diff --git "a/deduped/dedup_0351.jsonl" "b/deduped/dedup_0351.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0351.jsonl"
@@ -0,0 +1,43 @@
+{"text": "Embryo implantation plays a major role in embryogenesis and the outcome of pregnancy. Plasminogen activators (PAs) have been implicated in mammalian fertilization, early stages of development and embryo implantation. The invasion of trophoblast cells into the endometrium during the implantation process can be blocked by inhibitors of serine proteases, illustrating the role of these enzymes in the invasion process. As in vitro developing embryos resulted in lower implantation rate than those developed in vivo we assume that a reduced PAs activity may lead to it. There is hardly any information regarding qualitative or quantitative differences in expression of PAs in preimplantation embryos, or comparisons between in vivo and in vitro developed embryos. The purpose of this study was to assess the expression of urokinase type (uPA) and tissue type (tPA) plasminogen activators in in vivo and in vitro preimplantation development in rat embryos using immunofluorescence confocal microscopy and computerized image analysis.Zygotes, 2-cell, 4-cell, 8-cell, morula and blastocyst stages of development were flushed from the reproductive tract (control groups) of Wistar rats. Zygotes were flushed and grown in vitro to the above mentioned developmental stages and comprised the experimental groups. Immunofluorescence microscopy and computerized image analysis were used to evaluate both qualitative  and quantitative expression of plasminogen activators.uPA and tPA were found to be expressed in rat embryos throughout their preimplantation development, both in vivo and in vitro. While uPA was localized mainly in the cell cytoplasm, the tPA was detected mainly on cell surface and in the perivitelline space. In blastocysts, both in vivo and in vitro, uPA and tPA were localized in the trophectoderm cells. Total uPA content per embryo was higher in the in vivo as compared with the in vitro developed embryos at all stages measured. Blastocyst uPA content was significantly low as compared with the four-cell, eight-cell, and morula stages. Total tPA content was higher in embryos developed in vivo than those developed in vitro except for the 4-cell and 8-cell stages.In vitro embryo development leads to lower PAs expression in a stage dependent manner as compared with in vivo developing controls. The enzymes studied vary probably in the ratio of their active and inactive forms as there is no correlation between their content and the activity observed in our previous study. The localization of both PAs in the blastocysts' trophectoderm supports the assumption that PAs plays a role in the implantation process in rats. The inv failure ,13. In t failure .In the implantation process, two major factors participate: the uterus undergoes changes that prepare it for the arrival and implantation of embryos, and the embryos undergo cellular reorganization that enables them to penetrate the endometrium and to form the placenta. We assume that one of the reasons for low implantation rate of embryos developed in vitro involves reduced PAs activity.In a previous study we demonstrated differences in PAs activities between in vivo and in vitro preimplantation developed embryos. In both, uPA activity increased from the zygote towards the blastocyst stage while tPA activity remained relatively unchanged. However, tPA and uPA activities were lower in in vitro developed embryos as compared with in vivo developing ones, at all developmental stages, which may lead to a reduced implantation rate of in vitro developed embryos .There is hardly any information regarding qualitative or quantitative differences in expression of PAs in preimplantation embryos, or comparisons between in vivo and in vitro developed embryos. Therefore, the purpose of this study was to investigate the PAs expression and localization during embryo development in vivo and in vitro by immunofluorescence confocal microscopy.The following study was approved by the Institutional committee for animal care and ethics at Ben-Gurion University of the Negev, Beer-Sheva, Israel.Mature female Wistar rats 2\u20133 months old, weighing 180\u2013230 g were used. The animals were kept in a temperature-controlled room maintained at 22\u201324\u00b0C with lighting regimen of 14 hours light 10 hours dark (light on 5:00 AM \u2013 7:00 PM). The rats were allowed free access to rat chow and tap water.Daily vaginal smears were taken at 10:00 AM, and the stage of estrous cycle was determined. Overnight caging of a proestrous female with a male of proven fertility induced pregnancy. The next day, the presence of a vaginal plug or spermatozoa in the vaginal smear was designated as day 1 of pregnancy.Zygotes, two-cell, four-cell, eight-cell embryos and morulae were flushed with rat 1-cell embryo culture medium (R1ECM)  from oviZygotes in their cumulus mass were flushed and the cumulus cells were removed by gentle aspiration through a micropipette  several times in R1ECM containing 80 U/mL of hyaluronidase. Clean zygotes were washed 3 times by transfer into fresh R1ECM to remove traces of hyaluronidase. Flushed embryos were collected with a mouth-controlled micropipette .Blastocysts were flushed from the uterine horns by insertion of a 23-gauge needle attached to a syringe containing R1ECM. Flushed, free-floating blastocysts were collected into a polypropylene tube inserted through the vagina and pushed gently to surround the cervical openings. Tubes were removed, and their contents were poured into Petri dishes. Blastocysts were washed and collected as described for zygotes and embryos. These embryos developed in vivo were the control groups.2 in air. This medium was shown by Miyoshi et al. [As described for the in vivo embryos, clean zygotes were grown in vitro to the same developmental stages as controls; these were the experimental groups. Each group of embryos consisted of 25\u201335 embryos collected from six pregnant females. This was repeated three times for each developmental stage . Groups of 25\u201335 zygotes were placed into 35-mm-diameter culture dishes  containing 50\u03bcL of R1ECM medium under a layer of mineral oil  and cultured at 37\u00b0C under 5% COi et al.  to enablThe method used was basically that of Dubey et al.  with varThe distribution and concentration of PAs in the embryos were visualized by fluorescent microscopy on a Zeiss laser scanning confocal microscope equipped with an X100 objective. Z-sections and XZ-sections were obtained from 3D scanning by using LSM510 software  The PAs density for each embryo was computed by image analysis based on the same principles as manual counting described elsewhere . The embData are expressed as means \u00b1 SEM. Statistical analysis was performed with two-way analysis of variance, followed by the least significant differences test for multiple comparisons using computer software . P < 0.05 was defined as statistically significant difference.Immunohistochemical staining for the location of tPA and uPA in preimplantation embryos developed in vivo and in vitro are shown in figure 3, respectively, Fig. 3, respectively).Quantitative measurement of total uPA in an embryo at each stage showed significantly lower expression (p < 0.01) in in vitro developed embryos from the 4-cell stage up to the blastocyst stage compared with the in vivo developed corresponding timepoint. The highest expression of uPA was found in in vivo developed embryos from 4-cell to the morula stage (90.58, 78.78 and 79.35 Pixels per embryo \u00d7 103, respectively, Fig. Total tPA expression in a whole embryo showed highest expression in in vivo developed embryos at the 2-cell, 8-cell, morula and blastocyst stages (61.59, 52.71, 48.03 and 52.34 Pixels per embryo \u00d7 10Our study demonstrates that uPA and tPA are expressed throughout all stages of preimplantation development of rat embryos. Zhang et al.  reportedThe results show localization of immunoreactive uPA in the embryonic cell cytoplasm and plasma membrane in all developmental stages both in vivo and in vitro, while tPA is detected on the cell membrane and in the perivitelline space. In the blastocyst stage, PAs are localized mainly in the trophectoderm. In our previous study  we showePro-uPA is synthesized as an inactive single chain that can be stored or secreted. The secreted pro-uPA can be cleaved to produce the two-chain active molecule, uPA, by the aid of limited proteolytic activity of plasmin . The secHigh tPA expression was detected at the zygote stage which is in accordance with high tPA activity found in this stage . This isThe embryonic extracellular matrix is in a continuous turnover during the embryonic development. The 8-cell stage is characterized by structural changes taking place in the embryo during the compaction process. It is therefore very likely that such changes at the 8-cell stage could be associated with increased tPA expression and activity which is known to participate in tissue remodeling [Lower expression of uPA was observed in in vitro developed embryos as compared with in vivo ones from the 4-cell up to the blastocyst stage while tPA expression was lower only in the morula and blastocyst stages. This could be explained by reduced metabolic activity in the in vitro developed embryos as suggested by Krisher et al. . In addiAdditional studies addressing the regulation of PA/Plasmin system by adding exogenous factors may provide insights into its role in early embryo development and implantation.The purpose of the study was to determine the relative importance of tPA and uPA in preimplantation embryo development. In vitro embryo development leads to lower PAs expression in a stage dependent manner as compared with in vivo developing ones. The localization of both PAs in the blastocysts' trophectoderm supports the assumption that PAs may play a role in the implantation process in rats.EDA participated in the planning of the project, carried out the animal experimentation, immunohistochemistry and the image analysis studies. USM participated in the planning of the project, animal experimentation and participated in preparation of the manuscript. GP participated in preparation of the manuscript. IHV participated in the planning of the project, statistical analysis and in preparation of the manuscript."}
