diff --git "a/deduped/dedup_0166.jsonl" "b/deduped/dedup_0166.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0166.jsonl"
@@ -0,0 +1,44 @@
+{"text": "Thymine-rich Insulin Response Element (TIRE). The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase). However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3) is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase), whose products are required for gluconeogenesis.Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK), glucose-6-phosphatase (G6Pase) and insulin-like growth factor binding protein-1 (IGFBP-1), is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression.These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents. Insulin-like growth factors (IGF-I and II) have a broad range of biological activities that include the stimulation of mitogenesis and differentiation, and insulin-like effects on glucose uptake and lipogenesis . These aStudies using inhibitors of PI 3-kinase have demonstrated a requirement for this enzyme in insulin regulation of IGFBP-1 . Indeed,In the present study, we have examined the role of GSK-3 in the regulation of a third TIRE-containing gene promoter, namely IGFBP-1. We demonstrate that four different classes of inhibitors of GSK-3 can mimic the action of insulin and reduce IGFBP-1 gene expression. Furthermore, we find that inhibition of GSK-3 reduces the activity of a heterologous promoter containing the IGFBP-1 TIRE, and propose that this mechanism underlies the repression of all three promoters by inhibitors of GSK-3. Finally, we demonstrate for the first time a requirement for inhibition of GSK-3 in the insulin regulation of the TIRE, and hence IGFBP-1 expression.in vivo, reduces both basal and glucocorticoid-induced IGFBP-1 gene expression . Importin vitro -ethylamino}-nicotinonitrile) was synthesized in 7% overall yield using a convergent approach from 2,4-dichlorobenzoyl chloride and 6-chloro nicotinonitrile respectively -5-(4-methyl-1ctively ( and refsThe rat hepatoma cell line H4IIE was maintained in Dulbecco's Modified Eagle's medium (DMEM) containing 1000 mg/l glucose, 5% (v/v) foetal calf serum, as described previously . Cells wH4IIE cells were serum-starved overnight and treated with hormone/inhibitor for the times and at the concentrations indicated in the figure legends. Total cellular RNA was isolated using TriReagent\u2122 (Sigma) following the manufacturer's instructions. An RNase Protection Assay (RPA) was performed to determine the relative amounts of IGFBP-1 and cyclophilin mRNA in each sample . Band inH4IIE cells were incubated in serum-free medium with hormones and inhibitors for the times and at the concentrations indicated in the figure legends. Cells were then scraped into ice-cold lysis buffer  Triton X-100, 10 mM sodium pyrophosphate, 1 mM benzamidine, 0.1 mM PMSF, 0.27 M sucrose, 2 \u03bcM microcystin and 0.1% (v/v) 2-mercaptoethanol). Cell debris was removed by centrifugation at 13000 \u00d7 g for 5 min and the protein concentration determined by the method of Bradford, using BSA as an internal standard.Antibodies to phospho ribosomal protein S6 (Ser-235), phospho-FKHR-L1 (Thr-32) and GSK-3\u03b2 were purchased from Upstate , while the phospho-specific Ser9/Ser21 GSK-3, Thr-308 PKB, Thr389-S6K1, and Thr-183/Tyr185 p42/p44 MAPK antibodies were purchased from Cell Signalling Technologies . H4IIE cell lysates were prepared following incubation with hormones as described in figure legends and analysed by Western blot analysis.GAAACTTCTTTTG) produces a mutant promoter (BP-1 DM5) that is no longer responsive to insulin [The plasmids BP-1 WT and BP-1 DM5 were a gift from Dr Robert Hall and Professor Daryl K. Granner  . The BP- insulin . The FOXThe TOPflash reporter plasmid kit were obtained from Upstate Biotechnology . TOPflash has Tcf binding sites driving luciferase expression. Tranfections were performed using the calcium phosphate procedure as described previously . H4IIE c8 and 109 plaque forming units per ml, incubated at 37\u00b0C for 16 hr. Cells were then transfected with 10 \u03bcg of BP-1 WT as described above and incubated for a further 24 hr in the presence or absence of 10 nM insulin. Luciferase was harvested and assayed or cell extracts were prepared for western blot analysis, as described earlier.H4IIE cells were infected with virus between a titre of 10As a measure of statistical significance of differences in experimental groups, student t-tests were performed and 5% confidence limits applied.G6Pase, glucose 6-phosphatase; IGFBP-1, IGF-binding protein-1; phosphatidyl inositol 3, kinase, PI 3-kinase; TIRE, thymine rich insulin response element; PKB, protein kinase B; PEPCK phosphoenolpyruvate carboxykinase; GSK-3, Glycogen synthase kinase 3The majority of the data was obtained in equal measure by D.F. and S.P, the CHIR99021 was synthesised, purified and analysed by N.S. and R.M., the adenoviral vectors were produced and characterised by L.M.D. and C.J.R., while the project was conceived and supervised by C.S."}
+{"text": "Sporothrix schenckii implicated hay initially distributed through a commercial hay supplier as the source of the outbreak. Declining infection rates have occurred after various community measures were instigated.A cluster of sporotrichosis cases occurred in the Busselton-Margaret River region of Western Australia from 2000 to 2003. Epidemiologic investigation and mycologic culture for  Sporothrix schenckii. It predominantly causes subacute to chronic subcutaneous infection, which occurs when the fungus enters small breaks in the skin . The remaining patient had contact with hay grown on his property. Seven of the 9 persons with cases linked to hay exposure had used the hay for domestic gardening; the other 2 patients were exposed to hay used for commercial farming. Patients 10 and 11 were children who played together in hay purchased from outlet 1 before the onset of symptoms of sporotrichosis. Patients 1 and 3 had no documented hay exposure; sporotrichosis developed after a camping trip and after gardening, respectively.Nine case-patients were initially treated with oral antimicrobial agents for a presumed bacterial infection. Because of a lack of clinical response, wound swabs or biopsy specimens were obtained. Sporotrichosis was subsequently diagnosed, and antifungal therapy was then begun. Four patients required inpatient treatment for 1 of several reasons: initially to receive intravenous antimicrobial agents before the diagnosis, to undergo debridement surgery and biopsy, or to treat complications related to therapy. Ten of the 11 patients received oral itraconazole; 1 of these patients also received a saturated solution of potassium iodide, and 1 patient ceased oral antifungal therapy because of severe side effects. One of the 11 received only a naturopathic remedy.When hay was implicated as a likely source, local environmental health officers visited commercial hay outlets in the area to assess procurement, storage, and distribution practices. Fifty hay samples were collected from around the BMR region for mycologic culture. Sixteen samples were from properties associated with 6 of the cases, 9 from the 2 commercial hay outlets, 7 from a farm that supplied hay to a commercial outlet, and 18 from other properties in the BMR region not associated with the outbreak (control samples).Ophiostoma\u2013Sporothrix complex was performed on a portion of each hay sample. Isolates were examined for morphologic features and analyzed by pulsed-field gel electrophoresis (PFGE) . Using ITS sequencing, de Beer et al.  was used, these isolates had ITS2 sequences that conform to the clinical group noted by de Beer et al. . Each of these 3 patients had purchased hay from the same commercial hay outlet (outlet 1). One of the hay samples from outlet 1 was also culturally positive for S. schenckii clinical group. These 4 isolates had identical ITS2 sequences and morphologic features that were similar to all our patient isolates available for testing (the patient 5 isolate was not available). S. schenckii  was not isolated from any of the control hay samples, although other members of the Opiostoma\u2013Sporothrix complex were isolated in many environmental samples.Of the 6 case-patient\u2013related properties from which environmental samples were taken , 3 had aThe epidemiologic aspect of our study implicated contaminated hay as the source of an outbreak of sporotrichosis in the BMR region. Exposure was documented for 9 of the 11 case-patients. Most patients described contact with hay during gardening. Eight patients had contact with hay purchased at commercial suppliers in the Margaret River region.S. schenckii, as was a sample from a commercial hay supplier that had supplied hay to these properties. None of the control samples or samples from a farm that supplied hay to this hay supplier showed S. schenckii  on mycologic culture.Mycologic culture of hay samples confirmed that the hay was a possible source of infection. Half of the case-related properties tested were culture positive for the clinical strain of Ophiostoma\u2013Sporothrix complex tested from our survey and from eastern states\u2019 clinical isolates. Therefore, the epidemiologically implicated hay from the commercial hay suppliers was considered the likely source of the regional outbreak.All Western Australia clinical isolates tested\u2014including the BMR outbreak isolates, the isolates from the hay supplier, and 3 case-related hay samples\u2014are indistinguishable by ITS2 sequencing and PFGE. These isolates differ from the environmental isolates of the This finding prompted intervention in the community. Commercial hay suppliers cooperated by destroying any moldy hay on their properties and storing hay awaiting sale on rubber matting under cover. Information about the diagnosis and management of the infection was distributed to general practitioners in the area, and general information was distributed to the community through various sources such as community newspapers. Since the initial outbreak of sporotrichosis in the BMR region, the infection rate has decreased . Further"}
+{"text": "Receptors for the Fc domains of IgG (Fc \u03b3 R) play a critical role in linking humoral and cellular immune responses. The various Fc \u03b3 R genes may contribute to differences in infectious and immune related diseases in various ethnic populations. Polymorphisms of Fc \u03b3 R mainly Fc \u03b3 R IIA, IIB, IIIA, IIIB have been identified as genetic factors influencing susceptibility to disease or disease course of a prototype autoimmune disease like Systemic Lupus Erythematosus (SLE). Activated and inhibitory Fc \u03b3 Rs seem to play an important role in the pathogenesis of SLE, in initiation of autoimmunity, the subsequent development of inflammatory lesions and finally immune clearance mechanisms. This review focuses on the role of Fc \u03b3 R polymorphism and their association with clinical manifestations and initiation of autoantibody production, inflammatory handling of immune complexes and disease development in SLE patients. Many cells feature membrane glycoproteins called Fc receptors (FcR) that have an affinity for the Fc portions of secreted antibody molecules. These receptors are responsible for the movement of antibodies across cell membranes and transfer of IgG from the mother to the fetus across the placenta. These receptors allow passive acquisition of antibodies by many cell types, including B and T lymphocytes, neutrophils, mast cells, eosinophils, macrophages, and natural killer cells. Engagement of antibody-bound antigens by the Fc receptors of macrophages or neutrophils provides an effective signal for the efficient phagocytosis of Ag-Ab complexes.There are many different Fc receptors. The poly-Ig receptor is essential for the transport of polymeric immunoglobulins (polymeric IgA and pentameric IgM) across epithelial surfaces. In humans, the neonatal Fc receptor (FcRn) transfers IgGs from the mother to the fetus during gestation and also plays an important role in the regulation of IgG serum levels. Fc receptors have been discovered for many of the Ig classes. There is an Fc \u03b3 receptor that binds to IgA, an Fc \u03b3 receptor that binds to IgE, and several varieties of Fc \u03b3 receptors  capable of binding IgG and its subclasses. The cross-linking of Fc receptors by binding of Ag-Ab complex results in the initiation of signal transduction cascades that results in phagocytosis or antibody-dependent cell mediated cytotoxicity (ADCC).\u201364\u20136]Fc \u03b3 RI (CD64), a high affinity receptor expressed on monocytes, macrophages, neutrophils, and dendritic cells, is comprised of isoforms IA and IB. Fc \u03b3 RI has a high affinity for monomeric human IgG1 and IgG3. Fc \u03b3 RI does not show genetic polymorphism. Fc \u03b3 RI, Fc \u03b3 RIIA, and Fc \u03b3 RIIIA are activating receptors, characterized by the presence of an immuno receptor tyrosine-based activation motif (ITAM). In contrast, Fc \u03b3 RIIIB is a GPI-linked receptor found only in humans and is thought to be a neutrophil specific decoy receptor able to bind IgG immune complexes without triggering activation. In the case of Fc \u03b3 RIIA, a receptor unique to humans, the ITAM-motif is present in the cytoplasmic tail of the receptor. The diverse functions of these activating receptors together regulate a large portion of antibody-dependant inflammatory processes and therefore will probably have an important role in autoantibody mediated damage in SLE.Fc \u03b3 RII (CD32) is a low affinity receptor present on phagocytic cells, B cells, and dendritic cells. Fc \u03b3 RII is comprised of isoforms IIA, IIB1, IIB2, IIB3, and IIC. Fc \u03b3 RIIA has two codominantly expressed alleles R131 and H131 and they exhibit significant population polymorphism, the 131-Arg (R131) allele binding IgG2 much less avidity than the 131-His (H131) allele. R/R 131 homozygosity has been associated with severe disease manifestations, renal involvement, and an early onset of disease in SLE patients. Since immune complex clearance is essential in SLE, Fc \u03b3. RIIA genes are thought to be important disease susceptibility factors for SLE, particularly lupus nephritis.6 It remaFc \u03b3 RIIB is an inhibitory receptor carrying an immuno receptor tyrosine-based inhibition motif (ITIM) in its cytoplasmic domain. Its isoforms Fc \u03b3 RIIB1 and Fc \u03b3 RIIB2 are encoded by the same gene, but show distinct cell type distribution and functions. Fc \u03b3 RIIB1 is exclusively expressed on B cells and, upon cross-linking with the B-cell antigen receptor (BCR) by IgG containing immune complexes (ICs), it acts as negative feedback regulator by inhibiting BCR-elicited activations signals. Alternative splicing of the first intra-cytoplasmic exon results in Fc \u03b3 RIB2, which is mainly expressed on macrophages, where it internalizes bout IgG-containing ICs enabling antigen presentation .9]9]Fc \u03b3 RIII (CD16) encodes a single polymorphic protein, which is expressed on Natural Killer (NK) cells and monocytes. It has two isoforms IIIA and IIB. The wild-type sequence at position 176 encodes a phenylalanine (176-F), whereas the polymorphic variant is 176-valine (176-V). This change results in increased binding of IgG1 and IgG3. Fc \u03b3 RIIIn both human and murine SLE, susceptibility allele has been mapped to intervals linked to the Fc \u03b3 RII gene on chromosome I and it has been hypothesized that the Fc \u03b3 RIIB promotor polymorphism may possibly predispose through germinal center B cells abnormally down regulating Fc \u03b3 RIIB1 expression upon autoantigen stimulation and thus escaping negative signals for IgG production. The differential activity of Fc \u03b3 RIIB alleles suggests a novel mechanism of Fc \u03b3 RIIB regulation that may influence the risk of autoimmune disease such as SLE. Results of genome wide linkage studies have suggested that the chromosomal region 1q23 is one of the strongest candidate regions for human SLE. Three Fc \u03b3 receptor II genes  and two Fc \u03b3 RIII genes (Fc \u03b3 RIII A and Fc \u03b3 RIII B) have been physically mapped to a region of approximately 200 kb at 1q23 and are considered to be candidate susceptibility genes for SLE.Fc \u03b3 RII A polymorphism studies in Brazilian patients with immune complex-mediated SLE nephritis also showed over expression of the R131 allele with a significant increase in Fc \u03b3 RII A-R 131 homozygosity. The skewed distribution of Fc \u03b3 RII A with the predominance of homozygous R/R 131 genotype observed in Brazilian patients with lupus nephritis emphasize its importance as a heritable risk factor for immune complex-mediated renal injury in these patients. GenotypiA meta analysis report in Thai, Chinese, and Japanese populations in patients with SLE with nephritis and without nephritis suggests that the Fc \u03b3 RIIA-V/F 158 polymorphism has a significant impact on the development of lupus nephritis where a comparison of patients with lupus nephritis with patients with non nephritis SLE revealed a significant over presentation of the low binding F158 allele among patients with SLE who developed renal disease. F/F homozygotes had the highest risk of renal disease as compared with V/V homozygous.312 A sin3Human Fc gamma receptors constitute a clustered gene family located on chromosome 1q23 that consists of Fc \u03b3 IIA, Fc \u03b3 IIB, Fc \u03b3 IIC, and Fc \u03b3 III B genes. Fc \u03b3 II B is unique in its ability to transmit inhibitory signals and recent studies have demonstrated a role for Fc \u03b3 II B deficiency in the development of autoimmunity as seen in cases of SLE. Genetic variations of Fc \u03b3 IIA, Fc \u03b3 IIA, and Fc \u03b3 IIIB and their association with clinical severity of the disease with SLE have been studied in Asian populations, but results are inconsistent. To examine the possibility that another susceptibility gene of primary significance exists within the Fc gamma receptor region and the association of these polymorphisms with clinical course of SLE needs to be elucidated from our large immunogenetically diverse population. Finally, a combination of defects in Fc \u03b3 IIA and IIIA were shown to be particularly deleterious, both in African American and Caucasian patients. However, the fact that only one defective variant is already associated with SLE indicates that these receptors have distinct functions in the development of autoimmunity.8 Recent In an independent, large, case-controlled replication study, the association between Fc \u03b3 RIIIA and SLE was found to be stronger than the association of Fc \u03b3 RIIA with SLE. The data for Fc \u03b3 RIIIA satisfy the recommendations for evidence of linkage, a demonstrated association in both family-based and independent case-controlled cohorts, and functional relevance to disease as recently outlined for the definition of a true genetic effect.18 It is Activating and inhibitory Fc \u03b3 receptors seem to play an important role in the pathogenesis of SLE, both in initiation of autoimmunity and in subsequent development of inflammation. Though the mechanisms underlying the initiation of autoimmunity are yet to be elucidated, the ensuring development and maintenance of inflammatory processes could potentially be influenced at the level of Fc \u03b3 receptors. Modulating Fc \u03b3 receptor signaling mechanisms could influence the response to immune complexes and the course of the disease, making Fc \u03b3 receptors a potential candidate for immunotherapy. Characterization of Fc \u03b3 receptor genotypes, in conjunction with other properties of the humoral immune response such as antibody subclass and complement status, may provide essential insights into vaccine effectiveness and disease risk."}
+{"text": "However, a third of the treated patients do not respond to this therapy. Thus, the search for biomarkers of clinical response to these agents is currently highly active. Our aim is to analyze the number and distribution of circulating monocytes, and of their CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets, in 35 MTX non-responder patients with RA before and after three and six months of anti-TNF\u03b1 treatment using multiparametric flow cytometry. The number of circulating monocytes in an age- and sex-matched healthy population was monitored as a control.This prospective work investigated the number of circulating monocytes, and of their CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets after three months of adalimumab plus MTX treatment that remained significantly increased at six months. In contrast, significant normalization of the numbers of circulating monocytes was found in responders at three months of adalimumab plus MTX treatment that lasts up to six months. CX3CR1 expression is increased in monocytes in non-responders. At three months of anti-TNF\u03b1 treatment the number of circulating monocytes and their subsets was associated with at least 80% sensitivity, 84% specificity and an 86% positive predictive value (PPV) in terms of discriminating between eventual early responders and non-responders.Non-responder patients with RA show an increased number of monocytes and of their CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets at three months of adalimumab plus MTX treatment, have a predictive value (with high specificity and sensitivity) in terms of the clinical response after six months of anti-TNF\u03b1 treatment in patients with RA.The absolute number of circulating monocytes and of their CD14 Dramatic improvements in the management of patients with rheumatoid arthritis (RA) have been achieved in the last two decades. The possibilities of controlling disease progression and joint destruction have greatly increased through the use of biological drugs with tumor necrosis factor alpha (TNF\u03b1) blockade activity ,2. In ad+highCD16-). The minoritarian subsets (10% of the circulating monocytes) are characterized by the expression of CD16 plus either high or low levels of CD14  [Monocytes are bone marrow-derived cells that mediate essential regulatory and effector functions in innate and adaptative immunity . Circulactively) . These tctively) -10. Monoctively) ,13.+highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets, might help predict the early therapeutic response to anti-TNF\u03b1 biological therapy. The number of CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ monocytes was prospectively investigated in patients with RA before initiation of anti-TNF\u03b1 therapy and during the first six months of anti-TNF\u03b1 treatment. Furthermore, and with respect to active naive RA patients and healthy donors, we investigated the pattern of circulating monocyte subsets in patients with active RA before starting treatment with adalimumab plus MTX. This allowed the potential link between the activity of the disease and the pattern of abnormality in this cellular compartment to be studied.Roughly, 20 to 30% of RA patients show unresponsiveness to anti-TNF\u03b1 biological therapy ,15. ThesThirty-five patients visiting the Immunology and Rheumatology Service at the Hospital Universitario Pr\u00edncipe de Asturias (HUPA) were enrolled in the study. All gave their informed consent to be included; the study was approved by the hospital's clinical ethics committee. Patients were studied in parallel with sex- and age-matched healthy controls.The entry criteria included patients who had: 1) a diagnosis of RA according to the 1987 revised European League Against Rheumatism (EULAR) criteria with an of age higher than 18 years [The exclusion criteria for this study included severe cardiovascular disease , hematopoietic, lung, hepatic or renal disorders not related to the RA, diabetes mellitus, active bacterial or viral infections, other autoimmune diseases, treatment with glucocorticoids, immunosuppressors or other drugs that interact with the immune system in the previous three months, treatment with steroids in the previous month, possible pregnancy or lactation during the six-month study period, simultaneous malignancy, malnutrition and congenital immunodeficiency.We also included in the study 13 patients who were age \u226518 years, had a diagnosis of RA according to the 1987 revised European League Against Rheumatism (EULAR) criteria [All patients were treated weekly for at least three months with 15 to 20 mg MTX  plus 20 mg folic acid the next day and adalimumab 40 mg every other week. Patients were also advised to take non-steroidal anti-inflammatory drugs at fixed doses during the study. All were monitored monthly for clinical and analytical tolerance to MTX and adalimumab treatment and at three and six months to assess clinical response and to undertake immunological studies. Disease activity was determined by the DAS28 score according to EULAR criteria and using a validated Spanish version of the Health Assessment Questionnaire (HAQ) . The cliThree peripheral blood samples were taken from each patient by antecubital venipuncture at baseline , at three months of treatment and at six months of treatment.Peripheral blood mononuclear cells (PBMC) were separated out by Ficoll-Hypaque  gradient centrifugation . They weFor immunofluorescent staining, fresh monocytes were incubated with a combination of fluorescein (FITC), phycoerythrin (PE), peridinin chlorophyll protein conjugate (PerCP), and Alexa Fluor-647-labeled monoclonal antibodies (MoAbs). The MoAbs were used in a four-color combination (FITC/PE/PerCP/Alexa Fluor-647): CX3CR1/-/CD14/CD16. Control studies with unstained cells and cells incubated with isotype-matched irrelevant FITC-, PE-, PerCP and Alexa Fluor-647-labeled MoAbs were performed for each experiment. For these procedures, anti-CD14 and anti-CD16 were purchased from Becton Dickinson  and anti-CX3CR1 purchased from MBL, Medical and Biological Laboratories Co., Ltd . Cell acquisition and four-color immunofluorescence analyses were performed using a FACSCalibur flow cytometer (Becton Dickinson) running CellQuest Pro (Becton Dickinson) and FlowJo software , respectively. In the FSC-SSC dot plot, a biparametric gate was drawn around the monocyte population. The absolute number of circulating monocyte subsets was calculated by the percentage of each subpopulation in peripheral blood determined by flow cytometry multiplied by the total number of monocytes per microliter measured by Beckman Coulter, Inc. .Variables with nominal scale are described using absolute and relative frequencies. The Kolmogorov-Smirnov test was employed to verify the normality of distribution of continuous variables. For univariate description of normally distributed clinical variables, mean values and standard deviation (SD) are given. The differences in demographic characteristics were assessed using Pearson's chi-squared tests, Fisher's exact test, Student's t-tests or ANOVA with Bonferroni post-hoc adjustment for multiple testing. The results of the immunophenotype studies were expressed as mean and the standard error of the mean (SEM). Comparisons among healthy controls, responders and non-responders at baseline, were carried out using the Kruskal-Wallis test or ANOVA test for different samples. We used a two-sided analysis of variance (ANOVA) with Bonferroni adjustment to evaluate longitudinal changes. To assess the value of baseline circulating monocytes and their different subsets as predictors of MTX treatment response at six months of follow-up, receiver operating characteristic (ROC) curve analyses were performed, and the respective areas under the curves (AUC) were determined as measures of overall performance. The best predictive cut-off value was defined as that which gave the highest product of sensitivity and specificity, positive predictive value (PPV) and negative predictive value (NPV). All analyses were performed using the Statistical Package for the Social Sciences . Significance was set at P < 0.05.Table +highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets were studied in all 35 MTX-treated patients before starting adalimumab plus MTX treatment, and again at three and six months.Next, we investigated the absolute number of circulating monocytes, and those of the CD14Figure +CD16-, CD14+highCD16+ and CD14+lowCD16+ subsets than healthy controls at baseline and all over the six months of anti-TNF\u03b1 treatment. However, significant differences between responders and non-responders appeared at three months and remained until the end of the study of adalimumab plus MTX treatment for CD14+CD16- and CD14+highCD16+ subsets. In contrast, the number of circulating CD14+lowCD16+monocytes was significantly increased in non-responder patients with respect to healthy donors and responders at baseline and along the six months of study. No significant differences were found between responders and healthy controls in the absolute number of CD14+CD16-, CD14+highCD16+ and CD14+lowCD16+ subsets at any time of the study but the CD14+lowCD16+ subset was significantly increased in responder patients at baseline.The non-responders also had significantly higher numbers of circulating monocytes and their CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ monocyte subsets in the patients and healthy controls. Responders and non-responders showed a significantly smaller percentage of CD14+highCD16- monocytes at baseline with respect to healthy donors but they showed a reverse pattern of response to anti-TNF\u03b1 treatment. Non-responders showed a progressive decrease of the percentage of CD14+hihCD16+ monocyte subset along the study period. In contrast, responders presented a progressive increase of the percentage of CD14+highCD16+ monocyte subset that reached healthy controls values at three months of adalimumab plus MTX treatment and was significantly higher with respect to non-responder at six months of treatment.Figure +highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets, with respect to clinical response to adalimumab plus MTX. At baseline, we did not find that these biological markers show significant predictive value of the early response to anti-TNF\u03b1 therapy  in terms of the clinical response after six months of anti-TNF\u03b1 treatment in patients with RA. Furthermore, the pattern of abnormal redistribution of circulating monocyte subsets is similar in naive and MTX-treated active RA patients.This work shows that the absolute number of circulating monocytes, and of their CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets after three months of treatment with adalimumab plus MTX, have a highly predictive value of the clinical response after six months of treatment identifying those patients with an early treatment resistance to this anti-TNF\u03b1agent.The treatment of RA patients with anti-TNF\u03b1 biological drugs has dramatically improved the prognosis of these patients. However, a third of the treated patients do not respond to this therapy ,15,21. TThe explanation of this observed relevance of circulating monocytes as biomarkers of adalimumab response in RA patients has been not established. However, our data support that the absolute number of the monocyte subsets play a role in the activity of the disease and in the response to adalimumab plus MTX. Our data show that the number and distribution of the monocyte subsets in naive and MTX treated active RA patients is similar. However, the treatment with MTX plus adalimumab discriminates two patterns of behavior of the monocytic compartment in RA patients. In adalimumab responders, the number of the circulating monocyte subsets normalize at three months of treatment and remain similar along the study period. In contrast, in non-responders the significant increase in the pre-treatment number of monocytes and of their subsets remains the same or even increases along the treatment. This heterogeneity in the behavior monocyte compartment cannot be ascribed to different activity of the disease because it was similar in both responders and nonresponders at the beginning of the treatment. Thus, adalimumab plus MTX treatment in responder patients is able to show an immunomodulatory effect with a drastic reduction in the number of the three monocyte subsets. Interestingly, in experimental models of RA, the depletion of circulating monocytes or synovial macrophages is associated with control of the joint inflammation and disease ,28. In aThe mechanisms of the therapeutic effects of anti-TNF\u03b1 on RA have not been fully established . It has +highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets, in terms of clinical response to adalimumab plus MTX treatment in patients with RA requires confirmation in large multicenter studies including patients belonging to different races. The analysis of this biomarker with other anti-TNF\u03b1 agents is also required. However, the number of monocytes, and of their CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets, in peripheral blood would appear to be a practical biomarker for predicting the response to adalimumab plus MTX in patients with RA.The observed predictive value at three months of the absolute number of circulating monocytes, and of their CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets at three months of anti-TNF\u03b1 treatment, have a predictive value in terms of the clinical response after six months of anti-TNF\u03b1 treatment in patients with RA. Indeed, non-responder patients with RA show an increased number of monocytes and of their CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets after three months of anti-TNF\u03b1 treatment. In addition, non-responders show progressive redistribution of the monocyte subsets as well as an increased expression of CX3CR1. Thus, the number of monocytes, and of their CD14+highCD16-, CD14+highCD16+ and CD14+lowCD16+ subsets, in peripheral blood would appear to be a practical biomarker for predicting the response to anti-TNF\u03b1 in patients with RA.In summary, this study shows that the absolute number of circulating monocytes, and of their CD147-AAD: 7-aminoactinomycin D; AUC: areas under the curves; DAS28: Disease Activity Score 28; DMARDS: disease-modifying antirheumatic drugs; EULAR: European League Against Rheumatism; FITC: fluorescein; HAQ: health assessment questionnaire; HUPA: Hospital Universitario Pr\u00edncipe de Asturias; IgG: immunoglobulin G; IL: interleukin; LPS: lipopolysaccharides; LR: likelihood ratio; MoAbs: monoclonal antibodies; MTX: methotrexate; NPV: negative predictive value; PBMC: peripheral blood mononuclear cells; PE: phycoerythrin; PerCP: peridinin chlorophyll protein conjugate; PPV: positive predictive value; RA: rheumatoid arthritis; ROC: receiver operating characteristic; RPMI: Roswell Park Memorial Institute m\u00e9dium; SD: standard deviation; SEM: standard error of the mean; TNF\u03b1: tumor necrosis factor alphaThe authors declare that they have no competing interests.MA-M, IS, AH and AP were responsible for the study conception and design. JC, MAS and JM were responsible for acquisition of data. AP, EC, FA and AT were responsible for analysis and interpretation of data. DD, LC and AS-A drafted the manuscript. DD and MA-M critically revised the manuscript for important intellectual content. LC and AS-A contributed to this study equally. All authors read and approved the final manuscript.Absolute number of circulating monocytes and of their subsets in untreated naive and MTX-treated active patients with RA and healthy controls. The absolute number (cells/\u03bcl) of circulating monocytes (panel A), CD14+highCD16- (panel B), CD14+highCD16+ (panel C) and CD14+lowCD16+ monocytes (panel D) of untreated naive and MTX-treated active patients with RA and of healthy controls, are shown as the mean \u00b1 SEM. * Significant difference between patients with RA and healthy controls.Click here for fileAbsolute number of circulating monocytes and of their subsets in untreated naive and MTX-treated active patients with RA and healthy controls. Panel A represents flow cytometry analysis of circulating monocytes from a representative patient. The percentage of circulating monocytes, CD14+highCD16- (panel B), CD14+highCD16+ (panel C) and CD14+lowCD16+ monocytes (panel D) of untreated naive and MTX-treated active patients with RA and of healthy controls, are shown as the mean \u00b1 SEM. * Significant difference between patients with RA and healthy controls.Click here for file"}
+{"text": "Visceral pain is experienced by 40% of the population, and 28% of cancer patients suffer from pain arising from intra- abdominal metastasis or from treatment. Neuroanatomy of visceral nociception and neurotransmitters, receptors, and ion channels that modulate visceral pain are qualitatively or quantitatively different from those that modulate somatic and neuropathic pain. Visceral pain should be recognized as distinct pain phenotype. TRPV1, Na 1.8, and ASIC3 ion channels and peripheral kappa opioid receptors are important mediators of visceral pain. Mu agonists, gabapentinoids, and GABAB agonists reduce pain by binding to central receptors and channels. Combinations of analgesics and adjuvants in animal models have supra-additive antinociception and should be considered in clinical trials. This paper will discuss the neuroanatomy, receptors, ion channels, and neurotransmitters important to visceral pain and provide a basic science rationale for analgesic trials and management. Normal individuals do not perceive signals emanating from their intestinal tract; however, enteric and extrinsic visceral afferents become hypersensitive in pain-processing disorders such as functional bowel syndromes or in diseases associated with inflammation such as inflammatory bowel disease and pancreatitis. Both inflammatory bowel disease and cancer-related metastases to viscera may produce persistent pain despite resolution of the underlying disease state . UnexplaVisceral pain accounts for 28% of cancer-related pain. It is often accompanied by other pains such as neuropathic or somatic pain. Visceral pain in cancer patients may also be the result of treatment complications or comorbid diseases . Causes This sensory system of the gastrointestinal tract consists of intrinsic (enteric) sensory afferents and extrinsic  afferents. The intrinsic system functions independently of the CNS. Neurons are directly exposed mechanical forces and the chemical environment which is unlike somatic afferents neurons. Enterochromaffin cells within the mucosa and enteroendocrine cells release serotonin, cholecystokinin, orexin, and leptin which modulates and regulates motor activity . The sub The vagus receives input largely from the mucosa and muscle enteric afferents as do the pelvic extrinsic afferents. Cell bodies of the vagus are found in the jugular and nodose ganglia; both ganglia are morphologically, biochemically, and functionally different from one another. Expression of ion channels and signal transduction are distinctly different between the two ganglia . Vagal s Extrinsic spinal visceral afferents located in the serosa and mesentery ascend to the thoracolumbar dorsal root ganglia with parasympathetic and sympathetic fibers . A large Second-order visceral afferents ascend the thoracolumbar spinal cord through the dorsal column to gracile and cuneate nuclei. As a result, an anatomical cervical midline myelotomy interrupts dorsal column secondary afferent neurotransmission and reduces visceral pain and nocifensive responses in animal with pancreatic and duodenal pain \u201336. Thir Several channels are important to visceral pain: transient receptor potential vanilloid-1 (TRPV-1), ASIC3 channels and sodium channels (Na) particularly those that are tetrodotoxin resistant (NA 1.8 and 1.9), and calcium channels. Certain receptors downmodulate pain: the gamma aminobutyric acid-B (GABA-B) channels, kappa and mu opioid receptors, and somatostatin receptors. These channels and receptors are potential targets for novel analgesics to treat visceral pain.The TRP family of ion channels is TRPV1, TRPV2, TRPV3, TRPV4, TRPM 8, and TRPA1. These channels are, in general, thermoreceptors found on poorly myelinated and nonmyelinated afferents arising from the dorsal root ganglia, nodose ganglia, and the CNS \u201346. TRP TRPV1 channels are highly expressed on visceral spinal afferents and colocalize with nerve growth factor receptor (trk-A). They are selectively expressed on peptidergic neurons (neurons which express CGRP and SP) , 45. TRPTRPA1 is highly expressed on primary visceral afferents and is important in visceral hypersensitivity . TRPA1 iPsalmopoeus cambridgei, and the sea anemone, Anthopleura elegantissima, contain ASIC inhibitors. The potassium sparing diuretic, amiloride, also inhibits multiple ASIC subtypes [ASIC family of ion channels is directly gated by protons as \u201cchemoelectrical transducers.\u201d Tissue acidosis with ischemia, fractures, tumor, and incisions activates ASICs at a pH below 7.4, particularly below 7.0 , 64. ASIsubtypes \u201374.ASIC channels are more important to visceral mechanicoreceptors sensory function than cutaneous afferent function , 75. ASISodium-gated channels can be divided into those which are tetrodotoxin sensitive (Na 1.1\u20131.7) and resistant (Na 1.8 and 1.9) . TetrodoVoltage-gated calcium channels have an alpha-1 subunit which forms the channel pore and alpha-2 delta subunit which facilitates alpha-1 traffic to membrane surfaces . There aOther calcium channels may also be involved in visceral hypersensitivity. Activation of T-type calcium channels subtype Ca (v) 3.2 on primary spinal visceral afferents has been associated with irritable bowel-like symptoms in an animal model. Symptom behaviors resolved when T-type calcium channels were blocked . In expeKappa and mu opioid receptors are found on visceral afferents \u2013116. DisThere are 3 subtypes of kappa receptors which inhibit afferent firing and visceromotor responses to noxious colorectal distention in animal models \u2013129. In Kappa receptors are also found on the vagus and nodose ganglia. The kappa agonist, asimadoline, has been reported to reduce satiety and enhance postprandial gastric volumes , 136. AsDAMGO and morphine are more potent in reducing acetic acid peritonitis in experimental animals when given intracerebroventricular than intraperitoneal. Morphine antinociception was only partially reversed by peripherally restricted mu receptor antagonists . MethylnThere is evidence that fentanyl significantly reduces visceromotor responses to a greater extent when kappa receptors are nonfunctional (kappa receptor gene \u201cknocked-out\u201d mice) . The comGamma aminobutyric acid receptor-B (GABA-B) is involved in modulating mechanicosensory traffic through the vagus and brainstem pathways. GABA-B receptors block mechanico-sensory input but do not modulate chemosensitivity. GABA-B agonists directly influence sensory input via binding enteric receptors or by way of activating inhibitory interneurons within the CNS , 152. BaN-Methyl-D-aspartate (NMDA) receptors are calcium channels activated by glutamate and are slowly desensitized once activated. These high-calcium permeable channels generate synaptic neuroplasticity, wide dynamic range neuronal responses, and gene expression within the CNS , 171. NMThere are 2 purinergic ion channels, P2X and P2Y. P2X is an ATP-gated channel, and P2Y is a G-protein couple receptor. ATP released by cell damage, from the sympathetic nervous system or extrinsic sensory neurons, binds to P2X. A subset of P2X channels (P2X3) were upregulated in extrinsic afferents neurons by inflammatory bowel disease . ATP relOctreotide blocks somatostatin-2 receptors (SST-2). Mesenteric afferent firing rates caused by ramping jejunal pressures in Wistar rats were blunted by octreotide . ReducedBradykinin activates mesenteric afferents by way of B2 receptors and by stimulating prostaglandin production , 198. ThProtein kinase A phosphorylates NMDA receptor subunit NR-1 and the transcription factor cyclic AMP (cAMP) response element binding protein (CREB). CREB upregulates the receptor for SP (neurokinin-1 receptor) , 206. CoClinical trials of specific analgesics for visceral pain are sparsely published. Visceral pain is included with somatic and nociceptive pain in most clinical trials; as a result, it is difficult to determine the appropriate drug choices for visceral pain as a phenotype. The fact that there are some differences between somatic and visceral pain neurotransmission, neurotransmitters, channels, and receptors suggests that there may in fact be real differences in responses to analgesics. The use of potent opioids for inflammatory bowel disease has been associated with higher morbidity and mortality which is not reported for various types of somatic pain . This maIt is unlikely that a single analgesic or targeted agent will significantly reduce most visceral pains since multiple neurotransmitters, channels, and receptors are responsible for visceral pain. Analgesics combinations are anticipated to be better than single analgesics , 219. AnGastrointestinal motility has been assumed to be a surrogate for gastrointestinal symptoms . For insAnother point is that selective visceral blocks and procedures  needed to complement medical management , 227\u2013229There is little doubt that central sensitization plays a role in maintaining visceral pain , 231\u2013233Paracetamol is a weak cyclooxygenase-2 inhibitor and a selective cyclooxygenase 3 inhibitor. It also increases brainstem serotonin neurotransmission, redirects beta-endorphin, and inhibits 5-HT 3 receptors which are pronociceptive \u2013237. ParNSAIDs are effective in reducing cancer pain in the dose-dependent fashion . HoweverNine percent of individuals with inflammatory bowel disease treated with NSAIDs deteriorate clinically and improve once the NSAID is discontinued. Loss of prostaglandin by the NSAID leads to microvascular dysfunction and sustained inflammation , 254.Opioids reduce pain; however, poor coping skills, depression, and catastrophization correlate better with dose than the degree pathology , 256. OpSustained release oxycodone significantly reduces chronic cancer-related visceral pain. In a multicenter prospective observational study involving 350 individuals with visceral pain, oxycodone reduced pain severity from a mean of 7 to a mean of 2.4 on a numerical rating scale  over a two-week period of time. Less than 5% of individuals continued to have severe pain at the end of 2 weeks . A smallCombinations of analgesics which include opioids have been reported in the management of visceral pain. In an animal model, blocking TRPV1 enhanced opioid antinociception . In a moThere is preclinical and some clinical evidence that adjuvant analgesics should be used early for visceral pain. The combination of a gabapentinoid plus opioid is a reasonable choice , 219. OcVisceral pain is mediated by unique peripheral and central pathways. Several ion channels TRPV1, Na 1.8 and ASIC3, and the kappa opioid receptor appear are particularly important to modulating pain. There are qualitative and quantitative differences in pain processing from somatic pain such that visceral pain should be considered a distinct phenotype. Drug development and treatment paradigms have to take this into consideration in cohort and randomized trials. This has been done successfully for the irritable bowel syndrome. Targeted agents are being developed to ion channels; it is unlikely that these targeted agents will produce less dysmotility than mu opioid receptor agonists. Ion channel blockers are likely to have only a modest benefit due to the multiplicity of ion channels involved in visceral pain and will have to be combined with other analgesics. There is evidence that targeted agents for TRPV1 channels improve opioid responses. Adjuvant analgesics such as the gabapentinoids are effective as single agents and should be considered early in the course of opioid therapy to prevent opioid-induced hyperalgesia and minimize opioid side effects by being \u201copioid sparing.\u201d Peripherally restricted kappa agonists are in development and should be combined with other analgesics and adjuvants in hope of improving pain control. Interventional procedures should be considered early to avoid chronic visceral pain poorly responsive to analgesics. Treatment algorithms have been developed for neuropathic pain based on multiple randomized trials. The same approach should be taken in the management of visceral pain."}
+{"text": "The crystal structure of the N-terminal domain (NTD) of YabA solved at 2.7 \u00c5 resolution reveals an extended \u03b1-helix that contributes to an intermolecular four-helix bundle. Homology modeling and biochemical analysis indicates that the C-terminal domain (CTD) of YabA is a small Zn-binding domain. Multi-angle light scattering and SAXS demonstrate that YabA is a tetramer in which the CTDs are independent and connected to the N-terminal four-helix bundle via flexible linkers. While YabA can simultaneously interact with both DnaA and DnaN, we found that an isolated CTD can bind to either DnaA or DnaN, individually. Site-directed mutagenesis and yeast-two hybrid assays identified DnaA and DnaN binding sites on the YabA CTD that partially overlap and point to a mutually exclusive mode of interaction. Our study defines YabA as a novel structural hub and explains how the protein tetramer uses independent CTDs to bind multiple partners to orchestrate replication initiation in the bacterial cell.YabA negatively regulates initiation of DNA replication in low-GC Gram-positive bacteria. The protein exerts its control through interactions with the initiator protein DnaA and the sliding clamp DnaN. Here, we combined X-ray crystallography, X-ray scattering (SAXS), modeling and biophysical approaches, with  The interaction between Hda, DnaN and ATP-bound DnaA, promotes the hydrolysis of ATP and the accumulation of inactive ADP\u2013DnaA  and small angle X-ray scattering (SAXS) of the full-length protein to derive a model of the YabA structure. The crystal structure of the NTD of YabA revealed an extended \u03b1-helix, four of which assemble into a helical bundle. We found that the CTD of YabA binds to a single Zn2+ ion with a zinc binding motif resembling known short Zn binding domains. Solution studies demonstrated that YabA is a tetramer in which the monomeric CTDs are separated from the tetrameric NTDs by a flexible linker resulting in an extended conformation. We then showed that the CTD is sufficient for interaction with either DnaA or DnaN. The interacting surfaces with DnaA and DnaN have been mapped within the CTD and unveil an atypical motif for binding to the \u03b2-clamp. Our study provides a structural explanation for the capacity of YabA to bind multiple partners, hereby defining a novel protein hub central to DNA replication in low GC Gram-positive bacteria.To gain insight into the mechanism by which YabA interacts with multiple partners to control DNA replication, we have combined the X-ray structure of the N-terminal domain (NTD) of YabA, yabA gene sequence was amplified from B. subtilis (strain 168) genomic DNA by polymerase chain reaction (PCR) and inserted into pET151/D-TOPO (Invitrogen) to generate the plasmid pET151-yabA. E. coli BL21 (DE3) cells (Invitrogen) carrying pET151-yabA were grown in LB medium (with ampicillin at 100 \u03bcg/l) at 37\u00b0C until OD600 = 0.6. Protein expression was induced with 1 mM isopropyl \u03b2-D-thiogalactopyranoside (IPTG) for 16 hours at 20\u00b0C. Cells were centrifuged and resuspended in buffer L ) with protease inhibitor tablet , lysozyme (Roche) and Dnase (Sigma-Aldrich). The cells were lysed by sonication and centrifuged at 16 000 g for 20 min. The soluble fraction was loaded on a HisTrap\u2122 5 ml column equilibrated with buffer A  and the protein eluted using a 0\u2013100% gradient of buffer B (buffer A + 500 mM imidazole). Fractions containing YabA were incubated with TEV protease in the presence of 0.5 mM dithiothreitol (DTT) and 0.5 mM ethylenediaminetetraacetic acid (EDTA) and dialyzed for 16 h against buffer A at 4\u00b0C. The cleaved histidine tag was subsequently removed by passage of the dialysate through a HisTrap\u2122 column. The flow-through fraction was concentrated and injected onto a Superdex 200 10/300 GL gel filtration column  equilibrated with buffer A. Fractions containing YabA were pooled and concentrated to 5 mg.ml\u22121.The E. coli BL21 (DE3) cells (Invitrogen) harboring (pET Lic_duet_yabA-dnaN) were grown in LB medium (with kanamycin at 40 \u03bcg/l) at 37\u00b0C until OD600 = 0.6. Protein expression was induced by addition of 1 mM IPTG and cells were incubated 3 h at 37\u00b0C. Cells were harvested by centrifugation and resuspended in buffer L with a protease inhibitor tablet , lysozyme (Roche) and Dnase (Sigma-Aldrich). The cells were lysed by sonication and centrifuged at 16 000 g for 20 min. The soluble fraction was diluted four times with buffer A and applied on a HisTrap\u2122 5 ml column equilibrated with buffer A. The protein complex was eluted using a 0 to 100% gradient of buffer B. Fractions containing the YabA/DnaN complex were pooled and applied to a Superdex 200 10/300 GL gel filtration column  equilibrated with buffer A. The pure YabA/DnaN complex was concentrated to 5 mg ml\u22121.To produce the YabA/DnaN complex, a vector (pET Lic_duet_yabA-dnaN) was used which directs the co-expression of N-terminally histidine tagged YabA and DnaN. 1\u201358 and YabA70\u2013119, the coding region of yabA was amplified from B. subtilis genomic DNA (strain 168) by PCR using gene-specific primers, with appended sequences to facilitate ligation independent cloning. The PCR product was inserted into the vector pET-YSBLIC3C by ligation-independent cloning methods (1\u201358) and residues 70\u2013119 (YabA70\u2013119) respectively, were created using a deletion mutagenesis method. A whole vector amplification of pET-YSBLIC3C-YabA was performed by PCR using the primers listed in Supplementary Table S5. The recombinant plasmids pET-YSBLIC3C-YabA1\u201358 and pET-YSBLIC3C-YabA70\u2013119 direct the expression of YabA1\u201358 or YabA70\u2013119, respectively, each fused to a 3C cleavable N-terminal His-tag. The recombinant YabA fragments were overproduced in E. coli BL21 (DE3) and following cell lysis, purified by steps of immobilized nickel affinity and gel filtration chromatography similar to those described above with the affinity tag subsequently being removed by HRV 3C protease.For the preparation of YabA methods . Plasmid\u22121). A second crystal form (II) was obtained using YabA (5 mg.ml\u22121) and by including 0.025% (V/V) dichloromethane in the drop. For structure determination, form II crystals were soaked in reservoir solution supplemented with 10 mM platinum potassium thiocyanate for 16 h. Crystals were then flash-cooled in liquid nitrogen (100K) using mother liquor containing step-wise additions of glycerol  as cryoprotectant. X-ray diffraction data were collected at the ID14EH4 (form I) and ID23EH1 (form II) beamlines of the European Synchrotron Radiation Facility . Form I crystals belonged to the space group P3221 with unit cell dimensions of a = b = 83.4 \u00c5 and c = 64.7 \u00c5 and diffracted to a resolution of 2.7 \u00c5. Crystal form II belonged to the space group P6122 with unit cell dimensions of a = b = 83 \u00c5 and c = 110 \u00c5 and diffracted to a resolution of 4 \u00c5 according to CC1/2 , 100 mM Bis-Tris propane pH 6.5 and 200 mM potassium thiocyanate. Crystal form I was obtained using the purified YabA/DnaN complex (5 mg.ml1\u201362 have been deposited in the protein databank (pdb code 5DOL).A single high redundancy dataset was collected at the Pt edge on a form II crystal soaked into platinum thiocyanate. The structure was solved using Autosol from the PHENIX package . The exp1\u201358 and YabA70\u2013119 were loaded onto gel-filtration columns equilibrated with 50 mM Tris pH 8.0, 150 mM NaCl. YabA was loaded at a concentration of 2.5 mg.ml\u22121 onto a Superdex 200 HR 10/30 column and YabA1\u201358 and YabA70\u2013119 were loaded at concentrations of 5 mg.ml\u22121 onto a Superdex 200/75 HR 10/30 column. In each case, the column eluate was successively analyzed by a SPD20A UV/Vis detector, a Wyatt Dawn HELEOS-II 18-angle light scattering detector and a Wyatt Optilab rEX refractive index monitor. Data were analyzed with Astra software (Wyatt).Samples (100 \u03bcl) of YabA, YabA\u22121 in a buffer of 20 mM potassium phosphate, pH 8.0. Spectra were recorded across the wavelength range of 260\u2013185 nm. A buffer scan was also recorded and subtracted from the protein spectra to remove any contribution from the buffer. Analysis of YabA CD spectra was performed using Dicroweb (http://dichroweb.cryst.bbk.ac.uk) (Circular dichroism spectra were recorded at 20\u00b0C on a Jasco J-810 CD spectrophotometer using a quartz cell with a 0.1 cm path length. Experiments were carried out at protein concentrations of 0.2 mg.mlk.ac.uk) .\u22121 were analyzed in triplicate using a zinc-specific lamp of wavelength 213.9 nm and the absorbance values were compared to those for a standard curve derived from samples of zinc powder dissolved in HCl.For AAS we used a Phillips PU9200 double beam spectrometer equipped with a flame volatilization system. Samples of YabA dissolved in deionized water at 0.5 mg.mlhttp://www.ncbi.nlm.nih.gov/BLAST/) and using the All Non-Redundant (NR) amino acid sequence database from April 2000, which includes SwissProt, CDS translation of GenBank (gb), EMBL (emb), the DNA database of Japan (dbj) and the Protein Structure Database (pdb) (http://www.compbio.dundee.ac.uk/jpred) through the Jalview version 2 software  and Pattern Hit Initiated BLAST (PHI-BLAST) methods at NCBI (se (pdb) . Defaultsoftware .http://imed.med.ucm.es/Tools/sias.html) with a BLOSUM62 matrix. Based on alignment results, a 3D model of YabA was obtained by homology modeling using the software package Modeller 9v8 (http://swissmodel.expasy.org/qmean) (Full length YabA and two fragments encompassing residues 1\u201370 and 71\u2013119 were scanned against the protein databank (PDB) by PSI-BLAST over five iterations. PHI-BLAST was also used to search templates for the C-terminal part of YabA. The templates selected by the BLAST approach were aligned with YabA sequence using ISPALIGN (Intermediate Sequence Profile Alignment) . A manualler 9v8 . Image rg/qmean) ,32.\u22121 . The solution was injected in a fixed-temperature (15\u00b0C) quartz capillary with a diameter of 1.5 mm and a wall thickness of 10 \u03bcm, positioned within a vacuum chamber. A total of 80 \u03bcl of monodisperse protein sample were loaded onto a size-exclusion column (SEC-3 300 \u01fa Agilent), using an Agilent HPLC system and eluted directly into the SAXS flow-through capillary cell at a flow rate of 0.2 ml min\u22121 . The Aviex charge-coupled device detector was positioned to collect data in the q-range 0.006\u20130.5 \u00c5 \u00c5. The Aml min\u22121 .q region, indicating that the proteins had not undergone aggregation. The radius of gyration gR was derived by the Guinier approximation I(q) = I(0) exp(-q2Rg2/3) for qRg < 1.0 using PRIMUS (p(r). This approach also features the maximum dimension of the macromolecule, Dmax. The overall shapes of the entire assemblies were derived from the experimental data using the program GASBOR , full length DnaA and an N-terminally truncated DnaA fragment (71\u2013440), and DnaN proteins were expressed as fusions to the GAL4 binding domain BD or activating domain AD from the vectors pGBDU-C1 and PGAD-C1, respectively. pGBDU and PGAD derivative constructs were introduced by transformation into PJ694- (\u03b1) and (a) haploid strains, respectively. Binary interactions were tested by combinational mating of the strains expressing the BD and AD fusions as previously described . InteracyabA was performed by PCR amplification and fragment joining using degenerate oligonucleotides containing a randomized codon at the targeted position. The mutated PCR amplified yabA coding sequences were cloned into the pGBDU vector, in frame with the BD domain of GAL4 as previously described (yabA derivatives carrying mutations at the targeted codon leading to different amino-acid substitutions were introduced into the pJ69\u20134 (a) yeast haploid strain by transformation. Yeast haploid cells expressing the BD-yabA mutant derivatives were mated with haploid strains of the opposite mating type (pJ69\u20134 (\u03b1)), harboring the pGAD-partner constructs encoding interacting proteins DnaA, DnaN or YabA fused to the AD domain of GAL4, as previously described . For the fluorescence complementation assay, genomic DNA from a strain expressing the yfp-yabA-N85D fusion under the control of its native promoter at the locus position, (cfp-yabA constructs at amyE locus (see Supplementary Table S4), using chloramphenicol (5\u03bcg/ml) for selection.Wild-type and mutant ter Pxyl . The cfposition,  was usedCells expressing the CFP-tagged YabA mutant derivatives and cells co-expressing CFP-YabA and YFP-YabA were grown and treated as previously described . For micHomology-based sequence analysis suggested that YabA consists of N-terminal (residues 1\u201356) and C-terminal (residues 73\u2013119) structural domains separated by a region of low complexity and poorly conserved sequence, which we will refer to as a \u2018linker\u2019 or \u2018hinge\u2019 Figure , S1. TheB. subtilis YabA was thus studied by spectroscopic methods. Atomic absorption spectra of the purified protein dissolved in deionized water revealed strong absorption at 231.9 nm diagnostic of the presence of zinc . In these experiments, the protein samples are analyzed on a gel-filtration column and the absorbance at 280 nm and the refractive index of the eluting species are monitored together with the multi-angle laser light scattering of the sample. YabA eluted as a single peak from an S200 column with a retention time of \u223c26.5 min . Interestingly, YabA70\u2013119 eluted from the same column as a single peak with a retention time of \u223c28 min and an associated Mw of 6.2 kDa . In both cases, analysis of the unit cell contents and lattice interactions indicated that proteolysis occurred during crystallization. The final model allowed us to delineate the NTD boundary of the crystallized fragment as residing around residue F62 in the form I crystals, fragment that will be thus described as YabAr Figure . YabA1\u20136\u2019 Figure . The A'B\u2019 Figure  assemble\u2019 Figure . The tet\u2019 Figure  and\u00a0D. Te Figure . The hepe Figure .1\u201362 is consistent with the circular dichroism data which suggested a high proportion of \u03b1-helix in the YabA1\u201358 fragment and the SEC-MALS data which clearly point to a tetramer. The structure also shows that residues 59\u201361 previously assigned to the linker region can adopt a \u03b1-helical conformation.The flanking coiled-coil regions are formed by the C-terminal halves of chains A and B\u2019 on one side of the four helical region and chains A\u2019 and B on the other (residues 36\u201362). These pairs of helices, which are splayed in the four helix bundle region, converge at their C-termini Figure  where hySaccharomyces cerevisiae profilin (pdb code: 1YPR) which exhibited partial similarity to YabA CTD although it does not contain a zinc finger motif  of 63.2 \u00c5 and a maximum dimension (Dmax) of 250 \u00c5 .To gain insight into the overall architecture of the full-length tetrameric YabA, we used SAXS. YabA eluted from the online HPLC as a single peak and SAXS data indicated a radius of gyration . To limit the range of possibilities, internal P22 symmetry was imposed, giving a shape composed of a cylindrical core with pairs of elongated arms attached to each end .Using the scattering curve, a low-resolution structure of YabA was calculated by d Figure . To gaind Figure ). The mod Figure  and exhig Figure  and\u00a0D. Iin vivo . We found that indeed, YabA62\u2013119 was able to support interaction with either partner, implying that the NTD's quaternary structure is dispensable. This scheme raised the important question of whether a single CTD monomer could form simultaneous interactions with both DnaA and DnaN or whether the interactions with the two proteins are mutually exclusive. To answer this question, we performed a yeast 3HB assay in which a constitutively expressed YabA62\u2013119 was tested for its ability to trigger interacting phenotypes by bridging DnaA and DnaN. We found that in contrast to the full length YabA, YabA62\u2013119 was not able to bind simultaneously to DnaA and to DnaN whether they are fused with to the BD or the AD domains of Gal4. This observation sheds new light on the mode of binding of YabA to its partners. We conclude that DnaA and DnaN are able to bind concurrently to a YabA tetramer but not to a single CTD.Previous studies revealed that YabA forms heterocomplexes with DnaA and DnaN in vivo ,16. YabAin vivo . It was in vivo . Our strNext, the model of the YabA CTD was used to predict additional residues involved in interactions with the partner proteins DnaA and DnaN. The predictions were based on residue surface accessibility calculations, sequence conservation analysis, comparison with templates and previous work . CandidaE. coli cells (data not shown). This is consistent with reduced stability caused by loss of Zn binding, although the direct participation of H95 in Zn coordination is not yet proved. Substitutions of the neighboring residues, F94 and I96 also impeded interaction with DnaA but had only moderate effects on interaction with DnaN (Supplementary Table S3). The hydrophobic residue F94, is highly conserved as a F or Y among YabA homologs and is buried in our model . The F94Y mutation in YabA did not affect protein interactions. In contrast, substitution of F94 by a variety of polar and aliphatic residues led to specific defects in DnaA interactions . YabA mutants R105E, R105D and R105G lost the ability to bind to DnaA. However substitution of K106 by a range of amino acid residues had no effect on DnaA binding . Wild-type YabA localizes as one or two foci per cell, with single foci displaying a midcell localization . LOIn Figure . Here, wn Figure   or L (18%) (Supplementary Table S1) suggesting this might contribute substantially to the free energy of binding. In YabA, further amino-acid residues including two hydrophobic residues (V99 and L110), two acidic residues (E107 and D108) and a positively charged residue at the C-terminus (K119) have been found to contribute to binding to DnaN. These less conserved residues might be important for tuning the affinity and/or the specificity of the interaction. In summary, our results point to a YabA \u03b2-binding mode that differs from other \u03b2-binding proteins such as the replicative DNA polymerase and presumably requires a different interacting surface. This result is in agreement with the DnaN-dependent localization of YabA at the replication machinery for most of the bacterial cell cycle  after initiation with both DnaA and DnaN at the replication machinery. In the latter case, we anticipate that the two CTDs (say the AB\u2019 pair) at one end of the YabA tetramer could contact symmetrical binding surfaces on the ring-shaped DnaN dimer, with up to two DnaA monomers, interacting with the CTD pair (A'B) pair at the opposite end of the complex as depicted in Figure Thus YabA, Geminin and ZapA represent examples of the exploitation of a coiled-coil helical core as a protein hub allowing the assembly and disassembly of protein complexes in a dynamic way. The structural organization of YabA offers a simple explanation for how it forms heterocomplexes with DnaA and DnaN. The flexible C-terminal moieties provide YabA with the dynamic capacity to interact (i) with more than one DnaA molecule, preventing the helical assembly of the latter at"}
