those in the cold bath are rescaled to 27\u2009K in every simulation step for a total time period of 40\u2009ns, during which we collect the heat current and temperature distribution of the structure. The lattice thermal conductivity \u03bal of the structure is calculated as \u03bal\u2009=\u2009JL/[Ac(Th\u2009\u2212\u2009Tc)], in which Ac and L are the cross-sectional area and the length of the structure, respectively. The heat transfer rate J is calculated as Eh and Ec are the kinetic energy that has been added to or subtracted from the hot bath or cold bath by the time t. At steady state, Eh and Ec should be a linear function of t. Therefore, we fit the steady-state Eh-t and Ec-t curves using the linear least squares regression method to obtain J, and the standard deviation in J is used to estimate the error bars for \u03bal.Figure\u00a0g is the vDOS, \u03c9 is the angular frequency of phonons, vi is the velocity vector of atom i, \u2329vi(t)|vi(0)\u232a denotes the velocity-autocorrelation function, and N denotes the number of atoms in the group. \u03c9 is related to the phonon frequency f via \u03c9\u2009=\u20092\u03c0f. In our work, molecular dynamics simulations are conducted for 20,000 steps in the NVE ensemble to obtain the autocorrelation function.The vibrational density of states (vDOS) are calculated as the Fourier transform of the atomic velocity-autocorrelation functions averaged over the group of atoms of interest. Specifically, the normalized vDOS is calculated asThe datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.\u03bal of SLs substantially. The reduction in \u03bal has been attributed to the breaking of phonon coherence by the interface disorder34. Herein we focus on a general comparison between the \u03bal of perfect SLs, rough SLs, perfect RMLs, and rough RMLs.We first investigate the effect of interface roughness in the form of interfacial species mixing on thermal transport in SLs and RMLs. Interfacial species mixing is an inevitable source of lattice defect in multilayered structures fabricated by current layer deposition techniques. Its effect on phonon heat conduction has been investigated extensively and, in general, it was found to reduce the R of SLs and RMLs with smooth or rough interfaces as a function of the number of periods (NP). Specifically, R is calculated as R\u2009=\u2009Ac(Th\u2009\u2212\u2009Tc)/J. In addition to SLs and RMLs, we also study the case of NP\u2009=\u20090, which corresponds to a direct contact between a heat bath composed of m40 atoms and one composed of m90 atoms, i.e., a single interface between m40 and m90. Schematics of the structures with NP\u2009=\u20090, 1, and 2 can be found in the inset of Fig.\u00a0First, we compute the thermal resistance R of SLs and RMLs with an average layer thickness d\u2009=\u20092 UC. As for the effect of interface species mixing on thermal transport in SLs, the most striking feature we can observe is the crossover between Rperfect-SL and Rrough-SL occurring at NP\u2009=\u20092. Specifically, interface species mixing reduces the thermal resistance when the SL has no more than 2 periods, while it increases R when the SL has more periods. This elucidates the contradictory observations regarding the effect of interface disorder on phonon transport across single interfaces and SLs34. We attribute the crossover to the transition from incoherent-phonon-dominated heat conduction regime to coherent-phonon-dominated one when NP increases. Coherent phonons are formed due to the constructive interference between the incident and reflected phonon waves at multiple, parallel interfaces. For single interfaces and SLs with few periods, incoherent phonon dominates heat transfer because no or few phonon interferences can happen due to the limited number of interfaces. In these structures, incoherent phonon transport across each individual interface can be enhanced by interface species mixing through the phonon \u201cbridge\u201d mechanism36. As shown in Fig.\u00a0R of the SL is increased.In Fig.\u00a021. Accordingly, incoherent phonons dominate heat conduction in RMLs. Figure\u00a0R of rough RMLs is always lower than that of the corresponding perfect RMLs. Similar to the cases of single interfaces and few-period SLs, the reduced R is also caused by the phonon \u201cbridge\u201d effect discussed above.Different from SLs, coherent phonons are localized in RMLs owing to the random layer thicknessd\u2009=\u20098 UC, Fig.\u00a0R of perfect SLs and rough ones at NP\u2009=\u20092. For RMLs with d\u2009=\u20098 UC, however, the difference between perfect and rough ones is rather trivial, as displayed in Fig.\u00a0R for RMLs with relatively thick layers (d\u2009=\u20098 UC); thus interface species mixing cannot have a significant impact on the overall R even though it reduces TBR. Moreover, as discussed in ref. R of the SL. Therefore, it can be expected that interface species mixing does not affect the overall R of long-period SLs significantly.For SLs with \u03bal of SLs and RMLs with NP up to 128 for d\u2009=\u20092 UC cases and up to 64 for d\u2009=\u20098 UC cases. As we can see in Fig.\u00a0\u03bal of rough SLs is higher than that of rough RMLs when the structures contain many layers (NP\u2009=\u2009128 for d\u2009=\u20092 UC and NP\u2009\u2265\u200924 for d\u2009=\u20098 UC). The reason is that even though interface species mixing breaks phonon coherence significantly, there can still be a certain amount of coherent phonons surviving in rough SLs, while they are localized in rough RMLs. Therefore, rough SLs can have a higher \u03bal than rough RMLs. However, the \u03bal of rough RMLs with d\u2009=\u20092 UC is higher than that of the corresponding rough SLs for NP\u2009=\u200916 and NP\u2009=\u200924. This is because there are many layers containing only 1-UC-thick m40 or m90 layers, while interface species mixing effectively convert the whole 1-UC-thick layer into alloy. As a result, several such layers can sometimes connect as one continuous alloy layer rather than individual m40 or m90 layers, which reduces the number of interfaces in the RML. Consequently, the \u03bal of such rough RMLs might be higher than that of the corresponding SL, which always have distinct interfaces between layers.We also compare the \u03bal. The above results also suggest that strategies that can hinder the transport of short-wavelength incoherent phonons can further reduce the \u03bal of RMLs. This leads us to investigate the effect of impurities (point defects) on the \u03bal of RMLs, which is well-known to scatter short-wavelength phonons effectively.Based on the above analysis, we can conclude that for RMLs with short average layer thickness, it is beneficial to make the interfaces as smooth as possible, which helps to minimize the In this section, we investigate the thermal transport in RMLs doped with impurities in the form of point defects. Specifically, we simulate RMLs composed of m40 layers and m90 layers, both doped with 10% foreign atoms randomly. The dopant has an atomic mass of 22.5\u2009g/mol, 60.0\u2009g/mol, and 160.0\u2009g/mol, which will be referred to as m22.5, m60, and m160, respectively. These atoms interact with m40 and m90 atoms based on the same Lennard-Jones potential described in the Methodology section of this manuscript. We also simulate binary random alloy, which is composed of randomly mixed 50% m40 and 50% m90 atoms.\u03bal of binary random alloys is generally higher than that of perfect RMLs with d\u2009=\u20092 UC, while it is lower than that of perfect RMLs with d\u2009=\u20098 UC. The problem with binary random alloy is that even though short-wavelength phonons are scattered strongly, long-wavelength phonons can travel a long distance in the alloy and thus carry a considerable amount of heat37. In contrast, short-period RMLs can scatter short-wavelength incoherent phonons strongly by the interfaces and localize long-wavelength coherent phonons effectively by the random layer thickness, which can lead to a lower \u03bal than binary random alloys with the same composition. We can also see that adding m22.5 and m160 reduces the \u03bal of RMLs in all cases simulated in this work. In particular, m160-doping can reduce the \u03bal of RMLs by up to 33% and 53% for RMLs with d\u2009=\u20092 UC and d\u2009=\u20098 UC, respectively. It is reasonable because the short-wavelength incoherent phonons are scattered by these impurities owing to the mass-difference scattering mechanism and the bulk thermal resistance of each layer increases. Nonetheless, adding m60 atoms causes an increase in \u03bal for short-period RMLs (d\u2009=\u20092 UC), which is unwanted for thermoelectric applications.As shown in Fig.\u00a0\u03bal of RMLs, we simulate a series of RMLs doped with impurities of an atomic mass varying from mim\u2009=\u200910\u2009g/mol to mim\u2009=\u2009160\u2009g/mol. Specifically, 10% of the atoms in the pure RML lattice are randomly selected and their atomic mass is changed to mim. In this way, we can isolate the effect of the atomic mass of the dopants from the effect of the location of doping sites. As we can see in Fig.\u00a0\u03bal of doped RMLs with respect to that of pure ones, \u03bal increases with mim first and decreases thereafter. The maximum \u03bal occurs at mim\u2009=\u200960\u2009g/mol, which is the geometric average of the atomic mass of the two base materials, i.e., 40\u2009g/mol and 90\u2009g/mol. Moreover, the \u03bal of the doped RML is obviously higher than that of the undoped RML if 40\u2009g/mol\u2009<\u2009mim\u2009<\u200990\u2009g/mol. We find that the increase in \u03bal of RMLs is caused by the reduction in the TBR of interfaces. The dark triangles in Fig.\u00a0\u03bal of the RML. In contrast, in RMLs with large d, the bulk thermal resistance of layers dominates the overall heat transfer. Since the dopants scatter incoherent phonons, which increases the bulk thermal resistance of layers, the overall \u03bal is reduced by doping.To comprehensively understand the effect of the weight of dopants on the S using the approach defined in previous work38. In particular, S varies between 0 for completely non-overlapping phonon spectra and 1 for perfect overlap. Agreeing with the change in TBR, we find that S is significantly increased from 0.57 for undoped RML to 0.67 by m60-doping. The increase in S is expected to facilitate phonon transport across the interface owing to the phonon \u201cbridge\u201d mechanism discussed above.To further understand the above observations, we analyze the vDOS of m40 layers and m90 layers in a perfect RML and the vDOS of a m40\u2013m90 RML doped with 10% m60 atoms. The upper panel of Fig.\u00a0\u03bal of m60-doped RMLs is higher than that of undoped RMLs for d\u2009=\u20092 UC, m60-doping can still reduce incoherent phonon transport within each individual m40 and m90 layer, similar to m22.5 and m160. However, since m60-doping causes a more significant reduction in TBR than the increase in phonon scattering inside the layers, the overall \u03bal of the RML still increases. To avoid this, we recommend doping with impurities lighter than the lightest or heavier than the heaviest element of the original RML. In this way, no significant phonon \u201cbridge\u201d effect will occur. Moreover, the \u03b1\u2009=\u200910% impurity concentration already makes the TE material very heavily doped. In most cases, \u03b1 is lower than 10%, which, as we can expect, will lead to less scattering of incoherent phonons. As a result, the \u03bal of the RML will increase.It is worth mentioning that even though the \u03bal of RMLs, because the mixed interfacial region has an intermediate phonon vDOS between the adjacent layers and thus facilitates phonon transport across the interface through the phonon \u201cbridge\u201d effect. We also observed that the \u03bal of rough SL is usually higher than that of the corresponding rough RML. This is because interface disorder does not kill all the phonon coherence and the remaining coherent phonons lead to a higher \u03bal of rough SLs than that of rough RMLs. Moreover, we investigated the dependence of total thermal resistance R on the number of periods in SLs with smooth and rough interfaces. We revealed that interface roughness reduces the thermal resistance of a single interface or SLs with few periods, while it increases the thermal resistance of SLs containing many periods. The crossover in thermal resistance manifests a transition from incoherent-phonon-dominated heat transfer regime to a coherent-phonon-dominated one. When the SL has few periods, including the case for a single interface, heat conduction is dominated by incoherent phonons, of which the transmission can be enhanced by interface species mixing through the phonon \u201cbridge\u201d effect. In contrast, considerable amount of coherent phonons are formed owing to the interference of reflected and incident phonons at multiple, parallel interfaces in SLs. Interface disorder breaks phonon coherence and thus reduces the \u03bal of SLs significantly. Finally, we studied the effect of impurities on thermal transport in RMLs and found that point defects can substantially reduce \u03bal. However, if the atomic mass of the impurities is between that of the two base materials, \u03bal may be increased for RMLs with a short average layer thickness, which is ascribed to a reduction in TBR. This work revealed a novel strategy to hierarchically suppress both coherent and incoherent phonon transport in multilayered structures, which can aid the design of nanostructures with ultralow lattice thermal conductivity.In summary, we conducted nonequilibrium molecular dynamics simulations to investigate phonon transport in random multilayer structures containing lattice imperfections. We found that interface species mixing can increase the"}
+{"text": "The main obstacle preventing clinical applications of HDAd vectors is the host innate inflammatory response against the vector capsid proteins that occurs shortly after intravascular vector administration and result in acute toxicity, the severity of which is dose dependent. Intense efforts have been focused on elucidating adenoviral vector\u2013host interactions and the factors involved in the acute toxicity. This review focuses on the recent acquisition of data on such interactions and on strategies investigated to improve the therapeutic index of HDAd vectors.Helper-dependent adenoviral (HDAd) vectors that are devoid of all viral coding sequences are promising non-integrating vectors for gene therapy because they efficiently transduce a variety of cell types  Adenoviruses (Ad) are the most commonly used vectors in human clinical trials and approximately 75% of these trials are directed to cancer treatment . Replicacis for viral DNA replication. A cis-acting packaging signal, required for encapsidation of the genome, is located near the left ITR. The Ad genome can be roughly divided into two sets of genes: the early region genes  that are expressed before DNA replication and the late region genes (L1 to L5) that are expressed to high levels after DNA replication. First generation Ad (FGAd) vectors typically have foreign DNA inserted in place of early region 1 (E1). E1-deleted vectors are replication deficient and are propagated in E1 complementing cells such as 293 [in vivo because of acute and chronic toxicity secondary to low levels of viral gene expression from the vector backbone [Ad have a non-enveloped icosahedral capsid containing a linear double-stranded DNA genome of ~30\u201340 kb. Up to now, at least 55 different human Ad (species A\u2013G) have been reported and they are generally associated in immunocompetent patients with subclinical or self-limiting diseases of the airways, eyes, and gastrointestinal tract. Ad vectors most commonly used for clinical trials and experimental gene therapy applications, including helper-dependent adenoviral (HDAd) vectors, are derived from serotypes 2 (Ad2) and 5 (Ad5) of subgroup C . Moreover, the liver is a very attractive target for gene therapy because it is the affected organ in several genetic and acquired diseases and it can be used as a factory organ for systemic delivery through the circulation of vector-encoded therapeutic proteins. Inherited liver diseases are logical disease targets but several studies have also uncovered the opportunity to treat non-Mendelian diseases by liver-directed gene therapy. Expressing specific genes into hepatocytes can induce immune tolerance towards antigens that may be exploited for treatment of the deleterious consequences of immune response  or autoimmune disorders ,19,20. FSeveral examples of liver-directed gene therapy using HDAd in monogenic disease animal models have clearly shown long term transgene expression and phenotypic correction in the absence of chronic toxicity, thus supporting the potential of HDAd for clinical applications ,23,24,25The activation of the acute inflammatory response by systemic Ad injection is multifactorial and is observed in both rodents and nonhuman primates given comparable (on a per kg basis) systemic high doses of Ad vectors. However, mice are much more tolerant than nonhuman primates to high vector doses ,35,40. Dv integrins) [in vitro infection, it does not apply to in vivo infection, at least in the liver. Ad5-mediated hepatocyte transduction occurs independently of viral association with CAR and integrins [in vivo: mutations in the hexon protein or FX ablation by warfarin treatment [In recent years, new and important knowledge has been gained on Ad-host interactions and their role in activation of the innate immunity. According to the early model of the 1990s, Ad5 infection is dependent upon receptors for attachment  and entry (\u03b1tegrins) ,42,43. Wntegrins ,45. Follntegrins ,47,48,49ntegrins   ,76,77,78The observation that administration of polyinosine, as well as other polyanionic ligands, into mice prior to Ad intravenous injection drastically reduces Ad accumulation in Kupffer cells and increases hepatocyte gene transfer ,80, has The presence of endothelium fenestrations in the liver permits transduction of hepatocytes by Ad vectors whereas other tissues that lack such fenestrations are poorly transduced ,85. Neveex vivo [Systemic administration of high doses of Ad vectors likely results in widespread transduction of a large number of various extrahepatic cell types  which are also important barriers to efficient hepatocyte transduction. Over 90% of Ad vectors bind to human erythrocytes ex vivo  through ex vivo , in nonhex vivo ,91, and ex vivo .Given the potential of HDAd vectors for gene therapy, several groups have investigated various strategies to overcome the obstacle of acute toxicity. Because the severity of the acute response is dose-dependent and appears to correlate with extrahepatic systemic vector dissemination, one of these strategies aimed at targeting the vector to the liver thereby allowing the use of lower vector doses. This has been accomplished using physical approaches aiming at preferential hepatocyte transduction. One such strategy was to deliver the HDAd into surgically isolated livers to limit systemic exposure and resulted in greater hepatocyte transduction compared to intravenous injection and no chronic toxicity in nonhuman primates . A folloTo overcome the limitations due to the invasiveness of the surgical delivery method, a minimally invasive, percutaneous balloon occlusion catheter-based method was then developed to achieve preferential hepatocyte transduction. In this method, a sausage-shaped balloon is inflated in the inferior vena cava to occlude the hepatic venous outflow and the HDAd is injected directly into the liver via the hepatic artery. This vector delivery method resulted in high levels of transgene expression compared to peripheral intravenous injection in nonhuman primates using clinically relevant low doses ,29. FurtIn another approach, effective dose reduction was achieved by direct injections of HDAd into the liver parenchyma that resulted in improved efficacy and reduced toxicity. Direct vector injections into liver parenchyma is a relatively simple and flexible technique that is similar to the procedure accomplished routinely for liver biopsies and is performed in humans for treatment of hepatic metastases . HoweverKupffer cell depletion by pre-treatment with gadolinium chloride, dichloromethylene biphosponate, or clodronate lyposomes prior to vector injection result in enhanced hepatocyte transduction ,100,101,Genetic or chemical modifications or a combination of these changes to the viral capsid is another strategy that has been investigated to evade Kupffer cell uptake. Given that Ad-Kupffer cell interaction is mediated by the hypervariable loops of the virus hexon protein, Ad vectors have been genetically modified to disrupt such interactions. A chimeric vector in which the hypervariable region of Ad5 is replaced with that of Ad6 showed reduced Kupffer cell uptake, higher levels of liver transduction, and reduced hepatotoxicity compared to Ad5 vector . The hypIn addition, \u201cmasking\u201d the viral capsid has also been reported to attenuate the severity of the innate inflammatory response. Systemic administration of non-specific PEGylated Ad into mice resulted in 50%\u201370% reduction of serum IL-6 compared to unPEGylated vector without compromising hepatic transduction ,110,111.11 vp/kg of a HDAd expressing factor VIII (FVIII) [There was a single case of intravascular administration of an HDAd vector into a human patient; however, this study has not been published in a peer-reviewed format and much of the details are not available. From what is known, a hemophilia A patient received by intravenous injection 4.3 \u00d7 10 (FVIII) . This su (FVIII) . ex vivo clinical trial to treat anemia in patients with chronic kidney failure [ex vivo with an HDAd expressing erythropoietin (EPO), and implanted under local anesthesia in the subcutaneous tissue in an autologous manner. To achieve the pre-determined blood levels of EPO, a precise number of HDAd transduced cells was implanted. There were no adverse events in this trial and hemoglobin levels were sustained for up to one year after a single treatment with the HDAd transduced cells [HDAd has recently been used in an  failure . In thised cells . This trHDAd are attractive vectors for gene therapy particularly given their ability to drive long-term transgene expression with no chronic toxicity and with low risk of insertional carcinogenesis. To date, in small and large models, including nonhuman primates, HDAd transduced hepatocytes  are not eliminated by the immune system and result in multi-year transgene expression. Nevertheless, whether this holds true for humans is not known at the present time, particularly in consideration of the outcomes of the AAV clinical trials for hemophilia B that resulted in a CTL immune response against AAV-transduced hepatocytes ,116.The dose-dependent activation of the innate inflammatory response by viral capsids remains an important concern for those applications requiring systemic intravenous injection of high vector dose to achieve clinically relevant benefits. A significant amount of data on vector biodistribution, toxicity, and efficacy has been generated through studies performed in small animal models and clearly these studies have led to increased knowledge in the field. However, the translational relevance of several of these findings requires further validation in larger animal models that more closely predict human outcomes. The multitude of host factors interacting with Ad particles has highlighted a series of unforeseen and intriguing mechanisms that illustrate the complexity of Ad vector-host interactions. Importantly, these studies have identified potential molecules that could be targeted to avoid vector scavenging and degradation by macrophages with the goal of achieving efficient gene transfer to hepatocytes or tumors. Pharmacological approaches directed towards these targets in combination with advancements in vector targeting or de-targeting, or with physical methods, such as balloon catheter-assisted delivery, would result in more efficient and safer gene delivery with potential for clinical applications."}
+{"text": "It often takes considerable time for sufficient evidence to accumulate to support implementation of new methods in routine screening. Where national screening programmes are already effective, switching to a more sensitive screening test may not be a priority. Although risk associated with overly rapid implementation exists, postponement is also associated with a (to date unquantified) missed opportunity to prevent deaths. This risk tends not to be addressed where effective screening methods are already in use. We here estimate the monetary value of a one-year delay in replacing cytology cervical screening with human papillomavirus testing.Using a previously validated model, we calculated the number of incident and fatal cervical cancers that would be diagnosed by 2030 in England, under the assumption that human papillomavirus testing replaces cytology in 2020 rather than 2019, and the monetary value of the quality-adjusted life years lost in preventable cases.A one-year delay in the implementation of human papillomavirus screening would miss the opportunity to prevent 581 cases of cervical cancer, and lead to a loss of 1595 quality-adjusted life years (3.5% discount rate) with a monetary value of \u00a332 million .This is a measurable loss and should be considered in prioritising decision-making in screening. HPV was first associated with cervical cancer in 1983,8 and Turkey from 2014.9 By contrast, the pace in the European Union has been considerably slower, with HPV screening guidelines only being published in 2015.10 In the Netherlands, the Health Council announced its support for HPV-based screening in 2011 and the Ministry of Health made the decision to implement in 2013, but the full implementation was delayed from the initial plan in 2016 until early 2017. Denmark recommended HPV testing for primary screening in 2012 for women aged 60\u201365, but the test was not rolled out nationally until late 2014; in 2018, it was announced that the roll-out to women aged 30\u201359 will begin in 2019. Sweden made the decision to replace cytology with HPV testing for women aged 30 and above in 2015, with a gradual rollout starting in 2017. In Italy, HPV screening was recommended in 2013 and the rollout should be completed by 2018.11The United States led the way in introducing HPV-based screening as an adjunct to cytology  in the mid-2000s. Countries where call/recall cervical screening programmes had yet to be established implemented HPV primary screening soon after, for example, Mexico from 200812 and the cancer outcomes strategy for England13 recommended national rollout by 2020. Six English sites have been piloting HPV primary screening since 2013 on approximately 13% of the screened population, with the intention of a future national rollout. Public Health England and the National Health Service (NHS), who are responsible for the screening programme in England, have until recently aimed to switch-over in April 2019,14 but are now working towards a December 2019 deadline.In England, cervical screening is currently offered through a cytology-based call/recall programme three-yearly to women aged 25\u201349, and five-yearly to women aged 50\u201364. HPV testing is reserved for triage of equivocal cytology samples and follow-up after treatment of high-grade disease. In January 2016, the National Screening Committee recommended that HPV primary testing be adopted in the United Kingdom15 Consequently, cervical cancer is rare among screened women, and it may be presumed that short delays in replacing cytology with HPV testing will have negligible consequences.Where national screening programmes are already extremely effective, switching to a more sensitive screening test may not be perceived as urgent. The cytology-based UK screening programme is highly effective in identifying and treating pre-invasive cervical lesions.We estimated the excess number of screened women who will develop cervical cancer and the associated lost quality-adjusted life years (QALYs) under a scenario where the introduction of HPV screening is postponed by one year, while cytology-based screening continues.17 Separately, we estimated the proportion of cancers that would have been prevented by HPV testing by using data from a population-based case\u2013control study.15 In both steps, we assumed that age-specific screening-coverage remains as in 2014/15  . We tack 2014/15 .1815 to estimate (by age group and FIGO stage) the proportion of women with a negative cytology test prior to diagnosis. We excluded cancers diagnosed within 18 months of a negative test because, for these cancers, it is probably too late to prevent the cancer by treating pre-invasive disease. However, we included cancers diagnosed up to and including 1.5 years after the next screen   of additional cancers would be prevented by primary HPV testing. To take this into account, we multiplied the (age- and FIGO stage-specific) proportions of women with negative cytology by 0.632 , women will benefit if they are HPV positive but cytology negative; instead of receiving a three/five-year interval, they are re-called earlier and treated, if necessary. We used screening histories from the case\u2013control study screen) . Not allby 0.632 . Full me16 Ten-year cervical cancer relative survival20 is only slightly lower than the five-year survival, and so for fatal cases we assumed that, on average, women survive 2.5 years, and that survivors have the same remaining life expectancy as the general population.Age- and stage-specific five-year case fatality rates were taken from published literature.A QALY is a generic measure of disease burden, including both the quality and the quantity of life lived. Institutions such as the National Institute for Health and Care Excellence (NICE) use this indicator of health benefit to compare various health interventions, and typically only recommend treatments if their cost per QALY is less than \u00a320,000\u2013\u00a330,000. With this method, we estimated the monetary value of a timely HPV screening implementation, using England as an example. We did not attempt to quantify the risk associated with overly rapid implementation, but rather to calculate the benefits of early adoption.25 Finally, the discounted QALYs were multiplied by NICE\u2019s lower threshold incremental cost-effectiveness ratio, \u00a320,000.25The assumptions underlying the women\u2019s life expectancy, the estimation of lost QALYs and its monetary value resulting from failing to prevent cervical cancer were all based on published parameters . The tot26 We estimate that by 2030, 581 more cases could be prevented by introducing primary HPV testing in December 2019 rather than December 2020. Of these 581 cancers, 60% would have been diagnosed under age 50, and three-quarters at FIGO stage 1  is between \u00a332 and 46 million, depending on discounting, over the women\u2019s expected life spans. This means that, for every month the implementation is postponed, 48 additional women will be diagnosed with cervical cancer, at an estimated value of \u00a32.7\u20133.8 million in terms of QALYs.We have deliberately used conservative assumptions in our analysis. We assumed that all women who survive the first five years after cancer diagnosis will have normal life spans, and we have not taken into account the particularly severe QALY detriments during palliative care. The loss of quality of life among survivors was considered life-long, and therefore more affected by discounting, and we used the lower incremental cost-effectiveness threshold recommended by NICE.27 We have not attempted to estimate the cost to the health service of implementing change more rapidly. These and other considerations are discussed in online Appendix 3.Although these estimates are specific to England, they are informative for other countries. In fact, the opportunity cost of postponing HPV-based screening may be even greater in countries with less rigorous quality assurance and lower sensitivity of cytology than England.Making a change as profound as switching to a different screening test in a successful screening programme is no small task. The first challenge is obtaining official backing to implement a new screening test . Once this is obtained, there is a risk that it could need to be reverted, causing reputational damage and sunk costs. In the case of HPV screening, this scenario is unlikely. The second challenge is preparing for the roll-out, during which aspects such as changes in laboratory organisation, contracting, staffing, quality assurance and, not least, revised management guidelines, all need to be considered, and this takes time. Reducing the time devoted to planning and preparing a roll-out to ensure earlier implementation could jeopardise the quality of the service, so realistic timescales and appropriate upfront investment are key to timely implementation of any new public health intervention. A multitude of factors can negatively affect the process. Evidence from organised screening programmes in Europe and elsewhere demonstrate that, even after the new policy has been agreed, a timely implementation thereafter is not guaranteed, and implementation delays experienced elsewhere can offer instructive examples.28 Similarly, the existing screening databases in England are unable to cope with the impending changes. In 2015 Capita, an FTSE 100 outsourcer began a \u00a31bn contract to supply administrative support to NHS England. This contract included a redevelopment of the primary care support services (PCS) database, which handles several primary care services, including GP payments and screening call/recall. Capita\u2019s original commitment was to introduce a standardised national screening database by June 2017.29 The complexities of the call/recall part of the PCS database were poorly specified, and there have been a number of complications. It is currently unclear when the database is expected to be ready for testing. Other countries could potentially avoid delays by considering computer systems that are purpose-built for screening.30 These could offer a platform that can more readily overcome the complexities of screening data, while still allowing a degree of individual tailoring.Population-based call/recall databases underpin the running of organised screening programmes. Australia recently commissioned a single National Cancer Screening Register, with the objective of bringing together a number of existing databases. However, developing and implementing a screening registry solution, and the migration of existing databases, were more complex than expected, and this postponed the implementation date of HPV screening from May to December 2017. As a result, additional investment from the Government was needed to ensure continuation of cytology screening and staff retention.31 In 2015, however, this process was almost halted because of a media scandal due to incomplete disclosure of potential conflicts of interest of one of the country\u2019s leading HPV researchers. In addition, the Netherlands opted for centralised procurement of a single HPV assay, and then faced lengthy legal battles with the unsuccessful competitors. Consequently, implementation was delayed until early 2017.It is often unpredictable external factors that derail the implementation process, even when it is reasonably well planned. The Netherlands was the first European country to announce its intention to implement HPV-based screening, with the process of change organised across several years and planned in detail.26 This has been attributed to the increasing difficulty in maintaining staff numbers because cyto-screening is no longer an attractive or secure profession.Announcing a profound change in policy can have unexpected consequences. In England, for example, uncertainty around laboratory configuration once HPV primary screening is implemented has begun affecting the cytology screening programme. Since the laboratories began reorganising in 2012 to support the use of HPV testing for triage of low-grade abnormal cytology and test of cure, the proportion of women who receive their screening test result within two weeks (one of the key performance indicators) has fallen from the target 98% in 2012/13 to 71.6% in 2016/17.32 which should be cost saving to the NHS. At present, screening programme and treatment costs amount to \u00a3157 million per year.33 It is expected that the cost of 6 and 10-yearly HPV-based screening would be about half that of 3 and 5-yearly cytology-based screening, leading to an additional direct saving of \u223c\u00a375 million per year (or \u223c\u00a3500 million over seven years).The benefits as well as the risks of more rapid implementation of innovations of proven efficacy should be formally evaluated at the beginning of the process. With such planning, countries could have allowed pilots of primary HPV testing for cervical screening to have been set up in 2007, with national rollout five years later, by 2012. In England, had rollout happened seven years earlier than it is now planned, by 2030 some 4000 fewer women would experience cervical cancer, leading to a QALY gain with a value of at least \u00a3224 million. In the case of HPV primary testing, this loss is even more troublesome, because screening can be done just as safely at longer intervals,While careful planning is essential, sometimes there is a heavy price to pay for being overcautious.Click here for additional data file.Supplemental material, MSC800355 Supplemental material for Is a delay in the introduction of human papillomavirus-based cervical screening affordable? by Alejandra Casta\u00f1on, Matejka Rebolj and Peter Sasieni in Journal of Medical Screening"}
+{"text": "The Control group was provided with a pedometer but did not have access to the online program. Three-factor repeated measures ANOVAs indicated that there were improvements in physical fitness (p < 0.01), systolic blood pressure (p < 0.01), diastolic blood pressure (p < 0.01), waist girth (p < 0.01), mental health (p < 0.05), social functioning (p < 0.01), and general health (p < 0.01), but an increase in bodily pain (p < 0.01), from the baseline to week 12 and the three-month follow-up, irrespective of group allocation. Pedometer interventions, delivered with or without online support and step goal setting, show promise for improving the overall health of cancer survivors, at least in the short term.Cancer survivors are at an increased risk of experiencing physical and psychological ill-effects following cancer treatment. Rural cancer survivors are at a greater risk of future health problems following a cancer diagnosis compared to their urban counterparts. Physical activity has been targeted as a health promotion priority in cancer survivors. Research indicates that a large portion of cancer survivors do not meet physical activity recommendations. The purpose of this quasi-randomized controlled trial was to test the effectiveness of an online 12-week walking intervention designed for cancer survivors, and to explore its impact on physical health indicators and quality of life outcomes. Steps Toward Improving Diet and Exercise among cancer survivors (STRIDE) is an online resource designed according to Social Cognitive Theory and Self Determination Theory, based on individualized step goal setting. Measures of physiology, physical fitness, and quality of life were taken at the baseline, post-intervention, and three-month follow-up in an Intervention group ( Approximately 40% of the general population will receive a cancer diagnosis . AdvanceCancer survivors often experience adverse side effects including pain  and fatiThis quasi-randomized controlled trial aimed to investigate the effectiveness of an online tool, Steps Toward Improving Diet and Exercise (STRIDE), designed to improve physical activity  among cancer survivors. It was hypothesized that the STRIDE intervention would lead to an improvement in physical health indicators , QOL outcomes , and physical fitness from the baseline to the end of intervention and at the three-month follow-up.Participants were recruited via flyers, cancer support groups, newspaper advertisements, radio presentations, and allied health personnel in metropolitan and rural regions of South Australia. Participants were telephone screened for eligibility and were required to: (a) have had a cancer diagnosis (excluding skin cancer); (b) not be currently receiving active treatment such as surgery, chemotherapy, or radiotherapy; (c) be insufficiently active, defined as engaging in less than 20 sessions of exercise over the past month (one session is 30 min duration) ; (d) notThe STRIDE study was a quasi-randomized controlled intervention trial. Details of the protocol have been previously published . Cancer Eligible volunteers were provided with further study information, a consent form, and pre-exercise screening form, and were asked to obtain medical clearance from their treating doctor using a standardized medical clearance form. Pre-exercise screening was conducted using Stage 1 of the Sports Medicine Australia Pre-Exercise Screening System . The firA block design with an allocation weight of 3:3 was used to generate treatment allocation. According to the PEDro scale , this stThis study received ethical approval from the University of South Australia Human Research Ethics Committee prior to study commencement (Ref. 0000031039) and was registered with the Australian New Zealand Clinical Trials Registry .All participants (intervention and control groups) attended two baseline workshops, one week apart. Each workshop lasted approximately 90 min. At the first workshop, health measures were taken  and fitness was assessed using the six-min walk test (6MWT) . ParticiAt workshop two, all participants (intervention and control groups) were provided with lifestyle information and a pedometer . Only those in the intervention group were instructed on using the STRIDE website, including how to log their steps and other relevant data. On the basis of this information, they were emailed daily step goals that they were encouraged to achieve. Following the 12 weeks of the intervention period, all measures were repeated, and again after six months . At the conclusion of six months, the control group was offered the STRIDE program.The STRIDE program comprises two main components, the STRIDE website and weekly step goals. Participants used a pedometer to monitor the number of steps taken each day and recorded this information on the step log on the STRIDE website. Participants reported their Rating of Perceived Exertion (RPE) during walking and their daily affect. The step log included a graph of average weekly steps as feedback on progress during the intervention. An online forum provided an opportunity for participants to share experiences and offer peer support. A virtual noticeboard allowed community centers, health providers, and walking groups to advertise activities and events. The website included healthy eating information through the Cancer Council Australia\u2019s nutrition guidelines, based on recommendations in The Australian Guide to Healthy Eating .Personalized step targets were created using individuals\u2019 RPE and affect in combination with logged daily steps. RPE was determined using Borg\u2019s 6\u201320 Ratings of Perceived Exertion scale ,26 that Outcome measures were assessed at three time points: baseline, week 12 (end of intervention), and at a three-month follow-up.Participants wore a sealed pedometer for seven consecutive days (five week days and two weekend days). Minimum wear time, as recorded by a log sheet, was defined as 10 h per day (based on previous literature)  for fourThe following anthropometric measures were taken: standing stretch stature using a portable stadiometer ; body weight ; and waist and hip girths . All physical measurements were taken according to the International Society for the Advancement of Kinanthropometry . All antResting blood pressure was measured using automated sphygmomanometers  after participants had been seated for five minutes. Unless contraindicated, blood pressure was taken on the left arm, with the middle of the cuff on the upper arm at the level of the right atrium. A range of cuff sizes was available to suit participants\u2019 arm circumference. Measures were repeated until there were two readings within 5 mmHg for both systolic and diastolic pressure, up to a maximum of four times.The 6MWT is a valid, responsive, interpretable self-paced test that quantifies functional exercise capacity as the distance walked in six minutes . The tesFunctional status and QOL were measured using the Australian adaptation of the \u2018Short Form 36) Health Survey\u2019 (SF-36v2) ,36. The  Health SWhere necessary, scales were reverse-scored so that a higher score indicates better health . The SF-36 has been used in other studies of lifestyle interventions among cancer survivors and in self-management interventions in chronic disease . ConsistThe SF-36 data were scored using the \u2018RAND-36 Health Survey\u2019 scoring key . This inSocio-demographic variables were assessed by a self-report questionnaire: age, ethnicity, location , marital status , level of education , employment status , and smoking status . Details on cancer type, cancer stage at diagnosis, and treatment type(s) were collected at the baseline.t-tests. Assumptions of sphericity in an analysis of variance (ANOVA) with repeated measures were tested using Mauchly\u2019s test, and, if violated, the Greenhouse-Geisser correction was used.Data were analyzed using SPSS . The per-protocol analysis was applied and the significance level was set at 0.05. Baseline comparisons of treatment groups based on demographic characteristics were performed using independent Three-factor  by time  by region  ANOVA with repeated measures on time was used to examine the hypothesized effect of the intervention on outcome variables: fitness, BMI, waist girth, blood pressure, and QOL. Condition  by time repeated measures ANOVA was used to examine differences in these outcomes between the intervention and control groups over time. All models were controlled for marital status, level of education, employment status, and smoking status.The socio-demographic, health, cancer-specific, and comorbidity profiles of the intervention and control participants are presented in Internal reliability of the eight domains from the SF-36v2 in this sample was tested using Cronbach\u2019s \u03b1. The reliability was considered to be adequate if the \u03b1 value was >0.70 . The CroOn average, participants logged onto the website a total of 53 times over the 12-week program. This equates to an average of 4.4 times per week. Metropolitan participants logged onto the website more frequently (average of five times per week) compared to rural participants (average of three times per week).The time by region interaction term did not reach significance in any of the models and was consequently removed. There were no significant region main effects.The means and standard deviations and effects  are tabulated below . Where tp < 0.01, \u03b7p2 = 0.14), with meters walked increasing from the baseline (522.6 \u00b1 78.7 m) to week 12 (537.2 \u00b1 89.7 m) and the three-month follow-up (546.6 \u00b1 94.1 m). The time by condition interaction approached significance  = 2.65, p = 0.08, \u03b7p2 = 0.33). This appears to be due to the increase in distance walked from the baseline to week 12 in the intervention group.Blood pressurep < 0.01, \u03b7p2 < 0.14), with systolic blood pressure decreasing from the baseline (139.24 \u00b1 17.9) to week 12 (133.81 \u00b1 18.02) and three months post-intervention (131.21 \u00b1 16.04). An ANOVA with repeated measures on time with diastolic blood pressure resulted in a significant time main effect  = 11.5, p < 0.01, \u03b7p2 < 0.13), with diastolic blood pressure decreasing from the baseline (80.53 \u00b1 10.21) to week 12 (78.33 \u00b1 10.85) and three months post-intervention (76.24 \u00b1 10.59).As systolic and diastolic blood pressure are likely to be related, a three-way ANOVA was conducted to test if there was a condition effect on systolic and diastolic blood pressure over time. The ANOVA revealed no significant time by condition interaction or condition main effects. An ANOVA with repeated measures on time for systolic blood pressure resulted in a significant time main effect  = 13.3, BMIAn ANOVA with repeated measures on time resulted in no significant time main effect, condition main effect, or time by condition interaction.Waist girthp < 0.01, \u03b7p2 < 0.08), with waist girth decreasing from the baseline (98.62 \u00b1 13.12) to week 12 (97.58 \u00b1 13.32). This appears to be due to a significant decrease in waist girth measurement from the baseline to 12 weeks in both groups. Waist girth measures returned to baseline values at the three-month follow-up in both groups. There was no significant condition main effect or time by condition interaction.The ANOVA with repeated measures on time resulted in a significant time main effect  = 6.47, p < 0.01, \u03b7p2 < 0.39), with bodily pain increasing from the baseline (37.96 \u00b1 18.62) to week 12 (62.46 \u00b1 19.31) and the three-month follow-up (66.01 \u00b1 19.84); general health  = 42.1, p < 0.01, \u03b7p2 < 0.35), with general health increasing from the baseline (52.04 \u00b1 10.86) to week 12 (68.40 \u00b1 16.02) and the three-month follow-up (68.33 \u00b1 16.55); social functioning  = 23.3, p < 0.01, \u03b7p2 < 0.23), with social functioning increasing from the baseline (66.72 \u00b1 16.46) to week 12 (79.77 \u00b1 22.39) and the three-month follow-up (82.59 \u00b1 19.11); and mental health  = 4.25, p < 0.05, \u03b7p2 < 0.05), with mental health increasing from the baseline (66.33 \u00b1 7.43) to week 12 (71.26 \u00b1 12.29) and the three-month follow-up (69.14 \u00b1 14.80). There was a significant time by condition interaction for role emotional  = 3.07, p < 0.05, \u03b7p2 < 0.04), which appears to be due to a significant decrease in the intervention group from week 12 to the three-month follow-up and a significant increase in the control group from week 12 to the three-month follow-up.There was a significant time main effect, with no time by condition interaction effect, for: bodily pain  = 48.9, The current study aimed to test the effects of an interactive online walking promotion tool on health status among cancer survivors, and to compare these effects between metropolitan and rural participants. For all measured variables, there were no differences in responses by region, suggesting that the strategy has the potential to narrow the gap in health status that is evident between metropolitan and rural cancer survivors ,15. For There were significant time main effects for bodily pain, general health, social functioning, and mental health. For role emotional, there was a condition main effect and a time by condition interaction. Higher scores on the SF-36v2 represent better health and lower scores represent more disability. This means that the intervention group experienced more limitations due to emotional problems and the control group experienced fewer limitations due to emotional problems at week 12. As physical activity has been associated with an improved emotional state , and impThe main effect of bodily pain, with bodily pain increasing from the baseline to the end of the intervention and follow-up, may be explained by a range of factors, including muscle strain due to the increased walking or weather (arthritis worse in cold weather). Increased bodily pain over time is contrary to findings of other physical activity interventions in cancer survivors that reported improvements in QOL post-intervention ,46,47. ACompared with the baseline, meters walked in the intervention group improved by 4.3% after program completion and by 6.6% at the three-month follow-up. The control group improved by 1.2% after program completion and 1.3% at the three-month follow-up. The changes in the intervention group are quite modest compared with other similar studies. One physical activity study among cancer survivors reported increases of 14% and 17.7% in 6MWT distance in the intervention group at 12 weeks and the three-month follow-up, respectively . SimilarFitness scores in the present study remained high at the three-month follow-up in both groups, while step counts in both groups decreased during this period . A possiA MANOVA revealed no significant time by condition effects for systolic or diastolic blood pressure. ANOVAs revealed that there were time main effects for systolic and diastolic blood pressure, with both blood pressure variables decreasing from the baseline to post-intervention and decreasing further to the three-month follow-up. The intervention group decreased systolic blood pressure by approximately 7 mmHg and the control group by approximately 9 mmHg from the baseline to week 24. The intervention group decreased their diastolic blood pressure by approximately 5 mmHg and the control group by approximately 3 mmHg from the baseline to week 24. The finding of decreased systolic blood pressure is consistent with published meta-analyses of effects of physical activity on blood pressure ,55. ReduThere may be several reasons for the decrease in blood pressure over time. Firstly, it is well-established that regular physical activity lowers blood pressure . The incThis study found no significant change in BMI for the intervention or control groups across time, contrary to other pedometer-based studies. A systematic review of pedometers and physical activity found that pedometer users experienced a reduction in BMI , which wThere was a main effect of waist girth, with waist girth measures decreasing from the baseline to end of intervention, but regressing back to baseline values at the three-month follow-up. Waist girth is strongly associated with cardiovascular disease risk . These fThe results of this study provide further evidence that pedometer interventions can produce favorable outcomes among survivors of mixed cancer types. This is promising for survivors in rural areas, whose barriers to physical activity may include the lack of access to exercise facilities. Devices such as pedometers may be sufficient for improving health outcomes and quality of life in cancer survivors for whom motivation for lifestyle change is already high . This me"}
+{"text": "The patient was a 43-year-old woman with invasive ductal carcinoma in the left breast who was treated with skin-sparing mastectomy. She then underwent total breast reconstruction using a deep inferior epigastric artery perforator (DIEP) flap simultaneously with fat grafting with harvesting from zone IV in the DIEP flap. In the procedure, fat tissue was harvested from zone IV in the DIEP flap using the wet technique with a 3-mm cannula and a 20-mL Luer-Lok syringe under manually generated negative pressure . Fat wasDescribe zone IV in the Hartrampf perfusion zones of the lower abdominal flap.How can zone IV in the DIEP flap be used effectively?How is fat harvested from zone IV in the DIEP flap?What are the advantages and disadvantages of the fat grafting procedure?,The DIEP flap has become an increasingly common autologous reconstructive choice after mastectomy due to its volume, good color and texture, low donor site morbidity, and success rates comparable with those for other flaps.2The natural slope from the low neckline to the upper pole of the breast, which is called the d\u00e9collet\u00e9 line, is sometimes reconstructed by broadly paving the flat distal part of zone III of the DIEP flap. However, we often find that this part cannot be used because of blood flow insufficiency, unless bilateral perforators are included in the DIEP flap. In contrast, the central part of zone III has relatively stable blood flow but is too thick to be used for augmentation of the d\u00e9collet\u00e9 line on the upper chest. Fat grafting is helpful in implant-based breast reconstruction for augmenting the breast volume, improving contour irregularities, and optimizing aesthetic results.-Recently, a few reports have also shown the value of fat grafting in autologous reconstruction.5Breast reconstruction combined with fat grafting is effective for correction of deformities, especially in the d\u00e9collet\u00e9 region after breast reconstruction with an abdominal flap.Fat grafting with harvesting from zone IV in a DIEP flap is an ideal option for cosmetic breast augmentation in patients who wish to achieve moderate, natural enlargement of the d\u00e9collet\u00e9 line on the upper chest."}