+{"text": "Although various hematologic abnormalities are seen in tuberculosis, immune thrombocytopenic purpura is a rare event.We report a case of a 29 year-old male who was presented with immune thrombocytopenia-induced hemoptysis, macroscopic hematuria and generalized petechiae. The patient was found to have clinical, microbiological and radiological evidence of active pulmonary tuberculosis. The immune thrombocytopenic purpura was successfully treated with anti-tuberculous drugs combined with corticosteroids and high dose immune globulin therapy.Immune thrombocytopenic purpura can be one of the hematological manifestations of tuberculosis which has a global prevalence with increasing incidence secondary to HIV infection. During the past 2 decades, tuberculosis -both pulmonary and extrapulmonary- has re-emerged as a major health problem worldwide. Hematologic abnormalities have been described in association with mycobacterial infections for almost 100 years. Patients with both pulmonary and extrapulmonary tuberculosis (TB) may demonstrate peripheral blood abnormalities and findings may be minimal or profound  were normal. A bone marrow aspiration demonstrated hypercellularity of all cell lines with normal maturation of myeloid and erythroid precursors. Megakaryocytes were increased in number with normal morphology. On bone marrow aspiration hemophagocytosis was not observed. A chest X-ray  units throughout hospitalization. During his hospitalization findings of hemolysis or gastrointestinal bleeding and massive bleeding in another site except hematuria and hemoptysis were not established. A complete blood count at discharge demonstrated a WBC 17 \u00d7 109/l, Hb 9.6 g/dl, and platelet count 310 \u00d7 109/l -hemolytic uremic syndrome (HUS), hemophagocytic syndrome and disseminated intravascular coagulation (DIC) associated with TB. Idiopathic thrombocytopenic purpura  is an acquired disease of children and adults defined as isolated thrombocytopenia with no clinically apparent associated conditions or other causes of thrombocytopenia. Adult ITP typically has an insidious onset with long-lasting histories of purpura (thrombocytopenia for >6 months) and spontaneous remission is uncommon and is likely to be incomplete -13. Ster9/l and he had no side effect thought to be secondary to anti-tuberculous drugs [Several factors are known to cause bleeding in association with infections, of which thrombocytopenia is the most common. The etiology of thrombocytopenia in most cases appears to be increased destruction of platelets such as due to DIC or septicemia without evidence of DIC or platelet adherence to damaged vascular surfaces or direct platelet toxicity caused by the microorganism or involvement of bone marrow. Adult acute immune thrombocytopenic purpura is defined as a bleeding disorder in otherwise healthy person caused by transient destruction of platelets. Although the most important therapy for infection-related thrombocytopenia is that directed at the underlying infection, treatment decisions for immune thrombocytopenic purpura remain controversial and may include single or combination therapy with corticosteroids, intravenous immunoglobulin (IVIg) according to degree of thrombocytopenia or hemorrhage ,14. The us drugs ,16. The In conclusion, since the incidence of tuberculosis is currently increasing in worldwide countries and it may present with different hematologic manifestations, in case of immune thrombocytopenic purpura tuberculosis should also be recalled. Finally, further studies are needed in order to fully characterize the pathophysiology and immunological abnormalities in tuberculosis-related immune thrombocytopenic purpura."}
+{"text": "Recent research has pointed to the developing immune system as a remarkably sensitive toxicologic target for environmental chemicals and drugs. In fact, the perinatal period before and just after birth is replete with dynamic immune changes, many of which do not occur in adults. These include not only the basic maturation and distribution of immune cell types and selection against autoreactive lymphocytes but also changes designed specifically to protect the pregnancy against immune-mediated miscarriage. The newborn is then faced with critical immune maturational adjustments to achieve an immune balance necessary to combat myriad childhood and later-life diseases. All these processes set the fetus and neonate completely apart from the adult regarding immunotoxicologic risk. Yet for decades, safety evaluation has relied almost exclusively upon exposure of the adult immune system to predict perinatal immune risk. Recent workshops and forums have suggested a benefit in employing alternative exposures that include exposure throughout early life stages. However, issues remain concerning when and where such applications might be required. In this review we discuss the reasons why immunotoxic assessment is important for current childhood diseases and why adult exposure assessment cannot predict the effect of xenobiotics on the developing immune system. It also provides examples of developmental immunotoxicants where age-based risk appears to differ. Finally, it stresses the need to replace adult exposure assessment for immune evaluation with protocols that can protect the developing immune system. The premise of this review is that the developing immune system represents a particularly sensitive xenobiotic target that is not effectively modeled through routine screening for immunotoxicity using adult exposure. Hence, adult exposure testing for immunotoxicity is limited in application, cannot address the most significant immune vulnerabilities, and should be replaced with a more predictive assessment protocol. This conclusion is drawn from recent developmental immunotoxicity findings, including those from our own laboratory, as well as from the conclusions of numerous conferences and workshops. These sources point to the special vulnerabilities of the perinatal immune system compared with the fully matured and dispersed immune system of the adult.Individuals in early-life stages have been recognized as a special subset of the population that is likely to be at greater toxicologic risk than adults . Within In this review we highlight some novel processes of perinatal immune development that both contribute to the immunotoxic vulnerability of the developing immune system and cannot be effectively examined via current adult-exposure assessment. Additionally, specific examples of the problems associated with reliance on adult-induced immunotoxicity assessment are shown for a variety of immunotoxicants.Immune development has been characterized from a toxicologic perspective through a series of discrete functional changes representing critical windows of differential vulnerability to toxicants . These rOne of the early events connecting the immune system to virtually all organs is the differentiation and seeding of myelomonocytic lineage macrophages and macrophage-derived cells to various sites, including the bronchial , hepatic (Kupffer cells), neurologic (microglia), and reproductive systems (testicular macrophages). These cells provide regulatory and host defense roles in these tissues. Specific examples describe the vulnerability of these tissues during the perinatal period when exposure to toxicants impairs macrophages, including the possibility that the heavy metal lead can impair both the function and the self-renewal of testicular macrophages, which contributes to male sterility problems . SimilarAnother early immune process critical for subsequent host defense is the migration of pro\u2013T lymphocytes to the thymus and their expansion during thymopoiesis. During the perinatal period, the thymus is central to the production of T lymphocytes. Even in children, the thymus continues to play the major role in T-lymphocyte generation . In contp-dioxin (TCDD) is an example of such a toxicant  in the human fetus  population carries the phenotype FoxP3an fetus . Tregs aan fetus . It appean fetus . The proan fetus  and cyclan fetus  cause inan fetus , and thean fetus .H1) or type 1 responses. This does not happen in humans until parturition under normal circumstances   and acquire the capability of promoting T-helper 1  than can clinically alter adult TH balance.Beyond dendritic cells, some xenobiotics such as the heavy metals and tryptophan metabolites may directly affect Tcapacity , perinatdiseases . In contin situ, there is a special perinatal maturation of macrophages  that enables them to acquire increasing host defense capabilities  with increased postnatal age  with no corresponding effect in the exposed dams  activity, whereas their daughters exposed in utero had altered antibody-forming cell activity but no change in NK activity  , 1980 anin utero exposure to DES primes the immune system for postnatal unpredictable responses. A similar example has been seen after low-level exposure to lead where postnatal viral infection resulted in unpredictable alterations in leukocyte mobilization (Finally, one of the anomalies of early exposure is that a sublethal exposure to a toxicant may produce an unrecognizable immunotoxic alteration until the postnatal immune system is placed under subsequent stress. This hidden or cryptic state is referred to as \u201clatency.\u201d A classic example exists for early exposure to DES . In thislization . ObviousDifferential immunotoxic effects between sexes are neither universal after early exposure  nor uniqMany critical processes occurring during peri-natal immune development are either nonexistent or comparatively unimportant in the adult e.g., . Therefo"}
+{"text": "Of particular concern are exposures during the earliest stages of development that while failing to abrogate embryogenesis, may have long term effects on newborns or adults. The purpose of this study was to evaluate the effect of maternal exposure to the AhR-specific ligand 2,3,7,8-tetrachlorodibenzo-We performed a systematic 3 dimensional (3D) confocal microscopy analysis of rat pre-implantation embryos following maternal exposure to environmentally relevant doses of TCDD. Both chronic (50 ng/kg/wk for 3 months) and acute (50 ng/kg and 1 \u03bcg/kg at proestrus) maternal TCDD exposure disrupted morphogenesis at the compaction stage (8\u201316 cell), with defects including monopolar spindle formation, f-actin capping and fragmentation due to aberrant cytokinesis. Additionally, the size, shape and position of nuclei were modified in compaction stage pre-implantation embryos collected from treated animals. Notably, maternal TCDD exposure did not compromise survival to blastocyst, which with the exception of nuclear shape, were morphologically similar to control blastocysts.in vivo study to demonstrate a critical window of pre-implantation mammalian development that is vulnerable to disruption by an AhR ligand at environmentally relevant doses.We have identified the compaction stage of pre-implantation embryogenesis as critically sensitive to the effects of TCDD, while survival to the blastocyst stage is not compromised. To the best of our knowledge this is the first  The aryl hydrocarbon receptor (AhR) pathway is a widely expressed orphan receptor pathway activated by many environmental toxicants and carcinogens. AhR