+{"text": "Reverse genetics approaches revealed functional redundancy between the CP12-1 and CP12-2 proteins and a role for these proteins in determining the level of the Calvin\u2013Benson cycle enzyme phosphoribulokinase. in vivo has not yet been reported. We used Arabidopsis thaliana T-DNA mutants and RNAi transgenic lines with reduced levels of CP12 transcript to determine the relative importance of each of the CP12 genes. We found that single cp12-1, cp12-2, and cp12-3 mutants do not develop a severe photosynthetic or growth phenotype. In contrast, reductions of both CP12-1 and CP12-2 transcripts lead to reductions in photosynthetic capacity and to slower growth and reduced seed yield. No clear phenotype for CP12-3 was evident. Additionally, the levels of PRK protein are reduced in the cp12-1, cp12-1/2, and multiple mutants. Our results suggest that there is functional redundancy between CP12-1 and CP12-2 in Arabidopsis where these proteins have a role in determining the level of PRK in mature leaves and hence photosynthetic capacity.CP12 is a small, redox-sensitive protein, the most detailed understanding of which is the thioredoxin-mediated regulation of the Calvin\u2013Benson cycle, where it facilitates the formation of a complex between glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) in response to changes in light intensity. In most organisms, CP12 proteins are encoded by small multigene families, where the importance of each individual CP12 gene  The functioning of this pathway is dependent on the availability of ATP and reducing power in the form of NADPH produced from photosynthetic electron transport. The supply of ATP and NADPH within the chloroplast varies in response to fluctuations in light intensity. One important mechanism that links the availability of products from the electron transport chain to the activity of the enzymes of the CB cycle is the ferredoxin/thioredoxin system , CP12-2 (At3g62410), and CP12-3 (At1g76560). CP12-1 and CP12-2 proteins are highly similar, sharing up to 86% identity following cleavage of the transit peptide. Phylogenetic analyses of the CP12 genes across a range of species have been unable to differentiate CP12-1 and CP12-2 into two separate subgroups on the basis of their amino acid sequence, and have been classified as CP12 type I. CP12-3 shares 47% and 46% identity with CP12-1 and CP12-2, respectively, and phylogenetic analysis places CP12-3 in a distinct clade as CP12 type II , seeds, and root tips. In contrast, CP12-3 is expressed at lower levels and accumulates in roots, stigma, and anthers, but has very low expression in leaf tissue  was lower than in wild-type plants, and changes in pyridine nucleotide content were also evident. These results suggest a potential role for the CP12 protein(s) outside the formation of the regulatory PRK/GAPDH/CP12 complex  were surface sterilized with 95% (v/v) ethanol+0.05% Tween for 5 min, and rinsed five times with 70% ethanol, allowed to dry, and then placed in Petri dishes containing half-strength Murashige and Skoog (1/2 MS) medium and 0.8% agar. Alternatively, seeds were put in sterile water. Freshly sown plates or seeds in water were stored at 4 \u00b0C and darkness for 48\u201372 h before moving to the light or sowing on soil. Pots or plates were then moved to a controlled environment chamber for seeds to germinate. All plants were grown in controlled conditions with either 16 h light/8 h dark (long days) or 8 h light/16 h dark (short days) and light levels of 130 \u03bcmol m\u20132 s\u20131.Seeds of cp12-1, cp12-2, and cp12-3 mutants were identified in The Arabidopsis Information Resource (TAIR) database . Mutant genotypes were assessed by PCR and the location of each T-DNA insertion was determined precisely (JXB online). Double mutants cp12-1/2, cp12-1/3, and cp12-2/3 were obtained by crossing homozygous plants of each single mutant line and segregating the double homozygous plants. The triple mutant cp12-1/2/3 line was similarly obtained by crossing double homozygous mutants and allowing its progeny to segregate until triple homozygous plants were identified.The recisely  by sequehttp://www.mn-net.com/). Reverse transcription was performed using RevertAid reverse transcriptase from Fermentas. For semi-quantitative analysis, RT-PCR products were resolved by electrophoresis and stained with ethidium bromide; amplification of a GTP-binding elongation factor gene (AT1G07940.1) was used as loading control. For qPCR, a minimum of three biological replicates were analysed, and each one was measured in triplicate using the iCycler iQ thermocycler (Bio-Rad) and SensiFast SYBR taq ready mix (Bioline). Data were normalized using similarly derived data for expression of: cyclophilin (AT2G29960), actin 2 (AT1G07940.1), and elongation factor (AT1G07940.1). Data analysis was done using the Bio-Rad CFX Manager 3.1.RNA was isolated using the nucleospin RNA/Protein kit from Macherey-Nagel  was retrieved from the TAIR database, the promoter area was selected as described previously  from the Arabidopsis plastid terminal oxidase (PTOX) (EMBL accession no. ATT10I14). These were then assembled together with a Cauliflower mosaic virus 35S promoter and a NOS terminator into a plant expression construct using Golden Gate technology. Arabidopsis plants were transformed using the floral dip method (\u20131 hygromycin.For further reductions of  cloning . RNAi cop method  and tranA) to substomatal CO2 concentration (Ci) was measured using a portable gas exchange system . The measurement procedure was done as described in \u20132 s\u20131 for the duration of the A/Ci response curve. Measurements of A were made at ambient CO2 concentration (Ca) at 400 \u03bcmol mol\u20131, before Ca was decreased to 300, 200, 100, and 50 \u03bcmol mol\u20131. Following this, the Ca was increased stepwise to 1500 \u03bcmol mol\u22121 for completion of the curve in nine steps . The CO2 assimilation rate per unit leaf area and intercellular CO2 concentration (Ci) were determined using the equations of Vcmax) and the maximum rate of electron transport for ribulose bisphosphate (RuBP) regeneration (Jmax) to a leaf temperature of 25 \u00b0C based on equations from The response of net photosynthesis (A/Q) and as transients; all these were measured at ambient CO2 concentration (400 \u03bcmol mol\u20131). For A/Q curves, leaves were initially stabilized at saturating irradiance 1000 \u03bcmol m\u20132 s\u20131, after which A and stomatal conductance (gs) were measured at light levels between 0 to 1000 \u03bcmol m\u20132 s\u20131. Measurements were recorded after A reached a new steady state (1\u20132 min) and before gs changed to the new light levels.The response of net photosynthesis to changes in light was also measured both as light dose\u2013response curves , after which light was increased to 500 \u03bcmol m\u20132 s\u20131. After 10\u201315 min at the higher light intensity, light was returned to the original value.For transients, COa fluorescence were obtained as described by Images of Chl \u20132 s\u20131 and ambient (400 \u03bcmol m\u20131 s\u20131) CO2 were imaged directly in 1/2 MS agar plates. The operating efficiency of PSII photochemistry, Fq\u2032/Fm\u2032, was calculated from measurements of steady-state fluorescence in the light (F\u2019) and maximum fluorescence in the light (Fm\u2032) which were obtained after a saturating 800 ms pulse of 6200 \u03bcmol m\u20132 s\u20131 PPFD using the following equation Fq\u2032/Fm\u2032=(Fm\u2032\u2013F\u2032)/Fm\u2032. Images of Fq\u2032/Fm\u2032 were taken under a stable PPFD of 130 \u03bcmol m\u20132 s\u20131 and a PPFD of 300 \u03bcmol m\u20132 s\u20131. The significance of data obtained was statistically tested by running an ANOVA followed by Tukey test using R (https://www.r-project.org/).Seedlings at 14, 18, 20, and 22 days after sowing (DAS) grown in a controlled environment chamber at 130 \u03bcmol mFq\u2032/Fm\u2032 to changes in light intensity was also monitored. For this, mature rosettes were imaged. Prior to measurements, pre-dawn or 20 min dark-adapted plants were used to obtain the minimal fluorescence (Fo), which was measured using a weak measuring pulse. Maximal fluorescence (Fm) was measured using an 800 ms long saturating light pulse of 6200 \u03bcmol photons m\u20132 s\u20131. Plants were then exposed to an actinic light of 50 \u03bcmol m\u20132 s\u20131 PPFD for 20 min, and steady-state F\u2019 was continuously monitored, while maximum fluorescence in the light (Fm\u2019) was measured at 1 min intervals by applying saturating light pulses; light was then increased to 400 \u03bcmol m\u20132 s\u20131 PPFD for 10 min, and then returned to 50 \u03bcmol m\u20132 s\u20131 PPFD for 15 min. Fluorescence was monitored every minute as described. Using the images captured at F\u2032 and Fm\u2032, images of operating efficiency of PSII (Fq\u2032/Fm\u2032) were constructed by the imaging software (FluorImager).The response of http://rsb.info.nih.gov/ij/index.html). Within the plates, the 10 larger plants of each plate (containing up to 50 seedlings) were registered, while all the plants grown in soil were measured. Alternatively, in plants where chlorophyll fluorescence measurements were done using the CF Imager, the software used for calculation of the fluorescence parameters also was used to calculate total leaf/rosette area. The significance of data obtained was statistically tested by Kruskal\u2013Wallis analysis followed by Man\u2013Whitney tests (P<0.05) using SPSS  from IBM or by running an ANOVA followed by Tukey test using R (https://www.r-project.org/)For total leaf area and rosette area calculations, pictures of the seedlings in agar and older plants on soil were taken and processed using ImageJ , and 10 mM DTT] was added and ground further before transferring to a cold 1.5 ml microcentrifuge tube. Insoluble material was removed by centrifugation at 14 000 g for 2 min (4 \u00b0C). The supernatant was collected and aliquoted for protein quantification (Bradford assay) and further analysis. The presence of the CP12-FLAG protein was assessed in these extracts by immunoblots, employed as previously described , ATP\u03b4 (AS101591), Rieske FeS (PetC: AS08330), and against the glycine decarboxylase H-subunit (AS05074), purchased from Agrisera (via Newmarket Scientific UK).Frozen leaf tissue (30 mg) was ground to a powder using liquid nitrogen and a cold mortar and pestle. Protein extraction buffer . Samples were then treated with H2O2, with DTT, or kept in ice prior to 10 mM 4-acetamido-4\u2032-maleimidylstilbene-2,2\u2032-disulphonic acid (AMS) treatment. AMS treatment was performed overnight at 4 \u00b0C, and samples were then separated by non-reducing SDS\u2013PAGE.For investigation of protein redox states, proteins were extracted using trichloroacetic acid (TCA); leaf tissue (100\u201350 mg) was flash-frozen in liquid nitrogen and ground in an eppendorf tube on dry ice, TCA  was added, and incubated on ice for 10\u201320 min. Samples were spun at 14 000 CP12-1), AT3G62410 (CP12-2), AT1G76560 (CP12-3), AT3G18780 (Actin2), AT1G07940 (EF), AT2G29960 (Cyclophilin), and AT1G32060 (PRK).The gene sequences mentioned in this study can be found in the Arabidopsis Genome Initiative database under the following accession numbers: AT2G47400 . A wide collection of CP12 polymorphisms were found (66), 23 of which are insertion mutants . The three best candidate lines, SALK_008459.27.80.X (cp12-1), GK_397A01_017930 (cp12-2), and SAIL_854_F09.v2 (cp12-3), were selected based on the position of the insertion of the T-DNA to enable disruption of the exon or hit the promoter to interfere with gene expression. All T-DNA insertion sites were confirmed using PCR analysis (data not shown) of genomic DNA followed by sequencing of the T-DNA\u2013gene junctions. Diagrams of the positions of the T-DNA inserts are presented in To elucidate the functional significance of the individual members of the Arabidopsis CP12 gene family CP12 gene expression by qPCR  alleles. In contrast detectable levels of the CP12-2 transcript were found in the cp12-2 T-DNA line, and so this is considered to be a knockdown (KD) allele. Preliminary observations of these three mutant lines failed to reveal any major growth or developmental phenotypes. To investigate further the impact of the lack or decreased levels of the CP12 gene transcripts, double and triple mutant lines were generated. It was not possible to determine changes in protein levels as detection of CP12 protein in leaf extracts has not proved possible.Homozygous plants  for each of the lines were used to assess the effect of each T-DNA insertion on  by qPCR . Semi-qucp12-1/2, cp12-1/3, and cp12-2/3, and the triple mutant line cp12-1.1/2.1/3.1 were identified using PCR analysis of genomic DNA . The impact of the single and multiple T-DNA insertions on the expression of the CP12 genes was evaluated using qPCR analysis . The results, presented in CP12-1 and in CP12-3 yield KO mutants, as no expression of these genes is detectable in either the single or multiple mutants. In contrast, RNA transcripts for CP12-2 were detected in the insertion mutant for the CP12-2 gene, indicating that this is a KD mutant with 51\u201377% of the wild-type RNA levels. This analysis also showed that the T-DNA KO and KD effect was observed in the double and triple mutants.The double mutant lines cp12-1/2/3 triple mutant and the cp12-1/2 double mutant, which achieved only 48% and 52% of the total leaf area of wild-type seedlings by day 11, respectively  and in fresh and dry weight of the rosettes after 36 d growth . Leaf area was recorded every 2\u20133 d between days 4 and 11, and this showed a slow growth phenotype in the ectively . Small d mutants . A seconf growth . In thisd growth .cp12-1/2/3 and the cp12-1/2 mutants produced less seed than the wild type in two independent experiments done 2 years apart; yields for cp12-1/2/3 mutants were found to be between 48% and 71% of wild-type yield . Interestingly, individual seeds of the cp12-1/2/3, cp12-1/2, and cp12-1 plants weighed significantly less than those of the wild type, and the cp12-1/2/3 seeds were 28% below the weight of wild-type seed.Growth of the CP12 mutants in short days showed that the The results presented here so far suggest that CP12-1 makes a major contribution to the development of the growth phenotype described. To explore this further, we expressed a CP12-1-FLAG protein in the triple mutant.cp12-1/2/3 plants.For this, a construct for expression of a Flag-tagged CP12-1 protein, driven by the native promoter for this gene  were transformed into cp12-1/2/3 plants with the aim of obtaining triple KO mutants. Seven independent transgenic lines were produced and CP12-2 expression was evaluated by qPCR. Five lines were selected based on the most severe reductions of the CP12-2 transcript and used for further analysis (data not shown). Growth analysis was undertaken as described before in cp12-1/2/3, and cp12-1/2/3RNAi lines. These experiments showed that the cp12-1/2/3RNAi plants with further decreased CP12-2 transcript .Given that the CP12-2 T-DNA mutant line used in this study is a KD, and not a KO, an RNAi approach was taken to reduce the anscript  showed acp12-1/2/3RNAi3.1, referred to as RNAi3; and cp12-1/2/3RNAi4.2, referred to as RNAi4. To investigate further the slow growth phenotype of these plants, we looked at root development. Seedlings were grown on vertical plates for 24 d and roots scanned every 3 d to monitor root length, number of lateral roots, and the ratio between the number of lateral roots and the primary root length in wild-type, cp12-1/2/3, and cp12-1/2/3RNAi plants. Root length was reduced in the CP12 mutants and, somewhat more interestingly, the ratio between the number of lateral roots and the primary root length showed that in both cp12-1/2/3 and the cp12-1/2/3RNAi plants the number of lateral roots is reduced relative to wild-type plants .Due to the severity of the cp12-1/2/3RNAi phenotype , we focused the rest of the work on two independent lines with intermediate phenotypes: cp12-1/2/3, and cp12-1/2/3/RNAi plants for CB cycle proteins GAPDH, FBPA, SBPase, TK, or Rubisco, for other chloroplast proteins, MDH, Lhca1, Rieske FeS, ATP\u03b4, or ssAGPase, or even for the mitochondrial H-protein from the glycine decarboxylase complex involved in photorespiration. In contrast, PRK levels were reduced substantially in all of the mutants lacking the CP12-1 transcript, with particularly high reductions of >85% of wild-type PRK protein levels in the cp12-1/2/3 and the cp12-1/2/3RNAi plants .To explore the possibility that the decrease in PRK levels was caused by changes in the redox state of the PRK protein, non-reducing SDS\u2013PAGE followed by immunoblotting was performed on wild-type, cp12-1/2 and cp12-1/2/3) and the wild type. Assimilation rates (A) as a function of light intensity (A/Q) and intercellular CO2 [net CO2 assimilation rate (A) versus calculated substomatal CO2 concentration (Ci) response curve] were determined. The light dose\u2013response curves measured in the cp12-1/2 and cp12-1/2/3 mutants showed no significant differences when compared with wild-type plants.  and the maximum rate of electron transport for RuBP regeneration (Jmax) showed no significant differences between the mutants and wild type (data not shown). Considering that the GAPDH/CP12/PRK complex has been described as sensitive to dynamic light (\u20132 s\u20131) to light intensities of 500 \u03bcmol m\u20132 s\u20131; however, even under these conditions, no significant differences in assimilation rates were found (Fq\u2019/Fm\u2019); no significant differences were found in plants 4\u20136 weeks after planting .Given the slow growth phenotype described and the known role of the CP12-1 and CP12-2 proteins in the regulation of the CB cycle enzymes PRK and GAPDH, the rates of photosynthetic carbon assimilation were assessed in the two T-DNA lines with the most severe phenotypes , to light intensities of 500 \u03bcmol m\u20132 s1. Although no clear differences in CO2 assimilation were evident at low light intensities, once the plants were exposed to higher light, the assimilation rates of the cp12-1/2/3RNAi plants were much lower than those of the wild type and cp12-1/2/3 mutants. Line RNAi4, which revealed the lowest levels of PRK protein in immunoblots, also displayed the most severe impact on photosynthesis  in the cp12-1/2/3 mutants . It should also be noted that the dark-adapted maximum quantum efficiency of PSII photochemistry (Fv/Fm) was significantly lower in the RNAi lines, suggesting reduced efficiency or damage to the photosystems.In light of these results and considering that in tobacco PRK antisense plants, reductions in photosynthesis were only evident in plants with \u226420% of wild-type PRK levels . Since this phenotype is evident during the early stages of vegetative growth, we assessed the photosynthetic capacity of the cp12-1/2, cp12-1/2/3, and cp12-1/2/3RNAi lines compared with wild-type and single T-DNA mutant plants in early stages of development using chlorophyll fluorescence imaging. Fq\u2032/Fm\u2032 was determined in young seedlings (15\u201322 DAS) grown in 1/2 MS agar, under a light intensity similar to growth light (130 \u03bcmol m\u20132 s\u20131). No differences were evident between the wild type, cp12-1, cp12-2, and cp12-3 single mutants; but statistically significant lower values for Fq\u2032/Fm\u2032 were found in cp12-1/2, cp12-1/2/3, and cp12-1/2/3RNAi plants when compared with the wild type  suggested that there is some functional redundancy between members of the CP12 family. Additionally, the up-regulation of the CP12 transcripts in the T-DNA mutants when another member of the family was knocked out or knocked down by a T-DNA insert  and, although these plants have a significant slow growth phenotype, no detectable reduction in CO2 assimilation was evident in the mature leaves. Finally, the RNAi lines, with dramatic reductions of >80% below that of wild-type levels of PRK, not only develop a severe growth phenotype but also have significant decreases in photosynthetic CO2 assimilation. Furthermore, line RNAi4, which has the lowest levels of PRK, also has the largest reduction in CO2 assimilation. These decreases in PRK protein, but not PRK transcripts, in the CP12 mutants and cp12-1/2/3RNAi lines suggest a post-translational level of regulation and, therefore, an additional potential role for CP12. Several pieces of evidence showing that CP12 can act as a chaperone for GAPDH preventing heat-induced aggregation and deactivation in vitro and protect against oxidative stress in vivo to both GAPDH and PRK have been published  and by To explore the underlying causes of the reductions in photosynthesis and given that ild-type , we lookcp12-1/2/3 and cp12-1/2/3RNAi lines. Lack of photosynthesis and consequent reduced growth could be expected to lead to a reduced growth of the roots, but would not be expected to affect the development of lateral roots. In 2012, two reports described the presence of NTRC in non-photosynthetic plastids and its importance for lateral root formation (An interesting feature of the phenotype described herein is the apparent lack or reduced number of lateral roots in the in vivo evidence of the relative importance of the individual members of the CP12 protein family in higher plants. In the first instance, it highlights the fact that the CP12 proteins have some level of functional redundancy. Our data also suggest that CP12-1 and CP12-2 play leading roles in normal development. Finally, this work also highlights the fact that the importance of CP12 is not only limited to the regulation of the CB cycle enzymes GAPDH and PRK through the formation of the GAPDH/CP12/PRK complex, but that it also is important for the maintenance of normal levels of PRK protein and hence the function of the CB cycle.In conclusion, the phenotype described herein provides JXB online.Supplementary data are available at Table S1. Primer details for cloning and screening and expression analysis.Fig. S1. PCR analysis of genomic DNA from the CP12 mutants.Fig. S2. Leaf numbers in WT and CP12 T-DNA insertion mutants.Fig. S3. Seed yield of WT, CP12 insertion mutants, and RNAi plants.Fig. S4. Complementation of the cp12-1/2/3 mutant by expression of CP12-1::FLAG.Fig. S5 Immunoblot analysis of CP12::FLAG expression.Fig. S6. CP12-2 RNAi construct.Fig. S7. Lack of CP12 alters specific leaf area.Fig. S8. Lateral root development is inhibited in the CP12 mutants.Fig. S9. SDS\u2013PAGE of total protein extracts of cp12-1/2/3RNAi3.Fig. S10. SDS\u2013PAGE of total protein extracts of cp12-1/2/3RNAi4.Fig. S11. Lack of CP12 does not alter PRK or TK redox states.Fig. S12. Photosynthetic light induction responses are unaffected in the mature or young rosettes of the CP12 mutant plants.Fig. S13. Fq\u2032/Fm\u2032 is significantly decreased in cp12-1/2/3RNAi mature plants during a light induction treatmentPEL. and AOA conducted the experiments, PEL and CAR designed the experiments and wrote the paper, and TL helped design and interpret experiments for the physiological characterization of the plants and reviewed the manuscript.JXB_Supplementary_Figures_S1_S13_table_S1Click here for additional data file."}
+{"text": "Bacillus subtilis cells can adopt different life-styles in response to various environmental cues, including planktonic cells during vegetative growth, sessile cells during biofilm formation and sporulation. While switching life-styles, bacteria must coordinate the progression of their cell cycle with their physiological status. Our current understanding of the regulatory pathways controlling the decision-making processes and triggering developmental switches highlights a key role of protein phosphorylation. The regulatory mechanisms that integrate the bacterial chromosome replication status with sporulation involve checkpoint proteins that target the replication initiator DnaA or the kinase phosphorelay controlling the master regulator Spo0A. B. subtilis YabA is known to interact with DnaA to prevent over-initiation of replication during vegetative growth. Here, we report that YabA is phosphorylated by YabT, a Ser/Thr kinase expressed during sporulation and biofilm formation. The phosphorylation of YabA has no effect on replication initiation control but hyper-phosphorylation of YabA leads to an increase in sporulation efficiency and a strong inhibition of biofilm formation. We also provide evidence that YabA phosphorylation affects the level of Spo0A-P in cells. These results indicate that YabA is a multifunctional protein with a dual role in regulating replication initiation and life-style switching, thereby providing a potential mechanism for cross-talk and coordination of cellular processes during adaptation to environmental change. Bacillus subtilis is a developmental model organism capable of differentiating into spores or forming biofilms in response to environmental signals. How B. subtilis couples the developmental decision-making with the replication status is not fully understood. In B. subtilis, multiple regulatory processes contribute to regulating DNA replication at the onset of sporulation  of proteins by Ser/Thr/Tyr Hanks-type kinases . The phoB. subtilis, the phosphorylation of the single-strand DNA binding proteins SsbA on a tyrosine residue was found to modulate its binding to DNA  derivative CCBS185, containing a neomycin resistance gene under the control of the Lambda Pr promoter (\u03bbPr-neo) inserted into upp gene. The yabA-T71A and yabA-T71D mutants were constructed at locus by an improved mutation delivery approach as follows. The primers pair yabA fwd + YabAT71AR and YabAT71AF + yabA rev were used to amplify two partially overlapping DNA fragments containing parts of yabA gene and the flanking regions. Primers pair yabA fwd + YabAT71DR and YabAT71DF + yabA rev were used for yabA-T71D. The insertion cassette encoding the Lambda CI repressor and the phleomycin-resistance gene was flanked by mutagenized yabA fragments in direct orientation by joining PCR using primers yabA fwd and yabA rev. The amplified fragment was used to transform CCBS185 cells with selection on phleomycin. The obtained clones were controlled for the loss of neomycin resistance due to CI, which inhibits the transcription from the Pr promoter. Finally, homologous regions allow a recombination process leading to the excision of the cassette and cells were isolated by counter-selection for neomycin-resistance. CCBS185 cells were transformed with the chromosome from the strain BMR26  was synthesized in the chaperone overproducing strain d vector . CultureyabA gene and derivative genes carrying mutations T71A and T71D were amplified from pGBDU-yabA, pGBDU-yabA-T71A, pGBDU-yabA-T71D bait plasmids with yabA-NdeI and yabA-XhoI primers sets and cloned into NdeI and XhoI sites of pSMG201, which allow cloning of orf under the control of the T7 promoter. To purify the proteins, E. coli strain ER2566 was transformed with the resultant plasmids. Cells were cultured in LB medium supplemented with 30 \u03bcg ml-1 kanamycin. When the OD600 reached 0.6, IPTG was added to 0.5 mM to induce expression of the protein and the culture was incubated overnight at 18\u00b0C. All subsequent steps were carried out at 4\u00b0C. Cells were pelleted and resuspended in buffer A  and were disrupted by sonication and finally centrifuged at 40.000 rpm for 1 h. Proteins from the supernatant were precipitated by adding ammonium sulfate at a final concentration of 20%. After centrifugation, the pellet containing YabA protein was collected and resuspended in buffer B . The soluble fraction was concentrated and injected onto a Superdex 200 10/300 GL gel filtration column  equilibrated in buffer C . Fractions containing YabA, YabA-T71A or YabA-T71D were pooled, dialyzed and stored at -20\u00b0C in the presence of 50% glycerol  dissolved in 50 mM NH4CO3. The resulting peptides were extracted successively with 2% trifluoroacetic acid (TFA) and 50% acetonitrile (ACN) and then with ACN. Vacuum-dried peptide extracts were resuspended in 30 \u03bcl of 0.05% TFA, 0.05% HCOOH, and 2% ACN.A Q Exactive (Thermo Fisher Scientific) coupled to Eksigent nano LC (AB Sciex) was used for the nano-LC-MS/MS analysis. 4 \u03bcl were injected on the NanoLC-Ultra system (Eksigent) chain. Sample was loaded at 7.5 \u03bcl/min on the precolumn cartridge  and desalted with 0.1% HCOOH. Then, peptides were separated with a gradient of acetonitrile on the reverse phase column . Eluted peptides were analyzed on-line with a Q-Exactive mass spectrometer (Thermo Electron) using a nanoelectrospray interface. Ionization  was performed with stainless steel emitters . Peptide ions were analyzed using Xcalibur 2.1 with the following data-dependent acquisition steps: (1) full MS scan [mass-to-charge ratio (m/z) 400\u20131400] and (2) MS/MS. Step 2 was repeated for the 8 major ions detected in step 1. Dynamic exclusion was set to 40 s. Lock mass option was chosen \u201cbest\u201d, MS resolution 70000 at m/z 400, auto gain control was 3e6, maximum injection time 250 ms. For MS2, the resolution was 17500 at m/z 400, auto gain control was 2e5, maximum injection time 120 ms, isolation window m/z = 3, normalized collision energy: 25, underfill ratio 0.5%, intensity threshold 2.5 e4. Charge state: 2.3.4. Dynamic exclusion 40 s.1 and the B. subtilis strain 168 database was downloaded from UniProt Database site2 . This database was merged and in conjunction with reverse and contaminant databases, were searched by Xtandem CYCLONE  using XTandem pipeline (version 3.3.0) developed by PAPPSO platform3. Enzymatic cleavage was declared as a trypsin digestion with one possible miss-cleavage. Cys carboxyamidomethylation and Met oxidation were set to static and possible modifications, respectively. Precursor mass was 10 ppm and fragment mass tolerance was 0.02 Th. A refinement search was added with similar parameters except that semi-tryptic peptides, possible N-ter protein acetylation and phosphorylation of serine threonine or tyrosine were searched for the phosphoproteins.A database search was performed with XTandem (version 2011.12.01.1)E-value smaller than 0.1 were reported. Identified proteins were filtered and grouped using XTandem Pipeline4 according to: (1) A minimum of two different peptides was required with an E-value smaller than 0.05, (2) a protein E-value  smaller than 10\u20134. To take redundancy into account, proteins with at least one peptide in common were grouped. This allowed to group proteins of similar function. Within each group, proteins with at least one specific peptide relatively to other members of the group were reported as sub-groups. For phosphoproteomic data, only one peptide is required with an E-value smaller than 0.01 and the protein E-value  smaller than 10\u20132. Identified phosphopeptides were filtered and grouped using XTandem Pipeline confirmed with MaxQuant5 and manually validated.For data of proteomic, only peptides with an Phosphorylation reactions were performed in a total volume of 30 \u03bcl, in the presence of 40 \u03bcM of YabA, YabA-T71A or YabA-T71D, and 1.6 \u03bcM of YabT. In addition to the appropriate proteins, the reaction mixture contained 50 \u03bcM [\u03b3-32P] ATP (20 \u03bcCi/mmol), 5 mM MgCl2, and 50 mM Tris\u2013HCl pH 7.4. Reactions were incubated at 37\u00b0C for 1.5 h and stopped by adding loading buffer for SDS-PAGE. Proteins were separated by electrophoresis on denaturing 15% polyacrylamide gels. After drying the gels, radioactive signals were visualized using STORM phosphorimager.-1 lysozyme). After incubation for 10 min at 37\u00b0C, 10 \u03bcL sarkozyl 30 % were added to complete cell lysis. The samples were incubated at 65\u00b0C for 20 min followed by lithium chloride precipitation to precipitate proteins and other contaminants by salting out. 0.8 volume of 2-propanol was added before centrifugation at 16000 rpm. The pellet was then resuspended in 200 \u03bcL double-distilled H2O (ddH2O) and 200 \u03bcL of 10 M LiCl4. Samples were incubated at -20\u00b0C for 20 min and the DNA was precipitated by addition of ethanol and sodium acetate. Precipitated DNA was resuspended in 50 \u03bcL of ddH2O. Q-PCRs were carried out in triplicates of 25 \u03bcl each and using three dilutions of chromosomal DNA . 5 \u03bcL diluted DNA was used as template and added to a mixture of 12.5 \u03bcL ABsolute Blue qPCR SYBR\u00aeGreen ROX Mix (Thermo Scientific) and 0.3 \u03bcL primers mix (3 \u03bcM each forward and reverse) in a 96-well PCR plates. Primers pair for Origin proximal sequence (OriL3F and OriL3R) and Terminus proximal sequence  with the following program: 15 min at 95\u00b0C,  \u00d740 cycles, 15 s at 95\u00b0C, 15 s at 60\u00b0C, 20 min to reach 95\u00b0C, 15 s at 95\u00b0C. Results were analyzed with Realplex program (Eppendorf) and quantified by \u0394\u0394Ct method.DNA was isolated from cultures at exponential phase (OD = 0.3\u20130.4) in order to determinate the Ori/Ter ratio by Q-PCR. 2 ml of culture was centrifuged and rinced with 10 mM Tris\u2013HCl (pH 8), 10 mM EDTA (pH 8), and 300 mM NaCl. The pellet was resuspended in 200 \u03bcL Lysis buffer  and (a) haploid strains, respectively. Binary interactions were tested by combinational mating of the strains expressing the BD and AD fusions as previously described . InteracamyE locus in the B. subtilis chromosome. Primers yabA-apa and yabA-R-salI, carrying ApaI and SalI restriction sites, respectively, were used to PCR amplify the wild-type and mutant yabA genes from the corresponding bait vectors. The PCR fragments and pSG1729 were digested with ApaI + SalI. E. coli DH10B cells were transformed by the ligation mixtures, and single transformants were verified by sequencing. The gfp-yabA constructs were then integrated into the amyE locus of the B. subtilis \u0394yabA strain (JJS142) by transformation, using spectinomycin (60 \u03bcgml-1) for selection. The presence of the integrated gfp fusions was verified by PCR amplification from the amyE flanking region and by the inability of the strain to produce amylase. For induction of the GFP-tagged YabA proteins, cells from overnight cultures grown at 37\u00b0C in LB supplemented with spectinomycin were diluted to OD600 = 0.01 in the same medium supplemented with xylose to 0.5% and grown until the OD600 reached 0.3\u20130.5. Cells were rinsed in MM and mounted on 1.2% pads. When required, cells were stained with FM4-64 (Molecular Probes) to visualize the cell membrane or with DAPI to visualize the nucleoid. Fluorescence microscopy was performed using Leica DMRA2. System control and image processing were performed using MetaMorph software.The N-terminal tagged GFP-YabA proteins were conditionally expressed from the xylose-inducible promoter Pxyl, at the ectopic Cultures growing in a CH medium were induced to sporulate by transfer to resuspension medium (SM), essentially as described by To quantify spore formation, cells were induced to sporulate by nutrient exhaustion in Difco sporulation medium (DSM) . OvernigspoIIA and spoIIID transcriptional fusions with the butterfly luciferase gene luc . The cells were centrifuged and re-suspended in fresh DSM media to obtain OD600 1.0. The pre-cultures were next diluted in respective media to OD600 0.025. Then 200 \u03bcl were distributed into each well in a 96-well black plates (Corning) and 10 \u03bcl of luciferin were added to reach a final concentration of 1.5 mg ml-1 (4.7 mM). The cultures were incubated at 37\u00b0C with agitation in a Perkin Elmer EnVision 2104 Multilabel Reader equipped with an enhanced-sensitivity photomultiplier for luminometry. The temperature of the clear plastic lid was maintained at 37\u00b0C to avoid condensation. Relative Luminescence Units (RLUs) and OD600 were measured at 5-min intervals.To analyze genes expression, gene luc  were usespo0A expression, pBSBII-spo0A plasmid containing a GFP transcriptional fusion was used to transform B. subtilis strains. The plasmid was integrated by single crossover at chromosomal loci of the targeted gene. GFP expression was measured after induction of sporulation (T0) by the resuspension method using a TECAN instrument.For -1 tryptophan, 50 \u03bcg mL-1 phenylalanine] , 100 mM MOPS (pH 7), 2 mM MgCl2, 700 \u03bcM CaCl2, 50 \u03bcM MnCl2, 50 \u03bcM FeCl3, 1 \u03bcM ZnCl2, 2 \u03bcM thiamine, 0.5% glycerol, 0.5% glutamate, 50 \u03bcg mLalanine]  in glassn \u2265 3 samples.Strains were grown in LB to OD600 of 1.0 and inoculated in 12-well culture plates containing 3.5 ml of MSgg media at OD600 = 0.1. Cultures were maintained in a growth chamber at 28\u00b0C and 70% humidity for 48 h. Pellicles were brought up to the top of the wells by slowly adding MSgg media and peeled of onto a 2.5 cm diameter circular cover slide. The cover slides with intact biofilm pellicles were mounted onto an Attofluor Cell Chamber and stained with the FilmTracer FM 1-43 Green Biofilm dye (Thermo Fisher Scientific). Stained biofilms were observed using a spinning disk confocal microscope . Images were processed using IMARIS software . Biofilm images were quantified using the surface function in IMARIS (XTension biofilm). Biovolumes were calculated based on total volume (\u03bcm3) per area (\u03bcm2) from Cells were grown in LB shaking at 37\u00b0C to OD600 of 1.0. 10 \u03bcL cultures were then spotted on a dried MSgg plate (1.5% agar) and incubated for 96 h at 30\u00b0C. Colonies were measured and photographed using a camera. For each sample, a representative image from 3 examined colonies is presented.yabT gene was amplified using oligonucleotides YabT-F-SalI and YabT-R-SphI  and the secondary goat peroxidase-coupled anti-mouse IgG antibodies . The immuno-detection was developed using the kit Clarity Western ECL substrate (Bio-Rad) as per the manufacturer on a ChemiDoc (Bio-Rad) imaging system. The images were analyzed using Image Lab.For YabT overproduction, Figure 1). YabT was found to auto-phosphorylate and to phosphorylate YabA in vitro . The YabA phosphorylation site was identified by mass spectrometry as the threonine residue 71  and validated by MaxQuant . This extended linker was postulated to confer the high degree of flexibility observed in the YabA structure. These observations suggest that the phosphorylation at T71 could have an effect on the overall intrinsic flexibility of YabA.A purified His6-tagged recombinant form of YabT was incubated with the native YabA protein at a 1:25 ratio in the presence of 32P-\u03b3-ATP (yabA gene fused to the activating domain (AD) and binding domain (BD) of the yeast transcriptional factor GAL4 and the YabA-fusions were tested for their ability to interact with the different protein partners in a yeast two-hybrid assay  and terminus-proximal (ter) primer pairs , as already shown in previous studies . This indicated that the T71 residue was not involved in down-regulation of replication initiation and that YabT-dependent phosphorylation of YabA was not required for DnaA-mediated replication initiation control.We then investigated the role of YabA phosphorylation in replication initiation control.  studies . HoweverB. subtilis strains conditionally expressing a gfp-yabA, a gfp-yabA-T71A, or a gfp-yabA-T71D gene fusion from the ectopic chromosomal site amyE. These constructs were placed in their cognate wt-yabA, yabA-T71A, and yabA-T71D genetic backgrounds . Altogether, these experiments showed that YabA-T71A and YabA-T71D have retained all the functional properties of the wild type YabA, suggesting that phosphorylation of T71 is not involved in initiation control. Together with the retention of ability to interact with all there protein partners, these results provided evidence that the substitutions at T71 did not affect the structural and functional integrity of YabA.Previous studies established that YabA also exerts its function as part of a heterocomplex with DnaA and DnaN that localizes at the replication machinery. GFP-YabA fusion was found to form a discrete focus co-localizing with DnaN, and centrally localized at the nucleoid during most of the bacterial cell cycle . We consyabT from transcriptomes of B. subtilis cells exposed to many environmental and nutritional conditions revealed that yabT was expressed at an early stage of sporulation (data available at6). We examined the physiological conditions under which the yabT and yabA genes exhibited correlated expression profiles  during sporulation, with a maximum expression peak 3 h after the onset of sporulation, (ii) during biofilm formation, and (iii) after glucose exhaustion . We determined the survival efficiency of mature spores, expressed as the ratio of heat-resistant spores obtained 18 h after T0 . The yabA deleted strain was found to be significantly affected in sporulation, reaching 30% of efficiency compared to 70% of resistant spores for the wild type (P = 0.0038), indicating that yabA could play a role during sporogenesis. We observed that the yabA-T71A strain exhibited the same level of sporulation as the wild-type strain (\u223c70%) while the yabA-T71D mutant reached the highest sporulation efficiency slightly above 100% (P = 0.0043), indicating that YabA phosphorylation at T71 could enhance sporulation. Note that the sporulation efficiencies greater than 100% found in the yabA-T71D strain derivatives might result from the existence of short chains or doublets leading to an artificial excess of spore counts after heating treatment. The \u0394yabT mutant strain produced a final yield of mature spores similar to the wild-type, as previously observed. Examination of the \u0394yabT yabA-T71D double mutant revealed that the phosphomimetic mutant derivative of yabA exhibited the same propensity to stimulate sporulation in a yabT-deficient genetic background (yabT and yabA are part of the same pathway and suggests that YabT-dependent phosphorylation of YabA has an effect on sporulation (as further demonstrated below).Analysis of the transcriptional profiles of ckground . This inyabA-T71D  as compared to the wild-type (14.5%). In contrast, in the yabA-T71A strain the number of stage T2-sporulating cells was reduced by 1.6-fold  compared to the wild type  compared to the wild type (P < 0.0001). The sporulation increase phenotype observed in yabA-T71D was maintained over 6 h up to the production of mature spores , indicating a correlation between the level of YabT expression and the efficiency of entry into the sporulation process  upon the expression of the untagged YabT protein in yabA wild type cells, that was abolished in YabA-phosphorylation mutant cells, suggesting that the increase requires the integrity of the YabA phosphosite and did not result from unrelated YabT function . When cells enter the sporulation developmental program, phosphorylated Spo0A accumulates and activates its own expression . Indeed, the fluorescence profile of the gfp expressed from Pspo0A in the wild-type yabA background increased with time . Expression from Pspo0A in the yabA-T71A strain was found to be similar to that obtained in the wild-type background, while it is reduced twofold in the absence of yabA, hinting at a regulatory role of yabA in spo0A transcription. Interestingly, expression of the spo0A promoter was most efficient in the presence of the YabA-T71D protein, suggesting that indeed, accumulation of Spo0A\u223cP was enhanced in this strain. To further investigate the role of YabA phosphorylation on the sporulation transcription program, we examined the expression of promoters driven by the early sporulation specific sigma factors \u03c3F and \u03c3E. At the onset of sporulation, elevated levels of Spo0A-P activates the transcription factor \u03c3H that will trigger the expression of numerous genes including the spoIIA operon, encoding for \u03c3F as well as its regulators, and \u03c3E . Compared to the wild-type, the expression of PspoIIA-luc was diminished in the yabA-T71A strain but was significantly higher in a yabA-T71D background, consistent with sporulation kinetics and spore yields obtained earlier . Indeed, the lower expression in yabA-T71A could account for the sporulation delay observed in this strain , while the elevated expression in yabA-T71D is in accordance with the increased sporulation efficiency triggered by the phosphomimetic mutation. PspoIIID-luc expression is the highest in the yabA-T71D background. These observations are in agreement with the hyper-sporulation phenotype exhibited in the yabA-T71D strain. We also noticed that the expression of these early promoters was strongly delayed in the absence of YabA, which is consistent with a low sporulation efficiency of the \u0394yabA mutant. Taken together, these results highlighted a regulatory role of YabA phosphorylation at residue T71 during the early sporulation program. The stimulation of the expression of the early sporulation spoIIA gene indicates a positive activation of this \u03c3H-dependent promoter. These results provide additional evidence for enhanced levels of Spo0A-P mediated by YabA phosphorylation.Sporulation is an adaptive developmental program engaged when the bacteria encounter conditions of starvation, leading to the liberation of highly resistant spores . Sporulay system . Only cey system . Then, cy system . We evid, and \u03c3E . Both spB. subtilis is described to develop different biofilms from surface-associated to air-liquid pellicle . When cultured in glass tubes, the yabA-T71A and \u0394yabT mutant derivatives strains exhibited similar re-suspended biofilm cell densities than the wild type yabA, while biofilms formed by the \u0394yabA and the yabA-T71D strains were 44 and 77% less, respectively, suggesting a negative role of YabA phosphorylation in biofilm formation . Biofilm cell density was also investigated upon overexpression of a Flag-tagged YabT. We found that overexpression YabT correlated with a decrease of biofilm cell density , supporting that YabT-dependent phosphorylation of YabA may play a role in tuning of biofilm formation. The tridimensional structures of air-liquid biofilms pellicles formed in 12-well culture plates were visualized by confocal microscopy and their biovolume quantified using the software Imaris . Again, the wild type yabA, the yabA-T71A and \u0394yabT displayed similar biofilm structures with statistically comparable biovolumes. Contrastingly, both the YabA-T71D and the \u0394yabA strains totally failed to form a pellicle .Sporulation is an energy consuming process which becomes irreversible after engulfment of the prespore by the mother cell. Early after starvation, cells might also adopt other solutions to survive, such as cannibalism, competence or biofilm formation . The decpellicle . We lookFigure 7B). B. subtilis macrocolonies exhibit sophisticated three-dimensional structural designs on agar media, reflecting their ability to produce exopolysaccharides (EPS) polymers that compose the biofilm matrix, as well as other proteins important for the biofilm structure integrity  associated with localized zones of cell death that trigger mechanical forces to form wrinkled structures . This reduction of cell mass in the \u0394yabA biofilms could be attributed to the decrease of cell growth observed in this strain , associated with cell death during static growth in liquid as well as on semi-solid agar surfaces. Observation of the macrocolony morphology of the yabA-T71A revealed only a subtle difference compared to that of the wild-type strain, the later displaying a slight wrinkle phenotype at the center of the colony, not found in yabA-T71A . Interestingly, the yabA-T71D strain exhibited a smooth phenotype indicative of a defect in EPS production . The deletion of the yabT gene induced a similar absence of wrinkles as in yabA-T71A. This phenotype is not affected when combined with the non-phosphorylatable mutation of yabA (\u0394yabT yabA-T71A strain), while the \u0394yabT yabA-T71D strain exhibited the same smooth colony structure as the yabA-T71D strain. This indicated that YabT and YabA act in the same pathway regarding biofilm formation. Altogether, these results suggest that the YabA phosphorylation at T71 mediated by YabT prevents biofilm formation. Our results further support a role of YabT-mediated phosphorylation of YabA in negatively regulating biofilm formation through a Spo0A-directed repression of transcription of biofilm operons.We set out to confirm our findings from the angle of colony architecture formed on MSgg medium (ntegrity . The enhtor SinR . This istor SinR . We obseB. subtilis cell fate decision, through the modulation of Spo0A-P intracellular levels. YabA phosphorylation is carried out by the Ser/Thr kinase YabT, expressed at the early stage of sporulation and during biofilm formation. We established that YabA phosphorylation correlates with high cellular levels of Spo0A-P, leading to sporulation stimulation. A consequence of elevated levels of activated Spo0A is the prevention of the expression of the anti-repressor SinI, leading to full repression of the EPS operon by the master regulator SinR (Our results highlight the existence of a role of the phosphorylation of the replication initiation controller YabA in tor SinR . This coB. subtilis. Many proteins are found to be multifunctional in eukaryotic but also bacterial cells. These multitasking proteins exert a variety of activities in different biological pathways, thus contributing to cellular network complexity (The mechanism underlying this novel role of YabA remains to be further characterized. However, the discovery that YabA can carry out another function that seems to be unrelated to its primary function in replication initiation control contributes to the complexity of its biological role in mplexity . Post-trmplexity . Howevermplexity .B. subtilis cells with a useful cross talk between the different cellular processes for fine tuning cell fate decision and to better respond to environmental changes.YabA belongs to a family of replication controllers, largely conserved in low GC sporulating or non-sporulating Gram-positive bacteria. The YabT-targeted residue T71 of YabA is located in a structurally flexible domain linking the well conserved N-terminal and C-terminal parts. This flexible hinge is rather divergent among the YabA family of proteins and the residue T71 is not conserved in many other related bacteria. This novel function of YabA might provide SP, TGG,MV, andMFNGcontributed to the experimental design. SP, TGG, MV, VB, AD, CH, SCS, and MFNG performed the biological experiments. SP, TGG, IM, and MFNG contributed to critical analysis of the data. SP, TGG, and MFNG wrote the manuscript. All authors have read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Salmonella strains  from poultry used in the preparation of Salmonella antigens in Egypt.This work was conducted to study the phenotypic and genotypic characterization of locally isolated Salmonella strains was done using standard microbiological, biochemical, and serological techniques. Molecular identification was done using different sets of primers on different genes using different polymerase chain reaction (PCR) techniques.The phenotypic characterization of Salmonella strains was confirmed. Molecular identification revealed detection of 284 bp fragment of InvA gene in all studied Salmonella strains. Furthermore, multiplex PCR was used for more confirmation of being Salmonella spp., generally at 429 bp as well as genotyping of Salmonella Typhimurium and Salmonella Enteritidis at 559 and 312 bp, respectively, in one reaction.The phenotypic characterization of Salmonella strains were confirmed phenotypically and genotypically to be Salmonella Enteritidis, and Salmonella Typhimurium and could be used for the preparation of Salmonella antigens.The locally isolated field  Salmonella organisms are responsible for a variety of acute and chronic diseases in poultry, animals, and humans [Salmonella bacteria are facultative intracellular pathogens causing localized or systemic infections, in addition to a chronic asymptomatic carrier state. Many different serotypes of Salmonella have been isolated from poultry, most of them have a public health significance, but some include Salmonella Typhimurium, Salmonella Enteritidis, Salmonella Pullorum, and Salmonella Gallinarum can cause considerable losses in birds of less than a few weeks of age [Salmonella enterica serovars Typhimurium and Salmonella enterica serovars Enteritidis are the most frequently isolated serovar from foodborne outbreaks throughout the world [Salmonella Pullorum is a typical bacterial disease that has threaten the modern poultry industry over the past years. Chicken becomes the carrier in the spread of Salmonella Pullorum and may cause economic losses worldwide through mortality, morbidity, and reductions in egg production [Salmonella include selective enrichment and plating followed by biochemical tests and serological identification [d humans . Salmones of age . Salmonehe world . Salmoneoduction . Establification . In genefication . Howeverfication .In vitro amplification of DNA by the polymerase chain reaction (PCR) method is a powerful tool in microbiological diagnostics [Salmonella in natural environmental samples as well as food and fecal samples. Virulence chromosomal genes - including invA, invE and himA, phoP - are target genes for PCR amplification of Salmonella species [Salmonella contains sequences unique to this genus and has been proved as a suitable PCR target with potential diagnostic applications [Salmonella Enteritidis and Typhimurium using multiplex PCR reaction is depending on sefA gene which encodes for SEF14 fimbrial antigen characteristic for Salmonella Enteritidis while fliC gene variable region encoding for flagellin H1 was characteristic for Salmonella Typhimurium [gnostics . Several species . The invications . Multiplications . Typing himurium .Salmonella strains used in the preparation of Salmonella antigens in Egypt by both phenotypic and genotypic methods.The objective of this work was to characterize the locally isolated The approval from the Institutional Animal Ethics Committee to carry out this study was not required as no invasive technique was used.Salmonella strains  isolated from chickens, kindly obtained from Bacterial Sera and Antigens Research Department, Veterinary Serum and Vaccine Research Institute, Abbasia, Egypt were used to study their phenotypic and genotypic characterization. All isolates were confirmed as Salmonella different types using both morphological and biochemical identification [Salmonella antisera [Three local field fication . Serologantisera .g for 10 min. The supernatant was used for amplification by PCR using Salmonella-specific primers. The extract was divided into aliquots and kept at \u221220\u00b0C until use as PCR template [That was performed by boiling the overnight incubated culture broth for 10 min in dry bath and centrifuged at 5000 \u00d7template .Salmonella spp. generally, a primer set was used for amplification of 284 bp of InvA gene [Salmonella spp. as well as typing of Salmonella Typhimurium and Salmonella Enteritidis in a multiplex PCR reaction [Salmonella Pullorum was done using a duplex PCR, to differentiate between Salmonella Gallinarum and Salmonella Pullorum depending on the presence of speC gene in both strains but glgC gene is unique for Salmonella Gallinarum only [Primers used were supplied by Metabion (Germany) and summarized in nvA gene . Anotherreaction . Typing rum only .Amplification was performed as following: 12.5 \u00b5l of \u00d72 Dream Taq Green PCR Master Mix (Fermentas), 100 pmol of upstream primer, 100 pmol of downstream primer, 4 \u00b5l of template DNA and nuclease-free water up to 25 \u00b5l using thermal cycler PerkinElmer Gene Amp PCR system 9700. Amplification conditions of 284 bp of InvA gene where the thermal cycler were adjusted to 1 cycle at 95\u00b0C for 1 min, then 35 cycles at 95\u00b0C for 1 min, 64\u00b0C for 30 s, 72\u00b0C for 30 s followed by 1 cycle at 94\u00b0C for 4 min . For mulAll amplified products were analyzed by electrophoresis using 1-1.5% agarose gel  and visualized by ultraviolet transilluminator after gel staining with ethidium bromide stain (Fisher). The product size was measured using 100 bp DNA Ladder (Fermentas) that was used as a marker for PCR products. The gel was photographed by a gel documentation system , and the data were analyzed through computer software.Salmonella Pullorum was purified with agarose gel extraction kit Qiaquick . Sequence analysis of this fragment was performed using the same PCR primers .PCR fragment of speC gene of Salmonella strains used in preparation of Salmonella antigens in Egypt were tested and confirmed to be Salmonella species phenotypically by culturing and biochemical testing. Furthermore, these strains were confirmed serologically to be Salmonella Pullorum, Salmonella Enteritidis, and Salmonella Typhimurium  showing specific bands at 429 bp  showed that this PCR fragment is not related to speC or glgC genes at all but it was related to yejBEF gene which is common among many other Salmonella spp.Duplex PCR for identification of Salmonella contamination of eggs has been identified as a public health concern worldwide. Globally, Salmonella is one of the most prevalent causes of foodborne illness [Salmonella in foodstuffs [Salmonella identification by molecular techniques is the simplest and less expensive method [ illness . Cultureodstuffs . These todstuffs  and are odstuffs . InvA gee method .Salmonella antigens in Egypt were tested and confirmed phenotypically to be Salmonella Pullorum, Salmonella Enteritidis and Salmonella Typhimurium by culturing, biochemical testing and serological characterization. These strains were confirmed to be related to Salmonella spp. by invA specific PCR methods as all isolates showed positive bands at 284 bp  showing specific bands at 429 bp (Salmonella spp. Multiplex PCR could differentiate between Salmonella Enteritidis and Salmonella Typhimurium that showing sharp specific bands at 312 and 559 bp, respectively (Salmonella spp. as well as genotypic characterization of different Salmonella type either Salmonella Typhimurium, Salmonella Enteritidis and can be used as confirmatory tool with high sensitivity even if biochemical or serological tests were not available or the time factor is critical [In this study, all the three locally field isolated strains used in the preparation of t 284 bp  which agt 429 bp  for all ectively . Using tcritical ,12.Salmonella Pullorum at 174 bp [Salmonella serovars revealed several insertions, deletions, and rearrangements in serovars Gallinarum [Salmonella spp. [Salmonella genome as the primer design was based on an 11 bp deletion in the glgC gene and a 4 bp deletion in speC. Furthermore, it was found that glgC gene was a pseudogene in Salmonella Gallinarum while speC was a pseudogene in both biovars. In bacterial genomes, pseudogenes are continually created from ongoing mutational processes and are subject to degradation and removal by further accumulation of mutations. Their retention time seems to be extremely short and, even in very closely related bacteria, they tend to be deleted at a relatively rapid rate [Salmonella Pullorum, as the previously reported conventional DNA-based methods are not feasible due to a high level of sequence similarities among Salmonella serovars as well as the limitation in resolution between biovars Gallinarum and Pullorum [Duplex PCR results as shown in t 174 bp  but it wt 174 bp  and its llinarum . All thella spp.  that conlla spp. . The falpid rate . All thePullorum ,28. FurtPullorum ,30.Salmonella strains were confirmed phenotypically and genotypically to be Salmonella Enteritidis and Salmonella Typhimurium and could be used for the preparation of Salmonella antigens. Further studies are required to develop and establish rapid and accurate protocols for genotyping of Salmonella Pullorum.The locally isolated field HMI and HAA designed the work. HMI, DAMA and HAA conducted the research work. Data analysis and manuscript were written by HMI, DAMA and HAA under the guidance of MIE. All the authors have read and approved the final manuscript."}
+{"text": "The aim of this study is to evaluate the durability of off-label use of DEXP in the treatment of primary vesicoureteral reflux in children.DuraspherePatients who underwent subureteric injection of DEXP for the correction of primary VUR were retrospectively reviewed. Patients aged >18 years as well as those who had grade-I or -V VUR, anatomic abnormalities , neurogenic bladder or treatment refractory voiding dysfunction were excluded. Radiologic success was defined as the resolution of VUR at the 3rd month control. Success was radiographically evaluated at the end of the first year.Thirty-eight patients  formed the study cohort. Forty-six renal units received DEXP . Mean volume per ureteric orifice to obtain the mound was 0.70\u00b10.16mL. First con- trol VCUG was done after 3 months in all patients. After the first VCUG, 6 patients had VUR recurrence. Short-term radiologic success of DEXP was 84.2%. Rate of radiologic success at the end of the first year was 69.4% (25/32). Lower age (p:0.006) and lower amount of injected material (p:0.05) were associated with higher success rates at the end of 1 year.This is the first study to assess the outcomes of DEXP for treatment of primary VUR in children. After 1 year of follow-up, DEXP had a 69.4% success rate. Vesicoureteral reflux (VUR) is a challenging problem in pediatric urology. Treatment options include close observation, continuous antibiotic prophylaxis, endoscopic subureteric injection, and open/robotic ureteric re-implantation. Urinary tract infections (UTIs) concomitant with VUR can lead to renal scarring and hence hypertension and renal failure . TreatmeSubureteric injection of bulking agents has been shown to be a good alternative to ureteric re-implantation. The success of endoscopic treatment is dependent not only to the features of the bulking agent but also grade of VUR, presence of lower urinary tract dysfunction (LUTD) and anatomical abnormalities. The initial substance to be used was Teflon\u2122 while dextranomer/hyaluronic acid (Dx/HA) was the first agent to be approved by the US Food and Drug Administration (FDA) for VUR treatment in children in 2001. Since then, Dx/HA has been used widely for the correction of low-grade VUR and has become the \u201cgold standard\u201d. The migration risk of Teflon, reduced prevalence of overall success (77%) and a relatively high prevalence of recurrence of Dx/HA (11-26%) have had pivotal roles in the development of new bulking agents with better outcomes .\u00ae EXP (DEXP) has been actively used in urological practice since 1999 to treat stress urinary incontinence in women. Here, we evaluated the durability of off-label use of Durasphere\u00ae EXP (DEXP) for the treatment of primary VUR in children.Another non-biodegradable agent, DurasphereThe injectable bulking agent DEXP  is a compound of biocompatible and non-biodegrad-able particles of zirconium oxide covered with pyrolytic carbon suspended in a water gel with 2.8% beta-glucan . It is aAfter obtaining local review board approval, medical files of patients who had undergone subureteric injection of DEXP for correction of primary VUR in our clinic between February 2008 and March 2013 were reviewed retrospectively. Age, sex, presenting symptoms, laterality and degree of VUR , presence of renal scars in DMSA (Di-Mercapto-Succinic Acid) scintigraphy, volume of injected material, and previous intervention for VUR were noted. Patients aged >18 years as well as those who had VUR grade I or V, anatomic abnormalities , neurogenic bladder or voiding dysfunction refractory to appropriate medical treatment were excluded . All patEndoscopic procedures were performed after a sterile urine culture was obtained in all patients. Subureteric injection was undertaken under general anesthesia using a 9.5-Fr, 6\u00b0 pediatric cystoscope  with a metal 3.7-channel, 20-G, pencil point-tip needle (254mm or 381mm) by two surgeons . DEXP was applied using the STING/hydrodistention method. All patients were discharged after spontaneous voiding on the day of the procedure. Patients were continued on their previously started antibiotic prophylaxis until the first voiding cystourethrogram (VCUG) at 3-month follow-up. Radiologic success was defined as the resolution of VUR at the 3rd month control VCUG. The durability of success in those patients was ra-diographically and clinically evaluated at the end of the first year.The normality hypothesis of the variables was examined by the Shapiro Wilk test. The group comparisons between the categorical variables were analyzed using Kruskall Wallis test and Dunn test was applied for subsequent multiple comparisons (Post-hoc). The comparison of the qualitative variables was done using the Fisher Freeman-Halton test. Statistical analyzes were performed using SPSS Version 21 software.Thirty-eight patients  and 46 renal units were treated with DEXP. Indications for subureteric injection were recurrent febrile UTI in 25 patients, VUR and renal scarring (in DMSA scintigraphy) in 10 patients, and non-resolving VUR at the follow-up for antenatal hydronephrosis in 3 patients. VUR was unilateral  in 30 patients and bilateral in 8 patients. Ten patients had received two subureteric injections previously using Dx/HA, whereas 28 received their first subureteric injection. A total of forty-six renal units received DEXP . Mean volume per ureteric orifice in order to ob-tain the mound was 0.70\u00b10.16mL. First control VCUG was undertaken after 3 months in all pa-tients. After the first VCUG, 6 patients  had failure. Thus, the 3-month radiologic success rate was 84.2% .During the follow-up of the patients with no VUR at 3-months, 1 patient had febrile UTI. Imminent VCUG revealed VUR recurrence . First-year control VCUG showed that 4 out of 29 patients had VUR recurrence. Of those with recurrent VUR, one patient had bilateral grade-III VUR and renal scarring preoperatively. The grade of VUR was down graded to bilateral grade 2. Also, 1 had bilateral grade-III VUR, 1 had unilateral grade-III VUR and 1 had unilateral grade IV VUR, previously. However, all of those patients were infection and LUTD free. Radiologic success at the end of the first year was 69.4%.Nine patients  without VCUG at 1 year were accepted as clinically successful since they were UTI and LUTD free. Success at 1st year was higher in the patients with lower age  and less amount of injected material .Moreover, presence of renal scar and presentation with recurrent UTI were the risk factors for reduced success rate (both p:0.023). The ratios and significance of variables are given in After surgery, 1 patient had a transient de novo hydronephrosis without functional loss according to scintigraphy. In addition, ten patients had a mean follow-up of >3 years without any sign of a UTI or urinary obstruction.Biodegradable synthetic materials have a high rate of reabsorption over time. Dx/HA is included in this group, and its rate of recurrence in long-term follow-up studies has been reported to be 11-26% . It has \u00ae was introduced as a biocompatible, non-migrating, non-erosive, non-immunogenic, non-biodegradable substance comprising large (212-500 microns) carbon-coated particles of zirconium oxide. In 1999, it was approved by the US FDA for the treatment of stress-type urinary incontinence caused by sphincter insufficiency in women. Its production was discontinued because of its high viscosity (which caused difficulties in injection) and because patients had asymptomatic migration of lymph and formation of sterile pseudo-abscesses after periurethral injection. The manufacturer replaced the product with a sub-stance of smaller-sized particles (90-212 microns) under the name \u201cDurasphere\u00ae EXP\u201d  and radiologic  means, as well as by scintigraphy. We found the rate of short-term (3 months) radiologic success of DEXP to be 81.3% (32/38). Rate of radiologic success at the end of the first year was 69.4% (25/32). Our results indicated that durability of success is significantly higher in younger children and lower VUR degree. Additionally, achieving the intended amount of mound using as little injection material as possible was found to be associated with long-term success.The short-term success of non-biode-gradable PAHG for endoscopic treatment of VUR was shown to be 81.2%. The authors found at the second injection that the mound obtained with PAHG at first injection was flattened or displaced, and that the fluidity of PAHG could be the reason for such failures . In our PPC was shown to have good overall success in VUR treatment (83.6-95%) . RecurreIn our study, de novo hydronephrosis or a UTI were not observed in 10 cases who had a follow-up of 3 years. Postoperatively, 1 patient had a transient de novo hydronephrosis without functional loss according to scintigraphy and the hydronephrosis resolved eventually. The decrease of success in time may be related to the substance itself as well as patient related factors . This finding confirms that biodegradability may not be the scapegoat for reflux recurrence after endoscopic injection.One important aspect of the material was the rapid clotting potential. If the initial puncture was not in the right sub-mucosal plane or the needle faces some resistance, carbon particles may not find their route and the water-based carrier gel component of the material goes through the needle. If that happens, the carbon particles would no longer flow through the needle that ne-cessitate a brand-new needle and injection material to be used.Our study was limited due to its retrospective nature. In addition, the prevalence and type of complications were not reported. The sustainability of the ureteric mound could have been measured during control urinary ultrasonography.This is the first study on the 1-year outcomes of DEXP for endoscopic treatment for primary VUR in children. DEXP had a durability of 69.4%. Our results reveal that biodegradability of the injected material is not the sole factor for the late recurrence of endoscopic treatment of VUR. Further prospective, randomized controlled trials with long-term results are needed to determine the efficacy and durability of DEXP for VUR treatment.Ethical Standard: All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Formal consents were obtained from parents."}