+{"text": "The TiO2 NSs with high (001)-exposed facets were prepared via a hydrothermal method, while the TiO2 nanoparticles used the commercial Degussa P-25. It was found that the pore size, specific surface area, porosity, and electron transport properties of TiO2 NSs were generally superior to those of P-25. As a result, the TiO2 NS-based CdS/CdSe QDSSC has exhibited a power conversion efficiency of 4.42%, which corresponds to a 54% improvement in comparison with the P-25-based reference cell. This study provides an effective photoanode design using nanostructure approach to improve the performance of TiO2-based QDSSCs.CdS/CdSe quantum dot-sensitized solar cells (QDSSCs) were fabricated on two types of TiOThe online version of this article (10.1186/s11671-018-2842-5) contains supplementary material, which is available to authorized users. In recent years, quantum dot-sensitized solar cells (QDSSCs) have attracted considerable attention as promising alternatives to dye-sensitized solar cells (DSSCs). The specific advantages of quantum dots (QDs) over organic dyes and Ru-based dyes include larger extinction coefficient, tunable energy bandgap by controlling the dot size and chemical composition, higher photonic and chemical stability, and possibility for multiple exciton generation and hot carrier transfer \u20134. TheorS2\u2212/Sx2\u2212) as the liquid redox electrolyte, and Pt metal as the counter electrode. Many kinds of narrow bandgap semiconductor QDs, such as CdS, CdSe, CdTe, and PbS, have been utilized as light absorbers in the visible light regime [2/CdS [The photoelectric conversion scheme of QDSSCs is similar to that of DSSCs but using inorganic nanocrystals instead of organic dyes as light absorbers. Generally, QDSSCs consist of a QD-coated metal oxide as the photoanode, polysulfide complex  are mostly dominated by the thermodynamically stable (101) facets [In both QDSSCs and DSSCs, TiOtability . It has ) facets . However) facets , which a) facets \u201329. Addi) facets .2 nanostructures with high (001)-exposed facets, including nanosheets (NSs), hollow spheres, and nanotubes [2 NSs with a high percentage of (001)-exposed facets have been proven to exhibit unique surface structure characteristics which potentially lead to performance enhancements in water splitting, photocatalysis, and lithium-ion batteries [2 nanosheet structure in the QDSSCs system [2 NS- and NP-based CdSe/CdS QDSSCs. The TiO2 NSs with high (001)-exposed facets were prepared via a hydrothermal method [2 NPs used the commercial Degussa P-25. We found that the pore size, specific surface area, and porosity of TiO2 NSs were generally superior to those of P-25. The resulting TiO2 NS-based CdSe/CdS QDSSC exhibited an energy conversion efficiency of 4.42%, which is significantly enhanced by up to 54% as compared with the P-25-based reference cell under similar fabrication conditions.Various TiOanotubes \u201334, haveatteries , 35, 36.s system . In thisl method , while t2 NSs with high (001)-exposed facets were synthesized via a hydrothermal method [4, Aldrich, >\u200997%), and the mixture was sealed into a dried Teflon-lined stainless steel autoclave. The synthesis process was then conducted at 180\u2009\u00b0C for 16\u2009h in an electric oven. The resulting TiO2 NS precipitates were collected by centrifugation and washed with deionized water and ethanol several times. Two kinds of screen-printable pastes, the TiO2 NSs and commercial P-25, were prepared by mixing 6\u2009g of TiO2 NSs (or P-25 powder), 20\u2009ml terpineol, and 30\u2009ml 10\u2009wt% ethyl cellulose (EC) in a round-bottomed rotovap flask. After sonicating and concentrating, the resulting 13\u2009wt% homogenous pastes was coated on the fluorine-doped tin oxide (FTO) glass substrates  by screen printing. Finally, the screen-printed TiO2 NSs and P-25 photoanodes were annealed at 500\u2009\u00b0C for 1\u2009h in air to allow good electrical conduction.The anatase TiOl method . Briefly2 NSs, and P-25, were also in situ sensitized with CdS and CdSe QDs using the SILAR and CBD processes, respectively. For the deposition of CdS QDs, two separate precursor solutions were prepared: 20\u2009mM CdCl2 and 20\u2009mM Na2S were dissolved in a mixture of methanol and deionized water  as cation and anion sources, respectively. Both the TiO2 NSs and P-25 photoanodes were first dipped into the Cd2+ precursor solution for 1\u2009min, and then dipped into the S2\u2212 precursor solution for 1\u2009min. Before each immersion, the photoanodes were rinsed with methanol and then dried with N2 flow. These procedures were repeated several cycles to form a suitable CdS QD layer. For the subsequent deposition of CdSe QDs onto the CdS QDs, the TiO2/CdS photoanodes were dipped into an aqueous solution consisting of 2.5\u2009mM Cd(CH3COO)2, 2.5\u2009mM Na2SeSO3 and 75\u2009mM NH4OH. The deposition process was maintained at 70\u2009\u00b0C for 1\u2009h. The loading of the CdSe QDs was controlled by adjusting the number of reaction cycles.The deposition methods of QDs on metal oxides in QDSSCs can be classified into two types: (1) in situ growth via the successive ion-layer absorption and reaction (SILAR) process for CdS QDs and together with the chemical bath deposition (CBD) or chemical vapor deposition process for CdSe QDs; and (2) absorption of preprepared QD colloids via modified ligands. Although the latter method is easier to control the QD size and surface modification, the in situ growth associated with direct contact on the metal oxide method has lower fabrication cost . In this2 based CdS/CdSe QDSSCs were assembled in a conventional sandwich structure. The platinum-coated FTO glass and CdS/CdSe QDs sensitized TiO2 photoanodes were sealed together, separating with a 25\u2009\u03bcm hot-melting polymer spacer (DuPont Surlyn). The polysulfide electrolyte, which consisted of 0.2\u2009M Na2S, 0.2\u2009M\u2009S, and 0.02\u2009M KCl in aqueous solution, was injected into the space between the electrodes. The active area of all QDSSCs was ~\u20090.16\u2009cm2 (~\u20090.4\u2009cm\u2009\u00d7\u20090.4\u2009cm).The various TiO2 photoanodes were estimated by an inductively coupled plasma mass spectrometer . The current-voltage characteristics and electrochemical impedance spectroscopy (EIS) measurements of the photovoltaic cells were performed under simulated one-sun illumination . The incident photon converted to current efficiency (IPCE) was measured by employing a 150-W XQ lamp with a monochromator under the DC mode. The optical absorbance was carried out with a UV-VIS spectrophotometer (Jasco V-670) with a tungsten halogen lamp.All CdS/CdSe QDSSCs were characterized using field emission scanning microscopy , transmission electron microscopy , and glancing incident X-ray diffraction . The loadings of QDs on the various TiO2 NSs with high (001)-exposed facets were prepared as the photoanodes of QDSSCs via a hydrothermal method. Their performances were investigated, discussed, and compared with the commercial nanoporous Degussa P-25 photoanode. The crystal structure and composition of TiO2 NSs were characterized by X-ray diffractometry. As shown in Fig.\u00a02 NSs can be indexed to a pure anatase TiO2 phase with a tetragonal structure and space group I41/amd , with no rutile phase being observed. The (004) and (200) reflection peaks represent the c- and a-axes, respectively. The enhanced sharp (200) peak indicates well-crystallized TiO2 NSs grown along the a-axis. A typical FE-SEM image of P-25 is shown in Fig.\u00a02 NSs are shown in Fig.\u00a02 NS crystal. The lattice spacing of 0.235\u2009nm can be directly observed, which corresponds to the (001) planes of the anatase TiO2 NSs. Analysis of the above results indicates ~\u200970% of TiO2 NSs are comprised of the exposed (001) facets  classification [P/Po) range of 0.75\u20131 belongs to type H3, indicating the presence of slit-like mesopores and macropores. These types of porous structures render a relatively high surface area and large total pore volume. The BET-specific surface area was determined to be ~\u200952.8\u2009cm2\u2009g\u22121, based on the Barrett-Joyner-Halenda (BJH) pore size distribution as shown in the inset of Fig.\u00a02 NSs and P-25. The relatively larger crystal size, higher pore size, and bigger surface area of TiO2 NSs are beneficial to the absorption of the CdS/CdSe QDs.In this study, the anatase TiOh high 00-exposed h high 00-exposed h high 00-exposed h high 00-exposed h high 00-exposed fication . The corh high 00-exposed 2 NS film turned from white to dark brown. Figure\u00a02 NSs scraped from the FTO glass substrate. It can be seen that dense CdSe nanocrystals have coated on the surface of TiO2 NSs without obvious aggregation. Furthermore, the lattice fringes of CdSe QDs can be clearly distinguished in the high-resolution TEM image in Fig.\u00a0The cascaded CdS/CdSe QDs have been extensively used as co-sensitizers for the QDSSCs because of their wide absorption range and good electron transfer dynamics . In this2 NSs and P-25 electrodes prepared under similar deposition conditions. The excitonic absorption peaks usually observed in colloidal QDs were also detected here due to the broad range of size distribution of QDs fabricated by the SILAR and CBD processes. The corresponding bandgaps of the CdS and CdSe QDs can still be identified as 2.67 and 1.78\u2009eV, respectively, by the absorption edges. Apparently, these values are larger than those of bulk CdS (2.25\u2009eV) and CdSe (1.7\u2009eV), indicating the particle sizes of the two nanocrystals are still within the scale of quantum confinement even after the sequentially chemical depositions. In the visible region, a higher absorption for the TiO2 NS electrode compared to the P-25 electrode is observed, implying that the loadings of CdS and CdSe QDs on the TiO2 NSs are higher than on the P-25. Furthermore, ICP-MS was used to obtain the qualitative QDs loading on the two different types of TiO2 photoanodes. By analyzing the results obtained from the BET and ICP-MS, the surface concentration of CdS QDs absorbed on the TiO2 NSs (5.44\u2009\u00d7\u200910\u22129\u2009mol\u2009cm\u22122) is found to be higher than that on the P-25 (4.59\u2009\u00d7\u200910\u22129\u2009mol\u2009cm\u22122). This verifies the reactive (001) facets of TiO2 NSs can afford more effective sites for attachment of CdS QDs, thereby providing higher absorbance of CdSe QDs on CdS QDs. As a result, the surface concentration of CdSe QDs on the TiO2 NS photoanode is also higher than that on the P-25 (4.57\u2009\u00d7\u200910\u22129\u2009mol\u2009cm\u22122 vs. 3.77\u2009\u00d7\u200910\u22129\u2009mol\u2009cm\u22122), which is consistent with the previously reported results [2 NSs apparently improve the surface concentration of CdSe/CdS co-sensitizers and thus increase the light harvesting of resulting QDSSCs. The photovoltaic performances of the TiO2 NS- and P-25-based CdSe/CdS QDSSCs were examined by characterizing their current-voltage behaviors under the simulated one-sun illumination . The TiO2 NSs and P-25 photoanodes under investigation are both ~\u200910\u2009\u03bcm thick. The J-V characteristics and incident photon-to-electron conversion efficiencies of the two QDSSCs are illustrated in Fig.\u00a02 NS-based QDSSC achieved a larger open-circuit voltage (Voc) of 0.58\u2009V, a higher short-circuit current density (Jsc) of 15.07\u2009mA\u2009cm\u22122, and a better conversion efficiency (\u03b7) of 4.42% compared to the P-25-based QDSSC . The TiO2 NS-based QDSSC exhibits a 60-mV larger Voc than the P-25-based cell. This enhancement of the open-circuit voltage in the TiO2 NS-based QDSSC can be attributed to the negative shift of the flat-band potential for the (001) facets [Jsc is proportional to the amount of light absorbed on the metal oxide. Therefore, the larger Jsc in the TiO2 NS-based QDSSC is consistent with the result of ICP-MS, confirming the reactive anatase (001) facets favor the loading of quantum dots per unit area. Thus, the utilization of highly reactive TiO2 NSs as photoanodes can significantly improve the photocurrents of the TiO2-based photovoltaic devices. Moreover, the larger pore size of TiO2 NSs reduces the light scattering in the TiO2 NSs. This allows a longer distance that light can travel within the TiO2 NSs, thereby enhancing the electron absorption probability. As shown in Fig.\u00a02 NS-based QDSSC is located at 675\u2009nm, which is slightly red-shifted when compared with the P-25-based QDSSC. In general, the IPCE value is determined by light harvesting efficiency, charge injection efficiency, and charge collection efficiency of the photoanode. The result is well matched with the UV-VIS absorption spectra, and the photocurrents integrated from the IPCE curves are in good agreement with the J-V measurements. Compared to the P-25-based QDSSC, the TiO2 NS-based QDSSC has higher IPCE values in the measuring range of 300\u2013800\u2009nm, with the maximum IPCE value of ~\u200975%.Figure\u00a0 results . The hig) facets . On the 2 NSs has been verified to offer a more effective surface area for QD absorption. Moreover, TiO2 NSs are expected to reduce the surface traps and recombination centers at the TiO2-NS/electrolyte interface for electron transport [\u03c4eff is the electron effective lifetime, Rw (= rw.L) is the electron transport resistance in the TiO2, Rk (= rk/L) is the charge transfer resistance related to recombination of electrons at the TiO2/electrolyte interface, Dn is the effective electron diffusion coefficient, Ln is the electron diffusion length in TiO2, and L (~\u200910\u2009\u03bcm) is the thickness of the electrodes. Dn is estimated according to the following equation [The highly reactive (001) surface of TiOransport . In orderansport \u201342 were equation :1\\documefpeak, and the first-order reaction rate constant for electron loss, keff\u2009\u2248\u20092\u03c0fmax. The \u03c4eff can then be estimated as follows:From the phase Bode plots, inset of Fig.\u00a02 NS-based QDSSC has a lower characteristic peak frequency compared with the P-25-based QDSSC, indicating the electrons in the TiO2 NSs can diffuse further. The result reveals the employment of the nanosheet structure favors the electron transport and suppresses the charge recombination. The fitted smaller Rw and larger Rk for the TiO2 NS-based QDSSC also confirm the result. The smaller Rw for the TiO2 NS-based QDSSC indicates the connection network of the highly crystalline (001) facets offers a better-oriented electron pathway, which minimizes the grain interface effect and reduces the electron loss from TiO2 NSs to the FTO substrate. Likewise, the fitting result also shows that the TiO2 NS-based QDSSC has a larger Rk (28.26\u2009\u03a9) than the P-25-based QDSSC (8.98\u2009\u03a9). The larger Rk presents higher resistance for the electron recombination process, due to the higher surface coverage of QDs on the TiO2 NSs, resulting in more electrons surviving from the back reaction at the uncovered TiO2-NS/electrolyte interface. Previous reports using the ZnS passivation treatment technique on the P-25-based QDSSCs also showed similar results [Ln of TiO2 NSs was estimated to be ~\u200921\u2009\u03bcm, which is two times longer than that of P-25. In addition, the Ln of TiO2 NSs is found much longer than the thickness of the photoanodes (21\u2009\u03bcm vs. 10\u2009\u03bcm), implying most of the photogenerated electrons can be collected without recombination. The high electron collection efficiency in the TiO2 NS film was manifested by the high IPCE value.The TiO results . The cor2 NSs with high (001)-exposed facets have been prepared by a facile hydrothermal process and used as the photoanodes for the CdS/CdSe co-sensitized solar cells  facets. Both the TiO2 NS- and P-25-based QDSSCs are characterized in terms of the photovoltaic performance as well as the dynamics of electron transport and recombination. The TiO2 NS-based QDSSC can perform an overall energy conversion efficiency of 4.42%, which corresponds to 54% enhancement in comparison with the P-25-based cell (2.86%) under similar fabrication conditions. Furthermore, the IPCE value of over 70% can be achieved in the wavelength range of 450\u2013600\u2009nm for the TiO2 NS-based QDSSC, attributed by the higher light harvesting and electron collection efficiency of the TiO2 NS photoanode. The EIS analysis also confirms the dominant (001) facets of TiO2 NSs can dramatically improve the power conversion efficiency of the TiO2-based CdS/CdSe-sensitized QDSSCs system. This finding reveals the possibility of exploiting the (001)-oriented TiO2 NSs in colloidal QDSSC application since the QDs can be anchored probably on the TiO2 NSs without the need of extra linkers (which are electron transfer barriers between the QDs and TiO2 in most cases). In addition, the utilization of TiO2 NSs in this work has shown the following benefits: stable, mass production, cheap, etc., since the fabrication process is not complicated and does not need expensive additives.2D anatase TiOlls Fig.\u00a0. The TEMAdditional file 1:2 NSs and NPs. (DOCX 59 kb)Calculation of the percentage of the exposed (001) facets in anatase TiO"}
+{"text": "To investigate the attitudes, beliefs and behavior related to performance enhancing substances (PES) use in elite Saudi football players.A cross-sectional survey was conducted. Using a systematic random sample of elite Saudi male football players, the standard World Anti-doping Agency (WADA) Social Science Research Package questionnaire was distributed to 408 players.p\u2009<\u2009\u00a00.011, the estimate is \u2212\u20090.139), threat or deterrence appraisal  and beliefs about the reference group\u2019s endorsement  but not with legitimacy perceptions (p\u2009=\u20090.513) and beliefs about the benefits of doping (p\u2009=\u20090.678). The strongest relationship was found between threat or deterrence appraisal (p\u2009<\u20090.001), and beliefs about the reference group\u2019s endorsement of PES use (p\u2009<\u20090.001).The overall prevalence rate of PES use was 3.9%, with the overall prevalence rate of doping susceptibility 17.1%. PES use or doping susceptibility is strongly correlated but negatively associated with morality and cheating measures (Morality and cheating measures, threat or deterrence appraisal and beliefs about the reference group\u2019s endorsement are the main predictors for PES use in Saudi Arabia. The use of performance-enhancing substances (PES) by athletes (doping) is a prohibited practice, but prevalent globally. Two of the following three criteria must be met for a substance to be considered as PES: (1) The substance increases or has the potential to increase performance; (2) the substance represents an actual or potential health risk to the athlete; and (3) the substance violates the spirit of sport.Using a combination of questionnaires and models of biological parameters, the current prevalence of intentional doping in elite athletes is estimated as 14-39%. This variation in the range is related to different types of sport and athletes. It is estimated that approximately 1-2% per year is the result of doping control tests [To understand doping behavior and to develop preventive and educational programs for athletes, just estimating of doping prevalence is insufficient. It is essential to understand the psychological variables, as well as the beliefs and attitudes the athletes use as their motives to use or not use PES are diverse and complex. Behavioral factors influencing the use of PES vary and have been studied from different perspectives. For example, Strelan et al. concluded that the criminal decision-making theory and cost-benefit analysis are the main contributing factors for using PES . StudyinThe World Anti-Doping Agency (WADA) reviewed publications investigating the attitudes and behavior related to PES use. They found that the vast majority of attitudinal research was descriptive and used cross-sectional designs, which is not appropriate for planning educational and preventive programs to prevent doping in sport . As a reThe objective of this study is to investigate the attitudes, beliefs, behavior, and social factors in relation to PES use in a sample of elite Saudi football players using the WADA Social Science Research Package.A cross-sectional countrywide survey using a systematic random sample of all elite Saudi male football players above the age of 16\u2009years was conducted. An Elite Player is defined as a player who has a contract as a professional player at national or international level. The study was conducted by distributing the standard WADA Social Science Research Package questionnaire to 408 participants attending different sport clubs, stadiums, sports fields, and playgrounds affiliated with the Saudi Football Federation and the General Sport Authority throughout all regions of the country including Riyadh, Eastern, Northern border, Qassim, Hail, Jouf, Tabuk, Madinah, Makkah, Baha, Asir, Jazan and Najran.n\u2009=\u2009408) of the participants of the total number of registered elite football players . Recruiting players involved approaching them at events or after training and inviting them to participate in a face-to-face survey, (the interviewer provides the questionnaire to a player to self-complete). Written consent was obtained after explaining the aims and objectives of the study. Anonymity was ensured as the participant\u2019s name was not recorded and the data were kept confidential to protect privacy. Data were not used for purposes other than the objectives of the study. The study protocol received ethical approval from the Ethical Research Committee (IRB) of King Abdullah International Medical Research Center, Riyadh, Saudi Arabia.Players were selected using a random sample selection technique that selected a proportion , legitimacy perceptions (perceived seriousness and effectiveness of the Saudi Sports Anti-Doping Authority in preventing PES use), morality and cheating measures, beliefs about the benefits of doping (perceived necessity for athletes to use PES to perform at the very highest levels), threat or deterrence appraisal (beliefs about the negative consequences of doping), beliefs about the reference group\u2019s endorsement of doping (relevant others\u2019 perceptions of them if they were caught using PES), authorities\u2019 control of doping, and beliefs about other athletes\u2019 attitudes toward doping.The sample size was calculated as follows: given the size of the population , and allowing a margin of error of \u00b15% for determining the proportion of athletes with a positive predisposition to doping, the sample size required was 378.2-test. For RMSEA, values of \u22640.06 and\u2009\u2264\u20090.08 were used to consider the fitted model as excellent and acceptable, respectively. The 90% confidence intervals for RMSEA were used to assess the precision of point estimates. The values of \u22650.80 for CFI and IFI, and\u2009\u2265\u20090.85 for TLI were considered as having an acceptable and excellent fit to the data, respectively.Data were analyzed using SPSS software, version 21.0 and AMOS statistical software. Descriptive statistics  were used to describe the quantitative and categorical variables. Internal consistency of latent variables was assessed using Cronbach\u2019s alpha and convergent validity was evaluated using Pearson\u2019s correlation coefficient for the items, subscale scores, and total scores. The construct validity latent variables was determined by using confirmatory factor analysis in which the correlation matrix, Kaiser-Meyer-Olkin (KMO) measurement of sampling adequacy, and Bartlett\u2019s test of sphericity were used to assess the factorability of the items. Factor structure with five factors was used in the factor extraction process by using a principal component method. The proportion of variance explained by each of the factors was assessed through eigenvalues. Varimax rotation was used to obtain the rotated factors. The hypothesized model showing the relationship between the five variables and \u201cperformance-enhanced drug use\u201d was quantified using structural equation modeling (SEM). Model fitness was assessed by using comparative fit index (CFI), incremental fit index (IFI), Tucker-Lewis index (TLI), the root mean square error of approximation (RMSEA), and the Bollen-Stine \u03c7M\u2009=\u200923.1) completed the survey (response rate\u2009=\u200968%). The baseline characteristics and demographics of the players are shown in Table In total, 408 elite Saudi male football players aged between 16 and 40\u2009years (n\u2009=\u20095) of the football players reported regularly using PES, 0.5% (n\u2009=\u20092) reported occasionally using PES for specific purposes, and 2.2% (n\u2009=\u20099) reported briefly using PES in the past. Thus, the prevalence of using PES in football players in this study is 3.9% (16 players). The total number of players who used PES or thought of using PES is 16\u2009+\u200958\u2009=\u200974, which equates to a prevalence rate of doping susceptibility of 17.1%. A small proportion  had the intention to use PES during the season.With regard to doping susceptibility, 1.2% (n\u2009=\u2009287) believed that the Saudi Anti-Doping Committee treated all athletes equally, 72.5% (n\u2009=\u2009296) believed that drug-testing procedures were secure, 67.4% (n\u2009=\u2009275) were satisfied with a fair-hearing session for positive tests, and 24.5% (n\u2009=\u2009100) of the sample thought that athletes who had been given therapeutic use exemptions had not been thoroughly evaluated and that their exemptions were not justified.With regard to legitimacy perceptions, the majority of the participants  of the sample believed that deliberately using PES to improve performance was morally wrong under any circumstances. If a player was caught using PES or other methods, the majority  would feel ashamed, 80.0% (n\u2009=\u2009328) would feel embarrassed, and 81.0% (n\u2009=\u2009333) would feel very guilty.With regard to morality and cheating measures, 77.9% ., 65.0% (n\u2009=\u2009265) believed that they were likely to be drug tested at least once a year. Less than half of the sample  thought that they were likely to get away with taking banned PES if they really tried. Of the participants, the majority  believed that the penalties for a positive drug test were severe.With regard to threat or deterrence appraisalRegarding beliefs about the reference group\u2019s endorsement of doping when given the opportunity to use PES, 82% of players believed that coaches would disapprove, 85% that parents would disapprove, 66% that team mates would disapprove, and 84% that the team doctor would disapprove.Relating to authorities\u2019 control of doping, the majority of the players felt that the police and customs authorities were serious in preventing trafficking of banned PES .n\u2009=\u2009211) of the sample believed that less than 25% of the athletes in football sport engaged in doping to enhance their performance. In addition, the majority  of the participants believed that less than 25% of the coaches would encourage their athletes to use doping to enhance their performance ) testing the difference between the observed data from the participants and hypothesized model, is highly statistically significant. The root mean square residual (RMR), which is an index of the amount of the estimated (by our model) variances and covariance, differs from the observed variances and co-variances and shows a value of 0.083, which is close to the acceptable level of <\u20090.10. The goodness of fit index (GFI), which identifies the proportion of the variance in the sample variance-covariance matrix, is accounted for by the model. Our model GFI and AGFI values at 0.948 and 0.891 are satisfactory as both values are close to the acceptable value (0.90) for a good model. The goodness of fit indices  compare the default model to the independence model. All three indices of our model  are satisfactory. The root mean square error of approximation (RMSEA), which estimates lack of fit, is compared to the saturated model. Our model RMSEA value of 0.074 (90% CI\u2009=\u20090.065 to 0.0.89) indicates the acceptable fit of the model.The chi-square minimum (CMIN) value of this model . This indicates that the correlation matrix is not an identity matrix. The analysis of factor extraction with their eigenvalues, the percent of variance attributable to each factor, and the cumulative variance of the factors show that the first factor accounts for 42.1% of the variance, the second factor for 20.3%, the third factor for 14.1%, and the fourth factor for 10% with a cumulative variance of 86.5%. The loadings of the 21 items on the three factors were extracted. The higher the absolute value of the loading, the more the factor contributes to the variable. The loading indicates that four factors have contributed to each of the 21 items. The four factors are beliefs about the reference group\u2019s endorsement of doping (eight items), legitimacy perceptions (four items), morality and cheating measures (four items), and threat or deterrence appraisal (three items).The correlation among the 21 items of part of the instrument showed a statistically significant correlation. The KMO measures the sampling adequacy, which should be greater than 0.5 for a satisfactory factor analysis to proceed. The data show that the KMO measure of 0.822 and Bartlett\u2019s tests of sphericity are significant  (Table Table 1) Table . Figure The overall prevalence rate of self-reported use of PES in elite Saudi football players is 3.9%, which is less than what is reported by Australian athletes . The oveThe majority of the players have a positive attitude toward the Saudi Anti-Doping Committee in terms of equal treatment of all athletes with acceptable drug-testing procedures and satisfactory hearing sessions. This positive attitude reflects the professional level of the committee as well as compliance with all the international standards and regulations of doping prevention. In comparison, Waddington et al. reported that 68% of English professional football players were aware and had a positive attitude of the national guidelines, with the remaining 32% not aware of the guidelines [The majority of the players in the current study believe that using PES is morally wrong. They would feel shame and guilt if caught using PES because being caught would be detrimental to the reputation of the player and negatively affect his future. The majority of the players believe that they are likely to be drug tested at least once a year, that the penalties for a positive drug test are severe, and that they are not likely to get away with taking PES. The majority of the players believe that the people  around them would disapprove of the use of PES.When considering the five variables, PES use, or doping susceptibility is strongly correlated but negatively associated with morality and cheating measures, threat or deterrence appraisal, and beliefs about their reference group\u2019s endorsement but not with legitimacy perceptions or beliefs about the benefits of doping. The strongest significant relationship was found between threat or deterrence appraisal and beliefs about their reference group\u2019s endorsement regarding PES use. The strength of the association was significant but less strong for morality and cheating measures with PES use. The inverse relationship means that a player with higher morality and cheating measures and a higher threat or deterrence appraisal have less favorable attitudes toward using PES. The chance of PES use decreases by increases in the reference group endorsement.In this study, there was a significant relationship between threat or deterrence appraisal and attitudes toward PES use. This means that if the player believes he can get away with cheating if tested, he is willing to cheat and has a more favorable attitude of doing so. This is consistent with the study of Gucciardi et al., which showed a significant but small relationship between threat appraisal and PES use .The current study showed a strong association between beliefs about the reference group\u2019s endorsement and PES use which means that the chance of PES use decreases by increases in reference group endorsement. In our knowledge, there are currently no other published studies related to beliefs about the reference group\u2019s endorsement and PES use.In the current study, we found an inverse relationship between morality and cheating measures and favorable attitudes toward using PES. Regarding morality and cheating measures, Donovan et al. were the first to develop a model which indicated that personal morality is a major input in an athlete\u2019s attitudes and intentions to use PES . StrelanThis study provides strong evidence for the importance of moral values and cheating measures in decisions related to PES use. As the relationship between PES use and morality is inverse in this study, we highly recommend the introduction of concepts of morality, and moral and ethical reasoning in anti-doping educational programs. Although the majority of the players in this study had a positive attitude related to the Saudi Anti-Doping Committee treating all athletes equally with secure drug-testing procedures and satisfactory hearing sessions, there was no significant relationship between legitimacy and attitude toward PES use. This is an unexpected finding, as it is generally believed that the stronger an organization\u2019s perceived legitimacy, the more likely people will comply with that organization\u2019s rules and regulations . These fA meta-analysis conducted by Ntoumanis et al. to determine the effect sizes of psychological and social-contextual factors on doping intentions, indicated that the use of food supplements, perceived social norms, and positive attitudes towards doping were the strongest positive correlates of doping intentions, while, morality and self-efficacy to refrain from doping had the strongest negative association with doping intentions and behaviors . AccordiIn the current study, there was a no significant relationship between beliefs about the benefit of doping and attitude related to PES use indicating that achieving outcomes such as national or international celebrity status, financial gain, or opportunities for remaining in the sport as coach, trainer, or administrator are not the main predictors for Saudi players to use PES. Gucciardi et al. reported a contrasting finding as it was found that there was a significant relationship of moderate strength between attitudes toward PES use and appraisal of benefits .The inconsistencies between the current study and other studies may be attributable to variations in the measurement of the five variables. However, they could be related to differences in culture, social background, level of professionalism, and differences in nationality between Saudi and Western athletes. The current study was limited to male football players compared with other studies including both genders and other types of sport. There is evidence to support the notion that athletes in different sports have a different approach to doping. Participants who regarded doping as a minor health risk seemed to be more often associated with doping compared to athletes who regarded doping as a significant health risk. Doping susceptibility is highest in speed and power sports, and lowest in sports requiring strong motor skills .This study has several limitations, which should be considered when interpreting the results. It used a self-reporting format and due to the cross-sectional design, a causal relationship between PES use and the model variables could not be established. Although the response rate is 68%, this rate is acceptable in this type of survey. The WADA Social Science Research Package suggests that if the target population is elite athletes, acceptable response rates are 50% for face-to-face surveys, 40% for telephone surveys, and 25% for mail and online surveys . It shouAlthough many educational and awareness programs have been developed and implemented to prevent doping in sport, these programs are not focused on the psychological behaviors, attitudes, and perceptions of athletes related to doping. The results of this study add new knowledge and highlights that there is a necessity to shift direction in the fight against doping from education and awareness programs to more in-depth analyses of factors and predictors underpinning PES use, and in particular the value of threats and morality as key factors in doping susceptibility."}
+{"text": "Babesia microti protection against adverse environment agents like reactive oxygen species (ROS) and reactive nitrogen species (RNS). To better systematically understand TPxs, we identified a novel 2-Cys peroxiredoxin-Q (BmTPx-Q) of B. microti. The full-length BmTPx-Q gene is 653 bp that consists of an intact open reading frame of 594 bp that encodes a 197-amino acid protein. The predicted protein has a molecular weight of 22.3 kDa and an isoelectric point of 9.18. Moreover, BmTPx-Q showed low identity at the amino acid level to other peroxiredoxins (Prxs) among the currently known subfamilies. The recombinant BmTPx-Q protein (rBmTPx-Q) was expressed in Escherichia coli and purified with beads. The native protein BmTPx-Q was detected using mouse anti-BmTPx-Q polyclonal serum with western blotting and indirect immunofluorescence assay (IFA). In addition, enzyme activity was observed using nicotinamide adenine dinucleotide phosphate (NADPH) as substrate and triggered the NADPH-dependent reduction of the Trx/TrxR system. It was also discovered that BmTPx-Q mainly exists as a monomer whether under its native or functional states. In addition, when incubated with Chloroquine diphosphate salt for 24 h in vitro, the expression of BmTPx-Q showed a marked downward trend with the increase of drug concentration. These results suggest that B. microti uses BmTPx-Q to reduce and detoxify hydrogen peroxides to survive and proliferate inside the host. Furthermore, BmTPx-Q showed the lowest identity with host enzymes and could be a potential drug target for the development of novel strategies to control B. microti infection.Thioredoxin peroxidases (TPxs) are ubiquitous cysteine-based peroxidases that reduce peroxides as part of antioxidant defenses and redox signaling and are essential for  Babesia microti that is transmitted to humans via the bite of an infected tick or a contaminated blood transfusion. There have been many reports of cases from Europe and the USA in recent years  and reactive nitrogen species (RNS) that could induce oxidative DNA damage and lipid peroxidation (2O2), alkyl peroxides, and peroxynitrite  residue and those that have an additional conserved residue . HoweverPlasmodium falciparum  and constitute a large family of thiol-dependent peroxidases . Prxs arlciparum , 20. Reclciparum \u201324. Prx lciparum  besides lciparum . Among tlciparum . The TPxlciparum \u201331.Mycobacterium tuberculosis is monomeric under reduced and oxidized states, and it is a thioredoxin-dependent and highly efficient fatty acid hydroperoxide reductase  . It has eductase . Regardleductase .Plasmodium, little is known about the Trx peroxidases-Q (TPx-Q) of B. microti. Sequencing of the full genome for B. microti has been completed (B. microti (BmTPx-1 and BmTPx-2) (B. microti possesses at least two Prx subfamilies (Tpx and PrxQ). In this study, we identified and characterized a novel thioredoxin peroxidase (BmTPx-Q) from a strain of B. microti, analyzed the activity and assessed the BmTPx-Q expression after treatment with antiparasitic agents. All results suggest that B. microti can use BmTPx-Q to reduce and detoxify H2O2 for survival. Additionally, our new investigations on BmTPx-Q, a member of Prxs, provide new insights into the structure and function of Prx. We demonstrated that BmTPx-Q might act as an oxidative stress defensive molecule as well as drug target in B. microti.Although Prxs have been extensively studied, especially Tpx and Prx1 in ompleted , but theBmTPx-2) , 37 and B. microti was obtained from the American Type Culture Collection  and maintained by serial passage in BALB/C mice  using a method described previously . The blood of the infected mice was carefully collected under aseptic conditions and added to bacteria-free anticoagulant. Then the blood was passed through a 27G needle three to five times. The blood cell debris was removed with a 5 \u03bcm syringe filter, and most of the parasites were isolated. Subsequently, the parasites were centrifuged at 2,000 rpm for 5 min with a horizontal centrifuge. The supernatant was discarded and the pellets were re-suspended with sterile culture medium. The pellets used for incubation experiments were then washed three times with phosphate-buffered saline  containing 50 \u03bcg/mL gentamycin sulfate (Sigma) under aseptic conditions. Healthy red blood cells were taken from 21-days-old normal mice and were distributed in a 12-well culture plate. Subsequently, each well was cultured in 5% CO2 at 37\u00b0C in RPMI 1640  supplemented with 1% penicillin/streptomycin  and 40% fetal bovine serum . The incubations were performed for 12 and 24 h at 37\u00b0C in a 5% CO2 incubator.For one independent experiment, B. microti. Total RNA sequencing was performed to characterize all transcriptional activity. The brief method of preparing total RNA and cDNA for library construction and sequencing of the samples was described in our previous study (http://www.ncbi.nlm.nih.gov/blast/). The protein domain was identified using BLAST (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). The signal peptide was predicted with the SignalP 4.1 server .To find more novel genes from us study . The fulus study . The GenCAT ATG TTC AAA ATA CTG AAT TCA CGG-3\u2032 and (reverse) 5\u2032-TT CTCGAG CAG TTT ATC AAT AAA TTC-3\u2032 (the underlined sequences contain the NdeI and XhoI restriction sites). The PCR product was inserted into the expression vector pET-30a . The recombinant plasmids harboring the BmTPx-Q (BmTPx-Q/pET-30a) coding sequence were transformed into E. coli (strain BL21). Induction of rBmTPx-Q Histidine-tag expression was performed using 1 mM isopropyl thio-b-D-galactoside (IPTG), followed by purification using Ni-NTA agarose beads . Purified rBmTPx-Q was evaluated a sample in 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS\u2013PAGE) using reducing conditions and stained it with Coomassie Brilliant blue R-250. Protein concentration was determined with the BCA assay .The recombinant proteins (rBmTPx-Q) were produced as described previously . Briefly2O2 (1 mM) was used to start the reaction and was terminated with 40 \u03bcL of 26% trichloroacetic acid, which was added at 2-min intervals. The disappearance of H2O2 was monitored to assess rBmTPx-Q activity. In the reaction mixture, the remaining peroxide content was allowed to react with ~40 \u03bcL of 10 mM (NH4)2Fe(SO4)2 and 20 \u03bcL of 2.5 M KSCN, which formed a ferric thiocyanate complex that was red in color. The color intensity was measured at a wavelength of 475 nm using a microplate reader . In the presence of Trx and Trx reductase (TrxR), oxidation of nicotinamide adenine dinucleotide phosphate (NADPH) coupled with rBmTPx-Q to the reduction of H2O2 was examined using the method described by Kang et al. . The negative control (-)rBmTPx-Q indicates the absence of BmTPx-Q in reaction mixture.To evaluate the antioxidant activity of rBmTPx-Q applying a mixed-function oxidation (MFO) assay , 29, 38.B. microti, B. microti-infected red blood cells (iRBCs) were prepared from Kunming mice at 4, 5, 6, 7, and 8 days post-infection, and non-infected erythrocytes were used as a negative control. First, the infected blood samples were centrifuged in low speed and hemolyzed by red cell lysis buffer  after discarding the supernatant. The soluble fractions (20 mg per lane) were separated on a 12% SDS-PAGE. The Western blot analysis was performed as described previously  and used in quantitative real-time PCR (qRT-PCR) analysis. The qRT-PCR was performed with SYBR\u00ae Premix Ex Taq TM II  and a StepOne Plus PCR system (Applied Biosystems). The primer pair of BmTPx-Q were BmTPxQ-qRT-F: ACAAGCACAATCTCCCATAC (forward) and BmTPxQ-qRT-R: TCTCCAGCACTAACTCCC (reverse). The 18s ribosomal RNA of B. microti (Bm18S) (GenBank: XM_021481625.1) was used as an internal control. The primer pair of Bm18S were Bm18S-qRT-F: GTTATAGTTTATTTGATGTTCGTTT (forward) and Bm18S-qRT-R: AAGCCATGCGATTCGCTAAT (reverse). The parasitemia was calculated at each day post-infection. Analysis was performed using the 2\u2212\u0394\u0394ct method, and experimental values were expressed as relative amounts  was collected and iRBCs were washed with PBS. A 12-well flat-bottom plate  was used for drug screening. The B. microti iRBCs (~2 \u00d7 107) were cultured in RPMI 1640  supplemented with 25 mM HEPES  and 40% fetal bovine serum  at 37\u00b0C in a 5% CO2   was assessed. Quinine and Dihydroartemisinin were dissolved into dimethylsulfoxide (DMSO), while Chloroquine was dissolved in PBS. iRBCs were treated with various concentrations  of Quinine, Dihydroartemisinin, and Chloroquine at different timepoints , meanwhile the controls were treated with DMSO or PBS. Relative BmTPx-Q transcript levels were assessed as previously described, by Reverse Transcription (RT)-PCR. Briefly, total RNA was isolated from infected RBCs using TRI solution , and RT-PCR was carried out applying 1 \u03bcg of total RNA and specific primers by a PrimeScript\u2122 One-Step RT-PCR Kit . Conditions for the PCRs were as follows: 95\u00b0C for 30 s; 95\u00b0C for 5 s, 60\u00b0C for 35 s, for 40 cycles. The experiment was repeated in triplicate.To assess the mRNA relative expression profile of BmTPx-Q after treatment with antiparasitic agents, a short-term culture system of research . Brieflya 5% CO2 , 45. To t-tests. P < 0.05 was considered significant and P < 0.01 was considered highly significant.A GraphPad PRISM 5 software  was used for the data analysis. The mean \u00b1 standard deviation (SD) of each group was calculated. The differences between groups were assessed using two-tailed B. microti Prx Q , showing 35% sequence similarity with Prx Q of Babesia bigemina (XP_012767998.1), 35% with Prx Q of Blastomyces dermatitidis (EEQ83458.1), 39% with Prx Q of Babesia sp. Xinjiang (XP_028870106.1), and 43% with Ahp/TSA family-related protein, putative of Theileria annulata (XP_954500.1)  . The seq54500.1) . The BmT54500.1) . The BmT54500.1) .E. coli BL21 (DE3) as a his-tagged protein. The rBmTPx-Q protein was purified with Ni-NTA agarose beads and was analyzed by SDS/PAGE. As shown in The PCR product was cloned into the pET30a vector and the recombinant protein was successfully expressed in 3 and DTT generate hydroxyl radicals in the reaction mixture induced nicks in the supercoiled plasmid DNA, thereby altering the mobility of DNA during agarose electrophoresis. Both FeCl3 and DTT generated nicks in the DNA in the absence of rBmTPx-Q. Thus, there was an apparent increase in DNA size  was used by indirect immunofluorescence assay (IFA) with the mouse anti-rBmTPx-Q serum. The blue fluorescence indicates the nucleus of B. microti, whereas the green fluorescence shows BmTPx-Q located within the nucleus of B. microti merozoites in iRBCs  from  microti , 37. Her microti . In our  microti , 51. The microti . Afterwa microti  indicateR system . Unlike R system . In thisR system .E. coli purified by agarose beads  approved and the Animal Ethical Committee of Shanghai Veterinary Research Institute authorized this investigation.HZ and JZ conceived and designed this study. HZ and ZW performed the experiments. JH conducted the molecular analysis. JC performed the serology. YZ conducted the statistical analysis. All authors have read and approved the final version of this manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Acanthococcus lagerstroemiae), has spread across 14 states of the U.S. The infestation of CMBS has negatively impacted the growth, flowering, and even fruiting of some Lythraceae plants to various extent, including cultivars of Lagerstroemiaindica, L. fauriei, and Punica granatum. This raises concerns that CMBS would threaten other crapemyrtle species and native Lythraceae plants. Understanding the host range and the host suitability for CMBS would help evaluate the potential risks to landscapes and other ecosystems. Information on the host suitability provides beneficial information for breeding resistant cultivars. In this study, we conducted a host range test on six Lagerstroemia species  and a native Lythraceae plant in California  over 25 weeks. The infestation of CMBS was observed on all the tested Lythraceae plants. The suitability for CMBS differed significantly among the Lagerstroemia species. Lagerstroemia limii was the most suitable, whereas L. speciosa was the least suitable. This study expands the current knowledge on the host range for CMBS. Our results suggest that L. speciosa could be utilized in developing new cultivars with low CMBS suitability.An exotic insect, crapemyrtle bark scale , an invasive polyphagous sap-sucking hemipteran, has spread across 14 states of the United States since 2004. The infestation of CMBS has negatively impacted the flowering of ornamental plants and even the fruiting of some crops. Host identification is critical for determining potential risks in ecosystems and industries and helps develop strategic management. A host confirmation test was performed over 25 weeks using six Lagerstroemia species  and California loosestrife . The 25-week observations confirmed all tested plants as the hosts. The repeated measures of analysis of variance  at 17 weeks after inoculation (WAI), while the highest number was 57 \u00b1 15 on L. speciosa at 19 WAI. In addition, L. subcostata and L. speciosa had significantly high and low numbers of males, respectively, among the Lagerstroemia species. Our results suggest that L. speciosa could be incorporated in developing new cultivars with low CMBS suitability.Crapemyrtle bark scale (CMBS,  Erysiphe lagerstroemia) resistant Lagerstroemia fauriei was incorporated in crapemyrtle breeding programs, and many interspecific hybrids (L. indica \u00d7 fauriei) were released with powdery mildew resistance [Sarucallis kahawaluokalani) [Altica litigata) [Popillia japonica) [Lagerstroemia indica cultivar \u2018Carolina Beauty\u2019 was found to be less CMA-preferred than L. indica \u00d7 L. fauriei hybrids [L. fauriei. Based on this information, breeders and growers can more effectively select or target CMA-resistant or beetle-resistant cultivars.Plant germplasm evaluations are helpful for breeding cultivars that are resistant to diseases and insects. For disease resistance, powdery mildew  ,6, flea itigata) , or Japaaponica) . Subsequ hybrids , but mor hybrids  and Japa hybrids  than intAcanthococcus lagerstroemiae), a sap-feeding insect mainly found on crapemyrtle plants, is originally from Asia and has also been reported in the United Kingdom [Crapemyrtle bark scale  lagerstroemiae (Kuwana) based on both genetic and morphological evidence [When it was first reported in Richardson, TX in 2004, the CMBS was tentatively recognized as azalea bark scale, Comstock ,25. It wevidence . The CMBevidence . The aveevidence . Similarevidence ,29, newlevidence . The malevidence ,27. The evidence ,30,31. Tevidence . In Chinevidence . In Koreevidence ,13. Tempevidence . The phyevidence .Because honeydew secreted from the ingested sap leads to the growth of black sooty mold covering the leaf surface and bark ,35, CMBSPunica granatum as a host, which seriously impacts the growth and fruiting of pomegranate and even leads to plant death [Buxus microphylla var. koreana, Celtis sinensis, Diospyros kaki, Ficus carica, Hypericum kalmianum, Ligustrum obtusifolium, Mallotus japonicus, Malus pumila, Myrtus sp., and Prunus serrulata and Rubus sp. [Malus angustifolia, Malus domestica, Chaenomeles speciosa, Diospyros rhombifolia, Heimia salicifolia, Lagerstroemia \u2018Spiced Plum\u2019, and twelve pomegranate cultivars [L. indica, L. fauriei, and the interspecific hybrids, other crapemyrtle species, such as L. limii, L. subcostata, L. caudata, and L. speciosa, have been introduced into the United States as ornamental plants. To better manage CMBS in the U.S. and to help estimate its risks to ecosystems or green industries , further confirmation of CMBS hosts is necessary.Natural infestations have been reported on not only crapemyrtles, but also on a wide range of plants from different families. A host plant is defined as a plant on which an insect is observed to complete its life cycle, especially with the presence of ovipositing gravid females ,49. Crapnt death ,27,50,51ubus sp. ,13,52,53ultivars . Thus, CL. indica, L. fauriei, or interspecific cultivars are immune to CMBS infestation. Infestation by CMBS was observed on nine crapemyrtle cultivars  in both landscapes and controlled environments. In addition, CMBS was observed on ten crapemyrtle cultivars  in landscapes. Lythrum alatum, a plant in the same family (Lythraceae) as crapemyrtles, was reported as a CMBS host [Lythrum californicum) is native to California and is also distributed in Arizona, Kansas, New Mexico, Nevada, Oklahoma, Texas, and Utah. If Ly. californicum is indeed a host plant, its wide distribution will probably provide a continuum for spreading of CMBS. However, the suitability of Ly. californicum for CMBS is not yet known.Currently, no CMBS-resistant crapemyrtle species or cultivars have been reported. Based on our previous observations , it is rMBS host ,30. CaliLagerstroemia species . The identification of less suitable species provides important information for breeding new CMBS-resistant cultivars.The aims of this study were to confirm additional plant hosts for CMBS and to test the host suitability among six Lagerstroemia species  and Ly. californicum were tested in the study  and Blake Jones in Georgia. Lagerstroemia fauriei \u2018Kiowa\u2019 plants were purchased from The Crape Myrtle Company . Lagerstroemia limii, L. speciosa, and L. subcostata were propagated from plants at North Florida Research and Education Center . All plants (ranging from 50.8 to 88.9 cm in height) were transplanted into 3.79 L pots containing Jolly Gardener Pro-Line C/25 growing mixture  and put inside plant cages (75 cm \u00d7 50 cm \u00d7 40 cm) in March 2019 before CMBS inoculation. The cage was made of PVC pipe, covered, and enclosed with handmade Chiffon mesh netting , and a 30-cm-long zipper was added to water and observe plants easily.Six he study . Lagerst\u00ae, all except five ovisacs on the branches were removed  + 1) was conducted prior to data analysis. The numbers of males and females on different species over 25 weeks were analyzed as repeated measures, respectively, using analysis of variance (ANOVA) with a mixed effect in JMP Pro 15 . Plant species and data collection time were assigned with full factorial. The blocks were included as a random effect. Then, the least squares means (LSMeans) of the number of the CMBS on species were separated using Tukey\u2019s honestly significant difference (HSD) (Log transformation as logL. fauriei \u2018Kiowa\u2019 at two WAI. Beginning at three WAI (29 May 2019), white sacs were first observed on Ly. californicum and all other Lagerstroemia species. Meanwhile, the females were first seen on Ly. californicum and all Lagerstroemia species except L. speciosa and L. subcostata at five WAI, and were observed on all species at seven WAI. Average numbers of CMBS males and females increased and peaked around 17 WAI on most species. The number of the males decreased at 19 WAI . The fixed-effect test showed that the main factors, plant species  and time , had significant effects on the number of CMBS males. Based on the 25-week comparison results using Tukey\u2019s HSD . However, the LSMeans among these other species had no significant difference over the 25 weeks. According to the average number of CMBS (L. subcostata was 1057 \u00b1 107 (mean \u00b1 SE) at 17 WAI, whereas the highest number on L. speciosa was 45 \u00b1 29 (mean \u00b1 SE) at 19 WAI.The number of CMBS reflects the host suitability for CMBS among ey\u2019s HSD , the LSM of CMBS , the higF = 1.62; df = 55,132; p = 0.0135), time , and plant species  had significant effects on the number of CMBS females. The simple-effect differences among the species at each measuring time were examined. At 3, 5, 7, 9, or 11 weeks after inoculation (WAI), no difference was observed in the number of female CMBS among different species. At 13, 15, 17, 19, 21, 23, and 25 WAI, the number of female CMBS from different species was significantly different (The species\u2013time interaction (ifferent .L. limii (63) was significantly higher than that on L. subcostata (49), L. fauriei \u2018Kiowa\u2019 (30), and L. indica \u2018Dynamite\u2019 (16), followed by L. caudata (7) as well as L. speciosa (7) (L. limii was 576 \u00b1 25 (mean \u00b1 SE) at 17 WAI, and the number on L. speciosa peaked at 57 \u00b1 15 (mean \u00b1 SE) at 19 WAI  . The higt 19 WAI . These LL. subcostata, L. indica \u2018Dynamite\u2019, L. limii, L. fauriei \u2018Kiowa\u2019, L. caudata, and L. speciosa was 2.8:1, 2.5:1, 1.9:1, 1.6:1, 2.7:1, and 1.6:1, respectively   . There wl 11 WAI , and theLagerstroemia indica, which agrees with the CMBS hosts listed in Kozar\u2019s findings [L. fauriei  and Ly. californicum as CMBS hosts.The hosts confirmed in this study validated findings , and L. ost list ,53). MorL. speciosa is not suitable for the growth and development of CMBS. Among all tested crapemyrtle species, L. speciosa supported CMBS\u2019s growth and development the least, as indicated by the lowest numbers of male and female CMBS . The sex ratio  of CMBS on L. speciosa (1.6:1) was much lower than on other tested species, such as L. subcostata (2.8:1), which may restrict the occurrence of severe CMBS infestation on L. speciosa for a period. Herbivore sex ratios can be affected by environmental factors, host plant defensive chemistry, and nutrient availability [An interesting observation from this study was the different sex ratio of CMBS on different crapemyrtle species. Even though the number of male CMBS on 25 weeks , the numlability ,68,69,70lability ,72.Lagerstroemia species, such as L. indica, L. subcostata, L. fauriei, and L. speciosa [A. lagerstroemiae, which would help improve the integrated pest management for CMBS.Different levels of host suitability could be attributed to, but not limited to, physical properties , a balanspeciosa ,78,79. CL. limii, L. caudata, L. speciosa, L. subcostata, and Ly. californicum as CMBS hosts in addition to the previously reported L. indica \u2018Dynamite\u2019 and L. fauriei. Importantly, these Lagerstroemia species showed significantly different suitability to CMBS. Lagerstroemia speciosa was the least suitable for CMBS, as indicated by the lowest numbers of CMBS males and females, and can be utilized as a parental plant for breeding new CMBS-resistant cultivars.This study confirmed"}