ligands, including dioxins and polychlorinated biphenyls, induce a spectrum of developmental and toxic responses by modifying gene expression, altering hormonal profiles and disrupting cell proliferation and differentiation . EpidemiPast studies examining maternal dioxin exposure and subsequent fetal health have primarily focused on post-implantation embryogenesis, while the impact of environmental contaminants on the peri-conceptional and pre-implantation period remained largely unexplored. The maternal environment during this earliest window of development has been hypothesized as critical to the long term health of offspring . For exain vitro exposure of 2 cell mouse embryos to TCDD results in increased cavitation rates, a functional measure of TE differentiation [in vitro exposure of 2 cell mouse pre-implantation embryos to very low levels of TCDD reduced the number of pre-implantation embryos that developed to 8 cells relative to controls, whereas blastocyst formation of the surviving 8 cell pre-implantation embryos was accelerated [Compacting morulae may be particularly vulnerable to the effects of environmental toxicants. Compaction is a morphogenetic process during which mammalian embryos undergo major cytoplasmic, nuclear and cytoskeletal remodeling events that lead to the establishment of apical-basal polarity -17. Polantiation . Similarelerated . These sThe extent to which TCDD, at environmentally relevant doses, perturbs pre-implantation mammalian development in intact reproductively fit animals has yet to be fully evaluated. Thus, in a well-established rat model, we studied the effect of maternal TCDD exposure on early embryogenesis with respect to blastomere nuclear and cyto-architecture. We show specific nuclear and cytoskeletal modifications revealed from a systematic 3D confocal microscopy analysis of rat pre-implantation embryos following maternal exposure to TCDD. Both chronic and acute maternal TCDD exposure disrupted morphogenesis at the compaction stage (8\u201316 cell), with defects including monopolar spindle formation, f-actin capping, aberrant cytokinesis and distortion of nuclear shape and position. Notably, maternal TCDD exposure did not compromise survival to blastocyst, which with the exception of nuclear shape, were morphologically similar to control blastocysts. These studies raise further concerns regarding the consequences of early embryo exposures to prevalent environmental toxicants like TCDD.We first asked whether chronic maternal exposure to TCDD affected the number of pre-implantation embryos relative to controls. As shown in Table In contrast, significantly lower proportions ~37%) of pre-implantation embryos from chronically exposed dams were morphologically normal Table . Embryos7% of preThese initial findings prompted further analysis of cytoskeletal and nuclear characteristics in pre-implantation embryos to determine if limiting TCDD exposure to the time between oocyte maturation, ovulation and implantation  would similarly modify pre-implantation embryo organization. Mature naturally cycling female rats were exposed to a single dose of TCDD (50 ng/kg or 1 \u03bcg/kg) or vehicle on the evening of proestrus and compaction (8\u201316 cell) and early blastocyst stage (32 cell or more) pre-implantation embryos were collected and analyzed.Acute maternal TCDD exposure at the lower dose did not alter the number of compaction stage pre-implantation embryos relative to controls, but only ~52% of pre-implantation embryos from treated animals were normal Table . ExposurWe then asked whether the striking modifications evident at compaction were propagated through to the early blastocyst stage. In particular, it seemed likely that the occurrence of monopolar spindles would abrogate efficient cell cycle progression and negatively impact further pre-implantation embryo development. However, exposure to TCDD affected neither the number of pre-implantation embryos surviving to blastocyst nor the average number of cells within each blastocyst Table , suggestTCDD exposure at the higher dose did decrease the number of blastocysts exhibiting normal morphology ~46%) Table , though % Table ,In comparing nuclear structure among blastocysts, it was noted that while TE cells contained nuclei resembling controls in the 50 ng/kg TCDD exposed group, at higher concentrations (1 \u03bcg/kg TCDD) nuclei were conspicuously smaller and irregular in shape Fig. . Despitein vivo study to demonstrate a critical window of early mammalian development that is vulnerable to disruption by an AhR ligand at environmentally relevant doses.Exposure to environmental toxicants, such as TCDD, prior to and during the earliest stages of pregnancy has been linked to developmental disabilities after birth in both human and animal studies -8. We coin utero and continued until breeding sacrifice at 3 months of age. In other words, the acute exposures were comprised of exposures to both the mother and the embryo, while the chronic exposure entails exposure of grandmother, mother and offspring. The results presented here show that both acute and chronic TCDD treatment protocols significantly compromised embryo quality.The comparison of acute verses chronic maternal exposure to TCDD on subsequent embryo quality in the current study encompasses examination of both dose effects and transgenerational toxicant actions. Dams in the acute exposure paradigm were exposed to low and high doses of TCDD limited to a single administration immediately preceding ovulation. The half life of TCDD in the rat is approximately 3 weeks, implying significant exposure until collection of the embryo. In the chronic exposure model, continuous exposure to TCDD in the dam began in vitro exposure of mouse pre-implantation embryos to TCDD accelerates differentiation of the blastocyst [in vivo experimental design employed in this study, we can not rule out effects of TCDD on the oocyte nor on the mother's physiology, as factors contributing to the outcomes realized during pre-implantation embryo development. AhR ligands are known endocrine disruptors [in vivo studies [It is likely that pre-implantation embryos are a direct target for TCDD, given that AhR is expressed throughout pre-impanation development  and thatastocyst ,20. Howesruptors  and havesruptors . Additio studies .One of the most striking effects of TCDD, at both doses, was the induction of aberrant mitotic spindles and a failure in chromosome alignment in compaction stage pre-implantation embryos. AhR ligands, such as TCDD, may be involved in generating meiotic spindle aberrations by causing local increases in the concentration of 2-methoxyestradiol (2-ME) . 2-ME biin vitro exposure of 2, 4, or 8 cell mouse pre-implantation embryos to TCDD did not significantly increase the number of TUNEL positive cells, alter the Bax/Bcl-2 expression ratio, or change cell number at the blastocyst stage [Similarly, exposure to TCDD did not inhibit development to blastocyst and the data presented here clearly demonstrate that the overall structure and morphology of treated blastocysts were similar to control blastocysts. However, the widespread prevalence of defects uncovered in compaction stage pre-implantation embryos of treated animals, together with the relative paucity of cells exhibiting defects at the blastocyst stage, is disconcerting. Thus, a central question raised by this work is \"What is the fate of aberrant compaction stage blastomeres?\" We suggest three scenarios that may contribute to the survivability of TCDD exposed pre-implantation embryos. Firstly, defective cells may be eliminated by apoptosis during the transition from compacted pre-implantation embryo to blastocyst. Brison and Shultz showed apoptosis only occurs after compaction and is predominantly located in the ICM of the mouse . Howeverst stage .Alternatively, defective cells may initiate repair mechanisms to rectify errors. Surveillance mechanisms that alert cells to impending errors in chromosome segregation exist in many normal somatic cells exhibiting a stable euploid condition. Such cell cycle checkpoints are engaged in response to structural aberrations as wide-ranging as chromosome misalignment to centrosome number . NotablyIt is possible that our detection of monopolar spindles was biased by a prolonged prometaphase delay that yielded euploid daughter cells after a correction that we were unable to detect in fixed samples. While this seems unlikely given the similar distribution of M-phase stages observed in control and treated pre-implantation embryos, on-going live cell recording experiments should resolve this dilemma. Moreover, cytogenetic assays will be needed to establish the incidence of aneuploidy, known to be elevated in human embryos exhibiting similar spindle defects, to better understand the status of checkpoint controls during this critical juncture during mammalian embryogenesis.in vitro exposure of mouse pre-implantation embryos to TCDD increased methyl transferase activity, altered the methylation status of imprinted genes H19 and Igf2 and retarded subsequent fetal growth [A final possibility is retention of defective blastomeres and their contribution to either or both of the lineages established in the blastocyst. While it is interesting to speculate that the TE lineage naturally undergoes ploidy variations indicative of less stringent cell cycle checkpoint surveillance , our datl growth . Thus, dWe have observed that compaction stage pre-implantation embryogenesis as critically sensitive to the effects of TCDD, while survival to the blastocyst stage is not compromised. The present work assumes particular relevance when considered together with recent evidence suggesting long term impacts on the health and well-being of offspring following environmental perturbations during the periconceptional and pre-implantation period ,38. Whilad libitum. All procedures were approved by the University of Kansas Medical Center Institutional Animal Care and Use Committee. In all experiments, pre-implantation embryos were obtained from naturally mated rats. Estrus cycles were monitored by vaginal cytology, with normal estrous cycle duration of 4\u20135 days [Female Sprague-Dawley rats (Charles River Laboratories) were housed under a 12L:12D photoperiod at an ambient temperature of 23 \u00b1 2\u00b0C, with food and water 4\u20135 days . Source In experiment 1, rats were exposed chronically to doses of TCDD that mimic exposure of high risk populations in humans ,41. WeekIn experiment 2, female Sprague-Dawley rats  received a single oral dose (50 ng/kg or 1 \u03bcg/kg) of TCDD or corn oil vehicle (4 ml/kg) on the evening of proestrus and were housed with males of proven fertility. At the time of dosing rats were 50 days of age. Again, mating was confirmed by the presence of sperm on vaginal cytology the following morning. Pre-implantation