+{"text": "Indoor farming is becoming a popular alternative approach in food production to meet the demand of a growing world population. Under this production system, artificial light provides the main source of illumination in sustaining plant growth and development. The use of light-emitting diodes (LEDs) is a popular source of artificial light for indoor farms due to its narrow light spectra, modular design and energy efficiency. This study purposely assessed the effect of monochromatic LED light quality on the growth of three varieties of artichoke seedlings compared to greenhouse condition. Spectral quality assessment showed that photosynthetic photon flux density (PPFD) was highest under red LED light, but only a third of the total PPFD under natural light. Seedlings grown under red light showed 60\u2013100% more shoot dry weight and were 67\u2013115% taller than seedlings grown in the greenhouse. However, seedlings under blue or white light conditions showed 67\u201376% less in biomass compared to greenhouse-grown seedlings. Overall, plant response of seedlings under red light condition was much better compared to greenhouse-grown seedlings emphasizing the importance of red light spectral quality in plant growth and development. The world population is estimated to reach the nine-billion mark by 2050 of which 66% will be living in urban areas UN, . This grIndoor farming has become a popular form of urban agriculture as an alternative approach in food production. Artificial light source is a critical component in indoor farming since light is one of the most important environmental factors affecting plant growth and morphology  were germinated in 72-cell plug trays in the greenhouse. At two-leaf stage, artichoke seedlings were transplanted into cone-tainers 3.8 \u00d7 21 cm)  with SunGro soil medium . Then the seedlings were transferred to a growth room and were placed on light shelves with individual light-emitting diode (LED) LumiGrow Pro 325 light sources  set at red, white and blue lighting conditions. Another set of seedlings was left in the greenhouse for comparison. Black cloth was used to cover each shelf to prevent light contamination. Plants were grown in a 16/8 h photoperiod (day/night) at 22\u00b0C temperature. Spectral quality for each light condition  camera  at a shutter speed of 1/60 s, f-stop set at f/5.6, and focal length of 55 mm. The camera was mounted on a tripod and fixed at a distance of 51 cm from the leaf samples. The LED light source was placed at the same distance from the plants. The digital images were saved in JPEG format at a size of 5,184 \u00d7 3,456 pixels and were downloaded to a personal computer for analysis using ImageJ software. Batch measurement of the RGB values from each digital image was conducted using a macro developed for ImageJ software. The RGB values were converted to HSB  values using the colorsys module in Python. The Dark Green Color Index (DGCI) was calculated using the formula: DGCI = [(H \u2212 60)/60 + (1 \u2212 S) + (1 \u2212 B)]/3  tests were done on significantly different treatment means. All statistical analyses were done using JMP statistical software . Normality of residuals was assessed by normal quantile plot and tested for goodness-of-fit using Shapiro-Wilk W-Test. Tests of homoscedascity of variances were done using four different tests  for each factor  were used for significance tests of the treatment effects. \u22122s\u22121) was at 750 nm. For the blue LED light, the spectrum was narrow (423\u2013478 nm) with the highest PPFD value (1.497 \u03bcmol m\u22122s\u22121) observed at 448 nm. For the red LED light, the spectrum was also narrow (623\u2013695 nm) with highest PPFD value (7.879 \u03bcmol m\u22122s\u22121) observed at 666 nm. In contrast, white LED light showed low PPFD values ranging between 0 and 0.135 \u03bcmol m\u22122s\u22121 and the maximum value observed at 603 nm. Table \u22122s\u22121) in the region of 400\u2013700 nm wavelength. Red light treatment came in second at 236.54 \u03bcmol m\u22122s\u22121, while white light had the lowest total PPFD (21.44 \u03bcmol m\u22122s\u22121) among all light treatments. Among the different light treatments, R/B ratio was highest in red light (77.22) followed by white and natural lights, at 3.75 and 1.39, respectively. Illuminance was high under natural light at 44,679 lux followed by red, white and blue light at 2,120, 1,429, and 335 lux, respectively.Monochromatic LED lights provide specific light spectrum that can be used to assess the effect of precise spectral quality on the growth and development of crops. In our study, spectral quality for each light treatment was measured and Figure p = 0.0156). Influence of light treatment on plant height was highly significant (p < 0.0001). Under red light treatment, artichoke seedlings were taller (average of 22 cm) compared to plants under blue (11 cm), natural (11 cm), and white (7 cm) light conditions. The interaction between light treatment and artichoke genotype was apparent in all genotypes under red light . Root lengths of plants under red (27 cm) and natural (23 cm) light conditions were the longest and showed similar influence across all genotypes tested .In contrast, root length was not influenced by genotype but only by light treatment  and light conditions (p < 0.0001)  and light conditions (p < 0.0001), and the interaction of the two factors (p = 0.0047) as well. Genotype had a significant influence on biomass as shown by the Cardoon variety which was significantly different from Violetto (p = 0.05). Light spectral quality has significant influence on artichoke genotype biomass. Statistical analyses showed that Cardoon was significantly different from Violetto (p = 0.05), but not significantly different from Green Globe. Further, seedlings' shoot biomass was least for artichokes grown under white light (0.097 g) and significantly higher (8-fold) for those grown under red light. The blue light-treated seedlings resulted in a 6-fold decrease in the biomass compared to those exposed to red light. The same trend was noted in the root biomass for seedlings that underwent white and blue light treatments. Calculations of shoot/root ratio showed that Green Globe had the highest value (5.1) compared to Cardoon (3.7) and Violetto (3.6). Green Globe had the highest S/R ratio because it produced less root biomass compared to the two other varieties. Overall, seedlings grown under red light condition resulted in 22\u201397% increase in growth compared to natural light condition   Figure . Accumul) Figure , but wasp < 0.0001) influence on DGCI values. Correlation between DGCI and total chlorophyll content showed moderate positive correlation (r = 0.56) under white light. Other light treatments showed weak negative correlations between DGCI values and chlorophyll content. This shows that DGCI values can be used as an alternative indicator of chlorophyll content in artichoke, but protocol needs further optimization to determine if genotype could influence DGCI values. In turfgrass for instance, color evaluation under the National Turfgrass Evaluation Program, genetic color is being considered in the evaluation to cover the inherent color of the genotype being evaluated (http://www.ntep.org/reports/ratings.htm).Plant color is a criterion used in plant phenotyping to assess the effect of treatment imposed during the growing period of plants and is considered as visual indicator of quality in vegetables  when grown under red light compared to plantlets under blue or fluorescent light (13% rooted)  to a depth of 8 mm in gray-white soil .Red light treatment also influenced root growth by as much as 71% in var. Cardoon compared to same variety grown in the greenhouse. Our findings concur with a study about grapes grown in vitro propagation of P. cynaroides (Wu and Lin, Light quality also affected leaf development as artichoke seedlings under red light had 28% more leaves and 26% and 39% more leaves under blue and white light, respectively when compared to greenhouse-grown artichokes. Similarly, under red light, hydroponically-grown lettuce developed more leaves than those grown under blue light (Yanagi et al., The response to light is dependent upon genotype as other studies (Li et al., Light is an important factor in plant growth and development. In controlled environment agriculture, it is critical to optimize the spectral quality of the artificial light source for plant production in indoor farming facilities. The use of LED lights is becoming a popular source of artificial light for indoor farming. However, its utilization needs to be optimized because LED lights only provide a narrow spectrum of light. Using monochromatic LED lights, our study identified specific spectrum that greatly influenced the growth and development of indoor-grown artichoke seedlings. Results showed that red LED compared to natural light condition significantly influenced seedling growth and development by up to 97% increase across three artichoke genotypes. All plant characters measured exhibited 22\u201397% increase in red LED-treated artichoke seedlings compared to greenhouse-grown plants. Growth increase was highest in the red-light spectrum, establishing the importance of this spectrum for enhancing the growth of artichokes indoors. The study also demonstrated the contrasting effect of white and blue light treatments on seedling growth. The two light treatments resulted to 54\u201380% reduction in growth compared to natural-light grown plants. This study provides baseline information for indoor farming practitioners in the design of light system for indoor growing of artichokes.RR, PR, TT, and GB conceived the experiments. RR conducted the experiments. RR and TT analyzed the data. RR and PR wrote the manuscript. The manuscript was reviewed by RR, PR, TT, and GB.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Quadriacanthus Paperna, 1961 (Dactylogyridae). The genus remains taxonomically challenging due to its speciose nature and relatively wide host range representing two fish orders, i.e. Siluriformes and Osteoglossiformes, in Africa and Asia. Here, we investigated diversity of Quadriacanthus spp. parasitizing Clarias gariepinus (Burchell), Heterobranchus bidorsalis Geoffroy Saint-Hilaire, and Bagrus docmak (Forssk\u00e5l) collected in the Lake Turkana (Kenya) and Nile River Basin (Sudan). The interspecific relationships among Quadriacanthus spp. parasitizing catfishes inferred from ribosomal DNA sequences were investigated for the first time.African catfishes of the families Bagridae and Clariidae are known to be parasitized with monogeneans of Quadriacanthus spp., by means of phase contrast microscopic examination of sclerotized structures, and assessing the genetic divergence among the species found using rDNA sequences.A combined morphological and molecular approach was used for description of the new species and for a critical review of the previously described Quadriacanthus were identified. These were as follows: Quadriacanthus aegypticus El-Naggar & Serag, 1986, Quadriacanthus clariadis Paperna, 1961, Quadriacanthus fornicatus n. sp., Quadriacanthus pravus n. sp., and Quadriacanthus zuheiri n. sp. from Clarias gariepinus (Clariidae); Quadriacanthus mandibulatus n. sp. from Heterobranchus bidorsalis (Clariidae); and Quadriacanthus bagrae Paperna, 1979 from Bagrus docmak (Bagridae). For both 18S-ITS1 and 28S rDNA regions, Q. clariadis from a clariid fish was found to be most closely related to Q. bagrae from a bagrid host. Quadriacanthus mandibulatus n. sp. was observed to be the most distant species from the others. The separation of Q. mandibulatus n. sp. from the other species corresponds with the different morphology of its copulatory tube. The copulatory tube is terminally enlarged in Q. mandibulatus n. sp., while the tube in all other congeners studied is comparatively small and with an oblique tapering termination.Seven species (including four new) of Quadriacanthus spp. The observed interspecific genetic relationships among Quadriacanthus spp. from clariids and Q. bagrae from a bagrid host suggest a possible host-switching event in the evolutionary history of the genus. Our records extend the currently known geographical range for Quadriacanthus spp. to Kenya and Sudan.This study contributes to a better understanding of African dactylogyrid diversity and provides the first molecular characterization of  Monogenea is a diverse group of mostly ectoparasitic flatworms showing great potential as model organisms to study the ecological and evolutionary processes that drive diversification and speciation. The high host specificity shown by most monogeneans enables searches for links between the ecological characteristics of the hosts and the diversity of their parasites .Quadriacanthus Paperna, 1961 (Dactylogyridae) represents one of the genera with wider host and geographical distribution. Although this genus comprises mostly gill parasites of African and Asian clariids , one species has been recorded on bagrids  and one species on phylogenetically distant notopterids  in Africa  figure 1 (identified as the sclerotized structures of Q. bagrae) and figure 2 are identical ; indeed, figure 2 was later replaced with the correct version  as an erratum to Dou\u00ebllou & Chishawa's [The present specimens closely fit the characters of the original description of  & Serag  as well  & Serag  and Dou\u00eb & Serag  and ther & Serag  the illuishawa's  figure 1Quadriacanthus aegypticus is most similar to Q. clariadis on the basis of the morphology of the haptoral sclerites. It differs from the latter species by having (i) noticeably larger ventral anchors in relation to the ventral bar; (ii) a ventral anchor with an elongated shaft ; (iii) a sclerotized vagina; and (iv) an accessory piece with two claw-like hooks serving as a guide for the distal portion of the copulatory tube and a medial part modified into two protruding diverticula.Quadriacanthus bagraePaperna, 1979Quadriacanthus clariadis bagrae Paperna, 1979Syn. Type-host and locality:Bagrus docmak (Forssk\u00e5l) (syn. B. docmac) (Bagridae), Lake Victoria, Uganda [, Uganda .Host:Bagrus docmak (present study).Locality: Nile River Basin, Sudan  (present study).Site in host: Gill lamellae.Other records:Bagrus docmak (syn. B. docmac), Albert-Nile near Chobe, Uganda [Bagrus bajad (syn. B. bayad), Lake Albert, Uganda [Bagrus orientalis, River Ruaha, Tanzania [Clarias gariepinus (syn. C. lazera), River Nile near Cairo, Egypt [Clarias gariepinus, Lake Kariba, Zimbabwe [C. gariepinus, River Gomti, Lucknow, State of Uttar Pradesh, India [, Uganda ; Bagrus , Uganda ; Bagrus Tanzania ; Clariaso, Egypt ; ClariasZimbabwe ; C. garih, India .Voucher material: MNHN HEL628 ; MNHN HEL629 ; IPCAS M-633 . Hologenophore: MNHN HEL641 .Representative DNA sequences: 18S-ITS1 rDNA (GenBank acc. no. KX713993) and 28S rDNA (GenBank acc. no. KX685951) ; greatest width 156\u2013194 . Haptor 100\u2013124  long, 161\u2013194  wide. Ventral anchor: a\u00a0=\u00a027\u201333 ; b\u00a0=\u00a09\u201314 ; c\u00a0=\u00a08\u201311 ; x/y\u00a0=\u00a01.1\u20131.6 . Dorsal anchor: a\u00a0=\u00a037\u201343 ; b\u00a0=\u00a08\u20139 ; c\u00a0=\u00a016\u201318 ; x/y\u00a0=\u00a00.9\u20131.3 . Ventral bar: d\u00a0=\u00a047\u201357 . Dorsal bar: e\u00a0=\u00a058\u201373 ; f\u00a0=\u00a026\u201333 ; g\u00a0=\u00a017\u201323 ; h\u00a0=\u00a012\u201315 . Hooks: 7 pairs; i\u00a0=\u00a012\u201325 : hook I 14\u201316 ; hooks II\u2013V 12\u201316 ; hook VI 21\u201325 ; hook VII 13\u201315 . Vagina: not observed. MCO: k\u00a0=\u00a032\u201335 ; l\u00a0=\u00a029\u201333 .[Based on 10 flattened and 3 unflattened specimens in GAP; Fig. Q. clariadis and adequately redescribed by Kritsky & Kulo [Q. bagrae by Dou\u00ebllou & Chishawa [Quadriacanthus species, most probably with Q. clariadis. Their depiction of the sclerotized structures of \u201cQ. bagrae\u201d (figure 1) shows a ventral bar with elongated arms  and a dorsal anchor with an elongated bent shaft and short point , all of which are characters consistent with specimens identified as Q. clariadis by El-Naggar & Serag [Q. clariadis rather than to those of Q. bagrae. According to our observations, the morphology of Q. bagrae and Q. clariadis male copulatory organ is very similar; the morphology of haptoral sclerites, however, clearly differs between the two Quadriacanthus species.This species was elevated from subspecies status under y & Kulo . The mory & Kulo . Small dChishawa  is erron & Serag , Kritsky & Serag , Tripath & Serag , and the & Serag  themselvQ. bagrae was 921\u00a0bp long, of which 515\u00a0bp corresponded to the partial 18S rDNA region and 406\u00a0bp corresponded to the entire ITS1 region. The sequence of the partial 28S region was 777\u00a0bp long. No intraspecific variability was found in 18S-ITS1 or 28S sequences.The sequence of the 18S-ITS1 region of Quadriacanthus clariadisPaperna, 1961Quadriacanthus clariadis clariadis Paperna, 1979Syn. Type-host and locality:Clarias gariepinus (Burchell) (syn. C. lazera) (Clariidae), Lake Galilee, Israel [, Israel .Host:Clarias gariepinus (present study).Localities: Lake Turkana, Kenya ; Nile River Basin, Sudan  (present study).Site in host: Gill lamellae.Other records:Clarias gariepinus (syn. C. lazera), Bahr Mouis, River Nile near Zagazig, Egypt [C. gariepinus, River Gomti, Lucknow, State of Uttar Pradesh, India [C. gariepinus, Nwanedi-Luphephe Dams, Limpopo River System, South Africa [g, Egypt , Lake Mag, Egypt , River Ng, Egypt ; C. garih, India ; C. garih Africa .Voucher material: MNHN HEL627 ; MNHN HEL630 ; MNHN HEL631 ; MNHN HEL632 ; IPCAS M-262 . Hologenophore: MNHN HEL642 .Comparative material examined: Voucher specimen of Quadriacanthus clariadis Paperna, 1961 (MRAC 37.160).Representative DNA sequences: 18S-ITS1 rDNA (GenBank acc. no. KX713994) and 28S rDNA (GenBank acc. no. KX685952) ; greatest width 89\u2013115 . Haptor 68\u2013119  long, 113\u2013151  wide. Ventral anchor: a\u00a0=\u00a028\u201331 ; b\u00a0=\u00a010\u201313 ; c\u00a0=\u00a07\u201310 ; x/y\u00a0=\u00a01.1\u20131.9 . Dorsal anchor: a\u00a0=\u00a045\u201351 ; b\u00a0=\u00a05\u20137 ; c\u00a0=\u00a015\u201320 ; x/y\u00a0=\u00a00.9\u20131.0 . Ventral bar: d\u00a0=\u00a053\u201364 . Dorsal bar: e\u00a0=\u00a054\u201365 ; f\u00a0=\u00a029\u201337 ; g\u00a0=\u00a013\u201319 ; h\u00a0=\u00a013\u201316 . Hooks: 7 pairs; i\u00a0=\u00a012\u201339 : hook I 18\u201322 ; hooks II\u2013V 12\u201315 ; hook VI 33\u201339 ; hook VII 15\u201316 . Vagina: not observed. MCO: k\u00a0=\u00a026\u201328 ; l\u00a0=\u00a024\u201327 .[Based on 10 flattened and 3 unflattened specimens in GAP; Fig. Quadriacanthus clariadis contains photographs indicating that the authors found two Quadriacanthus species, i.e. Q. clariadis and Q. aegypticus, but were not able to distinguish between them  [Q. clariadis and Q. aegypticus is provided in the remarks for the latter species. Quadriacanthus allobychowskiella is easily separated from Q. clariadis by its dorsal anchor having a large accessory sclerite. In Q. agnebiensis and Q. longifilisi, the hooks of pair VII are markedly longer that those of the corresponding pair in Q. clariadis.This species was adequately redescribed by Kritsky & Kulo . Examinahem (see ). Quadrit, 1999) , 33, 36 Q. clariadis was 920\u00a0bp long. This sequence included 514\u00a0bp of the partial 18S rDNA region and the complete 406\u00a0bp long ITS1 region. The sequence of the partial 28S region was 845\u00a0bp long. No intraspecific variability was found in the 18S-ITS1 and 28S sequences.The combined 18S-ITS1 sequence of Quadriacanthus fornicatusFrancov\u00e1 & \u0158ehulkov\u00e1 n. sp.Type-host:Clarias gariepinus (Burchell) (Clariidae).Type-locality: Nile River Basin, Sudan .Other locality: Nile River Basin, Sudan .Type-material: Holotype: MNHN HEL633. Paratypes: MNHN HEL634 (1 specimen); IPCAS M-634 (1 specimen).Voucher material: MNHN HEL639 ; IPCAS M-634 . Hologenophore: MNHN HEL643 .Site in host: Gill lamellae.Representative DNA sequences: 18S-ITS1 rDNA (GenBank acc. no. KX713995) and 28S rDNA (GenBank acc. no. KX685953)  [zoobank.org:pub:ADCB9E56-E8F1-48B6-AD21-BBA5E52D0B39. The LSID for the new name Quadriacanthus fornicatus n. sp. is urn:lsid:zoobank.org:act:6C76112A-B9EA-45E4-9DBB-96B3738A12CF.e (ICZN) , detailsEtymology: The specific name is derived from Latin  and refers to the shape of the dorsal anchor shaft.n\u00a0=\u00a02); greatest width 75\u201384 . Haptor 77\u201384  long, 84\u201395  wide. Ventral anchor with moderate base, curved shaft, long point; accessory sclerite small, with subequal wings; a\u00a0=\u00a026\u201331 ; b\u00a0=\u00a011\u201313 ; c\u00a0=\u00a07\u20138 ; x/y\u00a0=\u00a01.0\u20131.3 . Dorsal anchor with broad base, curved shaft, long point; accessory sclerite moderate, with poorly differentiated wings; a\u00a0=\u00a032\u201339 ; b\u00a0=\u00a012\u201313 ; c\u00a0=\u00a09\u201314 ; x/y\u00a0=\u00a00.9\u20131.2 . Ventral bar composed of two elongated components; d\u00a0=\u00a044\u201354 . Dorsal bar with small anterior shield; mid-posterior process trapeziform, with uneven margins; e\u00a0=\u00a042\u201364 ; f\u00a0=\u00a017\u201333 ; g\u00a0=\u00a08\u201314 ; h\u00a0=\u00a09\u201313 . Hooks: 7 pairs, dissimilar in size; i\u00a0=\u00a012\u201329 : hook I 13\u201317 , hooks II\u2013V 12\u201314 , hook VI 25\u201329 , hook VII 13\u201314 . Vagina not observed. MCO comprising copulatory tube and accessory piece; k\u00a0=\u00a023\u201329 . Copulatory tube straight; base simple, without thickened margin or flange; l\u00a0=\u00a022\u201326 . Accessory piece basally articulated to the copulatory tube in the form of a spike-like structure; medial part lightly sclerotized; distal part a hook-like structure with broader base.[Based on 7 flattened and 2 unflattened specimens in GAP; Fig. Quadriacanthus fornicatus n. sp. could be confused with Q. simplex, a species described on Heterobranchus isopterus in Ivory Coast by N\u2019Douba et al. [Q. simplex is noticeably simpler than that in the new species.a et al. , by haviQ. fornicatus n. sp. was 912\u00a0bp long. This sequence included 493\u00a0bp of the partial 18S rDNA region and the complete 419\u00a0bp-long ITS1 region. The sequence of the partial 28S region was 847\u00a0bp long. No intraspecific variability was found in the 18S-ITS1 and 28S sequences.The combined 18S-ITS1 sequence of Quadriacanthus mandibulatusFrancov\u00e1 & \u0158ehulkov\u00e1 n. sp.Type-host:Heterobranchus bidorsalis Geoffroy Saint-Hilaire (Clariidae).Type-locality: Nile River Basin, Sudan .Other locality: Lake Turkana, Kenya .Type-material: Holotype: MNHN HEL635. Paratypes: MNHN HEL635 (1 specimen); MNHN HEL636 (1 specimen); IPCAS M-635 (1 specimen).Voucher material: MNHN HEL637 ; IPCAS M-635 . Hologenophore: MNHN HEL644 .Comparative material examined: Type-specimens of Quadriacanthus thysi N\u2019Douba, Lambert & Euzet, 1999 .Site in host: Gill lamellae.Representative DNA sequences: 18S-ITS1 rDNA (GenBank acc. no. KX713996) and 28S rDNA (GenBank acc. no. KX685954)  [zoobank.org:pub:ADCB9E56-E8F1-48B6-AD21-BBA5E52D0B39. The LSID for the new name Quadriacanthus mandibulatus n. sp. is urn:lsid:zoobank.org:act:AD61A17B-E49C-49B6-B47F-A5CCA2EDD221.e (ICZN) , detailsEtymology: The specific name is derived from Latin  and reflects the insect mandible appearance of the dorsal bar process.n\u00a0=\u00a05); greatest width 132\u2013148 . Haptor 140\u2013184  long, 164\u2013192  wide. Ventral anchor with narrow base, shaft sharply (at about 90\u00b0) bent medially, slightly recurved (poorly differentiated) point; accessory sclerite Y-shaped, with two subequal wing-like processes; a\u00a0=\u00a028\u201330 ; b\u00a0=\u00a012\u201314 ; c\u00a0=\u00a09\u201315 ; x/y\u00a0=\u00a01.0\u20131.3 . Dorsal anchor with small base, elongated shaft bent (at about 90\u00b0) proximally and waved distally, short recurved point; accessory sclerite triangular; a\u00a0=\u00a072\u201386 ; b\u00a0=\u00a08\u20139 ; c\u00a0=\u00a024\u201327 ; x/y\u00a0=\u00a00.9\u20131.4 . Ventral bar composed of two elongated components articulating medially; d\u00a0=\u00a054\u201368 . Dorsal bar broadly V-shaped, with small anterior shield; large mid-posterior process, an insect mandible-like sclerotized structure distally passing into a lightly sclerotized membrane ; e\u00a0=\u00a084\u2013102 ; f\u00a0=\u00a028\u201341 ; g\u00a0=\u00a012\u201318 ; h\u00a0=\u00a013\u201317 . Hooks: 7 pairs, dissimilar in size; i\u00a0=\u00a012\u201374 : hook I 14\u201318 ; hooks II\u2013V 12\u201317 ; hook VI 67\u201374 ; hook VII 49\u201356 . Vagina not observed. MCO comprising copulatory tube and accessory piece; k\u00a0=\u00a070\u201379 . Copulatory tube a broad slightly curved tube with spoon-like base and subterminal flange; l\u00a0=\u00a066\u201371 . Accessory piece articulated to the base of the copulatory tube, with constricted medial part and hook-shaped terminal portion.[Based on 10 flattened and 5 unflattened specimens in GAP; Fig. Q. mandibulatus n. sp. resembles Quadriacanthus thysi described on the gills of Heterobranchus longifilis  by N\u2019Douba et al. [Q. thysi) and from all other congeneric species by having a comparatively broad copulatory tube with subterminal flange.Based on the comparative morphology of the haptoral sclerites, a et al. . The newQ. mandibulatus n. sp. was 879\u00a0bp long, of which 500\u00a0bp corresponded to the partial 18S rDNA region and 379\u00a0bp corresponded to the ITS1 region. The sequence of the partial 28S region was 777\u00a0bp long. No intraspecific variability was found in the 18S-ITS1 and 28S sequences.The sequence of the 18S-ITS1 region of Quadriacanthus pravusFrancov\u00e1 & \u0158ehulkov\u00e1 n. sp.Type-host:Clarias gariepinus (Burchell) (Clariidae).Type-locality: Nile River Basin, Sudan .Other locality: Nile River Basin, Sudan .Type-material: Holotype: MNHN HEL638. Paratype: IPCAS M-636 (1 specimen).Voucher material: MNHN HEL639 . Hologenophore: MNHN HEL645 .Comparative material examined: Voucher specimen of Quadriacanthus numidus Kritsky & Kulo, 1988 (MNHN 146 HF).Site in host: Gill lamellae.Representative DNA sequences: 18S-ITS1 rDNA (GenBank acc. no. KX713997) and 28S rDNA (GenBank acc. no. KX685955)  [zoobank.org:pub:ADCB9E56-E8F1-48B6-AD21-BBA5E52D0B39. The LSID for the new name Quadriacanthus pravus n. sp. is urn:lsid:zoobank.org:act:11D623F6-CA7D-434F-AB7C-28D44D17C0A5.e (ICZN) , detailsEtymology: The specific name is derived from Latin  and refers to the shape of the ventral anchor point.n\u00a0=\u00a02); greatest width 98\u2013144 . Haptor 78\u2013108  long, 111\u2013162  wide. Ventral anchor with small base, long evenly curved shaft; doubly recurved (waved) point; accessory sclerite small, wings unequal; a\u00a0=\u00a039\u201340 ; b\u00a0=\u00a08\u20139 ; c\u00a0=\u00a08\u201310 ; x/y\u00a0=\u00a01.4\u20131.6 . Dorsal anchor with relatively broad base, bent shaft; tiny point; accessory sclerite triangular; a\u00a0=\u00a041\u201344 ; b\u00a0=\u00a02\u20133 ; c\u00a0=\u00a015\u201317 ; x/y\u00a0=\u00a01.0\u20131.0 . Ventral bar composed of two rapidly tapering components; d\u00a0=\u00a038\u201344 . Dorsal bar with small anterior shield; mid-posterior process triangular, with uneven margin: e\u00a0=\u00a047\u201353 ; f\u00a0=\u00a025\u201326 ; g\u00a0=\u00a011\u201314 ; h\u00a0=\u00a011\u201315 . Hooks: 7 pairs, dissimilar in size; i\u00a0=\u00a012\u201329 : hook I 19\u201321 , hooks II\u2013V 12\u201314 ; hook VI 28\u201329 , hook VII 16\u201317 . Vagina not observed. MCO comprising copulatory tube and accessory piece; k\u00a0=\u00a029\u201332 . Copulatory tube a short lightly curved tube; length 27\u201330 . Accessory piece articulated to base of the copulatory tube; proximal part rod-shaped ; medial part complex; distal part with terminal hook and subterminal pestle.[Based on 4 flattened and 2 unflattened specimens in GAP; Fig. Quadriacanthus pravus n. sp. resembles the following species by its ventral anchor having a doubly recurved point: Q. ashuri Kritsky & Kulo, 1988; Q. numidus Kritsky & Kulo, 1988; Q. papernai Kritsky & Kulo, 1988; and Q. gourenei N\u2019Douba, Lambert & Euzet, 1999 [Q. gourenei and Q. papernai by the ventral bar possessing longer (rapidly tapering) components, and is easily differentiated from Q. ashuri by having a ventral anchor with a longer shaft. The new species most closely resembles Q. numidus in the morphometry of the haptoral sclerites; in particular, the ventral anchor of both species is characteristic by having a relatively small base and markedly long evenly curved shaft, and by lacking a sclerotized vagina. However, Q. pravus n. sp. differs from Q. numidus in the shape of the accessory sclerite of the dorsal anchor (triangular in Q. pravus vs wing-shaped in Q. numidus), and in having an MCO characterized by an accessory piece with a terminal hook and subterminal pestle (an accessory piece lamellate in Q. numidus). Dou\u00ebllou & Chishawa [Q. numidus, was slightly different from that described by Kritsky & Kulo [Q. pravus n. sp.) rather than with the Q. numidus specimens of Kritsky & Kulo [Q. numidus of Dou\u00ebllou & Chishawa [Q. pravus n. sp. at this time.et, 1999 , 36. It Chishawa  reportedy & Kulo . Accordiy & Kulo  charactey & Kulo . HoweverChishawa  with Q. Q. pravus n. sp. was 919\u00a0bp long, of which 514\u00a0bp corresponded to the partial 18S rDNA region and 405\u00a0bp corresponded to the entire ITS1 region. The sequence of the partial 28S region was 799\u00a0bp long. No intraspecific variability was found in the 18S-ITS1 and 28S sequences.The sequence of the 18S-ITS1 region of Quadriacanthus zuheiriFrancov\u00e1 & \u0158ehulkov\u00e1 n. sp.Type-host:Clarias gariepinus (Burchell) (Clariidae).Type-locality: Nile River Basin, Sudan .Other locality: Nile River Basin, Sudan .Type-material: Holotype: MNHN HEL640.Voucher material: MNHN HEL639 ; IPCAS M-637 . Hologenophore: MHHN HEL646 .Comparative material examined: Type-specimens of Quadriacanthus agnebiensis N\u2019Douba, Lambert & Euzet, 1999 (holotype and two paratypes MNHN 572 HF Tk 89).Site in host: Gill lamellae.Representative DNA sequences: 18S-ITS1 rDNA (GenBank acc. no. KX713998) and 28S rDNA (GenBank acc. no. KX685956)  [zoobank.org:pub:ADCB9E56-E8F1-48B6-AD21-BBA5E52D0B39. The LSID for the new name Quadriacanthus zuheiri n. sp. is urn:lsid:zoobank.org:act:A725FAF7-9AAF-4156-9647-6AE3EB7A0BCC.e (ICZN) , detailsEtymology: This species is named in honour to Prof. Zuheir N. Mahmoud of the Department of Zoology, Faculty of Science, University of Khartoum, Khartoum, Sudan, for his valuable and kind assistance during our field campaigns in Sudan.n\u00a0=\u00a02); greatest width 124\u2013140 . Haptor 95\u2013113  long, 124\u2013125  wide. Ventral anchor with moderate base, slightly curved shaft, long point; accessory sclerite small, with subequal wings; a\u00a0=\u00a037\u201338 ; b\u00a0=\u00a010\u201311 ; c\u00a0=\u00a08\u201311 ; x/y\u00a0=\u00a01.1\u20131.6 . Dorsal anchor with large base, shaft bent proximally, tiny point; accessory sclerite large, triangular; a\u00a0=\u00a043\u201347 ; b\u00a0=\u00a02\u20133 ; c\u00a0=\u00a018\u201322 ; x/y\u00a0=\u00a01.0\u20131.3 . Ventral bar composed of two elongated components; d\u00a0=\u00a039\u201344 . Dorsal bar with small anterior shield; mid-posterior process tongue-like, with uneven margin; e\u00a0=\u00a042\u201351 ; f\u00a0=\u00a024\u201332 ; g\u00a0=\u00a013\u201318 ; h\u00a0=\u00a011\u201318 . Hooks: 7 pairs, dissimilar in size; i\u00a0=\u00a012\u201331 : hook I 17\u201318 , hooks II\u2013V 12\u201314 , hook VI 27\u201331 , hook VII 19\u201319 . Vagina not observed. MCO comprising copulatory tube and accessory piece; k\u00a0=\u00a030\u201334 . Copulatory tube straight to slightly curved; base with thickened margins; l\u00a0=\u00a028\u201330 . Accessory piece basally articulated to the copulatory tube; medial part formed as a clamp jaw; hook-shaped termination serving as a guide for distal portion of the copulatory tube.[Based on 6 flattened and 2 unflattened specimens in GAP; Fig. Q. zuheiri n. sp. most closely resembles Q. aegypticus El-Naggar & Serag, 1986, and may also be confused with Q. agnebiensis N\u2019Douba, Lambert & Euzet, 1999, a parasite of Heterobranchus isopterus from Ivory Coast [Quadriacanthus zuheiri n. sp. differs from Q. aegypticus by having a noticeably smaller MCO composed of a copulatory tube without basal flange (with flange in Q. aegypticus) and simpler accessory piece . Examination of the holotype and two paratypes of Q. agnebiensis showed that Q. zuheiri n. sp. differs from the latter species by possessing: (i) a longer ventral anchor with less arched shaft; (ii) a larger accessory sclerite on the part of the dorsal anchor; (iii) shorter and less robust hooks VI and VII; and (iv) an accessory piece with more complex medial part (formed as a lightly sclerotized clamp jaw) and hooked (double hooked in Q. agnebiensis) distal termination.Based on the comparative morphology of the haptoral sclerites, ry Coast , 36. QuaQ. zuheiri n. sp. was 877\u00a0bp long, of which 469\u00a0bp corresponded to the 18S rDNA region and 408\u00a0bp corresponded to the ITS1 region. The sequence of the partial 28S region was 772\u00a0bp long. No intraspecific variability was found in the 18S-ITS1 and 28S sequences.The sequence of the 18S-ITS1 region of Quadriacanthus species, Q. clariadis exhibited the lowest genetic divergence from Q. bagrae . Q. mandibulatus n. sp. and Q. fornicatus n. sp. exhibited the greatest genetic distances (5.87%) for 28S rDNA sequences, and Q. mandibulatus n. sp. and Q. bagrae represented the most divergent species pair for 18S-ITS1 sequences ; for 18S, Q. mandibulatus n. sp. formed one clade with Q. zuheiri n. sp. and Q. pravus n. sp. Moreover, the phylogenetic analysis of 18S-ITS1 rRNA gene sequences revealed identity between Q. mandibulatus n. sp. and Quadriacanthus sp. retrieved from GenBank (they differed in one nucleotide). Therefore, we consider this Quadriacanthus sp. with the HG491496 sequence, isolated from the airbreathing clariid Heterobranchus bidorsalis in Senegal , as a representative of Q. mandibulatus n. sp.An unambiguous alignment of 18S-ITS1 sequences spanned 799 positions, of which 275 positions were variable. The 28S alignment contained a total of 725\u00a0bp with 246 variable characters. The phylogenetic trees of ies Fig. . In bothQuadriacanthus suggest an interesting evolutionary history of the group. Species of Quadriacanthus have been confirmed as parasites of fishes representing three families, namely the Clariidae, Bagridae (Siluriformes), and Notopteridae (Osteoglossiformes) [Quadriacanthus infesting clariids occur in the freshwaters of Africa, India, Malaysia, Thailand, China and Vietnam [Quadriacanthus spp. on clariid hosts suggests comparatively old host-parasite relationships, i.e. lasting at least 15 MY. On the other hand, formulating a hypothesis on the origin of Quadriacanthus species on bagrids  in Africa is more problematical. Species of Quadriacanthus have not been found on bagrids in Asia, although these fishes have occasionally been examined for gill parasites [Bagrus!) previously considered members of the Bagridae [Protoancylodiscoides Paperna, 1969 and Bagrobdella Paperna, 1969, respectively, while those of Bagrus are known to be infected with one species of Quadriacanthus, i.e. Q. bagrae [The geographical distributions and host preferences of species of iformes) , 3. Clariformes) . From thiformes) . Species Vietnam , 7. Inasarasites . The famarasites  and de Parasites , who estBagridae . The welBagridae . Indeed,. bagrae .Quadriacanthus, the occurrence of Q. bagrae (while clearly a member of the genus) on African bagrid hosts probably resulted from host switching. Our phylogenetic reconstruction indicates that Q. bagrae is phylogenetically nested within the parasites from Clarias gariepinus at a derived position of the tree  transferred from clariids to species of Bagrus and not conversely. Several studies suggested that such lateral transfer (host switch) can occur both between related host species  is probably the result of a lateral transfer from species belonging to Clarias or Bagrus which live sympatrically with P. afer in Lake Ossa (South Cameroon). Although more data are needed to resolve phylogenetic relationships within Quadriacanthus, the occurrence of Q. bagrae on Bagrus docmak may represent a similar lateral transfer from a species of Clarias, probably C. gariepinus. Bagrus docmak inhabits, among other locations, the Nile River, where it lives in sympatry with Clarias gariepinus [Some authors (e.g. Brooks & McLennan ) believeree Fig. . More spes (e.g. ) and evees  of new parasite material from C. gariepinus. It will be interesting to see whether Q. bagrae on C. gariepinus is a genuine Q. bagrae (sensu stricto). If they represent two different species of Quadriacanthus, then the occurrence of Q. bagrae on Bagrus docmak may suggest, at this time, a case of host switching with speciation.Although we cannot verify the accuracy of the identification,  authors , 7. BecaQuadriacanthus spp.; thus, the molecular data presented here represent an important advance in the molecular identification and differentiation of this genus. In our study, molecular characterization is presented for six Quadriacanthus species . The interspecific genetic relationships among Quadriacanthus spp. observed in this study are congruent with the similarity of the basic morphology of the sclerotized structures, especially of those of the MCO (Figs. Q. mandibulatus n. sp. from the other species corresponds with the different morphology of its copulatory tube. The copulatory tube is terminally enlarged and with a subterminal flange in Q. mandibulatus n. sp., while the corresponding structure in all other congeners studied is comparatively small and with an oblique tapering termination (Figs. Until now, there were no studies on the genetic characteristics of CO Figs. , 12, 13.on Figs. .Fig. 11PQuadriacanthus parasitizing catfishes in the Old World provide useful models for the study of biogeography and coevolution. However, future studies are needed that would have to involve the examination of dactylogyrids from a greater number of host individuals and host species from a larger geographical area, the utilization of other monogenean taxa, and the incorporation of a homologous series of host features into the matrix derived from the parasite cladogram.This study suggests that species of"}
+{"text": "The brain regions showing the greatest discriminative power included the prefrontal cortex, anterior cingulate cortex, precentral gyrus, and occipital lobes. The application of SVM to rs-fMRI features may provide potential power for OCD classification.Previous resting-state functional magnetic resonance imaging (rs-fMRI) studies of obsessive-compulsive disorder (OCD) have facilitated our understanding of OCD pathophysiology based on its intrinsic activity. However, whether the group difference derived from univariate analysis could be useful for informing the diagnosis of individual OCD patients remains unclear. We aimed to apply multivariate pattern analysis of different rs-fMRI parameters to distinguish drug-naive patients with OCD from healthy control subjects (HCS). Fifty-four drug-naive OCD patients and 54 well-matched HCS were recruited. Four different rs-fMRI parameter maps, including the amplitude of low-frequency fluctuations (ALFF), fractional amplitude of low-frequency fluctuations (fALFF), regional homogeneity (ReHo) and functional connectivity strength (FCS), were calculated. Training of a support vector machine (SVM) classifier using rs-fMRI maps produced voxelwise discrimination maps. Overall, the classification accuracies were acceptable for the four rs-fMRI parameters. Excellent performance was achieved when ALFF maps were employed (accuracy, 95.37%,  While cortico\u2013striato\u2013thalamo\u2013cortical (CSTC) dysfunction has been found to contribute to the pathogenesis of OCD, emerging evidence suggests that broader brain regions, such as the parietal cortex and insula, are involved in this disorder4. Such widespread alterations may be due to the diversity of tasks used to investigate OCD. The investigation of altered patterns of brain activity during rest in OCD has the advantage of identifying neural mechanisms that are not specific to a task, which will provide a reliable measure of baseline brain activity5 and may complement and extend findings from task-based studies.Obsessive-compulsive disorder (OCD) is a common debilitating disorder characterized by persistent intrusive thoughts and repetitive actions, with a prevalence of 1% to 3%6. In addition, fALFF was originally regarded as less sensitive to physiological noise7. Regional homogeneity (ReHo) measures Kendall\u2019s coefficient concordance in neighboring voxels to reflect the coherence of the BOLD signal amplitude between a single voxel and its nearest neighbors8. Given the computational basis of this parameter, it has been suggested as a measure of localized connectivity9, providing information about local alterations in brain function. Functional connectivity strength (FCS), also known as degree centrality, takes a given region\u2019s relationship with the entire functional connectome into account. Examinations of FCS have focused on the identification of \u201cfunctional hubs\u201d in whole-brain networks11. Unlike the functional connectivity approach, all of these parameters do not require a priori seed selection; therefore, they have the potential to evaluate abnormalities of certain brain regions at the whole-brain level.Recent advances in resting-state functional magnetic resonance imaging (rs-fMRI) have facilitated our understanding of OCD pathophysiology based on its intrinsic activity. Among various rs-fMRI parameters, both the amplitude of low-frequency fluctuations (ALFF) and the fractional ALFF (fALFF) of the BOLD signal measure the magnitude of the regional activity amplitude and reflect the intensity of spontaneous neural activity14, fALFF17, ReHo19, and FCS21 maps in various cerebral regions, including traditional CSTC circuits and newly found regions, such as the parietal, occipital, and temporal lobes and the cerebellum. These altered spontaneous neuronal activity and OCD-related brain network hubs improve our understanding of the pathophysiologic characteristics of OCD by revealing intrinsically abnormal function within and beyond CSTC circuits. However, previous studies mainly focused on localizing alterations based on group-level differences using univariate analysis and ignored information contained in spatial distribution patterns. Thus, whether group differences can be useful for informing the diagnosis of individual OCD patients remains unclear.Previous studies have successfully revealed altered ALFF23. In particular, rs-fMRI has been applied to classify autism24, depression25, and schizophrenia26 with moderate accuracy using the support vector machine (SVM), a multivariate pattern analysis-based classifier. However, in regard to OCD, although accurate classification has been achieved based on structural27, diffusion28, and task-based functional MRI images29, few studies have explored the potential diagnostic value of rs-fMRI data to date, with one study reporting 73% classification accuracy by a whole-brain functional connectivity network30. However, it is difficult to draw a conclusion about the classification value of certain abnormal regions from such a study.Recently, multivariate pattern analysis based on a machine learning algorithm has been introduced for neuroimaging analysis. It is a promising analytical technique allowing the classification of individual observations into distinct groups and is sensitive to spatially distributed information. This approach has been used to identify neural imaging biomarkers of psychiatric disorders based on both structural and functional imagesIn the current study, we employed a multiparameter classification approach to distinguish drug-naive patients with OCD from healthy control subjects (HCS) at the individual level based on intrinsic neural activities reflected by ALFF, fALFF, ReHo, and FCS. Our aims were, first, to investigate which rs-fMRI parameter achieves the best discrimination between OCD and HCS and, second, to examine whether there is overlap between multivariate pattern analysis and univariate analysis.This retrospective study was approved by the Ethics Committee of the West China Hospital, Sichuan University, and written informed consent was obtained from each participant. A total of 54 OCD patients and 54 sex- and age-matched HCS participated in this study Table . All parThese patients had not received any prior psychiatric medications for various reasons, mainly because of (1) a lack of understanding or recognition of the severity of mental illness, (2) poor socioeconomic conditions that limited travel and funds for medical care in rural areas, and (3) a lack of medical care close to the time of illness onset due to the limited popularity of family physicians in China. As a result of these factors, each patient had been sheltered in the home without medical care through the course of the illness.HCS were recruited from the local area using poster advertisements and were screened using the SCID (nonpatient edition) by the same psychiatrists to confirm the current absence of psychiatric and neurological illness, as well as the absence of a history of psychiatric illness among first-degree relatives.2, 30 axial slices, and 200 volumes in each run.The MRI examinations were performed via a 3-Tesla GE MRI system with an 8-channel phase-array head coil. Foam pads were used to reduce head motion and scanner noise. Prior to the scan, the subjects were instructed to keep their eyes closed, remain relaxed but not fall asleep, and move as little as possible during scanning. The images were obtained via a gradient-echo echo-planar imaging sequence with the following parameters: time repetition\u2009=\u20092000\u2009ms, time echo\u2009=\u200930\u2009ms, flip angle\u2009=\u200990\u00b0, slice thickness\u2009=\u20095\u2009mm with no slice gap, field of view\u2009=\u2009240\u2009\u00d7\u2009240\u2009mmhttp://www.restfmri.net, version 2.1), implemented within the MATLAB toolbox. We discarded the first ten time-points to ensure signal stabilization. Slice timing and head motion correction were conducted. We used the motion correction strategy suggested by Yan et al.31: (1) regression of realigned data on 6 head motion parameters, 6 head motion parameters one time point before, and the 12 corresponding squared items (Friston 24-parameter model)32 and (2) identification of \u201cbad\u201d time-points using a threshold of framewise displacement\u2009>\u20090.2\u2009mm, as well as one back and two forward neighbors, as reported by Power et al.33, followed by modeling each \u201cbad\u201d time point as a separate regressor in the regression models35. All subjects were under the threshold of framewise displacement\u2009=\u20090.2\u2009mm. The subsequent analysis was performed within good data. Next, the images were normalized to the standard Montreal Neurological Institute template and spatially resampled to a voxel size of 3\u2009\u00d7\u20093\u2009\u00d7\u20093\u2009mm3. Subsequently, the linear trend of the fMRI data was removed, and bandpass filtering (0.01\u20130.08\u2009Hz) was conducted to decrease the impact of high-frequency physiological noise and very low-frequency drift. Six motion parameters and the signals from the cerebrospinal fluid and white matter were used as nuisance covariates to reduce the effects of head motion and nonneuronal BOLD fluctuations. The Resting-State fMRI Data Analysis Toolkit (REST)  was then used for computation of ALFF, fALFF, ReHo, and FCS. Details about the calculation of the four rs-fMRI parameters are presented below.The rs-fMRI data were processed using the Data Processing Assistant for Resting-State fMRI  Gaussian kernel.The ALFF images were computed by extracting power spectra via a Fast Fourier Transform and computing the sum of amplitudes in the low-frequency bands (0.01\u20130.08\u2009Hz). The ALFF measure at each voxel represents the averaged square root of the power in the above frequency windows normalized by the mean within-brain ALFF value for that subject. For fALFF, the measure was scaled by total power across all available frequencies8. Afterwards, a whole-brain mask was adopted to remove the nonbrain tissues. For standardization purposes, the individual ReHo maps were divided by their own global mean KCC within the whole-brain mask. Then, spatial smoothing was performed on the standardized individual ReHo maps with a Gaussian kernel of 8-mm FWHM.Individual ReHo maps were generated by calculating the Kendall coefficient of concordance (KCC) of the time series of a given voxel with those of its neighbors (26 voxels) in a voxelwise mannerz-score matrix using a Fisher r-to-z transformation. For a given voxel, FCS was computed as the sum of the connections  between a given voxel and all other voxels. Considering the ambiguous interpretation of negative correlations with removal of the global signal, we conservatively restricted our analysis to positive correlations above a threshold of r\u2009=\u20090.2. Such a threshold was chosen to eliminate voxels with weak correlations attributable to signal noise38. The FCS maps were further smoothed with an 8-mm Gaussian kernel and normalized to standard z-scores.We first computed Pearson\u2019s correlations between the time series of all pairs of voxels, constructing a whole-brain connectivity matrix for each participant. A prior gray matter map (threshold of 0.2) in SPM8 was employed. To improve normality, we then transformed individual correlation matrices to a t-tests and chi-square analyses were performed using SPSS software . We used a univariate approach to investigate differences in ALFF, fALFF, ReHo, and FCS between OCD patients and HCS in SPM8 software (http://www.fil.ion.ucl.ac.uk/spm/software/spm8/). Statistical inferences were made at p\u2009<\u20090.05 .To detect group differences in demographic variables between patients with OCD and HC, two-sample http://www.brainmap.co.uk/probid.htm, version 1.04), to investigate the diagnostic potential of four maps. The PROBID software allows for a linear kernel matrix  to be precomputed and supplied to the classifier. This approach affords a substantial increase in computational efficiency and permits whole-brain classification without requiring explicit dimensionality reduction. Individual brain scans were treated as points located in a high-dimensional space defined by the rs-fMRI maps in the preprocessed images. In this high-dimensional space, a linear decision boundary was defined by a \u201chyperplane\u201d that separated the individual brain scans according to a class label .We used the SVM, as implemented in the PROBID software package . Second, once the optimal hyperplane is developed from the training data, it is applied to a new \u201ctesting\u201d dataset to establish its generalizability. Feature selection was performed based on the training dataset. Four types of features, ALFF, fALFF, ReHo, and FCS, were used in the present study. The machine learning algorithm finds the discriminating regions using whole-brain information without prior selection of regions.40. The statistical significance of the overall classification accuracy was determined by permutation testing39, a nonparametric test that involves repeating the classification procedure 1000 times with a different random permutation of the training group labels and counting the number of permutations achieving higher sensitivity and specificity than the true labels.A \u201cleave-one-out\u201d cross validation was used, which involved excluding a single subject from each group and training the classifier using the remaining subjects. The subject pair excluded was then used to test the ability of the classifier to reliably distinguish between categories . This procedure was repeated for each subject pair to assess the overall accuracy of the SVM42. Classification performance was assessed by computing the accuracy, sensitivity, specificity, and receiver operating characteristic (ROC) curve, from which the area under the ROC curve (AUC) was calculated.To enable the visualization of the discriminating pattern for each measurement, we colored all voxels that had values >30% of the maximum value of the discrimination map. This arbitrary threshold predominantly eliminates noise components, thus enabling better visualization of the most discriminating regionsRelationships with symptom severity were examined by extracting ALFF, fALFF, ReHo, and FCS values from regions showing group differences and correlating these values with Y-BOCS scores, HAMA scores, and HAMD scores, with age, gender and onset time as covariates in the OCD group.p\u2009>\u20090.05). For the 54 OCD patients, the total Y-BOCS was 20.72\u2009\u00b1\u20095.30, corresponding to moderate and severe OCD symptoms, with obsessive and compulsive subscale scores of 10.67\u2009\u00b1\u20093.60 and 10.06\u2009\u00b1\u20094.44, respectively. The estimated duration of OCD symptoms was 8.15\u2009\u00b1\u20095.69 years. The HAMA score was 9.24\u2009\u00b1\u20095.15, generally accepted as normal, and the HAMD score was 8.19\u2009\u00b1\u20095.87, indicating mild depression. See Table Age and gender were not significantly different between the OCD and HCS groups . Although significant differences in fALFF, ReHo, or FCS values were not observed, uncorrected results are provided  , right dorsal lateral prefrontal cortex and bilateral insula; conversely, OCD patients showed lower ALFF values in the right inferior parietal lobe (IPL), occipital lobe at a threshold of el) Fig. .Fig. 1Sip\u2009<\u20090.001), respectively, followed by the classification based on ReHo . For the fALFF measures, the accuracy was 82.41%, the sensitivity was 79.63%, and the specificity was 85.19% (p\u2009<\u20090.001). For the FCS measures, the accuracy was 74.07%, the sensitivity was 74.07%, and the specificity was 74.07% (p\u2009<\u20090.001). The ROC curves demonstrated good performance, with AUC values ranging from 0.81 to 0.99 (p\u2009<\u20090.001)  in the ALFF discrimination map included the left vmPFC, right dorsal lateral prefrontal cortex and bilateral insula. In contrast, regions that contributed to the identification of controls (HCS\u2009>\u2009OCD) were mainly located in the right IPL and occipital lobe. The discriminative pattern for OCD in the fALFF map was composed of the right superior frontal lobe, bilateral precentral gyrus, right superior temporal gyrus, anterior cingulate cortex (ACC), and left cuneus and left lingual gyrus, whereas regions that contributed to the identification of HCS were mainly located in the right IPL. The discriminative pattern for OCD in the ReHo map primarily consisted of the bilateral orbitofrontal cortex (OFC), left ACC, left putamen, and left precentral gyrus. The discriminative pattern for OCD in the FCS map mainly contained the bilateral superior frontal lobe, left vmPFC, left ACC, left superior parietal, bilateral lingual gyrus, and right putamen.No significant association was observed between the values of rs-fMRI parameters and symptom scores after corrections.To our knowledge, this is the first study to investigate the potential diagnostic value of different resting-state fMRI features in adult drug-naive OCD patients. The regional neural activity across the whole-brain reflected by ALFF, fALFF, ReHo, and FCS can distinguish patients with OCD from HCS. Excellent performance was achieved when ALFF maps were employed, good performance was achieved by using ReHo maps, weaker performance was achieved by using fALFF maps, and fair performance was achieved by using FCS maps. Remarkably, the discrimination pattern of ALFF partially overlapped with the group differences. In addition, regions that contributed to the identification of patients with OCD were not only limited to the CSTC circuits, such as the vmPFC and putamen, but also involved additional brain systems, including the precentral gyrus and occipital lobe. These patterns provide preliminary support for the use of the four rs-fMRI parameters, especially ALFF, as promising classification markers for drug-naive patients with OCD.43.Classification accuracy varied among different resting-state functional parameters. The four indices of spontaneous brain activity revealed increased and decreased weighted vector values in drug-naive adults with OCD compared to those of HCS, but these patterns cannot be explained as neuronal activity increases or decreases in one group relative to the other. We emphasize that due to the multivariate character of SVM, each region in the discrimination maps should be interpreted in the context of the entire discriminating pattern and should not be considered in isolation. In multivariate methods, an individual region may display high discriminative power for two possible reasons: (i) the presence of a large group difference in that region; or (ii) the region is highly intercorrelated with other regions of the network. Thus, discrimination maps should be interpreted as spatially distributed patterns rather than as individual regions44. Nugent et al. suggested that impaired glutamate cycling is widespread throughout the cortex, particularly implicating neuronal dysfunction. This effect could make ALFF more sensitive to detecting dysfunctional neural activity than the other three parameters. In addition, we found that regions showing significant group differences had partially overlapping discrimination patterns. The strong group differences for ALFF may underlie the excellent classification achieved in the current study. Therefore, the SVM enabled the identification of brain regions that corroborate the existing differences in ALFF between patients with OCD and HCS, providing support for ALFF as a promising classification marker for OCD.Of the four measurements, ALFF showed the greatest diagnostic accuracy for discriminating patients with OCD from HCS. It has been shown that ALFF directly correlates with the intensity of spontaneous neural activity in the resting state and is related to the rate of regional glucose metabolism7. However, in the present study, a very different profile of spatially distributed patterns was observed in the fALFF map, with generally lower classification accuracies than those of ALFF. Therefore, we supposed that in the fALFF approach, power spectrum fractionalizing resulted in suppressed power in the low-frequency range in regions such as the cisterns, ventricles and sagittal sinus, as well as altered spectral distribution. Thus, fALFF was incapable of detecting subtle information for optimal differentiation.Initially, scholars believed that fALFF selectively suppressed artifacts from nonspecific brain areas while enhancing signals from cortical regions associated with brain activity, making use of the distinct characteristics of signals in the frequency domain and would therefore significantly improve the sensitivity and specificity in detecting regional spontaneous brain activity compared with ALFF21. The automated classification of patients with OCD versus HC using FCS did not show high accuracy. The reason for this may lie in the fact that the range of FCS values was highly overlapping for the two groups. Therefore, both weak group differences and poor classification were achieved.ReHo showed good classification performance as well, particularly in the bilateral OFC, left ACC, precentral gyrus and putamen, although the comparison between the two groups was not significant. Since the discrimination is based on the whole-brain pattern by taking into account correlations among the regions, rather than evaluating individual regions, we suppose that the whole-brain spatial pattern of ReHo differs between OCD and HCS. While the different resting-state fMRI approaches mentioned above are promising for measuring intrinsic spontaneous brain activity, we used graph-based voxelwise FCS to reveal the value of hub-related abnormalities in discrimination OCD. In general, regions with higher FCS values usually suggest a central role in the functional integrity of the whole-brain networks2, in OCD. A recent meta-analysis study4 has shown that the gray matter volume was reduced in ACC/vmPFC in patients with OCD. In the task state, several studies46 reported that increased ACC activation in patients with OCD in relation to error processing correlated with disease severity. In the resting state, Tian et al.20 and Hou et al.21 reported increased functional connectivity strength in the ACC in OCD patients compared with HCS. The hyperactivity in the ACC may reflect dysfunction of the action monitoring system and result in abnormal symptoms of OCD, such as feelings of being erroneous, a constant need for correction and incomplete performance. OCD patients also exhibited greater activity in the vmPFC due to a failure to deactivate this DMN region47, perhaps reflecting an inability of patients to disengage from automatic evaluative processes when errors occur. In addition, meta-analytical4 findings have also reported that structurally and functionally overlapping regions in the putamen show increases in both gray matter volume and activity in patients with OCD. Furthermore, Beucke et al.48 found greater local connectivity in the OFC and the putamen, and this connectivity was positively correlated with OCD symptom severity. Consistent with these findings, the ACC/vmPFC and putamen displayed a high degree of discriminative ability between OCD patients and healthy controls in the present study, providing further support for dysfunction in CSTC pathways in patients with OCD.The discrimination regions identified in our study are within and beyond CSTC circuits. Previous neuroimaging studies have revealed the critical role the ACC/vmPFC, a region crucially involved in detecting the presence of cognitive conflicts, error monitoring and detection50, which partially explains the nature of inhibitory control deficits in OCD. Furthermore, some results demonstrated that unmedicated OCD patients have impaired sensory-motor integration and sensory gating, as measured by prepulse inhibition and transcranial magnetic stimulation, which indicates that the abnormality of the sensorimotor system might impair the ability of OCD patients to suppress internally triggered intrusive and repetitive movements and thoughts52. Therefore, the notable contribution of these regions to accurate discrimination in the present study provides further support for their involvement in OCD.In addition, there is some evidence suggesting that individuals with OCD show activation in regions within the sensorimotor network, including the precentral gyrus and supplementary area, in inhibitory control processes53. A previous study54 reported that OCD patients showed hypoactivation of the superior and inferior occipital cortex during a target detection task following negative internally focused attention states, pointing to an OCD-related impairment in the visual processing of external stimuli when patients have experienced a period of negative internal focus.Our finding that the occipital lobe contributed to the discrimination of OCD patients from HCS is consistent with other evidence implicating the occipital region in OCD. For instance, OCD patients with poor insight had increased ALFF in the right middle occipital gyrusIt is noteworthy that there are some limitations of the present study. First, although the findings were encouraging, the sample size was relatively small, and the generalizability of the results was, therefore, unclear. Larger sample sizes are needed to confirm our findings. Second, we separated only patients with OCD from healthy subjects, leaving an unresolved issue of whether the use of the SVM to rs-fMRI would also successfully discriminate between subtypes of OCD. Future studies may be dedicated to the differential diagnosis of patients with OCD across subtypes or to differentiating between patients with OCD and other psychiatric conditions with potentially overlapping symptoms. Third, we need to be cautious when explaining the results of ALFF, as it contains not only low-frequency neuronal fluctuations but also low-frequency physiological fluctuations, such as breathing pattern changes. Given the low sampling rate used in this study (TR\u2009=\u20092\u2009s), we cannot fully exclude the confounding effect of cardiac pulsation and respiratory effects.55 that applies imaging to psychiatry and psychology.In conclusion, our results provide preliminary support for the hypothesis that multiple rs-fMRI features can be utilized for the diagnostic classification of drug-naive patients with OCD, with the ALFF providing the greatest accuracy. Furthermore, our findings emphasize the role of regions within and outside CSTC circuits in the pathophysiology of OCD. Therefore, this study demonstrates that the application of supervised machine learning methods, such as SVM, to neuroimaging data could potentially be used for reliable OCD classification, and also adds the development of psychoradiologySupporting Information for Investigating the predictive value of different resting-state functional MRI parameters in obsessive-compulsive disorderCertificate of Nature Research Editing"}
+{"text": "Previous resting-state functional magnetic resonance imaging (rs-fMRI) studies have revealed intrinsic regional activity alterations in obsessive-compulsive disorder (OCD), but those results were based on group analyses, which limits their applicability to clinical diagnosis and treatment at the level of the individual.We examined fractional amplitude low-frequency fluctuation (fALFF) and applied support vector machine (SVM) to discriminate OCD patients from healthy controls on the basis of rs-fMRI data. Values of fALFF, calculated from 68 drug-naive OCD patients and 68 demographically matched healthy controls, served as input features for the classification procedure.p\u2009\u2264\u20090.001). This discrimination was based on regions that included the left superior temporal gyrus, the right middle temporal gyrus, the left supramarginal gyrus and the superior parietal lobule.The classifier achieved 72% accuracy (These results indicate that OCD-related abnormalities in temporal and parietal lobe activation have predictive power for group membership; furthermore, the findings suggest that machine learning techniques can be used to aid in the identification of individuals with OCD in clinical diagnosis. Obsessive-compulsive disorder (OCD) is a chronic psychiatric disorder characterized by the presence of recurrent and persistent thoughts, urges or images, and repetitive behaviors, with a lifetime prevalence of 2\u20133% and a 12-month prevalence of up to 1% . This diResting-state functional magnetic resonance imaging (rs-fMRI) provides an effective and noninvasive approach to assess neural activation and connectivity between regions. The amplitude of low-frequency fluctuation (ALFF) of the blood oxygenation level-dependent (BOLD) signal is considered a physiologically meaningful measure that detects spontaneous regional brain activity with high sensitivity and specificity in rs-fMRI ; alteredHowever, these abnormal patterns of neural activation were identified by conventional univariate analysis in which ALFF was used to compare brain activity between a group of OCD patients and a healthy control group to identify regions with significant differences. While this type of statistical comparison can help localize regional differences that occur as a function of OCD, it cannot generally differentiate between OCD patients and healthy controls individually, because not all such group differences are guaranteed to be predictive, and there might be significant overlap between the two distributions of the pertinent metric. Moreover, traditional univariate approaches to functional magnetic resonance imaging (fMRI) analysis may overlook multivariate patterns in data , 10. RecOCD is currently diagnosed on the basis of a subjective clinical interview and scale evaluation, which always leads to diagnostic inconsistency among psychiatrists, cultures, and districts . Thus, rTo our knowledge, no study has yet utilized SVM classification with fractional ALFF (fALFF) \u2013 an improved approach to detect spontaneous regional brain activity with higher sensitivity and specificity than ALFF \u2013 for rs-fMRI in drug-naive OCD patients to identify disease characteristics and discriminate drug-naive patients from healthy controls . CharactAccording to the previous OCD classification studies, supposed expected specificity\u2009=\u20090.8, expected sensitivity\u2009=\u20090.8, \u03b4\u2009=\u20090.1, \u03b1\u2009=\u20090.05 (two-side), the number of each group we need in the study was 63. In our study, we enrolled 68 drug-naive OCD patients and 68 sex-, age-, and education-matched healthy control participants were enrolled from 2012 to 2015 under protocols approved by the Ethics Committee of West China Hospital, Sichuan University. All participants were of Chinese Han nationality and were right handed. All provided written informed consent. OCD patients were recruited from the clinic of the Mental Health Center at West China Hospital, Sichuan University. Potential participants were interviewed and scanned using the Structured Clinical Interview for DSM-IV Axis I Disorders (SCID) and diagnosed by two experienced psychiatrists (X. Yang and Y. Yang). Participants were excluded if they had any of the following characteristics or conditions: (1) age under 18\u2009years or over 60\u2009years; (2) any psychiatric comorbidity identified using the SCID; (3) any history of major physical illness, cardiovascular disease, or neurological disorders; (4) any history of continuous psychotherapy; and (5) pregnancy. The Yale-Brown Obsessive Compulsive Scale (Y-BOCS) was used to rate the severity of OCD symptoms. Healthy control subjects were recruited using poster advertisements and screened using the SCID (non-patient edition) by the same psychiatrists; subjects with any psychiatric or neurological illness, a family history of psychiatric illness, or any history of continuous psychotherapy were excluded.Resting-state fMRI data were collected with a 3\u2009T MRI system  equipped with an 8-channel phase array head coil. The resting-state functional images were obtained via a gradient-echo echo-planar imaging (EPI) sequence . During the MR examination, participants were instructed to relax their minds and keep their eyes closed but not to fall asleep. Foam padding and earplugs were used to reduce head motion and scanner noise.http://www.mricro.com) [Resting-state functional images were preprocessed using the software Data Processing Assistant for rs-fMRI (DPARSF), version 2.3   on the Mcro.com) , voxels http://www.restfmri.net/forum, version 1.8) software, we performed fALFF based on the procedure developed by Zou [Using the REST as some previous studies [As a supervised machine learning algorithm, an SVM performs pattern classification by finding a decision function or boundary that enables classification . The SVM studies , 22, 23  studies . The linP value [We used \u2018leave-one-out\u2019 cross-validation (LOOCV) to validate the performance of the proposed approach. A single sample from each group was designated as a test sample, while the remaining samples were used to train the classifier, and then the subject pair excluded was used to test the ability of the classifier to reliably distinguish between groups . This procedure was repeated for each subject pair to estimate the overall accuracy of the SVM , 25. TheP value , 26. TheSince the SVM classifiers are multivariate techniques and discrimination is based on the brain-wide pattern instead of patterns in individual regions, all voxels contributed to the classification, and local inferences should not be made. We selected the peak of the SVM weight vector for each classifier, setting the threshold to 30% of the maximum weight vector value, an approach that is consistent with previous studies , 26, 27.There were no significant differences in gender, age, and education years between OCD patients and healthy controls. In the OCD group, the mean duration of OCD symptoms and Y-BOCS score are shown in Table\u00a0P\u2009<\u20090.001. This overall classification accuracy of the algorithm measures its ability to correctly classify an individual as either an OCD patient or a healthy control.Figure\u00a0Classification plot Fig. a and ROCAcross the brain, the regions that made the most substantial contribution to the discrimination between OCD patients and healthy controls were determined on the basis of fALFF values, which were identified by setting the threshold to \u226530% of the maximum weight vector scores. Spatial maps of the regions are described in Table\u00a0Brain regions contributing to discrimination between the OCD and healthy control groups based on fALFF. These regions were identified by setting the threshold to \u226530% of the maximum weight vector scores. Positive weights (warm colors) indicate that the parameter values are higher in OCD patients than in healthy controls; negative weights (cool colors) indicate the opposite. The color bar represents the weight vector value (Wi) from the SVM analysis.To the best of our knowledge, this study is the first to employ a machine learning approach to rs-fMRI data for clinical application in in drug-naive OCD patients. We designed an SVM method to distinguish OCD patients from healthy controls and used LOOCV to validate our model. Our study demonstrated that patients with OCD could be distinguished from healthy controls with relatively high classification accuracy using fALFF values extracted from rs-fMRI data. This classification was driven by a distributed pattern of regional abnormalities in the temporal lobe, including the left superior temporal gyrus and right middle temporal gyrus, and in the bilateral parietal lobe, including the left supramarginal gyrus and right superior parietal lobule.A previous work achieved 84% accuracy according to LOOCV by developing a model from the DTI characteristics of 28 OCD patients and 28 healthy controls . A similPrevious univariate analyses have shown that abnormalities of classical orbitofronto-striatal circuits cannot fully explain the cognitive defects found in OCD. Further evidence in recent studies revealed the involvement of extensive brain regions in the pathophysiology of OCD; for example, the temporal gyrus has been shown to be a critical neural substrate for OCD . PreviouIn addition, the parietal lobe, including the left supramarginal gyrus and the right superior parietal lobule, showed decreased activity. The parietal lobe is important in a variety of cognitive executive tasks involving attention, spatial perception , 36, plaIn summary, this study represents an important step toward the clinical diagnosis of OCD with the aid of machine learning techniques. This study does have some limitations. First, single imaging modality data and a classification approach were evaluated. Further studies will need to address these issues by introducing classification to multimodal neuroimaging data and assessing different classification methods  to identify the optimal approach to discrimination. Second, the high dimensionality often induces the problem of collinearity. Although the linear kernel matrix implicated in PROBID could directly extract weight vector as an image and permits whole-brain classification without requiring explicit dimensionality reduction, the collinearity might still inevitable. Third, our research only compared OCD with HCS, other psychiatric disorders such as major depression and anxiety are not considered. Moreover, OCD patients with different dimensional symptoms could be compared to detect the pathophysiology of the symptoms. At last, the lack of follow-up limits the application of this study in predicting the treatment response of OCD. A suitable continuation of this study would be to focus on the discrimination of treatment outcomes using machine multivariate pattern recognition methods.We investigated functional abnormalities in OCD patients using a multivariate classification and explored the predictive value of fALFF in drug-naive OCD patients using an SVM framework. The SVM achieved an accuracy of 72% in LOOCV and provided good group separation. In our study, the fALFF values in the left superior temporal gyrus, the right middle temporal gyrus, the left supramarginal gyrus and the superior parietal lobule were identified as discriminative features distinguishing OCD patients from healthy controls. Our study not only identified functional biomarkers of drug-naive OCD patients but also revealed their discriminative power in distinguishing patients from controls. This study highlights the potential of machine learning approaches to aid in the clinical diagnosis of OCD."}
+{"text": "For patients with Lp(a) values \u2265 80th percentile, the risk for CVD events followed the same pattern, with an HR of 2.17  for LDL-C values \u2265 5.5 mmol/L. These results corroborated with those of the CCHS study: HR for CVD was 1.42 (95% CI 1.15\u20131.74) for patients with Lp(a) values <\u200980th percentile and LDL-C \u2265 5.5 mmol/L, and increased to HR 2.34  for patients with Lp(a) values \u2265 80th percentile and LDL-C \u2265 5.5 mmol/L. HR for CVD risk demonstrated the highest level of significance (P < 0.001) for patients with Lp(a) values \u2265 80th percentile and LDL-C \u2265 5.5 mmol/L, compared with patients with Lp(a) values <\u200980th percentile and LDL-C <\u20092.5 mmol/L. Risk estimates followed the same pattern when using the threshold of 50 mg/dL: for patients with Lp(a) \u2265 50 mg/dL and LDL-C <\u20092.5 mmol/L, HR was 2.56 (95% 1.94\u20133.39) and 1.71 (95% CI 1.32\u20132.22) in the EPIC-Norfolk and the CCHS cohort, respectively, when compared with subjects with Lp(a) <\u200950 mg/dL and LDL-C <\u20092.5 mmol/L. Of note, for a same given level of LDL-C, CVD risk increased by 40\u201350% when Lp(a) values were high (\u2265 50 mg/dL or \u2265 80th percentile).In this issue of the et al.\u2019s article further highlights that high Lp(a) levels are also closely associated with adverse clinical outcomes in subjects with low LDL-C values. For instance, HR was 1.44  in the group with LDL-C values ranging between 2.5\u20133.49 mmol/L in the EPIC-Norfolk cohort. On the other hand, in the relatively small group of patients with LDL-C <\u20092.5 mmol/L (<\u200910% of the cohort sample size) and high Lp(a), the association of CVD risk with Lp(a) levels was strongly attenuated: HR 1.11 (95% CI 0.77\u20131.59) and 1.08 (95% CI 0.85\u20131.38) in the EPIC-Norfolk and the CCHS cohort, respectively. However, the rate of CVD events did increase by more than 100% when high levels of Lp(a) were associated with higher LDL-C values (\u2265 5.5 mmol/L). The findings of this large observational study add new evidence to the role of Lp(a) as a potential independent CVD risk factor, and suggest that the risk is highest when both Lp(a) and LDL-C values are elevated. HRs are, on the other hand, modest when taken individually for Lp(a). The clinical implications of these findings for medical practice remain still to be assessed, and it is also unclear whether Lp(a) can be added as an incremental value for CVD risk prediction beyond traditional risk factors.Verbeek ,et al.\u2019s study is that it expressly assessed CVD risk associated with Lp(a) levels according to different LDL-C cut-offs, with adequately powered sample sizes across all strata of the cohorts.Previous studies, including a large meta-analysis, have suggested that the risk of CVD increased according to Lp(a) concentration, after adjustment for sex and age.et al.\u2019s study are valid for the primary prevention setting. Evidence is more controversial in secondary prevention and for patients on statins. In the Rosuvastatin Versus Atorvastatin (SATURN) trial, baseline and follow-up Lp(a) levels were not associated with changes in per cent atheroma volume as measured with ultrasound.P=0.66).The results reported in Verbeek Take home figure. Lp(a) particles have two major and distinct components: (i) a structure similar to an LDL particle containing Apolipoprotein (Apo) B and (ii) a glycoprotein [Apo(a)] that is similar to plasminogen.,What is the difference between Lp(a) and LDL-C? This key question is addressed in ,The 2010 consensus document on Lp(a) from the European Society of Cardiology proposed a linear association between Lp(a) levels and CVD events,In conclusion, for more than three decades now, Lp(a) has been explored in various mechanistic and clinical studies, but continues to take the role of perpetual supporting actor as a secondary or exploratory target, since no therapy has yet succeeded in specifically lowering Lp(a) without at the same time lowering LDL-C. Recent developments might finally change the scenario by highlighting Lp(a)\u2019s independent role in cardiovascular risk reduction. Lp(a) might yet receive a leading actor Oscar nomination after all."}