+{"text": "The human hand plays a crucial role in accomplishing activities of daily living. The contribution of each finger in the human hand is remarkably unique in establishing object stabilization. According to the mechanical advantage hypothesis, the little finger tends to exert a greater normal force than the ring finger during a supination moment production task to stabilize the object. Similarly, during pronation, the index finger produces more normal force when compared with the middle finger. Hence, the central nervous system employs the peripheral fingers for torque generation to establish the equilibrium as they have a mechanical advantage of longer moment arms for normal force. In our study, we tested whether the mechanical advantage hypothesis is supported in a task in which the contribution of thumb was artificially reduced. We also computed the safety margin of the individual fingers and thumb.Fifteen participants used five-finger prismatic precision grip to hold a custom-built handle with a vertical railing on the thumb side. A slider platform was placed on the railing such that the thumb sensor could move either up or down. There were two experimental conditions. In the \u201cFixed\u201d condition, the slider was mechanically fixed, and hence the thumb sensor could not move. In the \u201cFree\u201d condition, the slider platform on which the thumb sensor was placed could freely move. In both conditions, the instruction was to grasp and hold the handle (and the platform) in static equilibrium. We recorded tangential and normal forces of all the fingers.The distribution of fingertip forces and moments changed depending on whether the thumb platform was movable (or not). In the free condition, the drop in the tangential force of thumb was counteracted by an increase in the normal force of the ring and little finger. Critically, the normal forces of the ring and little finger were statistically equivalent. The safety margin of the index and middle finger did not show a significant drop in the free condition when compared to fixed condition.We conclude that our results does not support the mechanical advantage hypothesis at least for the specific mechanical task considered in our study. In the free condition, the normal force of little finger was comparable to the normal force of the ring finger. Also, the safety margin of the thumb and ring finger increased to prevent slipping of the thumb platform and to maintain the handle in static equilibrium during the free condition. However, the rise in the safety margin of the ring finger was not compensated by a drop in the safety margin of the index and middle finger. Many of our daily activities, such as holding a pen or lifting a cup, demand the use of our hand. An object held in the hand has to be maintained stationary, i.e.,\u00a0in static equilibrium for preventing tilt and slip. Studies have used a prehension handle to examine how forces of fingers and thumb are controlled during grasping. It is known that there will be a change in the distribution of fingertip normal forces whenever there is a change in the tangential force due to vertical lifting of the object followed by expected or unexpected changes in the load of the object . Also, iStudies on prehension stability have also shown that during tasks involving the production of pronation or supination moment, fingers with larger moment arms  tend to produce a greater share of normal force compared to the fingers with the shorter moment arms . In our study, as per the handle design, the finger force sensors were placed at two cm away from each other. Therefore, the index and little fingers have longer moment arms for normal force when the fingers are placed on the sensors. This led to the formulation of the mechanical advantage hypothesis (referred to as MAH henceforth) cf. . ZatsiorOne common objective of researchers is to address how the central nervous system chooses a specific force pattern when changes are induced to the five finger prehension handle held in static equilibrium. Five finger prehension stability was examined when a change was introduced to the entire width of the handle  or indivSecondly, with regard to the drop in the load contribution of the thumb, there would be an increment in the tangential force of the virtual finger (VF). Virtual finger is an imaginary finger whose output is equal to the collective summation of the mechanical output from index, middle, ring and little fingers . Since iFifteen young healthy right-handed male volunteers  participated in this experiment. Participants with any history of musculoskeletal or neurological illness were excluded.The experimental procedures were approved by the Institutional ethics committee of IIT Madras . The experimental sessions were conducted in accordance with the procedures approved by the Institutional ethics committee of IIT Madras. Written informed consent was obtained from all participants before the start of the experiment.We designed and built a vertically oriented prehension handle made of aluminium specifically for this study. The thumb side of this handle had a vertical railing. On this railing, we placed a slider platform such that it can move only in the vertical direction. The slider had ball bearings, and hence the friction between the slider and the railing was minimal (\u00b5\u223c0.001 to 0.002). We stored the handle in a dust-free environment during non-use. Further, we regularly cleaned and lubricated the ball bearing between experimental sessions to ensure minimal friction. We used five 6-component force/torque sensors  to measure the fingertip forces and moments in the X, Y and Z directions. The thumb sensor was mounted on the slider platform. Hence the thumb sensor could freely move in the vertical direction, whereas the other finger sensors were fixed to the handle.A laser displacement sensor  was mounted on a flat acrylic platform near the top of the handle on the thumb side. This sensor was used to measure the vertical displacement of the moving platform with respect to the geometric center of the handle. At the center of the handle frame, a thin horizontal solid line was drawn with a permanent marker to indicate the position at which the participants were required to maintain the slider in the free condition.On top of the handle, an acrylic block extending in the anterior-posterior direction was placed. A spirit level was positioned on the participant side of the acrylic block. An electromagnetic tracking sensor  was placed on the other side of the acrylic block as shown in Participants washed their hands with mild soap and water before the beginning of the experiment. Friction experiment was performed first, followed by the Prehension experiment.We designed a device that consists of a six-component force/torque sensor  mounted on the top of the aluminium platform. The platform moved linearly with the help of a timing belt-pulley system powered by a servomotor . A custoParticipants were seated comfortably on a wooden chair with their forearm resting on the table. The right upper arm was abducted approximately 45\u00b0\u00a0in the frontal plane, flexed 45\u00b0\u00a0in the sagittal plane with the elbow flexed approximately about 90\u00b0. The natural grasping position can be achieved by supinating the forearm at 90\u00b0. The movements of the forearm and wrist were restricted by strapping them to the tabletop with Velcro.The experiment involved a task that had two different conditions: \u201cfixed\u201d and \u201cfree\u201d. In the fixed condition, the vertical thumb slider was fixed securely using a mechanical constraint. This fixed position was such that the horizontal line passing through the center of the thumb sensor was precisely aligned with the solid horizontal line drawn at the center of the handle . In the free condition, this mechanical constraint was released so that the slider was free to vertically translate over the entire length of the vertical railing. Theoretically, the thumb sensor could move a maximum range of seven cm, approximately between the index finger and little finger. However, in the current study, we required the thumb platform to be maintained between middle and ring fingers. This was in addition to the requirement to maintain the handle in static equilibrium. The spirit level provided tilt feedback to the participant.In both conditions, the task was to lift the handle vertically upward from the suspended position with their right hand to support the load of the handle with the fingers and thumb. The handle was required to be held in such a way that the fingertips\u2019 center approximately coincided with the center of each sensor. Eight participants performed free condition first followed by the fixed condition. The other seven participants performed fixed condition first followed by the free condition. The experimenter (but not the participant) could view the normal force of all fingers, slider\u2019s vertical displacement data, position and orientation of the handle. The trial started only after the participant held the handle in a stable manner and informed the experimenter to start. The participants were instructed to grasp and hold the handle vertical by maintaining the bubble in the bull\u2019s eye at the center throughout the trial. They were also instructed to lift the handle with all fingers in both conditions and position the horizontal line on the thumb platform matching the horizontal line drawn at the midline between the middle and ring finger in the free condition. Although the friction between the thumb platform and handle was low, it was not zero. The experimental task required some practice. Five practice trials were provided at the start of each condition . After practice, participants were able to follow the instruction and perform the task successfully. Each experimental condition was conducted in a separate session. A rest period of one hour was provided between conditions. In each condition, thirty trials were recorded. Each trial lasted for ten seconds, with a minimum mandatory break period of thirty seconds between the trials. Additional rest was provided when the participants requested.The data was collected using a customized LabVIEW  program, and offline analysis was performed in MATLAB . Force/Torque data were low-pass filtered at 15 Hz using second-order, zero phase lag Butterworth filter. We only considered the data between 2.5 and 7.5s (500 samples) for all the analyses to eliminate the start and end of trial effects.Normal force sharing of the individual fingers (excluding the thumb) was expressed in terms of percentage by taking the average across 500 samples of each trial and then averaged across all trials and participants.Safety margin (SM) is the amount of extra normal force applied in addition to the minimally required normal force to avoid slipping of the handle. We computed SM for all fingers using the following equation . (1)\\doct refers to the time course of 5\u00a0s, Fn is the normal force, and Ft is the tangential force applied to the object. SM was calculated with the corresponding friction coefficient value \u00b5\u00a0of each participant that was computed from the friction experiment data. The average friction coefficient of index and thumb computed across 15 participants were 0.9689\u00a0\u00b1\u00a00.0054 and 0.9745\u00a0\u00b1\u00a00.0109, respectively. For statistical analysis, Fisher\u2019s Z-transformed SM (SMz) values were found by using the following equation. where \u00b5\u00a0is the coefficient of friction between the finger pad and sandpaper, z-transformed normal force sharing and safety margin. Sphericity test was performed on the data for all cases, and the number of degrees of freedom was adjusted using the Huynh-Feldt (H-F) criterion wherever required. Post-hoc pairwise comparisons were performed using Tukey test to explore the significance within the factors. We also performed an equivalence test using Two One-Sided T-test (TOST) approach  X finger  as factors for normal force, tangential force, approach , to checThe ideal performance of the task in both fixed and free condition would be to hold the object in static equilibrium. In the free condition, participants were also required to align the horizontal line on the slider to the horizontal line on the handle frame. p\u00a0=\u00a00.696, d\u00a0=\u00a00.14). The TOST procedure for the independent tilt angle samples was performed with the smallest effect size of interest (SESOI = 1.31) set as equivalence bounds (lower limit \u0394L = \u22121.31 and upper limit \u0394U\u00a0=\u00a01.31) obtained for the desired level of statistical power of 95%. The procedure revealed that the comparison was statistically equivalent (t(28) = \u22123.192, p\u00a0=\u00a00.00174) as the observed effect size (d) falls within the equivalence bounds. The amount of deviation of the center of thumb sensor from the marked position on the handle frame was calculated. It was computed by finding the absolute difference between the maximum and minimum values of the laser displacement data within each trial. This difference was then calculated for all trials, averaged, and then averaged across participants. During the free condition, the average deviation of the marked horizontal line on the slider from the horizontal line on the handle was 0.88\u00a0\u00b1\u00a00.06 mm.The tilt angles showed no statistically significant difference  = 0.395, p\u00a0=\u00a00.596, dz\u00a0=\u00a00.14). By employing the TOST procedure  = 3.059, p\u00a0=\u00a00.00425). As the observed effect size(dz\u00a0=\u00a00.14) falls within the equivalence bounds, this comparison was deemed to be equivalent.The normal force produced by the index finger  in free condition task was found to be greater than the normal force produced by the index finger  in fixed condition task. Hence, when plotted, the data of index finger normal force in fixed condition was found hidden under the plot of Index finger normal force during the free condition see . The averocedure , with eqThis was true in both the absolute and % values of the normal forces. The averages  of normal force and tangential force can be seen in \u00a0=\u00a085.44; p\u00a0<\u00a00.001, \u03b72p\u00a0=\u00a00.85) corresponding to a significantly higher (p\u00a0<\u00a00.001) normal force in free condition compared to fixed condition. There was a significant main effect of the finger \u00a0=\u00a0259.23; p\u00a0<\u00a00.001, \u03b72p\u00a0=\u00a00.94) corresponding to a significantly higher (p\u00a0<\u00a00.001) normal force for thumb than other fingers. To check for differences between fingers other than the thumb, we performed a one-way ANOVA. However, we did not find any such difference in the normal force of individual fingers other than the thumb. The interaction condition x finger was significant \u00a0=\u00a056.70; p\u00a0<\u00a00.001, \u03b72p\u00a0=\u00a00.80) reflecting the fact that the average normal force of thumb in free and fixed condition(9.16N & 5.36N) was significantly higher than the other fingers index(1.65N &1.63N), middle(1.84N &1.33N), ring(2.69N&1.21N) and little(2.86N & 1.09N). The normal force of the little finger (2.86N) in the free condition is significantly greater than the normal force of the index , middle , ring  fingers in fixed condition and index finger  in the free condition. Ring finger normal (2.69N) in the free condition is significantly greater than the normal force of the index , middle , ring  and little  fingers in the fixed condition.A two-way repeated-measures ANOVA on average normal force with factors condition and finger showed a significant main effect of condition \u00a0=\u00a013.44; p\u00a0<\u00a00.01, \u03b72p\u00a0=\u00a00.5) according to two-way repeated-measures ANOVA. A significant main effect was found for finger \u00a0=\u00a046.87; p\u00a0<\u00a00.001, \u03b72p\u00a0=\u00a00.77). This indicated that the thumb tangential force was different from other fingers. Pairwise comparisons showed that the tangential force of the ring and little finger increased significantly (p\u00a0<\u00a00.001) in free condition  compared to fixed condition . Interaction effects were significant \u00a0=\u00a0127.54; p\u00a0<\u00a00.001, \u03b72p\u00a0=\u00a00.90) for condition x finger reflecting the fact that the average thumb tangential force decreased significantly (p\u00a0<\u00a00.001) in free condition(1.09N) compared to fixed condition(2.70N). The average thumb tangential force in fixed condition (2.70N) is significantly greater (p\u00a0<\u00a00.001) than the average tangential force of index , middle , ring , and little finger  in fixed and free conditions. The average tangential force of little finger in fixed condition (0.41N) significantly decreased than the ring  and thumb  in free condition, index  and middle finger  in both conditions. Ring finger tangential force in free condition (1.25N) is significantly greater than the index finger index  in both conditions. In free condition, the tangential force of the little finger (1.14N) is significantly greater (p\u00a0<\u00a00.01) than the tangential force of ring finger in fixed condition (0.74N). Thumb tangential force in free condition (1.09N) is significantly greater (p\u00a0<\u00a00.05) than the ring finger in fixed condition (0.74N).The effects of condition on average tangential force were significant \u00a0=\u00a013.83; p\u00a0<\u00a00.01, \u03b72p\u00a0=\u00a01.06) on the normal force sharing of the individual fingers other than the thumb. Index (p\u00a0<\u00a00.001) and middle (p\u00a0<\u00a00.05) finger contributed significantly lesser normal force share in free condition compared to the fixed condition  = -0.655, p\u00a0=\u00a00.523, dz\u00a0=\u00a00.16). However, the TOST procedure confirmed that the comparison was statistically equivalent (t(14) = 2.947, p\u00a0=\u00a00.0053), as the observed effect size was significantly within the equivalence bounds of \u0394L = \u22120.93 and \u0394U\u00a0=\u00a00.93.Normal force sharing was different between the two conditions. We observed a significant main effect of condition \u00a0=\u00a050.40; p\u00a0<\u00a00.001, \u03b72p\u00a0=\u00a00.78) and finger \u00a0=\u00a029.26; p\u00a0<\u00a00.001, \u03b72p\u00a0=\u00a00.67) showed statistical significance. Post-hoc pairwise comparisons showed significantly higher SMz for ring finger (p\u00a0<\u00a00.05) and thumb (p\u00a0<\u00a00.001) in the free condition when compared to fixed condition. Interaction effect also showed statistically significant difference \u00a0=\u00a066.11; p\u00a0<\u00a00.001, \u03b72p\u00a0=\u00a00.82) for the safety margin between the factors. The safety margin of the thumb in the free condition (1.34) is significantly greater (p\u00a0<\u00a00.001) than the safety margin of the index , middle , ring  and little  in fixed and free conditions. Middle finger safety margin during free condition (0.35) is significantly (p\u00a0<\u00a00.01) lower than the little  in both conditions. In fixed condition, middle finger safety margin (0.20) decreased significantly compared to the little finger  in both conditions, index  and ring  in the free condition, thumb  in the fixed condition.Safety margin changed between the two conditions. A two-way repeated-measures ANOVA was performed using the factors condition and finger. Both factors, condition  from safety margin of index finger  in free condition. Similarly, the safety margin of middle  and little fingers  in fixed condition was not significantly different (Middle: t(28) = -1.796, p\u00a0=\u00a00.0833, d\u00a0=\u00a00.64; Little finger: t(28) = 0.582, p\u00a0=\u00a00.565, d\u00a0=\u00a00.20 ) from safety margin of middle  and little finger  in free condition. We observed a statistical equivalence among the safety margin of index (t(28) = 2.557, p\u00a0=\u00a00.00814), middle (t(28) = 1.792, p\u00a0=\u00a00.042) and little fingers (t(28) = \u22123.005, p\u00a0=\u00a00.00277) between the fixed and free condition as their observed effect sizes falls within the equivalence bounds of \u0394L = \u22121.31 and \u0394U\u00a0=\u00a01.31. We confirmed them through TOST T-test. These findings are illustrated in In addition to this, the safety margin of index finger  in fixed condition was not statistically different (t(28) = -1.031, In our study, participants attempted to maintain the handle in static equilibrium both during the fixed and free conditions. In the fixed condition, when the mechanical constraint was used to restrict the translation of the thumb vertically, the entire load of the handle was shared by the thumb and other fingers. In free condition, the thumb platform was made free to slide over the railing on the handle. The changes in friction that occurred on the surface between the thumb platform and handle can be perceived by the proprioceptors located in the thumb muscles and joints. This sensory information is communicated to the CNS via the afferent path. In response to that, CNS generates a motor command to the thenar muscles controlling the thumb. The critical difference between conditions is that in the \u201cfree condition\u201d the thumb cannot apply desired vertical tangential force as found in the fixed condition. The tangential force of the thumb dropped from \u223c2.7N to 1N during the free condition. The thumb could only produce 1N force without causing a translation of the slider. If the participant attempts to increase the tangential force above 1N, the thumb platform will slide upwards .The drop in the thumb\u2019s tangential force caused an increase in the tangential force of virtual finger to overcome the weight of the handle. The tangential force of the virtual finger was \u223c4.24N which was three times greater than the tangential force of the thumb (1.09N). This, in turn, could cause a tilt of the handle in the counter-clockwise direction. Such a tilt will disturb the rotational equilibrium of the handle. Eventually, there was a compensatory adjustment in the normal and tangential forces of the digits to retain the equilibrium of the handle. According to the mechanical advantage hypothesis, peripheral fingers (index and little) that have larger moment arms  tend to produce greater normal force compared to the central fingers (middle and ring) having shorter moment arms during moment production tasks. Earlier, this hypothesis was tested in the pronation or supination moment production tasks to establish static stabilization of the handle when external torques were introduced to the handle. From their results , it was However, we observed that both the ulnar fingers exerted a statistically equal absolute normal force (in Newton) and normal force sharing (in terms of %). The results of our current study are not in agreement with the mechanical advantage hypothesis as the ulnar fingers exerted comparable normal forces. This might be due to the lesser mass of the handle when compared to the studies  which foThe central nervous system probably has chosen to increase tangential forces of ulnar fingers, naturally accompanied by an increase in their normal forces. The increase in normal forces of ulnar fingers would disturb the horizontal equilibrium of the handle see . ConsequBy definition, the safety margin is meant to be the amount of extra normal force applied to avoid slipping. From the results of our study, we could observe a significant increase in the safety margin of the ring finger as there was a rise in the normal force of ring finger to compensate for the drop in the tangential force of the thumb. It is known that the tangential force of the virtual finger increases to compensate for the drop in the tangential force of the thumb in order to preserve the vertical equilibrium of the handle. Prior studies  have shoAccording to our second hypothesis, there will be a significant drop in the safety margin of the index and middle finger during the free condition compared to fixed condition. Contrary to our expectations, the safety margin of the index and middle finger showed no statistical difference between the fixed and free conditions. Hence, our findings were not in agreement with the second hypothesis, as well. One question that arises here is whether we can define safety margin in this case since the slider was frictionless, and by definition, safety margin does not exist when friction is zero. Friction was minimal (non-zero) between the slider and the handle due to the presence of ball bearings. Friction was much higher between the thumb and the ATI Nano sensor . If any slip happens, it would first happen at the interface of the slider and the railing, not the sensor and finger. The instruction was to hold the thumb platform in position by matching the horizontal line on the thumb platform to the horizontal line drawn at the midline between the middle and ring finger. The participants followed the instruction without causing any vertical sliding of the thumb platform. Therefore, the safety margin of the thumb is defined and increased in the free condition.Due to the unsteady thumb platform, proprioceptors on the thumb detect the frictional change under the slider. The CNS, in turn, responds by necessitating the mechanical action of lowering tangential force of the thumb. The magnitude of thumb tangential force in free condition depended on the mass of the thumb platform. We consider this to be the first local change which initiated the synergic effect in the ring and little finger. In our current study, the following chain effect was observed during the free condition: mechanical constraint to fix the thumb in position was removed \u2192 tangential force of the thumb decreases \u2192 VF tangential force increases \u2192 rise in the counter-clockwise moment \u2192 compensated by the increase in the normal force of ring and little finger \u2192 moment due to normal force of ring and little finger increases in the clockwise direction to counterbalance the rise in the counter-clockwise moment \u2192 increase in the normal force of ring, and little fingers were compensated by the increase in the thumb\u2019s normal force. Thus, the change in the tangential force of the thumb resulted in the re-arrangement of normal force of all the fingers. This is evident from Comparable normal forces exerted by the two ulnar fingers may be attributed to at least two distinct factors: biomechanical constraints and neural interdependency. Biomechanical constraints include the mechanical linkages and the tendinous interconnections. Firstly, the main source of the gripping force in the ulnar fingers was produced by the Flexor Digitorum Profundus (FDP). The tendons of the FDP muscle extend from the forearm to the tip of the index, middle, ring and little fingers. These tendons are responsible for flexion of the distal interphalangeal joint to exert appropriate normal forces. Since the tendons of middle, ring and little fingers share a common muscle belly, at the forearm level, contraction of one portion (or compartment) of the FDP muscle could cause shortening of the neighbouring muscle compartment of the same FDP. Thus, the mechanical linkage between the muscle compartments of FDP, restrict the independent rise in the normal force of the target finger. Secondly, at the palmar level, it is found that there is a tough fibrous sheet that interconnects the tendons of the middle, ring and little fingers . Therefop\u00a0<\u00a00.001) than the change in force produced by index, middle, ring motor units under their adjacent fingers.Apart from the biomechanical effects, there also exists an overlap in the motor units territories of the ring and little fingers at the medial portion of the FDP muscle which is responsible for the flexion of ulnar fingers . In a stAs there is a necessity to compensate for the drop in the clockwise moment caused by the tangential force of thumb, little finger motor units get activated (because of the longer moment arm of the little finger) to cause flexion  of the little finger. Subsequently, perhaps this results in the activation of the little finger motor units found at the ring finger portion of FDP muscle. Apart from the increase in the normal force of the ulnar fingers due to the little finger motor units, the normal force of ring finger increases due to the activation of ring finger motor units. Hence, this distinct behaviour of the activation of little finger motor units  and ring finger motor units on ring finger portion of FDP could be a reason for the exertion of significantly comparable normal force by the ulnar fingers.When the thumb undergoes a local change of decrease in tangential force, handle equilibrium is disturbed. Subsequently, the handle\u2019s equilibrium was restored by increasing the normal force of the ring and little finger. It was evident from our current study that the ring and little finger normal force showed a statistically comparable increase to counteract the drop in the thumb tangential force. Thus, the little finger  did not produce a greater share of normal force than the ring finger to cause supination moment for balancing drop in thumb tangential force. Therefore, our result does not support the mechanical advantage hypothesis, at least for the specific mechanical condition considered by us. In addition to this, there was no statistical difference in the safety margin of the index and middle finger in free condition compared to the fixed condition. This study can also be extended with various conditions that involve in examining mechanical advantage hypothesis in different situations. Further research is required to clarify how well these results generalise to other conditions. Our future studies will focus on investigating the hypothesis with various tasks that encompass different magnitudes of mechanical requirements.10.7717/peerj.9962/supp-1Supplemental Information 1Click here for additional data file."}
+{"text": "We have read the article titled \u201eQuality of life 10\u00a0years after cardiac surgery in adults: a long-term follow-up study \u201c by Perrotti A. et al. published in your distinguished journal with great interest. Unfortunately, we found few errors in this article. Dear Editor,I am contacting you in the name of the group of authors who published \u201cHealth-related quality of life five years after coronary artery bypass graft surgery\u201d in the International Journal of Cardiology . We read"}
+{"text": "Pancreatic ductal adenocarcinoma (PDAC), the fourth leading cause of cancer death, has a 5-year survival rate of approximately 7\u20139%. The ineffectiveness of anti-PDAC therapies is believed to be due to the existence of a subpopulation of tumor cells known as cancer stem cells (CSCs), which are functionally plastic, and have exclusive tumorigenic, chemoresistant and metastatic capacities. Herein, we describe a 2D in vitro system for long-term enrichment of pancreatic CSCs that is amenable to biological and CSC-specific studies. By changing the carbon source from glucose to galactose in vitro, we force PDAC cells to utilize OXPHOS, resulting in enrichment of CSCs defined by increased CSC biomarker and pluripotency gene expression, greater tumorigenic potential, induced but reversible quiescence, increased OXPHOS activity, enhanced invasiveness, and upregulated immune evasion properties. This CSC enrichment method can facilitate the discovery of new CSC-specific hallmarks for future development into targets for PDAC-based therapies. Long-term cultures of pancreatic cancer stem cells (PaCSCs) are difficult to obtain. Here, the authors present a 2D culture method, based on the use of galactose, to establish cell cultures from pancreatic ductal adenocarcinoma xenotransplants enriched in PaCSCs. At the time of diagnosis, <20% of patients present with localized  disease, 15\u201320% of patients have locally advanced (unresectable) tumors, and the remaining patients present with metastatic disease. To compound the situation further, even the strongest chemotherapeutic regimens only extend overall survival to approximately 11 months and very rarely result in long-term progression-free survival (>5 years)2. Thus radically new approaches are needed to identify novel and more effective therapies for PDAC.The past decade has seen great progress in the diagnosis and treatment of different cancers; however, the same cannot be said for pancreatic ductal adenocarcinoma (PDAC), which is currently the fourth most frequent cause of cancer-related death and projected to become the second most lethal tumor by the year 20303. Using CSC surface markers or three-dimensional (3D) spheroid cultures to isolate pancreatic CSCs (PaCSCs), we have advanced our ability to study and molecularly characterize these cells. For example, we now appreciate that PaCSCs are highly plastic and therefore have the capacity to alter their metabolism, induce quiescence, resist chemotherapeutic insults, and even evade the immune system by upregulating immune evasion receptors or checkpoint inhibitors4. While much progress has been made, we are still far from completely understanding the complex biological makeup of PaCSCs, largely due to the inability to establish long-term two-dimensional (2D) cultures enriched in CSCs that are amenable to characterization and screening studies.To achieve the latter, it is important to appreciate that pancreatic tumors are comprised of a heterogeneous population of cancer cells with diverse replicative, tumorigenic, metastatic, and chemoresistant capacities. Specifically, highly plastic subpopulations of stem-like cells within the tumor, known as cancer stem cells (CSCs), have been described for PDAC and are now accepted to be the drivers of tumorigenesis, chemoresistance, and metastasis5 could prove useful for (1) dissecting the underlying drivers of their plasticity and for (2) identifying new anti-CSC targets for drug development. Toward this end, and based on our previous work demonstrating the metabolic differences that exist between PaCSCs and non-PaCSCs, we describe herein a long-term and sustained cell culture system enriched in PaCSCs based on forced oxidative phosphorylation (OXPHOS), defined by electron transport chain\u2009+\u2009ATP synthase. In this culture system, cells increase the expression of PaCSC biomarkers and present better metabolic adaptation, plastic features such as a reversible quiescence-like state, and CSC-associated phenotypes, including chemoresistance, invasiveness, and immune evasive properties. This culture method not only sheds light on the link between previously unrecognized CSC features and mitochondrial-dependent metabolism but also represents a platform that could facilitate the discovery of CSC-specific properties that could lead to the development of new therapies against PaCSCs, which could ultimately improve the life expectancy of PDAC patients.Approaches that use specific signaling mechanisms to enrich and maintain CSC subpopulations with phenotypic plasticity in culture7] CSCs quickly return to their pre-sort distribution within 2\u20133 days post sorting 10, and as shown by Warburg in 1925, cancer cells use 18-fold less glycolysis when galactose, in lieu of glucose, is provided as a sugar source11. Thus galactose, together with exogenous mitochondrial OXPHOS substrates  leads to a compensatory upregulation of OXPHOS12. As a consequence, cells that are dependent on glycolysis but not on OXPHOS function (non-PaCSCs) cannot survive in galactose, while cells that have an efficient OXPHOS system (PaCSCs) will survive and become enriched  approaches\u00a0have also proven ineffective as marker-enriched CSCs quickly re-establish the heterogeneity of the culture present prior to sorting. Thus the enrichment in PaCSCs is not a stable phenotype and marker-enriched . Primary cultures were tested for Mycoplasma at least every 4 weeks.PDAC PDXs were obtained from Dr. Manuel Hidalgo under a Material Transfer Agreement with the Spanish National Cancer Centre (CNIO), Madrid, Spain (Reference no. I409181220BSMH) and were originally described and genetically characterized in ref. Low passage (<15) PDX-derived primary PDAC cultures were trypsinized and seeded at a concentration of 800,000 cells in p100 plates with RPMI medium supplemented with 10% FBS and 50\u2009units/ml of penicillin and streptomycin. After 24 h, cells were cultured with either glucose-free Dulbecco\u2019s Modified Eagle Medium  supplemented with 5\u2009mM glucose (0.9\u2009g/l), 10% FBS, 50\u2009units/ml of penicillin and streptomycin, and 1\u2009mM of pyruvate [Glucose: OXPHOS-independent conditions] or glucose-free DMEM medium (Thermo Fisher Scientific) supplemented with 5\u2009mM galactose (0.9\u2009g/L), 10% FBS, 50\u2009units/ml of penicillin and streptomycin, and 1\u2009mM of pyruvate [Galactose: OXPHOS-competent enriched conditions]. Sugar concentrations of 5\u2009mM were chosen to mimic physiological sugar levels  and to avoid potential biological artifacts mediated by supraphysiological sugar levels. Media for both conditions were changed every day, over a period of 14 days, after which cells were collected for further processing and analysis, as described below. Earlier time points  were also tested, but maximum levels of markers and gene expression were obtained at 14 days, and thus this time point was chosen for all experiments described herein. Gal-CC cultures can be maintained in culture indefinitely (>70 days tested), trypsinized, and passaged if necessary, as well as cryopreserved for future thawing and usage.7. For all assays, 2\u2009mg/ml 4,6-diamidino-2-phenylindole  was used to exclude dead cells with laser VL1. Data were analyzed with the FlowJo 9.3 software . For cell sorting, cells were resuspended in sorting buffer  and a\u00a0FACS Vantage SE Flow Cytometer was used and events were\u00a0analyzed by the BD FACSDivaTM software v.9.0 . Examples of gating strategies for all of the aforementioned cytometry-based analyses are presented in Supplementary Fig.\u00a0Cells were resuspended in Flow buffer  before analysis with a 4-laser Attune NxT Acoustic Cytometer (Thermo Fisher Scientific). Cytometry data were acquired with the Invitrogen\u2122 Attune\u2122 NxT software, version 3.1.1, unless specified otherwise. For cell surface marker expression, refer to antibodies listed in Supplementary Table\u00a0For mitochondria markers, Gluc-CC and Gal-CC were stained with Mitotracker Deep Red (Cat no. M22426), CM-H2XRos (Cat no. M7513), MitoTracker\u00ae Red CMXRos (Cat no. M7512), Mitotracker Green FM (Cat no. M7514), and NAO (Cat no. A1372)  in the absence of FBS for 30\u2009min at 37\u2009\u00b0C, at concentrations of 2, 100, and 10\u2009nM, respectively, and 0.1\u2009\u00b5M for Mitotracker Green FM and NAO. Fluorescence was detected using the filters RL1 , YL1 (PE), and BL1 (FITC). MitoSOX  was used at 5\u2009\u00b5M for 30\u2009min at 37\u2009\u00b0C and detected with laser YL1 (PE). MitoBlue  was used at 10\u2009\u00b5M for 20\u2009min at 37\u2009\u00b0C and detected with laser VL2. Data were analyzed with the FlowJo 9.3 software .One million cells were plated in 100\u2009mm tissue-culture dishes, and after 24\u2009h, their cell cycles were synchronized using serum-free medium. Twenty-four hours later, treatments with glucose and galactose media were initiated and cell cycle was determined 6 days later. Cells were trypsinized and fixed in cold 70% ethanol and stored at \u221220\u2009\u00b0C. After 24\u2009h, cells were incubated with 100\u2009\u00b5g/ml RNAase A (Sigma) in PBS during 30\u2009min at 37\u2009\u00b0C and then stained with 50\u2009\u00b5g/ml of PI solution  and stored overnight at 4\u2009\u00b0C. Approximately 20,000 cells/sample were analyzed using an Attune NxT Acoustic Cytometer (Thermo Fisher Scientific) with excitation at 561\u2009nm and emission at 615\u2009nm. The percentage of cells in each phase of the cell cycle was determined using the FlowJo 9.3 software .Cells were harvested in RIPA buffer  supplemented with protease inhibitor cocktail . Fifty micrograms of protein were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride (PVDF) membranes . Membranes were sequentially blocked with 1\u00d7 TBS containing 5% bovine serum albumin  and 0.1% Tween20 (v/v), incubated with a 1:1000 dilution of the indicated antibodies . Numbers of spheres were determined by microscopy using an inverted EVOS FL microscope (Thermo Fisher Scientific) using a \u00d710 objective with phase contrast.PDAC spheres were generated and expanded in DMEM-F12 (Invitrogen) supplemented with B-27  and basic fibroblast growth factor (PeproTech EC). One thousand cells/ml/well were seeded in ultra-low attachment 24-well plates (Corning) as described previously49. One microgram of purified RNA was used for the synthesis of cDNA using the Thermo Scientific Maxima First Strand cDNA Synthesis Kit  according to the manufacturer\u2019s instructions, followed by RT-qPCR analysis using SYBR green and a StepOne Plus real-time thermo-cycler (Applied Biosystems). The thermal cycle consisted of an initial denaturation step of 10\u2009min at 95\u2009\u00b0C followed by 40 cycles of denaturation (15\u2009s at 95\u2009\u00b0C) and annealing (1\u2009min at 60\u2009\u00b0C). The results obtained for each gene were normalized with the \u03b2-actin levels. For primers used, see Supplementary Table\u00a0RNA was isolated by using the standard protocol of the guanidine thiocyanate (GTC) method6 293T cells were co-transfected with 1\u2009\u03bcg packaging plasmid psPAX2, 1\u2009\u03bcg envelope plasmid VSVG, and 2\u2009\u03bcg of H2B-mCherry or the NANOG reporter lentiviral vector backbone . After 8\u2009h, the transfection medium was changed and recombinant lentiviruses were harvested 48 and 72\u2009h later. The virus particle-containing supernatant was filtered through 0.45-\u00b5m PVDF membrane filters and aliquoted and stored at \u221280\u2009\u00b0C until needed. For lentivirus transduction, PDAC cells were seeded in 6-well plates at a concentration of 3\u20135\u2009\u00d7\u2009104 cells/well. One milliliter of virus was directly overlaid on cells and polybrene  was added at a final concentration of 8\u2009\u03bcg/ml. After 16\u2009h, medium was changed. Stably transduced cells were obtained after mCherry-positive or YFP-positive cell sorting using a FACS Vantage SE Flow Cytometer and analyzed by the BD FACSDiva software (BD Biosciences).Lentiviral particles were produced by co-transfection of 293T cells  with the indicated plasmids using the polyethylenimine-based transfection method. Briefly, 5\u2009\u00d7\u200910JEM-1010 transmission electron microscope  and analyzed by Adobe PhotoShop CS4 EXTENDED V11.0 .After sorting cells for the indicated markers, cells were centrifuged and pellets were fixed with 0.1\u2009M cacodylate buffer with a pH of 7.4 at RT and sections were processed by the UAM Electron Microscopy unit per standard protocols. Pictures were taken with a TM 7.1  and processed with the program Adobe PhotoShop CS4 EXTENDED V11.0 .All the samples processed for optical microscopy were visualized and photographed with an Axiovert 135 TV microscope  equipped with an Olympus DP50 digital camera and a fluorescence lamp. The images were obtained with the program ViewFinderFifty thousand PDAC cells were seeded in a 96-well plate. After 24\u2009h, cells were cultured with glucose or galactose media for 14 days. Real-time analysis of proliferation and autofluorescence was performed by IncuCyte\u00ae Zoom System  taking images every 30\u2009min for 40\u2009h. The results were analyzed with the IncuCyte Zoom 2015A software .Non-sorted and sorted cells cultured with glucose or galactose were seeded in 24-well culture dishes (Corning) and incubated at 37\u2009\u00b0C. The mitochondrial probes MitoTracker DeepRed and MitoTracker CMXRos were added at 2 and 10\u2009nM, respectively, for 30\u2009min at 37\u2009\u00b0C , followed by two washes with 1\u00d7 PBS, and a\u00a0final\u00a05\u2009min incubation with DAPI . MitoTracker DeepRed was excited at 644\u2009nm and the fluorescence emitted was detected at 665\u2009nm (far red fluorescence) and assigned red fluorescence. MitoTracker CMXRos was excited at 579\u2009nm and the fluorescence emitted was detected at 599\u2009nm and assigned green fluorescence. For IF assays, cells were fixed with 4% PFA in PBS for 20\u2009min at RT, washed with PBS, permeabilized with 1% Triton X-100 in PBS for 15\u2009min, blocked with 1% BSA in PBS for 1\u2009h at RT, and then incubated with specific antibodies  were subcutaneously injected into 8-week-old female nude mice  and tracked for 10\u201314 weeks for tumor formation. If a mouse in a specific dilution group warranted sacrifice, all of the mice  in that dilution group were sacrificed in order to obtain the number of tumors for all mice at the exact same time. For the dilutions 50,000, 10,000 and 5000, mice were sacrificed at 10 weeks post inoculation. For the 1000-cell dilution group, mice were sacrificed at 14 weeks post inoculation. CSC frequencies were calculated using the ELDA software (http://bioinf.wehi.edu.au/software/elda/). For in vivo tail vein injection invasion assays, 8-week-old NOD-SCID mice (Instituto de Investigaciones Biom\u00e9dicas \u201cAlberto Sols\u201d CSIC-UAM) were injected intravenously via the tail vein with either 5\u2009\u00d7\u2009105 mCherry-H2B-labeled PANC185scd or PANCA6L Gluc-CC or Gal-CC  using a 27-G needle. The mice were sacrificed 10 dpi or 3 months pi. Indicated organs were collected, digested, and stained with antibodies to detect TAMs (CD45+CD11b+F4-80+)  and La Comunidad de Madrid (PROEX 335/14 and PROEX 294/19) and in accordance with the guidelines for Ethical Conduct in the Care and Use of Animals as stated in The International Guiding Principles for Biomedical Research involving Animals, developed by the Council for International Organizations of Medical Sciences (CIOMS). Briefly, mice were housed according to the following guidelines: a 12-h light/12-h dark cycle, with no access during the dark cycle; temperatures of 65\u201375\u2009\u00b0F (~18\u201323\u2009\u00b0C) with 40\u201360% humidity; a standard diet with fat content ranging from 4\u201311%; sterilized water was accessible at all times; for handling, mice were manipulated gently and as little as possible; noises, vibrations, and odors were minimized to prevent stress and decreased breeding performance; and enrichment was always used per the facility\u2019s guidelines to help alleviate stress.http://rsbweb.nih.gov/ij/).For histopathological analysis, 3-\u03bcm sections of formalin-fixed paraffin-embedded blocks were used for IHC analysis of human cytokeratin 19 using the primary and secondary antibodies and dilutions detailed in Supplementary Table\u00a0For autophagy flux analysis, Gluc-CC and Gal-CC were treated with the lysosomotropic reagent Bafilomycin A1 at a concentration of 150\u2009nM  for 5\u2009h. After treatment, Gluc-CC and Gal-CC were harvested and analyzed by WB as described above. For densitometry, WB images were analyzed using PhotoShop CS4 EXTENDED V11.0 . Autophagy flux compares the LC3B-II  levels with and without the autophagy inhibitor and is calculated as the ratio of LC3B-II in the presence and absence of the autophagy inhibitor compared to the control condition . The data were normalized to the indicated housekeeping protein.+ cells was determined using an Attune NxT Acoustic Cytometer (Thermo Fisher Scientific). DAPI (Sigma) was used to exclude dead cells with laser VL1.Gluc-CC and Gal-CC were labeled with PKH26 red fluorescent cell membrane labeling dye  according to the manufacturer\u2019s instructions. At the indicated days post staining, for a total of 14 days, cells were trypsinized, washed, and the percentage of PKH26+ cells were determined using an\u00a0Axiovert 135 TV optical microscope , and the ImageJ 2.0.0 software  was used for further analysis.\u03b2-Galactosidase activity was measured in Gluc-CC y Gal-CC according to the manufacturer\u2019s instructions . \u03b2-Galactosidase6 cells/well. Following 14 days of culture with glucose or galactose, Gal-CC or Gluc-CC cells were treated with 1\u2009\u03bcg/ml of GEM, 3\u2009\u00b5M of MTX, or 1\u2009\u00b5M of DXR for 2 days. After 2 days, drugs were removed and PDAC cells were allowed to recover for 3 days. For metabolic drugs, Gluc-CC and Gal-CC were treated with 5\u2009\u00b5M of Menadione, 10\u2009nM of Rotenone, 100\u2009\u00b5M of Resveratrol, 3\u2009mM of Metformin, or 5\u2009mM of 2-DG for 3 days. Following treatments, the supernatant was collected, and the ToxiLight\u2122 Bioassay Kit  was used to evaluate the toxicity using a bioluminescence GLOMAX Luminometer (Promega).PDAC cells were seeded in a 12-well plate at 105 cells per well in a XF24 cell culture microplate\u00a0with DMEM  supplemented with 10% heat-inactivated FBS (Gibco) and 1% Pen/Strep. On the day of the assay (24\u2009h after re-seeding), medium was changed to non-carbonated Seahorse measurement medium and the XF24 plate was transferred to a temperature-controlled (37\u2009\u00b0C) XF24 Extracellular Flux analyzer and equilibrated for 10\u2009min. To determine the basal respiration, four assay cycles  were performed. Then oligomycin (4\u2009\u03bcM) was added by automatic pneumatic injection (three assay cycles) to inhibit ATP synthase and thus approximate the proportion of respiration used to drive ATP synthesis versus proton leak-linked respiration. Oligomycin was followed by an injection of FCCP (carbonyl cyanide p-trifluoromethoxyphenylhydrazone) (0.5\u2009\u03bcM) to completely dissipate proton motive force and maximally stimulate mitochondrial respiration (three assay cycles), thus determining SRC and substrate oxidation capacity. An injection of rotenone (4\u2009\u03bcM) and antimycin A (2\u2009\u03bcM) was used to correct for the non-mitochondrial respiration rate (three assay cycles), which was subtracted from all the other rates. Basal respiration was calculated as the oligomycin-sensitive fraction of mitochondrial respiratory activity, estimating the proportion of basal respiration used to drive ATP synthesis. To determine ECARs, experiments were terminated by injection of 2-DG (100\u2009mM), correcting for non-glycolytic acidification. Injection of 2-DG enables the calculation of glycolytic acidification. Data obtained after oligomycin treatment induced glycolytic capacity. Raw data were normalized to total cell numbers, determined by optical absorbance of lysed crystal violet-stained cells.Measurements of OCR were performed with a XF extracellular flux analyzer , and data were collected with the XF96 1.4.2 Software (Agilent). Briefly, 14-day-old Gal-CC or Gluc-CC were trypsinized and re-seeded at a density of 1049. Sequencing libraries were prepared with the \u201cNEBNext Ultra II Directional RNA Library Prep Kit for Illumina\u201d (NEB no. E7760) as recommended by the kit manufacturer. Briefly, polyA+ fraction was purified and randomly fragmented, converted to double-stranded cDNA, and processed through subsequent enzymatic treatments of end-repair, dA-tailing, and ligation to adapters. Adapter-ligated library was completed by PCR with Illumina PE primers. The resulting purified cDNA libraries were applied to an Illumina flow cell for cluster generation and sequenced on an Illumina NextSeq 550 (with v2.5 reagent kits), according to the manufacturer\u2019s protocols. RNAseq data sets were analyzed using the tool Nextpresso51. Nextpresso is comprised of four basic levels: (1) quality check, (2) read cleaning and/or down-sampling, (3) alignment, and (4) analysis . The gene signatures  from GSEA\u2014Molecular Signature Database for Gene set enrichment analysis was used for pathway enrichment analysis with GSEA v4.0.3 (Broad Institute).Total RNA was isolated by the GTC method using standard protocolsDanio rerio, wild type), maintained in 30-l tanks with a ratio of 1 fish per liter of water, with 14\u2009h/10\u2009h light/dark cycle and a temperature of 28.5\u2009\u00b0C according to published procedures35. All the procedures used in the experiments as well as fish care were performed in agreement with the Animal Care and Use Committee of the University of Santiago de Compostela and the standard protocols of Spain (Directive 2012-63-UE). At the final point of the experiments, zebrafish embryos were euthanized by tricaine overdose.Zebrafish embryos were obtained by mating adult zebrafish  were used to perform the xenograft assays in the zebrafish embryos. Between 100 and 150 cells were injected into the circulation of each fish (Duct of Cuvier) using a microinjector  with an output pressure of 34\u2009kPA and 30\u2009ms of injection time per injection. Subsequently, the injected embryos were incubated at a temperature of 34\u2009\u00b0C for 6 dpi in 30\u2009ml Petri dishes for each condition with salt dechlorinate tap water. Imaging of the injected embryos was performed using a fluorescence stereomicroscope  at 1, 4, and 6 dpi in order to measure the proliferation of the PANC185scd- and PANCA6L-injected human cancer cells inside the zebrafish circulation in each of the conditions assayed.For zebrafish xenograft assays and image analysis, zebrafish embryos were collected at 0\u2009h post-fertilization (hpf) and incubated until 48 hpf at 28.5\u2009\u00b0C. At 48 hpf, hatched embryos were anesthetized with 0.003% of tricaine (Sigma). mCherry-H2B-labeled PANC185scd and PANCA6L Gluc-CC and Gal-CC were trypsinized, resuspended, and concentrated in an Eppendorf at 10The image analysis of the injected embryos was carried out using the Quantifish software v2.1  in order to obtain the proliferation ratio of the cells in the region of the caudal hematopoietic tissue of the embryos, where the cells proliferate and metastasize. This program measures in each of the images provided the intensity of the fluorescence and the area of the positive pixel above a certain threshold of the cells. With these parameters, an integrated density value is obtained allowing the researcher to compare different times between images to reach a proliferation ratio.Supernatant from Glu-CC and Gal-CC were collected to evaluate the changes in the levels of lactate production. The analysis was performed using the Lactate Assay Kit  according to the manufacturer\u2019s instructions. The optical density was determined using a Synergy\u2122 HT Multi-Mode Microplate Reader  at a wavelength set to 570\u2009nm.Lysate pellets of cells from Glu-CC and Gal-CC were collected to evaluate the changes in the levels of ATP. The analysis was performed using the Molecular Probes ATP Determination Kit  according to the manufacturer\u2019s instructions. Bioluminescence was determined using a Synergy\u2122 HT Multi-Mode Microplate Reader .Blood samples from healthy donors were provided by the BioBank Hospital Ram\u00f3n y Cajal-IRYCIS (PT13/0010/0002), integrated in the Spanish National Biobanks Network (ISCIII Biobank Register No.\u00a0 B.0000678). Samples were processed following standard operating procedures with the appropriate approval of the Hospital Ram\u00f3n y Cajal Ethical and Scientific Committee , with informed consent and according to Declaration of Helsinki principles. Blood samples were diluted with PBS  and Ficoll  was used to isolate peripheral blood mononuclear cells (PBMCs). PBMCs were divided across three 6-well culture plates (per donor) with RPMI 1640 media containing 10% FBS and 50\u2009units/ml penicillin/streptomycin. After 24\u2009h, monocytes adhered to the plate surface were separated from the lymphocytes that remain in suspension and that were seeded in T-75 flasks for their subsequent activation and growth.Changes in protein levels related to immune evasion processes were determined by measuring changes in the levels of cytokines or inflammatory-related molecules released into the culture medium by Gluc-CC and Gal-CC cells, using the Proteome Profiler Human Cytokine Array Kit , according to the manufacturer\u2019s instructions. Cytokine array images were obtained using the MyECL Imager (Thermo Fisher Scientific). For densitometry analysis, array images were analyzed using PhotoShop CS4 EXTENDED V11.0 . Data were normalized to the indicated array positive control.Culture medium from Gluc-CC and Gal-CC were collected to evaluate the changes in the levels of TGF\u03b2 secretion. The analysis was performed using the Human TGF\u03b21 Immunoassay Quantikine ELISA Kit  according to the manufacturer\u2019s instructions. The optical density was determined using a Synergy\u2122 HT Multi-Mode Microplate Reader  at a wavelength set to 450\u2009nm.Five days after isolation of macrophages from the blood of healthy donors (see above), macrophages were labeled with the red membrane dye DilC, according to the manufacturer\u2019s instructions . Gluc-CC and Gal-CC were harvested and labeled with PKH67 green fluorescent cell membrane labeling dye (Sigma) according to the manufacturer\u2019s instructions. Labeled cells were seeded together with labeled macrophages during 24\u2009h. Afterwards, macrophage-mediated\u00a0phagocytosis (DilC+/PKH67+ cell percentages) was determined using the AttuneNxT cytometer (Thermo Fisher Scientific), and data were analyzed with the FlowJo 9.3 software .Seven days after isolation and expansion of T cells from the blood of healthy donors, T cells were activated with phytohemagglutinin-P  at a concentration of 5\u2009\u03bcg/ml and with 20\u2009ng/ml of human rIL-2  for 7 days. Gluc-CC and Gal-CC were harvested and co-seeded with activated T cells during 10 days. Afterwards, T cells were removed and the extent of cytotoxicity was determined with the ToxiLight\u2122 Bioassay Kit  using a bioluminescence GLOMAX Luminometer (Promega). The data were analyzed with the Prism 8 software .t test to determine significance, two-way ANOVA with Tukey\u2019s multiple comparisons test, or unpaired two-sided  t test for multiple comparisons using the Holm\u2013Sidak method were used to determine differences between means of groups. p Values < 0.05 were considered statistically significant. GraphPad software  was used to perform the statistical analysis of the data.Results are presented as means\u2009\u00b1\u2009standard deviation (stdev) or \u00b1standard error of the mean (SEM), as indicated in the figure legends. Different two-sided statistical analyses were performed: one-way analysis of variance  with Bonferroni adjustment or with an unpaired two-tailed n\u2009=\u20091 (Figs.\u00a0n\u2009=\u20092 (Figs.\u00a0n\u2009=\u20093 (Figs.\u00a0n\u2009=\u20094 (Figs.\u00a0The number of biologically independent samples are indicated in the figure legends. Repeated independent experiments per each panel with similar results are shown below. \u20091 Figs.\u00a0, 7a\u2013d; n\u20092 Figs.\u00a0, 5b, h\u2013k\u20093 Figs.\u00a0, 6d\u2013f, n\u20094 Figs.\u00a0, 2f.Further information on research design is available in the\u00a0Supplementary InformationPeer Review FileReporting Summary"}
+{"text": "The theory of language must predict the possible thought\u2014signal (or meaning\u2014sound or sign) pairings of a language. We argue for a Meaning First architecture of language where a thought structure is generated first. The thought structure is then realized using language to communicate the thought, to memorize it, or perhaps with another purpose. Our view contrasts with the T-model architecture of mainstream generative grammar, according to which distinct phrase-structural representations\u2014Phonetic Form (PF) for articulation, Logical Form (LF) for interpretation\u2014are generated within the grammar. At the same time, our view differs from early transformational grammar and generative semantics: We view the relationship between the thought structure and the corresponding signal as one of compression. We specify a formal sketch of compression as a choice between multiple possible pronounciations balancing the desire to transmit information against the effort of pronounciation. The Meaning First architecture allows a greater degree of independence between thought structures and the linguistic signal. We present three arguments favoring this type of independence. First we argue that scopal properties can be better explained if we only compare thought structures independent of the their realization as a sentence. Secondly, we argue that Meaning First architecture allows contentful late insertion, an idea that has been argued for in Distributed Morphology already, but as we argue is also motivated by the division of the logical and socio-emotive meaning content of language. Finally, we show that only the Meaning First architecture provides a satisfying account of the mixing of multiple languages by multilingual speakers, especially for cases of simultaneous articulation across two modalities in bimodal speakers. Our view of the structure of grammar leads to a reassessment of priorities in linguistic analyses: while current mainstream work is often focused on establishing one-to-one relationships between concepts and morphemes, our view makes it plausible that primitive concepts are frequently marked indirectly or unpronounced entirely. Our view therefore assigns great value to the understanding of logical primitives and of compression. Several species show evidence of the formation of complex mental representations for aspects of their social and physical environment as well as their planned actions  or it may be a set of mathematical entities as in model-theoretic approaches to semantics. The latter view provides many advantages in our opinion, but this is not the place to argue in favor of it as we can remain agnostic.One of our basic assumptions is that of a set of primitive concepts thought is as follows: let C be the set of primitive concepts, and MC be the set of unordered, binary trees over C. MC is the set of (possible) concepts. For our current purposes, we can assume that all possible concepts are actual concepts, but work on concept combinations frequently assumes further well-formedness restrictions, e.g., of a type-theoretic nature  thought iff. there is a possible world such that w \u22a7c.Furthermore, let \u22a7 be a partial relation between a possible world Merge in Chomsky  of the language including a null message \u2205. For concreteness, the reader may assume that the set of messages is a set of strings, i.e., a free monoid with concatenation over a set of articulatory feature structures. Exponence relations may furthermore be subject to a context restriction. A context restriction r is derived by replacing from a concept r\u2032 one node or subtree with the symbol \u201c\u201d.c\u2192e\u2223r to indicate c can be exponed by e if r is satisfied. We understand that an occurrence of c as a part of structure s satisfies r iff. there is a node c\u2032 of s containing the occurrence of c such that replacing that occurrence of c with  renders c\u2032 and r identical. For example, the present tense, present, can be exponed in English either with \u201cdo\u201d or, if a direct sister to verb phrase, with the null morpheme. The English grammar is captured by the two exponence relations in (2).Now we turn to compression. A minimal formal characterization of compression is based on the exponence relation \u2192 of Distributed Morphology , is defined as c\u2192m\u2223r in c\u2032 or c is structure with the two subconstituent c1 and c2 and m is the concatenation of m1 and m2 in the order \u2113 of the linearization functionc\u2223\u2203s c\u21d2s}. Assuming for simplicity that we, like, and linguistics are primitive concepts and exponed by \u201cwe,\u201d \u201clike,\u201d and \u201clinguistics,\u201d respectively, (3-a) is predicted to have two exponents, (3-b) and (3-c).We define a general exponence relation \u21d2 that derives sentences by recursive reference to \u2192 -relations and a linearization function \u2113 (see below). We define an auxiliary notion of compression to capture manner implicatures  with k(\u2205) = 0 and k(ab)\u2265k(a) and k(ab)\u2265b. Furthermore we assume that there is a measure of probability of understanding specific thoughts by the receiver of m, i.e., a probability distribution P(\u2014\u2223m) on the set of expressible thoughts.Example (3) illustrates a problem: (3-b) and (3-c) intuitively do not mean the same. We still need to account for the fact that only (3-b) may be used to express (3-a). We do so by introducing the notion of compression function as follows: E is a compression function iff. E maps any expressible thought c to an exponent E(c)  and there is no cheaper message with higher likelihood of reconstructing c:m with c\u21d2m with k(m) \u2264 k[E(c)] and P({c}\u2223m)\u2265P[{c}\u2223E(c)]. Intuitively, a compression function can be understood as a licit way of relating thoughts to exponents. We will say that c can be expressed as sentence s if there is a compression function mapping c to s.Finally we define a 1 maps (3-a) to (3-b), and E2 maps (3-a) to (3-c). Assume also that both (3-b) and (3-c) have probability 1 of being understood as (3-a), as seems reasonable if (3-a) is the only thought that could be expressed as either. But if the cost k(\u201cdo\u201d) is greater than 0, the cost of (3-b) will be less than the cost of (3-c). These assumptions taken together entail that E2 is not a compression function because the cost of (3-c) is greater than that of (3-b) while the likelihood of c being understood is the same for both sentences. E1, however, is a compression function.Compression can derive the manner implicature in example (1) as follows: If (3-a) is the only expressible thought, there are two candidates for a compression function: Ec if there is a compressed way of expressing c, even if periphrasis is a possible exponent of c. Two classical cases that can be handled in the same way are the relation of \u201ckill\u201d to \u201ccause to die\u201d , where Boolean and is not directly applicable. Adapting a proposal by Winter , but required in Italian (8-b).That compression applies with different results in different languages is, we believe, frequently the case. The cross-linguistic variation of kind reference is another case in point. Chierchia  discusseEffability Hypotheses that each conceivable thought can be expressed verbally Beyond the concrete analyses discussed in this section already, compression also has some theoretical utility for understanding the The presence of unpronounced material in linguistic structure, and in particular in the three cases of compression presented above, is debated in linguistics. The debate concerns the relation between conceptual structure and articulated form: is the relation between the two rather \u201csimple\u201d and \u201cdirect,\u201d or rather is the thought internal concept composition uniform? Much research in linguistics has favored a one-to-one mapping between the primitive concepts and articulated linguistic elements as illustrated by (7) \u2013for example, both Cognitive Grammar  affects scopal relations. Initial empirical evidence came from data such as (9)  indicates the presence of a primitive concept, pass  argues against the Generative Semantics account where (9-b) and (9-c) articulate the same conceptual structure as (9-a). But the Meaning First approach assumes that three different conceptual structures underlie the sentences in (9) . Thirdly, while the difference between roots and functional morphemes is descriptively useful, there is little evidence to argue that it affects the basic generative system. These arguments led Marantz to propose that Vocabulary \u201cis the output of a grammatical derivation, not the input to the computational system\u201d , with a phonetic variant , quoted \u201cdog,\u201d spelled d-o-g, or lengthened dooog, and all variants serve to communicate some further layers of meaning such as the speaker's attitude toward dogs or a particular dog, but also other aspects of the speaker's state of mind. Semantic research has found, though, that semantic meaning can be broadly divided into two; we use the terms logical and socio-emotive meaning , but not logical meaning.Consider first that any use of the morpheme t Labov, , with ang Potts, .22 We asg Potts, . For exapresident occurs in two positions. We propose furthermore that socio-emotive content can affect the process of realization at each occurrence.The Meaning First approach can predict the relevant identity requirement by assuming the conceptual representation sketched in (11) for all exponents in (10), where the concept K\u00f6ter (\u201cfleabag\u201d) is not present in B's utterance.Our novel evidence in (12-a) shows that this mechanism can also lead to clear-cut cases of late insertion of a root.dog concept. We write these as in (14), where in (14-a) socio-emotive side effect of the exponent are indicated as explained in the following. For ellipsis licensing, we assume that only the conceptual level matters.Adopting ideas of Adger and Smith , we assuIntrusion for cases where socio-emotive content affects exponence. Consider briefly a starting point toward a model of intrusion: Assume that there is a function a mapping an exponent e and a socio-emotive property p to one of \u22121, 0, and 1. The arrow notations in (14-a), we take to indicate that a = 1 and a = \u22121, while the value of a is 0 whenever it is not indicated. For some properties, speakers aim for the closest possible match between concept exponed and the socio-emotive properties of the exponent. This is responsible for intrusive use of K\u00f6ter instead of Hund for dog by individuals disgusted by dogs. Furthermore speakers can adopt targets for properties like \u201cformal\u201d that they consider appropriate for a specific situation, e.g., \u03c4formal = 1. If we evaluate closest fit by the Euclidean distance between the target disgust-formal pair and the disgust-formal pair of the exponent, we correctly predict intrusive uses of \u201cHund\u201d by dog-haters in situations they perceive to require formal speech. The model we layed out is evidently a toy model that is insufficient to capture all relevant phenomena  from the feminine class in German must be marked with feminine morphology i K\u00e1ss-a (\u201cthe cash register\u201d) in code-mixing, even though the Greek translation tami-o (\u201ccash register\u201d) belongs to the neuter class. Cases of such sub-lexical mixing argue that language mixing is based on an integrated language-independent structural representation as both Distributed Morphology and the Meaning First approach assume. The realization mechanism can then be switched at certain points while a structure is realized (L\u00f3pez et al., Work on code-mixing has shown that bilinguals use different vocabulary items to realize a unified abstract structure. For example, Alexiadou  and AlexCode-blending provides evidence that favors the Meaning First approach over Distributed Morphology. Code-blending involves a mix of signed and spoken utterances which are to some extent produced simultaneously in the two modalities by bimodal speakers (Emmorey et al., Though Branchini and Donati  suggest NOT WORRY SMALL PROBLEM with English Don't cry over over spilled milk.