embryos were collected in FHM (Chemicon) media pre-warmed to 37\u00b0C by flushing oviducts and uteri on day 4.5 or 5.5 post mating.Pre-implantation embryos were processed for microtubule, DNA and f-actin immunofluorescence as previously described . ImmediaPre-implantation embryos were analyzed on a Zeiss LSM Pascal confocal imaging system mounted on a Zeiss Axioscope II using UV (405 nm), HeNe (543 nm) and Argon (488 nm) laser excitation. For every embryo, a complete Z-axis data set was collected at 0.8 \u03bcm intervals (~50 sections/embryo) using a x63 oil objective (na = 1.4). Laser power, gain and offset settings were not changed during acquisition. Line scans and spatial restoration and 3 dimensional projections for each Z-series data set were computed and analyzed using Zeiss LSM 5 Image Browser.Pre-implantation embryos were classified as abnormal if they contained blastomeres exhibiting one or more of the following: irregular size, irregular shape, weak or undetectable f-actin or tubulin, cellular fragmentation or micronuclei. Additionally, blastomeres containing metaphase-like chromosomes with mitotic spindles absent, or deviating from a focused bipolar microtubule array, were considered abnormal.Chi-square was used to analyze the proportion of normal and abnormal pre-implantation embryos. P-values of less than 0.05 were considered significant.KJH carried out the embryo collection, analysis and interpretation of the data and drafted the manuscript. ZS dosed the animals and collected the embryos. DFA analyzed and interpreted the data and helped to draft the manuscript. BKP conceived of the study and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.Control compaction stage pre-implantation embryo. Z-axis step through of control pre-implantation embryo. Green: tubulin; red: f-actin; white: DNA.Click here for fileChronically treated compaction stage pre-implantation embryo. Z-axis step through of a pre-implantation embryo following chronic maternal exposure to TCDD (50 ng/kg/wk). This is the same pre-implantation embryo as shown in Fig. Click here for fileNuclear profile of compaction stage pre-implantation embryos from control animal. 3D rotation illustrating the nuclear profile of a control pre-implantation embryo.Click here for fileNuclear profile of compaction stage pre-implantation embryos from chronically exposed animal. 3D rotation illustrating the nuclear profile of a pre-implantation embryo following chronic maternal exposure to TCDD (50 ng/kg/wk).Click here for fileControl blastocyst. 3D rotation illustrating the nuclear and f-actin profiles of a control blastocyst. This is the same embryo as shown in Fig. Click here for fileAcute 50 ng/kg blastocyst. 3D rotation illustrating the nuclear and f-actin profiles of a blastocyst following acute exposure to 50 ng/kg TCDD. Red: f-actin; white: DNA.Click here for fileAcute 1 \u03bcg/kg blastocyst. 3D rotation illustrating the nuclear and f-actin profiles of a blastocyst following acute exposure to 1 \u03bcg/kg TCDD. Red: f-actin; white: DNA.Click here for file"}
+{"text": "Previously, in both recent-onset T1D patients and \u03b2 cell antibody-positive at-risk individuals, we observed increased apoptosis and decreased function of polyclonal Tregs in the periphery. Our objective here was to elucidate the genes and signaling pathways triggering apoptosis in Tregs from T1D subjects.Type 1 diabetes (T1D) is a T-cell mediated autoimmune disease targeting the insulin-producing pancreatic \u03b2 cells. Naturally occurring FOXP3regs from recent-onset T1D (n\u200a=\u200a12) and healthy control subjects (n\u200a=\u200a15) were generated. Statistical analysis was performed using a Bayesian approach that is highly efficient in determining differentially expressed genes with low number of replicate samples in each of the two phenotypic groups. Microarray analysis showed that several cytokine/chemokine receptor genes, HLA genes, GIMAP family genes and cell adhesion genes were downregulated in Tregs from T1D subjects, relative to control subjects. Several downstream target genes of the AKT and p53 pathways were also upregulated in T1D subjects, relative to controls. Further, expression signatures and increased apoptosis in Tregs from T1D subjects partially mirrored the response of healthy Tregs under conditions of IL-2 deprivation. CD4+ effector T-cells from T1D subjects showed a marked reduction in IL-2 secretion. This could indicate that prior to and during the onset of disease, Tregs in T1D may be caught up in a relatively deficient cytokine milieu.Gene expression profiles of unstimulated Tregs from T1D subjects reflect a cellular response that leads to increased sensitivity to apoptosis, partially due to cytokine deprivation. Further characterization of these signaling cascades should enable the detection of genes that can be targeted for restoring Treg function in subjects predisposed to T1D.In summary, expression signatures in T This breakdown of immunological self-tolerance results in autoreactivity to islet self-antigens, and requires genetic susceptibility as well as environmental factors. Both the numerical and functional balance between killer  represent one of the best characterized sub-populations. There is accumulating evidence of a deficiency in either the frequency or function of Tregs in various human autoimmune diseases regs in recent-onset T1D subjects  and in subjects at-risk for T1D reg apoptosis was found to correlate with a decline in suppressive potential of these cells. The fact that both hyperglycemic T1D subjects and normoglycemic at-risk subjects showed this phenomenon suggests that Treg apoptosis is more a precursor to, rather than a consequence of diabetes. Although Treg apoptosis is likely to be one of the peripheral imbalances in T1D, there is very little known about the pathways and genes that make Tregs sensitive to apoptosis during the period right after the onset of disease.Among the regulatory T-cells that actively suppress effector T-cells, the FOXP3reg mediated tolerance under physiological conditions. There are also studies which have investigated Treg expression under diseased conditions in mouse models for T1D + T cells of human T1D and T2D subjects + T cell subset) comprising a heterogeneous cell population are difficult to correlate with expression changes that should occur specifically in apoptosis-sensitive Tregs at the onset of T1D.Several groups have studied expression profiles for various subsets of T-cells in both humans and mice, aimed at objectives ranging from differentiating regulatory T-cells from effector T-cells regs from recent-onset T1D. Expression profiles of unstimulated Tregs from T1D subjects reveal a cellular response that could make the cells sensitive to apoptosis, partially due to deprivation of cytokines. This global picture of pathway-specific expression signatures is a step further into dissecting Treg dysfunction in the pathogenesis of T1D.In this study, we investigated the expression signature that shapes the transcriptional program within functionally deficient Tregs from T1D subjects, using a suppression assay. In a pilot suppression assay, Tregs from healthy control subjects were co-cultured with CD4+CD25\u2212 effector T-cells (CD25\u2212 Teffs) at varying titrations of the Treg:CD25\u2212 Teff ratio (from 1\u22362 to 1\u223632) and the suppressive capacity of Tregs was measured using the formula described in the \u2212 Teff numbers resulted in minor changes in suppression (reg: CD25\u2212 Teff) ratio for the rest of the study. Tregs from T1D subjects (n\u200a=\u200a15) showed a significant reduction in suppressive capacity compared to control subjects (n\u200a=\u200a17) (Mann-Whitney p<0.0007)   . The raw<0.0007) . We furt<0.0001) , but theenotypes . Also, wat-risk non-diabetic individuals at-risk subjects, Tregs undergo spontaneous apoptosis in the periphery, which could result in a subsequent loss of suppressive potential. Increased apoptosis and decreased suppression of Tregs observed in both recent-onset T1D subjects and in at-risk individuals who have not yet been clinically diagnosed with disease, indicates that these Treg defects are more a cause than an effect of the disease.These results strengthened the trends reported earlier by our group in T1D subjects and regsin-vivoreg: CD4+Teff balance in the islets with concomitant reduction of CD25 and BCL2 expression on intra-islet Treg cells. Addition of IL-2 promoted Treg cell survival and protected NOD mice from diabetes. Further, in the NOD mouse, Yamanouchi et al. have shown that IL-2 gene variation impairs Treg function and influences diabetes susceptibility. They have also shown that the amount of IL-2 produced by autoreactive CD8+ T cells in response to antigen seems to control the size of the lymph node Treg pool reg function, we hypothesized that reduced IL-2 could be partially responsible for the increased apoptosis and reduced function of Tregs from human T1D subjects. Further evidence in support of this hypothesis is presented in the following sections.Several reports have demonstrated that IL-2 is an important signal for the development, function and homeostasis of natural Tregs, under conditions of IL-2 and IL-4 deprivation. It can be argued that it is more useful to establish the link between cytokine deprivation and apoptosis directly in Tregs from T1D subjects. However, functionally deficient Tregs from T1D subjects are likely to undergo irreversible apoptosis/necrosis in response to IL-2 deprivation, making this sort of analysis uninformative. Apoptosis was measured in Tregs and in CD25\u2212 Teff cells from control subjects, at 3 days and 5 days after IL-2, IL-4 and IL-2+IL-4 withdrawal. Results show that there was increased apoptosis in Tregs, but not in CD25\u2212 Teffs in response to IL-2 and IL-4 deprivation . BCL2, an anti-apoptotic gene which represses the caspase cascade and is known to make CD4+ T cells sensitive to apoptosis under conditions of serum starvation BCL2, as well as FAS and BCL10- two major caspase activators, were also upregulated in Tregs from T1D subjects. Further, genes related to stress response and known to be triggered by lack of survival factors regs from T1D subjects. The transcription factor FOXO3A as well as some its key pro-apoptotic transcriptional targets  were upregulated in Tregs from T1D subjects. Pro-apoptotic genes in the p53 signaling pathway  were upregulated in Tregs from T1D subjects. Finally, several members of the GIMAP gene family  and BGX (|z-score|>20) analyses. RT-PCR results . Downregulation of CCND2, a negative target of FOXO3A, was also confirmed. Trends in the expression of HLA Class I  and HLA Class II genes  were similar to those observed on the array. In agreement with the array results, GIMAP5 was also found to be downregulated by RT-PCR. Thus, RT-PCR results