+{"text": "Human endogenous retroviruses are remnants of ancient germline infections that make up approximately 8% of the modern human genome. The HERV-K (HML-2) family is one of the most recent entrants into the human germline, these viruses appear to be transcriptionally active, and HERV-K viral like particles (VLPs) are found in cell lines from a number of human malignancies. HERV-K VLPs were first found to be produced in teratocarcinoma cell lines, and since then teratocarcinoma has been thought of as the classical model for HERV-Ks, with the NCCIT teratocarcinoma cell line particularly known to produce VLPs. Treatment for teratocarcinoma has progressed since its discovery, with improved prognosis for patients. Since the introduction of platinum based therapy, first year survival has greatly improved even with disseminated disease; however, it is estimated that 20% to 30% of patients present with metastatic germ cell tumor relapse following initial treatments. Also, the toxicity associated with the use of chemotherapeutic agents used to treat germ cell tumors is still a major concern. In this study, we show that the depletion of the HERV-K accessory protein Np9 increases the sensitivity of NCCIT teratocarcinoma cells to bleomycin and cisplatin. While decreasing the expression of Np9 had only a modest effect on the baseline viability of the cells, the reduced expression of Np9 increased the sensitivity of the teratocarcinoma cells to environmental (serum starvation) and chemical (chemotherapeutic) stresses. Np9 is also essential to the migration of NCCIT teratocarcinoma cells: in a wound closure assay, reduced expression of Np9 resulted in cells migrating into the wound at a slower rate, whereas reintroduction of Np9 resulted in NCCIT cells migrating back into the wound in a manner similar to the control. These findings support the implication that the HERV-K accessory protein Np9 has oncogenic potential. The Np9 guide RNAs  were cloned into the pSpCas9(BB)-2A-Puro (pX459) V2.0 plasmid. The pSpCas9(BB)-2A-Puro (pX459) V2.0 was a gift from Feng Zhang . As a control, a scramble sgRNA (gScr: gagatcgagtgccgcatcac) cloned into the pX459 plasmid was used; the scramble plasmid construct was kindly provided by Dr. Xiaoyan Jia.The CRISPR/Cas9 guide RNAs were designed using the online CRISPR Design Tool  and grown for 24 hours. For transfection of pX459 constructs, we incubated FuGENE HD transfection reagent  with OPTI-MEM reduced serum medium , and 500 \u03bcg of each plasmid was incorporated at a 1:6 ratio (DNA:Transfection reagent) for 30 min at room temperature before being introduced into cells. After a 24 hour transfection with sgRNAs, the medium was changed to RPMI supplemented with 2 \u03bcg/mL puromycin  for selection, and the NCCIT cells were selected for 3 days and then cultured in RPMI for 2 days to recover. After 2 days of recovery, the NCCIT clones were transfected with two additional rounds of CRISPR/Cas9 constructs. As there are hundreds of copies of Np9 scattered around the genome, some with slightly different sequences, CRISPR/Cas9-mediated genome editing results in knockdown (KD), rather than a knockout cell line.NCCIT cells were treated with 0.3 \u03bcM epoxomicin  for 24 hours to allow for the stabilization of Np9. NCCIT cells were collected with a cell scraper and lysed in cold RIPA Buffer  supplemented with cOMPLETE protease inhibitor cocktail . Protein lysates (33 \u03bcg protein per sample) were separated in Bio-Rad 4\u201320% Mini-PROTEAN TGX gels . Proteins were transferred to 0.45 \u03bcm pore size polyvinylidene difluoride membranes (PVDF) , incubated with anti-Np9 rat monoclonal antibody 10B1 or 22E4 (1:25) overnight at 4\u00b0C, and then incubated with rabbit anti-rat secondary antibody (1:5000)  . The ant2 incubator overnight, and was analyzed the following day with a Tecan GENios plate reader. Days 4, 5 and 6 were done in similar manner and optical density (OD) measurements were obtained. The optical density measurements were used to calculate percent cell viability, days 4, 5 and 6 were divided by OD obtained on day 0, resulting number was multiplied by 100 to determine percentage viability.To synchronize and starve the teratocarcinoma cells, the NCCIT cells were seeded at a density of 1000 cells per well in a Falcon 96-well tissue culture plate  and cultured in 100 \u03bcL RPMI supplemented with 1% P-S for 24 hours. After 24 hours, the medium was removed and changed to 100 \u03bcL full RPMI medium (time 0). At time 0, each well was treated with 10 \u03bcL MTT -2,5-Diphenytltetrazolium Bromide) (5 mg/mL) for 3 hours, and then 100 \u03bcL of solubilization solution (10% SDS in 0.01M HCl) was added to each well to stop the reaction. The plate was then wrapped in aluminum foil and incubated in a 37\u00b0C/5% CONCCIT cells were seeded at a density of 1000 cells per well in Falcon 96-well tissue culture plates  and cultured in full RPMI media for 24 hours. At 24 hours, the media was changed to media supplemented with 5, 15, 30, 60 or 120 \u03bcg/mL bleomycin  or 0.1, 0.5, 1, 15, 15 \u03bcg/mL cisplatin  and the plates were cultured for 48 hours. MTT assay was performed at 0 and 48 hours post-treatment. Calculations were done in a similar manner as previously described.NCCIT cells were seeded at a density of 220,000 cells per well in a 6-well CytoOne tissue culture plate , cultured in RPMI, and the media was changed every 24 hours. The cells were trypsonized with TrypLE Express, collected and centrifuged at 700 rpm for 5 mins. The cell pellet was washed once with 1X phosphate buffered saline (PBS)  and fixed with 70% ice-cold ethanol for 30 mins on ice. The fixed cells were washed with 1X PBS, re-suspended with FxCycle PI/RNase staining solution , and stained in the dark for 30 mins prior to analysis. The cells were analyzed with a Bio-Rad ZE5 cell analyzer at the University of Michigan Flow Cytometry Core.NCCIT cells were seeded at 150,000 cells per well in a 6-well CytoOne tissue culture plate  and cultured in full RPMI medium for 24 hours. After 24 hours, the medium was changed to mock treatment (full RPMI media) or RPMI medium containing 30 \u03bcg/mL bleomycin. After 24 hours, the cells were trypsonized with TrypLE Express, collected, washed with 1X PBS (PBS), and stained with CellEvent Caspase 3/7 Green Detection Reagent  for 60 mins; for the last 5 mins the cells were stained with SYTOX AADvanced Dead Cell Stain . Caspase 3/7 analysis was performed with a Sony SH800 Cell Sorter at the University of Michigan Flow Cytometry Core.Wound closure assay was performed with NCCIT Np9 CRISPR cells or with control NCCIT scramble cells. The tissue culture plates were treated with 0.001% poly-L-lysine solution  and stored at 4\u00b0C until use. NCCIT cells were seeded at a density of 200,000 cells per well in a 12-well CytoOne tissue culture plate  and cultured in RPMI for 24 hours. After 24 hours, each well was scratched linearly with a pipette tip, and images were captured at 0 and 24 post-scratch. To determine percent migration, images were measured used to measure the width of the wound through the entire length of the wound within the image using the NIS Elements image software. The percent migration was calculated by dividing the width of the wound at time 24 with time 0 and then multiplying by 100 to obtain percentage of migration.Re-introduction of Np9 into NCCIT Np9 KD cells was performed using the piggyBac transposon system. Np9 complementation was performed with the PB-CAG-Np9-mCherry transposon, and the PB-CAG-H2B-mCherry transposon was used as the control. NCCIT cells  were seeded at a density of 1,000,000 cells per well in a CytoOne 6-well tissue culture plate. NCCIT scramble control cells and NCCIT Np9 KD cell clones 8 and 9 were co-transfected with PB-CAG-H2B-mCherry transposon plasmid and pCAG-PBase transposase plasmid at a 1:1 ratio as a control. NCCIT Np9 KD clones 8 and 9 were co-transfected with PB-CAG-Np9-mCherry transposon and pCAG-PBase transposase plasmid at a 1:1 ratio. Twenty-four hours post transfection, the cells were selected for mCherry using a Sony SH800 cell sorter, and allowed to grow for a week in full media. The cells were selected a second time for mCherry a week after the first selection to ensure that the mCherry expressing constructs were stably integrated. These cells were used for a wound closure assay done in a similar manner as previously described.In view of the potential link between Np9 and teratocarcinoma, we performed loss-of-function studies to investigate the role of Np9 in the viability of the NCCIT teratocarcinoma cell line. We used two independent CRISPR/Cas9 constructs to make permanent cell lines in which Np9 expression had been knocked down. The CRISPR/Cas9 system is an efficient gene editing system that uses guide RNAs specifically designed to target and edit the gene of interest ; in our In our study, we used two independent Np9 guide RNAs to knock-down and reduce the number of Np9 copies in NCCIT teratocarcinoma cells. As can be seen in In the clinical setting, testicular teratocarcinomas are frequently treated with combinations that include bleomycin and cisplatin, two highly toxic agents \u201343,45,46By appearance, the NCCIT cells in which Np9 was knocked-down appeared to be apoptotic through the loss of adhesion. We therefore stained NCCIT cells (KDs and Scr control) with activated Caspase 3/7 green detection dye and SYTOX AADvanced viability dye to discriminate early and late stage apoptotic cells from live and dead cells. We found that, in spite of the limited effect on overall growth and metabolism as measured by MTT assay , diminisThe data above demonstrate that the effect of Np9 on the growth, metabolism, and viability of teratocarcinoma cells is particularly visible when the cells are put under stress. We therefore wanted to examine another aspect of oncogenesis that reflects cell migration, and so employed a wound-closure assay. In this assay, a scratch is induced to cells growing in a monolayer and then the time it takes for the \u201cwound\u201d to close is monitored. This is one important test for examining the contribution of a cellular protein to the oncogenic process ,51. As cIn order to confirm that Np9 is crucial to cell viability and wound healing, we employed the piggybac system to stably overexpress the Np9-mCherry fusion protein; the mCherry was used as a visual indicator for the stable expression of Np9. Western blot analysis was performed to visualize the re-introduction of Np9 . The re-HERVs have long been implicated in autoimmune disorders and oncogenesis ,36,52\u201366In the field of HERV-K biology, the Np9 protein has been of particular interest in view of its potential to function as an oncogene. Indeed, Np9 has been shown to control cellular signal transduction pathways that modulate expression of growth genes such as Notch, Akt, Wnt/\u00df-catenin, and Myc ,30,31. FTeratocarcinoma is often a treatable disease, but the treatment regimens are often quite toxic. Furthermore, the relapse rate is high in advanced stage disease ,44,46. H"}
+{"text": "Their structures were determined by spectroscopic analysis especially 1D and 2D NMR spectroscopies. All isolated compounds were evaluated for their cytotoxicity against five cancer cell lines . Compounds 3\u20136 and 8 showed good cytotoxicity against all the five cancer cell lines with IC50 values in the range of 1.45\u20139.46\u00a0\u00b5M.Two new xanthone derivatives, named schomburgones A (The online version of this article (10.1007/s11418-018-1240-8) contains supplementary material, which is available to authorized users. Garcinia schomburgkiana Pierre (family Clusiaceae) is a medium-sized tree distributed in Thailand, Laos, Vietnam, and Cambodia. In folk medicine in these countries, its leaves, roots, and fruits are used for the treatment of cough, menstrual disturbances, expectorant, laxative and diabetes . He. HeGarci2Cl2 crude extract from the bark of G. schomburgkiana led to the isolation of two new xanthone derivatives, named schomburgones A (1) and B (2), along with eight known compounds  + . The UV spectrum displayed absorption bands at \u03bbmax 395, 315 and 243\u00a0nm, which is typical of the xanthone chromophore + . The UV spectrum displayed absorption bands at \u03bbmax 394, 315 and 244\u00a0nm. The IR spectrum showed phenolic hydroxyl groups and a hydrogen bonded carbonyl group at 3432 and 1642\u00a0cm\u22121. The 1H NMR spectrum showed the presence of a 1,1-dimethylallyl group, which was confirmed by a singlets at \u03b4H 1.61  for two methyls, a doublet of doublet at \u03b4H 6.70  for the methine proton and two doublets at \u03b4H 5.07  and 5.22  for the methylene protons. Moreover, the methoxy signal, hydroxyl signal, aromatic proton signal and hydrogen bonded hydroxyl signal appeared as four singlets at \u03b4H 3.91 , 6.42 , 6.43  and 13.25 , respectively. The ABC-type aromatic protons were assigned at \u03b4H 7.23 , 7.26  and 7.71 . The 1H and 13C NMR spectroscopic data . Moreover, two methyl protons at \u03b4H 1.61 showed cross-peaks with \u03b4C 113.9 (C-4) and 156.3 (C-2\u2032), confirming that a 1,1-dimethylallyl group was connected at C-4. Thus, the completed assignment of schomburgone B was determined as 2.Schomburgone B  was obta3\u20136 and 8 showed good cytotoxicity against all five cancer cell lines with IC50 values in the range of 1.45\u20139.46\u00a0\u00b5M. Compounds 1 and 7 showed weak cytotoxicity against all five cancer cell lines with IC50 values in the range of 34.69\u201373.10\u00a0\u00b5M. Compounds 2, 9 and 10 showed inactive cytotoxicity against all five cancer cell lines with IC50 values >100\u00a0\u00b5M. The SAR studied data . The IR spectra were measured on a Nicolet 6700 FT-IR spectrometer using KBr discs.G. schomburgkiana was collected from Bang Ramat Road, Khwaeng Bang Ramat, Khet Taling Chan, Bangkok Thailand , in June 2017. The plant material was identified by Dr. Suttira Sedlak, a botanist at the Walai Rukhavej Botanical Research Institute, Mahasarakham University, and a specimen retained as a reference (Khumkratok no. 92-08).The bark of G. schomburgkiana (2.0\u00a0kg) was extracted with CH2Cl2 at room temperature for 7\u00a0days (2\u2009\u00d7\u200925 L). The CH2Cl2 crude extract (91.0\u00a0g) was further separated by column chromatography (CC) over silica gel CC and eluted with a gradient of Hexane\u2013EtOAc  to give six fractions (A-F). Fraction A (4.0\u00a0g) was purified by Sephadex LH-20 column eluted with 80% CH2Cl2\u2013MeOH (2 L) and further applied to a radial chromatography (chromatotron) with 95% hexane\u2013EtOAc (200\u00a0mL) to afford compound 9 (3.2\u00a0mg). Fraction B (10.5\u00a0g) was purified by Sephadex LH-20 column eluted with 80% CH2Cl2\u2013MeOH (2 L) and further applied to a chromatotron with 50% hexane\u2013CH2Cl2 (200\u00a0mL) to obtain compounds 2 (4.2\u00a0mg), 4 (2.5\u00a0mg) and 7 (2.3\u00a0mg). Compound 1 (7.2\u00a0mg) was separated by Sephadex LH-20 column eluted with 50% CH2Cl2\u2013MeOH (2 L) from fraction C (2.0\u00a0g). Fraction D (6.5\u00a0g) was purified by Sephadex LH-20 column eluted with 50% CH2Cl2\u2013MeOH (2 L) to give compounds 5 (8.5\u00a0mg) and 8 (4.6\u00a0mg). Fraction E (8.5\u00a0g) was purified by Sephadex LH-20 column eluted with 50% CH2Cl2\u2013MeOH (2 L) and further applied to a chromatotron with 70% hexane\u2013EtOAc (200\u00a0mL) to obtain compounds 3 (5.2\u00a0mg) and 10 (5.5\u00a0mg). Finally, fraction F (1.2\u00a0g) was subjected to silica gel CC eluted with 100% CH2Cl2 and further purified by Sephadex LH-20 column eluted with 80% CH2Cl2\u2013MeOH (2 L) to yield compound 6 (6.5\u00a0mg).The air-dried bark of Schomburgone A (1): yellow oil; UV (CHCl3) \u03bbmax (log \u03b5): 395 (3.6), 315 (4.2) and 243 (4.4) nm,. IR \u03bdmax (KBr): 3422 and 1632\u00a0cm\u22121; 1H  and 13C NMR  spectroscopic data, see Table\u00a0m/z 407.1527 [M\u2013H]+ .urgone A : yellow Schomburgone B (2): yellow oil; UV (CHCl3) \u03bbmax (log \u03b5): 394 (3.5), 315 (4.0) and 244 (4.2) nm,. IR \u03bdmax (KBr): 3432 and 1642\u00a0cm\u22121; 1H  and 13C NMR  spectroscopic data, see Table\u00a0m/z 325.1098 [M\u2013H]+ .1\u201310) were subjected to cytotoxic evaluation against KB (human epidermoid carcinoma), HeLa S-3 , HT-29 (human colon adenocarcinoma), MCF-7 (human breast adenocarcinoma) and HepG-2 (human liver carcinoma) cell lines employing the colorimetric method [3 cells) suspended in 100\u00a0\u03bcg/wells of MEM medium containing 10% fetal calf serum  were seeded onto a 96-well culture plate . After 24\u00a0h pre-incubation at 37\u00a0\u00b0C in a humidified atmosphere of 5% CO2/95% air to allow cellular attachment, various concentrations of test solution  were added and these were then incubated for 48\u00a0h under the above conditions. At the end of the incubation, 10 \u03bcL of tetrazolium reagent was added into each well followed by further incubation at 37\u00a0\u00b0C for 4\u00a0h. The supernatant was decanted, and DMSO (100 \u03bcL/well) was added to allow formosan solubilization. The optical density of each well was detected using a Microplate reader at 550\u00a0nm and for correction at 595\u00a0nm. Each determination represented the average mean of six replicates. The 50% inhibition concentration  was determined by curve fitting.All isolated compounds Below is the link to the electronic supplementary material."}
+{"text": "Escherichia coli (E. coli) has traditionally relied on detecting specific virulence associated genes (VAGs) or combinations thereof. For E. coli isolated from faecal samples, the presence of specific genes associated with different intestinal pathogenic pathovars will determine their classification and further course of action. However, the E. coli genome is not a static entity, and hybrid strains are emerging that cross the pathovar definitions. Hybrid strains may show gene contents previously associated with several distinct pathovars making the correct diagnostic classification difficult. We extended the analysis of routinely submitted faecal isolates to include known virulence associated genes that are usually not examined in faecal isolates to detect the frequency of possible hybrid strains.Classification of pathogenic E. coli routinely submitted to the Norwegian Institute of Public Health (NIPH) from clinical microbiological laboratories throughout Norway were analysed for 33 VAGs using multiplex-PCR, including factors associated with extraintestinal pathogenic E. coli (ExPEC) strains. The strains were further typed by Multiple Locus Variable-Number Tandem-Repeat Analysis (MLVA), and the phylogenetic grouping was determined. One isolate from the study was selected for whole genome sequencing (WGS) with a combination of Oxford Nanopore\u2019s MinION and Illumina\u2019s MiSeq.From September 2012 to February 2013, 168 faecal isolates of E. coli (IPEC) and ExPEC VAGs. In particular, 93.5% (101/108) of isolates classified as belonging to an IPEC pathovar additionally carried ExPEC VAGs. WGS analysis of a selected hybrid strain revealed that it could, with present classification criteria, be classified as belonging to all of the Enteropathogenic Escherichia coli (EPEC), Uropathogenic Escherichia coli (UPEC), Neonatal meningitis Escherichia coli (NMEC) and Avian pathogenic Escherichia coli (APEC) pathovars.The analysis showed a surprisingly high number of strains carrying ExPEC associated VAGs and strains carrying a combination of both intestinal pathogenic E. coli strains were found at a very high frequency in faecal samples and were in fact the predominant species present. A sequenced hybrid isolate was confirmed to be a cross-pathovar strain possessing recognised hallmarks of several pathovars, and a genome heavily influenced by horizontal gene transfer.Hybrid ExPEC/IPEC The online version of this article (10.1186/s12879-018-3449-2) contains supplementary material, which is available to authorized users. Escherichia coli (E. coli) is a highly diverse and predominant species among facultative anaerobic bacteria of the human gastrointestinal tract [E. coli comprises non-pathogenic commensals as well as strains causing a range of diseases. E. coli strains capable of causing extraintestinal infections are designated as extraintestinal pathogenic E. coli (ExPEC) to distinguish them from strains causing intestinal disease, commonly designated as intestinal pathogenic E. coli (IPEC).al tract . E. coliE. coli (UPEC) associated with urinary tract infection in human and animals, neonatal meningitis-associated E. coli (NMEC), septicaemic E. coli (SePEC) causing systemic infection in human and animals, avian pathogenic E. coli (APEC) that cause avian colibacillosis, and a potentially emerging ExPEC lineage named endometrial pathogenic E. coli (EnPEC) [.ExPEC can cause a wide variety of extraintestinal infections at multiple anatomical sites. ExPEC frequently cause urinary tract infection (UTI), septicaemia, meningitis, as well as causing soft tissue damage , 3. ExPE (EnPEC) , 5.E. coli strain as ExPEC nor for definite pathovar classification within the ExPEC group. Thus, the true pathovar classification can only be done on the basis of the isolation source for the majority of ExPECs.A wide range of VAGs have been associated with ExPEC and common virulence attributes among ExPEC strains are those enabling their extraintestinal lifestyle e.g. genes coding for the production of adhesins, toxins, protectins, siderophores, iron transport systems, and invasins , 6\u20139. ItThere is limited information regarding the frequency of ExPEC strains in the human intestine, however a recent meta study of more than 500 published papers assessed a prevalence of ExPEC strains among faecal isolates of about 10% in healthy individuals [E. coli strains submitted from individuals showing signs of gastrointestinal infections. We assessed the frequency of ExPEC and IPEC strains, phylogenetic grouping and the MLVA-genotype.The aim of this study was to investigate the frequency and combination of virulence markers including VAGs used for IPEC pathovar classification and a selection of VAGs related to ExPEC pathovars among E. coli (EAEC)/Shiga toxin producing E. coli (STEC) strain [In light of the large German O104:H4 outbreak in 2011 [) strain , the monE.coli strains were obtained from the culture collection at the National Reference Laboratory for Enteropathogenic Bacteria at the Norwegian Institute of Public Health (NIPH).All 168 http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and DNASTAR\u2019s Lasergene software module \u201cPrimer Select\u201d : cytotoxic necrotising factors 1\u20133 cnf1, cnf2, cnf3; autotransporters (ATs) sat, tsh, vat, ehaA, and ehaG; iron acquisition iutA, sitA, iucD, iroC, fbpB, and fyuA; adhesins sfaS, papC, and tosA; protectins kpsS, traT and iss; the invasin gene ibeA, and primers directed at orf5 in the gimB genetic island (sequence acc. no. AY170898). Primers directed at the etsA gene encoding the macrolide-specific efflux protein EtsA were also designed , Multiplex 2 , Multiplex 3 , and Multiplex 4 .PCR-primers for amplication of the following VAGs were constructed using primer3 software  with the following conditions: multiplexes 1, 2 and 4; 95\u00a0\u00b0C for 15\u00a0min, then 25\u00a0cycles of 94\u00a0\u00b0C for 30\u00a0s, 58\u00a0\u00b0C for 90\u00a0s and 72\u00a0\u00b0C for 90\u00a0s, followed by a hold on 72\u00a0\u00b0C for 10\u00a0min after temperature cycling has ended. Multiplex 3; 95\u00a0\u00b0C for 15\u00a0min, then 25\u00a0cycles of 94\u00a0\u00b0C for 30\u00a0s, 60\u00a0\u00b0C for 90\u00a0s and 72\u00a0\u00b0C for 90\u00a0s, followed by a hold on 72\u00a0\u00b0C for 10\u00a0min after temperature cycling has ended. The multiplexes were diluted 1:25 and run in separate capillaries on an ABI 3130 Genetic Analyzer  with GS 600LIZ as internal size standard.stx1, stx2, eaeA, ipaH, LTI, STIa, STIb, aggR, ehxA, bfp with 16S control rrs  and 200\u00a0ng of DNA was used for library preparation. The strain was sequenced using the R9.4 SpotON flow cell and the SQK-RAD002 rapid sequencing kit. All runs were prepared according to the standard protocol of Oxford Nanopore Technologies . The flow cells were primed with a priming solution that consisted of a mixture of nuclease free water and Fuel Mix. The library was then loaded into the MinION SpotON port and the 48-h sequencing protocol was selected in the MinKNOW software. The basecalling was done through the Metrichor Desktop Agent using 1D Basecalling for the SQK-RAD002 protocol.Illumina sequencing was performed on an Illumina MiSeq platform . Library was prepared using the Nextera XT kit (Illumina Inc) according to manufacturer\u2019s instructions and was sequenced using a 300\u00a0bp paired-end sequencing kit (Illumina Inc).Raw Illumina reads were paired and quality filtered using Trimmomatic  and baseUsing combined MiSeq and MinION data, the sequences were assembled into a large contig constituting the genome and a contig containing a large virulence plasmid.http://www.genomicepidemiology.org/). Assembly and annotation of the isolate FHI_NMBU_03 and its plasmid are publicly available at NCBI .The sequence data was annotated using four different services, the NCBI Prokaryotic Genome Annotation Pipeline , the BASE. coli faecal isolates were as follows: 53 non-IPEC (31.5%), . One hundred eight IPEC (64.3%),  (29.2%), 31 STEC (18.5%), 21 enterotoxigenic Escherichia coli (ETEC) (12.5%), 7 necrotoxin producing E. coli (NTEC) (4.2%), 3 enteroinvasive Escherichia coli (EIEC) (1.8%), 2 EAEC (1.2%), 1 typical-EPEC (tEPEC) (0.6%), and 1 STEC/ETEC  hybrid strain (0.6%)). A total of 108 isolates (64.3%) contained both recognised IPEC and ExPEC VAGs, thus 93.9% (108/115) of the IPEC isolates also carried ExPEC VAGs. Fifty isolates (29.7%) carried only recognised ExPEC VAGs without any accompanying IPEC associated genes  followed by B2_3 (6.9 VAGs), D2 (5.7 VAGs), D1 (5.4 VAGs), B1 (5.1 VAGs), A1 (4.1 VAGs), and A0 (3.3 VAGs).The pathovar distribution among the 168 sitA, iss, traT, kpsS and ehaG), while the fifth isolate had a deviating VAG composition  and was designated NTEC due to the presence of the gene for cytotoxic necrotising factor 2 (cnf2). Cluster 2 comprised of three aEPEC strains of phylogenetic group D1 isolated in October and November 2012, all of serogroup O55 with identical VAGs . Cluster 3 contained six phylogenetic group B1 isolates from December 2012, where five isolates shared the same VAGs  and was designated ETEC due to the presence of the LTI gene. Of these five isolates, four were serotyped into serogroup O78 while no serogroup could be assigned to the fifth isolate. The sixth isolate of MLVA-cluster 3 was also an O78 B1 isolate, but with different VAGs . Cluster 4 consisted of four phylogenetic group B1 serogroup O103 STEC isolates from September to December 2012, all with identical VAGs . Cluster 5 consisted of six phylogenetic group B1 serotype O103:H2 STEC isolates from October and November 2012 submitted from the same Norwegian hospital with identical VAGs . Cluster 6 contained four phylogenetic group B2_2 aEPEC isolates from September and October 2012 where three of the isolates showed the same VAGs , while the fourth isolate had the following VAGs .The 168 isolates grouped into 131 different MLVA-profiles (1.23 isolates/MLVA-profile), where six clusters of identical MLVA-profiles containing three or more isolates were detected. Cluster 1 consisted of five ExPEC isolates of phylogenetic group A1, all from December 2012. Four of the isolates shared the same VAGs  did not carry any VAGs previously associated with ExPEC strains. Thus, the majority (91.8%) of our aEPEC faecal isolates contained VAGs related to ExPEC strains. The most common ExPEC related VAGs among the aEPEC isolates were: traT (49%), iss (38.8%), fyuA (32.7%), tsh (26.5%) and ibeA (26.5%). When we divided the aEPEC isolates by phylogenetic group, we observed that the ibeA gene was present in 86.7% (13/15) of the aEPEC B2 strains, and the VAGs ehaA and ehaG were also frequently present, 49 and 51% respectively.Among the 49 stx1 only positive strains and 9 stx2 only positive strains. The remaining four strains contained both stx1 and stx2. Among the STEC isolates, the following VAGs were additionally found: eae, iutA, iucD, iss, traT, iroC, ehaA, ehaG, etsA, fyuA, kpsS, ehxA and fbpB. The most common ExPEC related VAGs were: traT (58%), iss (35.5%), iucD (29%) and iutA (25.8%). Additional prevalent non-ExPEC factors present were: ehaA (96.8%), ehaG (90.3%), ehxA (74.2%) and eae (71%).The 31 STEC isolates contained 18 ehaG was detected in 12 strains (57%), but ehaA was not detected in any of the ETEC isolates.Among the 21 ETEC isolates, ehaA and ehaG in 60/168 (35.7%) of the isolates, ehaG and traT or iss both combinations in 49/168 (29.2%) of the isolates, eae and ehaA in 48/168 (28.6%) of the isolates, eae and ehaG in 46/168 (27.3%) of the isolates, iss and fyuA in 43/168 (25.6%) of the isolates, traT and eae or ehaA both combinations in 40/168 (23.8%) of the isolates, iucD and iutA in 40/168 (23.8%) of the isolates and traT and iss in 38/168 (22.6%) of the isolates.When we looked at pair-clustering of the VAGs we found that the most common pairs (in more than 20% of isolates) of VAGs included: selC tRNA gene. The eae-intimin subtype of FHI_NMBU_03 is \u03b22. The LEE-encoded Tir protein of FHI_NMBU_03 is, by BLAST search, identical to three Tir proteins from EPEC strains and one protein from a human strain designated as UPEC , as well as eight animal strains. Additionally the genome encodes the intimin-like proteins FdeC and a SinH-variant. FHI_NMBU_03 was also positive for a cluster of the non\u2013LEE-encoded effectors nleB, nleC, nleG, nleH and a frameshifted nleA pseudogene, located within a phage-region identified by PHASTER. Using CGE the MLST type was predicted to be ST28 and the fimH subtype was predicted to fimH90. A selection of chromosomal genes found by sequencing associated with virulence can be seen in Table\u00a0bor (an iss homologue), traT (serum resistance associated), the pyelonephritis-associated pilus pap operon; papABCDEFHJK, a putative pixG adhesin related gene encoding a protein 99% identical to a protein (EQZ28352.1) from the E. coli human UTI strain UMEA- 3585-1 (PRJNA186355), a putative autotransporter gene encoding an uncharacterized protein identical to protein EQZ28355.1 from UMEA- 3585-1, iroN (catecholate siderophore receptor), an AppA (HlyII) hemolysin protein and the leukotoxin genes lktBCD.One strain from this study designated FHI_NMBU_03 from MLVA-cluster 6 was selected for whole genome sequencing using a combination of long- and short- read technologies, Oxford Nanopore MinION  and Illumina MiSeq , respectively. We were able to assemble a complete closed circular genome  and a complete circular virulence plasmid  pFHI_NMBU_03\u20131 from the combined runs. The genome sequence (coverage 21.6x) contained 4954 genes (gene density 1.057 genes/Kbp) and 200 pseudogenes, with a GC content of 51%. The chromosome contains five integrated prophages according to PHASTER analysis , and 19 alkB gene coding for the alkylated DNA repair protein AlkB has an internal frameshift, and is probably inactive in FHI_NMBU_03. Several loci pertaining to fimbrial structures were found and noteworthy are genes related to K88-fimbria, 987P-fimbria and colonization factor antigen I fimbriae (CFA/I), which are all associated with ETEC strains. FHI_NMBU_03 is also positive for the YghJ protein gene, also known as SslE (Secreted and surface associated lipoprotein), which is a cell surface associated and secreted lipoprotein harbouring M60 metalloprotease domain [The e domain .mutS and rpoS, associated with phylogroup B2 and uropathogens [o454-nlpD region [A previously reported insertion of unknown origin with a base composition suggestive of horizontal gene transfer in a genetic region between athogens  is additD region .E. coli, PCR on faecal isolates [eae and bfp genes for EPEC, stx1 and stx2 genes for STEC, genes encoding the thermostable (ST) and thermolabile (LT) toxins for ETEC, the aggR gene for EAEC, and the ipaH gene for EIEC. These targets are also candidate targets for automatic pathogen identification systems, especially in a culture-independent diagnostic tests (CIDTs) workflow. The results from these assays will be a classification of the E. coli isolates into one of the recognized pathovars or, in case of no target amplification, a classification as a non-enteropathogenic or commensal strain.Clinical microbiological laboratories and reference laboratories rely increasingly on genetic testing of faeces to identify possible pathogenic microbes. For enteric bacteria, a widely used practice is to perform PCR or real-time PCR assays, or other amplification methodology, to detect specific genes used for pathogen identification. For isolates  is used isolates . These pE. coli isolates submitted to the Reference Laboratory for Enteropathogenic Bacteria at the Norwegian Institute of Public Health (NIPH). We especially searched for known ExPEC VAGs as in recent years a heighten interest in the frequency of ExPEC strains in the human gut has emerged, however there are few studies examining the selection of VAGs used in the present study.In the present study, we looked at a wider range of virulence factors in faecal E. coli strains (64.3%) with a combination of recognized IPEC and ExPEC VAGs. There are limited data on how common these IPEC/ExPEC hybrid strains are. In a study of 265 E. coli isolates from hospital inpatients and outpatients with UTIs, 10.6% of isolates harboured at least one IPEC virulence factor [E. coli strains are separately designated as IPEC or as commensal strains harbouring ExPEC VAGs, thus it is unclear how high of a percentage may be IPEC/ExPEC combinatory strains. The IPEC/ExPEC combination was especially high among the aEPEC strains (91.8%).One surprising finding in our study was the high frequency of e factor . In previbeA positive isolates was an EPEC strains of phylogenetic group B2. Thus, ibeA carriage in faeces seems to be associated with a distinct group of IPEC strains in our material. The ibeA gene is a known virulence factor of E. coli strains responsible for neonatal meningitis in humans (NMEC) by contributing to the invasion of brain microvascular endothelial cells (BMEC) [ibeA plays an important role in the invasion of intestinal epithelial cells, as the absence of ibeA accounted for a reduction in invasion of ca. 67% compared to wild type in experiments with the adherent-invasive E. coli (AIEC) strain NRG857c and an ibeA deletion mutant strain (NRG857c\u0394ibeA) [ibeA was present in the genome of 26% of pathogenic isolates from chicken (APEC), but absent from the genome of non-pathogenic isolates of avian origin [ibeA gene was positively linked to the pathogenicity of the APEC strains, and it was additionally shown that ibeA was involved in the invasion of human BMEC by the APEC strain BEN 2908 [One notable finding was that 13 out of 14 (92.9%) s (BMEC) . It has 7c\u0394ibeA) . Furthern origin . The ibeBEN 2908 .ehaG gene in 48% of the strains with one or more ExPEC VAGs and no IPEC VAGs, since EhaG mediates specific adhesion to colorectal epithelial cells [ehaA and ehaG are most prevalent in the phylogenetic groups B1 and D, while a difference between ehaA and ehaG was observed in phylogenetic group A where ehaA was not detected but ehaG was present in 34% of the isolates. The distribution pattern of ehaA and ehaG was in the same range as results from a study by Zude et al. 2014 [ehaG gene, while in the present study 7.1% of the B2 strains were positive for ehaG. EhaG is localized at the bacterial cell surface and, in addition to colorectal epithelial cell adhesion, promotes cell aggregation, biofilm formation, and adherence to a range of extracellular matrix (ECM) proteins [An interesting observation was the high number of strains harbouring genes coding for the trimeric autotransporter proteins (TAAs) EhaA and EhaG. Especially finding the al cells . This inal. 2014 , with thproteins . TAAs arproteins . Non-IPEproteins .eae gene alone will classify it as an aEPEC by most molecular diagnostics tests.The fully sequenced FHI_NMBU_03 phylogroup B2 strain (with plasmid) from this study shows hallmarks of ExPEC pathovars UPEC, APEC, NMEC and the IPEC pathovar aEPEC with some VAGs related to ETEC , thus it constitutes a truly pathovar-hybrid strain . It has previously been reported that any two of yfcV, vat, or chuA along with fyuA could be used to differentiate UPEC from diarrheagenic E. coli (DEC), human commensal, or animal commensal isolates. However, to differentiate UPEC from APEC, vat, fyuA, and yfcV together are necessary, where the presence of the putative fimbrial subunit gene yfcV is highly predictive of UPEC, increasing the odds of a strain being UPEC by 99.5-fold [Several factors classify this strain as UPEC (e.g. 9.5-fold .E. coli strains and was not found among 243 draft genomes of E. coli isolates in a study using the CGE FimTyper Web tool [fimH gene in a sequence scaffold from a human aEPEC strain (702898_aEPEC) isolated in Pakistan (GenBank: CYBW01000017.1). The CGE FimTyper confirmed this fimH gene to also be of subtype fimH90.The fimH90 subtype was also an interesting finding as it appears to be rare among Web tool . Howevertsh and vat while sequencing showed the presence of the highly related hbp gene on the chromosome and a putative related autotransporter on the virulence plasmid (locus tag: BXO92_24355). The PCR results can be explained by the similarity of the intended target genes, and the considerable confusion in GenBank submitted sequences on the correct nomenclature. The Tsh and Hbp proteins differ by only two amino acid residues. In addition, Vat and Tsh/Hbp are 77.5% identical in amino acids.The comparison of sequence data with PCR typing revealed PCR positive results for The plasmid located putative autotransporter protein (protein id: PRJNA362852:BXO92_24355) show 43.7% AA identity and 56.6% AA similarity to Tsh. RAST annotates this protein as EspC, while BASys annotates it as Hbp.alkB gene. It is known that AlkB relevant lesions appear to represent strong blocks to replication, but these blocks can be bypassed by error-prone translesion DNA polymerases as a part of the SOS-system, leading to mutagenesis [The number of GIs and integrated prophages indicate that FHI_NMBU_03 has obtained a high number of virulence factors by horizontal gene transfer and this may have been facilitated by a defect in the DNA-repair system with a frameshifted agenesis .o454-nlpD region was shown to consist of several genetic patterns, where pattern III (the FHI_NMBU_03 sequence contains pattern III) had significant associations with phylogenetic group B2 strains, representing the most virulent members of the ExPEC group. This o454-nlpD region pattern was proposed as a tool to identify highly extraintestinal virulent strains among a mixed population of E. coli [The  E. coli .eae-\u03b22 carrying B2 strains of sequence type ST28 was previously detected among 56 aEPEC isolates from faecal specimens from children <\u20095\u00a0years old in Norway (five strains were from community-acquired diarrhoea samples) [ibeA, malX and usp genes as FHI_NMBU_03.Strains closely related to FHI_NMBU_03 may have caused disease in Norway for an extended period of time as nine aEPEC intimin samples) . All ninThe high frequency of strains with combined IPEC/ExPEC VAGs found in this study is worrisome as they might be capable of causing both intestinal- and extraintestinal disease. One scenario could be a general weakening of the immune system caused by ongoing intestinal disease, thereby creating an opportunity for spread of bacteria with ExPEC VAGs to other anatomical sites where the ExPEC VAGs may contribute to severe extraintestinal disease.E. coli strains from Norwegian hospitals, previously characterized as IPEC, also harbour ExPEC virulence factors. Traditionally IPEC is regarded as a diarrhoeagenic pathogen with a set of virulence genes that is absent in ExPEC strains e.g. UPEC. This very high frequency of combined IPEC/ExPEC was an unexpected finding warranting further studies, as they may provide a rich source of opportunistic extraintestinal infections. WGS of one selected strain confirmed the pathovar-hybrid nature and revealed a genome heavily influenced by horizontal gene transfer (HGT). Sequence complex ST28 has previously been assigned to a hybrid group that was named \u201cphylogroup ABD\u201d [We report that a high frequency (>\u200993%) of routinely submitted faecal oup ABD\u201d , which sAdditional file 1:PCR primers used in study. Sequences of all PCR-primers used in this study, with references. (DOCX 18 kb)Additional file 2:E. coli strains included in this study. - PCR positive amplicons are listed as well as the MLVA profile and the results from the phylogenetic group PCR. (XLSX 21 kb)The Excel sheet contains VAGs PCR, Phylogenetic PCR and MLVA results for all Additional file 3:E. coli whole genomes with E. coli K-12 MG1655 as reference. The SNP based phylogenetic tree was constructed using CSI Phylogeny 1.4 (https://cge.cbs.dtu.dk/services/CSIPhylogeny/). (PDF 10 kb)FHI-NMBU-03 SNPtree03 slanted. The image shows results from comparing the genome of FHI-NMBU-03 with a selection of"}
+{"text": "Molecular characterization of selected 22 tomato genotypes were assessed using 25 simple sequence repeat (SSR) markers. Phylogenetic tree was constructed by the unweighted neighbour-joining method (UPGMA) using NTSYSpc cluster analysis software. The Jaccard's similarity matrix was constructed using the SIMQUAL method using UPGMA algorithm in NTSYSpc. Jaccard's similarity matrix among these tomato genotypes ranged from a minimum of 0.22 to a maximum of 1 with an average genetic similarity of 0.67. Hence this study has importance in identifying genotypes that could maintain good quality and higher yield under high temperature condition.High temperature induced by climatic fluctuations are an important threat for plant growth, development and quality of agricultural produces. Adaptableness to environmental changes generally derives from a large set of genetic traits affecting physio-morphological, biochemical and agronomic parameters. Therefore, the identification of genotypes with higher yield and good quality parameters at high temperatures is becoming increasingly necessary for future breeding programs. Here, we analyzed the performance of different tomato genotypes grown under elevated temperatures in terms of yield and nutritional quality of the fruit. High temperature stress was induced from flower initiation to maturity stage by keeping the pots in a temperature controlled green house facility for 45 days. The quality and yield parameters were taken at the harvesting stage. Starch and soluble sugar concentration in the leaves of tomato genotypes showed significant reduction in its amount under heat stress. Titrable acidity (TA), total soluble solids (TSS) and ascorbic acid content of tomato fruits were highest under high temperature conditions compared to ambient condition but lycopene content decreased with rise in temperature. The yield attributes  High temperature stress; Tomato; SSR markers; Quality traits; Yield traits. The genus Solanum includes annual or short-lived perennial herbaceous plants. It is a typical day neutral plant and is mostly self-pollinated crop. It is an excellent source of carotenoids, vitamins, antioxidants, lycopene and lutein. The limited caloric supply, relatively high fibre content and presence of minerals, vitamins and phenols such as flavonoids make the tomato fruit an excellent \u2018\u2018functional food\u2019\u2019 providing many physiological benefits and basic nutritional requirements. The recent scenario of global warming affected agricultural production and productivity  until flower initiation. Five plants per each replication were maintained. The experiment was laid out in completely randomized design with two treatment levels i.e. control and high temperature stress (36+/-2 \u00b0C) with three replications each. 20 days after transplanting, a set of 22 genotypes with three replicates were transferred to temperature controlled greenhouse for heat stress induction. The average maximum and minimum air temperatures for control condition during crop growth period was 32.1 \u00b0C and 24 \u00b0C and the average maximum and minimum relative humidity (RH) of air was 90.6% and 59.2% respectively. The daily temperatures including maximum and minimum temperatures were recorded under control as well as heat stress conditions using digital thermo-hygrometer throughout the experiment. Quality parameters and yield parameters were taken at harvesting stage.This experiment was conducted at College of Agriculture, Vellayani, Kerala Agricultural University, 8.4316\u00b0 N, 76.9860\u00b0 E. Tomato seeds were obtained from NBPGR (substation), Thrissur. Tomato seeds were sown in germination tray (60 cells in one tray of size 54 \u00d7 35 \u00d7 5 (L x W X H) in cm) and filled with potting mixture (coir pith compost and vermicompost @ 2:1 ratio) and labelling was done properly. Irrigation was provided regularly using a rose can. The one month old seedlings were transplanted to pots  with potting mixture made from loamy soil of pH of 5.8, sand and cow dung on equal volume by volume basis. Six replications were maintained for a single variety. The plants were grown in natural, outdoor environment conditions in a wired enclosure  = 3.1206\u03bcg lycopene/mL.Titration method was used to estimate titrable acidity . Five toTSS in terms of \u00b0Brix units was measured in fresh tomato juice using a digital refractometer .The ascorbic acid content in plants was estimated volumetrically by the method explained by The homogenate was filtered through a double layered cheese cloth. The filtrate was made up to a known volume and centrifuged at 10,000 rpm for 10 min. The supernatant was collected and made up to 25ml using oxalic acid. 5.0 ml aliquot was pipetted into a conical flask to which 10ml of 4% oxalic acid was added. This was titrated against dichlorophenol indophenol (DCPIP) solution until the appearance of pink colour (V2 mL). The amount of ascorbic acid is calculated as follows:The amount of ascorbic acid is calculated as follows:2.4The height of plants was measured from the base of the stem to the tip of the shoot at harvest stage. and the average height was calculated on per plant basis and expressed in cm.Fruit set was also expressed in percentage by counting the total number of flowers as well as total number of fruits per plant.Average fruit weight was calculated by adding the weight of fruits from each of three replication plants at harvest and divided it by total number of fruits and expressed in grams per fruit.The weight of all the fruits collected per plant was taken and the total yield was calculated at the harvesting stage.2.5Twenty-two genotypes of tomatoes were used for the present study. The leaf samples were obtained from one month old plant samples, and genomic DNA was isolated using CTAB method as defined in the procedure by . The genQuality was assessed by using gel electrophoresis with 5\u03bcl of crude DNA sample on agarose gel (0.8%) and stained with ethidium bromide. After electrophoresis, the gel was visualized under UV trans-illuminator and photographed with gel documentation system. The observations on the intactness of bands of DNA samples were taken which revealed the quality of the DNA .Figure\u00a012.6Solanum lycopersicum L. (http://solgenomics.net/) database. PCR reaction was performed in a 20\u03bcl reaction mixture which consisted of, 2.0 \u03bcl of genomic DNA with quantity 25ng/\u03bcl, 2.0 \u03bcl of 10X Taq assay buffer A, dNTPs mix (10mm each) of about 1.5 \u03bcl, 0.3 \u03bcl of Taq DNA Polymerase (1U). 0.75 \u03bcl of Forward and reverse primer (10pM) respectively and 12.7 \u03bcl of autoclaved distilled water (Twenty five SSR primers were randomly selected and tested on isolated genomic DNA of sicum L. . These ped water .Table\u00a02L2.7Twenty five primer combinations were screened. The documented SSR profiles were carefully examined for the polymorphism in banding pattern among the genotypes. Markers were scored according to the standard protocol using binary codes. Banding patterns were scored for absence (0) and presence (1) of bands.The amplified gel pictures obtained from twenty five SSR markers were scored. The binary data generated for all the varieties for the polymorphic markers was entered in the NTedit program of NTSYSpc version 2.10 software .2.8The overall effects of treatment and cultivar and their interaction were analysed by means of two-way ANOVA with heat treatment and genotypes taken as fixed factors. Genotypes were treated as fixed factors because we were interested in the response of the specific genotypes used in this experiment. Twenty two varieties were analysed with 3 replications each for the treatment levels. The statistical analysis were done using OPSTAT software .3\u22121 fresh weight) recorded the maximum starch accumulation followed by Manulakshmi (304.45 mg g\u22121 fresh weight) under control condition, while the minimum starch content was recorded in Arka Rakshak (214.06 mg g\u22121 fresh weight). In heat stress condition, the highest starch content was observed in Anagha (235.67 mg g\u22121 fresh weight), while the lowest was observed in Arka Sourabh (84.37 mg g\u22121 fresh weight). The percent decrease in starch content was more in Arka Sourabh and less in IIHR-2200. The average starch content of the tomato genotypes at flowering stage was 170.71 mg g\u22121 fresh weight and 262.86 mg g\u22121 fresh weight under heat stress and control condition respectively  and lowest concentration in Arka Rakshak (51.92 mg g\u22121 fresh weight) under control condition, whereas under stress condition Vellayani Vijay (59.6 mg g\u22121 fresh weight) showed the highest soluble sugar content and minimum in Arka Rakshak (35.73 mg g\u22121 fresh weight) \u22121 fresh weight and 61.19 mg g\u22121 fresh weight under heat stress and control conditions respectively. The percent decrease in starch content was more in Arka Rakshak and less in Arka Abha.Significant genotypic differences for soluble sugar content was observed in different genotypes under high temperature. Highest soluble sugar concentration was observed in Nandi (77.73 mg g\u22121 fresh weight). The highest lycopene content was recorded in IIHR-2200 (5.49 mg g\u22121 fresh weight) and the lowest was observed in Arka Alok (0.36 mg g\u22121 fresh weight) under the control conditions whereas, maximum lycopene content was recorded for Nandi (2.94 mg g\u22121 fresh weight) and minimum was recorded for Arka Vikas (0.35 mg g\u22121 fresh weight) under high temperature conditions (The lycopene content decreased with a rise in temperature and ambient condition recorded the highest lycopene content in fruits (2.03 mg gnditions . The perTitratable acidity of tomato fruits was found to be significantly different among different genotypes. Highest concentration recorded at high temperature condition when compared to low temperature regimes (control). The highest titrable acidity was recorded for Kashi Vishesh (0.76%) which is at par with Vaibhav (0.75%) and Nandi (0.71%), minimum was recorded for IC-45 (0.33%) under control condition and maximum for Kashi Vishesh (0.86%) which is at par with Vaibhav (0.80%) and Nandi (0.81%), and minimum for IC-45 (0.37%) under high temperature condition . The aveIn our study, TSS increased in all the genotypes under temperature stress condition compared to control . Highest\u22121 fresh weight) and lowest for Arka Sourabh (9.67 mg g\u22121 fresh weight) whereas, ascorbic acid was found highest in Palam Pride (40 mg g\u22121 fresh weight) and lowest in Arka Samrat (9.39 mg g\u22121 fresh weight) for control conditions. The percent increase in vitamin C content was maximum for IIHR-2200 (30%) and minimum for Pusa Ruby (1%).Vitamin C content showed significant differences among the genotypes, all tolerant genotypes showed higher vitamin C under temperature stress conditions compared to control . Under h2 (570 \u03bcmol mol\u22121). Maximum plant height was observed for Nandi (143.97 cm) and minimum height for Vellayani Vijay (51.9 cm) under control condition and for high temperature condition, highest value of plant height was observed for IC-45 (219.33 cm) and lowest for Arka Sourabh (128.33 cm). The average value of plant height under control and temperature stress condition were 96.79 cm and 162.21 cm respectively. The percent increase in plant height was maximum for Vellayani Vijay (70%) and minimum for Arka Vikas (14%).Under high temperature stress in polyhouse condition, all the genotypes showed an increment in the plant height because of the shading effect of polyhouse  and elevFruit set significantly decreased at high temperature in all the tomato genotypes as compared to control temperature . HighestAverage fruit weight was significantly decreased at high temperature in all the tomato genotypes as compared to control temperature . The maxYield per plant significantly decreased at high temperature in all tomato genotypes as compared to control temperature. Nandi (213.12g/plant) gave the maximum yield per plant under control condition whereas, Arka Rakshak (22.41g/plant) showed minimum yield per plant . Under h3.1Twenty-five SSR markers were used for PCR screening, and the sequence was taken from the Sol Genomics Network database. In 3 percent agarose gel electrophoresis, 7 out of the 25 primers displayed polymorphism  and the 3.2Based on the DNA banding pattern of twenty two tomato genotypes using 25 SSR markers, Jaccard's similarity coefficient were developed and displayed in Maximum genetic similarity (1) was shown by; Pusa Ruby with IC-45, IIHR-26372, Manulakshmi, Arka Samrat, Arka Alok, Sakthi and Arka Abha with Nandi. Quality and yield parameters also showed similarities among these genotypes. Titrable acidity content of Arka Abha and Nandi ranged from 0.6 to 0.7 and for Pusa Ruby with IC-45, IIHR-26372, Manulakshmi, Arka Samrat, Arka Alok, Sakthi ranged from 0.4 to 0.6. Fruit set percentage of Nandi and Arka Abha ranged from 36 to 44% while it ranged from 30 to 36% in case of Pusa Ruby with IC-45, IIHR-26372, Manulakshmi, Arka Samrat, Arka Alok, Sakthi. Yield of Nandi and Arka Abha showed a range between 180-213 g/plant and that of Pusa Ruby with IC-45, IIHR-26372, Manulakshmi, Arka Samrat, Arka Alok, Sakthi ranged 50\u201380 g/plant.\u22121), fruit set percentage (13\u201348%) and yield (80\u2013135g/plant).Minimum genetic similarity coefficient (0.22) was shown by two pairs of genotypes viz. Pusa Rohini with Akshaya and Kashi Vishesh. Since they have low similarities, they shown differences in the yield, physiological data and in molecular characterization. In case of yield, Pusa Rohini with Akshaya and Kashi Vishesh shown wide range differences in lycopene content  and increased stomatal conductance (gs) at 38 \u00b0C, and better leaf cooling. Sensitive genotypes had lower Fv/Fm and PN at 38 \u00b0C, and gs increased less than in the tolerant group and less leaf cooling. Under controlled conditions, all eight genotypes had the same plant size and pollen viability, but after heat stress, plant size and pollen viability reduced dramatically in the sensitive group  and yield per plant (g/plant) were observed among tomato genotypes. Nandi, Anagha, Akshaya, Vellayani Vijay, Kashi Vishesh showed high temperature tolerance. Jaccard's similarity coefficient matrix of these tomato genotypes ranged from a minimum of 0.22 to a maximum of 1. Further study has to be conducted for the confirmation of heat tolerance with respect to different attributes contributing for tolerance mechanisms.Significant genotypic differences for starch, soluble sugars, titrable acidity (TA), total soluble solids (TSS), lycopene content, yield attributes Amrutha Vijayakumar: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Wrote the paper.Shanija Shaji; Sarada, S.: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.Beena R.: Conceived and designed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.Sajitha Rani, T; Roy Stephen.; Manju, R.V.; Viji, M.M.: Contributed reagents, materials, analysis tools or data.10.13039/501100009937Kerala Agricultural University for providing student research fund.Acknowledgement to Data included in article/supplementary material/referenced in article.The authors declare no conflict of interest.No additional information is available for this paper."}
+{"text": "Phoenix dactylifera , Scrophularia striata (herbaceous plants), and Opuntia ficus-indica (cactus). These plants have been found to have various types of bioactivities, such as antimicrobial activities against both bacteria and fungi, in addition to exhibiting anti-inflammatory effects and anti-cancer characteristics which can be utilized in the clinical setting for treatment. Due to limited reviews focusing on plant extracts from the Middle East, we aim to provide a discourse on plants from this region which have various bioactivities and to provide information on the compounds that can be identified from these plants. This is to enhance our understanding to improve modern medicine problems such as antimicrobial resistance and to find an alternative cure for cancer. It is hoped that the collation of information from this review will enable an assessment of the direct role of Middle Eastern plants in providing therapeutic options to address the predicaments in the medical field.Middle Eastern countries are primarily known for their dry sand deserts; however, they have a wider physiographic range which includes upland plateau and mountain ranges. The Middle East is home to various types of plants, such as  Mycobacterium tuberculosis [After the Industrial Revolution in the 18th century, modern medicine as we know it began to emerge. There were a few achievements that led to the development of the field of modern medicine, which would be the discovery of the small pox vaccination by Edward Jenner in 1796, followed by inventions such as the stethoscope and syringes in 1816 and 1853 by Rene Laennec, and Charles Gabriel Pravaz together with Alexander Wood, respectively . This warculosis ,5,6,7. FAccording to a report published by World Health Organization (WHO), by 2050, there will be approximately 10 million deaths caused by the drug-resistant pathogens and common diseases such as respiratory tract infections and urinary tract infections every year, which will be higher than the number of deaths caused by cancer ,10. HencAcantholimon, Acanthophyllum, Astragalus, Centaurea, Cousinia, Dionysia, Nepeta, Phlomis, Salvia, Saponaria, Silene, Stachys, Thymus, and Verbascum are example of plants that are predominantly found in these regions [The Middle East is known as the driest region in the word and consists of Bahrain, Cyprus, Egypt, Iran, Iraq, Israel, Jordan, Kuwait, Lebanon, Oman, Palestine, Qatar, Saudi Arabia, Syria, Turkey, United Arab Emirates, and Yemen ,20. Howe regions . Iraq coEscherichia coli, Klebsiella pneumoniae, Salmonella typhi, and Proteus mirabilis, but, other than E. coli and K. pneumoniae strains, date palm trees from the Middle East have yet to be tested for antibacterial activity against other Enterobacteriaceae [Plants from this region are less explored, but their counterpart plants from other regions have or are being widely explored for their application in plant extracts. One example would be the date palm tree from the African region, which has been tested for its antibacterial activity and has been reported to have activity against Enterobacteriaceae, such as pathogenic strains of eriaceae . The natTraditional medicine is a term used to refer to any non-Western medical practice and the practice of traditional medicines dates back to prehistoric times, whereby fossil records indicate that humans have used plants as a medicinal source since 60,000 years ago ,24,25. TAs per the reports, approximately four billion people from developing countries (approximately 80% of the world population) rely on traditional medicine as a main source of cure for ailments. Meanwhile, in countries such as the United States of America, Canada, and France, it is estimated that 42%, 70%, and 75% of their populations, respectively, have used herbal medicines at least once ,28,29,30Traditional medicines have been used as a reference to isolate medicinal value compounds from plants by researchers to be applied in modern medicine. Such a discovery would be the discovery of morphine from the tarry poppy seed juice, by Friedrich Sert\u00fcrner, from the plant opium poppy ,33,34,35Ayurveda and Chinese traditional medicine are well established and widely practiced forms of traditional medicines with a lot of research and publications. However, there are some practiced traditional medicines which have been less reviewed compared to Ayurveda and Chinese traditional medicines, but with equally important information. One such example would be the Middle Eastern-based plant extracts, which are rich in different types of compounds that can be grouped based on their chemical structures and have high bioactive activities.The extraction of plants can be conducted in a few methodologies. Hydro distillation is one of the methods used to isolate the plant extract ,40. The The Middle East is home to different species of plants, which exist primarily in that region despite having an extreme climate. There are various plant extracts that have indicated antimicrobial activity against a wide range of microorganisms, such as bacteria, fungi, and viruses . The antPhoenix dactylifera) have been identified to exhibit antimicrobial activity from various parts of the tree, such as the fruit and seeds, due to the presence of phenolic compounds [Klebsiella pneumoniae and Escherichia coli to determine their antimicrobial activity and the zone of inhibition obtained was compared with known antibiotics [K. pneumoniae (16.351 mm), whereas for E. coli (10.00 mm) the zone of inhibition was similar to amikacin (14.00 mm) and aztreonam (15.33 mm). The antimicrobial activities of date seeds are due to the presence of phenolic compounds, such as p-coumaric, ferulic and sinapic acids, flavonoids, and procyanidins [Dates  and Gram-negative bacterial strains (Klebsiella pneumoniae ATCC 700603 and Escherichia coli ATCC 35218) [S. aureus was highly susceptible to the leaves extract compared to the other Gram-positive strains, whereas E. faecalis was the least sensitive. K. pneumoniae exhibited no susceptibility against all three extracts, however, E. coli showed a small amount of susceptibility towards Hillaliah leaf methanol extracts. The methanol extracts were further examined for antioxidant activity and Hillaliah methanol extract showed the highest antioxidant activity (93.2%) at a concentration of 100 mg/mL, and Hoshana and Sukkaria recorded 88.9% at a concentration of 100 mg/mL. Terpenoids, phenolic, and flavonoids, which have antimicrobial activity, also contribute to the antioxidant activity which was identified through 2,2-diphenyl-1-picryl-hydrazyl-hydrate (DPPH) radical scavenging activity, reducing power assay, total antioxidant capacity, and reduction of ferric ions assays [The leaves of the date palm are rich in phenolic compounds, whereby the highest phenolic content can be obtained when extracted using methanol . The leaC 35218) . All thrs assays .Scrophularia sp.) plant extract from various parts, such as the stem, rhizome, and seed, showed that the extracts contain phenolic compounds, which is attributed to the antimicrobial activity [S. striata) against oral pathogens, Actinomyces viscous PTCC (Persian Type Culture Collection) 1202, Streptococcus mutans PTCC 1683, Streptococcus sobrinus PTCC 1601, Lactobacillus fermentum PTCC 1638, Lactobacillus casei subsp casei PTCC 1608, and Eikenella corrodens PTCC 1391 [S. striata at 100% w/v was less significant when compared to the control (Chlorhexidine). The zone of inhibition of S. striata extract was higher than Irsha mouthwash and tooth brush tree for both L. casei and L. fermentum, whereas the zone of inhibition of S. sobrinus and A. viscous was equal to Irsha but less than the tooth brush tree. For S. mutans the zone of inhibition was less than the tooth brush tree but more than Irsha, and finally against E. corrodens the zone of inhibition was equal to the tooth brush tree but more than Irsha. The antibacterial activity of S. striata might be due to the presence of phenolic acids, such as phenylethanoids, and phenylpropanoids, such as flavonoids. Phenylethanoids are derived from benzoic acid and are commonly found in Scrophularia sp., whereas phenylpropanoids such as flavonoids are commonly found in plant extracts [Other than the date palm, the phytochemical analysis of figwort  is a plant native to Iran, and has been reported to have anti-malarial activity [Water figwort  is a plant which is commonly related to oral hygiene and is known to contain compounds such as silica, resin, alkaloids, and vitamin C [Actinobacillus actinomycetemcomitans ATCC 43717, Actinomyces naeslundii, Candida albicans ATCC 90028, Lactobacillus acidophilus CCUG 5917, Porphyromonas gingivalis W50 Black, Prevotella intermedia VPI 4197, and Streptococcus mutans CCUG 11877. From the study conducted, S. mutans were the most sensitive strain to all the extracts, however, L. acidophilus was sensitive only to the root-ethanolic extract. Compared with all the solvent extracts, ethanolic extracts exhibited the strongest antimicrobial activity. Both twigs and roots ethanol extracts were able to inhibit the growth of C. albicans, indicating its capability as an anti-fungal agent. Compounds such as N-benzylbenzamide, decane, and stigmasterol have been revealed to possess antimicrobial properties, and they are widely found in the stem region of the Meswak plant [N-benzylenzamide is an amide, and all these compounds have been identified to contain antimicrobial activity [Meswak  is an herbaceous plant grown mainly in the Middle East region and has been reported to have anti-viral activity. The plant has been used traditionally to treat stomach and intestinal disorders, such as cramps and indigestion [p-cymene, \u03b3-terpinene, borneol, caryophyllene, and bicyclogermacrene as major compounds [p-cymene, \u03b3-terpinene, borneol, caryophyllene, and bicyclogermacrene are terpene compounds. Ethanol extract of savory of crete leaves has been used against monkey kidney cell line infected with Herpes simplex virus type 1 [Savory of crete  is a plant that originated from the Iranian region and has been reported to have anti-fungal property [Candida glabrata and Candida krusei [C. krusei is more sensitive to the chicory ethanol extract compared to C. glabrata, as C. krusei growth was inhibited at a low concentration of 50 \u00b5g/mL, whereas growth of C. glabrata was inhibited at a concentration of 100 \u00b5g/mL. The anti-fungal activity of chicory leaves extract is due to the presence of compounds such as lactucin, lactucopicrin, deoxylactucin, and \u03b2-1,3-dihydrolactucin [Candida sp., and similar results were recorded [Candida cells, resulting in the leakage of intracellular cellular content of the cells [The anti-fungal property of a plant extract is determined by the presence of compounds such as phenols, tannins, flavonoids, terpenoids, and saponins, and the methanol extract of plants has been recorded to contain high amount of these compounds ,102. Chiproperty . The leaa krusei . From thlactucin ,104. A srecorded . All thehe cells ,105.Other than antimicrobial activities such as antibacterial, antifungal, and antimalarial bioactivities, plant extracts from the Middle East are known to have anti-cancer and anti-tumor properties, with the added ability to also enhance the immune system and induce apoptosis among carcinoma cells; this will enable the possibility of curing cancers and tumors, without much dependence on chemotherapy agents . The antAjwa, a variety of palm date that can be obtained from Saudi Arabia, is known to exhibit anti-cancer properties when tested against cancer cell lines due to its high polyphenolic content . The ethS. striata is also known to have anti-cancer properties against Human Astrocytoma Cell Line (1321), which is from the brain. In a study conducted by A. Lajimi and colleagues (2010) [S. striata can be due to the presence of monoterpenoid compounds such as iridoid glycosides, especially aucubin and catalpol [Other than antimicrobial activity, s (2010) , aerial catalpol . The comcatalpol .Scrophularia has been identified for various bioactivities, such as antimicrobial activity and also anti-cancer and anti-tumor. A similar study was conducted against human breast cancer cell line using methanolic sub-fractions  of Scrophularia oxysepala [The plant xysepala . The amoOpuntia ficus-indica) is another common plant found in the dry and desert area, belonging to the family Cactaceae, and has 130 genera with about 1500 species that have been identified to have various bioactivities, including anti-cancer properties [O. ficus-indica has a high total phenolic content and results in high anti-oxidant activity by inactivating genotoxic molecules such as reactive oxygen species [Cactus , oleic acid (monounsaturated fatty acid), vitamins such as tocopherols and vitamin K1, sterols, and carotenoids . A studyFrom this review, it has been shown that plants from the Middle Eastern region are able to exhibit various bioactivities, such as antimicrobial, anticancer, and antitumor activities; they are also rich in antioxidants. There are studies being conducted from the plants this region to obtain the analysis of phytochemicals from various parts of plants. These extracts from plants should be further studied to identify the composition and also their bioactivity as an individual compound. In future, isolated compounds from these plants can be tested along with current known antimicrobials to identify the ability of the compound to improve the efficacy of the currently-used drugs against antimicrobial resistant pathogens through synergistic interaction, and as well to determine the efficacy of chemotherapeutic drugs when combined with these isolated compounds against cancer and or tumor cells. All the compounds which have been identified to exhibit bioactivity can be isolated and clinical trials need to be conducted to determine the efficacy of these compounds as antimicrobial drugs. The recognition and trial of compounds which have anti-cancer or anti-tumor activities will aid in the reduction of the side effects caused by the current chemotherapy drugs. However, the challenge involved in Middle Eastern region plants would be the replication of extreme weather when the compounds are to be extracted. It is important to continue research in this region\u2019s plants by utilizing traditional medicine as a reference to overcome the challenges in modern medicine, such as the lack of antimicrobial, antimalarial, and anti-cancer compounds."}