\u2014i.e., meaning parallelism without morphological parallelism\u2014is judged much more acceptable than the reverse. The Distributed Morphology view does not predict an interpretive link of this kind: the English grammar should independently of the ASL grammar select either the idiomatic or non-idiomatic interpretation. However, the Meaning First approach predicts that the interpretations must be the same since both structures must derive from the same thought structure.The view of Branchini and Donati  would fuWe have presented three arguments for the Meaning First approach to grammar. This approach proposes that language structure derives from the structure of logical thought as sketched in bonus\u2013melior-*bonimus is not a possible human language.A central goal of linguistic theory is to predict the set of possible languages; i.e., those learnable by typical individuals. How does the Meaning First approach constrain the set of possible languages? In two important domains, it can build on existing lines of research: the work by G\u00e4rdenfors  on constmutatis mutandis to constraints in other components of the model such as concept combination, intrusion, and the possible cyclic conception of the Meaning First approach. We expect though that the focus on primitive concepts and their exponence on the Meaning First approach provides a better space to integrate such work than frameworks like Montague grammar (Montague, Painstaking empirical work such as Bobaljik's remains necessary to establish constraints on how both basic concepts and the compression component are constrained on the Meaning First approach as much as for other approaches. These remarks apply linguistic relativity, Deutscher, The Meaning First approach therefore has major repercussions for how we investigate language and thought. First of all, we cannot separate the study of the two if grammatical structure is derived from thought structure. But the presence of compression and intrusion also means that a thought structure may differ substantially from the sentence used to communicate it. In particular, the thought structure may be much more complex\u2014for all we know, language may achieve compression rates of 10 primitive concepts to one morpheme or even 100:1. Furthermore, the Meaning First approach provides two different avenues language may affect thought (i.e., the phenomenon of The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.US and AA conceptualized the paper and wrote the final paper. US wrote the first draft of the paper. Both authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Circular RNA (circRNA) is a class of newly discovered endogenous non-coding RNA with closed circular structure. Some circRNAs have been reported to be closely associated with acute lung injury (ALI). While the expression profile of circRNAs in lipopolysaccharide (LPS)-induced ALI and the underlying roles are still not completely clear. The LPS-induced ALI model of MRC-5 cells was first established, and the expression profiles of circRNAs and mRNAs in LPS-induced MRC-5 cells were confirmed through RNA sequencing analysis. Gene Ontologyanalysis and Kyoto Encyclopedia of Genes and Genomes pathway analysis were also applied to predict the latent functions and pathways of the differential mRNAs. After hsa_circ_0059930 knockdown, the proliferation and apoptosis of MRC-5 cells were identified by CCK-8, flow cytometer, and western blot assays. And we predicted the network analysis of hsa_circ_0059930. We testified that LPS could markedly prevent proliferation and induce apoptosis of MRC-5 cells. We discovered a total of 820 differential circRNAs (560 upregulated and 260 downregulated circRNAs) and 484 differential mRNAs (240 upregulated and 244 downregulated mRNAs) in LPS-induced MRC-5 cells. Besides, hsa_circ_0059930 was identified to be significantly upregulated in LPS-induced MRC-5 cells, and knockdown of hsa_circ-0059930 could notably accelerate proliferation and suppress apoptosis of LPS-mediated MRC-5 cells. Moreover, through the network analysis of hsa_circ_0059930, we preliminarily screened the potential regulatory axis hsa_circ_0059930/hsa-miR-382-5p/Topoisomerase 1 (TOP1) in LPS-induced ALI. Our data contribute to understand the importance of circRNAs and mRNAs in LPS-induced ALI. We also provided many hsa_circ_0059930-mediated microRNA (miRNA)\u2013mRNA axis, especially hsa_circ_0059930/hsa-miR-382-5p/TOP1 in LPS-induced ALI.  Sepsis is a systemic inflammatory response syndrome (SIRS), which is caused by severe trauma, shock, massive blood loss, reperfusion injury, and major surgical operation. Lung is the most vulnerable target organ in sepsis. And acute lung injury/acute respiratory distress syndrome (ALI/ARDS) is an early stage of sepsis. ALI is acute and progressive respiratory failure caused by various pathogenic factors, such as severe infection, shock, acute pancreatitis, trauma, burns, and inhalation of harmful gases ,2. ALI iA large number of data exhibited that genes that encode function only account for about 1% of the total genomes, and the remaining transcriptional products are non-coding RNAs (ncRNAs) that do not encode proteins ,12. In rIn this study, we further filtrated abundant differential circRNAs and mRNAs using RNA sequencing technology in LPS-induced MRC-5 cells. Potential functions and pathways of the dysregulated mRNAs also were predicted by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Besides, we confirmed the impacts of the selected hsa_circ_0059930 on LPS-induced MRC-5 cells. More importantly, we also predicted the miRNAs\u2013mRNAs, which might be regulated by hsa_circ_0059930 in LPS-induced ALI. Therefore, our results might provide many potential circRNAs and hsa_circ_0059930-miRNA\u2013mRNA axis in LPS-induced ALI, which might be potential biomarkers and therapeutic targets for LPS-induced ALI patients.2 at 37\u00b0C. Cell models of lung injury were constructed in the cultured MRC-5 cells, which were administrated with 100\u00a0ng/ml LPS  at 37\u00b0C for 24\u00a0h. MRC-5 cells in negative control (NC) group were added with phosphate belanced solution (PBS). A corresponding siRNA negative control (siNC) (5\u02b9-UUCUCCGAACGUGUCAGGUUU-3\u02b9) and the siRNA targeting hsa_circ_0059930 (5\u02b9-GUUCAGAAAGUACCAUGCAUU-3\u02b9) were synthesized from RiboBio Co., Ltd.  for knockdown of circ_0008934 expression. Cells were seeded into a 6-well plate until approximately 60% confluence, and then transfected with NC or hsa_circ_0059930 siRNAs by using Lipofectamine 3000 (Invitrogen).MRC-5 cells were from American Type Culture Collection (ATCC) . And MRC-5 cells were cultured in Eagle\u2019s Minimum Essential Medium  containing 10% fetal bovine serum  and 1% penicillin streptomycin solution  in an incubator with 5% CO4 cells/mL) were seeded into a 96-well plate and added with or without 100\u00a0ng/ml LPS at 37\u00b0C for 24\u00a0h. After 24, 48, and 72\u00a0h of incubation, cells in each well were added with 10\u00a0\u03bcL CCK-8 solution . After an additional 2\u00a0h of incubation, we adopted a Microplate Reader  to measure the absorbance at 450\u00a0nm.MRC-5 cells were collected and prepared into a single-cell suspension. MRC-5 cells (5\u00a0\u00d7\u00a0109 cells/L. The MRC-5 cells were then added with 5\u00a0\u03bcL 7-AAD (7-aminoactinomycin D) and 5\u00a0\u03bcL Annexin V-APC  for 10\u00a0min away from light. The number of apoptotic MRC-5 cells was identified using the FACS Calibur\u2122 flow cytometer (Becton-Dickinson).MRC-5 cells in NC and LPS groups were harvested and the cell density was adjusted to 1\u00a0\u00d7\u00a010The total protein was extracted from MRC-5 cells in NC and LPS groups using radio-immunoprecipitation assay (RIPA) buffer  containing 1% protease inhibitor . Protein concentration was determined by applying the bicinchoninic acid (BCA) protein kit . Also, 50\u00a0\u03bcg proteins were detached on the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) by electrophoresis (120\u00a0V for 90\u00a0min), then transferred to the polyvinylidene fluoride (PVDF) membranes. After sealing with 5% skim milk at room temperature for 90\u00a0min, the membrane with target protein were added with anti-Bax1 , anti-Bcl2 , and anti-GAPDH  overnight at 4\u00b0C, respectively. After washing, the membranes were treated with second antibody at room temperature for 60\u00a0min. The results were visualized by applying the electrochemiluminescence (ECL) kit .Total RNAs were isolated using TRIzol reagent . The quality of the RNAs was assessed, and the RNA concentration was determined using Nanodrop ND-1000 . The purity and integrity of RNA were verified by the 1% denaturing agarose gel electrophoresis. When absorbance ratio of 260/230 was greater than 2.0, absorbance ratio of 260/280 was in the range between 1.8\u20132.0, and 5S, 16S, and 28S were observed in agarose gel electrophoresis without smear, and RNA was used for further analysis.The purified RNAs were then handled with the RNase, amplified, and labeled based on the Arraystar\u2019s Super RNA Labeling (Arraystar Inc.). The library was constructed using the purified RNAs, and Qubit\u00ae 2.0 fluorometer  and Agilent 2100  were applied to confirm the concentrations and sizes of libraries. Next, the Illumina HiSeq 2000 System was adopted to quantitatively examine the library, and edgeR software was utilized to analyze the differential genes and circRNAs.https://david.ncifcrf.gov/) [http://kobas.cbi.pku.edu.cn/) [P value was used as the screening criteria.GO enrichment of the differential mRNAs was determined through the Bioinformatics Tool , version 6.8, rf.gov/) ,28. KEGGedu.cn/) . The numRNase R (3\u00a0U/\u03bcg) was added into total RNA (2\u00a0\u03bcg) and incubated for 10\u00a0min at 37\u00b0C. Then RNA was used for RT-PCR followed with separation of products in 1.8% agarose gel electrophoresis.The purified RNAs were utilized to reverse transcribe into cDNA (complementary DNA) in line with the experimental instructions of the First Strand cDNA Synthesis Kit . RT-PCR assay was conducted on the 1.8% agarose gel by electrophoresis, and the results were displayed using the ultraviolet gel imaging system . And the amplification products by divergent primers were applied to conduct Sanger sequencing . qRT-PCR assay was performed through SYBR Green qPCR Super Mix , and the results were gained using the ABI PRISM\u00ae 7500 Sequence Detection System. All primer sequences are exhibited in Based on previous research ,30, we at-test or one-way analysis of variance (ANOVA). P <\u00a00.05 signified significant difference.The data were emerged as mean \u00b1 standard deviation (SD). The results were counted through SPSS 23.0 software  with Student\u2019s CircRNAs have been reported to participate in ALI progress. However, many circRNAs in ALI still need to be further explored. In this study, we further filtrated abundant differential circRNAs and mRNAs using RNA sequencing technology in LPS-induced MRC-5 cells. Potential functions and pathways of the dysregulated mRNAs were predicted by GO and KEGG pathway analysis. Then, the impacts of the selected hsa_circ_0059930 on LPS-induced MRC-5 cells were tested by by CCK-8, flow cytometer, and western blot assays. In addition, hsa_circ_0059930\u2013miRNA\u2013mRNA network was constructed, and potential mRNA was further verified. Therefore, our results might provide many potential circRNAs and hsa_circ_0059930\u2013miRNA\u2013mRNA axis in LPS-induced ALI, which might be potential biomarkers and therapeutic targets for LPS-induced ALI patients.P <\u00a00.001, In previous study, cell model of ALI can be established through LPS disposition . We alsoTo further search the potential circRNAs, the expression profile of circRNAs was created through the RNA sequencing between LPS-induced and non-induced MRC-5 cells. A total of 820 circRNAs were discovered to be differentially expressed in the LPS-induced MRC-5 cells, including 560 upregulated and 260 downregulated circRNAs. And the expression profile of differential circRNAs was also presented through the hierarchical clustering analysis  and volcP <\u00a00.01, P <\u00a00.001, P <\u00a00.05, P <\u00a00.01, In accordance with the expression profile of differential circRNAs in LPS-induced MRC-5 cells, we filtered and validated the top three upregulated circRNAs with the largest difference between two groups  and the top three downregulated circRNAs with the largest difference between two groups  using qRT-PCR and RT-PCR assays. Our results uncovered that hsa_circ_0000002 and hsa_circ_0059930 were highly expressed in the LPS model group with respect to the NC group, which conformed to the sequencing results. Meanwhile, the circular structures of hsa_circ_0000002, hsa_circ_0059930, and hsa_circ_0001136 were validated through PCR assay, which hsa_circ_0000002, hsa_circ_0059930, and hsa_circ_0001136 could only be amplified by divergent primers in cDNA (http://www.circbase.org/), we showed the possible formation of hsa_circ_0059930, which was formed from the exons 2\u20136 on chromosome 20. Next, Sanger sequencing was conducted using the amplification products by divergent primers, and the results proved that hsa_circ_0059930 was circular (P <\u00a00.001, P <\u00a00.001, Subsequently, we further probed the impacts of hsa_circ_0059930 on the proliferation and apoptosis of LPS-induced MRC-5 cells. Firstly, based on the circbase database (circular . We alsocircular . SecondlTo further determine the possible downstream molecular mechanisms of hsa_circ_0059930, we further determined the differentially expressed mRNAs between LPS induced and LPS non-induced MRC-5 cells through RNA-sequencing. And compared with MRC-5 cells, a total of 484 differentially expressed mRNAs were discovered in the LPS-induced MRC-5 cells, which contained 240 upregulated mRNAs and 244 downregulated mRNAs. Meanwhile, a hierarchical clustering analysis was utilized to visualize the upregulated or downregulated mRNAs in the LPS model group compared to the NC group . Also, wP <\u00a00.05, P <\u00a00.01, Combined with circRNA and mRNA sequencing data, we further conducted bioinformatics analysis of possible target genes of hsa_circ_0059930. And the network analysis of hsa_circ_0059930 is displayed in Sepsis is the leading cause of death in critically ill patients. And ALI/ARDS is the most frequent complication of sepsis . In clinCircRNA, as a class of ncRNA with a closed structure, has been reported to be relevant to plentiful disease processes, including cardiovascular disease , neuroloCircRNA has also been proven to have a variety of biological functions, such as regulating transcription or splicing, acting as a sponge for miRNA, interacting with RNA-binding proteins and translating proteins . In our in vivo and in vitro experiments.However, our study only preliminarily screened many potential differential circRNAs, mRNAs, and hsa_circ_0059930-related miRNAs/mRNAs, and preliminarily determined hsa_circ_0059930/hsa-miR-382-5p/TOP1 axis in LPS-induced MRC-5 cells. The relationship between hsa_circ_0059930 and hsa-miR-382-5p, hsa-miR-382-5p, and TOP1 should be verified via double luciferase activity assay and RNA IP experiment. The specific functions and mechanisms of hsa_circ_0059930/hsa-miR-382-5p/TOP1 axis also need to be further validated through In conclusion, we for the first time defined and screened out the differential circRNAs and mRNAs in LPS-induced MRC-5 cells and revealed that the dysregulated mRNAs mainly were relevant to the TNF and NF-\u03baB signaling pathways and participated in cell process. Meanwhile, we suggested that the identified hsa_circ_0059930 might be the novel therapeutic targets for the LPS-induced ALI. Moreover, we predicted 261 potential hsa_circ_0059930-related miRNA/mRNA axis, especially hsa_circ_0059930/hsa-miR-382-5p/TOP1 axis in LPS-induced MRC-5 cells. Therefore, our research may provide potential circRNAs and possible regulatory axes for the diagnosis and treatment of ALI.Click here for additional data file."}
+{"text": "Next-generation sequencing (NGS), through the implementation of metagenomic protocols, has led to the discovery of thousands of new viruses in the last decade. Nevertheless, these protocols are still laborious and costly to implement, and the technique has not yet become routine for everyday virus characterization. Within the context of CRESS DNA virus studies, we implemented two alternative long-read NGS protocols, one that is agnostic to the sequence  and the other that use specific primers to target a virus (with a priori). Agnostic and specific long read NGS-based assembled genomes of two capulavirus strains were compared to those obtained using the gold standard technique of Sanger sequencing. Both protocols allowed the detection and accurate full genome characterization of both strains. Globally, the assembled genomes were very similar (99.5\u201399.7% identity) to the Sanger sequences consensus, but differences in the homopolymeric tracks of these sequences indicated a specific lack of accuracy of the long reads NGS approach that has yet to be improved. Nevertheless, the use of the bench-top sequencer has proven to be a credible alternative in the context of CRESS DNA virus study and could offer a new range of applications not previously accessible. Recent advances in metagenomics applied to viruses has fostered a greater inventory of the viral diversity ,2,3,4. HYet, as access to metagenomics is usually costly and requires sophisticated technical expertise in data management and analysis ,24; for Cressdnaviricota phylum), we harness the power of third-generation sequencing for routine full genome assembly of viruses. A breakthrough in CRESS DNA virus studies was associated with the development of protocols using isothermal rolling circle amplification (RCA) in frequent association with enzymatic restriction, cloning and Sanger sequencing [Geminiviridae family in particular [Here, within the context of the study of circular replication-associated protein encoding single stranded (CRESS) DNA viruses , the standardization of RCA based protocols lead to an explosion of its known diversity and the family regularly counts new genus-level lineage addition [cp) [Aphis Craccivora [Dysaphis plantaginea [Two alternative protocols for use on the MinION bench-top sequencing device were designed in this study and the assemblies of the nanopore-sequenced reads of multiple strains of capulaviruses infecting a ea plant  were come family . This fae family ,49. Wheraddition ,50,51,52addition . Their gion [cp) . It is kntaginea .Our analysis revealed that MinION sequencing followed by read assembly results in genome sequences mostly similar to the consensus of the virus population that was obtained after Sanger sequencing of multiple isolates. The two alternate protocols used, one that does not required knowledge of the viruses present within the sample (without a priori) and the other designed to specifically amplify a given virus (with a priori), were successful for full genome assembly of the two capulavirus strains. MinION assembled consensus sequences present with more differences in the homopolymeric tracks but remain closely related to any sequence of the sample than any Sanger sequence to one another. Overall, both nanopore-based protocols are adapted to the genome size of the CRESS DNA viruses and the cost of the method is on par with the Sanger sequencing approach.Medicago arborea were collected in November 2019 at Montferrier-sur-Lez (France). The sample was stored at \u221220 \u00b0C before use. Total DNA was extracted using the DNeasy Plant DNA extraction kit , following the manufacturer\u2019s instructions. DNA extract was stored at \u221220 \u00b0C before use. From a previous analysis [Leaf samples of an apparently asymptomatic analysis , using a\u00ae Master Mix Kit  and the following conditions: an initial denaturation at 95 \u00b0C for 5 min, 8 cycles at 94 \u00b0C for 30 s, 60 \u00b0C for 30 s, 72 \u00b0C for 3 min, and a final extension step at 72 \u00b0C for 10 min. A common second amplification step was then performed using the primer pair (3580F: 5\u2032-ACT TGC CTG TCG CTC TAT CTT C-3\u2032 and PR2: 5\u2032-TTT CTG TTG GTG CTG ATA TTG C-3\u2032) and the GoTaq\u00ae Master Mix Kit . The amplification conditions were as followed: an initial denaturation at 95 \u00b0C for 5 min, 25 cycles at 94 \u00b0C for 30 s, 60 \u00b0C for 30 s, 72 \u00b0C for 3 min, and a final extension step at 72 \u00b0C for 10 min. Amplification products of approximately 2.7\u20132.8 kb were gel purified, ligated to pGEM-T  and sequenced by standard Sanger sequencing using a primer walking approach.Pairs of abutting primers were designed to recover the full-length genome of TrV1-B and TrV1-C isolates. A two-step amplification was achieved, including a first amplification step using either the primer pair 3580F-CAPULUZARB-1F: 5\u2032-ACT TGC CTG TCG CTC TAT CTT CTC CCT TGG AGA TGT AAT CTG CCA CGT CAG-3\u2032, and PR2-CAPULUZARB-2R: 5\u2032-TTT CTG TTG GTG CTG ATA TTG CGG AGT TTT TGA GGA ACG AGG AAT ACT TAG AGC TTC A-3\u2032 for amplifying TrV1-B genomes or the primer pair 3580F-CAPUCORO-1F: 5\u2032-ACT TGC CTG TCG CTC TAT CTT CAA CTG TCC TCC CTT TGC AAT GTA GTC AGC C-3\u2032 and PR2-CAPUCORO-2R: 5\u2032-TTT CTG TTG GTG CTG ATA TTG CCG AGG AGC GAG GAC TTC TTA AGG CAA GT-3\u2032for amplifying TrV1-C genomes. Amplification was carried out using the GoTaqPhi29 DNA polymerase  by mixing 2 \u00b5L of total plant DNA extract with 5 \u00b5L of Sample Buffer before incubation at 95 \u00b0C during 3 min. After cooling at room temperature, 0.2 \u00b5L of enzyme mix and 5 \u00b5L of Reaction Buffer were added before incubation at 30 \u00b0C for 6 h followed by 20 min of polymerase deactivation at 65 \u00b0C. RCA products were cleaned-up using 2\u00d7 of Sera-Mag Select Size Selection beads  and the 10 \u00b5L eluate were digested with 1 \u00b5L of T7 Endonuclease I (NEB), 2 \u00b5L of 5\u00d7 buffer in a 10 \u00b5L reaction volume at 37 \u00b0C during 1 h. The fragments were purified with a 1\u00d7 Sera-Mag Select Size Selection beads and eluate with 10 \u00b5L of purified water. Library construction for MinION sequencing was performed using the PCR Barcoding Kit (SQK-PBK004), following the manufacturer\u2019s instructions but using SeraMag Select Size Selection beads  for DNA purification. Sequencing was performed as described below for the PCR-MinION procedure. Two Flongles (flow cell dongle) FLO-FLG001 were used for sequencing. Whereas in the first Flongle, a single RCA amplicon was sequenced, in the second, three distinct RCA amplicons were multiplexed.Two alternative protocols for MinION sequencing were used. In the first protocol, called hereafter the RCA-MinION protocol, a RCA amplification was performed using \u00ae Master Mix Kit  were employed. The amplification conditions were as follows: an initial denaturation at 95 \u00b0C for 5 min, 15 cycles at 94 \u00b0C for 30 s, 60 \u00b0C for 30 s, 72 \u00b0C for 3 min, and a final extension step at 72 \u00b0C for 10 min. The second amplification step was performed using the cDNA Primer (cPRM) supplied in the PCR-cDNA Sequencing Kit (SQK-PCS109) and the LongAmp Taq 2X Master Mix Kit . The amplification conditions were as followed: an initial denaturation at 95 \u00b0C for 30 s, 20 cycles at 95 \u00b0C for 15 s, 62 \u00b0C for 15 s, 65 \u00b0C for 3 min, and a final extension step at 65 \u00b0C for 6 min. The amplicons were purified using Agencourt AMPure XP beads  and MinION sequencing library was constructed using the PCR-cDNA Sequencing Kit (SQK-PCS109), following manufacturer\u2019s instructions. Sequencing was then performed on Flongle (FLO-FLG001) using MinKNOW software 19.06.8. Three Flongles were used, two for TrV1-B (Flongle 13 and Flongle 14) and another one for TrV1-C (Flongle 15).In the second protocol, called hereafter the PCR-MinION protocol, a two-step amplification was carried out. In the first PCR, both sets of abutting primers (3580F-CAPULUZARB-1F/PR2-CAPULUZARB-2R and 3580F-CAPUCORO-1F/PR2-CAPUCORO-2R) described above for respectively amplifying the genomes of strains TrV1-B and TrV1-C and the GoTaqFor the reads obtained through the two MinION protocols, accurate basecalling was performed using Guppy . DemultThe demultiplexed reads obtained from RCA-MinION procedure were assembled with FLYE 2.6 , using tAll the available capulavirus full genome sequences were downloaded from GenBank on 4 March 2021 and aligned with the sequences of strains TrV1-B and TrV1-C obtained after Sanger sequencing using MAFFT v7.475 . A maximSequences obtained using the three distinct protocols  were aligned together with MAFFT v7.475 before manual edit of the alignment. A home-made R script was used for sequence comparison and mutation count. Mutations were classified in three categories: substitution, insertion/deletion (INDEL) and homopolymer length variation (HLV) . ML treen = 19), sequences present with identity ranging from 99.5 to 100% with each other and were most similar to the isolate BG2_capuz_47 of the B strain of TrV1 (GenBank accession number MW698819) with a minimum identity of 99.7%. Within the second clade (n = 27), sequences present identity ranging from 99.0 to 100% with each other and were most closely related to the isolate BG2_coro_02\u20132 of the C strain of TrV1 (GenBank accession number MW698820) with a minimum identity of 99.1%. Therefore, our two groups of sequences belong to two distinct strains (TrV1-B and TrV1-C) of the capulavirus Trifolium virus 1 species  and a long intergenic region (LIR), a characteristic inverted repeat potentially capable of forming a stem\u2013loop structure that included a conserved nonanucleotide sequence TAATATTAC present at almost all geminivirus virion-strand replication origins, the cp, a spliced complementary-strand intron-containing transcript which expresses replication-associated protein gene (rep), a large complementary-sense ORF (C3) that is completely embedded within the rep gene, and a complex arrangement of possible MP-encoding ORFs located in the 5\u2032 direction from the cp gene, which is a unique feature of Capulavirus genomes [A total of 46 sequences were obtained after cloning and Sanger sequencing. These sequence groups in two distinct clades  that sha species . It is iMedicago arborea sample , 371,700 (89.6%), and 714,730 (93.0%) reads passed the quality control . The medIn order to more precisely determine the nature of the differences between the sequences obtained through the different procedures, per capulavirus strains, all the full genome sequences obtained were compared to the consensus of the Sanger sequences. With more than 99.1% nucleotide identity for both the RCA-MinION and PCR-MinION sequences, the two methods demonstrate their ability to recover full genomes that are accurately assigned to strains TrV1-B and -C and whose sequence are representative of the viral population they originate. However, none of the assemblies obtained from MinION sequences was 100% identical to the Sanger sequence.Beside mis-assemblies , these sites had globally more mutations among all the Sanger sequences . Whereas sequencing errors can explain a fraction of the mutation, with the high accuracy of Sanger sequencing in mind  mostly with substitutions (accounting for 79.5% of the variations) and more marginally with HLVs (19.4% of the variations) and INDELs (1.5% of the variations) . Except re of 50 ), one care of 50 ,75,76.The analysis of the RCA-MinION and PCR-MinION sequences revealed a different pattern of polymorphism. Two sequences, one of TrV1-B and one of TrV1-C, both assembled from a restricted number of reads  were, as expected, less accurate. Coverage of the assembly,  is therefore a good indicator of the reliability of the resulting assembly . Among tDefective genomes are frequently detected within geminivirus populations . For insMedicago arborea, two distinct strains of the capulavirus TrV1 have been cloned and sequenced by the Sanger methodology. Using both the a priori and the agnostic nanopore-based procedures, both TrV1-B and TrV1-C strains were detected, and full genome sequences were assembled. Despite being very similar to the consensus of Sanger sequences, mutations specific to the MinION assemblies were detected mostly within homopolymeric regions of the genomes, which is in agreement with other studies that have also pinpointed higher number of errors associated with homopolymer lengths [From an asymptomatic sample of  lengths ,79. Wher lengths , current"}
+{"text": "Amaranthus cruentus species grown in South Africa. Mature harvested grain had higher (p < 0.05) DM, CF, NDF and ADF content compared to prematurely harvested grain. There were no significant (p > 0.05) differences between CP, ADL and GE of premature and mature harvested grains. Mature harvesting resulted in higher grain Ca, P, Mg and K content. Essential amino acids spectrum and content remained similar regardless of maturity at harvest. The grains displayed an ample amount of unsaturated fatty acids; the highest percentage was linoleic acid: 38.75% and 39.74% in premature and mature grains, respectively. \u03b2-Tocotrienol was detected at 5.92 and 9.67 mg/kg in premature and mature grains, respectively. The lowest was \u03b4-tocotrienol which was 0.01 and 0.54 mg/kg in premature and mature grains, respectively. Mature harvested grain had a higher secondary metabolite content compared to premature harvested grains. The results suggest that mature harvested Amaranthus cruentus grain contain more minerals and phytochemicals that have health benefits for human and livestock immunity and gut function, which ultimately improves performance. This study concludes that A. cruentus grown in South Africa is a potential alternative cereal to major conventional cereals.This study aimed at investigating the impact of early versus normal grain harvesting on the chemical composition and secondary metabolites of  Amaranthus hipochondriacus, Amaranthus cruentus and Amaranthus caudatus. Amaranth grains contain a significant quantity of protein, which ranges between 14% and 17%, fat (5\u20139%) and starch (62%). However, Robertson and Clemants [A. cruentus grains consists of albumins, globulins, prolamins and glutelins fractions that range from 48.9\u201365%, 13.7\u201318.1% and 1.0\u20133.2% to 22.4\u201342.3% of the total protein, respectively. In addition, it contains sulphur amino acids such as methionine and cysteine [Amaranthus lipid content is also of interest because of its fatty acid profile that is characterised by three fatty acids, namely, palmitic, oleic and linoleic acids; the oil is highly unsaturated, containing more than 70% unsaturated fatty acid [Amaranthus cruentus, one of the three globally recognised grain amaranth types, has been identified as a prime candidate for pseudocereal developments.With the rising trend of the consumption of functional foods among the population, it is time to investigate alternative crops that can provide nutrients and health benefits at the same time. In addition, adverse climatic conditions have affected the yield of conventional crops, which warrants the search for alternative crops. Furthermore, the projected increase in the population to nine billion by the year 2050  has put d starch 2%. HowevClemants , the pro%, fat 5\u2013% and statty acid . All theHeteroptera and Sternorrhyncha (order Hemiptera), in particular, may occur in high abundance and diversity on pseudograin panicles including A. cruentus and Cenopodium quinoa in South Africa [A. cruentus plant are leafy vegetables (Morogo) consumed in South Africa, the nutritional composition of the grains and the optimal time of harvesting has not been fully investigated. Determination of the optimal harvesting periods is imperative to the success of future industries. This current study aimed at being a first investigation as to the effect of harvesting stage on the nutritional and chemical composition of the grain amaranth, intended for human and animal nutrition.The potential value of climate smart crops, such as amaranth, in terms of their inclusion in animal and human diets is becoming more apparent as global demand increases. Amaranth is considered a highly nutritious food crop with excellent scope in terms of the nutritional value derived from both grain and leaves . Most ofh Africa ,16. Althp < 0.05) DM, CF, NDF and ADF  contents than prematurely harvested grain . No similar results were reported on comparisons of DM, CF, NDF and ADF for prematurely and maturely harvested grain. No significant differences (p > 0.05) were observed between means for CP, ADL and GE calculated for premature and maturely harvested grains. During this study, crude protein was found to be within acceptable levels required for nutritional provision of poultry during both starter and grower diets. Significantly higher (p < 0.05) EE and ash contents  were found in mature grain compared to immature grain . Prematurely harvested grain had significantly higher (p < 0.05) starch content (37.96 g/100 g) compared to mature grain (29.11 g/100 g)  .p < 0.05) Ca, P, Mg and K contents  compared to premature harvesting . Prematurely harvested amaranth grain had a significantly higher (p < 0.05) Na content (46.99 mg/kg) when compared with mature grain (29.45 mg/kg). Significantly higher trace mineral content (p < 0.05) for Cu, Mn and Zn  were present in premature harvested grain compared to mature grain . Mature harvested grain contained significantly higher (p < 0.05) Fe (147.01 mg/kg) compared to prematurely harvested grain (104.97 mg/kg).The mineral composition of premature and mature harvested amaranth grain is presented in p > 0.05) between the essential amino acids and serine, glycine, glutamine, alanine, proline, isoleucine and phenylalanine content of premature and mature harvested grain. Premature harvested grain had a significantly higher (p < 0.05) aspartic acid content (0.71 g/100 CP) compared to mature grain (0.67 g/100 CP) (Amino acid composition of premature and mature harvested amaranth grain is shown in /100 CP) . Slight /100 CP) , but in Amaranthus cruentus grains, respectively. It contains mostly unsaturated fatty acids, which were seen to be almost similar in premature and mature grains. The dominant fatty acids in premature harvested grains were palmitic acid (15.15%), oleic acid (28.67%) and linoleic acid (38.75%). Whereas dominant fatty acids in mature harvested grains were palmitic acid (12.03%), oleic acid (30.65%) and linoleic acid (39.74%) (The oil in the current study ranged between 3.9% and 6.4% in premature and mature (39.74%) . The minAmaranthus cruentus grains, and the most dominant was \u03b2-tocotrienol (5.92 and 9.67 mg/100 g) in premature and mature grain, respectively. The lowest was \u03b4-tocotrienol which was (0.01 and 0.54 mg/100 g) in premature and mature grain, respectively  concentrations of rutin, hyperoside, tryptophan, quercetin 3-O-rhamnosyl-rhamnosyl-glucoside and kaempferol rutinoside  compared to premature harvested grain . On the other hand, the content of phenolic acids, such as ferulic acid, gallic acid, caffeic acid, p-coumaric acid and anthocyanins, was 310, 41.0, 6.5, 1.2 and 35.2 mg/kg, respectively, for premature grains and 345.20, 43.48, 9.93, 2.94 and 35.92 mg/kg, respectively, for mature grains. Ferulic acid content was significantly higher (p < 0.05) in the mature grain. O-rhamnosyl-glucoside and kaempferol rutinoside were not determined. However, these metabolites were detected but not quantified in the analysis. Normally harvested grain showed all secondary metabolites with a clear indication of the abundance of ferulic acid followed by rutin. Small contents of hyperoside and kaempferol rutinoside were observed.Secondary metabolites present in premature and mature harvested amaranth grain are shown in Amaranthus cruentus was more than 12%. Both prematurely and maturely harvested grain can confidently be used as a good source of protein. CF, NDF and ADF were significantly higher in mature harvested grain than prematurely harvested grain. To the best of our knowledge, no similar results have been reported on comparisons of CF, NDF and ADF for prematurely and maturely harvested grains. However, high fibre content was expected in mature grain due to the increased lignin, hemicellulose and cellulose, which are constituents of fibrous tissue essential for grain coat structure [In this study, the protein content of tructure . Dietarytructure . Plant-btructure .With regards to the lipid content, Soriano-Garc\u00eda et al.  reportedAmaranthus grains. The probable reason for the observed similarity in the content of amino acids may be that amino acids as building blocks for proteins are central to and present during all developmental growth stages. The values reported in the present study agree with the results reported by Soriano-Garc\u00eda et al. [Amaranthus is mostly extracted from the grain of A. cruentus and A. hipochondriacus, and the oil content ranges between 4.8% and 8.1% [Amaranthus cruentus. The consumption of unsaturated fatty acids reduces the low-density lipoprotein levels in blood and reduces the probability of cardiovascular diseases in both human and animals [A. cruentus grown in a Mediterranean environment. A. cruentus can be recommended for human and animal health due to the fact of its high content of balanced and favourable fatty acids.The results of this study indicate that both premature and mature harvested grains can supply adequate Fe to address deficiencies encountered in human and livestock. The findings also confirm the fact that amaranth grain can confidently be recommended to address the national and global issue pertaining to high animal feed cost. In addition, sodium (Na) is known to be a constituent of common salt, and it serves as an important osmotic regulator in body fluids . The reca et al. . Aspartia et al. . The speand 8.1% ,30. The and 8.1% . The linand 8.1% , who rep animals . The hig animals . The rat animals  and He e animals ; however animals  in A. crAmaranthus cruentus [A. cruentus grains with tocopherols. \u03b2-Tocotrienol and \u03b4-tocotrienol were reported to have the ability to inhibit the activity of HMG-CoA reductase, while \u03b1-tocopherol is known for its ability to increase reductase activity in both humans and animals [The tocopherols were within the range reported by Lehmann et al.  on a stucruentus , and als animals .Amaranthus cruentus proved to have ample ferulic acid content, which makes it a preferred candidate when selecting it for human and animal health purposes. Several studies indicated that daily intake of tryptophan in a supplemented diet maintains physiological processes such as tissue synthesis, feed uptake, growth, feed conversion ratio (FCR) and immunity enhancement in broiler chickens [The results of the present study agree with findings reported by Karama\u0107 et al. , who repchickens ,42. Accochickens , a dailychickens . Quercetchickens . The avechickens . Both prchickens . Accordichickens , the conA. cruentus grain was sampled from strip plantings at the Taung Experimental Farm  in the Ruth Segomotsi Mompati District of the North West Province, South Africa. Planting was conducted through direct sowing in a sandy soil. Average temperatures at the sampling site were above 22 \u00b0C during summer and below 20 \u00b0C in winter. Amaranth was sown on 6 November 2019  under dry land conditions (germinated with back-up irrigation) that received an average annual rainfall of less than 250 mm. Dual-stage grain sampling was performed from main inflorescences and related to the two-digit phenological code of the Biologische Bundesanstalt, Bundesortenamt and Chemical Industry (BBCH) scale [H) scale ,40. EarlGrains samples were dried separately at room temperature in a well-ventilated laboratory and hammer milled before sifting through a 1 mm sieve into flour in preparation for chemical analyses as described.v/v) HNO3. Calcium, magnesium, manganese, zinc, iron, sodium, potassium, copper, sulphur and phosphorus concentrations were determined via the AOAC method  [Proximate analysis for moisture, ash, crude protein (N \u00d7 6.25), fat and starch were carried out according to the standardised methods of the AOAC . Grain f.2 AOAC)  after a Amino acid separation and detection was performed via a Waters Acquity Ultra Performance Liquid Chromatograph (UPLC), fitted with a photodiode array (PDA) detector. Derivatising agent (AQC) was prepared by addition of 1 mL of dry acetonitrile to the reagent\u2014a vial containing 3 mg of AQC\u2014the vial was then heated, vortexed and sonicated to ensure the reagent dissolved completely.This required 1 \u00b5L of sample/standard solution to be injected into the mobile phase, which conveyed derivatised amino acids onto a Waters UltraTax C 18 column (2.1 \u00d7 50 mm \u00d7 1.7 \u00b5m) maintained at 60 \u00b0C. Elution of analytes off the column was performed by running a gradient. Analytes eluting off the column were detected by the PDA detector with individual amino acids coming off the column at unique retention times.Amaranthus cruentus grain was extracted using the method of STN 461011-28 (1988). Triplicate of the grain samples were extracted using a 100 mL of n-hexane in a Soxhlet. The first extraction lasted 5 h at 50 \u00b0C temperature, and then the grain was dried and extracted for the second time for 4 h. The formula used was ((m2 \u2212 m1/m) \u00d7 100) \u00d7 (100/W), where m2 is the mass of the flask with isolated oil, m1 is the mass of the empty flask; m is the mass of the weighed sample (g), and W is the dry weight (%). Methyl esters were prepared by mixing 10 mg of oil with 1 mL of n-hexane and 0.1 trans-esterificating agents (sodium methanolate in cyclohexane). In 20 min, 13% methanolic HCl (0.5 mL) was added. The solution was centrifuged at 850\u00d7 g for 5 min at ambient temperature (20\u201325 \u00b0C). Analysis of fatty acids was performed using gas liquid chromatography (GLC) to analyse the fatty acids, fitted with a photodiode array (PDA) detector. The quantification was performed according to similar individual fatty acids in the chromatograms.The oil content of the Amaranthus cruentus grains.A Waters Acquity UPLC was fitted with a PDA detector and was used to determine the composition of tocols in the m/z in the resolution mode as well as in the MSE mode.Extracts were prepared with 2 g of dry grain material +15 mL of 50% methanol and 1% formic acid dissolved in water with ultrasonication for 1 h and left standing overnight. This was followed by centrifugation and transferral of the supernatant to a glass vial readied for LC-MS analysis. Samples were then analysed via the LC-MS method using a Waters SYNAPT G2 Quadrupole time-of-Flight (QTOF) mass spectrometer (MS) connected to a Waters Acquity UPLC  for high-resolution UPLC-MS analysis. Electrospray ionisation was used in the negative mode with a cone voltage of 15 V, desolvation temperature of 275 \u00b0C and desolvation gas at 650 L/h; the rest of the MS settings were optimised for the best resolution and sensitivity. Data were acquired by scanning from 150 to 1500 ijk is the observation of the dependent variable ijk , \u00b5 is the fixed effect of the population mean for the variable, SMi is the phenological stage of harvested grain , and Eij is the random error associated with the observation of ij, assumed to be normally and independently distributed. Where significant differences were observed, means separation was conducted by LSD test at a 5% significance level. Pearson\u2019s correlation coefficient was calculated to determine the relationship between phenolic compounds with chemical and mineral compositions.Data were subjected to one-way ANOVA performed with SAS  softwareAmaranthus cruentus should be accorded significant attention as a prime candidate for the replacement of conventional grains in human and animal diets.Amaranth is not only a climate smart crop, but it also has favourable physical characteristics and chemical composition regardless of the stage of cultivation. Amaranth grain is underutilised in spite of its unique properties, high nutritional yield and high competitiveness comparative to mainstream grains. The present study confirms the invaluable contribution of amaranth grain, as a source of energy, starch, protein, fibre, vitamins E isomers, unsaturated fatty acids, and essential secondary metabolites, to the nutrition and health of humans and animals alike. The harvesting stage of amaranth grain will have an effect on some of its nutritive value and quality. The results of this study indicated that mature harvested grain had, overall, outstanding nutritional quality, even though amino acid composition was not affected by harvesting maturity. Secondary metabolites, specifically flavonoids, were shown to be abundant in mature harvested grains, which highlights its potential for enhancing immunity and gut functions in human and animals."}
+{"text": "To facilitate clinical trials, we explored the optimal dose range of 68Ga-NOTA-Nb109 in BALB/c A375-hPD-L1 tumor-burdened nude mice and C57-hPD-L1 transgenic MC38-hPD-L1 tumor-burdened mice by administration of a single intravenous dose of 68Ga-NOTA-Nb109 and confirmed the dose in cynomolgus monkeys. The biodistribution data of cynomolgus monkey PET images were extrapolated to estimate the radiation dose for the adult male and female using OLINDA2.1 software.Immunotherapy is a valuable option for cancer treatment, and the curative effect of anti-PD-1/PD-L1 therapy correlates closely with PD-L1 expression levels. Positron emission tomography (PET) imaging of PD-L1 expression is feasible using 68Ga-NOTA-Nb109 was stable in physiologic media and human serum. Ex vivo biodistribution studies showed rapid and specific uptake in A375-hPD-L1 or MC38-hPD-L1 tumors. The estimated ED50 was approximately 5.4\u00a0\u00b5g in humanized mice. The injected mass (0.3\u2013100\u00a0\u00b5g in nude mice and approximately 1\u2013100\u00a0\u00b5g in humanized mice) greatly influenced the general biodistribution, with a better tumor-to-background ratio acquired at lower doses of Nb109 (0.3\u201310\u00a0\u00b5g in nude mice and approximately 1\u00a0\u00b5g in humanized mice), indicating maximum uptake in tumors at administered mass doses below the estimated ED50. Therefore, a single 15-\u03bcg/kg dose was adopted for the PET/CT imaging in the cynomolgus monkey. The highest specific and persistent uptake of the tracer was detected in the spleen, except the levels in the kidney and urine bladder, which was related to metabolism and excretion. The spleen-to-muscle ratio of the tracer exceeded 10 from immediately to 4\u00a0h after administration, indicating that the dose was appropriate. The estimated effective dose was calculated to yield a radiation dose of 4.1\u00a0mSv to a patient after injecting 185\u00a0MBq of 68Ga-NOTA-Nb109.68Ga-NOTA-Nb109 showed specific accumulation in hPD-L1 xenografts in ex vivo biodistribution studies and monkey PET/CT imaging. The dose escalation distribution data provided a recommended dose range for further use, and the safety of the tracer was confirmed in dosimetry studies.The online version contains supplementary material available at 10.1186/s13550-021-00854-y. The Global Cancer Statistics report estimated 18.1 million new cancer cases and 9.6 million cancer deaths in 2018, with >\u200950% of the cancer deaths occurring in Asia BMS-986192 (anti-PD-L1 adnectin), which has been successfully used for same-day PD-L1 PET clinical imaging [68Ga-NOTA-Nb109, consistent with previous reports that attribute the high nanobody signals in the kidney to their clearance from the blood via the urine [64Cu-labeled peptide that binds, with low nM affinity, to human, but not to murine PD-L1), NOTAZPD-L1_1 (affibody molecule with affinities of 1\u00a0nM for human and rhesus PD-L1) [18F-labeled anti-PD-L1 adnectin  [Based on the protein mass dose of 1\u00a0\u00b5g/animal in humanized mice and an estimated body weight of 20\u00a0g for each mouse, the mouse-monkey dose conversion factor (mg/kg) was 0.25; therefore, the recommended dose for cynomolgus monkey was 12.5\u00a0\u00b5g/kg. Hence, we conducted PET/CT imaging in a cynomolgus monkey to further verify the in vivo specific binding of  studies \u201336, the he urine . The chas PD-L1)  and the y 10 kD) .68Ga-NOTA-Nb109 for clinical trials is approximately 185\u00a0MBq (5\u00a0mCi), which generates an effective dose of approximately 4.1\u00a0mSv. This absorbed dose is similar to the effective dose of 68Ga-NOTA-2Rs15d [18F-FDG measured by PET scanning [89Zr-labeled antibody [68Ga-NOTA-Nb109 can be regarded as safe for clinical diagnostic translation.Non-human primates are the ideal model of the human system; therefore, the absorbed dose was estimated based on the biodistribution data of the cynomolgus monkey. The dose-limiting organ in adult male human patients is the urinary bladder wall (0.29\u00a0mSv/MBq). The estimated absorbed dose converted from the male and female cynomolgus monkey to the adult male was about 0.0226\u00a0mSv/MBq (effective dose), and 0.0223\u00a0mSv/MBq for that of the female. The recommended dose of A-2Rs15d  (4.6\u00a0mSvscanning  (7\u00a0mSv fantibody  measured68Ga-NOTA-Nb109 was confirmed by its integrity in physiologic media and human serum (Additional file In previous studies, the high stability of 68Ga-NOTA-Nb109 accumulation accurately reflects the dynamic changes of PD-L1 in real-time. However, this remains to be confirmed in future studies.Although the relationship between PD-L1 level and the radioactive uptake has not been thoroughly investigated, previous studies , 26 have68Ga-NOTA-Nb109 showed specific accumulation in xenografts in ex vivo biodistribution studies and monkey PET/CT imaging. Based on the dose escalation distribution data, we recommended a dose range for further clinical use, and monkey dosimetry studies confirmed the safety of the tracer. Further quantitative studies might be required for the clinical translation of 68Ga-NOTA-Nb109.Additional file 1. Additional data on stability, pharmacokinetics and biodistribution analysis of transgetic mice or cynomolgus monkeys."}
+{"text": "Leptospira. Extracellular proteins play critical roles in the pathogenicity and survival of this pathogen in the host and environment. Extraction and analysis of extracellular proteins is a difficult task due to the abundance of enrichments like serum and bovine serum albumin in the culture medium, as is distinguishing them from the cellular proteins that may reach the analyte during extraction. In this study, extracellular proteins were separated as secretory proteins from the culture supernatant and surface proteins were separated during the washing of the cell pellet. The proteins identified were sorted based on the proportion of the cellular fractions and the extracellular fractions. The results showed the identification of 56 extracellular proteins, out of which 19 were exclusively extracellular. For those proteins, the difference in quantity with respect to their presence within the cell was found to be up to 1770-fold. Further, bioinformatics analysis elucidated characteristics and functions of the identified proteins. Orthologs of extracellular proteins in various Leptospira species were found to be closely related among different pathogenic forms. In addition to the identification of extracellular proteins, this study put forward a method for the extraction and identification of extracellular proteins.Leptospirosis is a re-emerging form of zoonosis that is caused by the spirochete pathogen  Leptospirosis, the zoonotic disease once confined to posing a risk during agricultural activities, has been re-emerging due to increasing urbanization and slum areas that have increased the reservoir rodent population . The incL. interrogans [Leptospira with specific antiserums [Staphylococcus aureus secretes a variety of immune evasion molecules, including proteases that cleave components of the innate immune system and also disrupt the integrity of the extracellular matrix. The secretory proteins of S. aureus can activate host zymogens that target host-specific defense and inhibit the anti-bacterial functions of the host, thereby enhancing the chances of pathogen survival in the host [Yersinia pseudotuberculosis is involved in pathogenicity by interfering with the signal transduction pathways of the host cell [Coxiella burnetii secretes Coxiella serine/threonine-protein kinase (CstK) that functions as a bacterial effector protein and assists in the biogenesis of parasitophorous vacuole and replication of the intracellular pathogen by interacting with the host protein TBC1D5 [Toxoplasma gondii, invasion and replication in the host is facilitated by secretory proteins by the modification of host cellular factors [It has been shown that there are many protease activities that can degrade the extracellular matrix and plasma proteins to contribute to the process of infection and pathogenesis in the culture supernatant of errogans . One of errogans ,9. Hemoltiserums ,11,12. Mtiserums ,14. The the host . A secreost cell . The Coxn TBC1D5 . The inv factors , which a factors .Leptospira, is a challenging process. In this context, a multipronged approach coupled with the enrichment of secretory proteins from culture supernatant, its analysis using high throughput Liquid Chromatography with tandem Mass Spectrometry (LC-MS/MS) based proteomics, and the use of bioinformatics tools for the selection of candidate proteins from the supernatant of Leptospira culture in complete EMJH medium was attempted. Previously, Triton X-114 fractionation coupled with LC-MS/MS-based proteomics to determine OMPs of L. interrogans [Secretory proteins are good diagnostic targets during infection and can be a direct indicator of pathogen load in the host ,21. Howeerrogans  was usedL. interrogans serovar Copenhageni strain Fiorcruz L1-130 and subsequent identification yielded 2425 proteins in aqueous fractions, 2646 protein in detergents, and 1684 proteins in a pellet that comprised 2957 unique proteins reported under the ProteomeXchange dataset identifiers PXD009050 and PXD016204 [LC-MS/MS analysis of TritonX-114 fractions of XD016204 . The anaThe abundance of secretory proteins across aqueous, detergent, pellet, wash, and supernatant fractions was calculated based on Intensity-Based Absolute Quantification (iBAQ) values . A proteLeptospira  retrieved orthologous proteins of 56 secretory proteins. The \u2018query cover\u2019 and \u2018identity\u2019 values were used to analyze protein similarity with the query sequence, which was the secretory protein of ptospira . The resptospira . The intLeptospira group , DNA helicase (LIC_11624), Putative lipoprotein containing peptidase M75 domain (LIC_10713), and Peptidase C39 domain protein (LIC_10511) showed an abundance of 1771-, 125-, 79-, and 76-times, respectively, in extracellular samples that were subjected to string analysis to find inter-correlation among the various proteins within the ra group . The C39Leptospira help in elucidating the functions of proteins that lead to pathogenesis and survival of the pathogen in the host. This study was conducted with the same sample that describes cellular proteins. Identification of proteins that are exclusively present in extracellular samples like wash and supernatant in spite of high-resolution analysis cellular fractions, which were separately analyzed in three  fractions, underlines the quality of extracellular protein preparations. Similarly, the exclusive proteins found within wash and supernatant samples showed the discriminatory power of the preparations to distinguish between surface and secretory groups in extracellular proteins. Out of 1176 unique proteins identified from wash and supernatant samples, 56 proteins were found with >1.5-fold abundance that indicates that 4.76% were extracellular proteins. The 19 abundant proteins found exclusively in the extracellular group showed a 1.61% rate of proteins identified in the wash and supernatant. The surface proteins were extracted in PBS containing 5 mM MgCl2 that was easily detachable and also had the unique presence of six proteins without shedding out into the supernatant, which showed its sufficiently good binding on the surface of Leptospira. It is also worth noting that 57% of the extracellular proteins found were pathogenic in nature, as was predicted by MP3 tool with a 27.9% rate (826 pathogenic proteins out of the 2957 proteins identified) in the whole proteome of Leptospira [Bacteria secrete a wide variety of proteins, enabling them to respond to their environment. These extracellular proteins have a diverse functional role such as degradation of substrates, response to environmental stimulus, migration, genetic exchange, feeding, ion-capturing, and sociobiological aspects like quorum sensing, biofilm formation, and host-pathogen interaction ,25. In tptospira . Even thLeptospira.The bioinformatics prediction of extracellular proteins using online tools did not achieve any appreciable level, as the true prediction with respect to 56 extracellular proteins made by CELLO v.2.5, PSORTb, and BUSCA were 21.4%, 12.5%, and 8.9%, respectively. Similarly, five proteins of the extra-cellular proteins were identified as extracellular proteins predicted in a previous report . This shLeptospira species and the unique extracellular proteins may have key functions in invasion, pathogenesis, or survival of the organism in the host. These can be used for diagnostic applications and identification of Leptospira species. The orthologous proteins in other species of Leptospira showed that all the 17 pathogenic proteins were closely related to the L. interrogans with respect to the 26 proteins with >90% coverage and >75% identity among the species. Three proteins: the WP_000141830.1 a Multispecies preprotein translocase subunit YajC, the WP_000587664.1 as a VOC family protein, and the WP_000658301.1 as a DNA starvation/stationary phase protection protein were found to be more closely related within the pathogenic forms. With respect to the preprotein translocase subunit YajC, it was reported that mice vaccinated with the yajC of Brucella abortus showed immune responses to YajC [Though the species was arranged against a preexisting phylogenetic hierarchy, based on ppk gene sequences, the data matched with the clusters and sequence of species. This shows that the extracellular proteins can discriminate between Leptospira in this study. The gene ontology was predicted to carry functions like signal transduction, and phosphorylation and molecular functions like phosphorylase sensor kinase activity and transferase activity by transferring phosphorus-containing groups. This shows that the protein is a two-component system with a histidine protein kinase (HPKs) and a response regulator protein [L. interrogans serogroup Icterohaemorrhagiae serovar Lai and was found to be associated with the chemotaxis and signal transduction system [With an abundance of 1700-times in wash with respect to cellular and supernatant fraction, histidine kinase sensor protein LIC_11528) was identified as the most abundant and pathogenic protein identified on the surface of  protein . The pho was iden protein . Further protein . Apart fn system . Chemotan system .The second abundant protein was DNA helicase  which was found to be 38-fold greater on the surface and 87-fold greater in the supernatant than its entire quantity in the cell. This was found to be nonpathogenic in MP3 and the gene ontology showed molecular functions like DNA helicase activity, ATP binding, DNA binding, and hydrolase activity. The STRING analysis showed the association with uvr A and uvr B types of DNA repair gene homologs, which are involved in repairing of DNA that is damaged due to stress factors such as ultraviolet light ,34. DNA Leptospira was significantly reduced when LruB is inactivated [The putative lipoprotein containing peptidase M75 domain (LIC_10713) was found to be 78-times more abundant in the supernatant as a secretory molecule. The protein contains an Imelysin-like domain with a GxHxxE signature. This domain was distributed widely in bacteria and was found to be involved in iron transport . This prctivated .E. coli, which was found to be directly associated to pathogenesis leading to macrophage survival, which can further lead to events of lateral gene transfer [The gene LIC_10511 encoding the protein C39 peptidase, which has been found to be 75-fold abundant in the supernatant, was reported to be an endo-peptidase family that mostly serves as ABC transporters along with the translocation of the mature bacteriocin across the cytoplasmic membrane . This prtransfer ,47. Thistransfer .Leptospira determining the functions like survival under stress conditions, cell-cell signaling, and binding to membrane receptors [Apart from these four proteins, other proteins also showed a significant rise in quantity as secretory molecules as compared to their presence in aqueous, detergent, and pellet fractions. These proteins were found to carry functions like cell-cell signaling, determining nutritional requirement, stress response, external specific stimuli, and homeostasis, which were interpreted by InterProScan 5. Further, significant domain class proteins like chaperone proteins, VOC family, SGNH hydrolase, ComF, and ATP binding cassette proteins were also identified from our study. Previous studies reported the presence of these domains in eceptors ,50,51.Leptospira culture in complete EMJH medium at standard culture condition was used for a complete subcellular proteomic analysis using Triton X-114, as shown in Leptospira pellet (surface) and proteins enriched from the culture supernatant (secreted). The total amount of each protein from Triton X-114 fractions identified in part one was added together and considered as a cellular portion of the protein in contrast to the number of the same extracellular proteins found, which is part two.The L. interrogans Copenhageni stain Fiocruz L1-130 was obtained from the repository of the ICMR-Regional Medical Research Centre, Port Blair, India. This is a WHO Collaborating Center for diagnosis, reference, research, and training in leptospirosis. Leptospira were cultured in EMJH medium supplemented with 1% bovine serum albumin at 30 \u00b0C with intermittent checking for contamination and growth. Afterwards, they were harvested at the mid-log phase for further protein extraction.Leptospira was centrifuged at 2500\u00d7 g for 30 min at 4 \u00b0C to obtain the culture supernatant for the separation of secretory protein. This supernatant was further centrifuged at 6000\u00d7 g for 30 min to remove any Leptospira left in the medium and the supernatant was again centrifuged at 12,000\u00d7 g for 30 min. The three-step centrifugation was to avoid tight packing and rupture of Leptospira while pelleting. This supernatant was used to separate secretory/extracellular proteins.The mid-log phase culture of The secretory proteins present in low abundance in comparison with the BSA or serum proteins. Enrichment of secretory proteins was carried out using ProteoMiner\u2122 Bio-Rad  protein enrichment technology based on binding of proteins to a library of combinatorial peptide ligands that act as unique binders for proteins ,53.The supernatant was dialyzed against PBS  to facilitate optimum binding condition to ProteoMiner\u2122. Slurry from ProteoMiner\u2122 Large-Capacity column (100 \u03bcL settled beads) was washed two times with 1 mL of PBS and added to 100 mL of the supernatant and allowed to bind overnight (>8 h) under shaking at 4 \u00b0C. After binding, the beads were allowed to settle and we removed the clear volume of supernatant, repacked in the ProteoMiner\u2122 column, and carried out 2 \u00d7 100 \u00b5L washes with PBS. The elution 2 \u00d7 20 \u00b5L was made using Elution Reagent  supplied by the manufacturer. The eluted secretory protein was subjected to quantification, electrophoretic characterization, and trypsin digestion to obtain peptides and further high-resolution LC-MS/MS based proteomics.g for 5 min at room temperature. The wash was again centrifuged at 12,000\u00d7 g for 30 min to remove any trapped leptospires and the supernatant was designated as a \u2018Wash fraction\u2019 that contains washable surface proteins of Leptospira and used for further processing to carry out LC-MS/MS.The pellet obtained after separation of supernatant was washed 3 \u00d7 with PBS containing 5 mM MgCl2 and we collected the wash supernatant by centrifuging the leptospires at 2500\u00d7 Leptospira pellet obtained after wash was used for Triton X-114 fractionation as described earlier [g for 30 min at 4 \u00b0C and the pellet was saved as a \u2018pellet fraction\u2019 and the supernatant was used for phase separation. The Triton X-114 concentration of the supernatant was increased to 2% by the addition of an adequate amount of Triton x-114, depending on the volume, mixed well, and incubated at 37 \u00b0C for 1 h for phase separation, then it was subsequently centrifuged at 1500\u00d7 g for 5 min to separate the upper aqueous phase from the lower detergent phase. The undissolved proteins from the pellet from the TritonX-114 extraction step, which contained a cytoplasmic cylinder, were further extracted using a buffer containing 10 mM Tris-Cl (pH8), 8 M urea, 4 mM dithiothreitol, and 1% sodium dodecyl sulfate. Following centrifugation at 12,000\u00d7 g for 30 min at 4 \u00b0C, the supernatant was used as the pellet fraction. Similar fractions of all four replicated were polled and the protein concentrations were estimated using the BCA method in the aqueous, detergent, and pellet fractions, which were then stored at \u221220 \u00b0C. This protein was used for mass spectrometry. Data from three replications of the same kind was used for further analysis.The  earlier . The extWash and supernatant samples protein concentrations were estimated by using the BCA (Bicinchoninic Acid) Protein Assay (Pierce\u2122 BCA Protein Assay Kit), and the protein amount was reconfirmed visually resolving on a 10% SDS-polyacrylamide gel electrophoresis (PAGE) gel. Based on the protein concentrations, a quantity equivalent to 250 g of protein was taken from wash and supernatant samples. Further samples were reduced with 10 mM dithiothreitol (DTT) and alkylated with 20 mM iodoacetamide (IAA). Prior to trypsin digestion, the lysate was precipitated with acetone to remove sodium dodecyl sulfate (SDS) to form the protein sample. The protein was digested with trypsin (1:20)  at 37 \u00b0C for 16 h. The peptides were dried overnight in SpeedVac and stored at \u221220 \u00b0C.Lyophilized peptides were subjected to basic pH reverse phase chromatography (bRPLC) fractionation. The samples were reconstituted in 1 mL of 10 mM Triethylammonium bicarbonate (TEABC) and separated on an XBridge C18 column  attached to a Hitachi LaChrom Elite HPLC system over 120 min using a linear gradient increase from 5% to 100% of 10 mM TEABC with 90% acetonitrile. Initially, 96 fractions were collected, which were then concatenated to 6 fractions and dried before desalting with C18 cartridges. Desalted peptides were vacuum dried and stored in a deep freezer at \u221280 \u00b0C prior to LC-MS/MS analysis.m/z mass range . The maximum injection time was 10 ms. For MS/MS analysis, data were acquired at top speed mode with 3 s cycles and subjected to a higher collision energy dissociation with 32% normalized collision energy. MS/MS scans were carried out at a range of 100\u20131600 m/z using Orbitrap mass analyzer at a resolution of 30,000 at 200 m/z. The maximum injection time was 200 ms.The tryptic peptides from bRPLC fractionation were analyzed on a Thermo Fischer Scientific Orbitrap Fusion Tribrid mass spectrometer  connected with an Easy-nLC-1200 nanoflow liquid chromatography system (Thermo Fischer Scientific). The lyophilized peptides were reconstituted in 0.1% formic acid and loaded onto a 2 cm trap column  (Thermo Fisher Scientific). Peptides were separated using a 15 cm analytical column  at a flow rate of 300 nl/min. For data-dependent acquisition, solvent gradients were set as the linear gradient of 5\u201335% solvent B (80% acetonitrile in 0.1% formic acid) over 90 min through 120-min run time. MS analysis was carried out at a scan range of 400\u20131600 L. interrogans serogroup Icterohaemorrhagiae serovar Copenhageni (strain Fiocruz L1-130) reference protein database obtained from NCBI (3667 protein entries), with common contaminants added to the protein database (115 contaminants entries). The mass spectrometry data was analyzed with Mascot  and SEQUEST-HT search algorithms in the Proteome Discoverer software suite, version 2.2 (PD 2.2) . The search parameters used were: (a) trypsin as the proteolytic enzyme (with up to one missed cleavage); (b) fragment mass error tolerance of 0.05 Da; (c) peptide mass error tolerance of 10 ppm; (d) oxidation of methionine as a variable modification; (e) carbamidomethylation of cysteine as a fixed modification. A false discovery rate (FDR) was set to 1% at PSM and peptide levels. The iBAQ (Intensity Based Absolute Quantification) value was generated using the iBAQ algorithm that estimates the relative abundance of the proteins within each sample [Mass spectrometry-derived data were searched against the h sample .The proteomics data of these mass spectrometry analyses have been deposited to the ProteomeXchange Consortium via the PRIDE , the parhttps://www.psort.org/psortb/, accessed on 9 March 2020) were used. Additionally, a web-server BUSCA  which integrates different tools  to predict localization-related protein features as well as tools like BaCelLo, MemLoci, and SChloro for discriminating subcellular localization of both globular and membrane proteins while predicting subcellular localization [To predict the sub-cellular location of secreted proteins, online tools like CELLO v.2.5 ,57  [http://metagenomics.iiserb.ac.in/mp3/application.php, accessed on 12 April 2020) [Functional annotation of the secretory protein is important to know the role of these proteins. Identification of functions and metabolic pathways of these proteins were made using the KEGG database (ry 2021) . Similaril 2020) . This toLeptospira was carried out using algorithm blastp (protein-protein BLAST) under online NCBI BLAST search at default parameters to retrieve top 1000 hits. Orthologous proteins of the highest score from each Leptospira species, irrespective of strains, were selected along with their \u2018query cover\u2019 and \u2018identity\u2019 values with respect to the query sequence.A search for orthologous proteins of extracellular within 64 species of Leptospira, we used String database  version 10. Under the search option, we entered the unique protein uniport ID and selected the autodetect option [To predict the protein-protein interaction among the species of t option .L. interrogans from protein-rich EMJH medium. It shows that the surface and secretory proteins can be easily identified with reference to the cellular proteins in quantitative terms. The extraction method was found to be easy, rational, and justified with the identification of exclusive molecules and significant times of abundance with respect to the cellular fraction of the proteins, though it was analyzed at higher resolutions due to three Triton X-114 fractions. Identification of pathogenic proteins and the correlation with pathogenic species shows the significance of the identified proteins. Similarly, a huge number (57%) of pathogenic proteins present as secretory molecules also highlight the significance of extracellular proteins. These key molecules identified can implement various functions like nutrient acquisition, cell-cell communication, detoxification of environment, and attaching to potential inhibitors. In this regard, the article presents an efficient method for extraction and analysis of extracellular proteins for other organisms too, as well as identification of extracellular proteome of L. interrogans.This study aimed to identify extracellular proteins of"}