confirm several array results, and establish the expression changes in the AKT pathway that make Tregs from T1D subjects sensitive to apoptosis.For confirmation of array results by quantitative RT-PCR, we restricted the selection of apoptosis-related and  results  confirm regs from T1D subjects, we selected 32 key genes from the various functional clusters discussed so far , and checked their expression trends in healthy Tregs, under conditions of IL-2 deprivation. As array results suggested early gene expression changes leading to apoptosis, we checked RNA expression at 12 hours, 24 hours and 3 days after IL-2 withdrawal. Results show that expression trends in TCR-Co (\u03b1CD3+\u03b1CD28) stimulated healthy Tregs under IL-2 withdrawal were in agreement with expression trends in Tregs from T1D subjects, for 19 of the 32 assayed genes  and cytokine/chemokine receptors  mimic those observed in Tregs from T1D subjects, at one or more time-points. Further, in the gene-expression results, important cytokine-responsive lymphocyte activation markers: interleukin-2 receptor alpha (IL2RA), chemokine (C-C motif) receptor 5 (CCR5) and human leukocyte antigen, class II, DR alpha 1 (HLA-DRA1) were downregulated in Tregs from T1D subjects. It has been documented that these three activation-linked genes are positively regulated by IL-2 in various T-cell subsets For reproducing expression signatures seen in Ted genes . Expressregs under cytokine deprivation were identical to those observed in Tregs from T1D subjects. These lines of evidence support the hypothesis that the expression signature in Tregs from T1D subjects may be partially induced by a cytokine deficient milieu. A pathway diagram in regs from T1D subjects, under conditions of cytokine deprivation.In summary, expression trends in healthy Treg activation, there is strong evidence supporting a role for IL-2 in the development and/or function of Tregsregsin vivo, are effector T-cells which control Treg development and function by secreting several cytokines, including IL-2. There is evidence for an imbalance in cytokine secretion from effector cells in T1D reg stimulation occurs in vivo by cytokines secreted from various effector cell types, but the CD4+ effector T cells which are the major producers of IL-2, play a primary role in shaping the Treg maturation and response. We also compared the production of cytokines in both the CD4+CD25\u2212 and the CD4+CD25low effector T-cell subsets from T1D and control subjects. As shown in +CD25\u2212). Further, although differences in the production of other cytokines across the two groups were not statistically significant, the trends were similar for each of the measured cytokines. These results collectively suggest that increased apoptosis, decreased Treg function and concomitant gene expression changes could be linked to deficient IL-2 secretion from effector T-cells.IL-2, a T-cell growth factor, plays an important role in multiple aspects of T-cell biology. Apart from the effect of IL-2 on Treg apoptosis and reduced Treg suppressive function at the onset of disease. Considering that Tregs are selective targets for destruction, expression profiling within Tregs provided us with a model for understanding the cause (Treg environment) by studying the effect (Treg expression changes). Our data supports the notion that in patients with T1D, the lack of suppression of autoreactive T-cells in the periphery is a result of increased apoptosis in Tregs, possibly precipitated by deprivation of growth signals such as IL-2. Increased expression of various apoptosis genes, and the downregulation of pro-survival GIMAP genes indicate a complex interplay amongst these pathways leading to apoptosis. Further, co-ordinate repression of cytokine receptors and HLA genes points to a possible proliferation defect in Tregs from T1D subjects.In line with this hypothesis, we observed elevated TFOXO subfamily of forkhead transcription factors plays an evolutionarily conserved role in cellular adaptation to stress stimuli and also regulates survival in response to cytokine deprivation, DNA damage and oxidative stress. Amongst several reports documenting apoptosis of lymphoid cells under conditions of cytokine deprivation regs from T1D subjects, we observe AKT to be downregulated, while PTEN and FOXO3A are upregulated, suggesting that in the absence of activated AKT, FOXO3A phosphorylation may be inhibited, which could lead to its activation and translocation to the nucleus. Transcriptionally active FOXO3A induces several pro-apoptotic genes such as PUMA, BIM, GADD45A, GADD45B, SESN1, TNFRSF10B, CITED2 and CDKN1B, all of which were upregulated in Tregs from T1D subjects (significant either on the array at |z-score|>20 or on RT-PCR at p<0.05) as well as show similar trends in healthy Tregs under conditions of IL-2 withdrawal. Our data suggests that in Tregs from T1D subjects, both the AKT and p53 pathways exert pro-apoptotic function through transcriptional regulation of multiple downstream targets that render the cells sensitive to apoptosis.The regs from T1D subjects could lead to defects in HLA-TCR interactions between Tregs and various other T-cell subsets in the periphery. Recently, it has been demonstrated that the direct ex vivo expression of HLA-DR in the context of CD4+CD25high T cells identifies a mature, functionally distinct regulatory T cell population involved in contact-dependent in vitro suppressionregs from T1D subjects and the associated loss of suppressive capacity is in line with this report. We are currently following up this relationship across HLA expression, Treg function and genotype as a separate study.Few studies have reported on the expression of HLA molecules in T-cells of patients with T1D. HLA class I expression has been reported to be decreased GIMAP family of novel GTPases  are also downregulated in Tregs from T1D subjects. Recent reports suggest crucial roles of GIMAP family proteins in regulating T-cell development, selection and homeostasis BCL2 family members, thereby regulating T-cell survival regs from T1D subjects could not be reproduced in healthy Tregs under IL-2 withdrawal, the IL-2 pathway does not seem to control expression of GIMAP genes.Several genes in the reg gene expression studies, in both the physiological and disease contexts. Amongst a subset of direct FOXP3 targets that exhibited consistent transcriptional behavior in hybridomas and in ex vivo T-cells EVI2B, GADD45B, PTPN22, TGIF, MYC, PHF6, POU2AF1 and GPR171) to be upregulated in Tregs from T1D subjects while positive FOXP3 targets  were downregulated in Tregs from T1D subjects. In summary, our results provide evidence that dysregulation in Treg specific as well as FOXP3 associated genes could lead to functionally compromised Tregs in T1D subjects.It is interesting to observe that some of the differentially expressed genes in this study have been discussed in other Treg isolation strategy may not be the most optimal way to isolate pure Tregs. However, isolation of bonafide regulatory T-cells remains difficult because the availability of specific marker molecules is still limited. Apart from CD25, additional surface molecules have been proposed as useful markers to distinguish regulatory from effector T-cells, such as CTLA4, TNFRSF18 (GITR), CD62L and NRP1. However, many of these molecules are also expressed by na\u00efve CD4+CD25\u2212 T-cells upon activation, thereby hampering discrimination between regulatory and conventionally activated CD4+ T-cells. Here we adopted a very conservative Treg isolation strategy, selecting only the top 1% CD25 expressing cells as Tregs. The additional confirmation that most of these cells were CD127-ve ensures that our cell population is highly enriched for Tregs  of the Children's Hospital of Wisconsin IRB no. 01\u201315 and participants and/or their parents (guardians) provided written informed consent.Recent-onset T1D subjects  were recruited through the diabetes program at Children's Hospital of Wisconsin. Diabetes was defined according to World Health Organization criteria and included blood glucose levels of >200 mg/dl with symptoms confirmed by a physician +CD25+ T-cells, expressing both low and high CD25 exhibits regulatory function in the mouse, only the CD4+CD25high population exhibits a similarly strong regulatory function in humans +CD25high T-cells as Tregs for this study. CD4+CD25low and CD4+CD25\u2212 effector T cells were also isolated using the same protocol. This additional stringency of collecting just the top 1% of CD4+CD25high cells as Tregs ensured removal of most of the activated CD25low T-cells. We found that most of the Tregs we isolate are CD127-ve +CD25\u2212 cells are CD127+, as an added confirmation of the purity of the isolated Tregs. See Supporting regs isolated using this protocol had a significantly higher percentage of FOXP3+ cells (61.88\u00b12.68) compared to CD4+CD25\u0305 cells (4.32\u00b10.80) (Mann-Whitney p<0.0001). Isolated Treg cells were anergic and showed good suppressive capacity in vitro (data not shown). Thus, our isolation protocol generated Tregs that maintained high level of sustained FOXP3 expression associated with phenotypic and functional stability.As this study assessed whether alterations in the function of regulatory T-cells could be involved in the pathogenesis of T1D, it was crucial to identify highly pure and homogeneous regulatory T-cells. It is now known that while the entire population of CD4+CD25high T-cells using TRIzol Reagent (Invitrogen Life Technologies) according to the manufacturer's protocol. The GeneChip human genome U133 plus 2.0 array (Affymetrix) was selected for this study which interrogates >47,000 probe sets, representing roughly 39,000 unique genes. Purified total RNA (\u223c50 ng) was amplified using an Affymetrix two-cycle cDNA synthesis kit  and cRNA was synthesized, labeled, fragmented and hybridized to the arrays in accordance to standard Affymetrix protocols. After hybridization arrays were washed, stained with PE-conjugated streptavidin (Molecular Probes) and scanned on a GeneChip Scanner 3000 (Affymetrix). Image data were analyzed with Affymetrix GeneChip operating software (GCOS).Total RNA was extracted from CD4affyQCreport package from the Bioconductor project Each microarray scan was visually inspected for irregularities, and the quality of the entire microarray set was assessed using the \u03bcg1 (level of expression of gene g in T1D) and \u03bcg2 (level of expression of gene g in Controls) is calculated. Within this framework, the samples from the posterior distributions of the differences  represent a natural base for inference on differential expression. For each gene, a kernel density plot for the expression index gp\u03bc and the difference gd was constructed. From the cumulative information of expression differences , a