+{"text": "Quantile normalization is an important normalization technique commonly used in high-dimensional data analysis. However, it is susceptible to class-effect proportion effects (the proportion of class-correlated variables in a dataset) and batch effects  when applied blindly on whole data sets, resulting in higher false-positive and false-negative rates. We evaluate five strategies for performing quantile normalization, and demonstrate that good performance in terms of batch-effect correction and statistical feature selection can be readily achieved by first splitting data by sample class-labels before performing quantile normalization independently on each split (\u201cClass-specific\u201d). Via simulations with both real and simulated batch effects, we demonstrate that the \u201cClass-specific\u201d strategy (and others relying on similar principles) readily outperform whole-data quantile normalization, and is robust-preserving useful signals even during the combined analysis of separately-normalized datasets. Quantile normalization is a commonly used procedure. But when carelessly applied on whole datasets without first considering class-effect proportion and batch effects, can result in poor performance. If quantile normalization must be used, then we recommend using the \u201cClass-specific\u201d strategy. This facilitates comparative analysis, providing an in-depth perspective on differential change, with the abductive implication that differential change is correlated with cause2 and batch effects4. These technical variations cause the overall measurement distributions of samples  to shift differently, obstructing cross comparability between tissues.However, -omics platforms are susceptible to various sources of technical variation such as general noiseDealing with technical variation requires an analytical intervention known as normalization. Normalization is not one technique, but rather, a body of techniques, with each having optimal usage requirements. Normalization techniques also make varied assumptions about data distribution. For example, some such as the quantile normalization, assumes all samples have similar distribution regardless of sample class. However, this assumption only holds true when small numbers of genes/proteins are dysregulated.5 and Surrogate Variable Analysis6 may also be considered as subtypes of normalization techniques.The purpose of normalization is to eliminate or minimize technical variability. A general strategy, common to many normalization techniques, is to re-distribute signal intensities across all samples such that they now all have the same distribution (e.g. same mean and/or standard deviation). Common examples of normalization techniques include linear scaling , Z-normalization, and rank-scaling . Specialized approaches for removing batch effects  such as ComBat8. In Wu et al.8, they examined the distortions produced when cancerous cells  are cross-normalized to the same baseline as normal cells. The distortions produced include false effects , effect-size reduction, and masking of true effects . Wang et al.7, also demonstrated that different normalization techniques result in different differential gene sets. In both papers, while they attribute the distortions to an imbalance of genomic count , they and in other related studies10 do not offer tangible mitigating measures. And so, while the analyst (or biologist) is now aware that normalization is imperfect, they are left none-the-wiser on best practices, or at least, how to perform normalization properly.It is widely known that normalization techniques are imperfect, and even error generating, especially when the data does not meet the assumptions of the normalization technique11  method. QN is extremely popular and produces very well-aligned distributions such that QN-normalized samples all have the same distributions13 but is now used across almost any kind of high-dimensional/-throughput -omics platform including RNA-sequencing14 and proteomics9. A particular danger in the use of QN is that lay analysts are easily misled by the rather \u201cperfect-looking\u201d post-normalization results: QN-normalized samples look deceptively similar, even if the underlying classes are in fact, very different. Furthermore, as with Wang et al.\u2019s observations, QN can obliterate true signals and generate false signals during data analysis7.QN was originally developed for gene expression microarraysHere, we examine five different (sub)strategies based on the QN-some not necessarily correct, but still shown here so that its deficiencies are made known-for performing analysis Fig.\u00a0B. These 15.To determine the best strategy (if one does indeed exist), we benchmark on an assortment of available proteomics data  and consider both natural and simulated batch effects across different levels of class-effect proportion (CEP), which is the proportion of differential proteins amongst all measured proteins, between two sample classes. We also evaluate which QN-strategy is robust in situations where datasets that were previously normalized on separate occasions, are merged. This procedure is especially valuable in practical applications such as boosting mega-analysis where datasets are combined from various independently-derived sources to boost statistical powerThe quantile normalization (QN) procedure is simple Fig.\u00a0A: it invAmongst QN-strategies Fig.\u00a0B, \u2018All\u2019 The \u201cClass-specific\u201d strategy splits data by phenotype classes first where the classes are then quantile-normalized independently. The normalized splits are then recombined into one dataset. This design is meant to counteract false positives/negatives caused by averaging out sample classes with highly different expressional profiles .The \u201cDiscrete\u201d strategy takes the \u201cClass-specific\u201d approach further, and also accounts for the batch factor. Each split (by class and batch) are then quantile-normalized separately, and then recombined into one dataset.S1,B,i/ExpS1,A,i . Note that we only compare samples from the same technical batch. This \u201cratio-ed\u201d matrix still preserves the batch factors while class effect is now effectively, a fold change.The \u201cRatio\u201d strategy involves generating a matrix of ratios, obtained by arbitrarily comparing samples from one class against another sample belonging to the other class. Suppose we have a sample S1,A from class A, with proteins 1\u20131000, and another (paired) sample S1,B from class B, with proteins 1\u20131000. We may calculate an expression vector B/A, such that for each protein i, its respective ratio is Exp20. qsmooth computes a weight at every quantile comparing the variability between groups relative to within groups. The weight shrinks the group-level quantile normalized data towards the overall reference quantiles if variability between groups is sufficiently smaller than the variability within groups.Unlike the other strategies discussed earlier, the \u201cqsmooth\u201d strategy is a generalized version of QN which preserves global differences in distributions corresponding to different biological conditionsTo simulate class-effect proportion (CEP), class effects are applied onto 0, 0.2, 0.5 and 0.8 of measured proteins . In this simplistic scenario, we simply assign half of the samples of each class, to each batch.t test; \u03b1\u2009=\u20090.05 significance level) and overall batch-effect correction based on the gPCA delta21 (see below).Since the set of differential variables are known a priori, normalization performance across the five strategies may be evaluated by statistical feature selection  are used. These are expressed as:22. This dataset is largely free of any batch or class effects. As we have used it for a large variety of benchmarking experiments in the past, we would also be able to determine if the simulation outcomes from the various QN-strategies are compatible/unexpected with reference to previous studies. Batch and technical effects are simulated as described above and shown in Fig.\u00a0The D2.2 dataset is a one-class proteomics dataset (n\u2009=\u20098) derived from shotgun proteomics in a study of arctic squirrels with no technical replicates (batches)23, making a total of 12 samples. This is a rare dataset because it is designed essentially for benchmarking. As with D2.2, we have also used it for a variety of benchmarking experiments in the past, and therefore we would also be able to determine if the simulation outcomes from across the various QN-strategies are consistent with respect to previous studies. Moreover, these samples all originate from normal kidney tissue and have already been well-characterized and described prior24.The Renal Cancer Control dataset (designated RCC for ease of reference) is a one-class proteomics dataset (n\u2009=\u20094) with three technical replicates each (batches)To generate batch effects in RCC, two different batches are simply combined into one dataset Fig.\u00a0B. Since Many similar but small datasets are available online. To boost power, it is sometimes desirable to combine these datasets together as a form of \u201cbig-data\u201d analysis (we term this the \u201ccombination\u201d scenario). However, as constituent datasets are normalized independently; merely combining these can lead to the generation of batch effects, and reduce detectability of true biological signals.It is possible that amongst the various QN-strategies, some may have value in facilitating this \u201ccombination\u201d scenario. RCC\u2019s three natural technical replicates 1, 2 and 3) are used to identify the appropriate QN-strategy strategies on two datasets, the RCC and D2.2. Since both datasets have effectively one class, we may randomly assign samples into arbitrary classes and simulate class effects by specifying which proteins should have a significant differential expression see \u201c\u201d sectionBoth RCC  and D2.2  demonstrate that the commonly used \u201cAll\u201d quantile approach is generally poorer at signal recovery Fig.\u00a0.In RCC, where a natural batch effect is created by combining technical replicates, the \u201cAll\u201d quantile strategy performs generally the worst (in terms of F-scores) in statistical feature selection. Averaging across all CEPs evaluated, \u201cAll\u201d is the second worst with an F-score of 0.52; \u201cClass-specific\u201d is the best at 0.86 (1.7-fold difference). Where CEP is low (0.20) and in what may be considered a typical scenario where \u201cAll\u201d is expected to work well if not abysmally, \u201cDiscrete\u201d is the best performing with an F-score of 0.77, and \u201cAll\u201d second last at 0.52 (1.5-fold difference). When CEP is high (0.8) and what we consider to be a non-optimal scenario for \u201cAll\u201d, \u201cClass-specific\u201d tops the list with an F-score of 0.94 while \u201cAll\u201d performs very poorly with an F-score of 0.46 (2.0-fold difference). Expectedly, the greatest performance differential is in the scenario where CEP is high. But what is surprising is that \u201cAll\u201d does not work well even in the low CEP scenario as well.In the RCC evaluation, \u201cAll\u201d is not always the worst. Other poorly performing strategies include the \u201cRatio\u201d strategy, which is the worst in the small CEP scenario with an F-score of 0.33 Fig.\u00a0. FurtherIn RCC, the best approach for signal recovery, when CEP is small, is not to do anything  where the F-score for \u201cAdjust\u201d is 0.89, compared to 0.77 for \u201cDiscrete\u201d. However, \u201cClass-specific\u201d and \u201cqsmooth\u201d strategies catch up quickly as CEP increases . This supports the notion that such strategies become increasingly suitable, when inter-class differences (higher CEP) become more pronounced.D2.2 shows that the gPCA Delta is not always an objective measure of batch effects. It is unexpectedly high in cases where no batch effects are present with a mean value of 0.83 for all scenarios examined . A desirable analytical procedure is to take these datasets and combine them for the purpose of boosting power. This procedure is known as mega-analysis.Since each dataset comes from a different source, combining these inevitably generates batch effects, which in turn, has adverse effects on statistical feature selection. Since RCC has three technical batches, we may use these in a combinatorial manner to demonstrate if any of the 5 QN-strategies has any value in preserving signal, while also being robust against any generated batch effects.Using RCC, we first simulated class-effect proportion (CEP) from 0 to 0.8. Each technical batch in RCC with only class-effects simulated is termed as \u201cAdjustment\u201d phase data. We then simulated batch effects by combining the 3 technical batches derived from the \u201cAdjustment\u201d phase data using two scenarios, Ba1Ba2 and Ba2Ba3, which refer to Batches 1 and 2, and Batches 2 and 3 respectively. Ba1Ba2 and Ba2Ba3 are each normalized using the five QN-strategies. This post-normalized Ba1Ba2 and Ba2Ba3 are referred to as \u201cNormalization\u201d phase data. Finally, since we have two sets of normalized data due to Ba1Ba2 and Ba2Ba3, we combine these to create the \u201cCombination\u201d phase dataset.For \u201cAdjustment\u201d, \u201cNormalization\u201d and \u201cCombination\u201d phase data, we perform statistical feature selection and summarize the findings as F-scores Fig.\u00a0A. We alsWhen CEP is weak (0.2), there is overall degradation in statistical feature selection performance in the \u201cCombination\u201d phase. In the case of \u201cAll\u201d, the F-scores for Ba1Ba2, Ba2Ba3 and \u201cCombination\u201d are 0.54, 0.56 and 0.48 respectively. This weaker performance in the \u201cCombination\u201d phase is also observed in the case of \u201cClass-specific\u201d for Ba1Ba2, Ba2Ba3 and \u201cCombination\u201d at 0.78, 0.76 and 0.63 respectively. Similar degradations are also observed for \u201cDiscrete\u201d and \u201cqsmooth\u201d. Only \u201cRatio\u201d remained invariant for Ba1Ba2, Ba2Ba3 and \u201cCombination\u201d phases, albeit with the same poor F-scores at 0.33.These results may come across as unsurprising, since combining discretely normalized data (Ba1Ba2\u2009+\u2009Ba2Ba3) will create additional batch effects that make it harder to select correct signal. Notably, the \u201cRatio\u201d strategy performs the worst, followed by \u201cAll\u201d. This is consistent with our earlier findings, since we already know that \u201cRatio\u201d is the worst at dealing with batch effects  distributions. Given a dataset with two classes and a single batch. Suppose QN is applied blindly to the entire dataset, we will find that even when samples in the two classes have different feature value distributions, they are both normalized by QN to the same incorrect target feature value distribution (which is the average of the two true distributions weighted by the proportions of samples in the two classes). On the other hand, suppose QN is applied on the two classes of samples separately, the samples would be normalized to their respective target feature value distribution. Hence applying QN blindly to the entire dataset is less likely to produce good results than applying QN in a class-specific way  becomes progressively higher, generally leads to poorer identification of real signal . This is further exacerbated by the presence of batch effects serving as an additional source of confounding. In contrast, for the other 4 QN strategies, as CEP increases, the F-score increases.16. A very important erroneous assumption is that the different sample classes only involve few differential genes, and that in total, the overall distribution between samples should be similar, irrespective of class. These two assumptions are obviously invalid when comparing normal tissue against highly proliferative cancer tissue18.In practice, we are well aware that data normalization based on unreliable assumptions does more harm, by distorting the data, and creating invalid conclusionsHere, when CEP increases, applying quantile normalization on the whole dataset, is not effective, is error generating, and should be avoided.Amongst the five QN-strategies, across various class-effect proportion (CEP) and batch-effect levels, the \u201cClass-specific\u201d QN-strategy emerges as the victor. It is most effective when CEP is high. And so, based on both sets of simulations (D2.2 and RCC), we advocate the use of the \u201cClass-specific\u201d strategy, especially when class-effect proportion is high, and where there is also the presence of a strong batch effect  as a normalization approach if the intended desire is to eventually combine these separate datasets in a bid for performing mega-analysis; that is, combining multiple separately-normalized datasets into one single whole for the purpose of enhancing power, signal recovery and functional analysis.Although the focus here is methodological, there are many practical uses for \u201cClass-specific\u201d QN in the biological setting. As mentioned earlier, due to limited sample availability and high running costs, many biological datasets lack power. But combining these generates batch and/or other technical effects. If we want to more effectively leverage on biological data on which much resources  have been invested, doing normalization better can certainly help. In specific biomedical phenotypes, there are also diseases which clearly have high CEP. Cancer, being an obvious scenario suitable for \u201cClass-specific\u201d QN.Although we evaluate five QN strategies, this study is essentially limited to proteomics data. Assuming platform-specific idiosyncratic bias is negligible, the outstanding issue of strong CEPs should manifest similarly in a non-platform specific manner. That is, we do not think the results would have differed greatly if we considered genomics or transcriptomics data.However, it is true that different platforms have different traits , which may affect the relative performance of statistical feature selection or batch-effect measurement. A future direction of this study would be to investigate if there are discernible differences across platforms, and if our finding that the \u201cClass-discrete\u201d strategy is optimal when CEP is strong, still holds true.19 and could be considered as additional proof regarding the batch-effect robustness manifested by some of the strategies tested here. Finally, while very convenient, the gPCA Delta does not appear to be always stable or objective, and in the absence of class effects, may manifest as high , even when no true batch effects actually exist. However, this is a compromise, as a summary statistic measuring total batch effect is still more desirable than to check for batch effects manually, via the hundreds of scatterplots that may be generated per simulation.Other limitations are simulation and measurement of batch effects. The approach for simulating batch effects here assumes uniformity, such that every protein carries some information regarding batch effects and is multiplicative. However, techniques for non-uniform or additive batch simulation also existFinally, this study is based essentially on simulations, with assumptions on how batch and class effects may manifest. While it is possible to deploy \u201cClass-specific\u201d QN on real data, it is much harder to prove that the predictions are necessarily correct. This would require experimental validation and mechanistic studies, which goes beyond the scope of this study.Quantile normalization is often used to normalize \u2013omics datasets. If inter-class effect proportion and/or batch-effects are strong, then a careless but commonly used \u201cblind\u201d approach which applies quantile normalization on the entire dataset is wrong, and leads to poorer statistical feature selection while also not sufficiently addressing batch effects (if present). Fortunately, this is easily addressed by alternative strategies, namely, those that take into account class-proportion effects. Here, we demonstrate that such strategies, including the \u201cClass-specific\u201d and \u201cqsmooth\u201d approaches, readily outperform the blind approach to quantile normalization; and they are also robust, preserving useful signal even when considering multiple independently-normalized datasets.Supplementary Information."}
+{"text": "Diabetic retinopathy (DR) scores have two fundamental objectives: (1) detecting DR complications and their severity and (2) predicting the risk of progression to DR complications when they are not yet present. Detecting complications is the easiest part as it only requires to properly evaluate the existing situation such as finding new vessels or an edema. On the contrary, predicting the risk of progression is the most challenging part as it involves predicting the future. Not all diseases and complications can be predicted with the exploration tools available. For example, the occurrence of diabetic macular edema cannot yet be appropriately predicted. Conversely, proliferative DR might be predicted based on the signs seen on fundus examination or, even better, on fundus photos. The ETDRS group has done a very precise step-by-step work, evaluating not only the value of the signs but also the reproducibility of their evaluation, to identify the most suitable signs. Their choices were also based on pragmatism. They did not have all the currently available imaging modalities, so they have mainly used 7-field fundus photos covering for that time a satisfactory wide surface of the fundus. Eventually, fluorescein angiography has been found to be slightly more powerful than standard photos. However, as it is an invasive technique, the extra power supplied has not been considered justified given the treatments available at that time. The diabetic retinopathy severity scale (DRSS) and its simplified versions have finally become the gold standard for evaluating DR in clinical studies and for treating patients.Over the last century, the Airlie house classification group and later the Early Treatment Diabetic Retinopathy Study Research (ETDRS) group have done an outstanding work, even with the current standard, to create and improve a scoring to be used to predict the risk of DR progression before the occurrence of complications.i.e. retinal h\u00e9amorrahges per se are not the problem), but are used to estimate the risk of DR progression to its complicated forms. The DRSS and its variants have been used for so long that over time many clinicians have ended up merging these surrogate signs with their meaning and the disease itself. Thus, a reduction in hemorrhages has become the equivalent of DR improvement. This might have been acceptable as far as there was no mean to dissociate disease progression and its surrogate signs.DR pathophysiology is better known today and it is obvious that, before the occurrence of proliferation, fundus signs act as surrogates for diabetes-related changes: deep hemorrhages are signs of capillary non-perfusion that leads to ischemia and vascular endothelial growth factor (VEGF) secretion, while venous beading is a feature of vessel impregnation with VEGF for example. Some hemorrhages may eventually disappear over time despite persistent non-perfusion but if the non-perfusion area expands, new hemorrhages appear. Therefore, the higher the extand of hemorrhages is, the more new non-perfusion areas occur, and the higher the risk of progression to proliferation is. It should be noted that these signs do not correspond to the disease itself , to 35, that is, mild NPDR, the risk of progression to proliferative DR during the year should decrease from > 50% to < 10%, and it should evolve at least as any mild NPDR that is likely to progress to severe NPDR usually several years thereafter.Intravitreal injections, in particular anti-VEGF agents, have since been developed and used for the treatment of diabetic macular edema. As expected from an effective anti-angiogenic agent, anti-VEGF drugs have been shown to be able to control new vessels in DR eyes. More interestingly, it has also been shown that the DRSS score based on color fundus photos could improve after anti-VEGF intravitreal injections. This may indicate that despite a DRSS score improvement, ischemia persists. To explore this assumption, we have conducted two successive studies evaluating retinal perfusion after three anti-VEGF injections. In the first study based on fluorescein angiography, no vessel reperfusion was found despite an improved DRSS score on color photos. Indeed, even after this short treatment, new vessels, when present, regressed partly or totally. Fundus signs also improved in others. Then, the DRSS score improved by at least one stage in 61% of eyes. Meanwhile, in our study based on ultrawide-field fluorescein angiography, no significant reperfusion of arterioles or venules was observed in or around the non-perfusion areas. In the second study, using a similar method but based on wide-field OCT angiography, we found that despite a rapid DRSS score improvement after anti-VEGF treatment, no reperfusion occurred, including at the capillary level. Thus, our two studies have shown that the DRSS score can improve in the absence of reperfusion.Data on DR evolution after anti-VEGF treatment are limited but the reported series tend to suggest that anti-VEGF intravitreal injections clear the fundus from hemorrhages and signs of vessel impregnation with VEGF without eliminating the risks of neovascularization shortly after treatment discontinuation.It is now the time to question the fundus-based evaluation of DR after intravitreal injections. When after intravitreal injection a severe NPDR (score 53 ETDRS-DRSS) changes its appearance to the one of a mild NPDR (score 35) on fundus photography but continue to have the non-perfusion of a score 53, will it evolve as a mild NPDR or as a severe NPDR? If one considers that the non-perfusion is the cause of ischemia and VEGF production leading to proliferation, unless other mechanisms are involved, the evolution should be closer to the evolution of a severe NPDR. This substantial doubt on the value of fundus-based ETDRS-DRSS scores invalidates relying only on color fundus for grading NPDR after intravitreal injections.Waiting more data or a new method for assessing the risk of progression available, what may be the practical effects of such an uncertainty on the post-injection value of the ETDRS-DRSS scores? In clinical practice, if the injections are continued with short enough intervals, they may prevent any complications, but if they are discontinued, to be on the safe side, regardless of the fundus appearance, the risk should be considered the highest measured during the medical history of the eye and the follow-up should be decided accordingly. In some cases, OCT angiography or fluorescein angiography may also help to reevaluate the status of retinal perfusion. In upcoming clinical trials on this topic, it would be safe to include as much as possible multimodal imaging to compile data and also to be able to provide information required by the updated standards when they will end. We can indeed hope that in the forthcoming years, we will better understand with which modality and how we should evaluate DR for eyes treated by intravitreal injections. More generally, regardless of injections, isn't it time to try to switch from the historical classification of DR to new modalities using the best available modern images and all available data?"}
+{"text": "Loeffler endocarditis is relatively under-recognized and can impose a diagnostic challenge. We present a case of Loeffler endocarditis where eosinophilia was associated with parasitosis. This case highlights the importance of clinical clues in a patient with restrictive cardiomyopathy, and appropriate ancillary testing which helps guide further management. Loeffler endocarditis is a form of restrictive cardiomyopathy and is possibly an advanced stage of eosinophilic myocarditis (EM). EM constitutes 6% of all types of myocarditis and is a potentially fatal form of myocardial inflammation associated with peripheral eosinophilia . It is aA 24-year-old Hispanic man presented with intermittent exertional dyspnea, palpitations, and pleuritic chest pain. Symptoms developed approximately within three months, limiting his daily activities. He had moved to the United States from Central America two months prior. Physical examination was significant for an irregularly irregular rhythm. He denied any prior medical history. Two first-degree relatives suffered from heart-related diseases, one of them had a sudden cardiac death. The electrocardiogram (EKG) showed rate-controlled atrial fibrillation Figure .Hematologic testing was significant for peripheral eosinophilia with an absolute eosinophilic count (AEC) of 1.8 K/\u00b5L, alanine aminotransferase 101 IU/L, aspartate aminotransferase 113 IU/L, hyperbilirubinemia 1.6 mg/dl, an elevated pro-B-type natriuretic peptide (pro-BNP) of 7704 ng/L, and undetectable troponin T level. Transthoracic echocardiography revealed a normal left ventricular systolic function with a bi-atrial enlargement Figure . A transFurther testing revealed positive antibodies for Toxocara. Serologic studies for malaria, strongyloidiasis, Chagas disease, and toxoplasmosis were negative. Stool studies were negative for parasitic ova or helminths. Immunoglobulin E level was 1293 IU/ml. Human immunodeficiency virus screen was non-reactive. Serum and urine protein electrophoresis and serum-free light chains were noncontributory. Computed tomography of the head revealed a small focus of intraparenchymal calcification in the left occipital lobe, possibly suggestive of old neurocysticercosis Figure .A right heart catheterization revealed the following pressures (mmHg): right atrial 6, right ventricular (RV) 38/0, pulmonary artery 34/17 mean 25) and pulmonary capillary wedge 18, and a cardiac index of 2.4 L/min/m2. RV endomyocardial biopsy (EMB) revealed fibrin rich clot in the endocardial surface containing eosinophils  constitutes 6% of all types of myocarditis . It is aToxocara canis (T. canis)  [A systematic revision on all published histologically proven EM cases until June 2017 (n=179) showed that an associated systemic disorder was identified in 64.3% of cases, with hypersensitivity reactions being the most frequently associated condition, followed by eosinophilic granulomatosis with polyangiitis and hypereosinophilic syndrome. Other less frequent causes were infections  mainly attributed to Patients with EM can present with a wide spectrum of clinical manifestations from subtle nonspecific symptoms to a life-threatening cardiac arrhythmia. The most common symptoms are dyspnea and chest pain ,7. EM prT. canis) and cats (Toxocara cati), that may transmit the roundworm to humans through the fecal-oral route. While most seropositive patients are asymptomatic, some will develop a form of human toxocariasis called visceral larva migrans (VLM), of which 10%-15% may have myocardial involvement [Toxocara causes parasitic infection in dogs  compared with those who do not receive steroids  [0, 9.9% cThe diagnosis of Loeffler endocarditis can be challenging. In the appropriate clinical setting, low threshold of clinical suspicion should be maintained. EMB is considered the gold standard for diagnosis and should be performed with adequate clinical suspicion. Etiology of eosinophilia should be determined as treatment can be targeted to a specific cause."}
+{"text": "Though interest in human simple sequence repeats (SSRs) is increasing, little is known about the exact distributional features of numerous SSRs in human Y-DNA at chromosomal level. Herein, totally 540 maps were established, which could clearly display SSR landscape in every bin of 1\u2009k base pairs (Kbp) along the sequenced part of human reference Y-DNA (NC_000024.10), by our developed differential method for improving the existing method to reveal SSR distributional characteristics in large genomic sequences.The maps show that SSRs accumulate significantly with forming density peaks in at least 2040 bins of 1 Kbp, which involve different coding, noncoding and intergenic regions of the Y-DNA, and 10 especially high density peaks were reported to associate with biological significances, suggesting that the other hundreds of especially high density peaks might also be biologically significant and worth further analyzing. In contrast, the maps also show that SSRs are extremely sparse in at least 207 bins of 1 Kbp, including many noncoding and intergenic regions of the Y-DNA, which is inconsistent with the widely accepted view that SSRs are mostly rich in these regions, and these sparse distributions are possibly due to powerfully regional selection. Additionally, many regions harbor SSR clusters with same or similar motif in the Y-DNA.These 540 maps may provide the important information of clearly position-related SSR distributional features along the human reference Y-DNA for better understanding the genome structures of the Y-DNA. This study may contribute to further exploring the biological significance and distribution law of the huge numbers of SSRs in human Y-DNA.The online version contains supplementary material available at 10.1186/s12864-021-07389-5. Simple sequence repeats (SSRs/microsatellites) are ubiquitous in eukaryotic, prokaryotic, and also viral genomes with repeat-units of 1\u20136\u2009bp/nt . SSRs haSSRs have been reported to constitute ~\u200912% of Japanese pufferfish genome, 15% of rabbit genome, 10% of primate genome and so on ; and it \u2212\u20094 to 7.44\u2009\u00d7\u200910\u2212\u20092 per Y SSR marker they selected per generation [3(TAGG)(TAGA)7\u201315 in Yp11.1 and mutation rate is 2.5\u2009\u00d7\u200910\u2212\u20094, as they can be widely applied in forensic investigation, paternity test, population study and evolutionary research [Human chromosome Y is unique with sex-determining genomic compositions and unusual evolutionary history , 22. Humneration . And resresearch , 28\u201333. Here, we developed a differential calculating method for further exploring the exact distributional features of the SSRs with human reference Y-DNA (NC_000024.10). Hundreds of maps were established to clearly show SSR landscape in every 1 kilobase (Kbp) genomic region of human reference Y-DNA. These SSR landscapes revealed significant regional variation of SSR distributional features in this Y-DNA at the differential resolution of 1 Kbp. This study may provide an important guide for further exploring biological significance and distributional laws of numerous SSRs in human Y-DNA.The exact distributional features of the SSRs were investigated in the reference sequence of human Y-DNA (NC_000024.10), and this well reviewed Y-DNA is still incompletely sequenced with 55 sequenced segments and 56 gaps  , 34, 37.n) was used as the resolutions of 100, 50, 10, 5, 2 and 1 Kbp in 10 large segments. So a SSR position-related Dn-relative density (pDnRD) concept was introduced in this method. The differential resolutions more than 50 Kbp revealed that the SSR pDnRD only vary a little around the average relative density value in the sequenced regions of the Y-DNA  method, which can calculate SSR densities by dividing the large segments into many differential units, and the alteration of differential unit size may give different resolutions to reveal the feature of SSR distribution; herein, the differential unit size , 76 high density peaks , 528 middle density peaks  and 1400 low density peaks   , and 540 SSR landscape maps were obtained; these maps show that SSRs are accumulated significantly in some small regions and also seriously sparse in some regions; and many same or similar motif SSRs were observed to locate neighborly forming SSR clusters. Large numbers of SSRs in human Y-DNA have been previously understudied because the related studies usually focus on some significant Y SSR markers, or only analyzed the average distributions in the coding, noncoding and intergenic regions , 29, 38..10, and Our observation of significant SSR accumulations to form density peaks indicates an obviously statistic bias of SSR distributions in the human reference Y-DNA, and such accumulations were also observed in other human and mammal Y-DNA Figs. S and S6, SSRs are widely considered to be more in noncoding and intergenic regions than coding regions \u20133, 6. HoBesides clearly showing SSR landscapes, this study also revealed that many SSRs with same or similar motif are located neighborly to form over 8000 different sizes of SSR clusters in the sequenced regions of human reference Y-DNA. Many SSR clusters were detected to distribute numbers of SSRs with same motif and small neighboring SSR distances, contributing to forming the SSR density peaks, and some SSR clusters even distribute hundreds of identical SSRs with regular neighboring SSR distances Tables S and S3. SSRs are commonly thought to be not just the simple sequences randomly distributed in genomes. The distributional laws of SSRs in human Y-DNA still remain to be further studied, but we hope that this study with 540 exact SSR landscape maps in human reference Y-DNA will help to elucidate the genetic and evolutionary mechanism involved, and our DCM 2.0 method can contribute to clarifying the SSR landscapes in other genomic sequences.We selected the reported reference genomic sequence of human chromosome Y (NC_000024.10), which is the published human Y-DNA with the highest sequencing completion (yet unfinished) and most convincing accuracy. The non-sequenced compositions (gaps) separated this reference Y-DNA into 55 different sequenced segments, which can be grouped into large (\u2265100 Kbp) and small (<\u2009100 Kbp) size segments  was usually calculated by the total SSR size dividing the total size of the sample genomic sequence , 49, 50,In this formula , M is thWe developed the Differential Calculator of Microsatellites Version 2.0 (DCM v2.0) method in the basis of DCM v1.0  to calcui is the size of the i-th differential bin  in large genomic sequence; la is equal to rounding (N/Dn) to up integer; Dn represents the resolution of differential unit size (Kbp), e.g., D50 means the differential resolution of 50 Kbp.In these 2 formulas, nn) critically affects the exactness of revealing SSR landscapes as well as the pixels affect the image quality, and la is negative proportional to Dn. The large genomic sequence is like a large differential resolution size with la =1, which is not proper mentioned above, so it is necessary to process an investigation to adjust into the best size for revealing fine SSR landscapes.The differential resolution size  into local SSR sizes in numerous differential units of the large genomic sequence, expressed as the following formula:i is the size of SSRs in the i-th differential bin; it is also critically affected by the differential resolution size (Dn).In this formula , mi is tn-relative density (pDnRD) was introduced in this method, which reflects SSR distributional features are critically influenced by both position  and differential resolution size (Dn), and it can be expressed as:Each differential unit represents a small region of the large genomic sequence, so a concept of SSR position-related DnRDi is the pDnRD in the i-th differential bin at the large genomic sequence. And the standard deviation (SD) of pDnRD was used to test the exactness of SSR distributional features at the corresponding differential resolution size.pDnRD distributions in the reference human Y-DNA into the Figures. Among the maps of SSR pDnRD distribution at 1 Kbp resolution (pD1RD), a normal size map represents a zone including 51 differential units of 1 Kbp with overlapping 1 unit to bilateral maps, and each zone was labeled into a zone serial number, e.g., S4-Z003 represents the third zone in S4. Owing to the gaps in this Y-DNA, some zones are in unnormal size, including those of the starts and ends of large sequenced segments, and those of short sequenced segments ; the much short sequenced segments (size <\u200910 Kbp) were all integrated into the same map. The reported protein coding genes and ncRNA genes were also marked in these maps according to the annotation of NC_000024.10.Ggplot2, a R package, was utilized to visualize the SSR pDAdditional file 1: Table S1. The sequenced segments and SSR statistics of human reference Y-DNA (NC_000024.10).Additional file 2: Table S2. The SSR clusters in the original statistics of SSR extraction in human reference Y-DNA (NC_000024.10).Additional file 3: Table S3. The features of identified SSR mini-clusters in 55 sequenced segments of human reference Y-DNA (NC_000024.10) (mini-cluster (MClu), 9\u2009\u2264\u2009clustered same or similar SSR number\u2009<\u200926).Additional file 4: Table S4. The features of identified super high density peaks in 55 segments of human reference Y-DNA (NC_000024.10) at 1 Kbp resolution (super high peak (sHP), pD1RD\u2009\u2265\u2009425.00).Additional file 5: Table S5. The statistics of identified different position related D1-relative density (pD1RD) map types in 55 sequenced segments of human reference Y-DNA (NC_000024.10).Additional file 6: Figure S1. 540 SSR position related \u00a0D1-relative density\u00a0maps in human Y-DNA (NC_000024.10)\u00a0at 1 kilobase resolution.Additional file 7:\u00a0Figure S2. The SSR position related D50-relative density (pD50RD) map in 10 large segments of human reference Y-DNA (NC_000024.10).Additional file 8:\u00a0Figure S3. The comparison of SSR position related Dn-relative density maps at differential resolutions of 100, 50, 10, 5, 2, 1 Kbp in human reference Y-DNA (NC_000024.10).Additional file 9:\u00a0Figure S4. The comparison of showing SSR distributional features in SSR pD1RD map and UCSC Genome Browser at the position of 1200001-1300000 bp in human reference Y-DNA (NC_000024.10).Additional file 10:\u00a0Figure S5. The example of comparing high SSR accumulations between human reference Y-DNA and other human Y-DNA at the same locations.Additional file 11:\u00a0Figure S6. The similar SSR accumulations of high densities located at the flanking region (about 15000 bp away) of SRY in human chimpanzee, rhesus monkey, mouse and rat reference Y."}
+{"text": "Case Presentation. The 43-year-old female patient has an annual check-up of computerized tomography to detect the mass in the right middle mediastinum, so the patient was admitted to the hospital. Chest computerized tomography image found a mass of the middle mediastinum with the size of 23 \u00d7 22.3\u2009mm located between the right pulmonary artery and the pericardium with uniform margins and clear boundaries, not invading the surrounding organization. Very little contrast is absorbed after injection. She underwent a uniportal video-assisted thoracoscopic surgery, and this mass was found to be originating from the right phrenic nerve. Resection of the portion of phrenic nerve with mass was performed. Postoperatively, the patient was discharged from the hospital after 4 days of treatment in a clinical condition with no difficulty breathing and no chest pain; postoperative X-ray showed no abnormality, and the right diaphragm was unchanged.  Neurogenic tumors in the mediastinum account for approximately 20-30% of all types of mediastinal tumors in adults. This pathology is usually benign and has no or very few symptoms. Schwannoma rarely involves the phrenic nerve. We report a unique case of schwannoma involvement of phrenic nerve.  Although they are very rare, schwannomas of the phrenic nerve should be considered in the differential diagnosis of mediastinal tumors. Uniportal video-assisted thoracoscopic surgery is a preeminent option with properly sized tumors that deliver good results and have no postoperative complications associated with surgery. Neurogenic tumors account for approximately 20%-30% of all mediastinal tumors in adults \u20135. They The 43-year-old female patient has no special history, and she has an annual check-up of computerized tomography to detect the mass in the right middle mediastinum, so the patient is admitted to the hospital. On-board examination, the patient was awake with good overall condition and has no abnormalities of the cardiovascular system and thoracic system during clinical examination. The manifestation on thoracic X-ray: right pulmonary hilum has an even, well-defined border . Chest cOperative procedure. We made a 3\u2009cm skin incision on the VI intercostal space in the right anteriolateral side. The intraoperative examination found that the tumor of the right diaphragmatic nerve was about 2 \u00d7 3\u2009cm in size ( in size  with cle in size . The rem in size . Postope in size . CT scan in size .Intrathoracic neurogenic tumors are usually localized at posterior mediastinum. They could arise either from the intercostal nerves or spinal nerve roots , 5, 7. HSince there are almost no clinical symptoms, preoperative diagnosis is difficult. However, with a well-circumscribed tumor, with spherical or oval contours, located in the anterior or middle mediastinum, lateralized to one side, in contact with the pericardia, pulmonary artery, or superior vena cava, as in our patient, it was suspected to involve the phrenic nerve. Therefore, it was a diagnosis of exclusion, because thymoma, lymphoma, and teratoma are the most common tumors of the anterior mediastinum or hilum.Surgical treatment of the tumor is the first and foremost option. Depending on the size of the tumor, either classical surgery or thoracoscopic surgery would be preferable.th postoperative day and reexamined 1 month after surgery. Most of authors agreed that patients with adequate pulmonary function preoperatively would remain asymptomatic after unilateral phrenic nerve resection. Otherwise, patients with poor pulmonary function or demonstrate postoperative symptoms from eventration after phrenic nerve resection may solve a diaphragmatic plication [The tumor could be easily resected through uniportal VATS in our case. Postoperative period showed no complications with normal diaphragm movement, and the patient was discharged at the 4lication . HoweverPostoperative pathological results with our patient as  with HE Neurogenic tumors in the mediastinum usually have the benign pathological results. However, some specific cases have malignant pathological results. Smahi et al.  reportedIntrathoracic phrenic nerve schwannomas are usually benign and slowly expanding and have very little clinical symptoms and almost no malignant transformation. Therefore, it is necessary to think about it and perform differential diagnosis with some types of tumors in the anterior and middle mediastinum, but they should be treated by surgical excision. Uniportal video-assisted thoracoscopic surgery is a preeminent option with properly sized tumors that deliver good results and have no postoperative complications associated with surgery."}
+{"text": "Three-dimensional genome organisation and replication timing are known to be correlated, however, it remains unknown whether nuclear architecture overall plays an instructive role in the replication-timing programme and, if so, how. Here we demonstrate that RIF1 is a molecular hub that co-regulates both processes. Both nuclear organisation and replication timing depend upon the interaction between RIF1 and PP1. However, whereas nuclear architecture requires the full complement of RIF1 and its interaction with PP1, replication timing is not sensitive to RIF1 dosage. The role of RIF1 in replication timing also extends beyond its interaction with PP1. Availing of this separation-of-function approach, we have therefore identified in RIF1 dual function the molecular bases of the co-dependency of the replication-timing programme and nuclear architecture. How nuclear architecture overall affects the replication-timing programme\u00a0is not yet\u00a0clear. Here the authors reveal RIF1\u2019s dual role as a chromatin-interaction scaffold and regulator of replication timing that allows the coordination of these two aspects of nuclear function. Both spatial and temporal replication patterns are re-established every cell cycle in G1, at the timing decision point (TDP)2, that coincides with chromosomal territories achieving their radial position3 and the re-establishment of chromatin architecture and interphase-nuclear configuration4. The spatial organisation of DNA replication is evident at multiple levels. The units of DNA replication timing, replication domains (RD), coincide with one of the basic units of three-dimensional (3D) genome organisation, the topologically associated domains (TADs)5. Recently, in cis elements (early replicating control elements\u2014ERCEs) that can simultaneously influence chromatin looping and replication timing have also been identified6. Moreover, the \u201cassignment\u201d of RDs as early or late replicating (the establishment of the replication-timing programme), takes place on a chromosome-domain level, prior to the specification of the active origins of replication2. On a global scale, the early and late replicating genomes overlap with the A and B compartments identified by Chromosome Conformation Capture methods (HiC)9 and are segregated in the nuclear interior or the peripheries of the nucleus and nucleolus, respectively. It has been shown that artificially re-localising chromocenters to the nuclear periphery affected their replication timing without an immediate impact on their epigenetic makeup10. Finally, a recent study from budding yeast has shown that activation of early origins drives their internalisation11. However, no molecular, causal link between the temporal and spatial aspects of DNA replication organisation has been established.In eukaryotes, origins of DNA replication are not activated all at once. Origin firing follows a cell-type\u00a0specific temporal programme known as DNA replication timing. The replication-timing programme is mirrored by the spatial distribution in the nucleus of replication foci, which are clusters of about five simultaneously activated bidirectional replication forks18. It is also involved in re-establishing spatial chromatin organisation in the nucleus at G113, and in the control of replication foci spatial dynamics12. RIF1 could therefore be a molecular connection between the temporal and spatial organisation of DNA replication in mammalian cells.RIF1 is a key genome-wide regulator of replication timing30, telomere length regulation in yeast35, cytokinesis36, epigenetic41 and DNA replication-timing control. Mammalian RIF1 (266\u2009kDa) interacts with components of the nuclear lamina42, behaving as an integral part of this insoluble nuclear scaffold and chromatin organiser. RIF1 associates with the late replicating genome, forming megabase-long domains called RIF1-associated-domains (RADs)13. It is unknown what directs RIF1\u2019s association with chromatin, but both the N and C terminus can mediate the interaction with DNA47. RIF1 has a highly conserved interaction with protein phosphatase 1 (PP1) that is reported to be critical to regulate the firing of individual late origins of replication51. Activation of these origins is promoted by RIF1 removal in late S-phase, led by the increasing levels of cyclin-dependent kinase (CDK) activity51. These studies therefore place the role of the RIF1\u2013PP1 interaction at the stage of execution of the replication-timing programme, in S-phase. However, we have also identified a role for RIF1 as a chromatin organiser earlier during the cell cycle, in G1, around the time of the establishment of the replication-timing programme13. Rif1 deficiency impacts nuclear architecture, relaxing the constraints that normally limit chromatin interactions between domains with the same replication timing13. It is unknown if RIF1-dependent chromatin architecture establishment affects the replication-timing programme, how RIF1 contributes to nuclear organisation, and if and how its interaction with PP1 plays a role in these functions. More generally, the functional relationship between nuclear architecture and replication timing is still unclear.The molecular function of RIF1 is still unclear, although it is involved in a variety of functions such as DNA repairRif1 that specifically abolish the interaction. Our results show that both replication timing and nuclear organisation depend upon RIF1\u2013PP1 interaction. However, unlike the replication-timing programme, we find that nuclear organisation is exquisitely sensitive to RIF1 dosage. Using this separation-of-function approach, we identify in RIF1 the molecular hub for their co-regulation. In addition, we show for the first time that the replication-timing programme can be established and executed independently of a specific 3D organisation or of\u00a0the spatial distribution of replication foci.Here, we tackle these\u00a0questions by interfering with the RIF1\u2013PP1 interaction, introducing point mutations in\u00a051. This suggests that, through RIF1, PP1 contributes to control of the time of firing of individual origins of replication. However, the functional significance of RIF1\u2013PP1 interaction for the establishment and domain-level regulation of the replication-timing programme, and in the context of nuclear 3D organisation is unknown.RIF1\u2013PP1 interaction promotes the continuous dephosphorylation of MCM4 at replication origins that are \u201cmarked\u201d to be activated only during the later part of S-phase\u0394PP1: SILK into SAAA and RVSF into RVSA52). We therefore sought to express the Rif1\u0394PP1 mutant allele\u00a0in mESCs. Rif1 overexpression is toxic, hence, to create a system to expresses Rif1\u0394PP1 at controlled and as physiological levels as\u00a0possible, we have utilised Rif1FH/flox mESCs. In these cells, one allele of Rif1 contains loxP sites flanking exons 5 to 719 (Rif1flox)), while the second is a knock-in of a FLAG-HA2 tag (FH) into the Rif1 locus (Rif1FH)12 . Thus, Cre-mediated deletion of the Rif1flox allele leaves either the FH-tagged Rif1\u0394PP1, Rif1TgWT or the parental Rif1FH allele as the sole source of RIF1, effectively creating inducible FH-tagged Rif1 hemizygous cells. Upon tamoxifen-mediated Cre recombination, we have then studied the consequences of abolishing RIF1\u2013PP1 interaction in Rif1\u0394PP1/flox , control Rif1TgWT/flox (Rif1TgWT/- abbreviated Rif1-TgWT) and the parental Rif1FH/flox  cell lines. In agreement with the fact that, upon Cre induction, all the Rif1 FH-tagged alleles are hemizygous, RIF1-\u0394PP1, RIF1-TgWT and RIF1-FH, are expressed at comparable levels . Both RIF1-\u0394PP1 and RIF1-TgWT have a comparable degree of chromatin-association . Point mutations of these residues reduce RIF1\u2019s interaction with PP1 to undetectable levels  results in an altered cell cycle similar to Rif1\u00a0deficiency  and control hemizygous (Rif1-FH and Rif1-TgWT) cells form a separate cluster , are very similar to the wild type cells , Rif1\u00a0deficiency induces changes of both the spatial distribution of replication foci and replication timing12. We find a comparable effect in Rif1-deficient mESCs, with an increased proportion of cells displaying an early-like replication pattern  similar to early S-phase also appears aberrantly in cells in later S-phase  and loss of RIF1\u2013PP1 interaction (Rif1-\u0394PP1) on replication timing, this discrepancy in the effect on the total number of forks is interesting and indicates that the altered distribution of replication foci observed in both cell lines is not linked to the change of total number of replication forks. Moreover, by matching the total number of replication forks to the number of replication foci, we could not find a correlation between the number of forks per replication focus  has an impact on the spatial distribution of replication foci that is similar to, although milder, than Rif1 deficiency or expression of Rif1\u0394PP1   shows an intermediate but reproducible degree of change. Halving Rif1 dosage is sufficient to induce a gain of in cis contacts between distant genomic regions  replication timing is only affected by complete loss of functional RIF1 (Rif1-KO and Rif1-\u0394PP1). (ii) On the contrary, nuclear compartmentalisation, long-range chromatin contacts, replication foci spatial organisation and MERVL repression all show sensitivity to RIF1 dosage, with the effect of lack of RIF1\u2013PP1 interaction clearly worsening the effect of hemizygosis for the long-range chromatin interactions and nuclear compartmentalisation. We hypothesise that the reason for the difference of the effect of RIF1\u2013PP1 loss of interaction between chromatin contacts/nuclear compartmentalisation and replication foci distribution/MERVL overexpression, is that chromatin contacts/nuclear compartmentalisation are the primary features affected by loss of RIF1-dependent dephosphorylation of critical substrate/s, that directly or indirectly control them. The alteration of replication foci distribution is a more indirect way to visualise the same changes (therefore less sensitive), and modifications in gene expression  could also be an indirect consequence of these architectural changes, as we had already hypothesised13. We have indeed shown that the transcriptome is only altered after a few cell cycles in the absence of RIF1, while nuclear architecture changes are an immediate consequence of RIF1 absence, in the first cell cycle after Rif1 deletion13. Analysis of the effects of the loss of RIF1\u2013PP1 interaction is extremely complex. Chronic deletion of Rif1 causes cell cycle arrest12, cell death13 and genome instability19. If and when a Rif1/\u2212\u2212 cell lines can be obtained, it is through selection of survivors that are transcriptionally and genomically unstable and difficult to control for. Since Rif1-KO and Rif1-\u0394PP1 share most of the cellular phenotypes, homozygous knock-in of Rif1-\u0394PP1 would have the same issues as Rif1\u2212/\u2212 cells. On the other hand, Rif1\u00a0over-expression can only be analysed in transient, as it is toxic. Therefore, although Rif1-hem present the inconvenience of a basal level of deregulation of most of RIF1 functions, this system represents the best-controlled situation to address the key question of the role of RIF1\u2013PP1 interaction.The remarkable coincidence of spatial distribution and replication timing of different portions of the genome, at multiple levels of organisation and throughout evolution, has encouraged the idea of a causal relationship between nuclear architecture and replication timing. At a molecular level, their covariation\u2014for example during cell fate determination and embryonic development\u2014finds a confirmation in their co-dependence on RIF1. In this work, we show that both aspects of nuclear function depend upon the interaction between RIF1 and PP1. However, 3D organisation of chromatin contacts and replication timing show a different degree of dependency on RIF1\u2013PP1 interaction and are differentially influenced by RIF1 dosage. The loss of RIF1\u2013PP1 interaction affects the compartmentalisation of chromatin contacts comparably to a complete loss of RIF1 function, while it partially recapitulates the effects of 61 and to interact with the nuclear lamina42. RIF1 multimers could act as a sub-stochiometric platform, interacting with different regulators of replication timing, in addition to PP1. In this case, the consequences of the complete loss of RIF1 function on the replication-timing programme would amount to the sum of perturbation of multiple pathways that control the timing of origin activation. For example, RIF1-\u0394PP1 may only specifically interfere with the PP1-dependent control of DDK (Dbf4-dependent kinases) activity at origins, while other RIF1 interactors may contribute to the epigenetic control of origin activation. Proteins associated with RIF1 are enriched for chromatin and epigenetic regulators52, and the contribution of histone modifiers to the control of replication timing has long been recognised66. However, an understanding of the effect of Rif1 deletion on the epigenetic landscape is still missing, leaving this hypothesis currently hard to test67. In the context of chromatin architecture, RIF1 multimers could directly participate in the creation of local scaffolds that restrict chromatin mobility or could regulate other proteins with this role. In either case, a reduction of RIF1 dosage could have structural, quantitative consequences.RIF1 is known to multimerise68 and that the definition of A/B compartments and Early/Late replicating domains is uncoupled at the time of zygotic genome activation in zebrafish69 and during the first cell cycles of human ESCs differentiation70. Altogether, these data suggest that replication timing and nuclear architecture, or at least 3D organisation of chromatin contacts and spatial distribution of replication foci, are not linked by a causative relationship. Yet, they are coregulated, both during cell cycle and embryonic development, and RIF1 is a point of convergence. Having established this is an important step to start addressing the fundamental question of why this coordination is important. During embryonic development in different organisms, for example in Drosophila melanogaster, replication timing16 and TADs definition both emerge around the time when zygotic transcription starts71. Could uncoupling these two events have consequences on gene expression? We can alter chromatin organisation, leaving replication timing intact, by halving RIF1 dosage. This affects cell cycle progression and the repression of MERVLs (this work). In a complementary approach, it has been shown that alteration of replication timing by overexpression of limiting replication factors during early Xenopus laevis development, that presumably leaves nuclear architecture intact, affects the onset of zygotic transcription and the transition into gastrulation72. It is therefore tempting to speculate that the covariation of replication timing and nuclear architecture could be important to coordinate gene expression and the choice of origins of replication.Our results identify RIF1 as a molecular link, a point of convergence and co-regulation. We propose that RIF1, specifically, and not generic nuclear architecture, coordinates the replication-timing programme with nuclear 3D organisation. In agreement with this view, recent data show that cohesin and CTCF are not involved in the regulation of replication timing13, with the addition of 1\u2009\u03bcM MEK inhibitor PD0325901 and 3\u2009\u03bcM GSK3 inhibitor CHIR99021  in the culture media, from the start of the protocol.Mouse ESC cells were derived as described in ref. FH/flox Rosa26Cre-ERT/+ mESCs were derived by crossing Rif1flox/+ Rosa26Cre-ERT/Cre-ERT19 with Rif1FH/FH12 mice. The Rif1FH allele was specifically targeted in the parental line Rif1FH/flox Rosa26Cre-ERT/+ (Rif1-FH). Integrants were selected by hygromycin resistance. The targeting vector encodes a codon-optimised cDNA of RIF1 (exon 8\u2013exon 36). Hygromycin-resistant colonies were screened for correct targeting of the Rif1FH allele by Southern blot (EcoRV digest) and using a PCR-amplified probe (primers in Supplementary Information table \u201cPrimers\u201d).Rif12 in Knockout DMEM (Gibco 10829-018), containing 12.5% heat-inactivated foetal bovine serum (Pan-Biotech), 1% non-essential amino acids (Gibco 11140-035), 1% penicillin/streptomycin (Gibco 15070063), 0.1\u2009mM 2-Mercaptoethanol (Gibco 31350-010), 1% l-glutamine (Gibco 25030024)), supplemented with 1\u2009\u03bcM PD0325901 and 3\u2009\u03bcM CHIR99021 and 20\u2009ng/ml leukaemia inhibitory factor .mESCs were grown at 37\u2009\u00b0C in 7.5% CO6 cells for Rif1-WT and 6.5\u2009\u00d7\u2009106 for Rif1-KO lines, per 15\u2009cm plate  were plated at day zero, when treatment with 200\u2009nM 4-hydroxytamoxifen  started. Fresh medium with OHT was added after 48\u2009h. Cells were collected about 96\u2009h after starting OHT treatment.Experiments were carried out each time from a frozen vial of cells, at least two passages after thawing. 5.2\u2009\u00d7\u20091073. Fastq files were aligned using Bowtie2 version 2.2.6 on mm10 as a reference genome. SAM files were converted into BAM files and sorted using Samtools version: 1.3.1. bamCompare version 3.1.3 was used to create bedgraph files with 50 and 1\u2009kb binning of the log2 ratio of the early and late fraction. Duplicated reads were excluded from the computation of the bedgraph files as well as reads mapped on XY chromosomes. The two fractions were normalised as reads per millions (RPM). Plots and data manipulation were carried out using R version 3.5.1. The original names of the cell lines used in these experiments, included in the name of the Repli-seq raw files are: RFHF14\u2009=\u2009Rif1-FH, 14 tgWT A7\u2009=\u2009Rif1-TgWT 1, 14 tgWT H4\u2009=\u2009Rif1-TgWT 2, 14 tgwt H6\u2009=\u2009Rif1-TgWT 3, 14 \u0394P G11\u2009=\u2009Rif1-\u0394PP1 1, 14 \u0394P H1\u2009=\u2009Rif1-\u0394PP1 2, 14 \u0394P H2\u2009=\u2009Rif1-\u0394PP1 3, mESC B\u2009=\u2009Rif1-WT 1, mESC F\u2009=\u2009Rif1-WT 2, mESC H\u2009=\u2009Rif1-WT 3, mESC 5\u2009=\u2009Rif1-KO 1, mESC 18\u2009=\u2009Rif1-KO 2, and mESC 24\u2009=\u2009Rif1-KO 3.Cells were pulsed for 2\u2009hours with 100\u2009\u03bcM BrdU, collected and fixed in 70% ethanol. Processing was as described in ref. 6 cells were fixed in 400\u2009\u03bcl of DPBS/2% paraformaldehyde (Sigma P-6148) for 10\u2009minutes at room temperature shaking. Paraformaldehyde was then diluted to 0.2% and next cells were washed in cold DPBS. After 2\u2009minutes permeabilisation in 200\u2009\u03bcl PBS-Triton X-100 0.1%, cells were incubated 5\u2009minutes in saponin solution  at room temperature and anti-HA antibody  was added at 1:500. After 1\u2009hour at room temperature rotating, cells were washed twice in DPBS/2% FBS, resuspended in 200\u2009\u03bcl of saponin solution with goat anti-mouse Alexa Fluor 647 1:1000  and incubated for 1\u2009hour rotating in the dark. After washing twice samples were resuspended in 400\u2009\u03bcl of saponin solution with DAPI 2.5\u2009g/ml (Thermo Fisher Scientific D1306) and analysed on an LSR II FACS (BD). .Data were processed using R version 3.5.1. The confidence intervals (CI) of the median shown in Fig.\u00a0After 4 days of OHT treatment, cells were collected and counted. 3\u2009\u00d7\u2009102, 300\u2009mM sucrose, 0.5% Triton X-100 and complete protease inhibitor cocktail tablet). Pre-extracted cells were subsequently fixed in 3% PFA/sucrose for 30\u2009minutes at room temperature shaking. Example of the gating strategy in Fig.\u00a0For the FACS analysis of RIF1\u2019s chromatin association, the samples were processed as above, except, fixation was preceded by 3\u2009minutes incubation in CSK buffer  for 10\u2009minutes on ice. After washing twice, cells were incubated in 900\u2009\u03bcl of DPBS with 10\u2009mM Na-Ascorbate (Sigma A7631-25G), 1\u2009\u03bcM Alexa Fluor 647 Azide (Thermo Fisher Scientific A10277) and CuSO4 0.1\u2009M (Sigma C1297) for 30\u2009minutes at room temperature in the dark, rotating. Cells were washed in DPBS/1%FBS/0.5% Tween 20 (Sigma P9416-100ML) for 10\u2009minutes and then twice in cold DPBS/1% FBS. After 1\u2009hour incubation in 300\u2009\u03bcl of DPBS/1%FBS/DAPI 2.5\u2009g/ml (Thermo Fisher Scientific D1306), the samples were analysed using an LSR II FACS (BD). The data acquired were analysed using Flowjo software and plotted in R 3.5.1. To calculate the percentages of cells in early, mid and late S-phase in Supplementary Fig.\u00a012. Gating strategy in Figs.\u00a0After 4 days of OHT treatment, cells were pulsed for 30\u2009minutes with 10\u2009\u03bcM EdU (Invitrogen A10044). Cells were then washed with cold DPBS (Thermo Fisher Scientific 14190094), collected, counted and fixed in 75%. EtOH Samples were kept at \u221220\u2009\u00b0C for at least overnight. 7.5\u2009\u00d7\u200910Further information on research design is available in the\u00a0Supplementary InformationPeer Review FileReporting Summary"}
+{"text": "Plasmodium vivax malaria cases worldwide. This case\u2013control study assessed socioeconomic determinants of urban malaria in coastal Mangaluru, Karnataka, southwestern India. Between June and December 2015, we recruited 859 malaria patients presenting at the governmental Wenlock Hospital and 2190 asymptomatic community controls. We assessed clinical, parasitological, and socioeconomic data. Among patients, p. vivax mono-infection (70.1%) predominated. Most patients were male (93%), adult , had no or low-level education (70.3%), and 57.1% were daily labourers or construction workers. In controls , 4.1% showed asymptomatic Plasmodium infection. The odds of malaria was reduced among those who had completed 10th school grade , lived in a building with a tiled roof , and reported recent indoor residual spraying . In contrast, migrant status was a risk factor for malaria . Malaria in Mangaluru is influenced by education, housing condition, and migration. Indoor residual spraying greatly contributes to reducing malaria in this community and should be promoted, especially among its marginalised members.India faces 0.5 million malaria cases annually, including half of all  Plasmodium vivax cases in 2018 [India achieved major reductions in the burden of malaria in recent decades. Still, the country contributed to 3% of the global malaria cases, and 47% of While elsewhere, e.g., in sub-Saharan Africa, urbanisation generally was associated with lower malaria transmission , this isMangaluru is a rapidly evolving harbour and business hub, located at the Arabian Sea in the southwestern Indian state of Karnataka. Between 1980 and 2010, the population in Mangaluru metropolitan area doubled . In 2015We aimed at estimating the effects of socioeconomic factors on malaria, in particular, education level, migrant status, housing conditions (with roof type as a proxy), and indoor residual spraying (IRS). These variables were chosen a priori by their presumed relevance to the local malaria acquisition pattern (labour migration) and for policymaking .Plasmodium infection, and species were confirmed by nested polymerase chain reaction (PCR) assays [The present unmatched case\u2013control study with a group of community controls was conducted between June and December 2015, i.e., during peak malaria season, in Mangaluru, Karnataka, India. Mangaluru has approximately 485,000 inhabitants  . Malaria) assays .Community controls were recruited between September and December 2015. The recruitment goal was 40 randomly selected healthy individuals in each of the 60 wards (census units) of the Mangaluru municipality. Community health workers of the Mangaluru City Cooperation visited randomly selected households in each ward during the daytime, and one volunteer per household was enrolled based on willingness to participate. Exclusion criteria were fever (axillary temperature \u2265 37.5 \u00b0C) and symptoms suspicious of malaria . Finger-prick blood samples were collected from consenting control participants both on filter paper  and on microscopy slides. Malaria diagnosis  was performed identically to the one in cases (see above).Regarding the sample size, recruiting 800 malaria patients and 2000 controls allows for detecting associations of rare exposures  at strength as small as odds ratio (OR) 1.4, considering usual assumptions . For exposures at 50% prevalence, this sample size facilities sufficient power to detect an OR as small as 1.2.Upon recruitment, all patients and control participants were interviewed by community health workers and completed a questionnaire on demographic and socioeconomic parameters including age, sex, education , religion, migrant status , occupation , housekeeping), number of persons in the household, number of rooms in the household, roof type , tiles, or cement), household possessions , household income, preventive measures taken to avoid mosquito contact  and recent history of malaria (for participants and any household members).Education level on malaria ;Migrant status  on malaria ;Roof type on malaria ;IRS within 6 months on malaria: .Characteristics for included participants were summarised using median values and ranges, or frequencies and percentages, as appropriate. We identified relevant confounding variables that should be included in the models to obtain estimates of the total causal effects using directed acyclic graphs (DAGs) ,20, builWe further estimated the direct effects of education and migrant status on malaria in a secondary analysis. The direct effect is the effect of exposure of interest on the outcome excluding any indirect effects via mediators on the causal path from exposure to outcome . In our In an attempt to reduce possible bias introduced by missing data and to increase the power of our analysis, we imputed missing values using a multiple imputation approach , assuminAs in all studies attempting to make inferences from observational data, interpretation of the regression coefficients as causal effect estimates relies on several important assumptions. In our case, relevant assumptions included positivity, consistency, conditional exchangeability, absence of measurement error, no model misspecification, and the rare outcome assumption .We used R version 3.5.3  for all analyses, the MICE package  to genern = 328 ) and 10 homeless patients living on a boat were excluded from analysis (for consistency with control selection).Between June and December 2015, 909 malaria patients presenting at the Wenlock Hospital and 2478 community controls were enrolled in the study. Participants still in an educational track  predominated over falciparum malaria (9.1%) and mixed-species infections (20.8%). The geometric mean parasite density was 3475/\u00b5L ; 3.0% of patients were hospitalised. Among the controls, 90 (4.1%) PCR-confirmed asymptomatic Plasmodium infections were present, the uneven distribution of which is illustrated in In total, 859 patients with microscopically visible and PCR confirmed Basic demographic parameters and socioeconomic factors differed greatly between patients and controls . PatientResults of the four models estimating the total effects of interest are displayed in In this case\u2013control study on urban malaria in Mangaluru, we observed considerable effects of education, IRS, roof type, and migrant status on the odds of malaria, after adjustment for confounding. Higher levels of education and, profoundly, IRS were protective as was, unexpectedly, poor-quality roofing (as compared with cement roofs). Migrant status increased the odds of malaria directly and indirectly via a set of mediating variables.Completing 10th-grade education reduced the odds of malaria by more than two-thirds in the present study, both as total and direct effect, confirming respective findings on education and malaria reported globally . EducatiPlasmodium strains [Recent IRS substantially decreased the odds of malaria (>95%). Vector control is the main pillar in malaria control worldwide . Our dat strains . Our datIn a context of very diverse housing conditions ranging from rudimental shelters to urban condominiums, we chose the roof type as an overall proxy parameter for the quality of housing. While residing in living quarters with a tiled roof decreased the odds of malaria, surprisingly, a cement roof doubled the odds of malaria compared to living in residences with poorer quality roof types . Prior studies suggest that\u2014in rural areas\u2014traditional housing bears an increased risk for malaria , and anoIn our analysis, we applied a causal framework using an a priori defined causal structure ,20,37. TAnother limitation is a potential selection bias of control participants since they were recruited during the daytime hours at home , while patients presented to the hospital were more frequently males and construction workers or daily labourers. Moreover, the community controls were randomly recruited among households in the city of Mangaluru, whereas recruited patients came also from nearby rural areas and did not always live in a classic household. We attempted to address this problem by excluding patients without a residence (homeless) from the study since this heterogeneity was not captured among included control participants. A deficit in our data is the lack of IRS coverage by neighbourhood, which could have provided a better insight into the effect of IRS since such vector control can have an effect beyond individual households. We further acknowledge that the reliability of the data on self-reported socioeconomic determinants obtained via interviews may have led to potential missing not-at-random mechanisms. Furthermore, assessing socioeconomic status by scale or questionnaire has inherent limitations .In conclusion, being a migrant in Mangaluru, coastal southwestern India, contributes to the urban malaria incidence directly and indirectly via mediating factors, such as housing conditions and occupation. Education level, roof type, and recent IRS have a substantial, mitigating effect on malaria. Our results suggest that urban malaria incidence in this setting is, at least in part, driven by the poor living conditions of migrant workers. Improved IRS coverage of the poor and marginalised would likely reduce the burden of malaria in this urban community. This appears both feasible and necessary considering the operational possibilities of an emerging Indian business hub, on the one hand, and the malaria-related losses, on the other."}