+{"text": "The experimental construction of a double-stranded DNA microcircle of only 42 base pairs entailed a great deal of ingenuity and hard work. However, figuring out the three-dimensional structures of intermediates and the final product can be particularly baffling. Using a combination of model building and unrestrained molecular dynamics simulations in explicit solvent we have characterized the different DNA structures involved along the process. Our 3D models of the single-stranded DNA molecules provide atomic insight into the recognition event that must take place for the DNA bases in the cohesive tail of the hairpin to pair with their complementary bases in the single-stranded loops of the dumbbell. We propose that a kissing loop involving six base pairs makes up the core of the nascent dsDNA microcircle. We also suggest a feasible pathway for the hybridization of the remaining complementary bases and characterize the final covalently closed dsDNA microcircle as possessing two well-defined U-turns. Additional models of the pre-ligation complex of T4 DNA ligase with the DNA dumbbell and the post-ligation pre-release complex involving the same enzyme and the covalently closed DNA microcircle are shown to be compatible with enzyme recognition and gap ligation. DNA circularization results from the covalent bonding of the two ends of the same linear DNA molecule. The formation of a phosphodiester bond between juxtaposed 5\u2032 phosphate and 3\u2032 hydroxyl termini in double-stranded DNA (dsDNA) is catalyzed by DNA ligases. An enzyme commonly used in laboratory research is bacteriophage T4 DNA ligase, which does not join single-stranded nucleic acids but efficiently joins blunt and cohesive ends and repairs single-stranded nicks in duplex DNA, RNA or DNA/RNA hybrids . DependiCircular DNAs present in nature exhibit attractive properties that have been amply exploited in biotechnology; two of their most outstanding applications are the use of plasmids for molecular cloning and the development of phage therapies. On another front, circular ssDNAs are routinely employed in the creation of three-dimensional 3D) nanostructures known as DNA origami D nanostr. AmongstTo covalently close a dsDNA into a circular structure using enzyme-mediated ligation, the DNA blunt or cohesive ends must be properly aligned and close enough for the ligase to seal the nick . AlthougStrikingly, the smallest dsDNA circle described to date is\u2014to the best of our knowledge\u2014the 42-bp microcircle constructed by Wolters and Wittig  followinGiven this background, we thought it would be of general interest to provide insight into the distinct features of all the 3D structures involved in the creation of this 42-bp dsDNA microcircle, namely: (i) the D42 dumbbell, (ii) the P42 hairpin, (iii) the putative pre-annealing complex, (iv) the DNA:ligase complexes, and (v) the final singly nicked and covalently closed 42-bp dsDNA microcircles.We first modeled in atomic detail and simulated using unrestrained molecular dynamics (uMD) the complementary D42 and P42 ssDNA sequences (42 nucleotides each) that eventually lead to formation of the 42-bp dsDNA microcircle  Figure .The D42 and P42 ssDNA molecules were modeled and simulated for 300 ns (in triplicate) as a nicked dumbbell and a tailed hairpin, respectively, to provide detailed 3D information on these particular DNA structures. The D42 sequence consists of two inverted repeats of seven and eight nucleotides that make it possible for the oligonucleotide\u2014upon pairing of the complementary bases\u2014to bend and form a double-stranded stem containing a single nick; the two loops on both sides of the stem are made up of six unpaired bases that are located between these inverted repeats in the primary sequence A. SimulaThe P42 sequence contains two inverted and self-complementary tracts of six and eight nucleotides each that allow it to bend back onto itself and form a double-stranded stem. In this case, however, only one loop is present that comprises the six unpaired nucleotides that connect both strands of the stem. The tail of this hairpin is made up of the remaining eight nucleotides (5\u2032-CTTCGGCG-3\u2032) that overhang unpaired at the 3\u2032-end B. The P4The fact that D42 and P42 sequences are fully complementary makes it possible for the two single-stranded oligonucleotides to pair by hydrogen bonding and give rise to a 42-bp dsDNA microcircle containing a single nick in the P42 strand. The most likely mechanism underlying this annealing is, in our view, through the formation of a kissing loop because six out of the eight nucleotides in the overhang of the P42 hairpin have their (unpaired) complementary bases in one of the dumbbell loops . We ther2+ or Na+ ions, helical distortions such as kinks and bubbles were readily apparent. The location of these structural alterations was shown not to be random. Although they accumulated in distinct sequence stretches depending on the offset present in the initial structure, all the topoisomers displayed an elliptical conformation with the kinks on opposite sides of the ellipse\u2019s longest axis  only in the case of the structure created with an initial offset of 7 bp (three replicas). Besides, the location of the kinks in the double helix coincided with those displayed by the covalently closed circles. In contrast, in the microcircles created either without an offset or with a 5-bp offset, the ends remained aligned in some replicas but not in others, although a correlation between fraying and ionic environment could not be established  with a suitable conformation for recognition by the T4 DNA ligase would result in a covalently closed structure. To be a substrate for T4 DNA ligase, the singly nicked DNA microcircle must fulfil three conditions: (i) its 3D architecture has to allow the three domains of the ligase to fully embrace the stretch containing the nick, (ii) the bases and the phosphates must be suitably positioned inside the enzyme active site, and (iii) the nucleotides involved in the ligation reaction need to be properly aligned. In addition to these general prerequisites, which can be applied to any canonical dsDNA, another necessary condition can be discerned in the case of a circular dsDNA of such a small length: the nick has to be located on the outer face of the microcircle. If the gap were on the inner face, it would be inaccessible to the ligase active site due to steric constraints and the efficiency of the enzyme would be compromised. Thus, it is safe to assume that the ideal substrate for T4 DNA ligase must have the nick located on the periphery of the microcircle. Interestingly, when the three topoisomers generated differing in the position of the nick were fitted inside the enzyme as explained in the methods section, only that containing a 7-bp offset displayed an optimal architecture compatible with location of the nucleotides to be ligated inside the active site without any steric clash with the enzyme. This finding, together with the results mentioned above concerning the stability of the nicked region of this particular microcircle, makes this topoisomer the ideal candidate for ligation.We therefore used the 7-bp offset microcircle, as directly provided by the MCDNA server  to modelAll-atom models of the D42 dumbbell and the P42 hairpin DNA molecules were built with the aid of the SimRNA web server , a MonteThe kissing loop complex was modeled using as scaffold the crystallographic structure of an RNA kissing complex, solved at 2.9 \u00c5 resolution and deposited in the Protein Data Bank with id. 2JLT . Each RNhttps://www.multiscalegenomics.eu/MuGVRE/ (accessed on 29 April 2021)). MCDNA makes use of the NUCGEN program and the molecular manipulation language NAB [kL = 0). Given the fact that the regular pattern of position-dependent helical parameters imposed by MCDNA for building a circular DNA molecule varies depending on the definition of the 5\u2032 end, three different starting models for each circle were created by shifting the register of the sequences by 5 or 7 bp following a previously reported protocol [All-atom models of circular DNA molecules were built with the aid of the MCDNA web server , a compouage NAB  present uage NAB , togetheThe crystallographic structure of the enzyme in complex with an AMP-bonded dsDNA ended with a 2\u2032,3\u2032-dideoxyribonucleotide, solved at 2.75 \u00c5 resolution and deposited in the Protein Data Bank with id. 6DT1 , was use+ or Mg2+ ions and ensuring a minimal separations of 4.0 \u00c5 amongst the ions and 6.0 \u00c5 between ions and DNA atoms. To avoid artifactual distortions of the double helix caused by the strong attraction of the Mg2+ ions by the DNA phosphate oxygens, an r\u22124 term that takes into account the ion-induced dipole interaction was added to the 12-6 Lennard-Jones model, as proposed by Li and Merz [2+ was tested in a previous work by our group [Each system was immersed in a truncated octahedron of equilibrated TIP3P water molecules. All the octahedra extended 12 \u00c5 away from any solute atom so that the resulting volume was enough to accommodate the D42 dumbbell , the P42 hairpin , the pre-annealing kissing loop , the 42-bp microcircle  and the T4 DNA ligase:DNA complexes . Electroneutrality within the boxes was achieved by addition of enough Naand Merz . This exur group  and showur group .pmemd.cuda_SPFP engine implemented in AMBER 18 [\u22121\u00c5\u22122) using energy minimization and the resulting systems were progressively heated from 100 to 300 K during 0.1 ns using the same restraints. Then, the systems were equilibrated at 300 K for 2.5 ns in the absence of any restraints and further simulated under the same conditions up to a total time of 300 ns during which system coordinates were collected every 5 ns for further analysis. Each system studied in this work was replicated three times by using different MD starting velocities that were assigned by means of a random number generator based on the current date and time. To simulate the same system under different ionic environments, the first and second replicas were neutralized with Na+ ions whereas the third one was neutralized with Mg2+ ions, thus resulting in a total simulation time of 0.9 \u00b5s.The molecular dynamics (MD) simulations were run essentially as described . BrieflyAMBER 18  running The combination of molecular modeling and uMD simulations has allowed us to characterize the different DNA structures involved in the construction of the smallest, to the best of our knowledge, dsDNA microcircle reported to date . Our 3D The uMD simulations of different topoisomers of the covalently closed and singly nicked 42-bp microcircle provides strong evidence that the architecture of such a small DNA circle does indeed differ from the canonical 10.5 bp per helical turn, as the formation of two U-turns appears to be inescapable to release the excess of bending stress. These theoretical results are in good agreement with those obtained for longer, but also small, dsDNA minicircles ,10,13. WThe description of observations on macromolecules by text and simple schemes alone is often insufficient to properly describe the underlying complexity of these systems . With pr"}
+{"text": "MCE-CCP combinations , selected based on CCP encapsulation efficiency, were tested for their stability and MCE polyphenols\u2019 bioaccessibility during digestion (monitored using an in vitro static procedure). During the oral and gastric phases of the digestion process, CCP gradually swelled and totally released MCE polyphenols. MCE-CCP50 had the fastest release. Moreover, anthocyanins were still detectable during the duodenal phase, in both MCE-CCP ingredients. Furthermore, CCP (5 mg/mL) exerted in vitro potential hypocholesterolemic activity via bile salts binding during digestion.A polysaccharide fraction obtained from camelina cake (CCP), selected as a carrier to encapsulate purple corn cob extract (MCE), was investigated. A wide population of carbohydrate polymers (with a polydispersivity index of 3.26 \u00b1 0.07 and an average molecular weight of about 139.749 \u00d7 103 \u00b1 4.392 \u00d7 10 Nowadays, the agro-food industry generates a huge amount of waste, which constitutes one of the main environmental problems due to the high organic charge , but it Therefore, great effort has been made by scientists and companies in order to investigate and characterize the potential applications of agro-food by-product bioactive compounds or metabolites in food, pharmaceutical, and cosmetic industries ,2. TheseZea mays L.) are pigmented corn varieties from South America, mainly Peru and Bolivia, which have strong antioxidant properties thanks to their high anthocyanin content [w/w dry material) for cob and husk, respectively [Among agro-food wastes, corn cobs are the main by-products generated during corn processing, and purple corn cobs are still lacking added-value applications . Purple  content . Several content ,7. Husk ectively . Moradynectively , as alreectively ; this beDuring the last five years, there has been growing interest in the application of encapsulation technology in order to entrap antioxidant compounds, protect them against environmental conditions during storage, extend their shelf lives, and enhance their bioavailability ,11. DiffCamelina sativa L. Krantz) was selected as potential carrier for MCE, based on the high encapsulation efficiency values registered at 1:1 and 1:3 core/wall material ratios. Camelina sativa is an important seed oil crop belonging to the Brassicaceae family. It is cultivated worldwide, and its oil is a valuable and well-characterized source of unsaturated fatty acids, mainly linolenic and \u03b1-linoleic acids [In our previous work, the polysaccharide fraction isolated from camelina cake  as a carrier for MCE could represent a valuable technological innovation. Preliminary spectroscopic analysis performed both on CCP and on MCE encapsulated with CCP indicated that CCP is mainly characterized by mannose, arabinose, and rhanmose residues, and by the presence of a protein component with a random coil conformation, suggesting a gum-like composition  maintainw/w .Therefore, considering these preliminary results, the aim of the present work was to determine the CCP\u2019s average molecular weight and rheological properties, since these physico-chemical and structural parameters are strictly related to the biological behavior of natural polysaccharides ,18,19. Tv/v), methanol, HPLC-grade acetonitrile, phosphoric acid (85% w/v), and sodium chloride were obtained from Carlo Erba . HPLC-grade formic acid, hydrochloric acid (37% w/v), Type VI-porcine pancreatic \u03b1-amylase, pepsin from porcine gastric mucosa (\u2265400 U mg\u22121), bile extract porcine, pancreatin (8 \u00d7 USP) from porcine pancreas, sodium taurocholate (NaTC), sodium glycocholate (NaGC), sodium taurodeoxycholate (NaTCDC), sodium glycochenoxycholate (NaGCDC), protease from Streptomyces griseus type XIV (\u22653.5 U mg\u22121), viscozyme L cellulolytic enzyme mixture, sodium azide, and cholesterolamine were provided by Merck KGaA .Ethanol .Pullulan gel filtration chromatography standard kit was purchased from Waters Corporation .Camelina cake was kindly provided by FlaNat Research Italia S.r.l. .v/v) at 4 \u00b0C overnight. Finally, the polysaccharide fraction was separated by centrifugation at 5000 rpm  for 10 min at 25 \u00b0C, freeze dried , and then used in the experiments.A CCP dried extract was prepared following the procedure previously optimized . BrieflyMoradyn chopped cobs were kindly provided by FlaNat Research Italia S.r.l.  and extracted with 50% aqueous ethanol for 3 h at 50 \u00b0C. The extract (MCE) was filtered through 0.45 \u00b5m membrane filters  and the organic solvent removed under reduced pressure at 40 \u00b0C  . Finallyw/w) to obtain MCE-CCP ingredients as follows: freeze-dried CCP was dissolved in water at 10 mg/mL final concentration and hydrated at 4 \u00b0C overnight. The carrier solution and MCE (core) were mixed at 1:1 or 1:3 ratio (w/w), and the obtained ingredients were dried under vacuum in a drying oven  for 48 h  [MCE was encapsulated in 50 or 75% CCP (Germany) .\u22121), to investigate their non-Newtonian behavior. To evaluate the storage (G\u2019) and loss (G\u201d) moduli of CCP, frequency sweep experiment results were recorded as a function of angular frequency (0.1\u2013100 Hz) at 0.5% fixed strain. To test CCP thixotropy, shear-thinning tests were performed by a series of peak hold tests in which shear rates were kept constant, as previously reported by Pugliese et al., (2021) [\u22121 and a shear rate of 5.3 s\u22121 were applied in sequence for 60 and 20 s, respectively. Subsequently, a high shear rate of 1000 s\u22121 for 20 s followed by a shear rate of 5.3 s\u22121 for 20 s were applied. Lastly, a shear rate of 0.01 s\u22121 was used to simulate the shear condition of CCP at rest. Each experiment was performed in triplicate, and data were processed using OriginLabTM 8 software.The CCP rheological properties were investigated using a Kinexus DSR Rheometer  equipped with a parallel-plate geometry . CCP viscosity was measured using a flow step program, at increasing shear rate  . Briefly3 g/mol range were used for the calibration curve . An Ultrahydrogel\u2122 2000 column  and an Ultrahydrogel\u2122 250 column   were coupled in series and operated at a constant flow rate of 0.8 mL/min. The mobile phase consisted of a 0.1 M NaCl solution (w/v) containing 0.02% NaN3 (w/v), filtered through a 0.45 \u00b5m PTFE membrane . Columns and detector were maintained at 40 \u00b0C.The CCP average molecular weight (Mw) and polydispersivity index (Pi) were deter-mined by size exclusion chromatography (SEC) using an Agilent 1200 chromatographic system coupled with a G7162A Refractive Index Detector (RID) . Narrow pullulan standards in the 5\u2212642 \u00d7 10Samples were prepared by dissolving CCP or pullulan standards in 0.1 M NaCl  and filtered  before injection (injection volume 50 \u00b5L).v/v/v) mixture was added to obtain a 10 mL final volume. Samples were concentrated up to 0.25 mL under reduced pressure at 40 \u00b0C  and then diluted to a 5 mL final volume by means of a binary mixture consisting of 0.1% formic acid aqueous solution and 0.01% formic acid in acetonitrile 80:20 (v/v) before HPLC analysis.The encapsulated polyphenols were extracted following a procedure described by Norkaew et al. (2019)  with sli\u00ae C18 analytical column  operating at 0.3 mL/min constant flow rate (injection volume 20 \u03bcL), using the mobile phase and the gradient elution program already applied and validated by Ferron et al. (2021) [Analyses were carried out using a 1260 Infinity II technology series system , equipped with a quaternary gradient pump, a vial sampler, a degasser, a thermostatted column system set at 25.0 \u00b1 0.5 \u00b0C, and a variable wavelength detector (VWD). The HPLC-VWD system was controlled using Agilent OpenLab CDS ChemStation software\u2014Windows 10. The chromatographic separation was carried out on a Gemini. (2021) . ChromatMCE-CCP 50% or MCE-CCP 75% water solutions (1 mg/mL) were submitted to an in vitro gastrointestinal simulation digestion process following the INFOGEST protocol; briefly, simulated salivary (SSF), gastric (SGF), and intestinal (SIF) fluids were prepared using proper mixtures of electrolytes, bile salts, water, and enzymes. Pepsin and pancreatin were directly added to SGF and SIF, respectively . ChangesThe percentage of soluble polyphenols in each collected digested sample represented the bioaccessible MCE fraction available for absorption.v/v)\u2014and filtered through 0.2 \u00b5m nylon syringe filters  before HPLC analysis.The samples collected during the digestion process were dissolved in 2.5 mL of 0.1% formic acid aqueous solution\u20140.01% formic acid in acetonitrile  of the marker compound in the ingredients after digestion, and totA represents the peak area (mAU) of the marker in the undigested sample, considered as 100%.The bioaccessibility index for each monitored polyphenolic compound was calculated as:The CCP bile salts\u2019 binding capacity was evaluated following the protocol reported by Lin et al. (2020) , with soFive different CCP concentration levels  were tested, and cholestyramine (10 mg/mL) was used as a positive control . Water wThe in vitro digestion procedure was carried out following the standardized INFOGEST protocol, but reproducing the intestinal phase conditions with a 10 mM BS mixture  instead of commercial bile, in order to mimic the BS composition and concentration typically present in an adult intestine under the fed condition. Samples collected at the end of the intestinal phase were centrifuged at 14,000 rpm for 30 min at 4 \u00b0C ; subsequently the supernatants were filtered  and immediately submitted to RP-HPLC analysis.BS separation and quantification were performed by HPLC-WVD , using a Zorbax SB-C18 column  operating at 0.8 mL/min constant flow rate (injection volume 100 mL). The mobile phase consisted of 0.3 M phosphoric acid (solvent A) and acetonitrile (solvent B) with the following gradient table: 0\u20131 min, 25% B; 1\u201310 min, 25\u201343% B; 10\u201312 min, 43\u201344% B; 12\u201322 min, 44\u201390% B; 22\u201324 min, 90\u201325% B, and 10 min column reconditioning. Chromatograms were recorded at 200 nm.A BS 10 mM mixture prepared dissolving NaTC, NaGC, NaTCDC, and NaGCDC in SIF was used to assess the separation efficiency of the HPLC method. To quantify the un-bound BS, a five-point standard curve was prepared for each BS in the concentration range 1\u201310 mM.BS blank is BS total concentration (expressed in mM) registered after the water digestion process and BS unbound is BS concentration (expressed in mM) detected in supernatants after the CCP intestinal digestion phase.The binding activity was calculated according to Equation (2):p < 0.05) were evaluated by variance analysis (ANOVA). Experiments were performed at least in three replicates.Statistical analysis of the data was performed using Microsoft Excel (version 365). The significant differences  eluting in the range 17\u201323 min and representing about 100% of the eluted material. CCP molecular distribution weight was extrapolated from the pullulan standard calibration curve, and it was in the range 7.224 \u00d7 103\u2212698.297 \u00d7 103 g/mol. The average Mw was about 139.749 \u00d7 103 \u00b1 4.392 \u00d7 103 g/mol; the Pi (Mn/Mw) was 3.26 \u00b1 0.066.The registered chromatogram clearly indicated the presence of a varied population of carbohydrate polymers  mucilage, which had a composition and rheological behavior close to those of camelina seed mucilage [These data and the results previously obtained by Fourier-Transform Infrared Spectroscopy (FT-IR) analysis  indicatemucilage ; howevermucilage ,28.\u22121) provided insights for its long-term stability in the application of hydro-colloidal systems and could be attributed to the intermolecular interactions among protein and polysaccharide molecules, which would result in the formation of entangled networks, similar to those observed for Camelina seed gum by Li et al. [\u22121) highlighted its shear-thinning propensity, which typical of hydrogel-like materials and was also observed in other food-derived materials  [The viscoelastic properties of CCP were evaluated by using shear-rate rheology. Firstly, we performed viscosity tests in order to assess the Newtonian/non-Newtonian flow behavior of CCP a. CCP shi et al. . On the eptides) .CCP mechanical properties were evaluated by measuring the storage (G\u2019) and loss (G\u201d) moduli using oscillatory shear rheological experiments b. G\u2019 refLastly, CCP thixotropy  was evaluated. CCP exhibited fast recovery after injection simulation through a series of constant shear rate tests  d. This fConsidering the above results and the effect of CCP in prolonging MCE shelf-life , the impThirteen different marker compounds selected in MCE were monitored in MCE-CCP50 and MCE-CCP75 at different time intervals during the in vitro simulated digestion process, as reported in O-glucoside, perlagonidin-3-O-glucoside, and peonidin-3-O-glucoside), flavonol -hexoside, isorhamnetin-7-O-rutinoside, isorhamnetin-3-O-hexoside, luteolin-7-O-glucoside, kaempferol-3-O-hexosyl-7-O-glucuronilhexoside), and hydroxycinnamic acid (ferulic acid derivative) as the percentage of soluble compound detected in the collected digestive fractions in comparison with that expected following the gradual dilution occurring during the static in vitro digestion procedure [The bioaccessibility index was calculated for each of anthocyanin  at the beginning of each digestion phase; thus, the expected bioaccessibility index was based on this dilution factor.Note: Following the INFOGEST protocol, samples were diluted 1:1 .The results of CCP BS-binding activity at the different tested concentrations are summarized in Considering that the experimental setup required a centrifugation step to isolate un-bound BS , the higAnother goal of this study was to investigate a putative functional property of the CCP-based ingredient by assessing the relationships between the CCP\u2019s structural and rheological properties and its capacity to retain BS during in vitro simulated digestion.Soluble and insoluble polysaccharides were reported to interact with bile salts, pre-venting their reabsorption and promoting their transit to the colon, thereby increasing the hepatic synthesis of primary bile acids and reducing serum cholesterol synthesis .2 > 0.990, and in CCP BS-binding ability was tested at five different concentrations in the range 0.5\u201310 mg/mL and compared with that of cholesteryramine, a known synthetic bile acid sequestrant ,40. An Hw/w). The structural and rheological properties of CCP were deeply investigated in this work, confirming that its carbohydrate fraction is mainly composed by neutral polysaccharides with a broad molecular weight distribution around 139.749 \u00d7 103 g/mol. Moreover, CCP showed a typical hydrogel-like profile, resulting in the formation of an entangled network of proteins and polysaccharides with a thixotropic feature. This property could gain it attention in the food or food supplement field, as it could allow the controlled delivery of bioactive compounds.CCP was the alcohol-insoluble polysaccharide fraction previously isolated from camelina cake, the main by-product generated from camelina oil production, able to pro-long the shelf life of an MCE-based ingredient when used at 50% and 75% (Furthermore, these rheological properties could justify the results obtained from in vitro digestion of the two MCE-CCP50 and MCE-CCP75 ingredients. In fact, the bioaccessibility index registered for selected polyphenols in MCE highlighted that CCP, at both 50% and 75%, allowed the gradual delivery of such compounds during oral and gastric phases by a swelling mechanism, which was already known of by a composite gel obtained from the interaction of lotus root extract and whey proteins.Considering CCP\u2019s structural and rheological features and the results obtained from solid-state stability and bioaccessibility studies performed on MCE-CCP50 and MCE-CCP75, it could be concluded that CCP can supply a protective barrier for MCE polyphenols, increasing their storage stability and bioaccessibility. Moreover, CCP, by improving anthocyanins\u2019 stability and keeping constant their concentrations during the digestion process, is supposed to preserve the antioxidant potency of MCE until the intestine.Therefore, since the ingredient containing CCP 75% represents a valuable solution for stabilizing MCE polyphenols and enhancing their bioaccessibility, hypoglycemic and anti-glycative in vitro tests will be carried out after digestion in order to fully characterize the potential efficacy of this final ingredient in the prevention of chronic and age-related disease risk factors."}
+{"text": "Bacteriophages (phages) are a promising anti-infective option for human disease. Major gaps remain in understanding their potential utility.Pseudomonas aeruginosa airway colonization. The single dose of phage consists of a mixture of four anti-pseudomonal phages. Six sentinel participants will be sequentially enrolled with dose escalation of the phage mixture by one log10 beginning with 4 \u00d7 107 plaque-forming units in an unblinded stage 1. If no serious adverse events related to the study product are identified, the trial will proceed to a double-blinded stage 2. In stage 2a, 32 participants will be randomly assigned to one of three phage dosages or placebo in a 1:1:1:1 allocation. An interim analysis will be performed to determine the phage dosage with the most favorable safety and microbiological activity profile to inform phage dosing in stage 2b. During stage 2b, up to 32 additional volunteers will be randomized 1:1 to the phage or placebo arm. Primary outcomes include (1) the number of grade 2 or higher treatment-emergent adverse events, (2) change in log10P. aeruginosa total colony counts in sputum, and (3) the probability of a randomly selected subject having a more favorable outcome ranking if assigned to receive phage therapy versus placebo. Exploratory outcomes include (1) sputum and serum phage pharmacokinetics, (2) the impact of phage on lung function, (3) the proportion of P. aeruginosa isolates susceptible to the phage mixture before and after study product administration, and (4) changes in quality of life.This is a randomized, placebo-controlled, double-blind study of a single dose of intravenous phage in approximately 72 clinically stable adult cystic fibrosis volunteers recruited from up to 20 US sites with P. aeruginosa colony counts and provide insights into the safety profile of phage therapy.This trial will investigate the activity of phages in reducing ClinicalTrials.gov NCT05453578. Registered on 12 July 2022. The order of the items has been modified to group similar items  bacterial infections remain an international public health concern . The cysrbations . Becausee needed .Bacteriophages  are viruses that target and kill bacteria . Since tUnique features that make phages attractive for clinical use include their bactericidal activity , 8, highP. aeruginosa in expectorated sputumDescribe the safety of a single dose of intravenous (IV) phage therapy in CF volunteers with P. aeruginosa in expectorated sputumDescribe the microbiological activity of a single dose of IV phage therapy in CF volunteers with P. aeruginosa in expectorated sputumDescribe the benefit-to-risk profile of a single dose of IV phage therapy in CF volunteers with P. aeruginosa in expectorated sputumCharacterize the serum and sputum pharmacokinetic profiles of a single dose of IV phage therapy in CF volunteers with Describe changes in lung function in CF volunteers after the administration of a single dose of IV phage therapyP. aeruginosa isolates from CF volunteersCharacterize phage susceptibility among geographically diverse Describe CF volunteers\u2019 quality of life (QoL) before and after receiving phagesP. aeruginosa in expectorated sputum. The primary study outcomes include the safety and microbiological activity of IV phage therapy. The single dose of IV phage will consist of a mixture of four anti-pseudomonal phages.This is a phase 1b/2, multicenter, randomized, placebo-controlled, double-blind study of a single dose of IV phage in approximately 72 clinically stable adult CF volunteers colonized with 10 starting at 4 \u00d7 107 plaque-forming units (PFU). In each dosing arm, two volunteers will be enrolled. Each sentinel subject will receive a single dose of IV phage therapy. If no serious adverse events (SAEs) related to the study product are identified during the 96 h after phage administration in stage 1 volunteers, the study will proceed to stage 2.Stage 1 will involve six volunteers assigned to one of three IV phage dosing arms  at the time of screeningCF diagnosis based on a compatible clinical syndrome confirmed by either abnormal sweat chloride testing or cystic fibrosis transmembrane conductance regulator gene variationsAbility to produce approximately 2 mL of sputum over a 30-min periodP. aeruginosa isolated from a sputum culture, throat culture, or other respiratory specimens in the past 12 monthsP. aeruginosa isolation from a sputum sample at the screening visitConfirmed Capable of providing informed consentCapable and willing to complete all study visits and perform all procedures required by the protocolVolunteers must meet all inclusion criteria to be eligible to enroll in the study:Body weight <30 kgForced expiratory volume in 1 s (FEV1) <20% of predicted at screeningElevated liver function tests obtained at screeningAcute clinical illness requiring a new oral, parenteral, or inhaled antibiotic(s) \u226430 days prior to the baseline visitPregnant, planning to become pregnant during the study period, or breastfeedingActive treatment of any mycobacteria or fungal organisms \u226430 days prior to the baseline visitAnticipated need to change chronic antibiotic regimens during the study periodKnown allergy to any component of the study productAny significant finding that, in the opinion of the investigator, would make it unsafe for the volunteer to participate in the studyEnrollment in a different clinical trial \u226430 days of the baseline visit, or while enrolled in the current clinical trialPrevious enrollment in the current trialVolunteers who meet any of the following exclusion criteria will not be enrolled in the study:Upon identification of a potentially eligible participant, study procedures, risks, and potential benefits will be presented by the local study team during a screening visit. Participants will receive a copy of the study consent and will have the opportunity to ask questions. Before any study procedures are performed, informed consent will be obtained and documented.P. aeruginosa isolates to identify changes that occur after exposure to phages, and the impact of phages on the respiratory microbiome. No human genetic testing  will be performed.The information and specimens collected for this study may be used for future research. The research may include, but is not limited to, investigating the role of serum neutralizing antibodies, whole genome sequencing of P. aeruginosa airway colonization. Phage therapy is not currently approved as an anti-infective for use in humans by the US Food and Drug Administration (FDA). As such, most humans who have received phages as anti-infectives have received them in conjunction with, rather than in place of, antibiotic therapy [This trial will compare the safety and microbiological activity of phages versus placebo in clinically stable CF volunteers with chronic  therapy . This co therapy . An undeP. aeruginosa. These phages are naturally occurring and free of known deleterious genes, including genes essential for lysogeny , antibiotic resistance genes, and toxin genes. Each phage lot has been manufactured by Adaptive Phage Therapeutics (APT) in accordance with current Good Manufacturing Practices. Endotoxin levels in the phage lots are below acceptable limits set by the FDA (5 endotoxin units/kg/h). The phage mixture is administered as a total of 4 \u00d7 107 PFU, 4 \u00d7 108 PFU, or 4 \u00d7 109 PFU, depending on the target dose. The final phage combination to be administered to a trial participant is diluted to the target dose in normal saline. The minimum and maximum phage doses that are being investigated were informed by previous case reports, case series, and clinical trials, which generally used IV doses ranging from approximately 107 PFU to 1010 PFU per dose [The product used in this study is WRAIR-PAM-CF1. WRAIR-PAM-CF1 is a cocktail of four phages in a 1:1:1:1 combination: PaWRA01Phi11, PaWRA01Phi39, PaWRA02Phi83, and PaWRA02Phi87 , all of which are lytic against per dose , 7. All Volunteers may withdraw consent for study participation at any time without penalty. An investigator may also withdraw a volunteer from receiving the study product if it is determined that participation in the study is not in the best interest of the subject. Follow-up safety evaluations will be conducted, if the volunteer agrees.If any of the following events occur, enrollment and dosing for all volunteers will be suspended until the event is assessed by the Data Safety and Monitoring Board (DSMB): (1) any volunteer develops an SAE related to the study product through the last study visit, (2) two or more volunteers in the study experience a grade 3 or higher AE that is related to study product and is of the same type through the last study visit, (3) any volunteer develops anaphylaxis within 24 h after receiving the study product, or (4) any volunteer reports two or more pulmonary exacerbations, from the time of study product administration through day 8. Moreover, an individual infusion will be stopped if a drug-related hypersensitivity reaction is suspected. Study withdrawal could also occur if the study or study site is terminated by the sponsor for any reason.Recruitment of volunteers will occur by site investigators who are clinicians who care for persons with CF. Although there are no prespecified strategies that have been developed to increase adherence, only volunteers willing and able to participate in all planned follow-up visits will be selected for trial inclusion.P. aeruginosa after receipt of the study product, the volunteer will continue in the trial and be included in an intent-to-treat analysis. Receipt of antibiotic therapy with activity against P. aeruginosa will be documented as a concomitant medication and the underlying condition for which the antibiotic was taken will be reported as an AE. Chronic medications, rescue medications, and over-the-counter medications are allowed.Concomitant medications will be reviewed during each trial visit. If a volunteer is prescribed antibiotic therapy with activity against All volunteers will be followed for 30 days. AEs will be assessed and followed from initial recognition of the AE through the end of the 30-day follow-up period. SAEs will be followed through resolution even if the duration of follow-up goes beyond the planned follow-up period.10P. aeruginosa total colony counts in sputum cultures after administration of study product, and (3) desirability of outcome ranking (DOOR) using the greatest reduction by the day 8 visit. More specifically, volunteers will be placed into one of four DOOR categories  the number of grade 2 or higher treatment-emergent AEs through the day 30 visit, (2) change from baseline to day 30 logP. aeruginosa isolates susceptible to the four individual phages and the phage mixture before and after exposure to study product, and (4) changes in QoL of participants based on responses documented in the Cystic Fibrosis Questionnaire-Revised and the Cystic Fibrosis Respiratory Symptom Diary before and after exposure to the study product.Several exploratory endpoints will also be investigated: (1) sputum and serum pharmacokinetics of phage therapy, (2) impact on FEV1 from the administration of study product through day 30, (3) the proportion of The participant timeline is illustrated in Fig. The sample size was calculated to provide desired precision of the estimate of the DOOR probability in order to describe the benefit-to-risk profile of a single dose of IV phage. If the DOOR probability comparing IV phage and placebo is 70%, when the total sample size in each arm is 20 (combining volunteers from stages 2a and 2b), the two-sided normal approximate 95% confidence interval for DOOR probability is calculated at 51% and 89%, respectively, with the lower limit larger than 50%. Superiority will be considered to have been achieved if the 95% confidence interval for the probability does not cross 50%.Based on the interim analysis after stage 2a, the planned sample size for stage 2b will be re-evaluated as to whether it provides the desired precision of estimates of the DOOR probability for a selected phage dose and placebo. The total estimated sample size for the trial is 72 participants. In the intention-to-treat population, it is estimated that there will be up to 25 volunteers in the phage arm  and 25 volunteers in the placebo arm.CF volunteers will be recruited from up to 20 outpatient clinics in the USA. There will be no enrollment from international sites. It is anticipated that approximately three patients will be enrolled per month. The anticipated enrollment period is from October 3, 2022, until January 31, 2024.In stage 2a, volunteers will be randomized to either one of three IV phage doses or placebo with a 1:1:1:1 allocation as per a computer-generated randomization stratified by site, using a permuted block design. In stage 2b, volunteers will be randomly assigned to one of two arms: the selected phage dose  or placebo in a 1:1 allocation. The block size will be concealed until the primary endpoint is analyzed.Volunteers will be randomized using the Advantage eClinical data management system, a centralized, web-based enterprise resource developed and maintained by the Emmes Company. Allocation concealment will be ensured, as the randomization code will not be released until the patient has been recruited into the trial. The codes will be kept confidential and allocation communicated to sites electronically via a separate online enrollment module.The randomization process will be managed via an online enrollment module within the Advantage eClinical data management system.In stage 2, the subject and the investigators will be unaware of treatment group assignments. The three phage doses and placebo will be packaged identically so that treatment blinding is maintained. Specimens provided to the laboratory for analyses will be blinded to participant identification and visit number in addition to treatment assignment. Only the site pharmacist preparing the study product will be unblinded.Randomization code breaks will occur only when knowledge of the actual treatment is essential for further management of the subject. Site investigators are encouraged to discuss with the study team and DMID if they believe that unblinding is necessary. In the case of a medical emergency, if the site investigator believes that unblinding would benefit the medical care of the volunteer, the unblinding process can occur on-site by contacting the unblinded pharmacist.Data will be entered electronically by site study staff into Advantage eClinical. Instructions for use of the system and completion of the electronic case report forms (eCRFs) for each study will be included in the Advantage eClinical User\u2019s Guide and the eCRF Instructions. Quality assurance reports will be generated to ensure study data are clean, accurate, and complete. Quality assurance reports will include, but are not limited to, the following: missing forms, missing and out-of-range values, automated data queries, and targeted manual reviews of study data. The schedule of events is described in Table Volunteers may voluntarily withdraw their consent for study participation at any time without penalty. An investigator may also withdraw a subject from receiving the study product for any reason. Follow-up safety evaluations will be conducted if the subject agrees. Volunteers who withdraw, are withdrawn, or are lost to follow-up after administration of the study product will not be replaced.DMID\u2019s monitoring staff will either conduct site visits or remote source verification to assure appropriate quality and completeness of data. Discrepancies in data entry in eCRFs will trigger data re-entry requirements and/or site retraining for the relevant data fields.Personal health information will be collected and stored securely within the electronic study database maintained by the Emmes Company for a minimum of 2 years after study completion.P. aeruginosa by culture and determination of phage concentrations. Phage susceptibility testing (PST) will be performed on cultured P. aeruginosa strains. More specifically, sputum will be collected before and after study product administration at the baseline visit, as well as all follow-up visits and processed within 48 h of collection. The total CFU/mL of all morphotypes of P. aeruginosa identified in sputum cultures will be evaluated at each visit. As persons with CF are often colonized with more than one morphotype of P. aeruginosa, colony size, color, mucoid phenotype, antimicrobial susceptibility testing results, and other morphological features will be documented for each P. aeruginosa colony type to determine whether isolates might represent the same P. aeruginosa strain over time from the same patient.Processing of serum chemistries, liver function tests, and hematology to monitor for AEs will occur at local laboratories, in accordance with local standard operating procedures. Sputum specimens will be shipped to a central laboratory for quantification of P. aeruginosa quantitative cultures are performed, phage quantitative polymerase chain reaction (qPCR) will be performed to understand the pharmacokinetics of phage in sputum. Phages are expected to amplify upon infecting a susceptible bacterial host (in this case P. aeruginosa); therefore, it is hypothesized that the quantity of phage identified in the sputum should increase in the days after a dose of phage is administered.From the same sputum specimens and after P. aeruginosa in their bloodstream, the identification of phage in serum is expected to be short-lived; serum will be analyzed prior to infusion of the study product, and at 30 min, 1 h, 1.5 h, 2 h, 2.5 h, 3 h, and 3.5 h post-administration. Serum PK studies will also be performed at a single timepoint during the day 2 visit .As the study product is being administered IV, serum pharmacokinetics will also be evaluated. As trial participants would not be expected to have P. aeruginosa obtained from sputum specimens will undergo PST using both index P. aeruginosa isolates  and sequential P. aeruginosa isolates identified in sputum samples collected at six timepoints after study product administration, for each subject. PST results will inform the proportion of trial participants with P. aeruginosa isolates susceptible to both individual phages and the phage mixture.Each morphotype of P. aeruginosa isolate \u201csusceptible\u201d to the phages. Replicate testing will occur for any P. aeruginosa isolates with discrepant PST results. Briefly, the plaque assay utilizes a modification of the double agar overlay plaque assay [As no reference standard testing method for assessing bacterial susceptibility to phages exists, PST will occur using two approaches: (1) plaque assay and (2) liquid assay. Susceptibility to both tests will qualify a ue assay . Phages ue assay . The liqAnalyses will be performed on the basis of the intention-to-treat principle. Grade 2 or higher treatment-emergent AEs will be summarized descriptively. The number of events and number and percentage of volunteers with events in each arm will be tabulated and presented by system organ class and likelihood of being related/unrelated. The difference in the proportion of the number and percentage of volunteers with events between phage and placebo arms will be calculated with the corresponding 95% confidence interval.10P. aeruginosa CFU/mL  in quantitative sputum cultures from administration of the study product through day 30 will be summarized descriptively, by treatment arm. The area under the curve (AUC) calculated using the trapezoidal rule will be used to summarize log10P. aeruginosa CFU/mL over time. Differences in mean changes in log10P. aeruginosa CFU/mL and AUC between the phage and placebo arms will be calculated with the corresponding 95% confidence interval.Changes in logThe DOOR will be summarized using the DOOR probability . The DOOThere will be one planned interim analysis of the primary endpoints after volunteers in stage 2a complete their day 30 follow-up visits. The interim analysis will be performed to select the phage dose with the most favorable benefit-to-risk profile compared to placebo for stage 2b. The interim analysis will consist of a quantitative evaluation of potential effect sizes and associated precision using a predicted interval plots approach that will be generated for a range of assumptions . The resP. aeruginosa isolates susceptible to each phage and the phage mixture will be evaluated. The difference between phage and placebo will be calculated, along with a 95% confidence interval.As previously stated, there will be four exploratory outcomes. Phage pharmacokinetics will be analyzed using compartmental population pharmacokinetic models to obtain population mean estimates of clearances and volumes as well as estimates of inter-individual variability. Individual estimates of clearances and volumes will be obtained from post hoc estimates and used to estimate exposure in the central compartment and a peripheral compartment representing the sputum. The change in lung function measured by FEV1 will be summarized descriptively. The proportion of The Cystic Fibrosis Questionnaire-Revised will be administered at the baseline and final visit for stage 2 participants. This questionnaire contains a series of questions regarding several physical health and ability domains. The Cystic Fibrosis Respiratory Symptom Diary will be collected at all visits for stage 2 participants. Change from baseline through day 30 follow-up visit in Cystic Fibrosis Respiratory Symptom Diary score will be presented by treatment group.The primary outcome will be analyzed on the intention-to-treat population. Endpoints may be missing for volunteers who withdraw from the trial. The reasons for withdrawal will be reported and compared by arm. The effect that any missing data might have on results will be assessed via a sensitivity analysis. Baseline characteristics of participants with missing data will be compared to participants without missing data.The datasets analyzed during the current study and statistical code will be available from the corresponding author, upon reasonable request. The full protocol will be available on clinicaltrials.gov.DMID within the NIH serves as the overall study sponsor, responsible for trial conduct and safety oversight. The DMID Clinical Research Operations and Management Support team will conduct site training, monitoring, and close oversight of study visits to assure proper adherence to trial protocol and research standards. Monitoring visits will include periodic review of data submission forms, source data verification, adverse event reporting, and consent documentation.Safety oversight will be conducted by a DSMB that is an independent group with the necessary expertise. The DSMB will monitor subject safety and advise DMID. The DSMB members will be separate and independent of research personnel participating in this study and will not have scientific, financial, or other conflicts of interest related to this trial. The DSMB will review data at prespecified intervals during the trial and will conduct ad hoc reviews, as appropriate when a halting rule is met or for immediate concerns regarding observations during the trial.All AEs will be graded for severity according to the Common Terminology Criteria for Adverse Events Version 5.0 and assessed for the relationship to the study product. The assessment of the AE\u2019s relationship to the study product will be performed by a licensed clinician. An AE is considered an SAE if, in the view of either the site principal investigator or sponsor, it results in any of the following outcomes: death, a life-threatening AE; inpatient hospitalization, a persistent or significant incapacity or substantial disruption of the ability to conduct normal life functions; or a congenital anomaly/birth defect.Monitoring for this study will be overseen by the DMID Clinical Research Operations and Management Support monitoring contractor. The Clinical Research Operations and Management Support team will conduct periodic site visits throughout the trial, including a review of data collection forms, source data verification, adverse event reporting, and consent documentation. The monitors will also count and view the study product to verify the number of phage vials.Protocol modifications will be submitted for review by participating institutional review boards (IRBs) for approval prior to implementation. Should any amendments alter the study conduct for participants, participants will be notified of the changes and will be requested to sign updated consent forms.Study results will be reported in accordance with Consolidated Standards of Reporting Trials guidelines for randomized controlled trials. Results will be submitted to clinicaltrials.gov within 1 year of study completion. The authors plan to submit study results for publication in a peer-reviewed scientific journal and/or present at relevant conferences. No participant-protected health information will be revealed in any publication or presentation.Phage usage in human medicine in the West currently remains experimental. In recent years, phage administration as an adjunct therapy to systemic antibiotics for the treatment of highly resistant and/or recalcitrant infections under compassionate use conditions has significantly expanded . SeveralP. aeruginosa otitis media in 24 patients in the UK [P. aeruginosa strains with susceptibility to at least one phage in a 6-phage mixture. A single topical application of the phage mixture was applied to the affected areas of patients randomized to the treatment arm. The trial was terminated early due to a 30% greater detectable efficacy signal in the treatment arm, without any treatment-related AEs observed.To summarize some notable trials: Wright and colleagues conducted a randomized, controlled trial evaluating the efficacy of phages for the treatment of chronic n the UK . EnrollmEscherichia coli diarrhea in 120 Bangladeshi children [E. coli susceptibilities to phage were not evaluated. Moreover, it was unclear if E. coli was the causative diarrheal pathogen in participating children and protection of oral phage during gastric transit was not provided. No treatment-related AEs were identified.Another trial evaluated the efficacy of oral phage therapy to reduce the severity and duration of children . The triP. aeruginosa using a 12-phage cocktail was investigated in 220 patients in France and Belgium [The treatment of burn-related infections caused by  Belgium . Patient4\u2013105 PFU and the unexpected effectiveness of the mechanical bladder irrigations.Finally, a clinical trial was conducted on males prone to urinary tract infections awaiting transurethral resection of the prostate . One hunAlthough several trials have sought to investigate the efficacy of phage therapy, they have all had notable limitations. Important gaps in knowledge that need further investigation include the efficacy of phage therapy; optimal frequency, dosage, and duration of phage administration; limitations in rapid and accurate laboratory testing platforms\u2014including a reference standard that reliably predicts phage susceptibility; an understanding of the frequency of the emergence of phage resistance; the role of the human immune system in phage efficacy; and the comprehensive safety profile of phage therapy. With continued advancements in medical care, complicated bacterial infections will remain challenging. It is essential to determine if the limitless supply of phages is an important adjunct to traditional anti-infectives. The current trial will provide important insight into the efficacy and safety of phage therapy and provide the foundation for future larger, multi-dose phage studies.The trial enrolled its first subject on October 3, 2022, and recruitment remains active as of the time of printing. It is estimated that recruitment will be completed by January 31, 2024. The most current protocol version number is 20-0001, version 4.0 dated 7 October 2022."}