histogram of the posterior probabilities of expression differences being less than zero  thymidine (Amersham Pharmacia Biotech) and harvested after 16 hours. The cpm per well was determined with a scintillation counter . The percentage of suppression was calculated as {(s\u2212c)/s}\u00d7100%, where s\u200a=\u200acpm in single culture and c\u200a=\u200acpm in co-culture.CD4+CD25high T-cells using the PE Anti-Human FOXP3 Staining Set (eBioscience) following the recommended protocol. Cells were first fixed, washed and permeablized, then stained with either FOXP3-PE (clone PCH101) or the isotype control rat IgG2a-PE. Intracellularly stained cells were then analyzed on a FACS LSRII using FACSDiva Software (BD Biosciences).Intracellular staining for FOXP3 was carried out in 15,000\u201325,000 CD4+CD25low cells were plated at 50,000 cells per well and stimulated with platebound \u03b1CD3 (5 \u00b5g/ml) and soluble aCD28 (2.5 \u00b5g/ml) (BD Biosciences) at 37\u00b0C/5%CO2. After 55 hours, 100 ul of supernatant was removed from each well and stored at \u221280\u00b0C until the cytokines were measured. The supernatants were thawed and 50 \u00b5l was used in the Cytometric Bead Array (CBA) Human Th1/Th2 Cytokine Kit (BD Biosciences). The assay was performed according to the manufacturer's recommended protocol. The samples were acquired on a FACSCalibur (BD Biosciences) following the cytometer setup protocol. The FACS data was analyzed using the CBA 6 bead analysis software (BD Biosciences).CD4+CD25high and CD4+CD25\u2212 T-cells were isolated from 6 buffy coats by FACS sorting as previously described in the cell isolation procedure above. Cells were plated at 75,000 cells per well under the following 6 conditions: TCR-Co ; TCR-Co+IL-2 ; TCR-Co+anti-IL-2 ; TCR-Co+IL-4 ; TCR-Co+anti-IL-4 ; and TCR-Co+anti-IL-2 (2 \u00b5g/ml)+anti-IL-4 (1 \u00b5g/ml). The cells were incubated at 37\u00b0C/5% CO2 and at the indicated time points , the cells were removed from the wells and 25,000 cells were used to measure apoptosis as previously described in CD4Figure S1Raw proliferation counts (cpm) for suppression assay. T-cell proliferation (cpm) in media only (background), single culture (only CD25- Teffs) and in co-culture (Tregs and CD25- Teffs) for both the phenotypic groups is shown for the suppression results shown in (0.03 MB TIF)Click here for additional data file.Figure S2Representative flow cytometry plot for measurement of Treg Apoptosis. Figure shows one representative FACS plot for measurement of Treg apoptosis, as described in the (0.09 MB TIF)Click here for additional data file.Figure S3Cytokine production from CD4+CD25- and CD4+CD25low effector T cell subsets. Production of some important cytokines was measured by a CBA assay, as described in the (0.03 MB TIF)Click here for additional data file.Figure S4Purity of FACS isolated CD4+CD25high T-cells. (A) Standardized sorting procedure based on gating of top 1.2% CD25-expressing CD4+ T-cells as CD4+CD25high (Tregs). Both CD4+CD25- and CD4+CD25high cell subsets were checked for CD127 expression. Most of CD4+CD25high T-cells do not express CD127 (80.5%) and most of CD4+CD25- -T-cells do express CD127 (87.1%). This is representative of 4 samples. (B) Intracellular staining for FOXP3 in CD4+CD25- and CD4+CD25high T-cells.(0.04 MB TIF)Click here for additional data file.Figure S5Quality assessment of the arrays using AffyQC package. These plots assess the overall signal quality for the arrays. (A) Boxplots of all the pm (perfect match) intensities for 12 T1D subjects (left) and 15 control subjects (right). (B) Density plot of the intensities  for 12 T1D subjects (left) and 15 control subjects (right). These plots suggest that arrays used in this study are good quality as none of the arrays have a low average intensity or a significantly different shaped density. (C) RNA digestion plot for (left) 15 control subjects and (right) 12 T1D subjects. The mean intensity of expression of all genes on each array is plotted as a function of 5\u2032-3\u2032 position of probes. For each array and within each probe-set, probes are arranged by their proximity to the 5\u2032 end of the gene. The plot shows the average intensity of the probes as a function of 5\u2032-3\u2032 position of probes. Each line corresponds to an array and the slope of its trend indicates potential RNA degradation of the genetic material hybridized to the array. Parallel lines indicate similar RNA degradation patterns across arrays.(0.14 MB TIF)Click here for additional data file.Figure S6Flowchart of the gene expression analysis pipeline(0.03 MB TIF)Click here for additional data file.Figure S7BGX measures and estimation of differentially expressed genes. These plots summarise the main steps of the BGX algorithm. (A) Kernel density plots are calculated for the expression of each gene (n\u200a=\u200a1 to 54675) in each phenotype, from the cumulative information from all subjects within a phenotype. (B) The corresponding plots of the posterior distribution of the expression differences are calculated for each gene across the two phenotypes. (C) Histogram of the posterior distribution of expression differences. Under the null hypothesis, the histogram of the posterior distribution of expression differences P(dg<0) will be unimodal with a mode of 0.5 and have smoothly decreasing tails. Towards the two tails of the histogram, the observed deviations from the expected shape indicate the presence of differentially expressed genes. The black curve is the expected distribution (by Efron's method (0.06 MB TIF)Click here for additional data file."}
+{"text": "A secondary objective is to integrate these significant improvements in diagnostic and prognostic biomedical applications into the clinical research arena. That is, to devise a framework for converting SLT results into direct, useful clinical information for patient care or pharmaceutical research. We, therefore, propose and preliminarily evaluate, a process whereby PLS, K-PLS, and Support Vector Machines (SVM) may be integrated with the accepted and well understood traditional biostatistical \"gold standard\", Cox Proportional Hazard model and Kaplan-Meier survival analysis methods. Specifically, this new combination will be illustrated with both PLS and Kaplan-Meier followed by PLS and Cox Hazard Ratios (CHR) and can be easily extended for both the K-PLS and SVM paradigms. Finally, these previously described processes are contained in the Fine Feature Selection (FFS) component of our overall feature reduction/evaluation process, which consists of the following components: 1.) coarse feature reduction, 2.) fine feature selection and 3.) classification (as described in this paper) and prediction.The primary objectives of this paper are: 1.) to apply Statistical Learning Theory (SLT), specifically Partial Least Squares (PLS) and Kernelized PLS (K-PLS), to the universal \"feature-rich/case-poor\"  and 3.996732 (60 months).Our results for PLS and K-PLS showed that these techniques, as part of our overall feature reduction process, performed well on noisy microarray data. The best performance was a good 0.794 Area Under a Receiver Operating Characteristic (ROC) Curve (AUC) for classification of recurrence prior to or after 36 months and a strong 0.869 AUC for classification of recurrence prior to or after 60 months. Kaplan-Meier curves for the classification groups were clearly separated, with SLT techniques such as PLS and K-PLS can effectively address difficult problems with analyzing biomedical data such as microarrays. The combinations with established biostatistical techniques demonstrated in this paper allow these methods to move from academic research and into clinical practice. The statistical problems are daunting because of the large number of represented genes relative to the small number of samples. This provides a prime opportunity to over-fit the data during the model building process. Biology is a significant component because identifying significant genes representative of a given clinical endpoint is a critical step toward understanding the biological process. Several consequences arise as a result of the statistical over-fitting problem. Very large Receiver Operating Characteristic (ROC) Area Under the Curve (AUC) values can be achieved on both training and validation data sets, but the results provided by these trained Complex Adaptive Systems (CAS) frequently fail to generalize to data sets other than training and validation sets. Furthermore, these CAS system designs do not necessarily operate on similar data sets with larger representative samples. Different CAS solutions may produce different gene sets from the same set of microarray data. Consequently, any CAS should first attempt to achieve some sort of generalization ability. Secondly, because of the over-fitting problem described above, each proposed feature (or gene) reduction CAS generally is based on a unique theoretical analysis, which means that how these separate CAS are connected is not well understood. Consequently, this difficulty results in the same problem stated above: different algorithms will generate different prognostic gene sets using the same microarray data. This means that developing an underlying theory for feature selection would help to understand these algorithms as well as classify which of these are the \"most\" useful for gene selection. Song  presentst-test , (3) sigt-test , (4) Cent-test ,8, (5) St-test ,10, and t-test . These ct-test ,13 with Lung cancer is the leading cause of death in cancer patients worldwide. The American Cancer Society predicts that 156,940 people will fall victim to the disease in 2011, accounting for 27% of all cancer deaths . The 5-yet al. [The experiments designed used the gene expression profiles of 442 lung adenocarcinomas compiled by Shedded et al. . These set al. [It is important to note that in Dobbin et al.  these sahttps://array.nci.nih.gov/caarray/project/details.action?project.id=182. Other work with this data set is described in [Gene expression profiles of all samples were quantified using the Affymetrix Human Genome-U133A GeneChip. The resulting CEL files generated at each of the four institutions were quantile normalized using the NCI_U133A_61L array as a reference. Final expression values were calculated using the DChip software (Build version February 2006) using the default settings. Each sample is characterized by 22,283 probes/genes  as well as a host of clinical covariates including age, gender, and T/N cancer stage. A few minor discrepancies were found in the probe data obtained from the caArray website. First, probe 207140 at contained expression values of \"NA\" for all patients in the study. To mitigate this problem, the data corresponding to this probe were removed prior to our analysis. Secondly, patients Moff 18351, Moff 