+{"text": "The interaction between host immunity and mycobacterial scape mechanisms determines the balance between antimicrobial activity and/or mycobacterial survival. This Research Topic, presented as original research and review articles, focused on mycobacteria-host cell interaction studies, including cellular and molecular targets of mycobacterial diseases, mycobacteria-mediated cell death mechanisms, host cell factors/pathways that act on mycobacteria to contain the infection, and immune evasion mechanisms utilized by mycobacteria \u20133.Ge et\u00a0al. review the importance of macrophage diversity and polarization for the granuloma formation in mycobacterial diseases. Specifically, they focus on the importance of less studied types of macrophages such as multinucleated giant cells, epithelioid cells, and foamy macrophages. Nogueira et\u00a0al. focused on the B cell diversity in response to mycobacterial infection analyzing the B cells subpopulations in the peripheral blood of patients across the leprosy spectrum. They found that patients with a high bacillary load have an alteration in the frequency and function of mature and memory B cells. A better understanding of the immune cell\u2019s polarization and plasticity in response to mycobacterial infection is essential to preventing and treating mycobacterial diseases.The immune cells\u2019 polarization and plasticity in response to mycobacteria are essential for an efficient innate and adaptative immunity. Kundu and Basu\u2019s review article focused on the role of non-coding RNAs (miRNAs and lncRNAs) as immune regulators in host immune response to mycobacterial infection, acting in important pathways such as inflammation, autophagy, apoptosis, the polarization of macrophages, and mycobacterial survival. The presence of different non-code RNAs in the fluids of latent and active tuberculosis (TB) patients opens an important window for using non-coding RNAs as a therapeutic tool and as biomarkers of active and latent tuberculosis. In addition, Park et\u00a0al. review the influence of host immune-mediated stresses, such as lysosomal activation, metabolic changes, oxidative stress, mitochondrial damage, and immune mediators, on the activities of the currently anti-TB drugs. Indeed, they also discussed how TB treatment facilitates the generation of Mycobacterium tuberculosis (Mtb) populations that are resistant to host immune response or disrupt host immunity. The long-term treatment may increase the risk of multidrug-resistant (MDR)- and extensively drug-resistant (XDR)-Mtb emergence.The activation of intracellular mechanisms by mycobacteria contributes to an efficient antimicrobial response, antigen presentation, and metabolic homeostasis. Saha et\u00a0al. provide a new mechanism for mycobacteria evasion mediated by the macrophage at protein Coronin1 by the increase of intracellular cAMP levels upon mycobacterial infection. The increase of cAMP enhances cytoskeletal protein\u00a0Cofilin1 to depolymerize F-actin around the mycobacteria-containing phagosome leading to the retarded phagosome maturation and acidification processes, providing mycobacterial survival. In their contribution, Zhou et\u00a0al. showed that Mtb infection down-regulated GSK-3\u03b1/\u03b2 activity and\u00a0induced matrix metalloproteinase-1 (MMP-1) and -9 expressions in THP-1 derived-macrophages. MMP-9 protein expression was increased in the lungs of pulmonary tuberculosis and lymph nodes lymphatic tuberculosis patients, compared with that in patients of chronic inflammation. Their study has detected autophagy, pro-inflammatory and anti-inflammatory cytokines including IFNs and IFN stimulated genes (ISGs) upon Mtb infection with the treatment of SB216763, a GSK-3\u03b1/\u03b2 inhibitor, in THP-1-macrophages. A better understanding of how mycobacteria interact with macrophage to block phagolysosome fusion and manipulate inflammation is important for the development of better therapeutic strategies.Moreover, the ability of mycobacteria to inhibit phagolysosomal fusion also represents a key step in the determination of latent and active disease and can weaken the ability of the host immunity to fight against MDR- and XDR-Mtb. Zenk et\u00a0al. showed the effects of one of the prolylhydroxylases inhibitors, Molidustat, which interferes with the interplay between Mtb and macrophages by interfering with the MAPK pathway via inhibition of p38 phosphorylation and stabilizes Mtb antigen mediated induction of hypoxia-inducible factor (HIF)-1\u03b1 via TLR-signaling. These events lead to HIF-1\u03b1 translocation into the nucleus and induction of the vitamin D antimicrobial pathway expression, resulting in the reduction of the proliferation of virulent Mtb in human macrophages. The study of how hypoxia can help to control intracellular pathogens including mycobacteria can be used as a new therapeutical strategy against mycobacterial diseases. Rasi et\u00a0al. demonstrated that the enzymatic activity of Granzyme A (GzmA) is dispensable to mediate mycobacterial growth inhibition in primary monocytes infected by BCG. Global proteomic analysis of BCG-infected primary monocytes demonstrated that the ER stress response and ATP producing proteins were upregulated after GzmA treatment. These data raise the possibility for new targets for host-directed therapies to better control mycobacteria infections. According to the authors, future experiments are required to discern whether primary alveolar macrophages infected with Mtb recapitulate their findings.An efficient antimicrobial response is critical for the clearance of mycobacteria inside of macrophages, metabolic response to hypoxia can regulate the expression and release of antimicrobial peptides. Zhang et\u00a0al. highlight that sirtuin (SIRT) 7 contributes to limiting intracellular Mtb growth in RAW264.7 macrophages. SIRT7-mediated antimicrobial responses are partly due to NO production and apoptosis induction during Mtb infection. In addition, Ahn et\u00a0al. presented the antimicrobial effects of recombinant interferon (IFN)-\u03b2 for intracellular growth of M. abscessus infection. The pretreatment of recombinant type I IFN led to an increased NO production in the mouse lungs during M. abscessus infection, highlighting the function of the type I IFN-NO axis in the host defense against M. abscessus. Because cytotoxic NO action appears to be controversial in human monocytes/macrophages, future studies are warranted to clarify the function of SIRT7 and type I IFN in the context of NO regulation during the human antimycobacterial defense. In this Research Topic, Silwal et\u00a0al. review the emerging position of autophagy in host defense against nontuberculous mycobacteria (NTM) infections. Although it is still in its infancy to understand the role of autophagy in various NTM diseases, compelling evidence suggests that autophagy-modulating strategies promote antimicrobial host defense and ameliorate pathological inflammation during several NTM infections. Together, these studies suggest that NO-inducing and autophagy-activating strategies may be curative therapeutic weapons to fight against TB and NTM infections.The old antimycobacterial function of nitric oxide (NO) was revisited in this Research Topic. This special Research Topic highlighted the innovative and review studies focusing on a complex interplay at the interface of mycobacteria and host factors, thereby counteracting mycobacterial pathogenesis and enhancing of protective host defense system. A deeper understanding of complex host-pathogen relationships will facilitate future investigations on this area for the development of potential candidates and the improved therapy against mycobacterial diseases.The four authors reviewed and edited the manuscript. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "In 2017, Polish Biobanking Network was established in Poland, within BBMRI.pl project titled \u201cOrganization of Polish Biobanking Network within the Biobanking and Biomolecular Resources Research Infrastructure BBMRI-ERIC\u201d as a strategic scientific infrastructure concept. One of the key elements of the project was the verification of the current status of QMS in the Polish biobanking institutions and the implementation of common solutions. The main goal was to indicate the current QMS level and determine the starting points for QMS development for each biobank of the Polish Biobanking Network (PBN). Within 3 years, 35 audit visits were performed. The current status and the level of QMS implementation in each biobank were assessed. Five hundred and seventy recommendations were prepared. The data was analyzed using Fischer Exact test to determine whether or not a significant association was observed. Three areas of analysis were covered: (1) BBMRI.pl status, (2) QMS implementation level and (3) private/public party, respectively. The results were discussed within 15 areas. Concluding remarks showed that some differences were observed in the case of subgroups analysis. There is convergence in QMS within the biobanks where Tissue Banks are located. Moreover, some discrepancies between the QMS implementation level in BBMRI.pl Consortium biobanks and PBN biobanks are observed. Nevertheless, the consortium members are obliged to prepare other biobanks willing to enter the PBN as Members/Observers or which already are in the PBN, so that they can meet the requirements of the quality management system that will enable efficient management of biobanking processes in these units. That is why some actions within BBMRI.pl projects are organized to help the whole biobanking community in Poland implement the harmonized solution. One of the main goals of biobanking is an increase in the efficiency and excellence of biomedical research, leading to the creation and development of new medical treatments . It can Quality aspects present an increasing trend in biobanking and biomedical issues. Each year, more quality-derived events are observed. Moreover, professional biobanking infrastructures such as BBMRI-ERIC, societies and organizations, including ISBER , ESBB anin vitro diagnostic test systems) and in bidirectional information exchange by communicating expert knowledge of the ISO working group to the BBMRI-ERIC community. In 2018, the first dedicated standard for Biobanks was published as ISO 20387:2018: Biotechnology-Biobanking-General requirements for biobanking  . Standarobanking .Quality Standards for Polish Biobanks (QSPB) were established as common standards for Polish Biobanking Network (PBN) entities . The objective evidence was collected using observations, documented information and interviews. The assumption of the audit was based on an accessible process called \u201cfriendly audit\u201d; a similar formula is also presented in BBMRI.de audit system  where quality aspects for all organizations are collected. The audit begins with an opening meeting conducted by the lead auditor to introduce the audit team and discuss the audit objectives, scope, and program. During the audit, the auditors took audit samples. During the first visit, the auditors got acquainted with the processes taking place in Biobank, documentation of the type of procedures and instructions (if established and implemented in Biobank), records of processes (paper and/or electronic). During the first visit, the auditors familiarize themselves with: the basis of Biobank's operations ; with protocols/instructions for handling biological material stored in the biorepository (if established); with the way of marking the material ; with the method of recording Biobank resources ; with the method of assessing the quality of the tasks performed ; with auxiliary processes concerning, inter alia, the process of hiring and training employees, assigning them authorizations, cooperation with suppliers. After the audit, at the closing meeting, the lead auditor presented and discussed the results of the audit, and the recommendations issued. A summary of the Audit report was a list of observations and recommendations for individual areas of QMS covered by the audit. It was planned that the 1st audit report will not contain non-conformities. The implementation and assessment of the effectiveness of the actions taken should be subject to verification, e.g., during the management review. Verification of the reference to the recommendations is also a part of the next audit (audit input no. 2). The background and audit preparation was presented also in our previous paper .Training was added to Human Resources Management, (2) Traceability of technical and technological processes, Controlled storage process were combined within one area of Traceability, (3) Strategic and operational objectives were added to Quality Management, (4) Quality control of deliveries were changed to Supplies, material management, (5) Monitoring of environmental conditions and Handling of hazardous waste were combined in one area of Environmental and staff hygiene. Some other areas were also changed or added, which resulted in the establishment of 15 areas (similar to QSPB) (1) Management of Biobanks, (2) Quality management, (3) Documentation and records, (4) Human Resources Management, (5) Ethical and Legal Aspects-ELSI, (6) Supplies, materials management, (7) Equipment, (8) Traceability, (9) Environmental and staff hygiene, (10) Biobanking processes and quality control, (11) Deviations, non-conforming product/data or service, (12) Audits, (13) Improvement, (14) Biobank cooperation in the scientific, research and development area and (15) Safety&Security.Cooperation in QM BBMRI-ERIC WGs, the Polish Committee for Standardization in TC 287 Biotechnology and ISO TC 276 WG2 and WG4 provides the best knowledge on standards dedicated to biobanking. The previously determined 13 areas  were modNo non-conformities are revealed in the first audit report. Furthermore, the scope of needs and expectations of each biobank toward BBMRI.pl QMS team was estimated.The obtained data were subject to statistical and descriptive analysis, with division into three main categories: group 1\u2014comparison of Members/Observers from PBN (35 units) and Consortium members (6 units); group 2\u2014the division into public (36 units) and private biobanks (5 units). Public biobanks were operating at universities, research institutes and public hospitals. Private biobanks operated as part of private laboratories; group 3\u2014biobanks with QMS implemented (11 units), biobanks without QMS (30 units), biobanks operating within tissue and cell banks- the entities specialized with the collection, processing, storage and production of human tissues and cells for therapeutic issues (6 units). Units with established and applied integrated QMS were considered as biobanks with QMS implemented, regardless of whether they are ISO 9001 certified or not. Within the groups, specific subgroups were analyzed.****/*** extremely significant , ** very significant (0.001\u20130.01), * significant (0.01\u20130.05), ns- not significant (>0.05). All statistical analyses and graphs were performed using GraphPad Prism 8.0.1. The results were presented in all figures.Categorical data were described using the scores for meeting the requirements of the audit area and percentage using the same criteria as described in the previous paper . The assELSI, 76% of biobanks met the requirements. The majority of biobanks possess well-prepared donor's documentation regarding national and international projects. Nevertheless, the most frequently identified deficiencies within the ELSI included incorrect IC forms in terms of the donor's rights and freedoms (20%); lack of records regarding the processing of personal data in accordance with the GDPR (16.7%); lack of procedures for obtaining IC (10%). The results show that effective activity is needed in Traceability and Management of Biobanks (12% fulfillment). Less than half of the biobanks (24%) had implemented the QMS system as well as the procedures and guidelines for biobanking processes, however, sufficient knowledge was presented. Recommendations indicate the lack of ability to quickly identify a critical device involved in the technological process (33.3%) and the lack of records for consumables and reagents used in the process (16.6%).In 2018\u20132020, 41 audits were performed. The current status and the level of QMS implementation in each biobank were assessed. Safety&Security and Scientific cooperation.Furthermore, the relationship between the level of QMS implementation and the biobank status in PBN (Member/Observer vs. Consortium member) was examined . The resTraceability and Biobanking processes and quality control, no evidence of dependence between the type of biobank membership and the fulfillment of the requirements was observed. Here, being a Member/Observer or a consortium member did not affect the fulfillment of the requirements.However, in the areas of p-value, the statement that extremely significance was estimated in all areas where the requirements comply with ISO 9001:2015 can be found. The strong importance of QMS implementation in all biobanks including Tissue Banks thus can be underlined. Only within the ELSI, no relevance was calculated. This might be due to the lack of any specific restrictions in the QMS. Moreover, the level of the fulfillment of the requirement is not determined by the implementation of different QMS, but it strongly depends on the method of obtaining biological material and related data. All statistically important results of the analysis indicate that the presence of the QMS system, compared to the absence of any system, has a great importance. Biobanks with Tissue Banks or any other quality management system, fulfill the requirements in high percentage level, which is as follows: Equipment-82%, Environmental and staff Hygiene 73%, Documentation and records, Management of biobanks, Supplies and materials management, ELSI, Traceability, Safety&Security, Scientific Cooperation, Quality Management, Biobanking processes and quality control, Human Resources Management, Audits, Deviations, Incompatible product/data or service, Improvement-respectively, 82% with the QMS system. It was also postulated that Biobanks with already implemented QMS systems are better prepared to meet the QSPB requirements. A set of SOPs already introduced in the parent organization helps Biobank to fulfill the QSPB documentation and create procedures which could be used as an integrated system. Also Biobank personnel is more aware when their work is already regulated by another quality system. Biobanks with an implemented quality system could also prepare biobank procedures based on the procedures existing in the other quality management system, which also facilitates compliance with the requirements.Further analysis focused on the relationship between the biobanks which are located together with Tissue Banks or biobanks with different QMS systems  implemented vs. biobanks which did not implement any quality system so far . In the p-value factor is not significant for biobanks with QMS systems other than GMP as compared to biobanks with no QMS system implemented. It could be concluded that the reason for this is the fact that Tissue and Cell Banks, like Biobanks, collect human biological material and the way they function is similar despite differences in the final use of the target product.The results show that there is a strong correlation between the implementation of the quality system, including the Tissue Banks requirement regarding GMP, and the lack of system implementation. Implementation of a quality system in the biobank's parent unit leads to better preparation of the entity to meet the requirements of the quality system in the specific areas of biobanking. During the audits, it was shown that biobanks which also functioned as Tissue and Cell Banks had a well-educated awareness of the need to develop and implement procedures describing the course of main and auxiliary processes. As a result, biobanks better understood the assumptions of the quality management system dedicated to biobanks and could more easily meet those assumptions. What is important in this context is the fact that a strong, well-developed quality system in Tissue and Cell Banks could be directly integrated with the arising quality system for biobanks. As a result, many procedures and forms could function simultaneously within two units. The most important aspect increasing the importance of the implementation of a properly prepared quality system in biobanks is the aspect of readiness for national and international cooperation within scientific projects, commercial use in the pharmaceutical industry and the development of personalized medicine, thanks to the awareness of the need for the implementation and maintaining of QMS system. Also, the implementation of the ISO 9001 or ISO 17025 system in the parent unit meant that the biobank staff was more aware of the processes taking place within the unit and the need to develop and use SOPs for well-maintained management of the biobank. It was also shown that the p-value (>0.05) in the field of Traceability and ELSI \u2014in the area of Biobanking processes and quality control, Safety&Security, Scientific Cooperation. The remaining comparison for the other twelve audited areas showed a high and extremely important statistical significance   . Almost Deviations/non-conforming product/data/service, Audits, Improvement. When identified during an internal audit, a non-conformity is removed and a new, better solution is implemented. Also, it is important to \u201cstay on the market\u201d and ensure sustainability. The decisions are more efficient and much faster, especially when the implementation leads to potential scientific cooperation between the biobank and an external unit. No significant p-value in meeting the requirements related to Biobanking processes and quality control, Safety&Security and Scientific cooperation results mainly from the fact that in both public and private units these areas are usually at a similar level of development and their improvement does not depend on the status of the unit.For the ELSI area, public biobanks met the requirements to a higher extent than the private ones. The differences concerning the level of compliance with the requirements and implementation of the QMS system in public and private biobanks mainly depend on financial resources and the management of the units. Private entities usually have more resources to hire an adequate number of staff, as well as to prepare and implement certain procedures. Therefore, in private biobanks, a correlation was observed between the following areas: Comparison with the first summary of 2019  showed aThe consciousness of relevance regarding the cooperation between the Data Protection Inspector in the organization, which can influence the improvement of the records which should be implemented on the IC in terms of processing personal data regarding GDPR.www.bbmri.pl \u201cCode of Conduct on the processing of personal data for the purposes of scientific research by biobanks in Poland,\u201d developed by BBMRI.pl ELSI and IT group is available, where useful information are enclosed for ELSI area improvement.It is worth to point out that on Quality control, Environmental monitoring and hazardous waste handling. During audits, a positive trend was observed that Biobanks present the highest activity in those three areas and developed other areas where biobanks are most active.Moreover, consortium members as model biobanks presented at least the level of 50% of the requirements implementation in most of the audited areas. In contrast, Ferdyn et al. indicated that the most developed areas were Furthermore, the results obtained in the group comparing the QMS level implementation in the biobanks from BBMRI.pl Consortium and biobanks from PBN indicate some significant differences between biobanks that belong to the BBMRI.pl consortium and other biobanks from the PBN. It is supposed that biobanks belonging to the BBMRI.pl consortium are characterized by a better prepared quality management system because they are located in the parent units that have implemented other quality systems, such as ISO 9001, ISO 17025 or GMP. Moreover, the consortium members are obliged to prepare other biobanks willing to enter the PBN as Members or Observers so that they meet the requirements of the quality management system to enable efficient management of biobanking processes in these units. It is possible to present the hypothesis that biobanks belonging to the BBMRI.pl consortium better meet the QSPB requirements and thus obtain better results during the audit for several important reasons: (1) they have a better developed infrastructure and more resources, (2) they have qualified personnel experienced in the development and implementation of quality systems (3) they have been selected for the consortium due to their high potential to create PBN and thus have an advantage at the start over biobanks outside the consortium.Audits performed in 2018\u20132020 brought a lot of relevant information about the status of biobanks. Different levels of QMS implementation have been identified in PBN. The process supervision is highly variable between individual biobanks. Here lies a high potential for improvement and it is a challenge for BBMRI.pl QMS team. Nevertheless, the awareness of the biobank personnel and readiness to improve the QMS and other processes, allows the conclusion that quality assurance is an aspect on which the biobanks want to focus their efforts, using the tools developed as a part of the BBMRI.pl project.The main goal was to indicate the direction of further harmonized and unified QMS development and improvement, as well as to determine the starting points for QMS development.All actions prepared within the BBMRI.pl QM Task are carefully designed and planned for a dedicated biobanking unit to unify and implement common solutions in PBN, which are convergent with BBMRI-ERIC general outline. The activities performed were aimed at spreading the idea of biobanking with the assumption that high quality biobank services associated with PBN BBMRI.pl are guaranteed. They are to encourage M/O of PBN to develop biobanking ideas and self-improvement, which will directly result in increased competitiveness, maintaining high position in the industry, reduced unit costs and, above all, improved quality of BM and associated data. It will also enhance the growth of the number and quality of scientific research and R&D carried out in cooperation with foreign scientific centers or enterprises.The results of the work allow not only for current improvement but also indicate the direction of further activities of BBMRI.pl QM group, including the process of the cross-audit program in Poland. Thanks to the identification of the areas that require special attention, the training offer will be adapted in order to intensify work in these areas. Moreover, it helps to develop the audit's plans in order to increase their effectiveness, through more precise planning of the auditors' working time.Today, biobanking units are no longer required to give access to BM only, but also to access high-quality material on which repeatable test results can be carried out. Therefore, the role and tasks of the Quality Management processes in biobanking units are subject to continuous development. Biobanks are responsible for building a quality model and creating a competitive, intuitive system that meets the requirements of a wide spectrum of stakeholders.Our work clearly shows the improvement of the processes and of the quality system itself in biobanks. This is a positive factor for the further development of translational medicine, taking into account the special role of biobanks. Thanks to this, the activities of the biobanks associated in networks as well as the activities of organizations such as BBMRI.pl directly contribute to the improvement of the quality of preclinical research. This is beneficial both for research funding institutions, the healthcare system and, above all, for patients.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.AM-W, JG-O, and PS: conceptualization. AM-W, PS, ML, MK, KZ, and JG-O: methodology, validation, investigation, and writing\u2014original draft preparation. MK and AM-W: software. AM-W, PS, MK, and KZ: formal analysis. AM-W, PS, ML, KZ, and JG-O: resources and data curation. AM-W, PS, ML, and JG-O: writing\u2014review and editing. AM-W, PS, and MK: visualization. AM-W: supervision, project administration, and funding acquisition. All authors have read and agreed to the published version of the manuscript.The project was financed and supported by the Polish Ministry of Science and Higher Education (DIR/WK/2017/2018/01-1). Organization of Polish Biobanking Network within the Biobanking and Biomolecular Resources Research Infrastructure BBMRI-ERIC.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Mice lacking Kv1.1 subunits (Kcna1\u2212/\u2212) display recurrent spontaneous seizures and often exhibit sudden unexpected death. Seizures in Kcna1\u2212/\u2212 mice resemble those in well-characterized models of temporal lobe epilepsy known to involve limbic brain regions and spontaneous seizures result in enhanced cFos expression and neuronal death in the amygdala. Yet, the functional alterations leading to amygdala hyperexcitability have not been identified. In this study, we used Kcna1\u2212/\u2212 mice to examine the contributions of Kv1.1 subunits to excitability in neuronal subtypes from basolateral (BLA) and central lateral (CeL) amygdala known to exhibit distinct firing patterns. We also analyzed synaptic transmission properties in an amygdala local circuit predicted to be involved in epilepsy-related comorbidities. Our data implicate Kv1.1 subunits in controlling spontaneous excitatory synaptic activity in BLA pyramidal neurons. In the CeL, Kv1.1 loss enhances intrinsic excitability and impairs inhibitory synaptic transmission, notably resulting in dysfunction of feed-forward inhibition, a critical mechanism for controlling spike timing. Overall, we find inhibitory control of CeL interneurons is reduced in Kcna1\u2212/\u2212 mice suggesting that basal inhibitory network functioning is less able to prevent recurrent hyperexcitation related to seizures.K A growing body of evidence has identified and strongly implicated defects in several ion channel genes in the pathogenesis of epilepsy2. Voltage-gated K+ channel subunits Kv1.1, encoded by the KCNA1 gene, are broadly expressed in the mammalian brain, predominantly in the cortex, hippocampus, cerebellum and brainstem where they play important roles in dampening neuronal excitability3. Kv1.1-containing channels mediate a number of functional roles associated with distinct underlying mechanisms and linked to their localization to discrete subcellular domains. Kv1.1 subunits expressed in the soma affect the action potential waveform and firing patterns4; those located to the axonal compartment control the initiation and conduction of action potentials7, and at synaptic terminals they regulate neurotransmitter release9.Epilepsy is a complex chronic neurological disease characterized by spontaneous and recurrent seizures resulting from abnormal electrical activity in the brainKCNA1 gene are primarily associated with episodic ataxia type 1 (EA1), an autosomal dominant neurological disorder characterized by ataxia and muscle rippling10. Notably, a subset of patients with EA1 also exhibit seizures, further implicating mutations in the KCNA1 gene in epilepsy12. In support of an epileptogenic role for Kcna1 mutations, a Kcna1 knock out mouse model (Kcna1\u2212/\u2212) exhibits phenotypes similar to patients with severe epilepsy as characterized by recurrent spontaneous seizures including myoclonic and generalized tonic\u2013clonic seizures beginning at 3\u20134\u00a0weeks postnatally14. Kcna1\u2212/\u2212 mice also exhibit cardiorespiratory dysfunction and an increased risk of sudden unexpected death18. As such, Kcna1\u2212/\u2212 mice have been employed as a useful model for studying the cellular mechanisms underlying epileptic phenotypes.Loss-of-function missense mutations in the Kcna1\u2212/\u2212 mice resemble well-characterized kainate-and kindling-induced seizure models of temporal lobe epilepsy (TLE), suggesting Kcna1 channel involvement in limbic brain circuits towards the generation and propagation of seizures20. EEG recordings of ictal and interictal activity from Kcna1\u2212/\u2212 mice showed that some seizure-like events recorded in the hippocampus precede the ictal episodes in the neocortex, and support the notion that epileptic seizures in this model originate in limbic structures19. Our current understanding of the mechanisms underlying epileptogenic and seizure activity in Kcna1\u2212/\u2212\u00a0mice is largely based on morphological and electrophysiological studies of hippocampal alterations22. Histological analysis of Kcna1\u2212/\u2212\u00a0mice experiencing seizures have provided evidence of hippocampal sclerosis, characterized by a selective neuronal cell loss in the CA1/CA3 region, degeneration of hilar interneurons, and sprouting of mossy fibers19. In vitro hippocampal slice recordings from Kcna1\u2212/\u2212 mice showing pathological high-frequency oscillations suggesting that network abnormalities contribute to seizure generation22. Given the role of the hippocampus in cognitive function e.g., learning and memory, deficits in hippocampal function are proposed to contribute to cognitive impairments associated with epilepsy23.Phenotypically, 25. Moreover, animal models of TLE show extensive neuropathology signs in the amygdala circuitry resembling those in human TLE24, including extensive loss of GABAergic neurons26. Additional evidence for a central role of the amygdala in the generation and propagation of seizure activity comes from kindling models of epilepsy in which the amygdala exhibits extreme susceptibility to electrically induced seizures27. Of the various amygdalar nuclei, the basolateral amygdala (BLA) both exhibits Kv1.1 immunoreactivity 28 and has the highest propensity to generate seizures29. At the molecular and cellular levels, Kcna1\u2212/\u2212\u00a0mice experiencing status epilepticus display extensive neuronal cell loss and gliosis in the BLA region19 and spontaneous seizures resulting in significantly enhanced cFos expression in BLA neurons20. Kcna1\u2212/\u2212\u00a0mice also possess an enlarged amygdala correlated with seizure activity31. Overall however, disturbances in non-hippocampal temporal lobe network regions, and their functional contributions to epileptogenesis and behavioral impairments associated with seizures in Kcna1\u2212/\u2212\u00a0mice have remained relatively unexplored.Studies have shown that the amygdala is a critical component for the onset and propagation of temporal lobe seizures33. Within the central amygdala, the central lateral subdivision (CeL) has received increasing interest due to its widespread function towards mediating fear responses34, anxiety36 and nociception38. Dysfunction of the amygdala has been linked to epilepsy-related mood disorders, contributing to the high comorbid occurrence of anxiety and depression in patients with epilepsy39. Moreover, it has been suggested that the amygdala is also involved in respiratory abnormalities associated with epilepsy40. Notably, Kcna1\u2212/\u2212\u00a0mice demonstrate respiratory failures including central apnea during seizures that can result in the phenomenon known as sudden unexpected death in epilepsy (SUDEP)18. A recent hypothesis proposes that spreading depolarization and subsequent brainstem dysfunction triggers respiratory failure in Kcna1\u2212/\u2212 mice16. Further, studies from both SUDEP patients43 and mice44 suggest that the amygdala, specifically the central amygdala, has a significant effect on seizure-induced apneas.The central amygdala provides the main output of the amygdala complex, projecting to the hypothalamus and brainstem regions involved in the expression of emotional and autonomic responsesKcna1\u2212/\u2212\u00a0mice exhibit alterations in intrinsic excitability and synaptic activity. Since the BLA appears to be a key site for seizure initiation in TLE, we first examined the functional characteristics of BLA pyramidal neurons and found that the lack of Kv1.1 subunits alters spontaneous synaptic activity in BLA pyramidal neurons with no changes in firing responses evoked by somatic stimulation. We also provide evidence for the loss of Kv1.1 subunits towards enhancing intrinsic excitability and impairing feed-forward inhibition into CeL GABAergic neurons. Together, we predict that these changes in synaptic and circuit properties contribute to neuronal hyperexcitability in Kcna1\u2212/\u2212\u00a0mice and to promote seizure activity.Here, we examined whether electrophysiologically distinct neuronal cell types from the CeL and BLA nuclei of Kcna1\u2212/\u2212 mice20, however experimental evidence showing functional alterations associated to BLA in this animal model remain lacking. Employing whole-cell current clamp recordings of BLA pyramidal neurons from Kcna1/++ and Kcna1\u2212/\u2212 mice, we initially examined whether the loss of Kv1.1 subunits in BLA pyramidal neurons affects their intrinsic excitability and synaptic activity  plots  compared with Kcna1/++ , and 8.03\u2009\u00b1\u20090.7\u00a0Hz and 58.1\u2009\u00b1\u20094.9 pA for Kcna1\u2212/\u2212 mice (n\u2009=\u20095 cells from 4 mice), respectively. To assess the net effect of altered spontaneous postsynaptic current (sPSC) activity onto Kcna1\u2212/\u2212 BLA pyramidal neurons, we calculated the sEPSCs/sIPSCs ratios of each measure (frequency and amplitude) for each cell and compared the ratio of the mean values between Kcna1\u2212/\u2212 and Kcna1/++ mice. The mean ratio of frequency of sEPSCs to sIPSCs in Kcna1\u2212/\u2212  was significantly increased compared with Kcna1/++ mice , indicating that the balance between excitation and inhibition in Kcna1\u2212/\u2212 mice is shifted toward excitation. The mean ratio of sEPSCs to sIPSCs amplitude was no different between Kcna1/++ and Kcna1\u2212/\u2212 mice . Overall, there is an increase in excitatory events in BLA pyramidal neurons that may contribute to the seizure induced pathological changes in BLA of Kcna1\u2212/\u2212 mice. Of note, a previous report shows that presynaptic alterations of glutamate transmission in BLA neurons is associated with both increased anxiety and seizure generation50.We examined spontaneous excitatory (sEPSCs) and inhibitory (sIPSCs) postsynaptic currents in BLA pyramidal neurons in ice Fig.\u00a0. Figure\u00a051 . Within the amygdala complex, the CeL consists almost exclusively of GABAergic interneurons that shape amygdala output and function as a relay station between the amygdala complex and other downstream targets54. Kv1.1-containing channels play crucial roles in regulating near-threshold properties and repetitive firing of fast-spiking neocortical55 and deep cerebellar nuclear GABAergic neurons56 thus here we studied their contributions towards regulating excitability of CeL GABAergic interneurons.Loss of GABAergic interneurons and alterations in inhibitory activity has been demonstrated in the amygdala of epileptic animal models, suggesting that GABAergic neurons may play key roles in the generation and spread of seizuresKcna1/++ and Kcna1\u2212/\u2212 mice. In response to depolarizing current injections, CeL neurons were shown to display two major firing patterns: late spiking (LS) and early spiking (ES), typical of that previously reported58. In control Kcna1/++ mice, LS neurons exhibited a substantial delay before the onset of the first AP  compared to Kcna1/++ mice.  and Kcna1\u2212/\u2212 ; after a brief spike delay, LS cells fire at high frequencies with relatively little or no spike frequency adaptation. In both Kcna1/++ and Kcna1\u2212/\u2212 neurons, the number of action potentials increased monotonically with stimulus strength; however, the LS neurons from Kcna1\u2212/\u2212 mice fired an increased number of APs during 1.2\u00a0s of current injections  to generating feedforward inhibition to CeL neurons63. ITCs comprise distinct clusters of GABAergic neurons located along the lateral and medial borders of basolateral complex. Medial ITC neurons (mITCs) gate signaling from the LA into the CeL and have been shown to play a crucial role in fear extinction64. mITCs are thought to exert fine-tuning inhibitory control of CeL output pathways and here we investigated whether loss of Kv1.1 subunits alters synaptic responses in CeL neurons elicited by the activation of direct projections from mITCs. We recorded evoked inhibitory post synaptic currents (eIPSCs) from CeL neurons at 0\u00a0mV in the presence of D-AP5 (50\u00a0\u00b5M), CNQX (20\u00a0\u00b5M) and CGP52432 (1\u00a0\u00b5M). Figure\u00a0Kcna1/++ (black traces) and Kcna1\u2212/\u2212 mice (red traces). Compared to Kcna1/++, the mean amplitude of eIPSCs was significantly reduced in Kcna1\u2212/\u2212 mice Kcna1/++ (black traces) and Kcna1\u2212/\u2212 mice (red traces). In response to the paired-pulse stimuli, facilitation of synaptic events was observed in both Kcna1/++ and Kcna1\u2212/\u2212 mice. Notably, the PPR obtained by two successive GABAergic eIPSCs was increased in Kcna1\u2212/\u2212 compared with Kcna1/++ mice  as an index of short-term facilitation, a known form of plasticity at mITC-CeL synapses. Figure\u00a0ice Fig.\u00a0e. Change63. To test whether loss of Kv1.1 subunits results in altered disynaptic FFI of CeL neurons, we applied electrical stimulation in the lateral amygdala while recording synaptic responses in CeL neurons from Kcna1/++ and Kcna1\u2212/\u2212 mice  also completely blocked the inhibitory component  compared with Kcna1/++ mice , and \u2212 25.8\u2009\u00b1\u20093.6 pA for Kcna1\u2212/\u2212 mice (n\u2009=\u20098 cells from 5 mice), respectively. It is known that feedforward inhibitory circuits permit a narrow window between excitatory and inhibitory inputs so that disynaptic inhibition occurs after a short delay from the onset of monosynaptic eEPSCs; this synaptic delay restricts the time window for temporal summation of excitatory inputs67. Given the importance of FFI inhibition in regulating the timing of neuronal responses, we measured the timing of each component of FFI in CeL neurons in response to stimulation of LA by voltage clamping the membrane at their respective reversal potentials  and Kcna1\u2212/\u2212 (red trace) mice the eIPSC component occurred with a delay following the onset of eEPSC component. However, the mean delay between the eEPSC and eIPSC was found to be significantly longer in Kcna1\u2212/\u2212 mice  compared with Kcna1/++ mice  onto neurons of the CeL, playing an important role in sculping amygdala network dynamicsice Fig.\u00a0a. At a hice Fig.\u00a0b that isv1.1-containing potassium channels in regulating network excitability of the amygdala circuitry. Using Kcna1 null mice (Kcna1\u2212/\u2212), a well-known mouse model of temporal lobe epilepsy, here we show that deletion of Kv1.1 subunits alters intrinsic excitability and synaptic activity in neurons from two amygdalar subdivisions known to be involved in epilepsy and epilepsy-related comorbidities.To our knowledge, the current study is the first to provide evidence of key roles of KKcna1\u2212/\u2212 mice  is under strong local inhibitory control and it has been reported that the CeL mediates autonomic and behavioral responses associated with comorbidities of epilepsy such as depression, anxiety and pain via projections to the brain stem72. As such, alterations in the intrinsic excitability of CeL neurons can affect the functional output of the amygdala circuitry. A previous report on CeL neurons showed that \u03b1-dendrotoxin (DTX)\u2014sensitive Kv1-containing channels of the Kv1 family (Kv1.1\u20131.6) regulate spike latency of LS cells58, although effects of Kv1.1-containing channels on CeL interneurons was not explicitly tested. In the present study, we demonstrate that the lack of Kv1.1 subunits has a major influence on the excitability of LS cells of the CeL by reducing the characteristic delay to first AP 77, would result in disinhibition of CeM output. Overall, it is likely that the enhanced excitability and AP firing of CeL LS interneurons contribute to the hyperexcitability and seizure occurrence in Kcna1\u2212/\u2212 mice.Loss of K AP Fig.\u00a0b, decrea AP Fig.\u00a0c, and in AP Fig.\u00a0e. These 79. CeL interneurons, receive inputs from amygdalar and extra amygdalar sites and send GABAergic outputs to various downstream targets including the hypothalamus and brainstem. Within the amygdala complex, the CeL receives excitatory inputs from the lateral amygdala and feedforward inhibitory inputs from the GABAergic medial intercalated cells (mITCs) and send outputs to the CeM and brainstem regions such as parabrachial nucleus and nucleus tractus solitarius. Having shown that Kv1.1-containing channels play a critical role in regulating the intrinsic excitability of CeL neurons, we also explored the potential impact of Kv1.1 subunits on synaptic plasticity of CeL neurons. We first studied the effect of Kv1.1 loss on the direct source of inhibitory input onto CeL neurons  of eIPSCs, a parameter affected by changes in release probability from presynaptic terminals65. We found that the PPR at mITC-CeL synapses was significantly increased in Kcna1\u2212/\u2212 mice compared to Kcna1/++ mice, suggesting that the release probability from the GABAergic terminals is decreased in the mITC-CeL pathway in Kcna1\u2212/\u2212 mice  is an important mechanism previously characterized in hippocampalion Fig.\u00a0c. It is ion Fig.\u00a0d, indica67. Our study suggests that Kv1.1-containing channels contribute to the regulation of the spike integration window in CeL interneurons. The spike integration window in Kcna1\u2212/\u2212 mice was wider (long delay between the eEPSC and eIPSC component) compared to Kcna1/++ mice  and null (Kcna1\u2212/\u2212) mice. For this study a total of 29 male and 30 female mice (P22-P28) were used. Breeding pairs of heterozygous (Kcna1\u2212/+) mice were on a C3HeB/FeJ congenic background and colonies were maintained in the Animal Resources Unit at the University of British Columbia. Mice were given food and water ad libitum and kept on a 12-h light/dark cycle. All the experimental protocols were approved by the University of British Columbia Animal Care Committee (UBC ACC Protocol A19-0233) and were in accordance with the Canadian Council on Animal Care (CCAC) guidelines. The present study complies with the pertinent aspects of ARRIVE guidelines.Experiments were performed on littermate wild-type (2-5% CO2) sucrose cutting solution containing the following (in mM): 214 Sucrose, 26 NaHCO3, 1.25 NaH2PO4, 11 glucose, 2.5 KCl, 0.5 CaCl2, and 6 MgCl2 (pH 7.4). 300\u00a0\u00b5m-thick coronal slices of amygdala complex containing basolateral and central amygdala were collected using a vibratome . Slices were incubated in artificial cerebral spinal fluid (ACSF) containing (in mM):126 NaCl, 26 NaHCO3, 2.5 KCl, 1.5 NaH2PO4, 2 MgCl2, 2 CaCl2,10 glucose (pH 7.4) with 95% O2-5% CO2 at 37\u00a0\u00b0C for 45\u00a0min prior to recording.Under isoflurane anesthesia [5% (vol/vol) in oxygen], mice were decapitated, and brains removed and transferred immediately to an ice-cold oxygenated  in combination with a X40 water immersion objective. Whole-cell patch-clamp recordings were performed to record intrinsic excitability and synaptic properties. All recordings were collected using a Multiclamp 700B amplifier and signals were digitized and acquired using Digidata 1550 and pClamp 10 and/or 11 software (Molecular devices). The recording\u00a0chamber was grounded with an Ag/AgCl pellet. Patch pipettes (4\u20136 M\u03a9) were pulled from borosilicate glass using a P-1000 micropipette puller (Sutter Instruments).2, 1 CaCl2, 11 KCl, 11 EGTA, 4 MgATP, 0.5 NaGTP, with pH adjusted to 7.2 using KOH and osmolarity adjusted to 290\u00a0mOsm/kgH2O using D-mannitol. The liquid junction potential was\u2009+\u200913.3\u00a0mV and the data was reported without subtraction. Bridge balance values were monitored during recordings and cell displaying bridge balance values\u2009>\u200930 M\u03a9 were excluded from the analysis. Action potentials were evoked with 1.2 -s long square-pulse current injections from -100 to 200 pA with increments of 10 pA. Data under current clamp conditions were sampled at 50\u00a0kHz and low-pass filtered at 10\u00a0kHz.Intrinsic excitability was recorded in current clamp mode using an internal recording solution containing the following (in mM): 120\u00a0K-gluconate, 10 HEPES, 1 MgCl2O with D-mannitol. To isolate spontaneous excitatory post synaptic currents (sEPSCs), the GABAA receptor antagonist picrotoxin  was added to the ACSF. To isolate spontaneous inhibitory postsynaptic currents (sIPSCs), the NMDA receptor antagonist D-2-amino-5-phosphonovalerate , and AMPA receptor antagonist cyanquixaline 6-cyano-7-nitroquinoxaline-2,3-dione  were added to the ACSF. To evaluate sIPSCs, cells were held at a membrane potential of 0\u00a0mV, and for sEPSCs cells were held at a membrane potential of \u2212 70\u00a0mV during a 60-s gap-free recording. Data acquisition was sampled at 20\u00a0kHz and low-pass filtered at 2\u00a0kHz. Recordings with a series resistance\u2009>\u200925 M\u2126 were excluded from analysis.Synaptic activity such as spontaneous and evoked postsynaptic currents were recorded in voltage clamp mode using a cesium based internal solution containing the following (in mM): 140 Cs-methanesulfonate, 5 CsCl, 5 tetraethylammonium-Cl, 1 EGTA, 10 HEPES, 4\u00a0MgATP, 0.5 NaGTP, the pH was adjusted to 7.2 with CsOH, and osmolality was adjusted to 290\u00a0mOsm/kgHTo evoke synaptic responses electric pulses were generated with an S48 stimulator via a stimulus isolation unit  and applied with a concentric bipolar electrode . Evoked inhibitory postsynaptic currents (eIPSCs) were elicited in CeL amygdala GABAergic interneurons when the stimulating electrode was placed on the medial intercalated cells (mITC). As shown in Fig.\u00a0B blocker CGP52432 (1\u00a0\u00b5M) in ACSF recording solution. For feed-forward experiments, the stimulating electrode was placed in the lateral amygdala (LA) and evoked synaptic responses were recorded in CeL neurons at a holding potential of \u2212 20\u00a0mV. For morphologic identification of BLA and CeL neurons, recorded neurons were labeled with biocytin  by applying hyperpolarizing current for 20\u00a0min in current-clamp mode. Subsequently, the recording pipette was withdrawn slowly and the slice was immediately fixed into 4% paraformaldehyde (PFA) solution at 4\u00a0\u00b0C. Biocytin-filled neurons were visualized by incubating the slices in avidin-biotinylated-horseradish peroxidase (ABC). Images of biocytin-filled neurons were obtained using an Olympus BX-53 Widefield Microscope with a 40\u00d7/NA 0.8 semi-apochromat objective in order to visualize cell morphology and confirm localization , D-AP5 (50\u00a0\u00b5M) and GABAf\u2013I relation). Rheobase was measured as the minimum intensity of 1\u00a0s current pulse required for initiation of AP. The spike delay was measured from the start of the current injection to the start of the rising phase of first AP evoked by the rheobase. Detection and analysis of the spontaneous synaptic postsynaptic currents was performed by creating a template in Clampfit 11. For calculation of sEPSCs to sIPSCs ratio, mean values of each measure (frequency and amplitude) for each cell were calculated and expressed as a ratio. The ratios were then pooled within groups and compared the ratio of the mean values. The paired-pulse ratio (PPR) was measured by delivering two pulses with an increasing interstimulus interval, and the PPR was calculated from the amplitude of the synaptic response to the second pulse divided by the first pulse. To measure the timing of feed-forward inhibition (synaptic delay between the eEPSCs and eIPSCs), the eEPSCs and eIPSCs were separated by voltage clamping at their respective reversal potentials . We used respective 10% rise time points to determine the eEPSC-eIPSC delay. All data are expressed as mean\u2009\u00b1\u2009SEM. Statistical comparison was performed with one-way ANOVA using Tukey post hoc test. Differences with P-value\u2009<\u20090.05 were considered statistically significant. The n value represents the number of cells tested. In most experiments, only one neuron was recorded from an individual animal; the sample size indicates the number of animals used for recordings. Synaptic and action potential parameters from age-matched male and female mice were pooled together for statistical comparison.Electrophysiological recordings were analyzed using Clampfit 11 (Molecular devices); data plotting, figures generation and statistical analysis were performed using Origin 8.6 (Origin Lab). The steady state frequency of action potentials was obtained from the last 500\u00a0ms period of the depolarizing current pulses and plotted as a function of normalized current injection (2O) and stored at \u2212 20\u00a0\u00b0C; working aliquots were thawed and added to ACSF. Drugs were applied by bath perfusion at a flow rate of 1\u00a0ml/min.D-AP5, CNQX and CGP52432 were purchased from Tocris Bioscience. Picrotoxin (PTX) was purchased from Sigma Aldrich. All drugs were prepared as stock solutions (CNQX was dissolved in DMSO and the other drugs in nanopure H"}
+{"text": "A broad array of molecular and cellular events is associated with developing resistance to treatment, such as deregulation of the cell cycle, inhibition of DNA damage repair mechanisms, and metabolic alterations. Most cancer therapy-induced responses, including resistance, involve the dysfunction of mitochondria. Mitochondria have acquired numerous functions throughout evolution, controlling energy production, cellular metabolism, cell survival, apoptosis and autophagy within host cells. Tumor cells can develop defects in mitochondrial function, presenting a potential strategy for designing selective anticancer therapies. However, non-specific targeting of mitochondrial functions may have significant unwarranted effects on normal cell growth and survival. Therefore, treatments conjugated with other anticancer therapy are needed to precisely target specific mitochondrial proteins involved in tumor progression and the acquisition of treatment resistance.In the present Research Topic, we have garnered several contributors to provide evidence\u2010informed insights into the mechanistic and pathogenic role of mitochondrial proteins to support the discovery of novel therapeutic targets for directed mitochondrial treatment and eventually facilitating enablers of knowledge translation. After a rigorous peer-review process, seven articles have been collected, consisting of two comprehensive review and five original research articles. Notably, these articles were contributed by renowned academic institutes from North America, Europe and Asia engaged in mitochondria-based biology and translational research, demonstrating the great interest in this hot area.Ippolito et\u00a0al. outlined several crucial functions of mitochondrial redox activity in different cancer stages by elaborating effects of mitochondrial ROS (mROS) on tumor initiation, progression, energy metabolism, stemness achievement, metastases and tumor immune environment. They also explored the impact of mROS on treatment response in cancer, such as tumor chemosensitivity. Because mitochondrial redox homeostasis crucially regulates cancer cell behavior and several cancer hallmarks, the authors also attempted to outline the potential redox-based targeted therapeutic strategies, either single or combined modality. It is worth mentioning that two new mROS-targeted treatments, photothermal and photodynamic therapy, have rendered their effectiveness in curing and preventing cancer. Criscuolo et\u00a0al. reviewed the available literature on the coordinated regulation of mitochondrial and cytosolic mRNA translation, as well as their effects on the integrity of the mitochondrial proteome and functions. The purpose of this review paper is to highlight the importance of mitochondrial protein quality control systems in coordinating mitochondrial and cytosolic protein translation. More than that, this critical review also hints that mitochondrial protein homeostasis dysfunctions are tightly associated with cancer development, and thus the most relevant therapeutics hold great promises as anticancer strategies.Cancer cells exhibit metabolic plasticity that endows them with a selective advantage to face harsh microenvironmental alterations and orchestrate nutrient sensing and upload, signaling, and redox circuits. The finely tuned reactive oxygen species (ROS) generation and scavenging within a certain sub-toxic tumorigenic range are two aspects fundamental to cancer cells as ROS mediate cell signaling to significantly impact a wide range of pathways involved in cancer development and progression. That is the reason why ROS have recently become an attractive target for anticancer therapies. Panina et\u00a0al.). Among these drug pairs, IACS-010759/vinorelbine impaired ATP level and disrupted mitochondrial respiration and coupling efficiency most profoundly, which also retained high synergy and strong selectivity in primary AML cells. This study supports the potential of mitochondria-based drug cocktails for future therapeutic development and optimization and reinforces the value of this approach.Mitochondrial dependency of leukemia cells and their altered oxidative metabolism have already been explored as a common abnormality existing in acute myeloid leukemia (AML). Accumulating evidence suggests that AML may be particularly sensitive to chemotherapeutics that target mitochondria. To further investigate this sensitivity, a research group at Rice University screened 36 drug combinations randomly paired one of six mitochondria-targeting compounds  with one of six compounds with other activities  in two AML cell lines . Mechanistically, downregulation of MIEF2 impaired mitochondrial stability and suppressed cytochrome C-dependent apoptosis, and eventually enhanced colorectal cancer cell resistance to OXL. These novel findings suggest that MIEF2 represents a predictive biomarker of OXL responsiveness and targeting it could improve chemotherapeutic effectiveness in colorectal cancer. In the same type of cancer, TRIAP1, a chaperone interacting with the Ups/PRELI family proteins, participates in the intramitochondrial transfer of lipids to synthesize cardiolipin and phosphatidylethanolamine. Nedara et\u00a0al. reported that depletion of TRIAP1 induced extramitochondrial perturbations, leading to remarkable changes in the endoplasmic reticulum-dependent lipid homeostasis and induction of a p53-mediated stress response. This depletion also conferred strong p53-dependent resistance to the metabolic stress mediated by glutamine deprivation. Another original research collected in this Research Topic shows that mitochondrial morphology and dynamics are altered during ovarian cancer progression and upon aggregation . In this study, the researchers utilized the mouse ovarian surface epithelial (MOSE) model for serous ovarian cancer and analyzed the morphological and functional changes that occur during the progression from benign (MOSE-E), to slow (MOSE-L) and fast-developing disease (MOSE-LTICv), and in response to aggregation and hypoxia. The resulting findings gain new insight into how the alterations in mitochondrial morphology contribute to the survival of aggregates in the non-permissive environment of the peritoneal cavity during metastasis.Interestingly, by performing genome-wide CRISPR/Cas9 library knockdown screening, a Chinese research team identified that mitochondrial elongation factor 2 (MIEF2) was among the top candidate genes in oxaliplatin (OXL) resistant cell lines  and constructed a classifier containing 10 mitochondrial-related genes (Mito-RGs) for predicting the prognosis of HCC. The results from bioinformatics reveal cross-talk between metabolic processes governing bile acid and the infiltration of tumors by immune cells, providing an innovative strategy for HCC metabolic therapy based on the modulation of mitochondrial function.Mitochondria are the powerhouse of the cell, while the liver is the center of human metabolism at the whole organism. Thus, identifying mitochondria localized proteins as prognostic biomarkers for hepatocellular carcinoma (HCC) will be interesting. Although mitochondrial oncology has been known for much longer than 20 years, the field has experienced a resurgence of interest in the past decade. We understand that a large proportion of this journal\u2019s readers are basic and clinical cancer researchers and as such wanted to give them a bigger voice in the journal\u2019s content. Beyond cancer, mitochondrial defects are often the underlying cause of other diseases. The articles within our collection add new value to the development of mechanism-informed therapeutic strategies that place the organelle as a promising target.The author confirms being the sole contributor of this work and has approved it for publication."}
+{"text": "Communications Biology 10.1038/s42003-022-03797-9, published online 19 August 2022Correction to: In this Article, the first names of the authors were accidentally provided only as initials. The full names have now been added."}
+{"text": "We develop a protocol for assessing the impact of an intervention aimed at improving sleep quality among university nursing students. The study is designed as a pilot randomized controlled trial to be applied during the 2022-23 academic year and is registered at Clinical Trials Gov website (NCT05273086). A total of 60 nursing students will be recruited from a Spanish university. They will be divided into two groups: (30) intervention group and (30) control group. The intervention group will attend two cognitive\u2013behavioural therapy sleep programme sessions focused on knowledge of anatomical structures involved in sleep, chronotype, synchronization, and good sleeping habits. Subjective and objective sleep quality will be assessed before and after the intervention for both groups. In addition to sleep quality, socio-demographic parameters, physical activity, lifestyle habits, and anthropometric measures will be considered prior to intervention. Finally, a satisfaction questionnaire will be applied for posterior analysis. This study is an innovative, relevant intervention that aims to improve sleep quality among university nursing students. Both the approach and the use of objective and subjective validated outcome measurements are key features of this study. Sleep has been defined as an essential brain state for maintaining energy and restoring bodily function . Sleep qGood sleep quality is a predictor of physical and mental health, well-being, and overall vitality . HoweverUniversity students are one of the population groups that suffer most sleep-related problems. Both lack of sleep and sleep disorders are the main characteristics involved in low sleep quality among university students . Over tiNursing students face complex situations that can specifically affect their sleep quality . DiffereSeveral studies have implemented intervention programmes to improve sleep quality among the adult population without resorting to the use of drugs . HoweverMany interventions in both the general population and university and adolescent populations focus on treating insomnia and mental health problems such as anxiety and depression. These works have a practical approach to sleep quality, but they do not take into account fundamental elements such as circadian rhythms, motor activity, skin temperature, sleep phases and position in 24 hours, which are key to understanding sleep quality and being able to improve it ,23,24.Interventions to improve sleep quality generally have several fundamental cornerstones. First, students are unaware of how sleep deprivation or disturbance affects cognitive functioning . This juSeveral studies indicate that cognitive-behavioural therapy yields positive results in this type of intervention  as it inPittsburgh Sleep Quality Index, PSQI [Assessing interventions to improve sleep quality is another issue that needs to be addressed. The complex nature of the construct requires the use of objective  and subjective  aspects in its assessment. Polysomnography and actigraphy are two different methods used to measure sleep quality . For a sex, PSQI  is typicex, PSQI , but itsex, PSQI . Studiesex, PSQI  because ex, PSQI . There aex, PSQI , and morex, PSQI . In factex, PSQI ,21. ThisLastly, despite numerous studies analysing the factors associated with poor sleep quality in nursing students ,31, no iThe aim of this study is to develop a protocol for assessing the impact of an intervention aimed at improving sleep quality among nursing university students.The study protocol is based on a randomized controlled trial. Participants will be randomly assigned to a control and an intervention group. Only participants in the latter group will receive the intervention based on two cognitive\u2013behavioural therapy sleep programme sessions.We pose the conceptual hypothesis that participants in the intervention group will improve their sleep quality, measured by objective monitoring parameters, and their subjective perception. ClinicalTrials.gov (accessed on 15 September 2022) with reference number NCT05273086. The study will be conducted at a Spanish university as a two-arm pilot randomized clinical trial (intervention and control). It will be single-centre and single-blind , comparing two conditions: the intervention group (IG), with a specific intervention on sleep quality, and the control group (CG), with no intervention. The study will be conducted at a university in Madrid (Spain). The intervention environment will be exclusively affecting undergraduate students during the first term of the 2022-23 academic year (October 2022\u2013February 2023).Students aged 18 to 25 years.Students enrolled in their first full year of a nursing degree, 2022-23.Prior mental pathology and/or sleep disorder diagnosis with or without medication .Participants that use any drugs to sleep.Combining work and studying.For a population size of 70, at least 60 samples are required to have a confidence level of 95% so that the real value is within \u00b15% of the measured/surveyed value. For two-group comparisons, at least 60 samples are required for an expected medium effect .An independent researcher who is unaware of the study characteristics will conduct the random assignment procedure. A computer-generated random number sequence , assigned to participants\u2019 academic record number will be used to randomly designate participants to one of the two groups (IG or CG). Random permuted blocks will also be used to reduce the random sequence predictability and guarantee a 1:1 ratio. This sequence will be password-protected in a table and will be hidden from other researchers during the study.The study design does not allow the treatment assignment to be blind for the sleep experts facilitating the intervention and the participants. However, analysts will be blinded to the group-assigned treatment. To prevent interobserver variability bias, measurements will be taken by the same researcher in all cases.The intervention group will receive the programme sessions based on knowledge and cognitive\u2013behavioural therapy to improve sleep quality, and the control group participants will continue with their normal routine. This programme will be developed with an active-constructive learning methodology in which students interact with the material so that their commitment to learning generates deeper knowledge . For thiThe intervention will consist of face-to-face 90-min group sessions executed twice a week during November and December 2022. Each session will be divided into four parts focused on different aspects related to sleep quality. The first session will focus on knowledge of anatomical structures involved in sleep and their effect at a cognitive level. Students may also self-assess their sleep pattern so that strategies can be adapted to improve this pattern at the next session. The second session will focus on developing skills for better sleep hygiene, working on the students\u2019 individual sleep routines and the results of their questionnaires and self-reports so that the elements of sleep hygiene can be adapted to each case. The experts implementing the intervention will be a PhD candidate in biology specialized in the brain function of sleep, chronobiology, and circadian rhythms, and a registered nurse expert in health promotion and in healthy lifestyles education, who will conduct the particular part of the sessions related to sleep hygiene and nocturnal habits. The assessment process will include self-assessment questionnaires in which participants must answer questions on their perception related to sleep quality, socio-demographic aspects and lifestyle. Sleep quality: Kronowise 3.0, Kronohealth, S.L., Spain. Kronowise 3.0 is a wrist device that conducts ambulatory circadian monitoring (ACM) based on thermometry, motor activity, and body position (TAP). TAP uses a combination of sensors in an algorithm that has been validated as ambulatory polysomnography. It was validated by comparing the assessment of these parameters with polysomnography in adults  and in pPerceived sleep quality: Pittsburgh Sleep Quality Index, PSQI . The PSQAll independent variables will be assessed before the intervention, except for the intervention group\u2019s satisfaction questionnaire, which will be measured immediately afterward. Questionnaires on socio-demographic data and toxic habits are prepared ad hoc by the researchers.Socio-demographic data: Date of birth, age in years, gender and sleep habits during the study .Toxic habits: Tobacco consumption (cigarettes/day), alcohol consumption , drug consumption (yes/no and type), and stimulating drink consumption .Physical exercise: The International Physical Activity Questionnaire (IPAQ), simplified version [ version . The que version .Anthropometric variables: Participants will report their weight (kg) and height (cm).Satisfaction with the programme: Using a questionnaire adapted to the proposal by Azpeleta et al. [a et al.  with 10 This study will be conducted according to the principles established in the Declaration of Helsinki, in the Convention on Human Rights and Biomedicine (Oviedo Convention), and in the UNESCO Universal Declaration on the Human Genome and Human Rights. This study has been approved by the Research Ethics Committee of Camilo Jos\u00e9 Cela University (code: 06-22-UCJC-Sleep). All participants will be informed of the duration and characteristics of the study, and of its voluntary nature. After receiving a detailed explanation of the project, any doubts raised by participants will be answered before the students are asked to sign the informed consent form, which mandatorily must be signed to participate.Participants may abandon the study at any time, with no further consequences. The highest professional conduct and absolute confidentiality will be always maintained, in accordance with European Regulation (EU) 2016/679 on the protection of natural persons and data processing and free movement, the Framework Act 3/2018 on personal data protection and the guarantee of digital rights, and Act 14/2007 on biomedical research. Only the principal researcher of the project will have access to the codified database.Participants will be recruited over two weeks and via four channels. Information and informed consent that is mandatory for participation will be provided on the institution\u2019s mobile app, in an institutional email and through two classroom sessions. Furthermore, information will be provided on informative posters on the electronic boards placed around the university premises.After the two-week recruitment phase, all informed consent forms will be collected, and the inclusion/exclusion criteria applied. This will be conducted by a team researcher who will not take part in the intervention. Once the recruitment phase has been completed, students will be codified with their personal academic record number, and the intervention and control group will be randomly assigned. The intervention group will be divided into two groups (intervention group 1 and intervention group 2) according to session schedule preferences.As shown in Ten Kronowise 3.0 devices will be acquiring data a whole week for each student, so the different phases will be staggered for the groups. This means that the intervention protocol will last a total of 16 weeks see .For the statistical analysis, all variables will be coded by using IBM Statistics SPSS v.21 software  for Windows and revised twice. A protocol approach will be followed where missing data will not be included in the analysis.All descriptive statistical parameters will be expressed as absolute (\u2018n\u2019) and relative (\u2018%\u2019) frequencies for each qualitative variable category. Quantitative variables will be analysed with the mean, median, and standard deviation to observe their behaviour at a confidence interval of 95%. Normal variable distribution will be analysed by using the Kolmogorov\u2013Smirnov test with Shapiro\u2013Wilk correction. p < 0.05.A repeated measures ANOVA will be used to compare mean differences between the intervention and control groups over time, considering the time\u2013group interaction effect. The size of the effect will be analysed based on Cohen\u2019s d : 0\u20130.3 lThe PROCESS macro will be used to examine the mediating effects of sleep quality on the relationship between attending the sleep intervention or not. This analysis uses linear regression to estimate indirect effects according to Hayes and Rockwood\u2019s methods recommended for clinical studies and focuses on two measurement moments . Post-trThis research aims to promote healthier lifestyles in nursing undergraduate students. It is specifically addressed to target groups that share risk factors that can compromise sleep quality and to act at the educational level. The main strength of this paper is the intervention itself, which is based on cognitive\u2013behavioural therapy and improved understanding of the physiology of sleep. The physiology of sleep targets both the nervous structures involved in sleep and the self-knowledge of sleep patterns and sleep hygiene strategies, which are the cornerstones of the intervention . It combThe assessment consists of objective and subjective components for a whole comprehensive approach to improve sleep quality. More specifically, the use of a TAP tool, validated as an ambulatory test using a wrist device vs. polysomnography, is an innovative added value of this study, as it will provide reliable, complete results on how the intervention affects sleep quality . Lastly, the methodological design of the controlled clinical trial is crucial in this type of study to guarantee results on the effectiveness of the intervention. Aside from the strengths already mentioned, other limitations should also be noted. First, the sample size may fall short of capturing differences between groups. However, the lack of prior studies and the complexity of developing the study depending on available devices, means that obtaining pilot study results will be enriching to analyse intervention barriers and facilitators for large-scale future implementation. Additionally, we cannot guarantee a possible type two error, as randomization will be individual, and there may be contamination between the control and intervention groups as they interact during their studies.Last, Kronowise 3.0 devices are highly useful for assessing the study despite their limited availability and cost. However, developing this pilot study will provide preliminary data which is crucial to apply for national or international external project funding to sustain the cost involved for interventions on a larger scale. The methodological design of this study supports interventions that can favour better sleep quality in university nursing students. The intervention is a novel strategy combining cognitive learning about sleep as a physiological process, the use of technological devices to monitor sleep parameters, and addressing students\u2019 knowledge about their individual habits through cognitive behavioural therapy. The research to be conducted using this protocol aims to demonstrate the positive effect of such an intervention on sleep quality in nursing students."}