+{"text": "Macrobilharzia at the base of the Schistosoma + Bivitellobilharzia radiation. Patterns of definitive and intermediate host use and a strong role for intermediate host-switching are discussed relative to schistosomatid diversification.Schistosomatidae Stiles and Hassall 1898 is a medically significant family of digenetic trematodes (Trematoda: Digenea), members of which infect mammals or birds as definitive hosts and aquatic or amphibious gastropods as intermediate hosts. Currently, there are 17 named genera, for many of which evolutionary interrelationships remain unresolved. The lack of a resolved phylogeny has encumbered our understanding of schistosomatid evolution, specifically patterns of host-use and the role of host-switching in diversification. Here, we used targeted sequence capture of ultra-conserved elements (UCEs) from representatives of 13 of the 17 named genera and 11 undescribed lineages that are presumed to represent either novel genera or species to generate a phylogenomic dataset for the estimation of schistosomatid interrelationships. This study represents the largest phylogenetic effort within the Schistosomatidae in both the number of loci and breadth of taxon sampling. We present a near-comprehensive family-level phylogeny providing resolution to several clades of long-standing uncertainty within Schistosomatidae, including resolution for the placement of the North American mammalian schistosomes, implying a second separate capture of mammalian hosts. Additionally, we present evidence for the placement of  Schistosoma Weinland, 1858 are the major etiological agents of human schistosomiasis, one of the world\u2019s most recalcitrant neglected tropical diseases still infecting over 250 million people globally [An informed understanding of diversification is lacking for most multi-host helminth groups ,2. In faglobally ,15. Moreglobally ,17.Among digeneans, schistosomatids have unusual characteristics, the most notable being that they are exclusively dioecious  parasites of endotherms , which are collective attributes not shared with any other digenean family ,19. Schi28S, 18S, ITS1, and 2) and a single mitochondrial gene (cox1).Despite advances, our understanding of schistosomatid interrelationships, patterns of host-use, and character evolution remains incomplete ,22,23,24Austrobilharzia, Bivitellobilharzia, Heterobilharzia, Macrobilharzia Ornithobilharzia, Schistosomatium, and Schistosoma. Gigantobilharziinae Mehra 1940 comprises Gigantobilharzia and Dendritobilharzia. Bilharziellinae Price 1929 includes Bilharziella, Trichobilharzia, Jilinobilharzia, Allobilharzia, and Anserobilharzia. A fourth subfamily, Griphobilharziinae Platt, Blair, Purdie & Melville, 1991, containing a single species Griphobilharzia amoena, has been recognized, but sequence-based data places this species within the Spirorchiidae [Currently, within the Schistosomatidae, there are 17 named genera and over 130 named species . Based orchiidae . Moleculrchiidae ,37,38,39AO Clade: Marine avian genera, Austrobilharzia and Ornithobilharzia (AO clade), are often recovered as well-supported sister genera [r genera ,39,40, aSB Clade: Species of the Afro-Eurasian mammalian clade  are found in tropical and sub-tropical latitudes. Schistosoma and Bivitellobilharzia are considered probable sister genera, but the use of traditional loci often does not statistically support this grouping. A better understanding of relationships within the SB clade and its placement within Schistosomatidae is essential to understanding the evolution of human schistosomatids.Macrobilharzia:Macrobilharzia is a monotypic genus with species that infect Anhinga anhinga in the Americas and has failed to group consistently with other schistosomatid lineages. Some rRNA phylogenies suggest an (unsupported) affinity with the SB clade, suggesting the possibility of the SB clade having had Afro-Eurasian avian-infecting ancestors. Cercariae (Schistosomatidae-W688) recovered from the freshwater snail Indoplanorbis exustus in Nepal [M. macrobilharzia.in Nepal  represenDAS Clade: The derived avian\u2013schistosomatid (DAS) clade includes the majority of avian-infecting genera  and several yet-to-be described genera. The monophyly of DAS is consistently supported (HS Clade:Heterobilharzia and Schistosomatium (HS clade) are both monotypic genera whose species infect North American mammals and form a well-supported clade in most studies  and C1 (Avian Schistosomatidae lineage 3). Nucleotide coverage was high in taxa of key interest such as Macrobilharzia macrobilharzia (81% of 554 loci), Schistosomatidae sp. W688 (84%), Heterobilharzia americana (93%), and Bivitellobilharzia nairi (73%)  .Macrobilharzia as a sister genus to Schistosomatidae sp. W688. Within the SB clade, there is strong support for Bivitellobilharzia as a sister to Schistosoma, and within Schistosoma there is strong support for the main species groups [Bilharziella polonica was found to be basal relative to the DAS clade.Across all phylogenies reconstructed  and meths groups ,63,64 thSchistosoma mansoni genome. Of 139 UCE loci that were mapped to the Z-chromosome (n = 35) and used for phylogenetic reconstruction (Macrobilharzia macrobilharzia (63% of 139 loci), Schistosomatidae sp. W688 (62%), Heterobilharzia americana (68%), and Bivitellobilharzia nairi (60%).All recovered loci were mapped to their presumptive chromosomal location within the romosome , 85 weretruction . Loci weMacrobilharzia + Schistosomatidae sp. W688 at the base of the SB clade. The corresponding maximum likelihood analysis of Z-chromosome UCEs also placed Macrobilharzia + Schistosomatidae sp. W688 at the base of the SB clade, but with weak support (66% of bootstrap replicates).Both the maximum likelihood and Bayesian inference analyses of Z-chromosome UCE loci yielded topologies congruent with the analysis of genome-wide loci . In analSchistosoma-derived bait set . We generated the first phylogenetic tree, for any helminth group, based on Z-chromosome-specific loci (sex chromosome). Based on material available from extant species, our results suggest that schistosomatids first appeared in marine birds and gastropods. They later colonized freshwater snails and both birds and mammals associated with freshwater. Two separate acquisitions of mammalian hosts are supported. From within a diverse freshwater-based lineage of avian schistosomatids, some representatives have secondarily colonized marine gastropod and avian hosts.Past studies using few or single loci to reconstruct the generic relationships within Schistosomatidae often failed to resolve deeper nodes, particularly those significant to diversification by host switching. Herein, we report the resolution of several pivotal nodes and thus an improved understanding of schistosomatid diversification, mainly in the context of intermediate host use. Relative to other taxa ,58,65, wResolved phylogenetic trees are necessary to estimate the timing of diversification events. However, without available fossil data, no primary calibration points exist to estimate divergence times for schistosomatids or other helminths. Parasitologists often use host divergence data to derive secondary calibration points ,66, but Austrobilharzia and Ornithobilharzia infect marine birds and snails. Schistosomatids have been hypothesized to have first diverged from spirorchiids (Spirorchiidae), modern day parasites of marine or freshwater turtles, which are the well supported sister clade to Schistosomatidae [All UCE analyses support the AO clade as a sister to the rest of the Schistosomatidae, suggesting an early diverging position. Members of omatidae ,27,72. Eomatidae ), which omatidae . The snaomatidae , while Comatidae . SchistoBivitellobilharzia, experimental hosts were found to be planorbids [Schistosoma species; (3) at least one representative of the M clade is hosted by a planorbid (Schistosomatidae sp. W688) [Bilharziella polonica, has a planorbid snail host, as do many other members of the this clade [Schistosoma use lymnaeid snail hosts; (2) the HS clade use exclusively lymnaeids; (3) they are prominently represented as snail hosts in the DAS clade. Caenogastropods too deserve consideration, as snail hosts prior to the split between the SB + M and DAS + HS clades, insofar as all members of the early diverging Schistosoma japonicum species group utilized Pomatiopsidae snails. Davis [Schistosoma had co-diversified with amphibious caenogastropods.Some evidence from contemporary gastropod host use among schistosomatids suggests that prior to the (M +SB) and (HS + DAS) split, the prevailing gastropod hosts may have been snails in the family Planorbidae . In suppanorbids ; (2) plap. W688) ; (4) theis clade . A role s. Davis  suggesteSchistosoma and Bivitellobilharzia have been considered to be sister genera despite conflicting phylogenies (Schistosoma originated in the mid-Miocene (16\u201311.6 mya), based largely on estimates by Davis [S. japonicum clade. The suspected role of this snail family in the diversification of Schistosoma led to the use of mt DNA to estimate pomatiopsid divergence between 12\u20135 mya [Bivitellobilharzia and Macrobilharzia represents important collection goals, as this will help to evaluate the likelihood of the various scenarios highlighted above\u2014planorbid, lymnaeid or pomatiopsid species as ancestral hosts for proto-Schistosoma, with possible attendant changes in the timing of molecular divergence among schistosomatids [Branch lengths in the phylogeny  suggest logenies , and allby Davis  using fo12\u20135 mya . Going fsomatids .Macrobilharzia at the base of the SB + DAS clades, thus diverging earlier than the majority of avian schistosomatid species. Mitochondrial cox1 studies, however, provide less consistent results [Macrobilharzia. For instance, whereas the cercariae for the M clade member W688 possess eyespots, cercariae within the SB clade do not. It is not known if cercariae of Macrobilharzia spp. have eyespots or not.Although branch support values were higher for the Z-chromosome phylogeny  than the results ,40, poss results ,81. OverBilharziella, Dendritobilharzia, Avian Schistosomatid C [Anserobilharzia , and this may suggest that ancestors to the DAS + HS clade similarly infected a broad host range, as might be expected during a transition from a marine to freshwater environment. UCE analysis . Avian Gigantobilharzia, Dendritobilharzia, and six undescribed genera form Clade 3. Branch lengths within this clade, specifically the distance between tips, are large, which may suggest missing taxa. Remarkably, the taxa in Clade 3 . Based Schistosomatium douthitti is a rodent parasite whereas Heterobilharzia americana is primarily a raccoon (Procyonidae) and dog (Canidae) parasite, though it has been reported from a broad spectrum of mammals [H. americana is truly a single species and not a complex of cryptic species [HS may have been historically more speciose, as the loss of the North American mammalian megafauna led to the extinction of many lineages relative to the mammalian megafauna in Africa and Asia , which d mammals ,88,89. B species  reconstrAcross the Schistosomatidae, definitive host associations appear less constrained, at the level of host order or below, relative to intermediate host associations ,91,92. OMost obviously within the DAS clade, intermediate host-switching events are characterized by short inter-nodal branches and do not appear to be associated with deep divergence events. This suggests that such host-switches can occur relatively rapidly and frequently over evolutionary time, and genetic differences among lineages  have not had time to accumulate.facilitated host-switching hypothesis\u2014intermediate host-switches may be facilitated by coinfections with other snail parasites [Austrobilharzia species seem to specialize in actively exploiting the presence of other trematode larvae to colonize their snail hosts [ecological fitting hypothesis would suggest that schistosomatid larvae may retain pre-adaptations, evolved from ancestral host-use, that enable them to infect different gastropod lineages [evolutionary potential hypothesis (this study) proposes that schistosomatid species maintain high genetic diversity and large effective population sizes, favoring the presence of rare alleles that might confer infectivity in a new gastropod lineage, as observed in population level studies of Schistosoma japonicum [Trichobilharzia spp. [S. mansoni [Why intermediate host-switches are seemingly so numerous within Schistosomatidae is an open question, one understandably hard to capture with experimental studies. Some hypotheses are as follows: (1) The arasites ,99. For il hosts , and in il hosts . (2) Thelineages ). The evaponicum ,102,103, mansoni ,106,107. mansoni ,109, whi mansoni . That sc mansoni , which fThe diminutive size and location of schistosomatids within their hosts  present significant challenges to next-generation sequencing applications and downstream phylogenomic analysis. Species of several novel, unnamed genera were not included in this dataset despite considerable effort, due to inadequate specimen quality; their future inclusion may increase resolution still more. We found that, in general, adult worms yielded the most DNA and average number of reads, and the best capture success for multiple loci. Notably, among cercarial samples, none of these measures improved, on average, by increasing the number of cercariae extracted, suggesting this pattern is not solely related to amount of starting tissue.Modifications of our sequence capture and library preparation protocols (see the Methods section) increased the recovery rate of UCE loci (a three-fold increase). Future studies performing sequence capture on organisms with a low quantity of or degraded museum specimens should consider incorporating these modifications. Large amounts of sequence data are fairly robust to missing data , and it This study supports the utility of Z-chromosome loci for the phylogenetic reconstruction of schistosomatids. Sex-chromosome markers have proven to be valuable phylogenetic tools among vertebrates ,116, oftOur analyses  demonstrHaminoea [Siphonaria [Additional schistosomatid biodiversity remains to be discovered. Brant and Loker  posit thHaminoea  and Siphphonaria ,35  and have originated from various collectors over the past two decades. This manuscript retained the taxa designations and/or collector IDs from the original publications (see Schistosomatid samples were collected as described in Brant and Loker  and Ebbsions see  to facilSchistosoma mansoni genome (described in detail below); the resultant set was used to mine published genomes. Fourteen schistosomatid taxa and five outgroup taxa  data.UCE probes were designed using the oup taxa  were minSeveral extraction protocols were used to obtain template DNA of sufficient quantity and quality, which is often a limiting factor in the number and quality of the UCE loci recovered from museum specimens ,126. MosSchistosoma mansoni genome as a reference. Approximately 4000 UCE loci were targeted. The bait set was manufactured by Arbor Biosciences .In total, 40 samples were selected for targeted sequence capture of UCEs , specifi\u00ae Manual v. 3.02) were followed, but with several modifications to the standard sequence capture and library preparation protocols to accommodate low amounts of DNA and a variable fragment size. To optimize sample preparation protocols, our samples were divided into four distinct sequence capture experiments and sequencing runs . R1 used standard sticky-end library preparation coupled with standard amplification polymerase. R2\u2013R4 employed blunt end library preparation chemistry and an uracil non-stalling amplification polymerase. This step aimed to reduce adapter dimers, which were abundant in R1 samples. For all runs, a size-selection step following library preparation was not performed due to low DNA quantity. Between R1 and R2\u2013R4, hybridization temperatures were modified . Post-capture libraries were amplified for 12 cycles. Sequencing of paired-end, 100 bp reads was conducted on an Illumina HiSeq 2000. All sequence data for taxa listed in Library enrichment procedures for the MYcroarray MYBaits kit  using the NCBI SRA-toolkit  in fastq format (fastq-dump in SRA toolkit) and trimmed the data following the steps described above. Draft genome sequences were assembled using the MEGAHIT program [Echinostoma caproni genome (PRJEB1207) had the highest number of shared loci and was selected as the outgroup.Quality control of the raw reads included trimming adapter contamination and low-quality bases from reads, using the program Trimmomatic  and a 4- program . UCE loc program . Among tn = 47,554 loci, 4,780,079 bases) were aligned for the purposes of phylogenetic reconstruction . Sex chromosomes, due to their reduced recombination rates and effective sizes, have been shown to make excellent phylogenetic markers, often resolving nodes that autosomal loci fail to resolve [Schistosoma mansoni Z-chromosome (PHYLUCE [All the shared UCE loci for Schistosomatoidea + outgroup (truction . A secon resolve . Based o(PHYLUCE ). Of the.All alignments were unpartitioned and analyzed in RAxML v.8.0.19  using thThrough the analysis of 554 nuclear UCE loci, and a subset of 85 Z-chromosome specific UCE loci, we were able to resolve many pivotal interrelationships within Schistosomatidae, representing the most comprehensive family-level phylogeny to date. Some nodes failed to be resolved or were weakly supported. Further resolution of the two primary radiations (SB + M and DAS + HS) resulting in derived schistosomatid diversity, may be challenging for two possible reasons. 1) Contemporary lineages might have radiated simultaneously and rapidly, resulting in incomplete lineage sorting , which c Contempo"}
+{"text": "In recent years, there has been a global resurgence of public interest in fermented foods. In parallel, there have been several new studies that associate the consumption of fermented foods with a variety of beneficial impacts. These combined developments have led to a renewed focus in research and innovation vis-\u00e0-vis fermented foods, particularly traditional fermented foods, with an aim to harness this information to develop novel fermented foodstuffs and ingredients and make them available in the market. Consequently, an ever greater and more diverse array of fermented foods, including functional fermented foods with health benefits, are becoming available for public consumption in global markets, with the number expected to grow substantially in the coming decade. This rapidly expanding portfolio of commercially available fermented foods has in turn required an evolution in the corresponding global regulatory frameworks. Due to the innovative and emerging nature of these foods, combined with historical differences in regulator approaches, significant disharmony exists across these frameworks, with individual nations and organizations often adopting unique approaches relating to the establishment of standards and specifications. In this review, we provide an overview of the current regulatory frameworks for a diversity of fermented foods across multiple jurisdictions, with special emphasis on differences in legislative structures and approaches, regulatory harmonization, and current legislative limitations. Overall, the review provides important perspective and context in relation to current global fermented food regulatory practices with possible directions and recommendations for future legislative efforts. Fermented foods, defined as \u201cfoods made through desired microbial growth and enzymatic conversions of food components\u201d , providein vitro studies /g of starter culture and 106 CFU/g of microbes mentioned in labels) for sterilized and non-sterilized fermented milks. Notably, the Codex Standard for fermented milk 7 CFU/g starter culture bacteria in yogurt and a minimum of 106 CFU/g of other microbes, if present, in line with the Codex Alimentarius Standards for fermented milk products (CXS 243-2003) , a fundamental part of the Food Standards Programme for the United Nations Food and Agriculture Organization (FAO) and the World Health Organization (WHO) . Most gl43-2003)  32, 35), 357 col43-2003) .Codex Alimentarius Standards for kimchi (CXS 223-2001) have been recently revised, having first been published in 2001  36). Th. Th36). Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus fermented yogurt listed as raw material; the definition also allows for use of other starter cultures, addition of flavor compounds, vegetables and dietary fibers (Aspergillus sp. (Bacillus sp. and/or Aspergillus sp.) with soybean being an essential component . It further specifies the essential composition of tempe as being comprised of soybeans and a \u201cmold of Rhizopus spp.  mix with cooked rice powder, rice bran powder and/or wheat bran powder as an inocula\u201d (Manihot esculenta Crantz) with subsequent fermentation in water, pressing, drying and cooking; no microbiological information is available  from Africa, and doogh (CXS 332R-2018), fermented soybean (CXS 298R-2009), gochujang (CXS 294R-2009), and tempe (CXS 313R-2013) from Asia . Doogh iy fibers  39). Th. ThStrepllus sp.  38). Op. OpStrepomponent  40). Ye. YeStrepinocula\u201d  41). No. NoStrepvailable  37). Fo. FoStrep4R-2020 fIn Europe, fermented foods, including cultured milks, fall within the scope of the General Food Law Regulation (Regulation (EC) No 178/2002; current consolidated version 26 July, 2019), which is designed \u201cto ensure a high level of protection of human life and consumers interests in relation to food, while ensuring the effective functioning of the internal market\u201d  42). Mi. Mi42). et al in relation to fermented soybean extracts (Novel Foods are covered by Regulation (EU) 2015/2283 , in amendment of Regulation (EU) 1169/2011 and repealing Regulation (EC) 258/97 of the European Parliament and the Council and Commission Regulation (EC) 1852/2001 . Under textracts . A list 8 CFU/g  . The reg8 CFU/g . All othRecent regulatory developments around probiotics in Europe may have important implications for FFs, particularly those with health claims. Currently, most EU countries consider the term \u201cprobiotic\u201d a health claim and several do not even allow unspecified claims such as \u201ccontains live bacteria.\u201d However, in the absence of a harmonized and well-defined policy, probiotics and functional FFs are subject to national provisions and several Member States are using the term \u201cprobiotics\u201d in more generic terms. Recently, the Spanish Agency for Food Safety and Nutrition (AESAN) has expressed willingness to accept the use of the term \u201cprobiotic\u201d on labels of food and food supplements produced and commercialized in the country without the authorization of any health claim until a uniform criterion for probiotics is generated by the Member States of the EU. AESAN has provided a 3-fold explanation for such a decision. Firstly, it recognizes that there are different interpretations for use of the term \u201cprobiotic\u201d among the Member States leading to a non-harmonized European Union market. Secondly, it argues that implementation of provisions set for the use of the term \u201cprobiotic\u201d in the NHCR Guidance is legally non-binding on EU Member States. Thirdly, it refers to the \u201cprinciple of mutual recognition\u201d established in the EU Treaty (Regulation EU 2019/515), whereby any product legally marketed and sold in one EU Member State may be sold in others as well. AESAN elaborates that due the non-harmonized European Market vis-\u00e0-vis probiotics, adjacent markets are already using the term \u201cprobiotic\u201d in a more generic fashion and in turn marketing their products in Spain, to the detriment of Spanish industry and market. Previously, France, Portugal and Belgium have allowed the use of the term \u201cprobiotic\u201d as a non-specific health claim, when accompanied by a specific health claim. More recently, Italy has indicated that the term \u201cprobiotic\u201d might be used for food and food supplements of probiotic microorganisms traditionally used for intestinal microbiota balance. Additionally, the Czech Republic has issued national guidelines allowing the use of the term \u201ccontains probiotics\u201d as a nutrition claim, subject to the fulfillment of the conditions of use for nutrition claims defined in the NHCR. The Netherlands, Denmark and Poland have recently stated that in the future they will consider \u201cprobiotics\u201d as a mandatory category term for dietary supplements but not for other foods or food ingredients. These regulatory reforms, understandably, will have significant impact on the development, commercialization and sale of FFs with health claims in the EU. Indeed, probiotic regulations are often closely linked with regulations for FFs with health claims, as we will see below. While deviation from the definition of probiotics with regards to labeling and communication as set forth by the NHCR in national policies of the Member States would certainly re-open the market for more products, it essentially creates a fragmented EU marketplace for probiotic products including functional FFs. Notably, this can create considerable confusion in differentiating \u201cdefinitive\u201d and \u201cgeneric\u201d probiotics/functional FFs.Within the Russian Federation, relevant legislation relating to FFs include the \u201cRequirements for Ferments and Enzyme Preparations\u201d (Article 12) and \u201cRequirements as to Facilities for Ferment and Probiotic Microorganisms production\u201d (articles 13 and 26) detailed in the Federal Law \u201cHygienic requirements for manufacturing and trafficking of biological active additives to food\u201d (SanPiN 2.3.2 1290-03)  Figure . AdditioL. bulgaricus and S. thermophilus; the regulation allows addition of probiotic cultures and other lactic acid bacteria (21 CFR 131.200) (Draft Guidance for Industry: Acidified Foods\u201d (75FR50268), which provided recommendations relating to the manufacturing, storage, packaging distribution, and quality control for acidified foods including eligible fermented foods. However, the guidance was later partially withdrawn on December 2015 (80FR81550) as several of the addressed topics are presently dealt through other documents. Acidified foods must also be compliant with other Federal Laws including Good Manufacturing Practice (21 CFR part 117 Subpart B), Acidified Foods Regulation (21 CFR 114), Emergency Permit Control (21 CFR 108), Thermally Processed Low-Acid Foods Packaged in Hermetically Sealed Containers Regulation (21 CFR 113), and FDA Acidified and low-acid canned foods guidance and regulations , among others. The regulation for yogurt, even though an acidified food, is provided through the \u201cRequirements for Specific Standardized Milk and Cream\u201d (21 CFR part 131.200); the regulation defines yogurt in terms of microbiological and nutritive parameters, and outlines labeling requirements, assessment methods, and acceptable additives, among others.In US, all foods are subject to both Federal and corresponding State Laws. While the US Food and Drug Administration (FDA) has put regulations in place pertaining to acidified foods including yogurt, it does not regulate other FFs since they have not found any cases of untoward consequences from consumption of same . In the 131.200) . In the 131.200) . On Septhttps://fermentationassociation.org/head-food-and-beverage-laws-passed-in-2021/, https://fermentationassociation.org/food-and-beverage-laws-passed-in-2021-part-2/).The Homemade Foods or Cottage Foods legislations in various US States are another set of important regulatory framework with respect to FFs . All staThe development of US legislation involving \u201cgluten-free\u201d health claims provide an example of how legislative frameworks can be developed for specific health claims, where a certain demography may be at risk. In this case, the vulnerable demography refers to individuals suffering from celiac disease, which is a hereditary, chronic inflammatory disorder of the small intestine that is triggered by gluten intake. An associated final rule was published in the US Federal Register by the FDA in 2013, in which the term \u201cgluten-free\u201d for voluntary use in labeling foods was defined . The rule provides protection to individuals with celiac disease through enforcement of truthful and accurate labeling of relevant information. More recently, in 2020, the US FDA released a final rule to establish compliance requirements for fermented and hydrolyzed foods that bear the \u201cgluten-free\u201d claim. The final rule, titled \u201cGluten-Free Labeling of Fermented or Hydrolysed Foods,\u201d covers fermented foods such as yogurt, sauerkraut, pickles, cheese, as well as green olives, FDA-regulated beers and wines, and hydrolysed plant proteins. Under this rule, FDA will determine compliance based on records kept by the manufacturer to show that their foods are gluten-free before fermentation or hydrolysis occurs .Keeping Our Manufacturers from Being Unfairly taxed while Championing Health) Act that demanded an update to the Internal Revenue Code to exempt kombucha from federal excise taxes and regulations intended for beer (27 CFR Part 5). More specifically, an increase in the allowable alcohol by volume (ABV) for kombucha only from 0.5 to 1.25% was demanded. This culminated in the drafting of the kombucha law by US senators in association with KBI in 2017. In the proposed law, kombucha was defined as a beverage that \u201c(a) is fermented only by a symbiotic culture of bacteria and yeast, (b) contains no more than 1.25% alcohol by volume, (c) is sold or offered for sale as kombucha, and (d) is derived from sugar, malt or malt substitute, tea or coffee and no more than 20% of other healthy ingredients.\u201d However, the law has yet to be ratified by the US senate  is a US-based trade association with 40 initial founding companies and 300 brewery members. It represents global commercial interests with respect to kombucha and provides a kombucha code of practice to ensure food safety, high standards of quality and transparent communication to enable consumers to make an informed choice . The KBIS senate . A proceS senate . The docS senate . The FDAS senate .Lactobacillus spp. and Bifidobacterium spp.) with a declared minimum viability level of 109 CFU per stated serving size of food maintained throughout the product shelf-life  for a variety of foodstuffs including FFs, which have now been incorporated in the Safe Food for Canadians Regulations (SFCR) that came into force on January 15, 2019 . LabelinIn Japan, food safety and standards fall within the scope of the Food Sanitation Act  . This inIn 1991, Japan's Ministry of Health, Welfare and Labor formed the Food for Specified Health Uses (FOSHU) guidelines as a regulatory system for functional foods, including probiotic-containing FFs  Figure . Foods fBacillus, most commonly Bacillus subtilis. For now, the standard is meant to be regional, rather than international, as consumption of fermented soybean products is highest in the said regions. The draft standard is expected in 2022, while the finalized standard is expected to be formally adopted by 2024.In order to boost the export and guarantee the safety of natto, one of Japan's iconic fermented foods, the Japanese Ministry of Agriculture, Forestry and Fisheries has started working with the Codex Alimentarius Commission (CAC) to develop the \u201cAsian Regional Standards for Soybean Products Fermented using microorganisms Bacillus.\u201d To this end, Japan will be working closely with other relevant stakeholders such as China, South Korea and Thailand. The Codex Standard will effectively involve most fermented soybean products similar to natto, such as South Korea's cheonggukjang, China's douchi, Thailand's thua nao sa and India/Nepal's kinema, among others. All of these foods involve fermentation using Lactobacillus helveticus R0052, Bifidobacterium infantis R0033 and B. bifidum R0071), a private enterprise involved in developing specialty ingredients including probiotic and yeasts strains, were added to the novel food raw materials list in 2020. China also has \u201cGuobiao\u201d (GB) or \u2018National Standards\u201d for certain FFs; these Standards are equivalent to the ISO standards used in Western countries (Pseudomonas cocovenenans in homemade suantangzi (fermented corn noodles). Such an incident highlights the need for Standards and regulations relating to FFs, especially in Asian nations where FFs have traditionally constituted an essential part of the staple diet.The Food Safety Law is the overarching food regulatory legislation in China with detailed rules for food standards, food surveillance and assessment, and food import and export, among others . Currentountries . The Natountries , 2. No oL. delbrueckii subsp. bulgaricus and S. thermophilus, but allows for addition of Bifidobacterium bifidum, Lactobacillus acidophilus or \u201cother harmless lactic acid bacteria\u201d if suitable declarations are made on the label, with microorganisms in the final product needing to be \u201cviable and abundant\u201d  established the Food Safety and Standards Authority of India (FSSAI), which is responsible for surveillance of foods and implementation of the act, and laid down science-based standards for manufacture, storage, distribution, export and import of foods, among others  Figure . Regulatbundant\u201d , 2. The bundant\u201d . While FThe Republic of Korea has several laws and ministries that are involved in the regulation of foodstuffs. With respect to FFs, the most important legislations include the Food Sanitation Act, the Food Code, Functional Health Foods Act (FHFA), Health Functional Food Code, and the Food Labeling and Advertisement Act . While m6 CFU/ml of lactic acid bacteria/yeasts has been set for the fermented beverages; additional descriptions include standards for counts of undesirable microbes and analytical methods. No specific mention of kombucha is made in the Food Code. Fermented milks, described in Section 5.19.4 of the Food Code, are defined as \u201cproducts made by fermenting raw milk or milk products with LAB or yeasts; or by adding food or food additives to such fermented milk products.\u201d Further clarification with respect to different types of fermented milks is provided, including for fermented milk (>3% non-fat milk solids), thick fermented milk (>8% non-fat milk solids), fermented cream (>3% non-fat milk solids and >8% milk fat), thick fermented cream (>*% non-fat milk solids and >8% milk fat), and fermented buttermilk with >8% non-fat milk solids. A minimum count of 107 CFU/ml of LAB or yeasts is specified for all fermented milk types, along with other microbiological standards, ingredients and analytical methods. Section 5.20.2 of the Food Code, attributed to salted and fermented seafood products, provides the following definition \u201c..products made by adding salt to fishes, crustaceans, mollusks or echinoderms etc., and fermenting and aging them; or by adding food or food additives to the filtrate separated from such fermented and aged foods and processing them. It includes jeotkal , seasoned jeotkal , fish sauce, and seasoned fish sauce\u201d. Jeotkal, seasoned jeotkal, fish sauce and seasoned fish sauce are separately defined as well. The Food Code additionally describes ingredients, analytical methods, and microbiological and organoleptic specifications for salted and fermented seafood products. Definitions for fermented soybean products such as meju (fermented soybean lump), doenjang (fermented soybean paste), gochujang (fermented hot pepper soy paste), chunjang (fermented black soybean paste), chungukjang (fast-fermented soybean paste) and mixed fermented pastes are provided in Section 5.12 of the Food Code. For each food type, ingredients, fermentative process, fermenting microbes (Bacillus sp. and Aspergillus sp.), processing, and organoleptic standards are specified. Additionally, analytical methods and tests for microbiological standards, tar colors, and total nitrogen content, among others, are described.Standards for a diverse range of FFs, including traditional Korean FFs, are controlled under the Food Sanitation Act (FSA) and covered in the Food Code (pursuant to Article 7(1) of the FSA)  Act No.. These SLactobacillus and Bifidobacterium species along with Lactococcus lactis, S. thermophilus and Enterococcus faecalis. Importantly, the only health claim approved for these probiotic functional ingredients is \u201c..may help to increase the number of beneficial bacteria and control harmful bacteria in the gut help to maintain healthy bowel function, maintain gut health\u201d (MFDS Notice 2020-63), with a recommended intake of 108-1010 CFU/g; probiotic species and amount in the food must be clearly mentioned in the label. A minimum of 108 CFU/g of live bacteria is recommended for functional foods using probiotics as functional ingredients, with manufacturing/processing specifications to be held identical to \u201cfermented milks\u201d in the Food Code.In South Korea, functional health foods are defined as \u201cfoods manufactured (including processing) with functional raw materials or ingredients beneficial to the human body\u201d in the Functional Health Foods Act (FHFA)  . The HeaL. acidophilus, Bifidobacterium and S. thermophilus, are permitted for yogurt compositions in Australia  is the overarching legislation that regulates the safety, production, transport, storage and processing of all foods, including FFs . This isustralia . No specSchizochytrium sp.) is listed as a novel food, to date, no live probiotics or FFs have been listed as novel foods in Australia-New Zealand. Similar to Europe, improved lactose digestion for live yogurt cultures in lactose intolerant individuals  is the only accepted health claim for live microbes  in Australia-New Zealand.Part 1.5 of the ANZFSC describes standards for foods that require pre-market clearance and includes novel foods (Standard 1.5.1). Novel foods are described in Standard 1.5.1 (version: F2017C00324) as non-traditional foods that require an assessment of public health and safety considerations having regard to source, patterns and levels of consumption, composition of food, preparatory process and potential for adverse effects, among others. Non-traditional foods are further defined as either (a) a food that does not have a history of human consumption in Australia or New Zealand; (b) a substance derived from a food, where that substance does not have a history of human consumption in Australia or New Zealand other than as a component of that food; or (c) any other substance, where that substance, or the source from which it is derived, does not have a history of human consumption as a food in Australia or New Zealand. Importantly, both new probiotic microorganisms and foods produced from new sources are listed as novel food categories, where non-traditional and functional fermented foods are eligible under this regulation through the latter. Currently permitted novel foods are listed in Schedule 25 (version: F2021C00564) of the ANZFSC. Although docosahexaenoic acid-rich dried marine algae  was proposed for manufacturers of kombucha . In brieMercado Comun Del Sur in Spanish, includes Argentina, Brazil, Paraguay, Uruguay and Venezuela) framework in the form of resolutions; these Standards are in turn influenced from: (i) the Codex Alimentarius, (ii) the EFSA, (iii) Council of Europe, (iv) German Federal Institute for Risk Assessment (BfR), and, (v) the US FDA , which was created as an Annex to National Law 18284/69 and put into force by Regulatory Decree 2126/71 in 1971 , regulate US FDA , 71. Thee US FDA , 71. The7 CFU/g of lactic acid bacteria in kefir, kumis, acidophilus milk, and yogurt  of the CAA . Articled yogurt   and consequently follows the Codex Alimentarius recommendations for regulation of foodstuffs. The regulatory framework for foodstuffs in Brazil is complex. Food regulations issued at the federal level are contained in various kinds of legal documents with different Government agencies and ministries sharing jurisdiction to ensure food safety, registrations and agricultural import regulation , 73. Twoartisanal in Portuguese) for cheeses, which allows the interstate transport and sale of the products without restriction, provided they have been inspected by Federal or State Agencies , which refers to the Codex Alimentarius Standards as well as Standard Methods for the Examination of Dairy Products (APHA) for recommendations on sample collection and analysis . ResolutAgencies .2 (1.1\u20133.9 atm). Labeling recommendations include clearly stating the pasteurization status of the drink, alcohol content, and prohibits use of expressions such as \u201ccraft, familiar, homemade, probiotic drink, elixir, elixir of life, premium, energizing, invigorating, live drink,\u201d among others. Overall, unauthorized attribution of superlative characteristics, i.e., functional or health claims are not allowed in labels , which is regulated by Normative Instruction (IN) n\u00b0 41 of September 17, 2019. This standard is the first Standard of Identity adopted for kombucha in the world and was developed in conjunction with the Associa\u00e7\u00e3o Brasileira de Kombucha (ABKOM); KBI was also involved . The Bran labels . AdditioNovel and functional foods regulations in Brazil have seen major developments in recent years and are relevant for functional FFs. ANVISA Resolution RDC n\u00b0 240/2018 (amends previous RDC n\u00b0 27/2010) requires that \u201cnovel foods and novel ingredients,\u201d \u201cBioactive substances and probiotic with functional claims and or health properties claims\u201d and \u201cFood with functional claims and/or health properties claims,\u201d among others, must obtain pre-market clearance . In BrazL. delbrueckii subsp. bulgaricus and S. thermophilus. The wording for the functional claim is also specified: \u201cyogurt cultures improve lactose digestion in individuals who have difficulty in digesting lactose (milk sugar)\u201d; this statement can only be appended to yogurt products when the yogurt cultures in yogurt are at > 108 CFU/g , two cultured milk products. In case of kefir, starter cultures made of bacteria such as L. kefiri, Leuconostoc sp., Lactococcus sp., and Acetobacter sp., as well as lactose fermenting and non-lactose fermenting yeasts are specified, along with a minimum of 107 CFU/g of viable lactic acid bacteria (at least 104 CFU/g of yeasts in case of kefir). R.1510 also specifies standards for various cheeses, along with packaging requirements for dairy products.In South Africa, three Government Ministries are responsible for food legislation: The Department of Agriculture, Forestry and Fisheries (DAFF), the National Department of Health and the Department of Trade and Industry. There is no single Food Law in South Africa, with various laws available for different categories of foodstuffs, viz., Agricultural Products Standards Act (Act No. 119 of 1990), Meat Safety Act (Act No. 40 of 2000), and the Liquor Products Act (Act 60 of 1989); several Acts have a plethora of overlapping legislations . Consequ08 CFU/g . The sec08 CFU/g  87). An. AnL. def yogurt . The legThe current regulatory frameworks for FFs, particularly outside fermented dairy products, are, in general, not mature enough to adequately regulate the significant diversity of FFs that are increasingly available in the market. Indeed, for several FFs, relevant regulations are simply absent. This is particularly true for artisanal FFs and functional FFs . Furthermore, the legislative efforts that have been made have been largely reactive, rather than being proactive, in nature. It is also clear that there is a lack of coherence with respect to such legislation at international, federal and even regional levels. Examples would include, as discussed above, fragmented regulations for the same fermented product at different levels of the federal structure in Australia, or overlapping legislations and numerous resolutions, as observed for Brazil and South Africa. This can, understandably, cause confusion among manufacturers and, indeed, hinder implementation of the legislation. Despite this, it is clear that consolidation of various standards and specifications into legislations and Standard Codes to a certain degree, as done recently by South Korea and India, can provide better harmonization throughout the federal governmental structure.In our opinion, each fermented product (or at least those resulting from similar fermentative processes) merit specific regulation, outlining specifications for composition, safety, communication and distribution. Some progress in this regard is visible with new legislations for non-dairy fermented products such as kombucha across various countries and the Codex Alimentarius Regional Standards for diverse FFs, as mentioned above. The latter provides a blueprint for developing harmonized regulations for various FF clusters. This is a pragmatic approach too, since most FFs involving similar fermentative procedures tend to be traditionally consumed in specific geographical regions. Furthermore, since many traditional FFs are now globally produced/exported, Codex Standards developed to this end can in turn be implemented in other countries to bring about global harmonization. Importantly, precedent for such implementation using the Codex Alimentarius Standards as guidelines already exists, particularly for fermented milk products; examples include the Argentine CAA as mentioned above, among others. Besides better harmonization of legislations, simpler procedures for approval from relevant authorities and availability of extensive guidance documents are also important instruments in attracting investment and encouraging innovation and commercialization. Other issues include a visible lack of consideration of the insights gained from the large corpus of microbiome studies on FFs and their microbial composition in corresponding global Food Standards or Codes, including the Codex Alimentarius. More must be done to ensure that knowledge gleaned from studies is incorporated into Standards, public policies and legislations. To this end, governments and organizations should consider the establishment of Expert Committees on FF microbiomes to facilitate the smooth translation of such knowledge into public policy recommendations. Finally, legislation for FFs with significant innovative potential, such as functional FFs, should not be frozen in time and must be updated regularly on the basis of robust, newer insights.In this review, we have discussed the rapidly evolving global regulatory frameworks for FFs with special emphasis on functional FFs and novel foods, along with the unique legislative bottlenecks and possible resolutions. While some progress has been made in recent years in the development of regulations for FFs, these have mostly been restricted to certain types of FFs . To preserve consumer confidence in FFs, urgent regulatory advances, including improved regulatory clarity, consistency and harmonization, need to be made to guide consumers on recommended compositions, intakes and to ensure safe production, storage, transport and distribution, among others. Over the years, a lack of understanding of the microbial and chemical composition of fermented products or the absence of appropriate methods to assess relevant safety metrics may have created impediments in the development of such legislations. With recent advances in high-throughput technologies such as genomics and metabolomics, and the resultant availability of suitable testing methods and data from an increasingly higher number of meta-analyses, we anticipate that evidence-based, targeted and harmonized legislations could be swiftly developed, at least for FFs with significant market shares. Indeed, such legislation would be particularly important for regulation of certain novel foods  and FFs with health claims, i.e., functional FFs. Importantly, care must be taken to ensure a continuous translation of available evidence to incrementally improve relevant regulations. Ultimately, addressing the challenges outlined here, would contribute to the ease of doing business, encourage consumer and investor confidence, leading to growth and innovation in this category, which in turn will catalyse overall economic progress.AM: conceptualization, methodology, validation, formal analysis, investigation, data curation, and writing\u2014original draft preparation. AM, BG, EO'C, JK, and PC: writing\u2014review and editing. PC: supervision, project administration, and funding acquisition. All authors have read and agreed to the final version of the manuscript.This work, including the article processing charges, was supported by the Institute for the Advancement of Food and Nutrition Sciences (IAFNS) through an ILSI North America Gut Microbiome Committee grant. IAFNS is a non-profit science organization that pools funding from industry and advances science through the in-kind and financial contributions from private and public sector members. IAFNS had no role in the design or presentation of the content of this paper; opinions are those of the authors.PC has received funding from Danone, PepsiCo and PrecisionBiotics Group and is sponsored by PepsiCo, H&H, National Dairy Council (USA) to contribute to conferences/meetings. He is also a co-founder and CTO of SeqBiome. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "The gastrointestinal flora consists of several microbial strains in variable combinations in both healthy and sick humans. To prevent the risk of the onset of disease and perform normal metabolic and physiological functions with improved immunity, a balance between the host and gastrointestinal flora must be maintained. Disruption of the gut microbiota triggered by various factors causes several health problems, which promote the progression of diseases. Probiotics and fermented foods act as carriers of live environmental microbes and play a vital role in maintaining good health. These foods have a positive effect on the consumer by promoting gastrointestinal flora. Recent research suggests that the intestinal microbiome is important in reducing the risk of the onset of various chronic diseases, including cardiac disease, obesity, inflammatory bowel disease, several cancers, and type 2 diabetes. The review provides an updated knowledge base about the scientific literature addressing how fermented foods influence the consumer microbiome and promote good health with prevention of non-communicable diseases. In addition, the review proves that the consumption of fermented foods affects gastrointestinal flora in the short and long term and can be considered an important part of the diet. Fermentation has long been used to preserve and enhance the shelf life, flavour, texture, and functional properties of food. Humans have been using the fermentation process for thousands of years, mostly to produce alcohol and preserve food. Fermentation is largely an anaerobic process that yields energy for the bacterium or cell while converting carbohydrates to other molecules . MicroorThe fermentation process was established long ago. The oldest winemaking techniques were used in Georgia, in the Caucasus region, around 6000 BC, and an alcoholic beverage produced from fruit, rice, and honey dates between 7000 and 6600 BC in the settlement of Jinhu . Roman cFoods that have undergone fermentation have a long history. The first time that humanity tasted fermented food may have been a simple accident. The first fermentation must have begun with the preservation of extra milk, as the next day\u2019s produce was fermented. The oldest food preservation technique, before drying, is also known as fermentation. With the advent of civilization, fermentation gained popularity since it not only preserved food but also offered it a diversity of flavours, shapes, and other sensory experiences. Fermented foods have gained popularity as people gradually became aware of their nutritional and medicinal benefits .Foods are fermented using one of two main techniques. Foods can naturally ferment, referred to as \u201cwild fermentation\u201d or \u201cspontaneous fermentation,\u201d which occurs in the presence of microorganisms present in the raw food or processing environment naturally. Examples of such foods include kimchi, sauerkraut, and fermented soy products . The addFermented foods can be classified into different categories based on (I) the presence or absence of viable microorganisms: (a) fermented foods with viable microorganisms such as non-heated fermented vegetables, kefir, most cheeses, sour cream, miso, yoghurt, tempeh, non-heated salami, natto, pepperoni and other fermented sausages, bushera, boza, and other fermented cereals; (b) fermented foods with no viable microorganisms such as heat-treated or pasteurised fermented vegetables, bread, vinegar, soy sauce, sausage, some kombuchas, distilled spirits, most beers and wine, and chocolate beans (after roasting); (II) classes: (a) cereal products, (b) dairy products, (c) fish products, (d) fruit and vegetable products, (e) legumes, (f) meat products, and (g) beverages; (III) commodity: (a) fermented cereals, (b) alcoholic beverages, (c) fermented vegetable proteins, (d) fermented animal protein and (e) fermented starchy roots; and (IV) commodity (a) cassava-based, (b) cereal, (c) legumes and (d) beverages .8\u20131012 CFU [Consumers now demand more readily available, nutritious, and safe food. Therefore, it is essential to understand the microbial diversity and nutritional components of traditional fermented foods and their health benefits. Fermented foods are prepared by the controlled and regulated growth of microbes and the enzymatic modification of food components, which serves as a center for microbial consortia . In ferm1012 CFU ,19.Fermented foods have been linked to several advantages against non-communicable diseases such as diabetes , anorexiThe formation of lactic acid, which prevents the majority of viruses from surviving due to the acidic environment present in fermented food and beverages, makes them one of the safer eating options. However, serious processing mistakes that occur in fermented food can potentially put consumer health at risk. Fermented foods may become contaminated with microorganisms that cause food poisoning or spoilage, which would undermine their safety. Additionally, harmful microbes are kept at bay when fermented foods are created using good production techniques and have the right amounts of acid, salt, and sugar. Food safety and nutrition are top priorities in the EU and around the world .Aspergillus and Penicillium mycotoxin-producing lineages from cheese, koji, and other fermented foods [Food safety for fermented foods has a long history when they combine low water activity, salt, nitrite, and other antimicrobials with considerable quantities of fermentation-produced organic acids (>100 mM). Likewise, beverages with a pH of less than 4.5 and 4% or more alcohol are regarded as microbiologically safe . By elimed foods . Guidelied foods .During the forecast period, the market for fermented foods and beverages is anticipated to rise at a CAGR of 6.35% (2022\u20132027). Due to the benefits of health supplements, the COVID-19 pandemic has had an impact on the fermented food and beverage business. However, due to the increased demand for probiotics brought on by the pandemic, fermented food and beverage items have now been given a chance. This tendency is mostly brought on by growing health consciousness and concern over preserving immunity and, by extension, health, and wellbeing.Foods and drinks that have undergone controlled microbial growth and fermentation are referred to as fermented. In the anaerobic process of fermentation, yeast and bacteria convert food components, such as carbohydrates including glucose, into other compounds . Various probiotic foods, probiotic beverages, alcoholic beverages, and additional categories of fermented food and drink are available. The supermarket/hypermarket, specialty retail store, convenience store, internet channel, and others are the market segments according to distribution channel. The market is divided into five geographic regions: North America, Europe, South America, Asia-Pacific, and the Middle East and Africa. The market size and predictions for each segment have been presented based on the value in USD million .Humans have utilised the fermentation of food from normally perishable raw materials since the Neolithic era  . Now fasDespite being one of the oldest categories of food ingredients in the world, FC is not defined in EU law, and most other countries\u2019 food laws also lack a definition of the term. From 1973 to 2010, Denmark\u2019s national rules inside the EU mandated FC approval. It is still feasible to voluntarily notify and be listed. The European Commission views probiotics as a health claim because no specific strains\u2014aside from the yoghurt microorganisms\u2014have been given authorization for such claims ,44.The USA lacks a dedicated FC regulation, much like the EU. For human consumption, some species are deemed \u201csafe and acceptable,\u201d while others are classified as \u201cgenerally recognised as safe\u201d (GRAS), which is reported to the FDA and published . The legThe Technical Rule \u201cOn Safety of Milk and Dairy Products\u201d (TR TS 033/2013) is the main regulation regulating the standards and requirements for milk and dairy products including the usage of FC . Dairy pData were retrieved from PubMed/Medline, Scopus, and Google Scholar search engines from October to November 2022, using keywords term such as \u201cfermented foods\u201d, \u201cprobiotic\u201d, \u201cgut microbiota\u201d, \u201chealth benefits\u201d, \u201ceubiosis\u201d and \u201cfermentation\u201d. The search resulted in several articles, including research papers, reviews, books, patents, and other freely available online sources. Inclusion and exclusion criteria were selected and used to determine recently published articles of importance to produce this document. The publications selected for this study were published on fermented foods and included clinical investigations, review articles, and case reports, all in the English language.Bacteroides, indicating that this genus is particularly crucial to the host\u2019s health [The greatest microbial community in the human body is found in the gastrointestinal tract. This community, which lives in the small and large intestines, is thought to have more than 100 trillion microbial cells, which is similar to the number of cells in the human body . Previous health . Similars health . The mics health .Streptococci and Escherichia coli, colonize humans when they are born. During the weaning stage, the gut flora changes dramatically, and obligate anaerobes become dominant  [Bacteroides that comprise around 30% of the total intestinal flora include at least four major species: B. thetaiotaomicron, B. vulgatus, B. distasonis, and B. fragilis, are most likely the main anaerobes in both health and sickness [Candida, Saccharomyces, Aspergillus, Penicillium, Rhodotorula, Trametes, Pleospora, Sclerotinia, Bullera, and other fungal taxa have all been found in the gut. Candida is more commonly discovered in people with chronic hepatitis B and cirrhosis of the liver than it is in those with inflammatory bowel disease [No one undervalues the significance of these enigmatic bacteria, even though at least half of these creatures cannot be grown. In this large population of intestinal flora, anaerobes exceed aerobes by a ratio of 100\u20131000 anaerobes to one aerobe, according to estimations. However, it is evident that facultative aerobes, such as species) . Intestisickness . Candida disease .In the intestinal tract, the gut microbiota coexists with its hosts in a mutually beneficial way, assisting the host in carrying out a range of biochemical and physiological functions by taking part in various complex metabolic processes as well as the growth and regulation of the immune system. The composition and function of the gut microflora are significantly influenced by nutrition, among other potential factors . The hosThe acidity, flavour, and texture of fermented foods, as well as the health