2362A and Moff 3009D did not have expression values for the 222086_s_at probe. In lieu of removing this probe entirely, the data for these patients were assigned an expression value equal to the mean (18.37114) of that probe's expression values across all other patients. The CEL files, DChip normalized expression values and clinical information for all patients involved in this study are available through the caArray website ribed in .To address the clinical issue of determining risk of recurrence delineated above, two classification experiments were designed. The first experiment classified NSCLC patients as \"high risk\" if cancer were likely to recur within 3 years of surgery and \"low risk\" otherwise. The 3 year cut-off was chosen because the majority of patients that do relapse will do so within the first 3 years . The secet al. [The first experiment contained 295 patients obtained from the Shedden et al.  data setet al. [et al. [The second experiment was composed of 257 patients, which were also obtained from the Shedden et al.  data set [et al.  showed tMicroarray data sets have a significant feature-rich/case-poor problem which can lead to over-fitting  unless the number of features are significantly reduced prior to the generation of any classification or prediction model. The objective of this three-step process is to identify those significant features which are most useful in producing an accurate classification or prediction model. The process of feature reduction/classification is depicted in Figure t-test followed by variance pruning (cut-off based on coefficient of variation). It is a simple process to remove lot of probes that are not useful for classification, i.e., those not considered statistically significant to classification. See [The automated CFR employees a simple two sample ion. See -24 for dy is predicted from p coordinates and n observations, denoted by X = {x1,x2, ...xn}T, where each y response as well as the covariate space and are denoted by the following expressions:This section contains a brief, heuristic overview of Partial Least Squares (PLS). PLS is an extension of least squares regression (LSR). In LSR, the response variable where:ts = the sth latent variable . Generally most of the variability is characterized by M latent variables with a maximum of M = 5 required for most problems.\u2022 ps and qs = the sth weight vectors .\u2022 \u03b5, \u03b6 = small errors in the remaining parts not explained by the latent variables.\u2022 y response while, at the same time, accounting for the feature space variability. A summary of the features and advantages of PLS follows:For this microarray data set, we began with 271 features after CFR and reduced this set to a minimum of 1 latent variable and a maximum of 5 latent variables (see Results section). Therefore, the principle advantage of PLS for a problem of this type is its ability to handle a very large number of features: a fundamental problem of a feature-rich/case-poor data set. PLS then performs a least-squares fit (LSF) onto these latent variables, where this LSF is a linear combination that is highly correlated with the desired \u2022 PLS algorithms are very resistant to over-fitting, when compared to LSR, and are fast and reasonably easy to implement.\u2022 For most problems with few data points and high dimensionality where PLS excels, a least squares solution may not be possible due to the singularity problem.W projection matrix and computes a least squares solution in this space. See the algorithm below for the definition of W.\u2022 PLS regression maps the original data into a lower-dimensional space using a \u2022 What makes PLS especially interesting for biomedical and data mining applications is its extension using kernels, which leads to kernelized PLS (K-PLS), similar to the treatment in SVM.\u2022 PLS may be considered a better principal component analysis (PCA).X and response y  in the process of computing the projection matrix W.- The first key difference from PCA is that PLS computes an orthogonal factorization of the input vector - The second key difference from PCA is that the least squares model for K-PLS is based on approximation of the input and response data, not the original data.XTX in PCA) is not a set of succession of orthogonal directions that explain the largest variance in data, but rather are a set of conjugate gradient vectors in the correlation matrices which span a Krylov space.- PLS and PCA use different mathematical models to compute the final regression coefficients. Specifically, the difference between PCA and PLS is that a new set of basis vectors Tym(a) Compute direction of maximum variance\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0X onto w\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0tm = Xm w m(b) Project t\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0tm = tm/|tm|(c) Normalize X\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0Xm+1 = Xm-tm(tm)TXm(d) Deflate y\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0ym+1 = ym-tm(tm)Tym(e) Deflate Y after deflation\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0ym+1 = ym+1/|ym+1|(f) Normalize \u03b2 = W(TTXW)-1TTy3. Finally, compute the regression coefficients using latent variables:\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0\u00a0where:wm is the mth column vector of W\u2022 tm is the mth column vector of T\u2022 Xm and ym are the input matrix and response vector that are being deflated, and \u03b2 is the linear regression coefficient vector. A geometric representation of part of the algorithm and the insight of deflation can be seen in Figure \u2022 \u03d5, which maps any data vector from the sample space to some other  Euclidean space Non-linear relationships between variables may be found by embedding this data into a kernel induced feature space. See  for a goThe mapping will \"recode\" the data set as:X space is non-linear, after the data are processed by the \u03d5 mapping, the data characterized by this mapping is linear in This mapping of the data set is from non-linear input space to a linear feature space. That is, although the environment data representation in the input K computes the inner products \u2329\u03d5(x1),\u03d5(x2)\u232a in the feature space x1 and x2, without having to explicitly perform the mapping, making the technique computationally efficient. This is especially useful for algorithms that only depend on the inner product of the sample vectors, such as SVM and PLS.Adding this kernel-induced capability to the PLS approach means that a real time, non-linear optimal training method now exists which can be used to perform computer aided diagnosis. A second advantage of this approach is that a kernel function Computationally, kernel mappings have the following important properties: (1) they enable access to exceptionally high (even infinitely) dimensional and, consequently, very flexible feature space, with a correspondingly low time and space computational cost, (2) they solve the convex optimization problem without becoming \"trapped\" in local minimal and, more importantly, (3) the approach decouples the design of the algorithms from the specifications of the feature space. Therefore, both learning algorithms and specific kernel designs are not as difficult to analyze.The algorithm used to develop the K-PLS model, is given below. Details can be found in .K0 = (Kij = \u2329\u03d5(xi), \u03d5(xj)\u232a = K) be the n by n Gram matrix induced by K, the selected kernel function corresponding to \u03d5(\u00b7). Let K1 be the centered form of K0,y be the be the response variable, normalized to have a mean of 0 and a standard deviation of 1, and M be the desired number of latent variables.1. Let m = 1 to M, do:2. For tm = Km \u00b7 ym(a) (b) (c) (d) (e) 3. Finally, compute the regression coefficients using: I is an m \u00d7 m identity matrix\u2022 Km is the Gram matrix\u2022 tm and ym are the mth columns of T and Y respectively\u2022 4. The regression equation then becomes:x is any sample from the testing data to be predicted and K1 is element from the centered form of the training/testing kernel matrix.Note The particular K-PLS kernel types and kernel parameters were derived using an evolutionary process based on the work of Fogel  called EThis process iteratively generates, valuates, and selects candidates to produce a near-optimal solution without using gradient information, and is therefore well suited to the task of simultaneously generating both the K-PLS model architecture (kernel) and parameters. Figure Initial K-PLS parameter population created: A population of candidate solutions (K-PLS kernel architectures and parameters) is randomly generated.1. Mutation of K-PLS machines: Each of these candidate solutions then is copied and mutated, yielding a solution pool of twice the original size, using the equation given below:2. m is the total number of configurable parameters being evolved, N is a standard normal random variable sampled once for all m parameters of the v vector, and Ni is a standard normal random variable sampled for each of the m parameters in the v vector.where i denote these elements for each of the individual member of the population, this update process will be accomplished as follows:The second step of this mutation process comprises the updating of each configurable parameter for all elements of the evolving population. If we let the vector \u03b3C is a standard Cauchy random variable. It is used because it has longer tails and offers better mutation performance.Here Selection of K-PLS machines: All elements of this pool are scored using an objective function. These objective function scores are then used to order the candidate solutions from the \"most fit\" to \"least fit.