+{"text": "Students in the intervention group rated \u201cmaking dormitory sleep rules\u201d and \u201cwearing eye masks\u201d as the most effective intervention measures. These findings could contribute to the limited body of scientific evidence about sleep intervention in Chinese medical students and highlight the importance of dormitory sleep environments in maintaining sleep quality.Medical students are vulnerable to sleep disorders, which could be further exaggerated by poor dormitory environment and roommate behaviour. However, there is little evidence of whether dormitory environment intervention is effective in improving the sleep quality of medical college students in developing countries. The present study aimed to evaluate the effects of a comprehensive multidomain intervention on dormitory environment and roommate behaviour among medical college students in China. In this cluster randomised controlled trial, a total of 106 dormitories (364 students) were randomly allocated into an intervention group  and a control group . The intervention group received a three-month intervention with multiple components to improve or adapt to sleep environments in dormitories; the control group received no intervention. Primary and secondary outcomes were measured at study enrolment and three months later for both groups. The linear mixed-effects models showed that, compared with the control group, the intervention was associated with a significantly decreased Pittsburgh Sleep Quality Index (\u03b2 = \u22120.67,  Sleep quality has a great impact on people\u2019s physical and mental state, which could affect a wide array of social behaviours and health outcomes. Good sleep quality has been proven to be associated with better academic performance among university students . HoweverGiven the current situation of prevalent sleep problems among medical students, a systematic review in 2020 advocated for an urgent intervention aiming at improving sleep quality of medical students . Up to nIn addition to the potential intervention approaches mentioned above, dormitory sleep environment may be a promising target for intervention. Since most university/college students in China live in residence halls (with shared rooms) on the campus, their sleep schedule and sleep quality could easily be influenced by roommate behaviour and dormitory environment in the evening. However, little attention has been paid to this research area and there lacks targeted research on sleep behaviour interactions between roommates in dormitories and relevant intervention strategies.Therefore, the present study aimed to examine the effectiveness of dormitory sleep environment intervention using a cluster randomised controlled trial (RCT) in a medical college in Beijing, China. We designed a comprehensive multidomain intervention approach to help students improve or adapt to their dormitory sleep environments with the purpose of improving their sleep quality.Participants were undergraduate students living in residence halls at a medical college in Beijing. The inclusion criteria were: long-term residence in the dormitory (defined as 4 days or more per week on average during the term time); 4 or 3 people living in a dormitory ; and all members of the dormitory agreed to participate in the study and signed the informed consent form. Participants who did not complete the baseline survey at recruitment were excluded from this study. This study was conducted between 2014 and 2015. The study protocol had been reviewed and approved by the Student Innovative Experiment Program Committee of Peking University Health Science Center and the Biomedical Ethics Committee of Peking University before implementation .We recruited 418 undergraduates of year 2\u20134 from 110 dormitories (the first-year undergraduates resided on a different campus), of whom 364 students from 106 dormitories fulfilled the inclusion criteria and were included in this study. Given the study design of cluster RCT, we considered dormitory as the cluster and randomised the 106 dormitories into an intervention group and a control group using random numbers generated by the SPSS software. The randomisation was stratified by sex and grade to avoid imbalanced randomisation results. After randomisation, there were 55 dormitories (193 students) in the intervention group and 51 dormitories (171 students) in the control group.The intervention setting was the college dormitory. The intervention focused on the night-time behaviour habits and interactions between roommates, such as roommates\u2019 sleep schedule, work and rest habits, dormitory light off time, noises generated by roommates and dormitory collective activities, but did not include the objective physical environment such as hardware facilities or temperature in the dormitory.The intervention lasted three months and included the following components: (1) health education on the importance of sleep, sleep hygiene, and dormitory sleep environment ; (2) making dormitory sleep rules , such as light off after 11 p.m., no loud conversation after at least one roommate go to bed, wearing earphone when listening to music/playing computer games at bedtime; (3) providing earplugs to reduce noise during sleep; and (4) providing eye masks to reduce light during sleep. The dormitories allocated to the control group received no intervention. We chose the 3-month intervention time because we want to keep the intervention within one school term to reduce the loss of follow-up and the possibility that some students would move to hospitals for training/internship in the longer term.The primary outcome of this study was the total score of the Chinese version of Pittsburgh Sleep Quality Index (PSQI) , roommatSecondary outcomes included the seven subdimensions of the PSQI, self-reflection of potential disturbance to roommate\u2019s sleep, reaction to roommate\u2019s reminder of disruptive behaviour when they were trying to sleep, dormitory conflict due to sleep disturbances, roommate relationship, and self-rated importance of sleep. Detailed items are presented in In addition, a short post-intervention survey was administered to participants in the intervention group to collect their feedback and subjective evaluation of the intervention program .t tests were then conducted to characterise the change in outcome variables  in intervention group and control group. A descriptive analysis of the feedback from the intervention group regarding the intervention procedures was also conducted.Data analysis was conducted by a statistician (QH) blinded to the group allocation status. Baseline characteristics of participants and outcome variables were described by group. The linear mix-effects model (random-intercept) was used to evaluate the intervention effect on outcome measure, with room number and participant ID as two nested random effects in consideration of the clustered design and the repeated measurements. In each regression model, the dependent variable was a specific outcome variable; the independent variables were group (intervention vs. control), time points (pre-test vs. post-test), and the interaction term of group and time which reflects the intervention effect. All models were adjusted for age, grade, sex, and academic stress as covariates. Within-group analyses by paired Several sensitivity analyses were conducted to assess the robustness of the main findings: (1) using linear mixed-effects models with no covariates; (2) additionally adjusting for major (seven categories), experience of living in the dormitory in high school, one-child family, monthly living expenses (reflecting economic status), self-rated physical health, baseline PSQI total score, and baseline level of self-rated importance of sleep.p < 0.05 was used as the significance threshold.All statistical analyses were performed using R  and all statistical tests were two-sided; p = 0.012; p = 0.011; lower PSQI means better sleep), but no change in the PSQI total score was observed in the control group (p = 0.643). The intervention effect on reducing roommates\u2019 influence on sleep schedule was of borderline statistical significance  but not in the control group (p = 0.761). Results of the linear mixed-effects model showed no significant intervention effects on self-rated dormitory sleep environment or dormitory environment influence on sleep quality (p = 0.278).The pre- and post-intervention levels of the four primary outcome variables and 12 secondary outcome variables are shown in  quality , but thep = 0.008), better reaction to roommate\u2019s reminder of disruptive behaviour  and improved roommate relationship . There was no evidence of significant intervention effects on other secondary outcomes  on sleep quality among 364 medical college students in China. There was a significant association between the intervention and a decreased Pittsburgh Sleep Quality Index , and suggestive evidence for the intervention effect on reducing roommates\u2019 influence on sleep schedule. We also observed that the most effective intervention measures reported by students in the intervention group were making dormitory sleep rules and wearing eye mask.The sleep quality of medical students could be affected by a range of physiological, social psychological, and environmental factors. Sexton-Radek et al.  reportedMaking dormitory sleep rules is an important and innovative component of the intervention and may improve all roommates\u2019 awareness of maintaining a good sleeping environment in the dormitory, and even restrict the inappropriate behaviour of roommates at bedtime. In addition, wearing eye masks and earplugs can directly reduce the degree of light exposure and noise exposure when falling asleep and during sleep. A cross-over clinical trial  tested tThere is a growing body of evidence  that pooThe present study also had some potential limitations. Firstly, the representativeness of the study population is limited, due to only covering one medical college in Beijing. Secondly, due to the practical restrictions and feasibility issues, there is no intervention component on the objective physical environment in the dormitory, and lack of objectively measured sleep quality and recorded night-time behaviour of roommates, though our measurements of dormitory sleep environment covered a wide range of subjective aspects. Thirdly, given that the dormitories under intervention may be close to the dormitories in the control group, there could be treatment contamination which may have led to the underestimation of intervention effects. Further large-scale RCTs on dormitory-based sleep intervention are required to validate our findings. We expect the results from this study will contribute to the design of appropriate comprehensive sleep intervention guidelines to achieve the purpose of improving sleep quality of medical students and students in other subjects.In conclusion, we found that comprehensive intervention on dormitory sleep environment and roommate behaviour was effective in improving the sleep quality of medical students. An urgent appeal for schools and students should be made to emphasise sleep problems from the aspect of dormitory environment, and to actively create a good dormitory sleep environment and avoid sleep conflicts among roommates. Our findings could contribute to the limited scientific evidence about the sleep behaviour intervention and the influence of dormitory sleep environment on the sleep quality of college students."}
+{"text": "Approximately one-third of stroke survivors develop poststroke depression. Post-stroke mania is relatively rare, with a prevalence of less than 2%. One review of case reports of late-onset mania in 2015 demonstrated that 51% of the patients had established vascular risk factors. In 28% of cases, the treatment of underlying organic cause contributed to successful remission of the manic episode.For this review, we aimed to compile published case reports from the past 20 years to review late-onset mania as one of the neuropsychiatric outcomes of stroke and its management.literature search on Pubmed, PsychInfo, and Embase utilizing keywords combinations: Bipolar, Manic, Mania, Secondary, Stroke, Poststroke, Post-stroke, Elderly, Old, Late onset, Late-onset, Lateonset, Hemisphere, Brain, Vascular, Infarction.Among the 17 case reports, the age of onset of manic episode ranged from 47 to 86 with a mean of 67 years. Of the 17 cases, the right hemisphere was the most frequently affected , with cerebrovascular lesion involving the left hemisphere in 3 cases (17.6%).Clinicians should consider mania secondary to an organic cause in patients presenting with focal or soft neurological signs or symptoms, manic episode with atypical symptoms such as visual or olfactory hallucinations, altered mental status, disorientation, impairment in memory or cognition, unusual age of onset for bipolar disorder, or unusual illness course such as single episode of mania or poor response to psychopharmacologic treatment. Some reviews suggest combination of mood stabilizers and second-generation antipsychotics. Benzodiazepines recommended as an adjunctive drug for acute management such as agitation, aggressive behavior or disinhibition.No significant relationships."}
+{"text": "The 99th centile of cardiac troponin, derived from a healthy reference population, is recommended as the diagnostic threshold for myocardial infarction, but troponin concentrations are strongly influenced by age. Our aim was to assess the diagnostic performance of cardiac troponin in older patients presenting with suspected myocardial infarction.In a secondary analysis of a multicenter trial of consecutive patients with suspected myocardial infarction, we assessed the diagnostic accuracy of high-sensitivity cardiac troponin I at presentation for the diagnosis of type 1, type 2, or type 4b myocardial infarction across 3 age groups  using guideline-recommended sex-specific and age-adjusted 99th centile thresholds.In 46\u2009435 consecutive patients aged 18 to 108 years , 5216 (11%) had a diagnosis of myocardial infarction. In patients <50 (n=12\u2009379), 50 to 74 (n=22\u2009380), and \u226575 (n=11\u2009676) years, the sensitivity of the guideline-recommended threshold was similar at 79.2% , 80.6% , and 81.6% , respectively. The specificity decreased with advancing age from 98.3%  to 95.5% , and 82.6% . The use of age-adjusted 99th centile thresholds improved the specificity  and positive predictive value (59.3% [57.0%\u201361.5%] versus 51.5% [49.9%\u201353.3%]) for myocardial infarction in patients \u226575 years but failed to prevent the decrease in either parameter with increasing age and resulted in a marked reduction in sensitivity compared with the use of the guideline-recommended threshold (55.9% [53.6%\u201357.9%] versus 81.6% [79.8%\u201383.3%].Age alters the diagnostic performance of cardiac troponin, with reduced specificity and positive predictive value in older patients when applying the guideline-recommended or age-adjusted 99th centiles. Individualized diagnostic approaches rather than the adjustment of binary thresholds are needed in an aging population. In older patients presenting with suspected myocardial infarction, the majority of cardiac troponin elevations are explained by acute or chronic myocardial injury or type 2 myocardial infarction.The specificity and positive predictive value of high-sensitivity cardiac troponin to identify myocardial infarction decreases with age and is observed whether applying sex-specific or age-adjusted 99th centile diagnostic thresholds or a \u201crule-in\u201d threshold for the triage of patients at high probability of myocardial infarction.Serial troponin testing incorporating an absolute change in troponin concentration increased discrimination for myocardial infarction in older patients.In older patients presenting with suspected myocardial infarction, clinicians should be cautious when interpreting a single troponin measurement.Clinicians should routinely perform serial cardiac troponin measurements and consider absolute changes in concentration to identify those older patients with elevated troponin concentrations more likely to have myocardial infarction.1 This value is influenced by the characteristics of the reference population used for derivation.5 Elevated concentrations of cardiac troponin >99th centile are frequently observed in older adults,8 including among those presenting to the emergency department without myocardial infarction11 and in the general hospitalized older population.12 The application of diagnostic thresholds derived from younger reference populations may incorrectly suggest myocardial infarction in older patients, resulting in inappropriate treatment and potential harm.The 99th centile upper reference limit (URL) of cardiac troponin, derived from a cohort of healthy individuals, is used as the threshold to indicate myocardial injury and potential infarction.3 Cardiovascular comorbidities including hypertension, diabetes, left ventricular dysfunction, and existing ischemic heart disease are independently associated with chronic elevations in cardiac troponin.9 The higher prevalence of these conditions among older patients further complicates the interpretation of cardiac troponin in an aging and increasingly multimorbid society.The relationship between age and cardiac troponin has been noted for both troponin I and T assays, with the observed 99th centile URL for older adults in the general population double the reference value for cardiac troponin I and 3 times the value for troponin T.15 An alternative strategy to increase the specificity is the use of a threshold >99th centile. Introduced in recent practice guidelines, direct rule-in approaches using the presentation troponin concentration and a threshold \u22483 times the 99th centile value to identify patients at high probability of myocardial infarction are reported to have greater specificity and a positive predictive value (PPV) of up to 75%.14Age-adjusted thresholds that use the observed 99th centile within different age groups to guide the diagnosis have been proposed as a means of increasing the specificity of cardiac troponin for myocardial infarction in older patients.17 Although both type 1 and type 2 myocardial infarctions represent important clinical entities, they have divergent treatment strategies, and an understanding of how age affects diagnostic performance specifically for type 1 myocardial infarction would help guide treatment decisions in older patients.Previous evaluations on the effect of age when applying either strategy have focused on the identification of any form of myocardial infarction.In this prespecified secondary analysis of a multicenter trial of consecutive patients with suspected acute coronary syndrome, we evaluate the effect of age and cardiovascular comorbidities on the performance of high-sensitivity cardiac troponin I for the diagnosis of myocardial infarction using the guideline-recommended sex-specific 99th centile, age-adjusted sex-specific 99th centiles derived in a general population, and a universal rule-in threshold >99th centile. In addition, we assess the performance of each threshold in combination with absolute and relative change in troponin concentration for the diagnosis of myocardial infarction.https://www.clinicaltrials.gov; Unique identifier: NCT01852123). A detailed description of this trial has been reported previously.18 In summary, all patients attending the emergency department between June 2013 and March 2016 in whom the attending clinician suspected acute coronary syndrome and underwent cardiac troponin sampling were considered eligible for inclusion. Patients were excluded if they had been admitted previously during the trial period or did not reside in Scotland. Patients were enrolled using an electronic form integrated into the clinical care pathway completed at the time of cardiac troponin sampling.The High-STEACS trial  is a stepped-wedge cluster randomized controlled trial that evaluated the implementation of a high-sensitivity cardiac troponin I assay in consecutive patients presenting with suspected acute coronary syndrome across 10 secondary and tertiary hospitals in Scotland . This assay has a limit of detection of between 1.2 and 1.9 ng/L, an interassay coefficient of variation of <10% at 4.7 ng/L, and a 99th centile URL of 34 ng/L in men and 16 ng/L in women. Sex-specific URL was determined by the manufacturer on the basis of 4590 samples from healthy men and women aged 21 to 75 years.20Cardiac troponin testing was performed at presentation and repeated 6 or 12 hours after the onset of symptoms at the discretion of the attending clinician in accordance with international guidelines in use during enrollment.21 Two physicians independently reviewed all clinical information, with discordant diagnoses resolved by an independent third physician. Type 1 myocardial infarction was defined as myocardial necrosis  in the context of a presentation with suspected acute coronary syndrome and symptoms or signs of myocardial ischemia. Patients with myocardial necrosis, symptoms or signs of myocardial ischemia, and evidence of increased myocardial oxygen demand or decreased supply secondary to an alternative condition without evidence of acute atherothrombosis were defined as type 2 myocardial infarction. Type 4a myocardial infarction was defined in patients with symptoms or signs of myocardial ischemia after percutaneous coronary intervention where high-sensitivity cardiac troponin I concentrations were 5-fold greater than the 99th centile or increased further if elevated before the procedure. Type 4b myocardial infarction was defined where myocardial ischemia and myocardial necrosis were associated with stent thrombosis documented at angiography. Patients with high-sensitivity cardiac troponin I concentrations above the 99th centile without symptoms or signs of myocardial ischemia were classified as having myocardial injury. All nonischemic myocardial injury was classified as acute, unless a change of \u226420% was observed on serial testing,1 or the final adjudicated diagnosis was chronic heart failure or chronic renal failure, where the classification was chronic myocardial injury. The term \u201cmyocardial infarction\u201d is used to denote patients with an adjudicated diagnosis of type 1, type 2, or type 4b myocardial infarction. A detailed summary of the adjudication process is provided in the Supplemental Material.All patients with a high-sensitivity cardiac troponin I concentration >99th centile were adjudicated and classified according to the Fourth Universal Definition of Myocardial Infarction.2, Kruskal-Wallis, or 1-way ANOVA tests as appropriate.Baseline characteristics are summarized as number (%) for categorical variables, and continuous variables are summarized as mean\u00b1SD or median (25th to 75th percentile) when not normally distributed. The study population was divided into 3 clinically relevant age groups: young (<50 years), middle-aged (50\u201374 years), and older adults (\u226575 years). For additional analyses, the population was divided by 5-year intervals between the ages of 40 and 90 years to create 12 groups. Patients aged <40 and \u226590 years were pooled into groups of <40 and \u226590 years, respectively. Groupwise comparisons were performed using \u03c71 age-adjusted 99th centile thresholds in patients >60 years , and a universal rule-in threshold (64 ng/L) recommended by the European Society of Cardiology.14 Age-adjusted thresholds were previously derived in 19\u2009501 individuals in the Generation Scotland Scottish Family Health Study.3 Overall performance was assessed using area under the curve (AUC) and compared between thresholds and age groups using a DeLong test.We evaluated the proportion of patients with at least one troponin concentration above the sex-specific 99th centile URL for each age category. Diagnostic performance was assessed by using sensitivity, specificity, negative predictive value, and PPV, and calculated using a 2\u00d72 confusion matrix. Corresponding 95% CIs were calculated using bootstrapping with replacement and a sample of 1000. We calculated diagnostic performance for a high-sensitivity cardiac troponin I concentration at presentation above the guideline-recommended sex-specific 99th centile ,22 The effect of change in cardiac troponin concentration on discrimination was assessed using the AUC and compared between thresholds and age groups using a DeLong test.1A sensitivity analysis was undertaken using the 99th centile as the diagnostic threshold restricted to patients presenting with chest pain. Additional analysis restricted to patients with serial samples taken within 24 hours of admission was performed to assess the effect of the change in cardiac troponin concentration from serial samples on diagnostic performance. We evaluated models that incorporated absolute or relative change in troponin concentration of 15 ng/L or 20% as recommended in international guidelines in combination with the presentation troponin concentration stratified by age group and threshold.\u20131\u00b71.73 m\u20132 determined by the Modified Diet in Renal Disease equation) and diabetes were added individually (model 1) and collectively (model 2) to a baseline model, including a binary explanatory variable of presentation troponin greater than the sex-specific 99th centile. Collinearity was assessed visually and by calculation of the generalized variance inflation factor. All analyses were performed in R Version 3.5.1.Logistic regression was used to explore the influence of cardiovascular comorbidities on the probability of myocardial infarction given a cardiac troponin value greater than the sex-specific 99th centile. A history of ischemic heart disease, myocardial infarction, heart failure, cerebrovascular disease (defined as previous ischemic or hemorrhagic stroke), chronic renal impairment , those in whom the final diagnosis could not be adjudicated according to the Fourth Universal Definition of Myocardial Infarction (n=890), those with an adjudicated diagnosis of type 4a myocardial infarction (n=9), and those without a presentation high-sensitivity cardiac troponin result (n=23) were excluded.Table S1). Compared with younger patients, those aged \u226575 years were more often female and less likely to present with chest pain or ischemia on 12-lead ECG . There was a higher prevalence of cardiovascular comorbidity in patients \u226575 years, including ischemic heart disease, heart failure, diabetes, and chronic kidney disease . More than half of patients \u226575 years had \u22652 chronic cardiovascular health conditions compared with a third aged between 50 and 74 years .Participants were aged between 18 and 108 years . Baseline characteristics for the population are shown in Table P<0.001 for difference between groups). In patients aged \u226590 years, 49% had one cardiac troponin above the sex-specific 99th centile . Myocardial infarction was the final adjudicated diagnosis in 5216 (11%) patients with the prevalence highest in those aged \u226575 years (18%). In patients with at least one troponin measurement greater than the sex-specific 99th centile, the proportion of those with type 1 myocardial infarction decreased with advancing age as type 2 myocardial infarction, acute myocardial injury, and chronic myocardial injury increased  patients had at least one cardiac troponin measurement above the sex-specific 99th centile. For those aged <50, 50 to 74, and \u226575 years, the proportion of patients with at least one measure above the sex-specific 99th centile was 5%, 16%, and 34%, respectively (Table S2).In patients aged <50, 50 to 74, and \u226575 years, the sensitivity of the guideline-recommended sex-specific 99th centile at presentation for a diagnosis of myocardial infarction was similar at 79.2% , 80.6% , and 81.6% , respectively. The specificity fell with advancing age from 98.3%  to 95.5% , and 82.6%  for those aged <50, 50 to 74, and \u226575 years, respectively. The PPV for those aged <50, 50 to 74, and \u226575 years was 63.0% , 70.1% , and 51.6% , respectively .In a sensitivity analysis restricted to those with chest pain at presentation (n=33\u2009446), the sensitivity for myocardial infarction was similar to patients presenting with any symptom, whereas specificity and PPV were markedly increased across all age groups. In patients \u226575 years, the specificity and PPV were 89.8%  and 70.4% , respectively (Table S2). In patients \u226575 years, sensitivity, specificity, and PPV were 55.9% , 91.3% , and 59.3% , respectively. Despite the use of age-adjusted thresholds, the specificity and PPV remained lower in patients \u226575 years than in patients <50 or 50 to 74 years old. Compared with the guideline-recommended sex-specific 99th centile, discrimination was reduced .Applying age-adjusted thresholds resulted in higher specificity and PPV for myocardial infarction in patients \u226575 years at the expense of a marked reduction in sensitivity (Table Table S2). In patients \u226575 years, sensitivity, specificity, and PPV were 50.1% , 92.7% , and 60.9% , respectively. Specificity and PPV remained lower in patients \u226575 years than in those <50 or 50 to 74 years. Compared with the guideline-recommended sex-specific 99th centile, discrimination was reduced .Applying a universal rule-in threshold of 64 ng/L resulted in increased specificity and PPV for myocardial infarction, with reduced sensitivity across all age groups, compared with sex-specific or age-adjusted 99th centile thresholds .In a sensitivity analysis restricted to those with serial samples taken within 24 hours of admission {n=20\u2009881 } both a relative change of 20% and absolute change of 15 ng/L significantly improved discrimination across all groups compared with a presentation sample alone . Adjusting for cardiovascular comorbidities did not alter the association between a high-sensitivity cardiac troponin above the 99th centile and a diagnosis of myocardial infarction but did improve overall discrimination across all age groups .An elevated troponin above the 99th centile was associated with myocardial infarction across all age groups, but this relationship was weakest in patients \u226575 years Table . SeveralTable S4).Compared with a diagnosis of any type of myocardial infarction, assessing the diagnostic performance of each threshold specifically for type 1 myocardial infarction resulted in similar sensitivity across all age groups with reduced specificity and PPV, in particular, in older patients. Using the guideline-recommended sex-specific 99th centile, specificity and PPV in patients \u226575 years was 78.8%  and 36.8% , respectively  patients in whom the primary presenting symptom was not chest pain. For meaningful interpretation of the diagnostic performance of cardiac troponin, it is important that assessments are performed in study populations representative of those seen in clinical practice. Selective inclusion criteria that result in the exclusion of older patients reduce generalizability and risks mirroring previous biases that resulted in the systematic underdiagnosis of myocardial infarction in women.20The majority of patients diagnosed with myocardial infarction are aged >70 years.24 Reiter et al11 compared the performance of sensitive troponin assays between patients >70 and <70 years using a cohort of 1098 patients from the APACE study . Boeddinghaus et al16 assessed the effect of age on the performance a 0/1 hour chest pain pathway using the 99th centile diagnostic threshold for both high-sensitivity cardiac troponin I and T assays in a cohort of 3123 patients from APACE, BACC (Biomarkers in Acute Cardiac Care), and TRAPID-MI  with chest pain. Both studies reported that specificity for myocardial infarction decreased with advancing age.Our finding of reduced specificity of the sex-specific 99th centile in older patients is consistent with previous literature assessing both sensitive and high-sensitivity assays for the diagnosis of myocardial infarction.16 Reclassification of patients using an age-adjusted diagnostic threshold has also been shown to improve the identification of patients at increased short-term mortality.17 Parallels could be drawn with the use of sex-specific thresholds that are recommended in the Fourth Universal Definition of Myocardial Infarction.20 Is it therefore time to consider adopting age-adjusted thresholds? There are several factors to consider. First, age is not a dichotomous variable. Deriving the 99th centile in a population by age still confers the same issues inherent with a universal 99th centile: defining normality in a heterogeneous group. Second, higher cardiac troponin thresholds may disadvantage older patients with fewer comorbidities. Third, elevated cardiac troponin levels above the 99th centile are associated with adverse outcomes in both young and old patients and implementing higher thresholds may normalize values that still confer risk, limiting the opportunity for intervention.25 Fourth, age-adjusted 99th centiles did not prevent a decline in diagnostic performance of troponin testing in older patients. Last, overall discrimination was greatest when using an absolute change in cardiac troponin in combination with the 99th centile as the diagnostic threshold. For these reasons, we do not support the adoption of age-adjusted thresholds for the diagnosis of myocardial infarction.We found that the use of age-adjusted thresholds improved specificity and PPV in older patients than the use of the 99th centile, a finding mirrored in several observational studies.14 This extends the concept of safety from a single low cardiac troponin concentration to an idea that high presentation concentrations are very likely to correlate with the severity of coronary artery disease.26 Rule-in thresholds were designed to maximize the specificity and PPV of testing with their recommendation based on observational data from cohorts of consented patients with chest pain as the primary presenting symptom.28 We found that the application of a rule-in threshold of 64 ng/L achieved the greatest specificity and PPV for both myocardial infarction and type 1 myocardial infarction across all ages in comparison with both sex-specific 99th centiles and age-adjusted thresholds. This approach is analogous to the use of optimized rule-out or risk stratification thresholds that prioritize high sensitivity and negative predictive value to identify patients at presentation who are unlikely to have myocardial infarction on serial testing. However, unlike these thresholds, we observed that a rule-in threshold did not have consistent or adequate performance across age groups or key cardiovascular comorbidities. Despite higher specificity and PPV, 2 in every 5 patients aged \u226575 years with a presentation cardiac troponin >64 ng/L did not have myocardial infarction, and 1 in every 2 patients aged 75 years did not have a final diagnosis of type 1 myocardial infarction. In addition, sensitivity was decreased across all age groups. This may miss diagnoses of myocardial infarction and other forms of myocardial injury that confer clinically relevant and prognostic information.29 Ultimately, any increase in a binary threshold comes at the cost of decreased sensitivity, regardless of age. Although defining optimal thresholds for a series of age groups and comorbidities to achieve a predefined specificity or PPV may be possible, these would be impractical to apply in clinical practice.The latest European Society of Cardiology guidelines have included new rule-in thresholds above the 99th centile to identify those with a high probability of myocardial infarction using a single presentation cardiac troponin test.34 Given the ease of access to early retesting within 1 hour, and the improvements in diagnostic performance when incorporating an absolute change in troponin concentration, clinicians should consider whether the rule-in of myocardial infarction on the basis of a single presentation cardiac troponin sample should be applied to older or more complex patients. Patients requiring immediate or expedited revascularization are often identifiable by clinical features, and decisions based on presentation troponin concentrations should first focus on safe rule-out and minimizing the risk of missed myocardial infarction.Regardless of threshold, diagnostic performance was reduced in older patients. We observed an increase in type 2 myocardial infarction and myocardial injury with age. Cardiac troponin is not specific for myocardial infarction, and there is little evidence that the magnitude of cardiac troponin can distinguish the mechanism of release, and the differentiation of acute from chronic causes of injury requires serial testing.We observed a lower specificity and PPV when using high-sensitivity cardiac troponin to diagnose type 1 myocardial infarction compared with a diagnosis of type 1, type 2, or type 4b infarction. Although chest pain diagnostic pathways predominately assist with patient triage, they are also used to guide the early administration of antiplatelet therapy and anticoagulation that are not indicated in patients with type 2 myocardial infarction and conversely may cause harm. Clinicians should be aware of these changes when considering the risks and benefits of early management strategies in older patients.6 Age may therefore have a stronger association with cardiac troponin concentrations than individual comorbidities. Second, noncardiovascular comorbidities were not collected as part of the High-STEACS trial. Conditions such as chronic obstructive pulmonary disease and other inflammatory conditions are associated with elevations in cardiac troponin.37 Third, we cannot exclude the effect of unmeasured subclinical cardiovascular disease in our cohort. Objective measures of disease severity such as natriuretic peptide concentrations or echocardiography could add to the granularity of a binary comorbidity status. Approaches to sequentially exclude patients from reference populations used to derive the 99th centile using such testing has been shown to affect the threshold level, in particular, in older patients.39Few studies have assessed the effect of comorbidities on diagnostic performance of troponin testing. We found that, although several cardiovascular comorbidities were associated with the diagnosis of myocardial infarction, their presence did not alter the odds of myocardial infarction in those with an elevated cardiac troponin above the 99th centile. This suggests that the cardiovascular comorbidities we assessed do not directly influence the diagnostic performance of a binary rule-in strategy using cardiac troponin at the sex-specific 99th centile. There are several potential explanations for these findings. First, older patients free from cardiovascular disease may still exhibit higher baseline cardiac troponin concentrations than younger reference populations used to derive 99th centile thresholds.40 One such example is the myocardial infarction3 model that uses machine learning to provide individual probability estimates and has been shown to perform favorably in an observational study with superior specificity and PPV compared with universal thresholds.42 Further research is required to explore the efficacy of such approaches and understand the effectiveness of integration into clinical practice.Of note, the addition of comorbidities to our baseline model resulted in an improvement in model discrimination, suggesting that approaches which consider multiple individual patient factors could offer an alternative to threshold-based diagnosis.Our study has several strengths. The enrollment of consecutive patients using clinician suspicion of acute coronary syndrome eliminates selection bias. This ensured that our analysis included a wide range of patients, representative of the changing demographics observed in clinical practice, including more than a thousand patients aged >90 years, a group largely excluded from cardiovascular studies. A further strength is the adjudication of myocardial infarction according to the Fourth Universal Definition of Myocardial Infarction, in particular, given the increase in type 2 myocardial infarction and myocardial injury in older patients.STAT high-sensitivity assay. The 99th centile is assay dependent. Cardiac troponin I and T are not biologically equivalent neither is their relationship to age or cardiovascular risk.3 Our findings must therefore be interpreted with caution when considering other cardiac troponin assays. However, reduced performance with advancing age has now been observed in both high-sensitivity cardiac troponin I and T assays.16 We also recognize the challenge of diagnostic adjudication using routine health care data, in particular, in the older population where diagnostic procedures such as coronary angiography are performed less frequently.There are limitations that should be considered. Although our study reflected aging demographics, our local population is predominantly White, and findings may differ in a more ethnically diverse population. Our analysis was also based on cardiac troponin I measured using the Abbott ARCHITECTIn conclusion, age has a significant effect on the diagnostic performance of cardiac troponin at the guideline-recommended 99th centile for myocardial infarction, with reduced performance in older patients. The use of age-adjusted 99th centile thresholds or a higher universal rule-in threshold did not achieve parity between middle-aged and older patients. Individualized diagnostic approaches and serial testing to determine absolute change in troponin concentration rather than adjustment of binary thresholds are needed to avoid disadvantaging older patients.The authors thank the High-STEACS Investigators for their contributions to the conception or design of the work, or the acquisition, analysis, or interpretation of data for the work.This work was supported by the British Heart Foundation (grant number SP/12/10/29922) with support from a Research Excellence Award (grant number RE/18/5/34216). Drs Lowry, Doudesis, Wereski, and Bularga and are supported by Clinical Research Training Fellowships  from the Medical Research Council. Dr Lee is supported by a Clinical Research Training Fellowship (grant number FS/18/25/33454) from the British Heart Foundation. Dr Kimenai is supported by a grant from Health Data Research UK, which receives its funding from HDR UK Ltd (grant number HDR-5012) funded by the UK Medical Research Council, Engineering and Physical Sciences Research Council, Economic and Social Research Council, Department of Health and Social Care (England), Chief Scientist Office of the Scottish Government Health and Social Care Directorates, Health and Social Care Research and Development Division (Welsh Government), Public Health Agency (Northern Ireland), British Heart Foundation and the Wellcome Trust. Dr Newby is supported by the British Heart Foundation  and is the recipient of a Wellcome Trust Senior Investigator Award (grant number WT103782AIA). Dr Mills is supported by a Chair Award (grant number CH/F/21/90010), a Programme Grant (grant number RG/20/10/34966), and a Research Excellence Award (grant number RE/18/5/34216) from the British Heart Foundation. Dr Chapman receives support from a Starter Grant for Clinical Lecturers by the Academy of Medical Sciences (grant number SGL021/1075). Abbott Laboratories provided cardiac troponin assay reagents, calibrators, and controls without charge. The funders played no role in the design, conduct, data collection, analysis or reporting of the trial.Dr Mills reports research grants awarded to the University of Edinburgh from Abbott Diagnostics and Siemens Healthineers outside the submitted work, and honoraria from Abbott Diagnostics, Siemens Healthineers, Roche Diagnostics, and LumiraDx. The other authors report no conflicts.Tables S1\u2013S6Figures S1\u2013S3MethodsThe High-STEACS trial makes use of several routine electronic health care data sources that are linked, de-identified, and held in our national safe haven, which is accessible by approved individuals who have undertaken the necessary governance training. Summary data can be made available on request to the corresponding author."}
+{"text": "Fungal infections are among the major infections among immunocompromised patients. They are becoming more common with the widespread use of antibiotics, steroid therapy, and the increasing number of immunocompromised patients. However, the incidence of laryngeal fungal and bacterial co-infection has rarely been reported. As same as laryngeal fungal infection, it mimics other types of laryngeal disease such as gastroesophageal reflux disease, granulomatous disease, and malignant lesions. There is a high likelihood of misdiagnosis, leading to delayed treatment and morbidity from fungal and bacterial co-infection of the larynx. A high index of suspicion is required to make the diagnosis and one should look for evidence of immunosuppression and predisposing factors to local mucosal barrier impairment. However, herbal medicine is a rare cause. We present a case of fungal and bacterial co-infection of supraglottis in an immunocompetent patient secondary to herbal medicine. Streptococcus pneumoniae,\u00a0Haemophilus influenzae,\u00a0and\u00a0Staphylococcus aureus [Opportunistic laryngeal infection is primarily caused by pathogens that are normally present in the upper\u00a0respiratory tract of the normal population which\u00a0take advantage of a locally or systemically compromised immune system to invade and proliferate in the tract and becomes pathogenic. The microbial community of the respiratory tract is diverse and harbors many opportunistic pathogens. Candida, which is widespread in the natural world, is found to be both the most common opportunistic organism colonizing the respiratory tract and the causative agent of opportunistic laryngeal infection, namely fungal laryngitis . Bacteris aureus .Co-infection of fungal and bacterial supraglottitis is a rare clinical entity. Immunocompromised patients with diabetes, AIDS, leukemia, aplastic anemia, and long-term use of steroids as well as patients with certain medical conditions like inhaled steroid therapy, laryngopharyngeal reflux disease, prior radiotherapy, and prolonged antibiotic use are at high risk of infection . Herbal An 84-year-old male, a chronic smoker with underlying hypertension, dyslipidemia, and a history of minor stroke 3 years before, presented\u00a0with dysphagia and hoarseness\u00a0associated with yellowish sputum for the past 6 months. The dysphagia was described as difficulty in swallowing solid food and the presence of a lump sensation in the throat. Neither of the symptoms has\u00a0worsened over time. He denied any constitutional symptoms, shortness of breath, chest pain, or halitosis. Flexible laryngoscopy showed edematous bilateral arytenoids and epiglottis with the presence of yellowish plaque extending to post cricoid area and aryepiglottic fold and significant pooling of saliva Figure . However Candida albicans and Klebsiella pneumoniae, hence a diagnosis of fungal laryngitis with bacterial co-infection was made. He was thoroughly screened for any conditions, including immunodeficiency status, diabetes, prolonged usage of immunosuppressive drugs, and previous radiotherapy, all of which were\u00a0negative. The patient\u2019s routine blood investigations and chest X-ray were normal. Upon further questioning, he admitted to taking herbal medicine which was composed of Curcumae\u00a0xanthorrhizae rhizoma, Curcumae\u00a0domesticae rhizoma, and Imperatae cylindricae rhizoma for the past 3 years on a daily basis. The reasons for him taking the herbal medicine were for good health and to prevent another recurrence of the minor stroke. Thus, we attributed his condition to his herbal medicine consumption as the predisposing factor.A provisional diagnosis of tuberculous laryngitis with a differential diagnosis of fungal laryngitis was made. A sputum sample was collected and sent for tuberculosis workup and culture. The sputum was negative for tuberculosis but the culture grewThe patient was prescribed oral fluconazole 100 mg once daily and oral cefuroxime 500 mg twice daily and\u00a0was instructed to stop consuming the herbal medicine. After 2 weeks, the patient showed a remarkable improvement\u00a0after the full course of the antifungals was completed, and flexible laryngoscopy revealed a reduction of the lesions in the larynx (Figure Two months after his initial evaluation, the patient complained of a recurrence of symptoms. Upon further questioning, the patient had resumed the consumption of the herbal medicine for the same reason after the resolution of his symptoms. The flexible laryngoscopy showed similarities to the initial findings. The same antimicrobials were restarted and completed for 2 weeks, and the herbal medicine was discontinued. The patient has been well since then.Although herbal medicines are widely considered to be of lower risk compared to synthetic drugs, they are not entirely free of potential toxicities and side effects. Studies have shown that herbal medicines have the capacity to suppress the immune response effects through induction of apoptosis or modulation of cell proliferation and cytokine secretion, and therefore, can have beneficial applications in some immune-mediated disorders, including autoimmune diseases . On the In our case, the main components of the herbal medicines used by the patient were Curcumae xanthorrhizae rhizoma and Curcumae domesticae rhizoma, in which the bioactive compound is curcuminoid. Curcuminoid is a potent anti-inflammatory that can alter the expression of various transcription factors, cell cycle proteins, and signal transducing kinases\u00a0. High doAnother notable constituent is Imperatae cylindricae rhizoma.\u00a0Saponins and flavonoids are two of its important bioactive compounds. Saponin\u00a0is a large family of amphiphilic\u00a0glycosides\u00a0of steroids and\u00a0triterpenes. It has shown a significant decrease in the number of monocytes and granulocytes count in human whole blood and a decline in CD3 count and macrophage activation in an animal model with a dosage-dependent relationship . FlavonoCandida albicans in the tract could impair the immune response which could decrease the normal antibacterial function of the immune system\u00a0permitting bacterial pathogens to cause infection instead of being cleared by the immune cells. Klebsiella pneumoniae has been considered an opportunistic pathogen that commonly colonizes mucosal surfaces in humans and typically causes infections in hospitalized or immunocompromised individuals [This case reports fungal laryngitis with a bacterial co-infection. A study has shown that a secondary bacterial infection of respiratory tract could prevail due to airway fungal colonization . The preividuals .As seen in our case as well, the clinical findings of hoarseness and dysphagia often bear a resemblance to granulomatous disease and gastroesophageal reflux disease. With a history of chronic smoking, one may think of the diagnosis of a malignancy in the upper aerodigestive tract. With all of the differential diagnoses possible, if the diagnosis of fungal laryngitis is not proactively considered, it may be missed and eventually, inappropriate treatment and unwarranted surgical intervention may follow.The role of biopsy is controversial. While some advocate biopsy of the lesion to establish the diagnosis, others reserve this for refractory cases or for cases that are highly suspicious of malignancy . In our The diagnosis of opportunistic laryngeal infection in an immunocompetent patient is rare and yet, herbal medicine is not widely reported in the medical literature to cause such infections. It demands great attention on the presenting history and physical examination together with laboratory work-up in ruling out other conditions. The presence of dysphagia and hoarseness with chronic consumption of herbal medicine should raise the level of suspicion for the diagnosis, or otherwise, we might land ourselves in the wrong diagnosis and consequently, delayed treatment. Early diagnosis and treatment are crucial to prevent the spread and morbidity of fungal laryngitis. Recognition and elimination of the predisposing factor are of paramount importance as well."}
+{"text": "With the COVID-19 pandemic continuing, more contagious SARS-CoV-2 variants, including Omicron, have been emerging. The mutations, especially those that occurred on the spike (S) protein receptor-binding domain (RBD), are of significant concern due to their potential capacity to increase viral infectivity, virulence, and breakthrough antibodies' protection. However, the molecular mechanism involved in the pathophysiological change of SARS-CoV-2 mutations remains poorly understood. Here, we summarized 21 RBD mutations and their human angiotensin-converting enzyme 2 (hACE2) and/or neutralizing antibodies' binding characteristics. We found that most RBD mutations, which could increase surface positive charge or polarity, enhanced their hACE2 binding affinity and immune evasion. Based on the dependence of electrostatic interaction of the epitope residue of virus and docking protein (like virus receptors or antibodies) for its invasion, we postulated that the charge and/or polarity changes of novel mutations on the RBD domain of S protein could affect its affinity for the hACE2 and antibodies. Thus, we modeled mutant S trimers and RBD-hACE2 complexes and calculated their electrotactic distribution to study surface charge changes. Meanwhile, we emphasized that heparan sulfate proteoglycans (HSPGs) might play an important role in the hACE2-mediated entry of SARS-CoV-2 into cells. Those hypotheses provide some hints on how SARS-CoV-2 mutations enhance viral fitness and immune evasion, which may indicate potential ways for drug design, next-generation vaccine development, and antibody therapies. Unfortunately, the pandemic is continuing. It is much likely that SARS-CoV-2 will coexist with humans over a long period (Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) led to an unprecedented pandemic known as Coronavirus disease 2019 (COVID-19), which is raging world widely, resulting in catastrophic effects on human health and a terrible social as well as a financial crisis  protein, a glycosylated trimer that protrudes from the SARS-CoV-2 lipid envelope , 8, sincLooking deep into nature, the attachment and following interaction of the S protein to cellular heparan sulfate (HS) is the initial phase of the viral invading the target cell \u201318. HS ihttps://covid19.trackvaccines.org/vaccines/), which is critical to blocking the pandemic of COVID-19 (* (Alpha) lineage was first identified in Britain and quickly dominated (* (Delta) lineage in Indian (* (Omicron) lineage in South Africa  , 30. ForSeveral RBD mutations after natural selection have been shown to affect viral infectivity, pathogenic mechanism, and immune evasion. Here, we concluded 21 mutations in the RBD domain of VOCs and Variants of Interest (VOIs) and summarized their change of hACE2 binding affinity and ability to escape protective antibodies respectively . Among tAs noted earlier, RBM interacts directly with hACE2 and contains most of the hACE2 contact residues. What's more, Lan et al. found that ten RBD residues  are responsible for hACE2 identification and interaction by 13 H bonds and 2 salt bridges . It is wFurthermore, G446S, L452Q, F490S, and G496S, whose common features are mutating the hydrophobic residues  to polar residues (Ser and Gln), enhance the interactions with hACE2 . This hiProtein electrostatic properties depend on the whole and partial charge distribution of the three-dimensional protein structure . ElectroAdditionally, adaptive Poisson-Boltzmann equation solver (APBS) analysis of the RBD-hACE2 complex showed charge distribution appears to vary between RBD and hACE2. The RBD surface that faces the hACE2 appears positively charged surface, while the hACE2 surface that faces the RBD has a complementary negative charged surface . BesidesIt is widely known that different variants have some common and unique mutations. How does this affect the whole electrostatic distribution of protein, when a single RBD point mutation is combined with other co-occurring RBD mutations? Hence, the surface electrostatic potential distributions of the S trimers and RBDs of VOCs and VOIs were also computed , 6. The via altering the antigenic properties of S trimers by various distinct mechanisms , an enzyme that degrades cell surface HSPGs. In addition, at molecular levels, recombinant RBD mutated proteins can be incubated with hACE2 with or without heparin, then comparing the binding complex with western blotting or cryo-electron microscopy , or low molecular weight heparin (LMWH) mainly as an anticoagulant . With thIn summary, our hypothesis emphasizes electrostatic interaction between SARS-CoV-2  and HSPGs, in the entry into host cells, but also predicts heparin's potential in the invasiveness blockage to virulent variants of SARS-CoV-2, which would be informative for drug design and vaccine development. The hypothesis provides an unproven theory for preventing and controlling the COVID-19 pandemic caused by present and new virus variants.https://www.rcsb.org) (https://www.gisaid.org) available on 26 December 2021, we summarized information about the most common mutations in the RBD domain of VOCs and VOIs. Structures with the mutated residues were predicted by using the Rotamers tool of UCSF  Chimera v1.15 based on the WT SARS-CoV-2 S Protein and hACE2-RBD complex (The structure of the SARS-CoV-2 S Protein (PDB ID:7DWZ and 7DF3) and RBD-hACE2 receptor complex (PDB ID: 6M0J) were collected from the Protein Data Bank (csb.org) , 11, 70. complex . We used complex .3-dimensional surfaces of the molecular electrostatic potential (MEP) were generated on PyMOL using the APBS , 74. An The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.ZZ drafted the paper and searched the literature, performed structural analyses, prepared figures, and edited and revised the manuscript. JZ did the literature search, edited and revised the manuscript, and helped prepare figures. JW put forward the hypothesis, conceptualized, supervised the execution of the work, and critically revised the manuscript. All authors contributed to the article and approved the submitted version.This work was supported by grants from the National Natural Science Foundation of China (91957124) and the Program of Shanghai Academic/Technology Research Leader (20XD1403200).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Bacteria in lake water bodies and sediments play crucial roles in various biogeochemical processes. In this study, we conducted a comprehensive analysis of bacterioplankton and sedimentary bacteria community composition and assembly processes across multiple seasons in 18 outdoor mesocosms exposed to three temperature scenarios. Our findings reveal that warming and seasonal changes play a vital role in shaping microbial diversity, species interactions, and community assembly disparities in water and sediment ecosystems. We observed that the bacterioplankton networks were more fragile, potentially making them susceptible to disturbances, whereas sedimentary bacteria exhibited increased stability. Constant warming and heatwaves had contrasting effects: heatwaves increased stability in both planktonic and sedimentary bacteria communities, but planktonic bacterial networks became more fragile under constant warming. Regarding bacterial assembly, stochastic processes primarily influenced the composition of planktonic and sedimentary bacteria. Constant warming intensified the stochasticity of bacterioplankton year-round, while heatwaves caused a slight shift from stochastic to deterministic in spring and autumn. In contrast, sedimentary bacteria assembly is mainly dominated by drift and remained unaffected by warming. Our study enhances our understanding of how bacterioplankton and sedimentary bacteria communities respond to global warming across multiple seasons, shedding light on the complex dynamics of microbial ecosystems in lakes. With continued warming this century, extreme weather events, such as heatwaves and large temperature fluctuations, are projected to become more frequent ,2. OngoiAquatic microbial communities are highly dynamic and continually change in response to seasonal environmental variables  ,7. The cThe water column and sediment are two distinct lacustrine habitats , which iHow climate warming will affect microbial communities is a matter of debate ,32,33,34Based on the above findings, we aimed to investigate (1) how planktonic and sedimentary bacterial communities respond to different warming scenarios, (2) what the seasonal differences in the response of bacterial communities to warming, and (3) which ecological processes mediate the bacterial assembly in water and sediment. We tested the community structure, co-occurrence patterns, and assembly mechanisms of the sedimentary and planktonic bacterial communities in the 18 mesocosms and showed the temporal changes in the community. The effects of stochastic and deterministic processes on the bacterial community were elucidated, and their drivers were identified. At the same time, co-occurrence networks were used to explore how ecological processes affect putative interactions between taxa. The results may provide helpful information for better understanding and predicting the response of lacustrine lakes in a warming future.The mesocosms used in our experiment are situated at the Huazhong Agricultural University in Wuhan City, Central China . The experimental design of this study has been described previously ,42 and wWe conducted a long-term and multi-seasonal study using 18 outdoor mesocosms with the aim of investigating the microbial communities\u2019 long-term adaptation and evolutionary processes in water and sediments. These mesocosms simulate shallow lake systems under three temperature scenarios with six replicates: (1) control ; (2) constant warming  according to the IPCC climate scenario RCP8.5 ; and (3)43\u2212-P concentration using the molybdenum blue method [4+-N concentration in filtered water was determined using Nessler\u2019s reagent colorimetric method [3\u2212-N was determined using spectrophotometric microdetermination method employing chromotropic acid reagent [Water samples were collected from each tank every 2 weeks in winter and every week in the other seasons using a Plexiglas tube . Total nitrogen (TN) and total phosphorus (TP) were determined by spectrophotometry  after digestion with alkaline potassium persulfate . Water we method , NH4+-N c method , and NO3 reagent ,46. Chlo reagent . Dissolv4+-N, NO3\u2212-N, NO2\u2212-N, TP, and inorganic phosphorus (IP) [4+-N, NO3\u2212-N, and NO2\u2212-N levels was achieved utilizing precise spectrophotometric techniques in accordance with the potassium chloride processing protocol (HJ 634-2012). Furthermore, the determination of IP was conducted using the sodium hydrogen carbonate solution\u2013Mo\u2013Sb anti spectrophotometric method (HJ 704-2014), ensuring the robustness and accuracy of the analytical procedures.Sediment samples were simultaneously collected alongside water samples and subjected to rigorous analysis using established methodologies. Upon collection, fresh samples underwent meticulous thawing, homogenization, and subsequent processing to quantify critical parameters, including TN, NHrus (IP) . The detBacterioplankton and sediment microbial samples were collected quarterly throughout the year . To obtain these samples, 100 mL of water from each tank was filtered through a 0.22 \u03bcm white polycarbonate membrane. The filtered water was subsequently preserved at \u221280 \u00b0C until DNA extraction. Likewise, the sediment microbial samples were also stored at \u221280 \u00b0C until DNA extraction.\u00ae DNA Isolation Kit  according to the manufacturer\u2019s protocols. The barcoded primer sets 338F (5\u2019-ACTCCTACGGGAGGCAGCAG-3\u2019) and 806R (5\u2019-GGACTACHVGGGTWTCTAAT-3\u2019) [Water and sediment samples for molecular analysis were stored in a freezer at \u221280 \u00b0C prior to use. Genomic DNA from water and sediment samples was extracted and purified using the MOBIO PowerWaterTAAT-3\u2019)  were useAmplicons were extracted from 2% agarose gels and purified using the AxyPrep DNA Gel Extraction Kit  according to the manufacturer\u2019s instructions and quantified using QuantiFluor\u2122-ST . Purified amplicons were pooled in equimolar amounts and sent for paired-end sequencing on an Illumina Miseq PE300 platform .Raw reads were trimmed using Trimmomatic (version 0.38) and Flash (version 1.2.11) to remove those of low quality (<20) and short length <50 bp). Briefly, the raw reads were combined, denoised, trimmed, quality-filtered, and aligned  to the S bp. Briep < 0.05 were accepted for network analysis [p-values were corrected for a false discovery rate (FDR) of 0.05 using the Benjamini\u2013Hochberg method [The total datasets were divided into two subgroups: water and sediment samples, which were analyzed individually. Network analysis was performed at the microbiome OTU level, and OTUs with total relative abundance > 0.1% were selected to reduce computational complexity and ensure the reliability of the constructed network . Only Spanalysis ,53. Corrg method . The resg method  and thenInterspecific phylogenetic distances were calculated using the maximum likelihood method in MEGA 7 ,57. To ip < 0.05  was considered significant for all statistical tests unless otherwise stated. Box plots, bar plots, and heatmaps were generated using R version 4.3.0 with the vegan, linkET, and ggplot2 packages [Alpha diversity was calculated using Mothur (version 1.30.2), and Bray\u2013Curtis was calculated from the relative abundances of OTUs using Fast Tree and UniFrac . Permutapackages .Water temperature in the mesocosms for the duration of the experiment followed the desired experimental design . In the 4+-N levels. During spring, summer, and autumn, warming led to elevated conductivity and TN levels, while winter experienced adverse effects. Furthermore, warming was associated with higher concentrations of both Chl-a and NH4+-N in the water column, with the impact being more significant in heatwaves  throughout the experimental period (March 2018\u2013February 2019) . It was eatwaves . Warmingh NO3\u2212-N .In this dynamic environment, we comprehensively analyzed microbial community composition using sequencing amplicon libraries. A total of 3,090,859 high-quality sequences were obtained from 72 water samples, while 2,603,551 high-quality sequences were obtained from 71 sediment samples. To account for the difference in sequencing depth, the planktonic and sedimentary bacterial sequences were normalized to 32,139 and 23,770, respectively, based on the minimum sequence number. Through clustering at a 97% sequence similarity level, we identified 4735 OTUs for the bacterioplankton and 12,825 OTUs for the sedimentary bacterial community. The rarefaction curves of water and sediment samples reached a plateau, indicating that the sequencing depth was sufficient and accurate .p = 0.037), Aminicenantes (p = 0.030), and Latescibacteria (p = 0.023) significantly changed in the heatwave mesocosms, while the constant warming (T) mesocosms did not differ from the ambient mesocosms , Actinobacteria (21.01% in water vs. 1.84% in sediments), Chloroflexi (1.15% in water vs. 30.67% in sediments), Firmicutes (0.44% in water vs. 23.01% in sediments), and Acidobacteria (0.30% in water vs. 8.48% in sediments) were significantly abundant in both water and sediments A. The imesocosms .2\u2212-N, TP, and IP contents in sediment.Dissimilarity tests confirmed significant differences between water and sediment communities, highlighting the distinct composition and structure of these microbial communities . We obsep > 0.05, Wilcoxon test). However, we did observe notable differences in richness during spring between the ambient temperature group (C) and the heatwave group (H) of sedimentary bacteria. During winter, significant differences emerged in both diversity and richness between these two groups (p < 0.05)  and diversity (Shannon index) . The ric < 0.05) .p < 0.001) from spring to autumn, followed by a decrease in winter (p < 0.001). In contrast, the richness and diversity of sedimentary bacteria exhibited distinct patterns, with changes becoming apparent from autumn onwards across all three temperature scenarios. Notably, the constant warming group exhibited a more pronounced alteration in richness and diversity compared to the other groups. During spring, the constant warming group showed relatively lower richness and diversity compared to the control and heatwave groups. However, as the season transitioned to winter, both the constant warming and heatwave groups displayed higher richness and diversity than the control group  in different habitats A. Most sFor the benthic bacterial community, stochasticity emerged as the dominant ecological process, accounting for 85.71% to 100% of community turnover. This suggests that stochastic processes had a more significant influence on the assembly of this community. In fact, the undominated process (drift) accounted for 100%, indicating that no other ecological process played a more important role in driving the assembly of bacterial communities in sediment samples. On the other hand, the water community showed a relatively lower proportion of stochasticity (ranging from 46.67% to 100%), indicating that determinism played a relatively more substantial role in driving community assembly. These results revealed that the undominated stochastic process dominated the sediment communities. In contrast, homogenizing dispersal and homogeneous selection exerted a relatively greater influence on the water communities, leading to an increased similarity in planktonic bacterial communities over the course of the year.The impact of warming on bacterial communities in the water column was apparent in the one-year study. However, sedimentary bacterial communities exhibited greater stability. In terms of seasonal variations throughout the year, both the ambient temperature group and the constant warming group exhibited a general trend of increasing importance of deterministic processes from spring to winter. Additionally, constant warming led to an increase in the proportion of stochastic processes throughout the entire year. However, the effects of heatwave on community assembly appeared to be more complex; it shows a decrease in deterministic processes in summer and an increase in autumn and winter B.p = 0.001), DO , NH4+-N , TN , TP , and Chl-a  exhibited significant positive associations with the community structure. Moreover, sediment parameters such as TN , NO2\u2212-N , and IP  levels demonstrated significant positive correlations with \u03b2NTI.Overall, the analysis revealed distinct mechanisms governing the assembly of microbial communities in water and sediment communities, highlighting the context-dependent nature of these processes. To further understand the drivers of community dissimilarities, we examined the correlations between \u03b2NTI and environmental variables using Mantel tests . The resIn this study, we conducted a comparative analysis of microbial interactions and community assembly mechanisms within mesocosms, focusing on water and sediment environments under various scenarios. Our results demonstrated the following: (1) bacterial communities in sediment exhibited higher levels of diversity, richness, stability, and phylogenetic clustering in comparison to the water body; (2) the dominant influence shaping both water and sediment communities was stochasticity, although determinism had a stronger influence in the water environment; and (3) constant warming increases the randomness of assembly among planktonic bacteria, whereas heatwaves present significant seasonal variations in this process.Habitat differentiation likely contributed to differences in microbial community structure and assembly between lake water and sediments, and exploring the underlying ecological processes may be helpful in explaining these differences ,67,68. CMicrobial correlation networks offer critical insights into the emergent properties of microbial communities. Our results, as depicted in Phylogenetic null modeling analyses have suggested that stochastic assembly processes dominate in high-diversity communities . ConsistWe find that the proportion of stochastic processes in sediments was higher compared to the water body. In sedimentary bacteria, drift dominates, while in planktonic bacteria, the random processes are jointly dominated by drift and homogenizing dispersal. Drift refers to the random changes in the relative abundance of different species due to random births, deaths, and reproduction events. Homogenizing dispersal, on the other hand, refers to the movement of organisms between different habitats, leading to a more uniform distribution of species across habitats . PlanktoIn this study, it was found that the proportion of different assembly processes in the assembly of planktonic bacteria varies greatly. Mantel tests showed that a suite of environmental variables had a positive association with water community assembly . TemperaWe find that seasonal variations had a more pronounced influence on microbial diversity and community composition in both water and sediment compared to temperature treatments, indicating the robustness of yearly rhythms in microbial communities. Seasonality plays a crucial role in shaping the temporal patterns of bacterial community composition in natural environments ,85. In nHomogenizing dispersal typically manifests in communities inhabiting relatively stable and small environments . In our In this experiment, we observed that both warming scenarios enhance sedimentary microbial network complexity and stability. Molecular ecological networks under warming became significantly more robust, with network stability strongly correlated with network complexity, supporting the central ecological belief that complexity begets stability . However3\u2212-N, and NH4+-N. Aminicenantes are involved in processes such as ammonia oxidation and denitrification, leading to notable fluctuations in their abundance during cold seasons.Heatwaves were found to stimulate an increase in bacterial abundance, and this effect was more pronounced in sediment . The ricIn contrast, we did not observe differences in sediment bacterial community assembly patterns between seasons and warming scenarios. This can be attributed to the nature of the sediment habitat. The more clustered network structure and stronger species connections in sediments could enhance resource and information transfer efficiency, resulting in high stability of community function. Sedimentary bacterial communities are known to be more persistent and have limited effects on planktonic bacteria in the water column of long-term stable ecosystems, primarily due to the habitat-specific bacterial community compositions ,103,104.In this year-long study, we investigated the effects of constant warming and heatwaves on bacterial communities in water bodies and sediment across all four seasons. Our findings reveal that warming scenarios significantly contribute to seasonal variations in community composition, but long-term warming is insufficient to overwhelm the influence of seasonal variation. Notably, we observed an increase in deterministic processes during specific seasons in the heatwave group compared to the ambient temperature group, signifying a shift toward more predictable assembly dynamics. This underscores the dynamic interplay between warming scenarios and seasonal influences on bacterial communities. However, constant warming led to an increase in the random process of planktonic bacterial communities across all seasons. Furthermore, we determined that planktonic bacterial assembly is primarily driven by homogenization, while sedimentary bacterial assembly is predominantly influenced by drift. This research advances our understanding of how climate change affects bacterial communities, providing insights into the intricate dynamics within aquatic ecosystems."}