advantages that go beyond basic nutrition, all depend on gut microorganisms . MicrobeBacillus fermentation in West Africa, filamentous moulds and bacilli are uncommon in fermented foods and beverages in America, Australia, Europe, and Africa [During fermentation, bacteria alter the chemical components of raw materials from plant and animal sources, boosting the nutritional content of the goods, enhancing their flavour and texture, extending their shelf life, and bolstering them with bioactive substances that promote health . Asia\u2019s d Africa .The global supply of food for humans is unavoidably impacted by fermentation, a natural process. Wild fermentation bacteria and yeast are natural resources that are accessible to people all over the world. They are found all over the world in the air, soil, water, and animal guts. They also blanket the continents and penetrate ecosystems . FermentPropionibacterium, Bifidobacterium, Brevibacterium, Brachybacterium, Micrococcaceae, Bacillus, etc., are also involved in the fermentation of food, mostly as a secondary group of microorganisms employed to facilitate the efficient progression of the fermentation process [E.coli, a Gram-negative, rod-shaped, coliform, facultative anaerobe, that leads to health problems in humans. The bacteria isolated from probiotics showed significant production of antimicrobial substances that can inhibit the growth of food-spoilage bacteria [Bacteria: Foods that have undergone spontaneous fermentation as well as those that have been fermented using starter cultures both have bacteria as the predominant microorganism. Lactic acid bacteria (LAB) are more commonly used in the manufacturing of acidic fermented goods than other types of bacteria. Non-LAB bacteria, such as  process . LAB are process . Certain process ,77. Bact process . Bacteri process . LAB cre process . Numerou process . This rebacteria . The terbacteria .Actinomucor, Amylomyces, Aspergillus, Candida, Cladosporium, Penicillium, Pichia, Rhodotorula, Rhodosporidium, Saccharomyces, and others are examples of different fungal genera. Particularly, filamentous fungi are found in traditional Asian starters with a variety of functions, including liquefaction, saccharification, and ethanol synthesis to create a variety of low- and high-alcohol distilled spirits. They are employed in Europe for the synthesis of enzymes as well as the development of various dairy products and cheese ripening [Aspergillus species from waste materials such as apple pomace. Aspergillus species frequently cause food deterioration by inducing unfavorable alterations. On the other hand, cheese ripening and flavour development are related to Penicillum species. While Ceratocystis species contribute to the creation of fruit flavours, Penicillium is the cause of the synthesis of toxins such as patulin [Non-Yeast Fungi: ripening . Citric  patulin .Candida, are used to produce single-cell proteins, others, such as Pichia, are thought to cause food goods to decay. The Saccharomyces genus of yeasts, particularly S. cerevisiae, which is used in the fermentation of bread and wine to produce alcohol, is best for producing acceptable food fermentation. In the process of creating wine, Saccharomyces cerevisiae var. ellipsoideus is frequently used [Rhodotorula and Cryptococcus, are capable of producing pigment for use as color [Yeast: In food fermentation, yeasts are advantageous with unfavorable impacts, just like bacteria and other fungi. While some yeasts, such as tly used . Severalas color .Bifidobacteria and Lactobacilli [The human gut flora has drawn much interest in recent years due to various research findings that it affects both mental and physical health ,87 and tobacilli ,94. Numeobacilli .6 microbial cells per gram, while quantities can vary based on the region, age, and time of analysis or consumption of the product [Fermented foods may have positive impacts on health and disease via several processes that contain probiotic microorganisms such as lactic acid bacteria . Most fe product . By buff product .The modes of action for beneficial fermented food effects include altering the host immunological response, which strengthens resistance to pathogenic challenge, and host microflora at the specific region, including changes in composition and metabolic activity . The gutToxins and anti-nutrients can be reduced through fermentation; for instance, soybeans may have lower quantities of phytic acid . AdditioLactobacilli [Bifidobacterium and Lactobacilli [Humans have eaten fermented foods from the dawn of time and utilised them in various forms throughout the world. Fermented milk is the most typical traditional source of obacilli . Prebiotobacilli ,102. HumConsuming traditionally fermented meals prepared from a range of raw materials, microbes, and production methods has gained popularity recently all around the world. Global production of fermented foods and beverages made from milk, vegetables, or fruits is thought to number over 3500 different varieties. Soybean- and cabbage-based fermented foods are a good source of protein, soluble fibre, linolenic and linoleic acid, iron, zinc, vitamin K, vitamin B9, vitamin B1, and vitamin B6. Similar to yoghurt, kefir, and dahi, some fermented milk products also contain calcium, high-biological value (BV) proteins, and vitamins B2, B9, and B12 . NumerouLaminaria japonica have been investigated. The quantity of sugar, alcohol, and microorganisms has not been considerably impacted by the varied L. japonica concentrations. Human volunteers accepted the presence of L. japonica in Makgeolli at a range of 5\u20137.5%. The Makgeolli made with 5\u20137.5% L. japonica shown a high degree of protein tyrosine phosphatase 1B inhibitory action and was generally regarded as acceptable [Momordica charantia) when fermented with Lactiplanti bacillus plantarum subsp. plantarum, demonstrated anti-diabetic potential in a type 2 diabetic rat model fed a high-fat diet with modest doses of streptozocin. In addition to increasing the concentration of SCFA in the rat model, fermented bitter melon juice was effective in treating hyperinsulinaemia, hyperglycemia, hyperlipidaemia, and oxidative stress [Monascus purpureus Went (Monascaceae) NTU 568, were used to ferment dioscorea roots, long-grain rice, and adlay. The fermented products were fed to diabetes-induced Wistar rats for eight weeks. Rats were evaluated to see if their discomfort from diabetes had improved following the intervention period. The findings demonstrated that the addition of red-mould-fermented products substantially decreased the plasma glucose, triglyceride, amylase, and cholesterol levels, as well as ROS production. The glutathione reductase, glutathione disulfide reductase, and catalase activities all significantly increased in diabetic rats fed red-mould-fermented products [The body experiences persistently elevated blood sugar levels as a result of diabetes or diabetes mellitus. Recently, the potential anti-diabetic properties of a number of fermented dietary components have been investigated . The alcceptable . Newly de stress . The rele stress . Additioe stress . In anotproducts ,112.Lactobacillus delbrueckii subsp. Lactis, fermented milk has been shown to have anti-hypertensive benefits by lowering elevated systolic and diastolic blood pressure caused by hypertension [Worldwide, cardiovascular disease (CVD) is a leading cause of death. Low-density lipoprotein (LDL) cholesterol, a rise in triglyceride-rich lipoproteins, and low levels of high-density lipoprotein (HDL) cholesterol are a few instances of disease-associated hazards that might be either modifiable or unmodifiable factors . Diets irtension . Moreovertension .C. tricuspidata modulated Desulfovibrio, Adlercreutzia, Allobaculum, Coprococcus, Helicobacter, Flexispira, and Odoribacter decreased the levels of alanine aminotransferase, serum triglycerides, and fat mass [Obesity is a condition that is classified as a disease and is characterised by an abnormal or excessive build-up of body fat. Since 1980, the prevalence of obesity and overweight has doubled worldwide, posing a serious threat to public health and placing a heavy burden on individuals and communities. Obesity is the main cause of morbidity and mortality worldwide and a key risk factor for several non-communicable diseases . Obesityfat mass .Aspergillus oryzae-mediated fermented brown rice (FBRE) extract (Jurkat cells). Human acute lymphoblastic leukaemia cells\u2019 viability was decreased by the aqueous extract of FBRE in a concentration- and time-dependent manner. In human acute lymphoblastic leukaemia cells, FBRE increased the expression of death-receptor-related proteins such as membrane-targeted death ligand , death receptor-5 (DR5), and apoptosis antigen , while inhibiting the expression of an apoptosis inhibitor . Trials with inhibitors demonstrated that the caspase-8 inhibitor can reduce cellular toxicity. Collectively, the findings demonstrated that FBRE might cause death-receptor-mediated lymphoblastic leukaemia cell death [Asian nations account for about half of the world\u2019s cancer cases. According to estimates, 10.6 million more instances of cancer could be diagnosed in 2030 . Urbanizll death .The antioxidant content and anticancer properties of naturally fermented beetroot juices derived from beetroots cultivated both organically and conventionally were studied by Kazimierczak et al. (2014). In AGS cells, naturally fermented beetroot juice triggered late apoptosis and necrosis (gastric adenocarcinoma cells). In organically grown beetroot as opposed to conventionally grown beetroot, the bioactivity\u2019s effectiveness was higher. The chemical composition of organic and conventional beetroots may differ, according to metabolomic analysis using ultra-performance liquid chromatography-quadrupole time-of-flight-liquid chromatography-mass spectrometry, and fermented beetroot extracts  demonstrated a distinguishable chemical property. According to the findings, fermentation of beetroots has a significant impact on the chemical composition and bioactivity, particularly the anti-cancer activity .L. bulgaricus, S. thermophilus, L. plantarum, and Limosilactobacillus fermentum) and a prebiotic (xylooligosaccharides) had significantly less abdominal distention and improved quality of life than the control group [In industrialised Asian and Western nations, the incidence and prevalence of inflammatory bowel diseases (IBDs), such as ulcerative colitis and Crohn\u2019s disease, are rising quickly. The majority of patients who stop receiving treatment have a relapse even though biologic medicines that target the immune system have been successful in treating IBD patients, indicating that intrinsic immune dysregulation is an outcome of IBD rather than its primary cause . Accordiol group .Arbutus unedo L. [For lipid-related illnesses including atherosclerosis and coronary heart disease, hyperlipidemia is a frequent risk factor. Genetics and lifestyle are two common reasons for hyperlipidemia. According to research, hyperlipidemia  affected 39.6% of the 19,513 female participants with coronary heart disease . Modulatunedo L. , lowerinunedo L. ,142. Thrunedo L. . Accordiunedo L. .L. casei strain Shirota was investigated for its ability to inhibit the growth of E. coli. After the challenge, 106 CFU pathogens remained as a chronic infection in the urinary system (bladder and kidneys) for more than 3 weeks. During the period of infection, there was a considerable increase in the number of polymorphonuclear leukocytes and the myeloperoxidase activity in the urine. One dosage of L. casei Shirota (108 CFU) given 24 h before to the trial infection effectively suppressed the growth of E. coli and inflammatory reactions in the urinary tract [Genitourinary tract infections are a prevalent condition in the immunocompromised host, just like they are in the general population. They can also be separated into genital tract infections and infections of the urinary tract. Genitourinary tract infections are a frequent source of morbidity in both healthy people and people with weakened immune systems. Urinary tract infections (UTIs), which include cystitis, pyelonephritis, and prostatitis, can be broadly divided into two categories: a) UTIs; and b) genital tract infections, which include urethritis, cervicitis, epididymitis, genital ulcerative diseases, endometritis, and pelvic inflammatory disease . In a mory tract .According to the current state of affairs, the post-genomic era of microbiology is now here, and many microbes that are employed in food fermentation or microorganisms that are isolated from food fermentations have already been sequenced. This provides a novel knowledge-based strategy for using microbes for food fermentation, ranging from metabolic engineering of bacteria to create antimicrobials or nutrients to molecular mining of yet-unknown but potentially beneficial actions. A brand-new variety of LAB called fructophilic lactic acid bacteria (FLAB) has been discovered through a recent study; these bacteria prefer fructose to glucose as a growth substrate. In fructose-rich niches, which are the environmental and biological conditions necessary for a species to survive, develop, and reproduce, FLAB are present. P-coumaric acid can be transformed by FLAB enzymes into 4-vinylphenol in the first step and 4-ethylphenol in the second. These secondary metabolites have strong antioxidant properties and are biologically active; they may also improve the flavour of fermented foods . DifferePrecision and biomass fermentation to create specific chemicals for the food and chemical sector or medical purposes are recent developments based on genomics and synthetic biology. Biomass fermentation, which relies on microorganisms\u2019 capacity to grow quickly under ideal conditions and create a very high protein content of more than 50% dry weight, is an even more environmentally friendly method of producing protein. Whole-cell biomass produced in this manner can be consumed alone or combined with other dietary components. Marmite manufactured from yeast extract, fermented bean paste, and, more recently, the mycoprotein from a filamentous fungus called Fusarium venenatum, which is utilised as the foundation for meat analogues, are examples of such goods. In order to augment or replace our reliance on animal proteins while both reducing the carbon footprint and boosting nutritional value, biomass fermentation is an appealing alternative .After cereals and grain legumes, tropical root and tuber crops such asyams, colocasia, sweet potatoes, etc. are the third-most significant food crops for humans. They provide either staple or supplementary food for nearly a fifth of the world\u2019s population . These cFermented foods have gained popularity recently, largely as a result of their claimed health advantages. Fermented foods became an important part of the diet in many cultures, and over time fermentation has been associated with many health benefits. While fermented foods manufactured in Asia and Africa frequently rely on spontaneous fermentation, those made in Europe, North America, Australia, and New Zealand typically depend on specific starter cultures. Given all these considerations, commercial probiotics must be found to be safe for the general public before being marketed as foods or dietary supplements.As fermentation can create numerous food types that we generally acquire through a farming-based system, but in a much more sustainable way, it can have a huge impact on the future of our food. Nevertheless, scaling up the production of alternative proteins through fermentation confronts difficulties despite the many advantages. These include production costs, consumer acceptance, and regulatory approval. Additionally, the availability of the genomes of numerous food pathogenic and spoilage bacteria may create new opportunities for the development of novel antibiotics that specifically target these troublesome bacteria\u2019s vital functions. Utilizing this plethora of data for improved cultural performance and activities is the fundamental issue of the genomics and proteomics era as it relates to food systems, enhancing the safety, quality, and composition of our food supply. Although fermentation is one of the oldest human-made technologies, there is still plenty of room for advancement."}
+{"text": "PcLec-EPS and PcLec-QPS, respectively) were identified from Procambarus clarkii. PcLec-EPS and PcLec-QPS originate from GD and the main difference between them is exon 3. PcLec-EPS and PcLec-QPS respectively contains EPS and QPS motif in their carbohydrate recognition domain. The mRNA levels of PcLec-EPS and PcLec-QPS in hemocytes, gills, intestine and lymph underwent time-dependent enhancement after D-Mannose and D-Galactose challenge. Recombinant PcLec-EPS and PcLec-QPS could bind to carbohydrates and microbes, and agglutinate bacteria. The results of experiments on recombinant protein injection and RNA interference indicate that PcLec-EPS and PcLec-QPS can respectively strong recognize and bind D-Mannose and D-Galactose, activate the Relish transcriptional factor, and further upregulate the expression of different antimicrobial peptides (AMPs). In addition, these two CTLs and Relish could positively regulate the expression of each other, suggesting that there is a positive feedback loop between two CTLs and Relish that regulates the expression of AMPs. It may contribute to the expansion of the immune response for host quickly and efficiently eliminating pathogenic microorganisms. This study provides new knowledge for clear understanding the significance and function of different CTL generated by GD in immune defenses in crustacean.Gene duplication (GD) leads to the expansion of gene families that contributes organisms adapting to stress or environment and dealing with the infection of various pathogens. C-type lectins (CTLs) in crustaceans undergo gene expansion and participate in various immune responses. However, the functions of different CTL produced by GD are not fully characterized. In the present study, two CTL genes (designated as  Gene duplication (GD) is a major source of genetic innovation. In eukaryotic organisms, the vast number of genes is in large part due to GD. In a GD event, one gene gives rise to two genes by unequal crossing over, retrotransposition, or chromosomal (or genome) duplication . The dupInvertebrates lack the typical adaptive immunity of vertebrates and mostly rely on the robust innate immunity to defense against infection by invading pathogens. The first step of innate immune responses is the recognition of pathogens by host pattern recognition receptors (PRRs) . PRRs caAs an example of gene expansion, CTLs are the largest and most diverse of the lectin families in animal with one or more characteristic carbohydrate recognition domain (CRD) that mediates ligand binding. The CRD forms a double-loop structure and the inner/long loop region participates in the calcium-mediated carbohydrate interaction . MoreoveCompare with the roles of CTLs in the cellular immunity in insects and crustacean, the functions of CTLs in the humoral immunity are not well explained. Although a few studies have shown that CTLs in shrimp and crab could regulate the expression of AMPs by JNK or JAK/STAT signaling pathways \u201321, the PcLec-EPS and PcLec-QPS) from Procambarus clarkii. In detail, rapid-amplification of cDNA ends (RACE) and genome amplification were conducted to acquire full-length cDNAs and genome structures of PcLec-EPS and PcLec-QPS. The protein domain, evolution, and differences in amino acid sequence of PcLec-EPS and PcLec-QPS were analyzed. Their tissue distributions and temporal response to D-Mannose and D-Galactose challenges were examined by quantitative Real-Time PCR (RT-qPCR). Recombinant CTL proteins (rPcLec-EPS and rPcLec-QPS) were obtained to analyze their activities of sugar binding, bacterial binding, and bacterial agglutination in vitro. AMPs expressions regulation by mixture of recombinant CTL (rPcLec-EPS or rPcLec-QPS) and carbohydrates  was analyzed. RNA interference (RNAi) was used to explore the effects of PcLec-EPS and PcLec-QPS knockdown on the expressions of AMPs under normal or carbohydrate  challenge. RNAi was used to study the effects of Relish transcriptional factor knockdown on the expressions of AMPs that induced by rPcLec-EPS or rPcLec-QPS. Furthermore, the regulatory relationship of two CTLs, Relish, and AMPs in normal crayfishes was explored by RNAi.To clarify the significance and function of different CTL generated by GD in the innate immunity, we systematically explored the producing way, pattern recognition, immune responses, and expression regulation of two CTLs with EPS and QPS motif respectively (named P. clarkii (approximately weight 10 g each) were purchased from an aquatic product market in Huaian, Jiangsu, China and kept in an aerated water tank filled with freshwater for 7 days before processing. Hemocytes, heart, hepatopancreas, gills, stomach, intestine, and lymph were collected from five crayfishes and quickly stored at \u201380\u00b0C for further RNA extraction. For hemocytes collection, the hemolymph was extracted from five crayfishes and placed in an equal volume of precooled anticoagulant solution . The mixture was centrifuged at 4\u00b0C, 2000 rpm for 10 min to isolate hemocytes. For carbohydrate challenge, each crayfish was injected with 100 \u03bcL of D-Mannose (100 \u03bcg/mL) and D-Galactose (100 \u03bcg/mL) dissolved in ddH2O. At 0, 2, 6,12, and 24 h after carbohydrate injection, the hemocytes, gills, intestine, and lymph were selected from five random crayfishes for total RNA extraction.Healthy Total RNA was extracted from the collected samples using an RNApure high-purity total RNA rapid extraction kit  in accordance with the manufacturer\u2019s protocols. The quality of RNA was evaluated by 1% agarose gel electrophoresis. RNA concentration was measured by measuring the absorbance at a wavelength of 260:280 nm (OD260/OD280 = 1.8\u20132.0) by using Nanodrop 2000 . RNA (1 \u03bcg) was used to synthesize the first-strand cDNA using the TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR . The obtained cDNA was kept at \u201320\u00b0C.\u00ae RACE 5\u2032/3\u2032 Kit . Based on the partial CTL sequence acquired by transcriptome sequencing, specific forward  under the following conditions: five cycles at 94\u00b0C for 30 s and 72\u00b0C for 3 min; five cycles at 94\u00b0C for 30 s, 70 \u00b0C for 30 s, and 72\u00b0C for 3 min; and 25 cycles at 94\u00b0C for 30 s, 68\u00b0C for 30 s, and 72\u00b0C for 3 min. The RACE products were characterized via cloning and sequencing by a commercial company . The full-length cDNA sequences of PcLec-EPS and PcLec-QPS were obtained by overlapping EST sequences and 5\u2032 and 3\u2032 fragments. The genomic DNA sequences of PcLec-EPS and PcLec-QPS were acquired by PCR amplification, screening positive clones, and sequencing. Primers  used for genome amplification were listed in The 3\u2032 - and 5\u2032 -RACE-Ready cDNA samples used for RACE were obtain using SMARTerhttp://www.ncbi.nlm.nih.gov/BLAST/). The deduced amino acid sequences were obtained using the Expert Protein Analysis System (ExPASy) (https://web.expasy.org/translate/). Putative domains and motifs were predicted by the Simple Modular Architecture Research Tool (SMART) program (http://smart.embl-heidelberg.de/). The theoretical isoelectric point (pI) and molecular weight (Mw) were determined using ExPASy (http://web.expasy.org/compute_pi/). Multiple sequence alignment was carried out with DNAMAN software. An evolutionary tree was constructed using the neighbor-joining (NJ) algorithm in MEGA 7.0 software  at NCBI website . The 10 \u03bcL of reaction system contains 5 \u03bcL of 2 \u00d7 TransStart Top Green qPCR SuperMix, 0.4 \u03bcL (10 mM) each of the qF and qR primers, 1 \u03bcL of cDNA template, and 3.2 \u03bcL of PCR-Grade Water. Amplification was conducted at 94\u00b0C for 30 s, followed by 40 cycles of 94\u00b0C for 5 s, and 60\u00b0C for 30 s. Melting curve analysis was performed from 60\u00b0C to 95\u00b0C. 18S rRNA from P. clarkii was used as internal reference and was amplified from all samples with 18S rRNA-qF and 18S rRNA-qR primers (\u2212\u0394\u0394CT threshold cycle (CT) method  method . StatistPcLec-EPS  using the HiScribe\u2122 T7 Quick High Yield RNA synthesis kit  in vitro. The crayfishes were initially injected with 20 \u03bcg of PcLec-EPS-dsRNA, PcLec-QPS-dsRNA, or GFP-dsRNA (as control). After 24 h, 20 \u03bcg of PcLec-EPS-dsRNA, PcLec-QPS-dsRNA, or GFP-dsRNA was injected into the same prawn. At 24 h after the second dsRNA injection, the gills from five crayfishes were collected for RNA extraction and cDNA synthesis. The RNAi efficiency of PcLec-EPS and PcLec-QPS were checked using RT-qPCR. Expression levels of multiple AMPs [including crustin (Crus) and anti-lipopolysaccharide factor (ALF) ] in the gills of PcLec-EPS RNAi and PcLec-QPS RNAi crayfishes were detected by RT-qPCR using primers  that was digested by restriction enzymes EcoR I and Xho I . Recombinant plasmid was transformed into Escherichia coli BL21 (DE3) cells  for the expression of recombinant protein. rPcLec-EPS and rPcLec-QPS proteins with GST tag were purified using glutathione Sepharose 4B chromatography  in accordance with the manufacturers\u2019 protocols. Purified protein was separated using 12.5% SDS polyacrylamide gel electrophoresis (SDS-PAGE) and visualized using Coomassie brilliant blue R250. The concentration of recombinant protein was determined using Bradford protein assay kit .Two pair of primers . Three biological repeats were used for each group. Data are presented as mean \u00b1 SD.Enzyme-linked immunosorbent assay (ELISA) was performed to analyze the ability of rPcLec-EPS and rPcLec-QPS to bind directly to D-Mannose and D-Galactose. D-Mannose or D-Galactose  was added to a 96-well microtiter plate, incubated overnight at 37\u00b0C, and heated at 60\u00b0C for 30 min. To prevent non-specific adsorption, each well was blocked with 200 \u00b5L of 1 mg/mL bovine serum albumin (BSA) in Tris-buffered saline  at 37\u00b0C for 2 h. After washed with TBS (200 \u00b5L/each well) four times, purified rPcLec-EPS or rPcLec-QPS with different concentrations in BSA\u2013TBS (0.1 mg/mL) were added to the wells and incubated at room temperature for 3 h. The same concentration of GST protein was used as control. Each well was washed with 200 \u00b5L TBS for four times. Each well was incubated with 100 \u00b5L of mouse monoclonal anti-GST antibody (1: 2000 dilution in 0.1 mg/mL BSA\u2013TBS) at 37\u00b0C for 2 h. The plate was washed as above and then incubated with peroxidase-conjugated goat anti-mouse IgG (1: 5000 dilution in 0.1 mg/mL BSA\u2013TBS) at 37\u00b0C for 1 h. The plate was washed as above and then added 100 \u00b5L/well of 0.01% 3,3\u2032,5,5\u2032-tetramethylbenzidine (Sigma) to develop color. 2 M HStaphylococcus aureus, Bacillus megaterium, and Bacillus subtilis) and three species of Gram-negative  bacteria were used for microbial binding assay. In brief, 10 \u00b5g of purified rPcLec-EPS or rPcLec-QPS was incubated with microbes (approximately 2 \u00d7 108 cells each) in midlogarithmic phase by gentle rotation for 1 h at 37 \u00b0C. After centrifugation at 6000 rpm for 5 min, the cells were collected, washed four times with TBS, and eluted with 5% SDS. The binding between microbes and recombinant protein was analyzed through 12.5% SDS\u2013PAGE and detected by Western blot using mouse monoclonal anti-GST antibody . The bacterial cells used as controls were incubated with the GST protein and subjected to the same treatments. The experiment was repeated three times.Three species of Gram-positive (S. aureus) and Gram-negative (V. parahaemolyticus) were used for bacterial agglutination assay. Bacteria were cultured overnight, harvested, washed twice with TBS, and suspended at 2 \u00d7 108 cells/mL. In the presence or absence of 10 mM CaCl2, a microorganism-TBS solution (25 \u03bcL) was incubated with 25 \u03bcL recombinant protein-TBS suspension  or BSA-TBS suspension  at room temperature for 1 h. Agglutination was observed with microscopy.Gram-positive bacteria  injected crayfishes were detected by RT-qPCR. The transcriptional levels of Crus2, ALF3, ALF5, ALF8, and ALF11 in the gills of mixture  injected crayfishes were measured by RT-qPCR. Three independent experiments were performed in triplicate. The normalized data were subjected to statistical analysis followed by Student\u2019s t-test. Significant difference was accepted at p < 0.05Purified rPcLec-EPS or rPcLec-QPS (4 \u00b5g) was mixed with D-Mannose or D-Galactose (10 \u00b5g) and then injected into crayfishes. At 24 h after mixture injection, the gills from five crayfishes were collected for RNA extraction and cDNA synthesis. Samples from untreated crayfishes  were collected as control. Expression levels of Lec-EPS-dsRNA, Lec-QPS-dsRNA, and GFP-dsRNA were synthesized as described above. Total 40 \u00b5g of each dsRNA was injected into crayfish. At 48 h after dsRNA injection, 100 \u00b5L of D-Mannose or D-Galactose (100 \u00b5g/mL) was injected into the same crayfish. At 24 h after carbohydrate injection, the gills were collected from five individuals. The expression level of PcLec-EPS in the gills at 24 h after D-Mannose challenge in PcLec-EPS RNAi crayfishes was detected by RT-qPCR. Samples from D-Mannose only and GFP-dsRNA plus D-Mannose groups were used as controls. RT-qPCR was also used to analyze the transcription level of PcLec-QPS in the gills at 24 h after D-Galactose challenge in PcLec-QPS RNAi crayfishes. D-Galactose only and GFP-dsRNA plus D-Galactose were used as controls. In addition, the mRNA expressions of Crus2, Crus3, Crus5, ALF3, and ALF6 in the gills at 24 h after D-Mannose challenge in PcLec-EPS RNAi crayfishes were detected. The transcriptional levels of Crus2, ALF3, ALF5, ALF8, and ALF11 in the gills at 24 h after D-Galactose challenge in PcLec-QPS RNAi crayfishes were measured. 18S rRNA was used as an internal reference gene for internal normalization, and samples were performed in triplicate. Student\u2019s t-test was conducted for statistical analysis, and the significance was accepted when p < 0.05.PcRelish-iF and PcRelish-iR, PcRelish. The obtained DNA fragment was used to synthesize the PcRelish-dsRNA following the method described earlier. Approximately 40 \u03bcg of PcRelish-dsRNA or GFP-dsRNA (as control) was injected into each crayfish. The gills from five crayfishes were collected at 48 h after dsRNA injection. To detect the efficiency of RNAi, the transcriptional level of PcRelish in the gills of dsRNA (PcRelish-dsRNA and GFP-dsRNA)-injected crayfishes were analyzed by RT-qPCR using primers PcRelish-qF and PcRelish-qR  was injected into each crayfish. At 24 h after recombinant protein injection, the gills from five crayfishes were collected for RNA extraction, cDNA synthesis, and RT-qPCR analysis. The mRNA expressions of Crus2, Crus3, Crus5, ALF3, and ALF6 in the gills at 24 h after rPcLec-EPS injection in Relish RNAi crayfishes were detected by RT-qPCR. Samples from rPcLec-EPS only and GFP-dsRNA plus rPcLec-EPS groups were collected as controls. The transcriptional levels of Crus2, ALF3, ALF5, ALF8, and ALF11 in the gills at 24 h after rPcLec-QPS injection in Relish RNAi crayfishes were analyzed by RT-qPCR. Samples from rPcLec-QPS only and GFP-dsRNA plus rPcLec-QPS groups were collected as controls. Student\u2019s t-test was conducted for statistical analysis, and significant difference was accepted when p < 0.05.A pair of specific primers  in the gills at 48 h after Relish-dsRNA injection were detected by RT-qPCR. Group of GFP-dsRNA injection was set as control. Three independent experiments were performed in triplicate. Student\u2019s t-test was conducted for statistical analysis, and p < 0.05 was considered statistically significant.RNAi of P. clarkii were obtained by RACE. The open reading frame (ORF) of PcLec-EPS , a low complexity region (amino acids 30\u201344 and 31\u201344), and a CLECT/CRD domain (amino acids 67\u2013194 and 67\u2013190) , whereas Lec-QPS-dsRNA injection made no change in the expression of PcLec-EPS. The mRNA expression of PcLec-QPS in the gills of Lec-QPS-dsRNA-injected crayfishes was greatly decreased, whereas Lec-EPS-dsRNA injection made no change in the expression of PcLec-QPS . As a negative control, the rGST protein had no binding activity to D-Mannose or D-Galactose  and Gram-negative bacteria , whereas rGST can\u2019t bind to these bacteria (S. aureus and V. parahaemolyticus in the presence of Ca2+ (Recombinant CTLs protein were obtained by prokaryotic expression system. PcLec-EPS and PcLec-QPS proteins were respectively estimated to have an MW of 22.4 and 21.6 kDa. The apparent molecular mass of the purified rPcLec-EPS and rPcLec-QPS were approximately 48 kDa with a GST-tag (about 26 kDa)  plus carbohydrate  can promote the expression of different AMPs. Moreover, combinations  were stronger to induce the expression of different AMPs.The rPcLec-EPS and rPcLec-QPS incubated with D-Mannose or D-Galactose were injected into crayfishes to study the effects of rPcLec-EPS and rPcLec-QPS on the regulation of AMPs expression. The expression levels of PcLec-EPS and PcLec-QPS knockdown on the expression levels of different AMPs during D-Mannose or D-Galactose challenge. The expression level of PcLec-EPS in the gills of D-Mannose challenged Lec-EPS-dsRNA silenced crayfishes was remarkably decreased compared with that in control groups (D-Mannose only and GFP-dsRNA plus D-Mannose)   , Relish, and AMPs in crayfishes was explored by RNAi. As shown in Relish remarkably downregulated the expression levels of PcLec-EPS and PcLec-QPS, suggesting that PcRelish play a positive role in regulating the expressions of PcLec-EPS and PcLec-QPS. Moreover, knockdown of PcLec-EPS and PcLec-QPS could decrease the transcription of PcRelish in P. clarkii   RNAi and carbohydrates  challenge further confirmed the above conclusion. Crustin and anti-lipopolysaccharide factor are two kinds of important AMPs with multiple groups in crustacean that have strong antimicrobial effects  pathways, which further to regulate the expression of different sets of AMPs , 39. RelPcLec-EPS and PcLec-QPS, we also explored the regulation of expressions of these two CTLs. RNAi analysis showed that knockdown of Relish significantly decreased the expression levels of PcLec-EPS and PcLec-QPS in P. clarkii, indicating that Relish plays a positive regulatory role in the expressions of PcLec-EPS and PcLec-QPS. As NF-\u03baB transcription factor, study has shown that Dorsal in Litopenaeus vannamei can activate the promoter of LvCTL3  and ALF . These findings reveal that there is a positive feedback loop between CTLs (Lec-EPS and Lec-QPS) and Relish that regulates the expression of AMPs.In addition to study the humoral immune responses mediated by f LvCTL3 . And, thf LvCTL3 . FurtherPcLec-EPS and PcLec-QPS) were identified from P. clarkii. PcLec-EPS and PcLec-QPS were produced by GD. Carbohydrates  challenge activated the expressions of PcLec-EPS and PcLec-QPS. Studies in vitro showed that recombinant PcLec-EPS and PcLec-QPS protein can bind to carbohydrates and microbes, and agglutinate bacteria. Moreover, rPcLec-EPS and rPcLec-QPS showed a stronger binding activity to D-Mannose and D-Galactose, respectively. Studies in vivo showed that the strong recognition and binding of PcLec-EPS and PcLec-QPS to D-Mannose and D-Galactose leads to the activation of Relish transcriptional factor, and upregulation of different AMP expression. In addition, two CTLs and Relish could positively regulate the expression of each other. Therefore, there is a positive feedback loop between CTLs (PcLec-EPS and PcLec-QPS) and Relish that regulates the expression of AMPs, which may contribute to the expansion of the immune response for host quickly and efficiently eliminating pathogenic microorganisms.In conclusion, two CTLs with EPS and QPS motif respectively : OP450964.Publicly available datasets were analyzed in this study. This data can be found on Genbank: Procambarus clarkii), which does not require ethical certification.Ethical review and approval were not required for the animal study because the research species of this manuscript is a lower invertebrate \u2013 crayfish , the Natural Science Foundation of Jiangsu Province (BK20190698), the \u201cJBGS\u201d Project of Seed Industry Revitalization in Jiangsu Province (No. JBGS\u30142021\u3015031), the National Key R&D Program of China (2018YFD0901303), the Agricultural Project from Jiangsu Province Science and Technology Agency (no. BE2020348), the Jiangsu Agricultural Industry Technology System (no. JATS [2022] 344 and no. JAST [2022] 412), and the Postgraduate Research & Practice Innovation Program of Jiangsu Province (1812000024880).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "We hypothesized that WFA would inhibit adhesion, migration, and respiratory burst by equine neutrophils and promote timely apoptosis of primed equine neutrophils. Consistent with this hypothesis, our data show that WFA causes a significant, concentration-dependent inhibition of equine neutrophil adhesion, migration, and respiratory burst in response to diverse stimuli. Further, WFA treatment increased apoptosis of equine neutrophils exposed to GM-CSF for 24 h. This pro-apoptotic effect of WFA was not observed in unprimed neutrophils, nor at the 2-h time point relevant to our functional neutrophil experiments. Our data demonstrate that WFA may reduce neutrophil-mediated inflammation through multiple mechanisms, including suppression of inflammatory responses and promotion of apoptosis. Additional research is needed to elucidate the molecular mechanisms for these effects and evaluate the potential clinical use of WFA in veterinary and human patients.Neutrophils play a major role in many equine conditions, including equine asthma, laminitis, and intestinal ischemia and reperfusion injury, and therefore represent an attractive target for innovative therapeutic approaches. Novel strategies for reducing neutrophilic inflammation include modulation of neutrophil functions and lifespan. Withaferin A (WFA) is a phytochemical with well-established  While neutrophils are an integral part of the innate immune system, dysregulation of neutrophil functions can cause substantial damage to host tissue. In horses, neutrophilic inflammation has been implicated in the pathophysiology of diseases that can be acutely life-threatening or compromise quality of life and/or athletic performance \u20136. The cNeutrophil participation in immune responses can be characterized by a series of interrelated and overlapping events; these processes, from initial neutrophil recruitment to microbicidal activity at the site of inflammation, represent potential opportunities for collateral tissue injury. Adhesion of circulating neutrophils to endothelium is an early requisite step for neutrophil trafficking to sites of inflammation and for preparing neutrophils to respond to subsequent inflammatory mediators , 13. AftUnder healthy conditions, the detrimental potential of neutrophils is controlled by constitutive apoptosis , limitinRegulation of neutrophil effector functions and apoptosis are potential strategies for novel anti-inflammatory therapies \u201340. HoweWithania somnifera plant, which has been used for millennia in Ayurvedic medicine to treat many different conditions  is a steroidal lactone derived from the nditions . More ref cancer \u201350. Neutf cancer \u201356. In af cancer \u201344, 57. hia coli . HoweverIn addition to being anti-inflammatory, WFA is also reported to induce apoptosis in a variety of cancer cell lines \u201366. Intein vitro support for WFA as a therapeutic for neutrophil-mediated diseases, which could have important implications for both veterinary and human patients.Based on previous evidence of WFA's anti-inflammatory and pro-apoptotic properties, we hypothesized that WFA would inhibit neutrophil adhesion, migration, and respiratory burst and would promote apoptosis of primed neutrophils. Here we report that WFA significantly attenuated neutrophil functions without affecting short-term neutrophil viability. Additionally, WFA treatment promoted timely apoptosis in GM-CSF-primed neutrophils. These findings provide strong Escherichia coli (O111:B4), luminol sodium salt, and penicillin-streptomycin were from MilliporeSigma ; recombinant equine granulocyte-macrophage colony-stimulating factor (GM-CSF) was from Kingfisher Biotech, Inc. ; heat-inactivated fetal bovine serum (FBS) and Roswell Park Memorial Institute (RPMI) 1640 Medium were from Thermo Fisher Scientific ; Hank's Balanced Salt Solution (HBSS) was from Fisher Scientific .Withaferin A (WFA), leukotriene B4 (LTB4), and platelet activating factor  were from Cayman Chemical ; dimethyl sulfoxide (DMSO), ethanol (EtOH), recombinant human interleukin-8 (IL-8), phorbol 12-myristate 13-acetate (PMA), bovine serum albumin (BSA), rabbit anti-bovine albumin antiserum (anti-BSA), lipopolysaccharide (LPS) from Crystalline WFA was dissolved in anhydrous DMSO, producing a 35.4 mM WFA stock solution that was aliquoted and stored at \u221220\u00b0C. WFA treatment solutions were prepared fresh each experiment by diluting WFA stock in the assay media. The treatment vehicle control (VC) was equivalent to the concentration of DMSO in the highest concentration of WFA for each assay.University-owned horses at North Carolina State University were blood donors for this study. All horses were considered healthy based on physical examination and history. The blood collection protocol was approved by the North Carolina State University Institutional Animal Care and Use Committee (IACUC protocol #19-779).Neutrophils were isolated from equine whole blood as previously described , 75. Bri2, 1 mM MgCl2, and 5% FBS (HBSS++ + 5% FBS). Neutrophils (1 x 105) and treatment solutions  were combined in wells of high binding plates coated with FBS and allowed to settle for 10 min at 37\u00b0C. Neutrophils were stimulated with interleukin-8 , leukotriene B4 , platelet activating factor , phorbol 12-myristate 13-acetate , or respective stimulus controls  and incubated for 3 min  or 30 min (PMA) at 37\u00b0C. For insoluble immune complex (IIC) stimulation, BSA-coated plates were incubated with rabbit anti-BSA antibody for 2 h at 37\u00b0C to reach IIC densities of 5 \u03bcg and 20 \u03bcg per well. Unstimulated wells were coated only with 100 \u03bcg/mL BSA. The plates were washed to remove non-immobilized IIC, and neutrophils (1 x 105) and treatment solutions were combined in wells and incubated for 30 min at 37\u00b0C. All treatment/stimulation conditions were performed in triplicate. Fluorescence was measured at the end of the incubation period using a plate reader  and in between serial washing of the wells with HBSS. Percent adhesion was calculated by dividing fluorescence after washing by the initial fluorescence, and the wash at which adhesion of media control, unstimulated neutrophils was approximately 10% was used for data analysis.Isolated neutrophils were resuspended in HBSS and loaded with calcein-AM  for 30 min at room temperature prior to resuspension in HBSS containing 1 mM CaCl++ + 2% FBS as described for adhesion assays and pre-treated with WFA, VC, or media for 30 min at 37\u00b0C. Chemoattractants , chemoattractant controls , or media were added to the lower wells of a ChemoTx system (Neuro Probe) and overlaid by a membrane with 5 \u03bcm pores. Pre-treated neutrophils  were loaded on top of the membrane. All treatment/stimulation conditions were performed in triplicate. Control (100% migration) wells consisted of the same number of neutrophils placed directly into the lower wells, representative of the fluorescence if all the neutrophils had migrated. After incubation for 1 h at 37\u00b0C, non-migrated cells remaining above the membrane were removed using a scraper. EDTA  was added to membranes above each well and incubated for 10 min at room temperature before centrifugation of the plate for 5 min at 100 \u00d7 g. The membrane was removed, and fluorescence of each microplate well was determined using a plate reader. Percent migration was calculated by dividing fluorescence of experiment wells by the mean fluorescence of 100% migration control wells.Neutrophils were loaded with calcein-AM and resuspended in HBSS++ + 5% FBS and pre-treated with WFA, VC, or media for 30 min at 37\u00b0C. Where indicated, priming with GM-CSF (1 ng/mL) was performed during the pre-treatment period. Pre-treated neutrophils  were plated in FBS-coated wells, and luminol sodium salt (1 mM) was added to each well. Once stimuli (100 ng/mL LPS or 100 ng/mL PMA) or the appropriate stimulus control  had been added to each well, the plate was incubated at 37\u00b0C in a plate reader, and luminescence values were recorded every 5 min (t = 0\u201390 min). In separate experiments, pre-treated neutrophils (3 x 105) were added to wells coated with 5 \u03bcg insoluble immune complexes . These plates were also incubated at 37\u00b0C with luminescence values recorded every 5 min for 90 min. The timepoint at which maximum luminescence of media control, stimulated neutrophils was determined and used to establish the timepoint for data analysis for each stimuli: GM-CSF/LPS: 40 min, PMA: 60 min, IIC: 30 min (Neutrophils were resuspended in HBSS: 30 min  74). Lu. Lu++ + 6/mL) in RPMI with 10% FBS, 100 U/mL penicillin, and 100 \u03bcg/mL streptomycin were simultaneously treated with WFA, VC, or media and primed with GM-CSF (50 ng/mL) or left unprimed. Primed and unprimed neutrophils were also treated with staurosporine (1 \u03bcM) as a positive control for induction of neutrophil apoptosis  according to manufacturer instructions . Cells were analyzed via flow cytometry , and unstained samples were used to gate neutrophils based on size (forward scatter) and granularity (side scatter). Quadrants were defined using cells singly stained with annexin V or PI. Populations of live (annexin V\u2212/PI\u2212), apoptotic (annexin V+/PI\u2212), and dead (annexin V+/PI+) neutrophil singlets were quantified based upon at least 10,000 events. Post-acquisition data analysis was performed using commercial software (FlowJo v. 10.7.1). Raw percentages of neutrophil viability, apoptosis, and death are available in Isolated neutrophils resuspended (1 x 10poptosis . After 2t-tests were performed to compare VC-treated neutrophils under stimulated vs. unstimulated conditions. Withaferin A treatment groups and the media control group were compared to the VC group within each stimulation condition using one-way repeated measures ANOVA with post hoc Holm\u2013\u0160id\u00e1k multiple comparisons. The WFA concentration at which 50% inhibition of each function was achieved relative to the VC (IC50) was determined using commercial software based upon four parameter nonlinear fit.For functional assays, one-tailed paired t-tests. Results from WFA-, VC-, or staurosporine positive control-treated neutrophils were compared to findings from media control neutrophils within each priming condition using one-way repeated measures ANOVA with post hoc Holm\u2013\u0160id\u00e1k multiple comparisons. All analyses described in this section were performed using GraphPad Prism v. 9.3.0. Significance was set at p < 0.05 for all analyses.For apoptosis/viability data, apoptosis or viability of media control neutrophils under GM-CSF-primed conditions was compared to that of media control, unprimed neutrophils using one-tailed paired 50 values ranged from 6.8 to 21.3 \u03bcM . There was no significant effect of WFA on adhesion of unstimulated neutrophils. There was a small but statistically significant difference between percent adhesion of VC-treated neutrophils (78 \u00b1 2.1%) compared to media control (71 \u00b1 4.8%) with PMA stimulation. This was not observed with the other stimuli.Adhesion of circulating neutrophils to endothelial ligands is a critical initial event in neutrophilic inflammation. Using a modified protocol previously established by our laboratory, we evaluated the effect of WFA on neutrophil static adhesion induced by IL-8, LTB4, PAF, PMA, or IIC , 75. Eac50 values for IL-8, LTB4, and PAF stimulation were 2.5 \u03bcM, 2.9 \u03bcM, and 1.0 \u03bcM, respectively. Withaferin A also decreased neutrophil migration in the absence of stimulation relative to the VC treatment  and to quantify apoptotic neutrophils (annexin V+/propidium iodide\u2212). After 2 h incubation in the presence or absence of GM-CSF priming, the percentage of live neutrophils was not different in WFA-treated cells (0.1\u201325 \u03bcM WFA) compared to media control-treated cells . This finding suggests that WFA treatment does not suppress neutrophil functions by causing neutrophil cell death. However, we recognize that compromise of plasma membrane is a relatively late event in the process of cell death, so inability to exclude trypan blue has limited sensitivity for evaluating cell viability. Trypan blue staining also does not identify cells in early apoptosis. Therefore, we used flow cytometry to assess neutrophil viability using a more stringent definition of live neutrophils  signaling \u201391. One in vivo WFA studies. Third, our population of dead neutrophils was defined by cells that were double positive for annexin V and propidium iodide staining and includes both late apoptotic and necrotic cells. We attempted to differentiate the two processes using a pan-caspase inhibitor, z-VAD-FMK, but none of the three concentrations of z-VAD-FMK previously reported to inhibit neutrophil apoptosis  (+/propidium iodide\u2212 neutrophils in our experiments (data not shown). Therefore, we were unable to determine whether the higher percentage of dead neutrophils following 25 \u03bcM WFA treatment for 24 h was reflective of an earlier onset and/or more rapid progression of apoptosis leading to secondary loss of membrane integrity or whether the 25 \u03bcM WFA caused necrosis rather than apoptosis. Since necrosis is an inherently pro-inflammatory process, understanding the potential of this higher concentration of WFA to cause necrosis of neutrophils is relevant to its future clinical use. Finally, we base our assertion that WFA does not compromise short-term neutrophil viability on flow cytometry data from neutrophils simultaneously treated with WFA and primed with GM-CSF or left unprimed for 2 h. The 2-h treatment time exceeds the length of exposure to WFA during our functional assays . However, we acknowledge the possibility that stimuli used in the functional assays may affect impact of WFA on neutrophil viability. We repeated apoptosis/cell death flow cytometry experiments using similar conditions as adhesion and respiratory burst assays, including a 30-min WFA pretreatment period followed by stimulation with PMA or GM-CSF/LPS or no stimulation (30\u201360 min). There was no evidence that WFA reduced neutrophil viability under conditions used in functional assays (data not shown).We recognize several limitations of this study. First, neutrophils used in the functional assays were pretreated with WFA for 10 min (adhesion experiments) or 30 min (migration and respiratory burst experiments) prior to stimulation. This timeline does not replicate clinical conditions in which WFA may be a valuable therapeutic, since treatment administration prior to the onset of inflammation is generally not feasible for acute diseases. However, it is important to note that inflammatory events, particularly those involving dysregulated neutrophils responses, are cyclical, with initial neutrophilic inflammation contributing to tissue damage that often recruits additional neutrophils. In these situations, anti-inflammatories such as WFA might be useful for \u201cinterrupting\u201d a dysregulated cycle of inflammation. Additionally, our 24-h apoptosis findings suggest that WFA may actively promote resolution of existing inflammation. In other scenarios, particularly for diseases that are chronic with episodes of exacerbation, WFA could be used in a chemopreventive capacity to reduce inflammatory flares. Second, our experiments were conducted with isolated neutrophils containing a low percentage of other leukocyte populations. While this reductionist approach is essential for examining direct effects of WFA on neutrophils to better understand mechanisms, it ignores the effects of WFA on other cell types  and the resulting complex interactions that may influence neutrophils indirectly. We plan to incorporate other relevant cell types into future experiments in preparation for subsequent VAD-FMK) , 112 hadin vitro results that provide proof of principle evidence for WFA as a novel anti-inflammatory strategy for neutrophil-mediated diseases. We have shown that WFA inhibits neutrophil adhesion, migration, and respiratory burst across a wide range of stimuli, including those that are relevant to inflammatory diseases, through a mechanism that does not impair short-term neutrophil viability. We also demonstrate that WFA promotes timely apoptosis of GM-CSF-primed neutrophils, a rare example of pro-apoptotic effects of WFA in non-neoplastic cells. The combination of these effects may have clinical benefit in reducing inflammation and hastening resolution of inflammation. Further studies on WFA are needed to better understand the molecular mechanisms underlying these effects, confirm the favorable safety profile suggested by laboratory animal and human data .RB: conceptualization, study design, funding acquisition, study execution, data analysis and interpretation, original draft preparation, manuscript review and editing, and final approval. MS: supervision, data interpretation, manuscript review and editing, and final approval. SJ: conceptualization, study design, funding acquisition, supervision, data interpretation, manuscript review and editing, and final approval. All authors contributed to the article and approved the submitted version.Stipend support for RB and partial funding for study supplies were provided by the NIH T32 Ruth Kirschstein Institutional National Research Service Award (NRSA) Training Grant (NIH T32 OD011130). Other sources of funding for experiments included the North Carolina State University College of Veterinary Medicine Competitive Research Grants Program and the North Carolina State University Comparative Medicine Institute Associate Member Flash Grant Program.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Thermal runaway is a major safety concern in the applicationsofLi-ion batteries, especially in the electric vehicle (EV) market.A key component to mitigate this risk is the separator membrane, aporous polymer film that prevents physical contact between the electrodes.Traditional polyolefin-based separators display significant thermalshrinkage (TS) above 100 \u00b0C, which increases the risk of batteryfailure; hence, suppressing the TS up to 180 \u00b0C is critical toenhancing the cell\u2019s safety. In this article, we depositedthin-film coatings (less than 10 nm) of aluminum oxide by atomic layerdeposition (ALD) on three different types of separator membranes.The deposition conditions and the plasma pretreatment were optimizedto decrease the number of ALD cycles necessary to suppress TS withouthindering the battery performance for all of the studied separators.A dependency on the separator composition and porosity was found.After 100 ALD cycles, the thermal shrinkage of a 15 \u03bcm thickpolyethylene membrane with 50% porosity was measured to be below 1%at 180 \u00b0C, with ionic conductivity >1 mS/cm. Full batterycyclingwith NMC532 cathodes demonstrates no hindrance to the battery\u2019srate capability or the capacity retention rate compared to that ofbare membranes during the first 100 cycles. These results displaythe potential of separators functionalized by ALD to enhance batterysafety and improve battery performance without increasing the separatorthickness and hence preserving excellent volumetric energy. Among different technologies, lithium-ionsecondary battery has achieved widespread penetration in consumerelectronics and, in the past decade, also in electrified transportation.Thanks to recent developments and the cost reduction driven by massproduction,2, LiMn2O4, and LiNiMnCoO2 as a positive electrodeor cathode,3 a separator consisting ofa porous membrane soaked in a Li-ion conducting liquid electrolyteto prevent electrical contact between the anode and cathode, and anintercalation host, like graphite or Li2TiO3 as a negative electrode or anode, respectively.4 Cathodes are chosen to have relatively high potential (3.7\u20134.3V) vs Li/Li+, allowing for exceptionally high power andenergy density compared to other electrochemical storage systems.5The Li-ion battery technology takes advantage of intercalation-basedlithium-doped multimetal oxides, e.g., LiCoO6 thermal runaway and subsequent overheating are one of themajor failure mechanisms, especially in high-power applications. Inthis context, the separator is a key component to improve lithium-ionbatteries\u2019 safety. The separator membrane prevents electricalcontact between two electrodes  while allowing for ionic conduction through it.Typically, polyolefin materials, such as porous polyethylene (PE)or polypropylene (PP) are used in liquid electrolyte Li-ion batteriesbecause of their low cost and wide chemical stability. However, undermechanical, thermal, or operational abuse, PE separator membranesshrink as the cell\u2019s temperature increases above 100 \u00b0C,thus approaching the melting temperature of PE. After shrinkage, thephysical contact of positive and negative electrodes can no longerbe prevented, causing an irreversible thermal runaway, swelling, andpossible explosion.7 A typical solutionto mitigate this issue consists in laminating a PP layer on both sidesof the PE separator (PP/PE/PP) and making the battery nonoperationalbefore the thermal shrinkage (TS) of the separator, hence preventingoverheating.8 Despite this feature, ithas been demonstrated that the shutdown function may not be enoughto stop the thermal runaway, especially if the cell\u2019s temperaturequickly reaches the melting point of PP.9 To enhance the safety of the battery, a separator with no thermalshrinkage above 180 \u00b0C is desirable.10Despite the technology being inherentlysafe with a failure rateestimated at around one for five million cells,11 Among these strategies, ceramic particles on polyolefin separatorsshowed significant improvements in thermal stability and wettabilitywhile preserving flexibility and low manufacturing cost.12 However, a major drawback of this approach isthe large increase in the separator thickness and the increase ofinactive weight, leading to battery performance degradation, suchas faster capacity fading and lower capacity retention at high chargingrates (C-rates). The deposition uniformity and the agglomeration tendencyof the ceramic particles blocking the pores are also often reportedas downsides of this strategy. The above drawbacks are even more pronouncedfor double-side coated separators, which yield improved thermal stabilityby preventing bending at high temperatures (>120 \u00b0C).14Alternatively, ceramic- and polymer-based slurry coatingshavebeen investigated to improve the thermomechanical properties and electrochemicalperformance of the polyolefin separators.16 In 2012,17 Jung et al. showed how ALDof aluminum oxide (AlOx) on a commercialPP separator can allow for a drastic reduction of the TS and an increasein wettability without any noticeable thickness increase or flexibilityloss. Despite these encouraging results, coatings on polyolefin separatorsusing ALD are challenging due to the lack of intermolecular interactionsbetween the membrane and the coating precursors, leading to a nonefficientsubsurface nucleation mechanism. To mitigate the limitation of subsurfacenucleation, Xu et al.18 demonstrated thepotential of air plasma to activate the surface of the separator.The authors also observed an improvement in terms of conformality,which was used by Chen et al.19 to rationalizethe higher thermal stability of plasma-activated ALD-coated membranesover the nonactivated ones.To overcome these limitations, coating of the separator byatomiclayer deposition (ALD) has been used due to its self-limiting, conformal, and monolayerdeposition properties.20 took advantageof the large pore size of a nonwoven mat, which was combined withAlOx deposited by ALD. This approach demonstratedthe expected improvements in terms of electrolyte uptake and ionicconductivity, leading to better rate capability and suppression ofTS up to 270 \u00b0C. AlOx ALD on PE separatorswas also used by Moon et al.21 to enhancethe uniformity of polydopamine coatings, which has been one of thebottlenecks of this chemical treatment since its origin.22 These examples show the ability of ALD coatingsto reinforce the porous membrane without increasing its total thicknesswhile avoiding pore clogging or the use of solvent slurries, in contrastwith solution-based coatings.23 Despiteits high potential, ALD is not widely used in the battery manufacturingchain due to high CapEx and OpEx and its low throughput, especiallyfor films thicker than 10 nm. This can be mitigated using spatialALD (compatible with fast roll-to-roll processing)25 and depositing ultrathin films (<10 nm). So far, there are noreports of effective thermal shrinkage suppression on standard PEseparators using only ALD coatings at meaningful thicknesses of <10nm.To tackle the problem of pore narrowingalso observed in the firstALD applications, Shen et al.x ALDprocess to suppress TS while maintaining or even improving the ionicconductivity of the separator. We show a process optimization leadingto thin-film coatings (with less than 100 ALD cycles) that can beoptimized for different porosities typical of PE separators and PP/PE/PPlaminates, showcasing the versatility of this process. The correlationbetween the separator material, its pore size, and its porosity withthe minimum film thickness needed to suppress TS is found and discussed.The results are presented starting from TS results, which reveal insightsinto the difference in coating growth depending on the membrane\u2019sporous morphology. Water contact angle measurements are used to reinforcethe conclusion proposed from the TS test. Gas permeability and ionicconductivity data show a relationship with water wettability quantifiedby water contact angle (WCA). Finally, coin cell cycling curves arepresented to demonstrate how thin-film coatings on the separator canimpact the battery cycling performance.Herein, we demonstrate a unique combination of an in situplasmaactivation step and an optimized AlO2 squares before deposition and washedwith 2-propanol.Different separators purchased from industrialsuppliers were used in this work see 1: a trilGraphite and NMC532  were used as negative and positive electrodes, respectively. A1M LiPF6 mixture of EC/DMC/DEC 1:1:1 (Merck) was used as an electrolyte.26 the thickness attained on polymers is similarto the one measured on Si. Since the exact thickness on top of membraneswas not measured, cycles (and not thickness) were used throughoutthe text.Separator sheets were coatedon both sides by thermal atomic layer deposition (ALD) of aluminumoxide using trimethylaluminum (TMA) and water as precursors with anOxford FlexAL ALD system. The chamber temperature was 80 \u00b0C.The growth rate was measured to be 1.1 \u00b1 0.1 \u00c5/cycle oncrystalline silicon witness samples. According to Wilson et al.,2 squares werecut and sandwiched between two paper sheets. The TS measurement wastaken in the machine direction starting from a temperature of 120\u00b0C and then repeated 60 min after increasing the temperaturesequentially by 20 \u00b0C. L0 is 2cm and L(T) is the measured valuealong the machine direction at a given temperature.To evaluate the thermalstability of the composites, 2 \u00d7 2 cmWater contact angle (WCA) measurementswere performed on DSA30 (Kruss) with a 2 \u03bcl drop.The morphology ofthe separators was observed with a JEOL-JSM-7500 TFE scanning electronmicroscope (SEM).The Gurley value of thebare and coated separators was measured using a Gas Permeameter GP-101A-G-T200by Porous Materials Inc., situated at Ruschlikon\u2019s IBM ResearchInstitute Facility, belonging to ETH Department of Information Technologyand Electrical Engineering.CR2032 coin cells were assembled inan argon-filled glovebox with oxygen and water level below 0.2 ppm.For ionic conductivity, the separators were sandwiched between twostainless steel spacers of 0.5 mm thickness and 15 mm diameter. Thecell\u2019s stack was sandwiched between two 0.5 mm spacers, heldin place by a conical spring.Coin cells were testedon a BCS815 cycler by Biologic. For EIS measurements, a 10 mV sinusoidalamplitude was applied from 10 kHz to 0.1 Hz. A Debye circuit was usedto estimate the circuit\u2019s resistance.x coating on the separator\u2019sporosity, pore size, and polymertype, three different membranes were used: a trilayer separator composedof a PE core laminated with PP shells on both sides (Trilayer) andtwo pure PE membranes, with either 48 or 83% porosity . x coating on the TS, we evaluated the latter at 180 \u00b0C, as thistemperature is safely above both melting points and is the temperatureat which runaway starts.To understand the dependenceof the AlOx coatingswere appliedto the trilayer separator, since it is supposed to have better thermalintegrity due to the PP layers. An N2/O2 plasmapretreatment was introduced to improve the conformality of the ALDcoatings on the membranes. To evaluate the impact of the plasma treatment,trilayer separators were coated with AlOx ALD layers with or without the pretreatment. x shell can be achieved for the trilayer separatorwithout or without plasma pretreatment, but at a different numberof #cy , suggesting thata structurally stable shell was not built around the PP matrix. Eventhough the WCA measurements show that the PP surface is covered bythe AlOx coating, it was not possibleto prevent the structure to fail once its melting point is reached.This could suggest either that the ALD coating is more effective onPE than PP with equivalent coating thickness, or that the growth ofAlOx is hindered on PP. Both hypothesesare possible since the membranes are different in chemical composition,mechanical proprieties, and porous structure. These investigationsallow nonetheless to indicate a positive impact of the AlOx coating on the TS properties of the trilayermembrane.x ALD on PE, ALD deposition was performed onpure PE membraneswith higher permeability , butit is still incomplete. The number of required cycles to suppressTS is different for PE48 and PE83\u2013100 and 50 #cy. Since themembranes are made of the same polymer, the difference must dependon the structural morphology.x ceramic shell aroundthe polymer matrix must be reached to prevent shrinkage. From a mechanicalperspective, the melting polymer exerts compressive stress on theshell. The coating can withstand this stress if it is below the fracturestrength of the ceramic layer. Following the definition of stressas the force divided by the surface, we assume that increasing thethickness of the coating helps decrease the compressive test imposedon the shell\u2019s cross section. The threshold thickness is reachedonce the shell is thick enough to resist the compressive stress ofthe PE membrane without collapsing. The latter could strongly dependon the morphology and on the mass of the polymer matrix. PE83 hasa lower surface density compared to that of PE48; in fact, for anapproximate PE density of 0.9 g/cm3,33 the surface densities of PE48 and PE83, based on theirporosity and thickness, are 0.7 and 0.3 mg/cm2, respectively.The twofold difference seems to be correlated with the number of ALDcycles necessary to suppress the TS.Knowing from the WCA measurementsthat a total surface coverageis obtained after 50 #cy for PE48 but the suppression of shrinkageis reached only at 100 #cy, we hypothesize that a minimum thresholdthickness of the AlOx coatingon the membrane\u2019s permeabilityand ionic conductivity was studied to assess the electrochemical propertiesof the coated separators; for this purpose, the PE48 separator wasselected instead of PE83, which is not robust enough for battery applications. x coating, the lower the separator\u2019s permeability.It is hypothesized that the ceramic shell reduces the porosity, thushindering the gas flow through the membrane. This observation couldbe a consequence of pore narrowing and, eventually, clogging of thelower fraction of the pore size distribution. A different trend isfound when comparing the ionic conductivity of the separators: \u03c3initially increases from 1 to 2 mS/cm after 25 #cy with HS and thendecreases with the increasing number of cycles, returning to the initialvalue of 1 mS/cm after 100 #cy with HS. This trend could be explainedby a combination of improved wettability and decreased permeability,both due to the increased thickness of the AlOx coating. The initial increase in ionic conductivity resultsfrom the improvement of the surface interaction with the liquid electrolytes:polyolefin materials have high contact angle with polar solvents,which slows down the separator impregnation and prevents the wettingof the smaller pores. We hypothesize that the ceramic shell reducesthe liquid\u2013solid contact angle and allows the electrolyte solutionto fill a larger fraction of pores, thus improving the ionic conductivity.With the increasing ALD cycles, the smaller pores are clogged first,hence their contribution to the ion transport is lost and the conductivitydecreases to the initial value.After effectively suppressingTS, the influence of the AlOx ALDcoatings with HS and with an increasing number of cycles. Followingtwo forming cycles at 0.2C rate (not shown), the first three cyclesat 1C do not display a significant difference in discharge capacitybetween coated or uncoated separators. Increasing the discharge rateto 2C and subsequently 4C leads to a \u223c5% drop in dischargecapacity for the 100 #cy separator. The 25 and 50 #cy samples insteadoverlap with the bare PE48. Finally, the cells undergo three morecycles at 1C charge and discharge. A permanent capacity fading isobserved for the 100 #cy samples, indicating that permanent damagewas inflicted to the battery electrodes for the thicker AlOx coating. Since the electrodes are NMC532 andgraphite, the operating C-rates are limited to 1C for charging and4C for discharging. By testing the coin cell at these rates, the electrodesare pushed to their operational limit. For a high number of ALD cycles,hindering battery performance was previously reported.17 The same is observed for the 350 #cy Trilayerseparator, displayed in Figure S4 in theSupporting Information. This was attributed to an increase in internalresistance due to pore clogging.The ionic conductivity trends presented in The ALD-coated separators are then compared basedon dischargecapacity fading of graphite/NMC532 cells cycled at 1C-rate both incharge and discharge 5b. The rFor polyolefin-basedseparators, the total suppression of TS isachieved only with a core\u2013shell functionalization, as in literature,similar results are only achieved by a wet coating of expensive high-performancepolymers such as polyimide or aramids. The better thermomechanicalintegrity of the ALD-coated PE separators 3 is a six ALD performed on polyolefin-based separatorsprovides significantimprovement in thermomechanical integrity and surface interactionwith liquid electrolytes. Moreover, depending on the separator material(PP/PE or PE) and its porosity, a different number of cycles is neededto suppress thermal shrinkage. Optimization of the deposition processby pretreating the separators with a plasma step allows us to totallysuppress thermal shrinkage at 100 deposition cycles for 15 \u03bcmPE separators of 48% porosity. The introduction of a hold step inthe ALD cycle reduces the WCA of the coated separator by a factorof 2, reaching 38\u00b0 after 25 deposition cycles. Symmetrical andfull battery electrochemical characterizations show that the inorganicAlOx ALD coating doubles its ionic conductivitywhen wetted with conventional liquid electrolytes and extends thebattery\u2019s lifespan compared to an uncoated counterpart.In this work, it was found that AlO"}
+{"text": "Traumatic brain injury (TBI) is a major public health problem that may be associated with numerous behavioral problems, including impulsivity, aggression and violence. Rates of self-reported TBI are high within offender populations, but the extent to which TBI is causally implicated in causing illegal behavior is unclear. This study examined the psychological and functional correlates of histories of traumatic brain injury in a sample of impulsive violent offenders.Study participants, all men, had been recruited to participate in a randomized controlled trial of sertraline to reduce recidivism. Study entry criteria were an age of at least 18\u2009years, a documented history of two or more violent offenses and a score of 70 or above on the Barratt Impulsiveness Scale. An extensive list of standardized questionnaires was administered to obtain information on previous TBI and other neuropsychiatric conditions or symptoms.In the sample of 693 men, 66% were aged between 18 and 35\u2009years old, and 55% gave a history of TBI (\u201cTBI+\u201d). Overall, 55% of study participants reported at least one TBI. High levels of neuropsychiatric symptomatology were reported. In 75% of TBI+ individuals, their most severe TBI (by self-report) was associated with loss of consciousness (LOC)\u2009<\u200930\u2009min. Compared to TBI- (those without history of TBI) participants, TBI+ individuals were more impulsive (Eysenck Impulsivity), irritable, angry, and reported higher levels of assaultive behavior, depressive symptomology, alcohol use disorder, suicidal ideation, suicide attempts, and lower quality of life. Potential \u201cdose effects\u201d of TBI severity and frequency in terms of neuropsychiatric symptomatology were identified.Like other studies of offender populations, single and multiple TBIs were very common. The associations of TBI, TBI severity, and TBI frequency  with adverse neuropsychiatric phenomena suggest TBI contributes importantly to offender morbidity but the select nature of the sample and cross-sectional study design constrain the interpretation of these findings. TBI is The extent to which TBI might operate as a risk factor for violence or criminality remains unclear. Longitudinal and linkage studies, where the temporality of TBI can be established  have suggested an up to a two-fold increase in the risk of offending outcomes, but such studies generally lack any proxy measure for pre TBI behavioral characteristics that might represent a confound .Specifically, the trait of impulsivity or poor self-control, is typically established early in life, and might explain an apparent association of TBI with offending, given that this trait increases the risk of both outcomes . Lack ofIn the present study, we had the opportunity to examine self-reported data on past TBI, neuropsychiatric symptoms and conditions and indices of impulsivity in a sample of impulsive individuals who had previously been found guilty of violent offenses. These data comprise baseline information from a larger randomized controlled trial of sertraline designed to determine whether that medication might reduce repeat offending . We used2.2.1.Study participants were all men who met the criteria for randomization in the ReINVEST study . That st2.2.Participants were asked to complete the medical history questionnaire which included the following questions about past episodes of TBI; \u201cHave you ever had a head injury where you passed out or had a \u2018blackout\u2019?\u201d and \u201cHow often have you experienced a head injury?\u201d Up to five separate episodes of traumatic brain injury were recorded and participants were asked to report the TBI in order of severity. The first reported TBI was the most severe. The traumatic brain injury questionnaire included the following questions: How long were you unconscious (blackout)? When did this happen? Additional information included whether they suffered a skull fracture or bleeding on the head or surgical procedure on the head?If the participant suffered multiple TBIs, they were instructed to provide information related to their most severe form of TBI under the first episode of TBI, followed by other episodes of TBIs. The burden of TBI was determined in this study based on LOC, the number of TBIs and duration since the severe TBI.2.3.Demographic data was collected relating to age, gender, ethnicity, marital status, children, education, employment, and accommodation.2.4.Baseline assessments included administration of the Barratt Impulsiveness Scale (BIS-11) and the Eysenck Impulsivity Questionnaire (EIQ) providing information on state and trait indices of aspects of impulsive behavior. The Anger Irritability and Aggression Questionnaire (AIAQ) was used to measure the subjective level of anger and aggression in recent weeks and the State Trait Anger Expression Inventory (STAXI-2) was used to measure the subjective level of anger in different situations. The Beck Depression Inventory-II (BDI-II) examined symptoms in the past week potentially indicative of a mood disorder. The Alcohol Use Disorders Identification Test (AUDIT) measured alcohol consumption in the 12 months prior to incarceration. AUDIT identified safe, harmful and hazardous levels of alcohol consumption. The Kessler Psychological Distress Scale (K-10) is a 10-item questionnaire that provides a global measure of distress based on questions about anxiety and depressive symptoms in the past 4 weeks. The International Personality Disorder Examination (IPDE) was used to categorize participants as having Impulsive Personality Disorder, Dissocial Personality Disorder and Borderline Personality Disorder. As a measure of reading ability, Wechsler Individual Achievement Test Score was collected. In addition, details of substance use and abuse were collected and psychiatric assessment recorded information on suicide attempts, self-harm and sexual abuse as part of the routine reception interview.2.5.The Duke Social Support Scale provided information on social interaction and the Quality-of-Life Short Form Questionnaire (SF-12) assessed health-related quality of life.2.6.Descriptive statistics were used to describe the sample characteristics, presence of TBI, self-reported duration of any LOC, time of occurrence, the severity of the head injury, symptoms following head injury, and overall response distribution of the psychological and functional measures. Hosmer-Lemeshow goodness of fit test based on chi-square formulation was used to investigate the association of the presence of TBI with sample characteristics, personality disorder, psychiatric assessment, and substance abuse. This procedure was repeated on different study outcomes including duration of LOC, time of occurrence, and duration of LOC among participants who reported only one episode of TBI. Fisher\u2019s exact test was used when the expected count assumption of the chi-square test was not achieved. Meanwhile, One-way ANOVA  was performed to investigate the study outcome with continuous numerical covariates including demographic characteristics, and psychological and functional measures. Pairwise comparison test using the Bonferroni method was applied where one-way ANOVA is significant in more than 2 groups. All statistical procedures were two-sided and computed on R4.3.3. All results are interpreted at the 5% significance level.3.SD =\u20093.46). One third had left school without completing a high school qualification. Three quarters (75%) had been suspended from school and 40% had been expelled.Data cleaning procedure was employed prior to data analysis. Out of 935 participants, 244 participants with incomplete data were removed. The 244 participants were missing mostly TBI history, AUDIT, AIAQ, STAXI-2, substance abuse, SF-12, Duke and demographic data. A total of 693 individuals with complete data were used for the analyses. As indicated in p\u2009=\u20090.027) and who lived with their partner  or with relatives  and they had had higher school suspensions  than those without TBI.Univariate analysis showed significant associations between any TBI with LOC and employment, accommodation, and suspension from school. The number of TBI cases was significantly higher among those who had been unemployed in the last 6 months .In p\u2009=\u20090.026).We then sought further evidence for possible \u201cdose effects\u201d of TBI by comparing groups defined by reported numbers of TBIs  . Here, tp\u2009=\u20090.006), verbal assault , indirect assault , anger expression-out , and anger expression-index . Furthermore, relative to TBI-, those with a single mild TBI included a significantly higher proportion of current  and former  substance abusers.We then compared TBI- participants with TBI+ participants who reported a history of a single mild TBI. In univariate analyses , those w4.In this sample of highly selected, impulsive and violent men, 55% reported a history of at least one TBI associated with some alteration of consciousness, a prevalence consistent with rates found in prisoner populations in the literature . AlthougTBI aside, neuropsychiatric conditions are highly prevalent in offender populations, and the current sample is no exception. Based upon the International Personality Disorder Examination, impulsive personality disorder was present in over 70% of the sample, likely a reflection of their offending history and the recruitment criteria requiring a threshold (high) score on the Barratt Impulsiveness Scale for inclusion. Borderline (47%) and dissocial (46%) personality disorders were also extremely common. Reflective of early life disadvantage, a history of sexual abuse was highly prevalent as were high rates of past suicidal ideation, self-harm or suicidal attempts. Such findings are particularly notable in light of the exclusionary criteria such that individuals with active major mental illness were not recruited into the ReINVEST study . High lep\u2009<\u20090.001) in the community non-offending sample , may reflect neuropsychiatric sequelae of TBI. Cross sectional studies are inherently limited with respect to establishing causal relationships, but they may nevertheless yield interesting results of relevance to this issue. In a previous study by our group, we collected \u201ccontrol\u201d data by telephone interview to supplement previously-collected data from recent prison entrants . Past TBg sample . When thThe present study shares certain features with our earlier  study deany injury) might represent a confound. Seen in this light, the occurrence of a mild TBI might constitute a proxy for risk taking or impulsivity that represents the actual underlying risk factor for offending behavior. The plausibility of the hypothesis that mild TBI may be causally implicated in offending depends on the nature of the neuropsychiatric consequences of TBI that might be anticipated, either following a single event or when multiple instances occur.On the question of causation, the relevant studies that are most methodologically sound are longitudinal, often linkage, studies in which the temporal sequence of TBI exposure and the offending outcome can be more or less assured . TypicalIt has been long recognized that multiple TBIs, even when classified as mild TBI, can have cumulative deleterious effects . There iIn our study, there were significant differences between groups defined by the number of reported TBIs , consistent with possible \u201cdose effects\u201d with respect to Beck Depression Inventory, psychological distress, quality of life, suicide ideation and suicidal attempts. The >2 TBIs category also had lower social supports, and were most impulsive of the three categories of TBI frequency without an obvious gradient of effect. That the >2 TBIs group reported greater substance abuse, including alcohol, may perhaps reflect consequences rather than causes of those exposures, recognizing that all of the above is necessarily speculative.It has become increasingly apparent that a single mild TBI may be complicated by long-term physical, cognitive, and emotional consequences which may include an increase in aggression and impulsivity. When considering the effects of a single mild TBI, it is important to note that the definition encompasses a considerable spectrum of severity, e.g., from transient alterations in awareness to LOC lasting up to 30\u2009min on one clinical measure .Results from recent large cohort studies with pre-injury assessments have substantially contributed to our knowledge of complications by reporting actual change scores associated with the TBI, meaning that post TBI symptoms cannot be solely attributable to pre-injury characteristics. The Project on Human Development in Chicago Neighborhoods study involved a longitudinal assessment of 1,827 adolescents with serial assessments . MultivaIn relation to the possible dose effects of a single TBI, we established categories of severity based upon the duration of LOC  for thosIt is well established that socio-demographic variables such as age, poverty and unemployment are influential in terms of an individual\u2019s criminal risk . In thisWe found a significant association between TBI and employment, accommodation, and suspension from school . SeveralThe association between TBI and criminality is very complex. Study participants who are, perhaps developmentally, impulsive and violent are inherently more risk-taking and less harm avoidant. Thus, pre-existing factors may predispose individuals to TBI and conversely, TBI may contribute to an exacerbation of impulsive behavior and poorer social skills . The disDeveloping services to reduce the disability associated with TBI and the re-offending risk is a very complex task. We have been impressed by the literature suggesting the high importance of impulsivity and poor self-control as risk factors for offending. Indeed, these considerations, together with the evidence to suggest that SSRIs may reduce impulsivity and aggression prompted us to undertake the ReINVEST study from which the current sample of participants were drawn . More geWe acknowledge important limitations, several alluded to already. By virtue of the parent study from which these data were drawn, all study participants were violent offenders and all had threshold levels of impulsivity. This selective nature of the sample leads to at least the potential for correlations between some variables to be spurious . FurtherIn conclusion, the impulsive individuals with histories of violence who participated in this study reported high levels of anger, distress, substance abuse and early life trauma as well as high rates of past TBI and, frequently, multiple TBI with a hard-to-quantify contribution toward their current levels of criminal justice engagement and neuropsychiatric morbidity. Increased public health efforts, targeting social disadvantage and early childhood adversity, are fundamental to minimizing the prevalence of such conditions that present expensive and complex challenges for the criminal justice system, public health and forensic clinicians. Nevertheless, defining the treatable (in adulthood), and treating appropriately, should continue to be rewarding challenges.The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.The study was approved by these independent ethics committees: the University of New South Wales Human Research Ethics Committee (HREC) , Aboriginal Health and Medical Research Council HREC (822/11) and Corrective Services NSW HREC (09/26576). Approval from the NSW Justice Health and Forensic Mental Health Network HREC (G8/14) will allow participants to continue the study while in detention. The studies were conducted in accordance with the local legislation and institutional requirements. The participants provided their written informed consent to participate in this study.VCR and PS defined the objectives for the study. VCR managed the data and analyzed and interpreted the results, and wrote the first draft of the manuscript. PS and TB critically reviewed and edited the final version. BT, LK, RS, PM, JJ, DG, SA, VC, AE, VG, and KW revised the manuscript. All authors read and approved the final manuscript.The ReINVEST trial was initially funded by the National Health and Medical Research Council (GNT0533559) and subsequently by the NSW Department of Communities and Justice. The funding agencies had no role in study design, data collection, data analysis, data interpretation, or report writing.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "During May 17\u2013December 31, 2022, 125 probable or confirmed U.S. monkeypox (mpox)During September 25\u2013December 31, 2022, 17 children aged \u226412 years with probable or confirmed mpox were identified through national surveillance. CDC provided a questionnaire to state and local health departments for collection of the child\u2019s history of exposure to any person with mpoxThree of the 17 pediatric patients were aged \u22647 days and had likely perinatal exposures; all three neonates were non-Hispanic Black or African American (Black). Two of these three mpox cases in neonates were previously reported ; in fiveThis report includes the first three U.S. mpox cases reported in newborns in the 2022 outbreak; these cases were not included in the earlier report of cases of diagnosed persons aged <18 years during May 17\u2013September 24, 2022, (The findings in this report are subject to at least four limitations. First, because timing of initiation of precautions relative to exposure was not collected, and the number of children and infants who did not acquire mpox after exposure is unknown, effectiveness of specific precautions could not be evaluated. Second, because pediatric infections during the 2022 outbreak were rare, the sample size is small, and generalizability is limited. Third, it is not possible to investigate racial disparity of mpox cases among children and in adults because of the small number of mpox cases among children. Finally, for some cases, exposure histories might be affected by misclassification because of recall error or social desirability bias.This report adds to the information about mpox among children during the 2022 outbreak ("}
+{"text": "Revamping the current biomarker landscape of hepatocellular carcinoma (HCC) with cell-free DNA (cfDNA) could improve overall outcomes. The use of commercially available cfDNA testing  is limited by the low prevalence of targetable mutations and does not have any prognostic or predictive value. Thus, current cfDNA testing cannot be relied upon for perioperative risk stratification (POR), including early detection of recurrence, long-term surveillance, predicting outcomes, and treatment response. Prior evidence on cfDNA mutation profiling (non-specific detection or gene panel testing) suggests that it can be a reliable tool for POR and prognostication, but it still requires significant improvements. cfDNA methylation changes or epigenetic markers have not been explored extensively, but early studies have shown potential for it to be a prognostic biomarker tool. The predictive value of cfDNA (mutations and EM) to assist treatment selection  and to monitor response to systemic and locoregional therapies should be a future area of focus. We highlighted the unmet needs in the HCC management and the current role of cfDNA testing in HCC in addressing them. Hepatocellular carcinoma (HCC) is the third leading cause of cancer-related death worldwide, with a 5-year survival rate of 18% . HCC manp = 0.0120) with adjuvant therapy. The risk stratification is based on tumor burden, MVI, and differentiation. SR for early-stage HCC may be curative, but outcomes are less favorable for patients with aggressive features (macrovascular invasion or MVI) found on final pathology ,6. The 5LEGACY study, TRACE, and RASER trials have shown that TARE is a favorable option in uncomplicated solitary HCC in patients with Child\u2013Pugh score (CP) A and good performance status (PS), but the failure of other prominent trials  indicates that it may not be an ideal option over ST in the treatment of advanced tumors  ,12,13,14Treatment selection (SR vs. TACE vs. SBRT vs. TARE vs. ST) is often based on the patient and tumor-related characteristics such as size, number, and location of the lesions, baseline liver functional status (by CP or Albumin-Bilirubin (ALBI) score), PS, and feasibility of the procedure intended. One of the main reasons for poor outcomes is the lack of biomarkers with a reliable prognostic or predictive value that guides HCC management. Alpha-fetoprotein (AFP) has poor sensitivity and specificity to detect recurrence or assess treatment response . SimilarGenomic testing and tumor or cell-free DNA (cfDNA) do not have roles in HCC management in its current form except in identifying rare targetable mutations in advanced cancers. Circulating tumor DNA (ctDNA), genomic material from the tumor cells, is often used synonymously with cfDNA, but there is a considerable difference between them. cfDNA refers to DNA floating in the bloodstream, including ctDNA, circulating tumor cells (CTC), exosomal DNA, and DNA from normal cells . The accMutation profiling of cfDNA in HCC patients is commercially available and accessible for daily practice. The most frequently detected mutations are TP53 32\u201380%), TERT 42\u201369%), CTNNB1 (17\u201342%), ATM 25\u201339%), and ARID1A (7\u201313%) \u201380%, TER,34,35,36%, and AR\u201369%, CTNHCC patients tend to have lower methylation levels (median: 59.3% vs. 76.9%) in cfDNA than normal controls . SignatuEtiology-specific cfDNA markers were reported in previous studies that can help in certain situations. Hepatitis B (HBV) carriers with HCC tend to have higher circulating ERBB2 and TERT mutations, higher methylation rates in RASSF1, TFPI2, TRG5 , and XPO4, and low methylation rates in CDKN2A than those without HCC ,70,71,72The prior cfDNA studies for POR can be broadly divided into three main categories : (a) thecfDNA testing preoperatively (preop) helps select a population of patients who can benefit from NAT, and by serial testing, we can determine the ideal time for resection. Similarly, postoperative (post-op) serial testing can complement current SOC (AFP and imaging). The mutation profiling was shown to be more robust than imaging and other protein markers such as AFP, AFP-L3%, and des-gama-carboxy prothrombin (DCP) . The ctDA tissue agnostic serial ctDNA mutation test proved useful to predict recurrence and microvascular invasion by serial monitoring . The ctDReliable blood-based  markers that can foretell poor clinicopathological features beyond standard imaging modalities (CT or MRI) may be helpful in treatment planning for patients with HCC (summarized in n = 10 genes) and another for prognosis (n = 8). The former was also valuable in predicting tumor burden and poor outcomes [EM were less explored than mutations in HCC. EM were usually single-gene-based, such as LINE1, TFPI2, IGFB7, or small panels  ,87,88. Ioutcomes .Genomic biomarkers have not been studied to predict the response to common LRTs performed for HCC such as TACE, TARE, SBRT, or systemic therapy (ICI and TKI). Very few studies have explored this area of HCC management and are summarized in Sefriouri et. al studied the change in MAF of TERT mutations and cfDNA levels from baseline, post-TACE (day 2), and one month later . They reNakatsuka et al. reported that higher baseline cfDNA levels were an independent negative risk factor among HCC patients receiving LRTs (TACE and RFA) and systemic therapy (TKIs and ramucirumab) . InteresHCC is rising in incidence and overall outcomes remain poor. Despite having robust screening procedures in place, patients are often diagnosed in advanced stages with limited effective treatment options. A lack of reliable biomarkers that could improve current POR and predict or monitor the response to LRT and ST presents a clinical challenge for patients and treating physicians alike. One promising area of interest involves the use of cfDNA testing; however, serial improvements are needed before widespread use. Early reports of EM are promising and should be further explored on how to best incorporate it in current practice (summarized in"}
+{"text": "Frontiers in Nutrition Research Topic aimed to address various issues related to the robustness of nutritional science, from methodological issues with field-specific research and counseling, to managing conflict of interest and problems with scientific decision making in public health nutrition. Our Research Topic gathered 30 authors from North America, Europe and Asia that provided a mix of original research, review and perspective papers that timely suit co-editors invitation, exploring topics in nutritional epidemiology, food policy and economics, and nutritional methodology. Addressing the aforementioned topics holds the potential to fortify evidence-based knowledge within the realm of human nutrition as a scientific field, and perhaps pave the way for the establishment of elevated scientific standards and a heightened sense of public responsibility, echoing the sentiments expressed by Ioannidis  delved into the international research landscape of the past decade concerning vitamin D and its implications on reproductive health. The researchers meticulously analyzed over 1,800 articles and reviews, revealing a significant diversity in terms of represented subdisciplines, authors' backgrounds, research frontiers, and the quality of peer-reviewed journals where these papers were disseminated. While the field of study has garnered substantial global attention, it has displayed an uneven progression, marked by multidisciplinary research hotspots primarily focusing on risk factors and detrimental consequences of vitamin D deficiency. Nevertheless, the report emphasizes the need for more robust investigations. Specifically, it suggests delving into the heterogeneity of vitamin D deficiency across populations, enhancing the utility of vitamin D-related biomarkers, and adopting a mechanistic approach to scrutinize the effects of vitamin D on health indicators. This significant report reiterates the call for the design of more comprehensive cause-and-effect studies within the realm of nutritional sciences. Furthermore, it underscores the importance of embracing personalized approaches, aligning with previous views of Bassaganya-Riera et al. . Through collaborative efforts involving federal and public stakeholders, as well as expert groups, and the meticulous execution of systematic reviews, NESR has emerged as a pivotal initiative in informing evidence-based decisions by the U.S. government concerning public health nutrition. This encompasses pivotal contributions to the development of the Dietary Guidelines for Americans. The article also underscores the imperative need for other organizations to contemplate adopting a similar approach, perhaps modeled after NESR, to ensure a collaborative process that adeptly addresses potential or perceived conflicts of interest among all stakeholders involved.Another review article within this Research Topic look into the systematic review process of the U.S. Department of Agriculture's Nutrition Evidence Systematic Review Branch (NESR), exemplifying the utilization of a diverse range of expertise and experiences while effectively managing potential conflicts of interest  and randomized-controlled trials may offer a more favorable strategy for generating pertinent insights into the intricate interplay between nutrition and health.A thought-provoking perspective article by Ko et al. investigated the reliability and validity of the Korean version of the Children's Eating Behavior Questionnaire (K-CEBQ) for children with anorexia. This parent-reported measure is designed to assess variations in eating style, and the researchers conducted two rounds of the study, surveying over 350 participants online. They demonstrated good internal consistency reliability and temporal stability of the K-CEBQ, indicating its reliability for assessing the eating behavior of children with this eating disorder. The paper also calculated the optimal cut-off values for the two category scores of the K-CEBQ, food approach and food avoidance. This provides a practical tool for healthcare professionals that could aid in diagnosing children with anorexia and assessing their treatment progress. The article emphasizes the need for future studies to consider other confounding factors (besides age and gender) that may influence anorexia features in children.Finally, a research paper by The current Research Topic offers a comprehensive overview of advancements in the realm of scientific integrity within nutritional research, advocating for a robust and practical approach from both clinical and public health standpoints. By adopting optimal strategies for research data generation and analysis, while also embracing a personalized approach such as precision nutrition, and considering diverse diet-specific neuro-psychological factors, the field can be revitalized. This rejuvenation holds the potential to bolster public policy, shed light on the broader population, and ultimately contribute to a more informed and healthier society.SO: Writing\u2014original draft. N\u00d8: Writing\u2014review & editing."}
+{"text": "Disruptive and aggressive behavior is frequent in patients with a psychotic disorder; furthermore, it is a recurrent reason for compulsory admission. Even during treatment, many patients continue to show aggressive behavior. Antipsychotic medication is posed to have anti-aggressive properties; its prescription is a common strategy for the treatment (and prevention) of violent behavior. The present study aims to investigate the relation between the antipsychotic class, according to the dopamine D2-Receptor binding affinity , and aggressive events perpetrated by hospitalized patients with a psychotic disorder.We conducted a four-year retrospective analysis of legally liable aggressive incidents perpetrated by patients during hospitalization. We extracted patients\u2019 basic demographic and clinical data from electronic health records. We used the Staff Observation Aggression Scale (SOAS-R) to grade the severity of an event. Differences between patients with a \u201cloose\u201d or \u201ctight-binding\u201d antipsychotic were analyzed.X2\u2009=\u200919.687; p\u2009<\u20090.001). There were no demographic or clinical differences between the groups and no differences regarding dose equivalents or other prescribed medication.In the observation period, there were 17,901 direct admissions; and 61 severe aggressive events . Patients with a psychotic disorder perpetrated 51 events , with an OR of 15.85 (CI: 8.04\u201331.25) compared to non-psychotic patients. We could identify 46 events conducted by patients with a psychotic disorder under medication. The mean SOAS-R total score was 17.02 (2.74). The majority of victims in the \u201cloose-binding\u201d group were staff members , while the majority of victims in the \u201ctight-binding\u201d group were fellow patients ; (In aggressive behaviors conducted by patients with a psychotic disorder under antipsychotic medication, the dopamine D2-Receptor affinity seems to have a high impact on the target of aggression. However, more studies are needed to investigate the anti-aggressive effects of individual antipsychotic agents. Although violence and aggression are not easy to define and delimit; they are understood as the intentional use of physical force, verbal or non-verbal abuse or threats against another person that either result in (or has a high likelihood of resulting) injury, death, or psychological harm , 2. The In mental disorders, violence and aggression are common in patients with a psychotic disorder , 5. FurtViolence and aggression in psychiatric wards pose a great challenge for treatment and a juristic liability for service providers. Moreover, aggressive events during hospitalization are detrimental for everyone involved. Not only because they pose a risk for injury (and even traumatization) for the victims but also because they have adverse effects on the perpetrators, including the use of force for involuntary medication, isolation or restraint . TherefoIt is claimed that psychiatric medication, particularly individual antipsychotic agents, have an anti-aggressive effect \u201313. For This study aimed to analyze the relationship between antipsychotic medication and aggressive behavior in (medicated) patients with a psychotic disorder using a retrospective, explorative design. In particular, we analyzed the relationship between the type of pre-existing antipsychotic medication and the characteristics of the aggressive event. Unfortunately, inconsistent definitions and delimitation of violent and aggressive behavior make comparison and generalization difficult . TherefoThe current study is a retrospective analysis of the characteristics of aggressive events perpetrated by adult  patients with a psychotic disorder during their hospitalization in a psychiatric ward of the Department of Psychiatry, Psychotherapy and Psychosomatics of the University Hospital of Psychiatry Zurich. For all patients admitted between January 2018 and December 2021, we reviewed the clinical incident system and extracted their demographic and clinical data from the electronic medical record.The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of the Canton of Zurich (BASEC-Nr. 2021\u2009\u2212\u200901246). Patient consent was waived due to approval by the Ethics Committee of the Canton of Zurich.The University Hospital of Psychiatry Zurich is a public hospital with a service mandate for psychiatric care covering a mixed urban and rural region of approximately 500,000 inhabitants. It offers in- and outpatient treatment for adults with a psychiatric disorder. Since the definition and operationalization of violence and aggression in the medical field are heterogeneous, we decided to use the definition as it is anchored in Swiss legislation . Furthermore, due to legal and liability requirements, all such events are monitored and systematically reported to a clinical incident system.For analysis, we included basic demographic data . Diagnoses were made using the WHO ICD-10 diagnostic criteria; we included the Health of the Nation Outcome Scale (HoNOS); and the Staff Observation Aggression Scale (SOAS-R) in its revised version.The main diagnosis was made during hospitalization according to the ICD-10 diagnostic criteria by the treating physician or psychologist and confirmed by a board-certified psychiatrist. For the analysis, we included all diagnoses with psychotic features since these diagnoses exhibit a clear indication for the prescription of an antipsychotic drug. Therefore, diagnoses of interest included: schizophrenia (F20); delusional disorder (F22); brief psychotic disorder (F23); schizoaffective disorder (F25); mania with psychotic features (F30.2); and bipolar disorder with psychotic features, either manic (F31.2) or depressive (F31.5) episode. Existing comorbid diagnoses of substance use disorder were also made according to the ICD-10 criteria. . For the analysis the following substances were included alcohol use disorder (ICD-10: F10); opioid use disorder (ICD-10: F11); cannabis use disorder (ICD-10: F12); benzodiazepine use disorder (ICD-10: F13); cocaine use disorder (ICD-10: F14); and stimulant use disorder (ICD-10: F15).The Health of the Nation Outcome Scales (HoNOS) is a measurement instrument used to assess the severity and treatment requirements of patients with a psychiatric disorder; it has become a widely used evaluation tool, and in some countries, it is a mandatory outcome measure. The HoNOS evaluates 12 domains covering behavior, symptomatology, impairment, and psychosocial functioning. Each item is rated on a five-point Likert scale from 0 (\u201cno problem\u201d) to 4 (\u201csevere to very severe problem\u201d). We evaluated the HoNOS at scale level  \u201321. FurtThe Staff Observation Aggression Scale-Revised Version (SOAS-R) was developed to measure the nature and severity of aggressive events ; it has The first domain of the SOAS- R appraises whether there was a provocation leading to the aggressive event, it is scored from 0 to 2 points. A score of zero (\u201c0\u201d) indicates that the event was provoked through waiting, receiving help in daily activities, or the patients being denied something or provoked by other patients. A score of one (\u201c1\u201d) is given if there is no obvious or understandable provocation; a score of two (\u201c2\u201d) is given if the event is provoked through the request or instruction of the staff .The second domain rates the means used by the patient and can be scored from 0 to 3 points. A score of zero (\u201c0\u201d) indicates verbal aggression or threats. A score of one (\u201c1\u201d) is given if aggressive events involve the use of ordinary non-dangerous objects . A score of two (\u201c2\u201d) is given if there is bodily aggression . Finally, a score of three (\u201c3\u201d) is given if weapons, dangerous objects, or methods are used .The third domain rates the target of aggression scored from 0 to 4 points. A score of zero (\u201c0\u201d) is given if there is no target of aggression. A score of one (\u201c1\u201d) is given if the target of aggression is an object . If the aggression involves other patients, a score of two (\u201c2\u201d) is given. A score of three (\u201c3\u201d) is given if the target of aggression are staff members . Finally, a score of four is given if the targets of aggression are visitors or strangers to the ward .The fourth domain rates the consequences for the victim(s); it is scored from 3 to 9 at three-point intervals . Zero (\u201c0) represents no harm or damage. Three (\u201c3\u201d), the object was damaged. Six (\u201c6\u201d) of the affected person(s) felt threatened. Finally, nine (\u201c9\u201d), there was an injury or pain requiring treatment.The fifth and last domain rates the measures used to stop aggression, with a score between 0 and 4 in two-point intervals . A score of zero (\u201c0\u201d) is given if talk down is sufficient and no other measures are necessary. A score of two (\u201c2\u201d) points is given if medication  is given; or if the police have to be involved. Finally, a score of four (\u201c4\u201d) is given if the use of force is necessary for seclusion/isolation or restraint.Antipsychotic medication was characterized according to their action on the dopamine D2 receptor affinity into two categories  or mood stabilizers . We calculated the Daily Defined Dose for each prescribed psychopharmacological agent and the Chlorpromazine Equivalents for the prescribed antipsychotic drugs. Only medication continuously taken in the past three days was considered. In case of changing doses, the higher dose was chosen. If patients took a combined antipsychotic therapy of a loose binding and tight binding antipsychotic they were grouped into the group of the agent with the higher CPZ-equivalent dose.The demographic and clinical characteristics of the sample were analyzed using descriptive statistics; results are presented with mean (standard deviation) and proportions. In the first step, the sample was classified according to the type of prescribed antipsychotic drug in \u201cloose binding\u201d or \u201cthigh binding.\u201d Differences between both groups were analyzed: we used non-parametric testing  for continuous variables, with the Mann-Whitney U for independent samples. For differences in proportions, Chi-Square tests were used. For positive results, a subsequent Chi-Square omnibus comparison for the different subcategories was performed if pertinent. We calculated the correlation between the antipsychotic groups and the characteristics of the aggressive events. For differences found between the groups, we calculated their probabilities and their relationship with demographic and clinical variables using the general linear model. All tests were performed two-sided, with an alpha level of p\u2009<\u20090.05. Since the study was designed exploratively, adjustments for multiple comparisons were not made. The analysis was performed in the R environment (version 4.2.1).In the observation period, there were 17,901 direct admissions; of those, 4,394 had a diagnosis of interest for the analysis, and there were 61 critical incidents involving aggressive behavior by patients, leaving an incidence of 3.4 events for every 1,000 admissions. Patients with a psychotic disorder perpetrated 51 of the aggressive events, resulting in an incidence of 2.90 for every 1,000 admissions year. Patients with a psychotic disorder (or a disorder with psychotic features) had an OR of 15.85 (CI: 8.04\u201331.25) for perpetrating a severe aggressive event compared to non-psychotic patients. For the final analysis, five patients with a psychotic disorder did not have any medication at the time of the event and were therefore excluded from further analysis. This resulted in a final sample size of 46 patients with a psychotic disorder that perpetrated a severe aggressive event.The mean age of the patients included in the sample was 33.9 SD 12.8) years; the majority were male . Over two-thirds  of patients had a compulsory admission order. Most patients had over ten previous hospitalizations, 11.9 (16.6) with a right skewed distribution . Diagnoses of alcohol and substance use were recorded, the most frequently consumed (abused) substances were: cannabis ; cocaine ; alcohol ; and opioids ; the consumption of benzodiazepines and stimulants were both below 10%. The HoNOS score at admission was 26.59 (6.93). For further details, see Table\u00a0.8 years;Two-thirds  of patients had an antipsychotic monotherapy. Another third (32.6% n\u2009=\u200915) had a combination of two antipsychotic medications. There were 66 prescribed different antipsychotic medications, either as monotherapy or in combination. The most prescribed medication as either monotherapy or combination was olanzapine , followed by risperidone , paliperidone ; and quetiapine . The majority of patients with monotherapy had olanzapine , followed by risperidone  and paliperidone . The most prescribed Long Acting Injectable was Paliperidone (n\u2009=\u20098); with just one patient prescribed Risperidone. The Daily Defined Dose (DDD) of antipsychotics was 1.80 (1.05), with 654.72 (498.26) Chlorpromazine Equivalents. For further details, see Table\u00a0In 19 (41.3%) of all patients, an augmentating mood stabilizer was prescribed. In half of the patients them (52.6% n\u2009=\u200910) the mood stabilizer was prescribed in addition to an antipsychotic monotherapy. The most prescribed medication for augmentation was valproate ; lithium  was marginally prescribed, and other augmentation strategies were not recorded. Over half of patients  were prescribed a benzodiazepine. The most frequently prescribed benzodiazepine was lorazepam , followed by diazepam ; alprazolam and oxazepam were prescribed in three (10.7%) patients each. The DDD of anxiolytics was 1.15 (2.19); the DDD of mood stabilizers was 0.46 (0.70). The total DDD of psychopharmacologic drugs was 3.42 (2.52).The time elapsed from admission to the aggressive event was 21.7 (27.7) days. The majority  of events occurred during the daytime. The SOAS-R total score was 17.02 (2.74). For the majority  of patients, the aggressive behavior did not have an obvious provocation. The means of aggression were mostly physical aggression  or objects used as weapons . The majority of victims of the aggression were either staff  or other patients ; most of the victims had injuries  or felt threatened . In almost all cases , force had to be used to stop aggression.Of the 46 patients included in the analysis, 26 (56.5%) had a prescribed \u201cloose binding\u201d antipsychotic drug , and 20 (43.5%) had a \u201ctight binding\u201d antipsychotic drug . There was no difference between the \u201cloose binding\u201d and \u201ctight binding\u201d groups regarding age ; sex . There was also no difference in alcohol or substance consumption: Cannabis ; Cocaine ; Alcohol ; and Opioids . There were also no differences regarding compulsive admission , the number of past admissions , the HoNOS at admission was similar : without any difference at subscale or item level. There were also no differences in length of stay ; time to the aggression .There were also no differences regarding antipsychotic monotherapy between the \u201cloose binding\u201d and \u201ctight binding\u201d ; combination ; augmentation . The most frequent combination was with an antipsychotic from the opposite group . There were no differences between the groups using long-acting injectables (either as monotherapy or combination) (p\u2009=\u20090.15). There were no differences regarding the agents used for augmentation (p\u2009=\u20090.10) or the rate of prescribed anxiolytics (p\u2009=\u20090.27). There were no differences regarding DDD of antipsychotic drugs ; Chlorpromazine Equivalents . There was no difference for the DDD of anxiolytics ; or the DDD of mood stabilizers . There was also no difference in the total DDD of psychopharmacologic drugs . For further details, see Table\u00a0X2 \u2009=\u200919.687; p\u2009<\u20090.001), and the results remained stable after Chi-Square omnibus testing for each category . There were no differences regarding the consequences for the victims (p\u2009=\u20090.31) or the means used to stop aggression (p\u2009=\u20090.96). For further detail, see Table\u00a0Regarding the SOAS-R, we could not find differences in total score . There were also no differences regarding the provocation for the aggressive behavior (p\u2009=\u20090.31); the means of aggression were also identical (p\u2009=\u20090.39). The majority of victims of the aggression in the \u201cloose binding\u201d group were staff members , while in the \u201ctight binding\u201d agents, the most frequent victims of aggression were other patients . This difference reached statistical significance (The Odds Ratio for an aggressive event against other patients with a \u201ctight binding\u201d antipsychotic drug was 22.3 (CI: 4.8\u2013167.0). Inversely the risk for an aggressive event against a staff member for a \u201cloose binding\u201d antipsychotic drug was 10.86 (CI: 2.91\u201349.4). In a confirmatory analysis including the combination of \u201cloose binding\u201d and \u201ctight binding\u201d antipsychotics as an additional category, the relationship between the D2 binding antipsychotic and the target of aggression remained stable; however, for the case of the combination of both classes of antipsychotics the relation was inconclusive . However, in this approach the actual dose and more important the Chlorpromazine Equivalents of each antipsychotic medication were not considered.Through the general linear model analysis, we could not find any demographic , clinical , pharmacological , or service use ; triggers (SOAS-R Item-1); and characteristics of the aggressive event (remaining SOAS-R Items) variables modifying the relationship between the type of antipsychotic drug and the target of the aggression.The study was designed to analyze the relationship between the type of pre-existing antipsychotic medication and the characteristics of the aggressive event.While it is known that there are anti-aggressive effects of antipsychotic medication in general and of clozapine in particular , 15, to The numbers of severe aggressive events during hospitalization are generally low; in the observation period, there were a total of 61 events (in 17.901 direct admissions); however, over 80% of the events are accountable to patients with a psychotic disorder; within these the majority with schizophrenia, and a few with a bipolar disorder. Most events were perpetrated through patients with a psychotic disorder, in the majority despite antipsychotic medication being initiated.The severity of recorded events (mean SOAS-R of 17.02 (2.74)) was higher in our sample of psychotic patients than in a general sample from adult psychiatry in Germany reporting a mean SOAS-R of 11.79 (1.08) in patients with schizophrenia spectrum disorder .Several factors contribute to aggression development and escalation, reflecting the difficulty of predicting aggression. Recent studies indicated that the most important predictor of physical violence, including while in a psychiatric institution, was a history of aggressive behavior in combination with male gender , 30, 31.In our sample, the time elapsed from admission to the aggressive event was 21.7 (27.7) days. Therefore, we consider that factors related to the length of stay could have triggered the aggressive event, therefore in our analysis we controlled for triggers (SOAS-R Item 1); time to event and length of stay.\u2019 subjective well-being also had no conclusive findings [In our sample, for patients with a \u201cloose binding\u201d antipsychotic medication, aggression was mainly directed at staff members. In contrast, for those with a \u201ctight binding\u201d antipsychotic medication, the victim of aggression was largely another patient. We intended to interpret these striking differences in the target of aggression with dynamic aspects. However, the triggers and characteristics of the aggressive events were somewhat similar; we were also unable to find interaction effects related to the targets of aggression. Studies investigating the relationship between the antipsychotic affinity for dopamine D2 receptors and patientsfindings . Patientfindings . The impIn our sample, the most prescribed drugs were olanzapine and risperidone/paliperidone, overlapping with the current prescription praxis. The most commonly used second-generation antipsychotics were risperidone, olanzapine, clozapine, aripiprazole, and quetiapine , 37. In We limited our sample to patients with a psychotic disorder because the indication for antipsychotic medication is clearly stated for these patients . Since our analysis focused on the relationship of antipsychotics with aggressive events, these patients were required to take the prescribed antipsychotic medication. To further delimit the effects of antipsychotics, we included other prescribed psychoactive medications, such as mood stabilizers and anxiolytics, in the analysis. This approach led us to reduce the bias potentially derived from medication other than antipsychotics.This study is subject to several limitations. First, the modest size of our sample limits the generalizability of our results. Still, the sample only contains severe aggression events, which are by definition rare. Only legally liable events that have been registered in our clinical incident system could be analyzed. Second, due to the small sample size and low numbers of prescribed antipsychotics, we could not analyze single antipsychotic drugs or attribute a causality to the correlation found. The use of non-parametric testing was intended to overcome the limitations derived from the low sample size and increase the validity of the results. We used the general linear model to analyze the influence and interaction of the different factors. In the study period of four years, we registered 61 incidents for 17,901 0.34%) of all consecutive admissions; and 51 events in 4,394 (1.16%) perpetrated by patients with a psychotic disorder. Although desirable, the inclusion of a larger collection period was not possible since, for the time before January 2018, the collection of aggressive events was not systematically conducted. For a refined analysis, we also miss information that might play a role in aggressive behavior, like the kind and rate of adverse events or cognitive deficits. Third, following prior research [4% of allIn conclusion, our analysis uncovered a robust correlation between the antipsychotic medication prescribed and the focus of aggression in patients with a psychotic disorder. This result, especially its markedness, is astonishing and has potential clinical implications. Since our study is explorative, our results show a correlation, and we cannot derive causality from them. Therefore, we can merely speculate on the reasons for our findings. Nevertheless, the findings underscore the significance of vigilant clinical monitoring, particularly in regard to infrequent events. While our study did not provide definite answers, it paves the way for further inquiries and more refined questions.The study raises up the question if individual antipsychotic agents should be preferred with a view to cases where reducing aggressive behavior seems to be a primary aim of therapy. Therefore, a prospective randomized study comparing the use of different substances with regard to the occurrence of aggressive events is needed."
\ No newline at end of file