+{"text": "Caulobacter crescentus. Unexpectedly, depletion of OpgH results in striking asymmetric bulging and cell lysis, accompanied by misregulation of cell wall insertion and mislocalization of morphogenetic complexes. The enzymatic activity of OpgH is required for normal cell morphology as production of an OpgH mutant that disrupts a conserved glycosyltransferase motif phenocopies the depletion. Our data establish a surprising function for an OpgH homolog in morphogenesis and reveal an essential role of OpgH in maintaining proper cell morphology during normal growth and division in Caulobacter.Bacterial growth and division rely on intricate regulation of morphogenetic complexes to remodel the cell envelope without compromising envelope integrity. Significant progress has been made in recent years towards understanding the regulation of cell wall metabolic enzymes. However, other cell envelope components play a role in morphogenesis as well. Components required to maintain osmotic homeostasis are among these understudied envelope-associated enzymes that may contribute to cell morphology. A primary factor required to protect envelope integrity in low osmolarity environments is OpgH, the synthase of osmoregulated periplasmic glucans (OPGs). Here, we demonstrate that OpgH is essential in the \u03b1-proteobacterium  Caulobacter crescentus (hereafter Caulobacter), is well-established as a model for physiological adaptation in the face of changing environments. Originally classified as an aquatic oligotroph, there is now evidence that Caulobacter also inhabits soil environments . In tectants . Theorettectants . We rece glucose .E. coli, OpgH is necessary for OPG production . Also notably, Caulobacter opgH is annotated as essential , encoding a putative inner membrane-associated glucan glycosyltransferase, was essential in Caulobacter .This study was initiated through our interest in identifying essential components of the cell envelope that contribute to morphogenesis. Transposon sequencing indicated that  CCNA_0207, encodinditions . We theropgH expression (+OpgH), cells looked morphologically wild type (WT) in both the complex media peptone yeast extract (PYE) and in defined minimal media (M2G)  (Caulobacter in M2G (opgH from the vanillate-inducible promoter in the presence of native opgH did not impact cell growth (vanA::Pvan-opgH).When grown with vanillate to induce ia (M2G)  t=0. Witdensity)  and solidensity) . When Opdensity) . The bulr in M2G . In addir in M2G  and spotr in M2G  assays. We were surprised by the speed at which we began to see morphological defects from depleting OpgH. Notably, we saw morphological changes beginning around three hours of depletion, which is approximately two cell cycles in PYE. Typically, depletion of a protein requires growth to reduce the available pool of protein, and morphological changes require enzymatic remodeling of PG during growth and division. Since the morphological defects we observed occurred fairly quickly, we wondered whether the morphology change resulting from OpgH depletion required active cell growth. To test this, we depleted OpgH in the presence of sub-lethal concentrations of chloramphenicol to inhibit cell growth. Depleting OpgH in the absence of chloramphenicol yielded the expected asymmetric bulging and lysis, however, these phenotypes were suppressed in the presence of chloramphenicol . This suThe unique bulging phenotype of the depletion observed by eye motivated us to quantify the shape changes resulting from loss of OpgH. Using CellTool  to perfoCaulobacter to determine if the bulging consistently occurred at the same pole or was random. Every Caulobacter cell has a defined orientation, with a stalked pole and a swarmer pole, that can be visually tracked over the course of a few cell cycles. We performed timelapse microscopy of the OpgH-depleted cells in the absence of vanillate to observe depletion over the course of five hours. The most notable phenotypes are summarized in We were especially interested in the unique asymmetric bulging phenotype of OpgH-depleted cells. To investigate this asymmetry, we leveraged the inherent cell polarity of Caulobacter. HADA incorporated at the cell pole and/or broadly along the cell body in swarmer cells and then localized to mid-cell in stalked and pre-divisional cells  under the control of its native promoter. RodZ is an essential part of the elongasome complex and its localization corresponds to sites of PG synthesis . RodZ loSince RodZ\u2019s midcell localization is also dependent on FtsZ, we next assessed FtsZ localization in the OpgH depletion strain. FtsZ, the master regulator of the divisome, is an essential protein. FtsZ forms a dynamic scaffold, called the Z-ring, that directs assembly of the divisome to the future division site . When OpCaulobacter chromosome segregation machinery, forming a unipolar focus in swarmer cells, then becoming bipolar as the origin of replication is segregated. Bipolar MipZ inhibits FtsZ polymerization at the poles and directs Z-ring formation at midcell. MipZ-YFP localization in cells with OpgH was consistent with the previously reported unipolar to bipolar MipZ localization over the Caulobacter cell cycle  has an auxiliary role, as well, acting as a direct inhibitor of FtsZ that coordinates cell size with nutrient availability , we sought to compare the sequences and predicted structures of EcOpgH and CcOpgH to understand if CcOpgH may perform a similar moonlighting function to EcOpgH.OpgH has been best studied in ubstrate , 19. E. lability . SpecifiCaulobacter cells  and CcOpgH (AF-B8GX72-F1), with very high model confidence scores for the majority of residues in each , 21. We er cells  and the E. coli and the similarity between the predicted structures of E. coli and Caulobacter OpgH, we wondered if it has a similar enzymatic function in Caulobacter. We attempted to demonstrate a role for Caulobacter OpgH in producing OPGs using established methods for isolation and detection of E. coli OPGs  in Caulobacter OpgH)  , which aer OpgH) . MutatioCaulobacter OpgH D-X-D motif to an alanine (OpgHD247A) at the native opgH locus, but were unsuccessful. This initial observation suggested that the enzymatic activity of OpgH may be essential. We therefore investigated the phenotype of cells producing this variant protein by creating a strain harboring a native deletion of opgH, along with a vanillate-inducible copy of WT OpgH and a xylose-inducible copy of either WT opgH or the OpgHD247A variant. Depletion of both copies of OpgH resulted in the expected elongation and bulging phenotype, and expression of WT opgH yielded normal growth and morphology. However, production of OpgHD247A phenocopied depletion of OpgH    is unifong MreB) , 28, resng MreB) , 30.Caulobacter morphogenesis. The essentiality of Caulobacter OpgH and morphological defects associated with its loss provide an opportunity to elucidate the mechanism of action of OpgH and the OPG biosynthesis pathway. The previously studied OpgH homologs have all been nonessential, which limits the questions that we can ask. For instance, it is more challenging to study functional mutants in vivo or conduct genetic screens in an organism where OpgH is nonessential. Thus, this provides an appealing possibility for future work on Caulobacter OpgH, including avenues such as a mutagenesis screen to isolate novel mutants or a larger scale functional domain analysis study. We have already identified functional OpgH mutants that suppress the lethality of cell envelope stresses in a hypersensitive mutant  medium. Xylose and glucose were used at a concentration of 0.3% (w/v) and vanillate at 0.5 mM for induction/depletion experiments. Antibiotics used in liquid (solid) medium as are follows: gentamycin, 1 (5) \u03bcg/mL; kanamycin, 5 (25) \u03bcg/mL; spectinomycin, 25 (100) \u03bcg/mL. streptomycin was used at 5 \u03bcg/mL in solid medium. For growth curves, a Tecan Infinite M200 Pro plate reader measured absorbance every 30 minutes at OD600 of a 100 \u03bcL culture volume in a 96-well plate in biological triplicate with intermittent shaking. For spot dilutions, cells were grown to mid-log phase and diluted to an OD600 of 0.05. Cells were then serially diluted up to 10\u22126 and 5 \u03bcL of each dilution was spotted onto a PYE plate with indicated inducer and/or antibiotic. Plates were incubated at 30\u00b0C for 48 hours. Strains and plasmids used in this study are listed in opgH::\u0394opgH; vanA::Pvan-opgH), EG3770 , EG3790 , EG3808 , EG3828 , EG3787 , EG3957 , and EG3959 . For 500 mL of M2G plates, 465 mL of water and 7.5 g agar (1.5%) were autoclaved. Once cooled, 25 mL of 20X M2 salts, 500 \u03bcL of 500 mM MgSO4, 500 \u03bcL of 10 mM FeSO4 10 mM EDTA (Sigma F-0518), and 0.3% glucose were added. Additional antibiotics or media supplements for selection were added at this time. After initial strain construction, all strains were able to be grown in either M2G or PYE liquid media with appropriate inducers.We could not make the following strains in low osmolarity PYE media, so they were constructed in M2G minimal media: EG3421  oil Ph3 objective and Photometrics CoolSNAP HQMicrobeJ  using thMicrobeJ . Inducib600 of 0.3 in 4 mL and filtered through 0.22 \u03bcm nylon filters (Millipore GNWP04700). The cells were quenched by placing the filter upside down in a 60 mm dish containing 1.2 mL pre-chilled quenching solution (40:40:20 Acetonitrile:methanol:H2O + 0.5% formic acid) and incubated for 15 minutes at \u221220\u00b0C Cells were removed by pipetting the quenching solution over the filter, added to chilled bead beating tubes containing 50 mg of 0.1 mm glass beads, and neutralized with 100 \u03bcL 1.9M NH4HCO. Cells were lysed using a Qiagen Tissulyzer at 30Hz for 5 minutes. Samples were spun at 4\u00b0C for 5 minutes at 16,000 x g and transferred to pre-chilled tubes to remove debris.Metabolomic samples were prepared as described previously . BrieflyMetabolomics was performed at the Metabolomics Core Facility at Rutgers-Robert Wood Johnson Medical School. Analysis used a Q Exactive PLUS Hybrid Quadrupole-Orbitrap mass spectrometer (Thermo Fisher Scientific) using hydrophilic interaction chromatography. LC separation included the Dionex UltiMate 3000 UHPLC system (Thermo Fisher Scientific) with XBridge BEH amide column  and XP VanGuard Cartridge . LC gradients were as follows: solvent A ; solvent B ; solvent B percentages over time: 0 min, 100%: 3 min, 100%; 3.2 min, 90%; 6.2 min, 90%; 6.5 min, 80%; 10.5 min, 80%; 10.7 min, 70%; 13.5 min, 70%; 13.7 min, 45%; 16 min, 45%; 16.5 min, 100%. Flow rate was 300 \u03bcL/min and injection volume 5 \u03bcL and temperature maintained at 25\u00b0C. MS scans used negative ion mode, resolution of 70,000 at m/z 200, and an automatic gain control target of 3 \u00d7 10^6 and scan range of 72 to 1000. MAVEN software package was used to analyze metabolite data .Western blots were performed using standard lab procedures. Log phase cultures were lysed in SDS-PAGE loading buffer and boiled for 10 minutes. Equivalent OD units of cell lysate were loaded. Standard procedures were followed for SDS-PAGE and protein transfer to nitrocellulose membrane. Antibodies were used at the following concentrations: Primary antibodies used were Flag-M2 \u2013 1:1,000  and CdnL \u22121:2,500 . SecondaSupplement 1Supplemental Table 1.Polar metabolites in extracts from cells producing OpgH or depleted of OpgH for 5 h in M2G or PYE. Metabolites reduced at least two-fold during OpgH depletion in both media conditions are highlighted in red, those increased at least two-fold during OpgH depletion in both media conditions are highlighted in green.Supplement 2Supplemental Table 2.Strains and plasmids used in this study.Supplement 3"}
+{"text": "TSPO expression and its regulatory mechanisms in large in silico datasets and by performing direct bisulfite sequencing of the TSPO promotor. In glioblastoma tissue samples of our TSPO-PET imaging study cohort, we dissected the association of TSPO tracer enrichment and protein labeling with the expression of cell lineage markers by immunohistochemistry and fluorescence multiplex stains. Furthermore, we identified relevant TSPO-associated signaling pathways by RNA sequencing.TSPO is a promising novel tracer target for positron-emission tomography (PET) imaging of brain tumors. However, due to the heterogeneity of cell populations that contribute to the TSPO-PET signal, imaging interpretation may be challenging. We therefore evaluated TSPO enrichment/expression in connection with its underlying histopathological and molecular features in gliomas. We analyzed TSPO expression is associated with prognostically unfavorable glioma phenotypes and that TSPO promotor hypermethylation is linked to IDH mutation. Careful histological analysis revealed that TSPO immunohistochemistry correlates with the TSPO-PET signal and that TSPO is expressed by diverse cell populations. While tumor core areas are the major contributor to the overall TSPO signal, TSPO signals in the tumor rim are mainly driven by CD68-positive microglia/macrophages. Molecularly, high TSPO expression marks prognostically unfavorable glioblastoma cell subpopulations characterized by an enrichment of mesenchymal gene sets and higher amounts of tumor-associated macrophages.We found that In conclusion, our study improves the understanding of TSPO as an imaging marker in gliomas by unveiling IDH-dependent differences in TSPO expression/regulation, regional heterogeneity of the TSPO PET signal and functional implications of TSPO in terms of tumor immune cell interactions.The online version contains supplementary material available at 10.1186/s40478-023-01651-5. Adult-type diffuse gliomas are the most frequent malignant brain tumors  and diagIDH mutations are commonly associated with a genome-wide hypermethylation phenotype GE180 were injected intravenously. Summation scans 60 to 80\u00a0min post injection were used for image analysis. For amino acid PET, approximately 180 MBq [18F]FET were injected and 40\u00a0min post injection summation images were analyzed as described previously [18F]GE180 and FET uptake at the exact localization of the acquired tissue specimen were retrospectively measured by fusing the intraoperative CT or intraoperatively acquired navigation points with the PET images using a Hermes workstation . Standard histological and molecular assessment for diagnostic purposes was performed at the Center for Neuropathology and Prion Research LMU Munich according to WHO criteria as described above. Formalin-fixed and paraffin-embedded (FFPE) tissues from all 26 patients with IDH-wildtype GBM (18 newly diagnosed and 8 recurrent tumors) were used for further immunohistochemical analyses in Regensburg and assessment of tumor cell content within the framework of this study. The tumor cell content of each specimen was evaluated histologically at the Department of Neuropathology at Regensburg University Hospital using H&E stains and classified into one of four categories by the following histologic criteria: \u201cno tumor\u201d, characterized by cortex and white matter with no visible tumor cells; \u201csome tumor\u201d, characterized by cortex and satellitoses or only sporadic infiltrating tumor cells; \u201cinfiltration zone\u201d, characterized by a low tumor cell content intermixed with non-neoplastic tissue; \u201csolid tumor\u201d, characterized by a tumor cell content of at least 70\u201380%. For whole transcriptome analyses (bulk RNA-Seq), fresh-frozen tumor tissue from a subset of 18 patients with IDH-wildtype GBM was available (Suppl. Table\u00a03).We used 26 IDH-wildtype GBM (biopsies/resections) from our FOR2858  TSPO-PET imaging study (Suppl. Table\u00a02) GE180 was first used by Albert and colleagues for TSPO-PET imaging of untreated and pretreated GBM and showed remarkably high tumor-to-background contrast and TSPO-PET signal even in areas without contrast-enhancement on MRI [18\u00a0F]GE180 TSPO imaging protocol. First, we successfully showed that the TSPO-PET signal correlates with TSPO expression as detected by immunohistochemistry with a thoroughly validated antibody. Secondly, our results revealed that the TSPO signal originates from multiple cellular sources, including tumor cells, reactive astrocytes, microglia/ macrophages and endothelial cells. Assessment of the regional heterogeneity of TSPO revealed that solid tumor-cell-rich areas are the major contributors to the overall TSPO signal. Tumor-adjacent areas show a lower TSPO enrichment/expression. Of note, in these regions the TSPO signal is mainly driven by CD68-positive microglia/macrophages.The current literature on TSPO as an imaging marker (for review see ) clearlyt on MRI . This stt on MRI . We now 18\u00a0F]DPA-714 imaging tracer and a different spectrum of tumors  so that the results may not be entirely comparable. Zinnhardt and colleagues found a strong relationship between [18\u00a0F]DPA-714 uptake and activation of glioma-associated myeloid cells. TSPO expression was mainly restricted to tumor-infiltrating HLA-DR+ myeloid-derived suppressor cells (MDSCs) and TAMs. These findings match our observations in the tumor-infiltration zone. However, we additionally describe a relevant degree of intratumoral heterogeneity with higher TSPO expression in the solid tumor core that is characterized by the highest tumor cell content. It appears indeed very likely that in our patient cohort there is a stronger contribution of tumor cells to the overall TSPO signal, as GBM/IDH-wildtype gliomas (as outlined above) have an unmethylated TSPO promotor and overall higher TSPO expression levels than the IDH-mutant gliomas studied in the Zinnhardt paper GE180-PET and [18\u00a0F]FET-PET within a maximum of 18 and a median of 3 days before the operation. MRI included gadolinium enhanced T1- (1\u00a0mm slices) and T2\u2010weighted scans (2\u00a0mm slices). For [18\u00a0F]GE180-PET, approximately 180 MBq [18\u00a0F]GE180 were injected intravenously and summation scans 60\u201380\u00a0min post injection were used for image analysis. For [18\u00a0F]FET-PET, approximately 180 MBq [18\u00a0F]FET were injected and 40\u00a0min post injection summation images were analyzed as described previously [18\u00a0F] GE180 and FET uptake at the exact localization of the acquired tissue specimen were retrospectively measured by fusing the intraoperative CT or intraoperatively acquired navigation points with the PET images using a Hermes workstation .eviously . Areas oSupplementary Fig.\u00a02 TSPO promotor methylation across the entire TSPO gene locus and across GBM methylation subtypes. Overview of the methylation distribution per probe covering the entire TSPO gene locus (n\u2009=\u200915) in TCGA-GBM and TCGA-LGG gliomas (a). Further analyses of TSPO mRNA expression (RPKM) and methylation  in TCGA-GBM and TCGA-LGG in silico data sets (b-d). TSPO expression was analyzed based on reported GBM methylation subtypes . There were no significant TSPO expression difference between the GBM methylation subtypes (Post hoc Games Howell test) (b). Analysis of TSPO methylation at probe cg00343092 based on GBM methylation subtypes showed a significantly higher TSPO methylation in RTK II compared to MES gliomas . Nevertheless, most beta values were below the 0.5 threshold (c). Spearman rho correlation of matched values does not show an inverse correlation between TSPO methylation (probe cg00343092) and TSPO mRNA expression in any of the different GBM methylation subtypes (d). Significances are displayed as follows: p\u2009>\u20090.05\u2009=\u2009n.s., p\u2009<\u20090.05 = *, p\u2009<\u20090.01 = **, p\u2009<\u20090.001 = ***. CpG: 5\u2019-C-phosphate-G-3\u2019, IDH: isocitrate dehydrogenase, IDH-wt: IDH-wildtype, IDH-mut: IDH-mutant, GBM: glioblastoma, LGG: low-grade glioma, MES: mesenchymal methylation pattern, RPKM: reads per kilobase per million, RTK I: receptor thyrosine kinase I methylation pattern, RTK II: receptor thyrosine kinase II methylation pattern, TCGA: The Cancer Genome Atlas.Supplementary Fig.\u00a03 TSPO antibody validation showed a specific staining pattern with no unspecific binding. Western blot analysis with an anti-TSPO [EPR 5384] and a polyclonal control in two transient TSPO-knockdown (+) glioma cell models (U87\u2009+\u2009U251MG) vs. a scrRNA control (-) showing a signal decrease in the TSPO-knockdown sample (+) and only one band at the expected TSPO height (18\u00a0kDa) when using anti-TSPO [EPR 5384]. Another polyclonal anti-TSPO antibody showed unspecific staining pattern and was not used further (a). Western blot signal of an antibody epitope blocking experiment in two scrRNA-transfected glioma cell models (U87\u2009+\u2009U251MG) vanishes completely when the antibody epitope binding site is blocked (b). Western blot of anti-TSPO [EPR 5384] in 4 GBM lysates demonstrates specific binding patterns in all samples (c). TSPO-IHC shows a very strong TSPO labeling in a TSPO-wildtype control while two TSPO-knockout C20 microglia cell models (B11\u2009+\u2009D9) had no detectable TSPO staining (d). Antibody epitope blocking experiment: TSPO-IHC of in the infiltration zone of an anaplastic astrocytoma shows no antibody binding when epitope binding site is blocked, (e). GBM: glioblastoma, IHC: immunohistochemistry, L: ladder, scrRNA: scrambled RNA, siRNA: small interfering RNA pool.Supplementary Fig.\u00a04 TSPO-/FET-PET and MRI enrichment of a TSPO-low and a TSPO-high IDH-wildtype glioblastoma. TSPO-PET overview images of a TSPO-PET low GBM case (GBM_20) (a) and a TSPO-PET high GBM case (GBM_10) (b). Corresponding FET-PET overview images of a TSPO-low GBM case (c) and a TSPO-high GBM case (d). Corresponding MRI overview images of a TSPO-low GBM case (e) and a TSPO-high GBM case (f). Corresponding full H&E staining (400x) of a TSPO-low GBM case (g) and a TSPO-high GBM case (h). Corresponding full TSPO-IHC (400x) of a TSPO-low GBM case (i) and a TSPO-high GBM case (j). FET: F-18-fluorethyltyrosin, GBM: glioblastoma, MRI: magnetic resonance imaging, PET: positron-emission tomography.Supplementary Fig.\u00a05 TSPO group split criteria for RNA sequencing analysis of glioblastoma patients. Normalized TSPO mRNA counts  correlate with TSPO protein expression  (a). IDH-wt GBMs were grouped together by median split  in a TSPO-low (9 TSPO LOW) and a TSPO-high (9 TSPO HIGH) group for analysis of differentially expressed genes (b). GBM: glioblastoma, IDH: isocitrate dehydrogenase, IDH-wt: IDH-wildtype, IHC: immunohistochemistry, RNA-Seq: RNA sequencing.Supplementary Fig.\u00a06 High TSPO expression in glioblastoma indicates the prognostic unfavorable mesenchymal subtype. Enrichment of mesenchymal signature genes [TSPO-high group (marked red) and not in the TSPO-low group (marked blue cases) (a). When splitting the TSPO-high group further into a TSPO HIGH II and TSPO HIGH III cluster, significant higher TSPO expression levels were found in the TSPO HIGH III cluster (b). Spearman rho gene-to gene correlation in patients with IDH-wt GBM  showed significant associations between TSPO and STAT3 , TSPO and OSM , TSPO and CD44 , and TSPO and OSMR  (c). TSPO single-cell mRNA expression levels (scRNA-Seq) displayed across reported cell type clusters . TSPO mRNA expression was observed in all these cell types (d). Significances are displayed as follows: p\u2009>\u20090.05\u2009=\u2009n.s., p\u2009<\u20090.05 = *, p\u2009<\u20090.01 = **, p\u2009<\u20090.001 = ***. CD44: cluster of differentiation 44, GBM: glioblastoma, IDH: isocitrate dehydrogenase, IDH-wt: IDH-wildtype, IHC: immunohistochemistry, OSM: oncostatin M, OSMR: oncostatin M receptor, scRNA-Seq: single-cell RNA sequencing, STAT3: signal transducer and activator of transcription 3, TPMs: transcripts per million.re genes  was founSupplementary Fig.\u00a07 Full H&E and IF images of the GBM cases from Fig.\u00a07e. Representative images of H&E staining and OPAL multiplex immune fluorescence staining (400x) showed a higher TSPO/CD68-positive cell portion in the TSPO HIGH III (GBM_25) case in comparison to TSPO HIGH II (GBM_11 II) and TSPO LOW I (GBM_17) cases. CD68: cluster of differentiation 68/ macrosialin, DAPI: 4\u2032,6-diamidino-2-phenylindole.Supplementary Fig.\u00a08 ETS1/2 expression in non-neoplastic and glioma tissue and correlation to TSPO expression. ETS1 and ETS2 mRNA expression  displayed across reported GBM sample types  (a) and reported LGG histological subtypes  (b). Substantial ETS1/2 mRNA expression levels were observed in GBM and low-grade gliomas, with ETS1 upregulation and ETS2 downregulation in GBM in comparison to non-neoplastic brain tissue (p\u2009<\u20090.05). In silico spearman rho gene-to gene correlation in 152 GBM samples  showed a weak association between TSPO and ETS2  (c), and no association between TSPO and ETS1 (data not shown). Spearman rho gene-to gene correlation in 18 patients with IDH-wt GBM  also showed a significant association between TSPO and ETS2  (d). Significances are displayed as follows: p\u2009>\u20090.05\u2009=\u2009n.s., p\u2009<\u20090.05 = *, p\u2009<\u20090.01 = **, p\u2009<\u20090.001 = ***. ETS1: ETS Proto-Oncogene 1 transcripton factor, ETS2: ETS Proto-Oncogene 2 transcription factor, GBM: glioblastoma, LGG: low-grade glioma, TCGA: The Cancer Genome Atlas, TPMs: transcripts per million, UALCAN: University of Alabama at Birmingham.Supplementary Material 9: Supplementary Table 1. Overview of TSPO promotor CpG island location  with transcription factor binding sites, direct bisulfite PCR methylation and qPCR results per tested sample.Supplementary Material 10: Supplementary Table 2. IDH-wt WHO grade 4 glioma study collective.Supplementary Material 11: Supplementary Table 3. Molecularly analyzed IDH-wt WHO grade 4 glioma study collective.Supplementary Material 12: Supplementary Table 4. Primer and PCR conditions for bisulfite PCR methylation analysis.Supplementary Material 13: Supplementary Table 5. Opal Multiplex IF staining parameter."}
+{"text": "N-alkylation of a NH pyrrolidine-fused chlorin with methyl 4-(bromomethyl) benzoate and subsequent ester hydrolysis as a straightforward strategy to obtain carboxylic acid functionality in the pyrrolidine-fused chlorin, as a single reaction product. We studied the reaction\u2019s scope by extending the N-alkylation of the free-base chlorin and its corresponding Zn(II) complex to other alkyl halides, including 1,4-diiodobutane, N-(2-bromoethyl)phthalimide, and 2-bromoethanaminium bromide. In addition, two new chlorin\u2013dansyl dyads were synthesized by reacting dansyl chloride with the 2-aminoethyl pyrrolidine-fused chlorin (dyad 6) and NH pyrrolidine-fused chlorin (dyad 7). According to spectral studies, the linker length between the two fluorophores influences the response of the dyads to the solvent polarity. Because of the simplicity of these approaches, we believe it will enable access to a vast library of custom-tailored N-functionalized chlorins while preserving their important absorption and emission spectra as photosensitizers in photodynamic therapy (PDT) of cancer and photodynamic inactivation (PDI) of microorganisms.In this work we pursued research involving the microwave-assisted  Photodynamic therapy (PDT) is a type of photochemotherapy approved for diagnosis and treatment of various diseases. The mechanism of action is based on the obliteration of cancerous and microbial cells by reactive oxygen species (ROS) generated by energy transfer from a light-activated photosensitizer (PS) into molecular oxygen. Among the studied PSs, chlorins  demonstrate outstanding potential for medicinal use, mainly due to their high phototoxicity, low dark toxicity, and strong absorption bands at ca. 650 nm, making them suitable for the diagnosis and therapy of deep-seated tumors . Photody\u00ae) +, consistent with the structure proposed for chlorin 3, which was obtained from a yield of 68% , and two triplets at 3.41 ppm (J = 7.3 Hz) and 3.94 ppm overlapped with the signal from one CH2-pyrrolidine resonance  to study the influence of the metal ion on the NH pyrrolidine\u2019s nucleophilicity. Under the conditions tested, a 74% chlorin Zn-3 yield was obtained with only one addition of a large excess (25 molar equiv.) of 1,4-diiodobutane phthalimide, aimed at the subsequent hydrolysis of the phthalimide group that functions as an amine protecting group. Thus, the use of N-(2-bromoethyl)phthalimide under a microwave-assisted heating protocol  afforded a chlorin 4 yield of 89%  with successive additions of methylamine , which afforded a 68% yield of chlorin 5  and 5 (bearing a primary amine) in a reaction with dansyl chloride, extending the family of chlorin derivatives to more complex ones. Dansyl  is an attractive fluorophore as it possesses a large Stokes shift and strong fluorescence and it can be easily combined with a wide range of amino-substituted derivatives yielding conjugates with improved photophysical properties + Calcd for C54H22F20N5O2+ 1152.1449, found 1152.1507.A solution of chlorin 2b  and anhydrous DMF (100 \u03bcL) were transferred into a 10 mL thick-walled glass tube equipped with a Teflon-coated magnetic stir bar. To this solution were then added 1-hydroxybenzotriazole monohydrate , N,N-diisopropylethylamine , 1-ethyl-3-(3\u2032-dimethylaminopropyl)carbodiimide hydrochloride , and aniline . The vessel was sealed with a silicone septum in a N2 atmosphere and placed in the cavity of the microwave reactor. The reaction mixture was then heated to 75 \u00b0C using a maximum microwave power of 100 W, which was automatically modulated for 20 min. The reaction mixture was washed with water once and the organic layer was extracted with ethyl acetate. The organic solvent was partially evaporated and the residue was chromatographed in a silica gel column using a mixture of toluene:ethyl acetate (7:3). The first eluted fraction was the activated ester, then chlorin 2c , then chlorin 2b. 1H NMR  \u03b4 (ppm): \u22121.80 , 2.66\u20132.73 , 3.03\u20133.12 , 3.51 , 5.19\u20135.23 , 7.16 , 7.37 , 7.59\u20137.66 , 7.67\u20137.75 , 8.38 , 8.49 , 8.72 . 13C NMR  \u03b4 (ppm): 29.9, 52.5, 60.7, 120.3, 124.0, 127.2, 128.2, 129.3, 132.5, 134.3, 135.4, 140.5, 152.9, 165.4, 169.0. HRMS (ESI) m/z: [M+H]+ Calcd for C60H27F20N6O+ 1227.1921, found 1227.2080.Chlorin 1 , DMF (3 mL) and DIPEA  were transferred into a 10 mL thick-walled glass tube equipped with a Teflon-coated magnetic stir bar. Immediately, 1,4-diiodobutane  was added to the resulting solution and the vessel was sealed with a silicone septum and placed into the microwave cavity. The reaction mixture was then heated to 75 \u00b0C using a maximum microwave power of 50 W, which was automatically modulated for 30 min. After this time, one more addition of 1,4-diiodobutane  was performed and the reaction followed the same procedure as described previously. The reaction mixture was then diluted with ethyl acetate and washed four times with deionized water, and the organic extract was dried (Na2SO4), filtered, and concentrated. The resulting residue was dissolved in CH2Cl2 and chromatographed (silica column) using a mixture of CH2Cl2/MeOH (98:2) to elute the starting chlorin 1 (~10%). The eluent was changed to CH2Cl2/MeOH (95:5) to elute chlorin 3. After crystallization from CH2Cl2/hexane, 40 mg were obtained (68% yield). 1H NMR  \u03b4 2.11  2.31 , 3.43 , 3.94 , 4.32\u20134.21 , 5.91 , 8.69 , 8.71 , 9.06 . 19F{1H} NMR  \u03b4 (ppm): \u2212164.93 , \u2212162.48 , \u2212155.42 , \u2212153.87 , \u2212140.77 , \u2212140.58 , \u2212140.04 , \u2212138.91 . 13C{1H} NMR  \u03b4 (ppm): 23.8, 23.9 (C-3\u2019 and C-4\u2019), 52.5 (C-2 and C-3-pyrrolidine), 64.4, 64.5 (C-2\u2019 and C3\u2019), 68.5 (C-21 and C-31), 98.1, 108.3, 115.9, 126.2, 130.3, 134.3, 137.1, 141.8, 155.0, 165.6. UV-Vis (DMF) max\u03bb (\u03b5) 401 (162 \u00d7 103); 500 (12 \u00d7 103); 527 (4 \u00d7 103); 595 (3 \u00d7 103); 647 (41 \u00d7 103) nm. Fluorescence (DMF) max\u03bb 651; 716 nm; \u03d5F = 0.333. MS (MALDI-TOF) m/z: [M]+ Calcd for C50H22F20N5+ 1072.155, found 1072.544.Chlorin Zn-1 , DMF (1 mL) and DIPEA  were transferred into a 10 mL thick-walled glass tube equipped with a Teflon-coated magnetic stir bar. Immediately, 1,4-diiodobutane  was added to the resulting solution and the vessel was sealed with a silicone septum and placed into the microwave cavity. The reaction mixture was then heated to 75 \u00b0C using a maximum microwave power of 50 W, which was automatically modulated for 30 min. The reaction mixture was then diluted with ethyl acetate and washed four times with deionized water. The organic extract was dried (Na2SO4), filtered, and concentrated. The resulting residue was dissolved in CH2Cl2 and purified by preparative thin-layer chromatography using ethyl acetate as the eluent. After crystallization from CH2Cl2/hexane, 12.6 mg of chlorin Zn-3 were obtained (68% yield). 1H NMR  \u03b4 (ppm): 1.96 , 2.16 , 3.40 , 3.74\u20133.82 , 4.04 , 5.67 , 8.42 , 8.66 , 8.84 . 19F{1H} NMR  \u03b4 (ppm): \u2212163.23 to \u2212162.97 , \u2212161.30 to \u2212161.09 , \u2212160.73 to \u2212160.52 , \u2212154.66 , \u2212153.75 , \u2212139.86 , \u2212139.03 , \u2212137.17 . UV-Vis (DMF) max\u03bb (\u03b5) 417 (200 \u00d7 103); 622 (34 \u00d7 103) nm. Fluorescence (DMF) max\u03bb 625; 675 nm; \u03d5F = 0.076.Chlorin 1 (94.2 \u03bcmol) and anhydrous DMF (150 \u03bcL) were transferred into a 10 mL thick-walled glass tube equipped with a Teflon-coated magnetic stir bar. To this solution was then added N-(2-bromoethyl)phthalimide  and K2CO3 . The vessel was sealed with a silicone septum and placed into the microwave cavity. The reaction mixture was then heated to 75 \u00b0C using a maximum microwave power of 50 W, which was automatically modulated for 30 min. After this time one more addition of N-(2-bromoethyl)phthalimide (165 \u03bcmol) and K2CO3 (204 \u03bcmol) was performed. The solution was again heated to 75 \u00b0C using the same microwave reactor parameters. The reaction mixture was washed several times with water, and the organic layer was extracted with ethyl acetate. The organic phase was concentrated and chromatographed in a silica gel column using a mixture of CH2Cl2:hexane (16:4). Chlorin 4 was isolated in 89% yield (100 mg). 1H NMR  \u03b4 (ppm): \u22121.90  2.54 , 2.64 , 3.31 , 3.58\u20133.67 , 5.09 , 7.17\u20137.28 , 8.40 , 8.50 , 8.71 . 13C{1H} NMR  \u03b4 (ppm): 36.4 (N-CH2CH2-Phth), 51.5 (N-CH2CH2-Phth), 52.6 (CH2-pyrrolidine), 60.3 (C-N-pyrrolidine), 97.1, 106.2, 122.7 (Ar-Phth), 124.1, 128.1, 131.7 (\u03b2-pyrrole), 132.4 (Ar-Phth), 133.5, 135.4, 140.5, 152.7, 168.1, 169.2. 19F{1H} NMR  \u03b4 (ppm): \u2212161.52 , \u2212160.58 , \u2212160.34 , \u2212151.77 , \u2212151.38 , \u2212137.82 , \u2212136.96 , \u2212135.44 . HRMS (ESI) m/z: [M+H]+ Calcd for C56H23F20N6O2+ 1191.1558; Found 1191.1513.Chlorin 1 , 1 mL of DMF, K2CO3  and 2-bromoethanaminium bromide  were placed in a 10 mL thick-walled glass tube equipped with a Teflon-coated magnetic stir bar. The vessel was sealed with a silicone septum and placed into the microwave reactor cavity. The reaction mixture was then heated to 75 \u00b0C using a maximum microwave power of 50 W, which was automatically modulated for 5 min. After this time, the solution was washed with a saturated solution of NaHCO3 and deionized water. The organic extract was dried (Na2SO4), filtered, concentrated, and purified by preparative TLC using CH2Cl2/MeOH (95:5) as an eluent system, isolating 14.2 mg of chlorin 5 (68% yield). 1H NMR  \u03b4 (ppm): \u22121.83 , 2.54 , 2.65 , 2.99 , 5.30\u20135.45 , 8.39 , 8.48 , 8.71 . 19F{1H} NMR  \u03b4 (ppm): \u2212161.70 to \u2212161.25 , \u2212160.83 , \u2212160.25 , \u2212151.73 , \u2212151.53 , \u2212137.65 , \u2212136.93 , \u2212135.81 . UV-Vis (DMF) max\u03bb (\u03b5) 405 (153 \u00d7 103); 503 (15 \u00d7 103); 597 (5 \u00d7 103); 650 (43 \u00d7 103) nm. Fluorescence (DMF) max\u03bb 655; 717 nm; \u03d5F = 0.147. HRMS (ESI) m/z: [M+H]+ Calcd for C48H21F20N6+ 1061.1503; Found 1061.1513.Chlorin 5  in acetone (2.5 mL) was transferred into a 10 mL thick-walled glass tube equipped with a Teflon-coated magnetic stir bar. In a separate vial, a solution of dansyl chloride  in acetone (2.5 mL) was prepared and K2CO3  was added. After thoroughly dissolving the dansyl chloride in the acetone solution, it was added to the chlorin 5 solution in the glass tube, sealed with a silicone septum, and placed into the microwave reactor cavity. The reaction mixture was then heated to 60 \u00b0C using a maximum microwave power of 30 W, which was automatically modulated for 5 min. After this time, the solution was diluted with 2.5 mL of dichloromethane and washed with deionized water and the organic extract was dried (Na2SO4), filtered, concentrated, and purified by silica gel column using CH2Cl2/MeOH (99:1) as the eluent, obtaining 31 mg of chlorin-dansyl 6 (80% yield). 1H NMR  \u03b4 (ppm): \u22121.83 , 2.29 , 2.44\u20132.48 , 2.85\u20132.90 2 + 2H, N-CH2-C2H-NHSO2-), 3.00\u20133.07 , 5.02 , 5.05\u20135.08 , 7.09 , 7.14\u20137.24 , 7.47 , 8.05 , 8.18 , 8.36 , 8.49 , 8.53 , 8.72 . 19F{1H} NMR  \u03b4 \u2212161.09 to \u2212162.02 , \u2212160.18 , \u2212159.78 , \u2212151.66 , \u2212150.72 , \u2212137.32 , \u2212136.76 to \u2212137.07 , \u2212135.44 ; 13C{1H} NMR  \u03b4 (ppm): 41.10 , 45.31 (dansyl-N(CH3)2), 52.34 , 53.30 (C2\u2032-N-CH2-CH2-NHSO2), 60.22 , 76.71, 77.02, 77.34, 96.74, 106.29, 115.00, 118.50, 123.02, 123.92, 127.90, 128.06, 129.59, 129.63, 129.89, 130.50, 132.45, 134.40, 135.31, 140.30, 152.06, 152.82, 168.35. UV-Vis (DMF) max\u03bb (\u03b5) 405 (144 \u00d7 103); 503 (13 \u00d7 103); 597 (4 \u00d7 103); 650 (37 \u00d7 103) nm. Fluorescence (DMF) \u03bbmax 655; 717 nm; \u03d5F = 0.188. HRMS (ESI) m/z: [M+H]+ Calcd for C60H32F20N7O2S+ 1294.201, Found 1294.192.A solution of chlorin 1  in acetone (2.5 mL) was transferred to a 10 mL thick-walled glass tube equipped with a Teflon-coated magnetic stir bar. In a separate vial, a solution of dansyl chloride  in acetone (2.5 mL) was prepared and K2CO3  was added. After thoroughly dissolving the dansyl chloride, the solution was added to the chlorin 1 solution, the glass tube was sealed with a silicone septum and placed into the microwave reactor cavity. The reaction mixture was then heated to 60 \u00b0C using a maximum microwave power of 30 W, which was automatically modulated for 5 min. After this time, the solution was diluted with dichloromethane (2.5 mL) and washed with deionized water and the organic extract was dried (Na2SO4), filtered, concentrated, and purified by silica gel column using CH2Cl2/acetone (98:2) as the eluent. Four mg of chlorin\u2212dansyl 7 (20% yield) were obtained. 1H NMR  \u03b4 (ppm): \u22122.15 , 2.20 2), 3.28 , 3.89\u20133.98 , 5.12\u20135.24 , 6.08 , 6.33 , 7.20 , 7.77 , 7.97 , 8.31 , 8.48 , 8.68 . 19F{1H} NMR  \u03b4 (ppm): \u2212161.48 to \u2212161.13 , \u2212159.33 , \u2212151.38 , \u2212150.00 , \u2212137.28 , \u2212137.12 to \u2212136.84  \u2212135.15 ; 13C{1H} NMR  \u03b4 (ppm): 44.73, 52.30, 54.09, 96.70, 114.15, 118.14, 122.48, 124.13, 127.33, 128.27, 129.25, 129.99, 130.50, 130.91, 131.31, 132.78, 135.43, 140.29, 151.00, 153.09, 166.76. UV-Vis (DMF) max\u03bb (\u03b5) 405 (132 \u00d7 103); 502 (11 \u00d7 103); 597 (4 \u00d7 103); 650 (35 \u00d7 103) nm. Fluorescence (DMF) \u03bbmax 655; 716 nm; \u03d5F = 0.123. HRMS (ESI) m/z: [M+H]+ Calcd for C58H27F20N6O2S+ 1251.159, Found 1251.161.A solution of chlorin N-substituted chlorins through microwave-assisted N-alkylation of a NH pyrrolidine-fused chlorin, within 5 to 30 min at 60\u201380 \u00b0C with yields between 20% and 89%. This approach proved to be of value in obtaining a chlorin bearing a benzoic acid function (chlorin 2b) that, as a proof of concept, was converted into amide 2c, therefore proving the accessibility of carboxylic acid in conjugation with nucleophiles. High yields were also observed when 1,4-diiodobutane, N-(2-bromoethyl)phthalimide and 2-bromoethanaminium bromide were used as alkylating agents, yielding chlorins 3\u20135. In addition, two new chlorin\u2013dansyl dyads (dyads 6 and 7) were successfully obtained by the reaction of chlorin 1 or 5 with dansyl chloride.In this work, we were able to obtain N-functionalization of NH pyrrolidine-fused chlorin leads to slight variations in fluorescence quantum yields, while the absorption and emission bands are maintained. Regarding dyads 6 and 7, their emission properties are dependent on the polarity of the solvent, being generally less emissive in methanol and acetonitrile.The photophysical results showed that the We believe this work will contribute to the existence of a wide library of biologically active chlorin\u2013biomolecule conjugates with the ultimate objective of enhancing PDT activity."}
+{"text": "The pipeline designed in this work is key to the developmentof other PAS inhibitors that not only inhibit the esterase actionof the enzyme but could also modulate the non-cholinergic functionsof AChE linked to the process of amylogenesis. Our studies showedthat 1 inhibits the enzyme not simply by blocking themain gate but by an allosteric mechanism. A detailed and careful analysisof the ligand binding position and the protein dynamics, particularlyregarding their secondary gates and active site, was necessary toconclude this. The same analysis was executed with an inactive analogue.Our first computational results showed no differences in affinityto AChE between both steroids, making further analysis necessary.This work highlights the variables to be considered and develops arefined methodology, for the successful design of new potent dual-actiondrugs for AD, particularly PAS inhibitors, an attractive strategyto combat AD.Alzheimer\u2019s disease (AD) is a progressive neurodegenerativedisorder that has no cure because its etiology is still unknown, andits main treatment is the administration of acetylcholinesterase (AChE)inhibitors. The study of the mechanism of action of this family ofcompounds is critical for the design of new more potent and specificinhibitors. In this work, we study the molecular basis of an uncompetitiveinhibitor (compound  The World Health Organizationhas stated that about 139 million people would be affected with ADby the year 2050 due to the increase in life expectancy. This goeshand in hand with the increasing mortality and morbidity rate of AD.2Alzheimer\u2019s disease (AD) is a neurodegenerativebrain disordercharacterized by a progressive memory loss, a decline in languageskills, and other cognitive dysfunctions.3The etiology of this disorder remains unclearbut there are differenthypotheses regarding its causes such as the cholinergic hypothesis,amyloid hypothesis, tau propagation hypothesis, mitochondrial cascadehypothesis, among others. However, as the understanding of this diseaseimproves, more potential targets are known for AD therapy\u2014differentreceptors, proteins , enzymes , oxidative imbalance, and RNA interference.4 The selective and irreversible deficiency ofcholinergic functions results in the memory impairment in AD, andthis is what the cholinergic hypothesis proposes.5 Enhancement of ACh concentration in the brain, which compensatesthe cholinergic neurotransmitter deficit by inhibition of its hydrolyticenzymes , has provided the first generationof drugs for the treatment of AD. Nowadays, three of the four drugsadministered for AD approved by the U.S. Food and Drug Administrationare acetylcholinesterase inhibitors (AChEIs).6 Enhancing the cholinergic transmission produces modest but statisticallysignificant improvements in the cognitive and global functions inmild to moderate AD.7Among all the physiopathologies in AD, lower levelsof the neurotransmitteracetylcholine (ACh) in the brains of patients are observed. ACh regulatesthe memory and learning process and the cognitive performance.8 It is reported that AD patients using cholinesteraseinhibitors showed a significant decrease of plaque formation12 and as a consequence, AChEIs have shown more promising results inthe treatment of AD than any other strategy explored.16Moreover, anothersignificant pathology observed during the diseaseis the abnormal plaque formation in the brain. These plaques are soluble\u03b2-amyloid oligomers or insoluble amyloid fibrils deposited inthe area of brain parenchyma and cerebral blood vessel walls.17 Moreover,since the latest anti-AD drug approved in 2003, more than 100 anti-ADdrug candidates have been rejected, many of them in advanced phases,due to efficacy or safety issues. This fact highlights that the ADdrug development has one of the highest attrition rates in all therapeuticareas.19 For this reason, the discovery and developmentof new drugs to treat this disease are highly of the paramount picture.The three FDA-approved AChEI have problems and limitations,suchas pharmacokinetic disadvantages and side effects due to the highdoses needed to be administrated.20 Among steroidal AChEI, most are alkaloids. Forexample, five potent steroidal alkaloids were isolated from the bulbsof Fritillaria walujewii and kineticstudies revealed that these are mixed-type inhibitors.21 A research group obtained three new steroidalalkaloids from the bark of Holarrhena pubescens with strong AChE inhibiting activity and IC50 valuesranging from 1.44 to 23.22 \u03bcM.22 RecentlyLiu and co-workers isolated a novel sterol with an unprecedented polycyclicring system from the mushroom of Tricholoma matsutake with a moderate inhibitory activity (IC50 = 20.9 \u03bcM).23There is a broad spectrum of AChEI obtained from natural productsor by synthesis. Among the natural ones, these are mostly alkaloidsisolated from plants, fungi, or marine organisms. Regarding the syntheticinhibitors, these are mainly synthetic derivatives or inspired bythe FDA commercial drugs and tacrine, or strong hybrid inhibitors.25 including the compound 2\u03b2,3\u03b1-dihydroxy-5\u03b1-cholestan-6-one disulfate .On the other hand, the desulfated analogue, 2 . To gain insight intothemechanism of action of 1, the active steroid 1 and inactive analogue 2 were studied by computationalmethods. Molecular docking studies were performed with the AChE crystalstructure, complexed with ACh based on previous kinetic evidence,24 which revealed that 1 is an uncompetitiveinhibitor of the enzyme, i.e., the compound binds reversibly to theenzyme\u2013substrate complex (AChE\u2013ACh), resulting in aloss of activity. The docking results indicate that both steroidsbind to the enzyme into the peripheral anionic site , penetrating the gorge with the aliphatic side chain. Therefore,the question arises as to why 1 is active while 2 is not. In this work, we present computer simulations thatallow us to understand the molecular mechanism of AChE inhibitionby these compounds. These simulations not only help to rationalizethe mechanism of inhibition of these compounds, but they could beapplied to other uncompetitive inhibitors that bind to the PAS orother allosteric inhibitors.In the search for AChE inhibitors andfollowing this line of work,different steroids with sulfate groups at the C-2 and C-3 positionswere synthesized,lfate 1, 1, the mo1 and AChE-2 complexes),a first simulation was achieved with the AChE\u2013ACh complex toverify protein stability and to determine if the enzyme undergoesstructural rearrangements. Protein backbone root-mean-square deviation(RMSD) from a 500 ns MD simulation revealed AChE stability from 15ns onward, with an average RMSD value of around 2.0 \u00c5 with respectto the X-ray structure . The alternating PAS closing and opening processes wereobserved, according to the \u201cbreathing motion\u201d describedfor the protein, which is necessary for a fast movement in/out ofthe active site by substrates and products.26 The distance between carbon CZ of Phe330 and the phenol oxygen ofTyr120, both residues in the bottleneck of the enzyme, evidenced thismovement, and it is represented in Figure S2 . The closed form is the favored conformation.28Prior to molecular dynamics(MD) simulations of the acetylcholinesterase-steroidcomplexes . The stability of the complex was monitored by RMSD ofthe protein backbone (1.6 \u00b1 0.3 \u00c5) and RMSD of heavy atomsin 1 .During this MD simulation (MD1),the steroid fitted into the gorge, within the enzyme PAS, and theanionic sulfated substituent located on C-3 interacts with the backboneamide groups of helix 13 , which causes the steroidto adopt its conformation within the binding site 2. The suFigure S5, Supplementary Materials). This A-ringmobility is explained by the increased volume of the pocket due tothe presence of the steroid  with water molecules and protein residues.Hydrophobic interactions are the main ones thatanchor the steroidwithin the enzyme and are denoted by the lesser RMSD of carbon atomsof rings C and D and side chain (3.4 \u00b1 0.6 \u00c5 from \u223c44ns onward) than the RMSD of ring A heavy atoms (including its substituents), by water-mediated hydrogen bonding. This rotationraised the RMSD of the ligand up to 6.9 \u00b1 0.4 \u00c5 at 400 nsand remained stable until the end of the simulation . Protein backbone RMSDwas stable along the simulation . Once again,no particular H-bond between the sulfate groups and the enzyme wasobserved.Another 500 ns MD simulation (MD2) was performedin order to increasesampling simulation time, starting from the docking conformation.MD2 revealed that at 400 ns, compound din MD1 4.MD2 aldin MD1 3 that ma1 in MD2 also presents a conformationof 5 kcal/mol more stabilized when the steroid rotates 180\u00b0 aroundits longitudinal axes and places the carbonyl group near the \u03a9-loop.Although the same hydrogen bonds are not observedduring MD1 andMD2, they are very similar as verified by the free binding energyof the ligands to the enzyme. The average values over the entire simulationwere 26.4 \u00b1 5.4 and 26.4 \u00b1 6.4 kcal/mol, respectively, forMD1 and MD2 5. During2 was docked into AChE and a similar conformation to the oneadopted by 1 was observed, even though 1 inhibits the protein but 2, does not. Two 500 ns MDsimulations of this complex were performed starting from the dockingconformation to check the stability of the enzyme\u2013inhibitorcomplex. Both simulations showed that the AChE-2 complexwas stable with a protein backbone RMSD of 2.4 \u00b1 0.3 \u00c5 (MD3)and 2.1 \u00b1 0.3 \u00c5 (MD4) and compound 2 RMSD of4.5 \u00b1 0.6 \u00c5 (MD3) and 2.8 \u00b1 0.5 \u00c5 (MD4) . This result,at first, was not expected according to the experimental results.Compound Figure S9, Supplementary Materials),while the C-2 hydroxyl group was exposed to the solvent , ring A of 2 adopted a twist boat conformationthat allows both hydroxyl groups to interact simultaneously with thecarboxylate group of Asp276 . In addition, the hydroxylgroup on the C-2 atom of 2 was observed to interact withthese residues directly  or water-mediated.Consequently, the carbonyl group at the C-6 atom was able to interactwith the NH in the amide group of Arg289 .In the MD4 simulation, the steroid fitted intothe gorge in a similarmanner and remains in a conformation that allowed hydrogen bondinginteractions between the hydroxyl group on the C-3 carbon atom andthe carbonyl group of Leu282 or Phe284   . It is importantto highlight that MM/GBSA binding free energies for compounds 1 and 2 are not comparable since they have differentcharges.32Both MD simulations of AChE-2 had a stable conformationinto the PAS, our first hypothesis was that the enzyme may have itsalternative doors opened, explaining the observed activity of theenzyme.33 AChE has secondary gates thatallow the substrates/products to enter/leave the active site fromthe solvent bulk, explaining the high catalytic rate of AChE. Twoof these gates are the back door (BD) and the side door (SD), theirnames referring to their position from the main gorge .Transient doors opening were confirmed by tunnelsdetection duringthe MD trajectory. In order to detect these gates, two computationalmethods were used: MD Pocket2 complex are related to the presence of the steroid withinthe PAS,blocking the main entrance, most of the time. Furthermore, the presenceof compound 2 seemed to significantly modify the openingfrequency of the back door (BD). Caver analysis showed there is analternative pathway to the active site through the BD when compound 2 is inside the enzyme, allowing the ACh to move back andforth into the active site. This might explain the activity of theenzyme in the presence of inactive compound 2.The main differences observed in 2 complex; 2 is located at the PAS (MD4). Indeed, the catalytic triad residuescan be observed from the BD entrance, as depicted in Figure S19, Supplementary Materials). The molecular process underlyingthe opening involves the breaking of hydrogen bonds between residuesin the omega loop and residues between 427 and 432. The synchronybetween these events correlates with the moment when the BD openingis observed in Figure S20, Supplementary Materials).Additionally, the interaction between Gly80 (C=O) and Trp432(indole NH) is also disrupted . This rearrangement leads to Trp84 establishinga new hydrogen bond with the C=O backbone of Pro76 , and Trp432rearrangement allowed it to continue the hydrogen bond with the hydroxylgroup of Tyr442 . This stabilizes the new conformation of the protein withits BD open. These results are in accordance with those reported byBui et al.39 that showed an access to theactive site by \u03a9-loop movement in the presence of the PAS inhibitorFasciculin-2. Regarding the SD, the blockage of this gate is observeddue to the position of the side chain of the steroid 2 during MD3 and MD4 . A clear opening of the SD was observed several timesbut the side chain of compound 1, near the \u03a9-loop,blocked it. In accordance, nearly no tunnels connected the side doorwith the active site, as shown by the orange bars in However, thesetransient doors were also observed in the inhibited AChE-38 This finding demonstrates thepossibility of ACh to easily exit through the secondary doors.As shown in 1 complex (MD1). The MDpocket tool also supports the occurrenceof this transientdoor (BD) at the AChE-Although the active site is accessible from thebulk, the catalytictriad was not in a suitable conformation for effective base catalysis14, right1 at the PAS, there is enough space to connect the bulk with the activesite through the PAS. This reflected the PAS expansion observed in Regarding MD2, both secondarydoors remained mainly closed duringthe simulation 12b. Howe40 but the ACh radiusequals to 2.4 \u00c5,28 larger than mostaverage radii observed in the bottleneck radius distribution .In addition, it must be noted that the absence of a certain tunneldoes not necessarily point that the ACh cannot cross these gates.That is, it is the enzyme\u2019s flexibility that allows it to adaptto the presence of organic molecules larger than the probe used inCaver\u2019s study. In other words, the tunnel does not need tobe fully formed for the ligand to exit the protein. However, it isnecessary to calculate the energy related to the escape from the enzyme.Free energy profiles for the exit of the trimethylammonium (TMA),as a ligand model, were obtained using umbrella sampling simulations. Profiles were obtained for the threeexit pathways PAS, SD, and BD in the presence of compounds 1 and 2  and in agreement with the catalytic rate of the AChE.27The TMA escape-free energies associated to the proteincomplexedwith inactive compound  and PAS 12a,b, a 1 shows a low barrier, consistent with ACh leavingthe AChE through the BD in MD1. This observation led us to hypothesizethat activity of compound 1 is not based on the blockageof the pathways to the active site but inducing a change in the activesite conformation, rendering the enzyme inactive. This suggests thatcompound 1 would be an allosteric inhibitor. To testthis hypothesis, a comprehensive analysis of the conformation of theactive site was performed throughout MD simulations.Surprisingly, the pathway through BD inthe presence of activecompound \u2013) and His440 (NH\u03b4) and between Ser200 (\u2212OH) and His440(N\u03b5) were evaluated. The hydrogen bond between the carboxylategroup of Glu327 and the N\u03b4H of His440 would enhance the N\u03b5histidine basicity. As a consequence, hydrogen bonding between theN\u03b5 of His440 and the hydroxyl group of Ser200 leads to deprotonationof the catalytic serine, enhancing its nucleophilicity.41 For this reason, 16 MD simulations of 50 nseach were propagated for each complex , starting from the conformationsof compounds 1 and 2 obtained from the moleculardocking analysis. The results are summarized in 1 complex, the active site conformation ischanged in almost 70% of the simulations, i.e., \u223c30 and 25%more than that observed for AChE\u2013ACh and AChE-2, respectively. This study allows us to verify that the active-siteconformation is more sensitive to the presence of compound 1 than compound 2. Both AChE\u2013ACh and AChE-2 complexes have a similar behavior regarding the active siteconformation and the active site tended to conserve the catalytictriad conformation more than in the presence of compound 1.To analyze the allosterism,the hydrogen bond interactions between Glu327  maintained the optimal arrangement of the catalytictriad residues  or thereare low barriers to cross them  where thehigh hydrophobicity of these compounds stabilized the inhibitor\u2013enzymecomplexes, highlighting the hydrophobic interactions observed at theperipheral site.We propose that this allosterism is thekey feature that distinguishesthe inhibition activity of compound 42 Another example showedthat the AChE enzyme in the presence of the peptide ligand Fab410at the PAS modulated the opening of a secondary gate connecting theoutside of the enzyme to the active site, explaining the observedremaining activity.44 It was also shownthat the AChE\u2013Fasciculin complex presents a pathway to theactive site, by movement of the \u03a9-loop, which would explainthe remaining activity observed in the enzyme.39These results suggest that the mere presenceof ligands that bindand block the PAS does not guarantee that they inhibit the AChE catalyticactivity. There is evidence of ligands that exhibit affinity for AChEand occupy the PAS but without affecting its catalytic activity. Forexample, Barak et al. reported that a PAS inhibitor lost its inhibitoryactivity but with no loss of affinity when bound to the mutant enzymesW86A and Y133A.1 inhibits but also provides a methodologywhen screening compounds located at the PAS. Molecular docking isa helpful and a widely used tool in searching chemical libraries.It is frequent that the most promising compounds after a virtual screening are prone to synthesize or purchase with no further molecularmodeling analysis.46 This study highlights the importanceof long MD simulations of enzyme\u2013ligand complexes followingmolecular docking calculations, for those potential PAS inhibitors.Although the molecular docking indicates affinity toward the enzyme,it is essential to analyze not only the complex stability but alsothe conformation of the active site, in order to verify allosterism.Moreover, in those cases where the active site has the proper conformationand it is suspected that the ligand inhibits by obstruction of thePAS, analysis of the secondary doors opening plays a relevant role(open/close frequency and the energetic cost to cross them). Our caseevidences this problem: since every AChE-2 simulationshowed complex stability, along with other known polyhydroxylatedAChE inhibitors,49 this could lead to the erroneous conclusion thatthis compound may inhibit the enzyme. However, the careful analysisrevealed that inactive compound 2 seems to encouragesecondary doors of access to the enzyme\u2019s active site. Thismay not be a problem for catalytic anionic site (CAS) inhibitors ordual-site inhibitors since the active site is occupied, but PAS-ligandsshould be carefully examined before synthesis or purchase. Particularattention has been given to PAS inhibitors since AChE catalyzes theconformational change of the amyloid peptide (\u03b1-helix) to \u03b2-sheetsthrough the interaction of the peptide with part of the AChE PAS,accelerating the \u03b2-amyloid plaque formation.54 This leads to the design and development of dual-actingligands.55 This is the main advantage ofPAS inhibitors: they may modulate this non-cholinergic function ofAChE linked to the process of amylogenesis by interfering in the interactionwith amyloid \u03b2-peptide.56 Therefore,these inhibitors would not only reduce the cognitive symptoms butwould also reduce the formation of \u03b2-amyloid plaques linkedto synaptic dysfunction, inflammation, neuronal death, and, eventually,dementia.57This work not only brings to light the molecularbasis of the mechanismby which compound Torpedocalifornica AChE complexed with Xe, solved at 2.3\u00c5 resolution . The xe59 The systemswere immersed in an octahedral box of TIP3P water molecules60 using the tleap module. The minimum distancebetween protein and the boundary of the box was 10 \u00c5. All systemswere simulated employing periodic boundary conditions and Ewald sumsfor treating long-range electrostatic interactions.61 SHAKE was used to keep bonds involving hydrogen atoms attheir equilibrium length.62 This allowedus to employ a 2 fs time step for the integration of Newton\u2019sequations. The Amber 99 force field, General AMBER force field, andTIP3P implemented in AMBER were used to describe the protein, ligands,and water, respectively.63 The temperaturewas regulated with the Berendsen thermostat, and pressure with thebarostat, as implemented in AMBER. All systems were first optimizedto minimize any possible structural clashes. Subsequently, the systemswere heated slowly from 0 to 300 K using a time step of 0.002 ps,under constant volume conditions. Finally, a short simulation at aconstant temperature of 300 K and constant pressure of 1 bar was performedusing a time step of 0.002 ps, to allow the systems to reach a stabledensity. These equilibrated structures were the starting point forproduction MD simulations.All the MD simulations were performedwith AMBER 16 software package.64 (AmberTools18package). The threshold values (distances and angles) used for H-bondinteractions were a maximum distance of 2.5 \u00c5 from the hydrogenatom to the heteroatom and a minimum angle of 135\u00b0.During the MD analysis, hydrogenbond parameters were calculatedwith the auxiliar program CPPTRAJ38 The clustering threshold was set at a valueof 3.5 \u00c5 but, due to the closer positions of the doors, carefulanalysis of the tunnels presented in each snapshot was done to avoidtunnels overestimation or misallocated. For bottleneck average radiusdistribution, all tunnels were considered. The lowest bottleneck radiiare equal to the size of the probe (1.4 \u00c5). Other default parameterswere used as listed in the CAVER user guide version 3.0.The program CAVER 3.0 was chosenfor this analysis. Snapshots were taken at 1 ns intervals along theMD trajectories, generating a total number of 500 snapshots of thesystems for the tunnel analysis. The ACh was previously removed fromthe active site to find the tunnels. The probe was placed at the activesite of the enzyme. The radius for the probe was set as 1.4 \u00c5.N\u00b0 of Voronoi Vertices inside a cube (8 \u00c53) around each grid point in every snapshot. In addition, thisvalue was taken to calculate the pocket volumes.Theprogram MDpocket allows us to get pocket descriptors from the MD trajectory and the images of pocket occurrences. Proteinconformations  were subject to tunnel analysisfrom each MD simulation. All pockets represented in the figures havebeen delimited using a 0.32 isovalue. This unit is related to the 60 in orderto obtain the energy profiles for the exit of model compound TMA throughpathways PAS, SD, and BD. The umbrella sampling calculations wereperformed by fixing the distance between TMA and residue Gly441 from5.09 to 24.56 \u00c5, with an interval of 0.33 \u00c5 and a forceconstant of 5 kcal/(mol \u00c52). Results were analyzedand extra windows with intermediate values were added whenever necessary.Each window was simulated for 6 ns, and the last 5 ns were includedfor the energy calculation. The weighted histogram analysis method65 was used in order to construct the free energyprofiles. Independent calculations were run for the protein boundto compounds 1 and 2.Umbrella sampling calculationswere carried out using AMBER 16COO\u2212) and His440 (NH\u03b4)and between Ser200 (\u2212OH) and His440(N\u03b5) in each simulation. The thresholdvalues used for analyzing active site conformation were \u223c3.5and 2.5 \u00c5, respectively. Confirmation of active site rearrangementwas determined by clearly marked jump in the graphic .This analysiswas performed by plotting the distances between Glu327 ; where G is calculated as following:\u0394G = Ebind + Eelectrost + EvdW + Gpol + Gnp \u2013 TSwhere Ebind + Eelectrost + EvdW are the standard molecular mechanicsterms and Gpol and Gnp arethe polar and non-polar contributions to the solvation-free energies,respectively. Gpol is obtained using thegeneralized Born method, and Gnp is estimatedfrom the linear relationship with solvent-accessible surface area.Entropy\u2014computationally expensive to calculate\u2014, inthis case, was not calculated as similar entropy states were compared.66 part of the open source AmberTools package.The binding free energy of the enzyme\u2013ligand complex insolution was calculated along the MD simulation analyzing 25 snapshots/ns with the MMPBSA.py,"}
+{"text": "A total of four items were allocated in eating concern, with correlations ranging from 0.748 to 0.556. The internal consistency of the global and the three subscales were high, with Cronbach\u2019s \u03b1 ranging from 0.762 to 0.900. Findings of the current study suggest that the Arabic version of the EDE-Q-14 is a valid and reliable tool to screen for EDs among adults in Saudi Arabia.The prevalence of eating disorders (EDs) is growing, and early screening is important to prevent related health complications. The Eating Disorder Examination Questionnaire (EDE-Q) has been widely used as a diagnostic tool to identify cases of EDs; however, a validated Arabic version of the tool is needed to help in the screening process of EDs. The aim of this study was to validate the Arabic version of EDE-Q. A cross-sectional study included a sample of 549 adults, who were recruited mainly from the four major provinces in Saudi Arabia. A forward\u2013backward translation method was conducted, and then the tool was validated using the confirmatory factor analysis (CFA). The dataset was split for further convergent analysis using exploratory factor analysis (EFA) and CFA. The results of CFA from the main dataset did not support the four-factor original EDE-Q. The results of EFA from the first data-split suggested a three-factor EDE-Q-14 Arabic version. This was supported by the results of CFA of the second data-split. A total of five items were allocated in each  Eating Disorders (EDs) are mental health issues that can affect eating behaviors and body weight . Forms oEDs have a significant impact on health and contributes to high rates of mortality  and healRecent reports documented a steadily increasing prevalence of EDs in many countries ,24. TherStudies have shown that EDs may particularly occur in cultures experiencing rapid socioeconomic and cultural transitions ,32, whicIn Saudi Arabia, a number of research studies have been conducted to assess the prevalence of EDs and its related factors among young individuals using different ED screening tools ,43,44,45This cross-sectional study aimed to validate the Arabic EDE-Q among Saudi adults residing in the most populated provinces in Saudi Arabia ; participants living in all other 13 provinces were also invited. The EDE-Q was designed to be self-reported, and it was validated from the interview-based EDE (23). The EDE-Q consist of two types of data: frequency data as in term of number of episodes , and subscale scores as in term of severity of eating disorder  (28). The adapted EDE-Q has gone through forward\u2013backward translation process. Two native Arabic speakers, one expert in the field of nutritional assessment who is fluent in English and one with expertise in English translation, conducted the forth translation of EDE-Q from English to Arabic. An independent bilingual specialist in both Arabic and English has carried out the backward translation of the questionnaire. Another two expert researchers, who did not participate in the forward translation, have critically reviewed the backwards-translated questionnaire against the original version. The wording of the items was approved after minor grammatical changes made to the translated Arabic version.The translated Arabic version of the EDE-Q was pilot tested among 10 participants with equal proportions of males and females to ensure clarity of the items. The ages of the participants ranged from 18 to 60, with varied educational level ranging from high school to Ph.D level. For each item, a scale from 0 (not clear) to 1 (clear) with a comment box was introduced for the participants. There were a few comments suggesting minor changes in words and terms, and these were addressed accordingly, preserving the same meaning.The study was conducted between January 2021 and August 2022. Arabic-speaking adults residing in the aforementioned four major provinces were targeted in our study. The final version of the EDE-Q was distributed online through major universities\u2019 email portal and varied social media platforms. Participants who were adolescents or lived outside Saudi Arabia were excluded from this study. According to Monte Carlo sample size calculation method, a sample size of 200 has a high percentage of convergence for 10 variables and 3 factors . AccordiThe data was analyzed by using the Statistical Package for Social Sciences (SPSS) software version 23 and Amos structural equation modeling (SEM) version 26. Demographic data were illustrated in counts and percentages. The normality of the data was investigated by Kolmogrov\u2013Smirnov test. The homogeneity of variance was tested by Levene\u2019s test. Confirmatory factor analysis (CFA) with the maximum likelihood estimates was performed to test the original four-factor model of the EDE-Q for the main dataset and in each of the samples of four major provinces . The comparative fit index (CFI) and Tucker\u2013Lewis index  were indices in addition to the root mean square error of approximation  ,47. DataThe final Arabic version of the EDE-Q has reached to 626 participants. After data cleaning, 549 participants completed the questionnaire with an 88% response rate. All completed questionnaires were included in the analysis. The majority of participants were Saudis (95.4%), females (83.6%), and single (70.3%), while over two-thirds of the participants were holding a bachelor\u2019s degree (67.9%), After 100,000 iterations with a minimum of 15 achieved, CFA for Saudi adults as whole and in each four major provinces failed to converge to the original four-factor model of EDE-Q. In all samples, CFI/TLI < 0.90 and RMSEA > 0.10 suggested poor fit, p < 0.001. The correlations among the three-factor model are reported in p-value > 0.001. In addition, positive slight to moderate correlations were found between BMI and both restraint and eating concerns, ranging from 0.158 to 0.341, with p-value > 0.01. According to cross-tabulation results, no associations were found among participants socio-demographics and their scores of EDE-Q14 Arabic version except their speciality, Fourteen out of twenty-two items of the EDE-Q were allocated into three subscales by performing exploratory factor analysis (EFA) on first half split of dataset (n = 275) with the extraction method Principal Axis Factoring (PCA) and the rotation method Oblimin with Kaiser\u2013Meyer\u2013Olkin (KMO). A total of 5 five were allocated in shape and weight concern components with correlations ranging from 0.969 to 0.462 and Eigenvalues equal to 6.211. The other items were allocated in restraint (five items) and eating concern (four items), with correlations ranging from 0.847 to 0.437 and from 0.748 to 0.556, respectively, and Eigenvalues equal to 1.963 and 1.078, respectively. The final percentage of variance was explained by approximately 66%. The results of EFA are reported in The Cronbach alpha values of the EDE-Q Arabic version and the three subscales were 0.900 for global, 0.891 for shape and weight concern, 0.839 for restraint, and 0.762 for eating concern. The distribution of the EDE-Q-14 Arabic version was normally distributed with slight positive skewness (Mean = 0.62) and slightly heavily tailed negative kurtosis (Mean = \u22120.82). Similar results were found in all subscales except Weight and Shape Concern and Eating Concern. The distribution of Weight and Shape concern was moderately light-tailed negative kurtosis (Mean = \u22121.51), and Eating Concern was slightly positively skewed (Mean = 1.08) with slightly heavily tailed positive kurtosis (Mean = 0.02). The results of consistency and distribution are presented in After 100,000 iterations with a minimum of 8 achieved, the CFA for Saudi adults of the second half of the split dataset (n = 274) succeeded to converge to the three-factor model of EDE-Q-14 Arabic version suggested by EFA of the first half of split dataset (n = 275). In samples, CFI/TLI within 0.90\u20130.95 and RMSEA within 0.06\u20130.08 suggested acceptable fit, Findings of this study showed a poor fit for a four-factor model  according to the CFA results. The dataset was split into two halves for further convergent validity test . The results of EFA indicated wide correlation values ranged between 0.969 and 0.462 for the five items that were allocated in shape and weight concern component. Seven questions that had correlations less than 0.4 were removed from the three-factor model to reach a good fit for the Saudi adults. Factor loading > 0.4 was determined as stable and acceptable for the model in eating disorders ,49,50. Tp < 0.001). Our findings of the EDE-Q Arabic version did not support the use of the original EDE-Q four-factor model  [Exploratory factor analysis (EFA) suggested a good fit for a 3-factor model  and 14-item with adequate sampling  . In the Concern) , the SweConcern) , and theConcern) . All of Concern) , TurkishConcern) , ItalianConcern) , and FijConcern)  were simConcern) ,56,57. OFurthermore, our 3-factor model has 14 items compared to 22 items of the original EDE-Q, as 8 items were removed according to EFA and CFA results of 2 halves split dataset. Similar removing were found in versions including the Italian , Sweden The results of our study suggest high internal consistency to the EDE-Q-14 Arabic version and all three subscales. Similarly, studies with goodness of fit to a three-factor model had adequate Cronbach\u2019s \u03b1 values for their global and three subscales ,52,59, wThe strengths of this study include the adequate sample size collected mainly from four heavily populated provinces, and the wide range of age groups recruited. In addition, this study was the first to translate and validate the original EDE-Q into Arabic using both CFA and EFA. However, some limitations should be addressed. First, this study had a high proportion of females compared to males. However, females in the Arab world have been frequently documented to be at higher risk for EDs ,61,62 beThe findings of this study suggest the validity and reliability of the Arabic version of EDE-Q among adults residing in Saudi Arabia. However, discriminant validity of the EDE-Q Arabic version among patients with EDs should be investigated. In addition, future research should investigate the validity and reliability of the Arabic version of the EDE-Q among younger populations. Further studies are required for examining possible risk factors of EDs among Saudi population."
\ No newline at end of file