\" Better results usually are obtained from using tournament selection methodologies. With tournament selection, each candidate solution competes against a random subset of the remaining solutions. Finally, the upper 50% of the solution pool is selected to continue as the basis for the next generation and the remaining 50% are \"killed off\" (discarded) to reduce the pool to the original population size. This process is generally repeated for a specified number of generations, unless some other \"stopping\" criteria is used.3. For more details on the EP process, refer to our previous work .The K-PLS results were validated by using another kernel-based Statistical Learning Theory model called a Kernelized Support Vector Machine (K-SVM). SVMs was developed by Vapnik -31. TutoThe discussion below provides the theoretical explanation for why SVMs can always be trained to a global minimum, and thereby should provide better diagnostic accuracy, when compared with neural network performance trained by back propagation.n experimentally derived observations. Each observation (or training example) consists of a vector xi containing the input pattern and a corresponding known classification yi. The objective of the learning machine is to formulate a mapping xi \u2192 yi. Now consider a set of functions f with adjustable parameters \u03b1, that defines a set of possible mappings x \u2192 f. Here, x is given and \u03b1 is chosen. In the case of a traditional neural network of fixed architecture, the \u03b1 values would correspond to the weights and biases. The quantity R(\u03b1), known as the expected risk, associated with learning machines is defined as:Assume there exist p is an unknown probability density function from which the examples were drawn. This risk function is the expected value of the test  error for a trained learning machine. It may be shown that the best possible generalization ability of a learning machine is achieved by minimizing R(\u03b1), the expected risk. There exists a error bound of generalization, for binary classification, which holds with the probability of at least 1 - \u03b7, 0 \u2264 \u03b7 \u2264 1 for all approximating functions that minimize the expected risk.where, Remp(\u03b1), is known as the \"empirical risk\", expressed by:The first term on the right hand side, \u03b1 and a given training set {,i = 1,2, \u00b7\u00b7\u00b7n}. The second term in (9) is the \"Vapnik-Chervonenkis (VC) confidence interval.\" This term is a function of the number of training samples n, the probability value \u03b7 and the VC dimension h. The VC dimension is the maximum number of training samples that can be learned by a learning machine without error for all possible labeling of the classification functions f, and is, therefore, a measure of the capacity of the learning machine. In traditional neural network implementations, the confidence interval is fixed by choosing a network architecture a priori. Neural network training by back-propagation minimizes the empirical risk only.Empirical risk is a measure of the error rate for the training set for a fixed, finite number of observations. This value is fixed for a particular choice of n \u2192 \u221e, the empirical risk approaches the true risk because the VC confidence interval risk approaches zero. The reader may recall that obtaining larger and larger sets of valid training data would sometimes produce  a better performing neural network using classical training methods. This restriction is not incumbent on the SRM principle and is the fundamental difference between training neural networks and training SVMs. Finally, because SVMs minimize the expected risk, they provide a global minimum.In contrast to neural network, in a SVM design and implementation, not only is the empirical risk minimized, the VC confidence interval is also minimized by using the principles of structural risk minimization (SRM). Therefore, SVM implementations simultaneously minimize the empirical risk as well as the risk associated with the VC confidence interval, as defined in the above expression. The bound in (9) also shows that as Understanding what similarity as applied to K-PLS and K-SVM often provides additional insight in proper kernel selection. Therefore, we now consider kernel functions and their application to K-PLS and K-SVMs. K-PLS and K-SVM solutions in non-linear, non-separable learning environments utilize kernel based learning methods. Consequently, it is important to understand the practical implications of using these kernels. Kernel based learning methods are those methods which use a kernel as a non-linear similarity to perform comparisons. That is, these kernel mappings are used to construct a decision surface that is non-linear in the input space, but has a linear image in the feature space. To be a valid mapping, these inner product kernels must be symmetric and also satisfy Mercer's theorem . The conA kernel function should yield a higher output from input vectors which are very similar than from input vectors which are less similar. An ideal kernel would provide an exact mapping from the input space to a feature space which was a precise, separable model of the two input classes; however, such a model is usually unobtainable, particularly for complex, real-world problems, and those problems in which the input vector provided contains only a subset of the information content needed to make the classes completely separable. As such, a number of statistically-based kernel functions have been developed, each providing a mapping into a generic feature space that provides a reasonable approximation to the true feature space for a wide variety of problem domains. The kernel function that best represents the true similarity between the input vectors will yield the best results, and kernel functions that poorly discriminate between similar and dissimilar input vectors will yield poor results. As such, intelligent kernel selection requires at least a basic understanding of the source data and the ways different kernels will interpret that data.Some of the more popular kernel functions are the (linear) dot product (11), the polynomial kernel (12), the Gaussian Radial Basis Function (GRBF) (13), and the Exponential Radial Basis Function (ERBF) (14), which will be discussed below.The dot and polynomial kernels are given by,i.e., unit vectors). This restricts the range of the dot product in (12) to \u00b11, yielding kernel outputs between 0 and 2d, where d is the degree of the polynomial. The implication of the dot product kernel having a positive and negative range  is that the classification process can learn from the unknown vector's dissimilarity to a known sample, rather than just its similarity. While the dot product kernel will give relatively equal consideration to similar and dissimilar input vectors, the polynomial kernel will give exponentially greater consideration to those cases which are very similar than those that are orthogonal or dissimilar. The value of d determines the relative importance given to the more similar cases, with higher values implying a greater importance. Measures of similarity for these two kernels are depicted in Figures respectively, both use the dot product (and therefore the angle between the vectors) to express similarity; however, the input vectors to the polynomial kernel must be normalized  Curve. These two techniques each help address the question of how important a particular parameter is to evaluating risk/survival. The following subsections will give a basic overview of how Cox and K-M can be combined with our techniques. For simplicity, such a combination will only be described with PLS, though it could just as easily be done with KPLS or SVM.and the total number of patients. These removals are marked on a K-M curve with a cross. The best way to utilize a K-M curve is to create different curves for different groups and compare them. For instance, a K-M curve for men and one for women would be far apart if a particular condition was much more fatal in one gender than the other. Using this concept with our techniques, we can use the PLS (or KPLS/SVM) to split a data set of patients into good and poor prognosis categories. This can be done by first splitting training data around some cut-off survival time , such as survival before or after 36-months, and training the system to make predictions on a validation set. K-M curves can then be made for those predicted groups, and if the difference between them is significant, then the system is performing well. A chi-square test is the standard for comparing curves, and a p-value derived from that test of below .05 would indicate statistically significant difference between the two prognosis categories predicted by PLS.Developed in the 1950s, the K-M curve is the gold standard in survival analysis . In a noAnother common survival analysis technique is the Cox Proportional Hazard model . The CoxThe goal of the experiments discussed herein were to derive models from the microarray data to classify each sample as belonging to either the class of recurrent or non-recurrent patients. The class of non-recurrent samples are those samples belonging to patients which, after being treated did not recur cancer before the given cut-off period. Patients that did recur cancer before the cut-off period are considered to belong to the recurrent class. Two separate experiments were performed with cut-off periods of 36 and 60 months respectively.As mentioned in the Methods section, the data were pre-processed using CFR, followed by FFS, and finally classification model building and evaluation.t-test p-value of 0.05. Then, this probe count was further reduced to 594 using a coefficient of variation cut-off of 0.632. In like manner, using CFR for the 60 month classification experiment, the number of probes was reduced from 22,282 to 829 using the same hard cut-off t-test p-value of 0.05. This number was then further reduced to 212 using coefficient of variation cut-off of 0.641. After reducing the initial feature set using the CFR technique, the process of FFS and classification was performed.For the 36 month classification experiment, CFR was used to reduce the original number of features (probes) from 22,282 to 2,675 using a hard cut-off In this section, we use the AUC value as the fitness metric to evaluate the relative worth of the classification model. Higher AUC values are indicative of better classifiers, with an AUC value of 1.0 indicating a perfect classifier, which is arguably impossible for any non-trivial classification task.The FFS process utilizes the weight vector of the first latent variable generated by the Linear PLS (L-PLS) algorithm to ascertain feature importance. The most important features (those with the largest corresponding weight vector components) are ranked highest and features with lower corresponding components are discarded. This step, called Fine Feature Selection, provides a ranking of importance, which means the magnitude of each feature's respective component is directly correlated with its predictive power in the model.The FFS process builds this \"importance metric\" by iterating the analysis of the weight vectors of randomly assigned training folds 10,000 times employing three sensitivity settings, where these three sensitivities score the top 20, 30, and 150 most influential performers for each of their respective 10,000 runs, based on each feature's weight in the weight vector of L-PLS. For example, if 'Age' has the largest component and 'Sex' has the second largest in the top 30 sensitivity setting, the score for 'Age' would be 30 and that for 'Sex' would be 29. For each run time, the data is split randomly into training and validation folds. These data are normalized then analyzed using Linear PLS and the weight vector is extracted, sorted, and 'winning' features have their scores updated by position.p, of features are retained based on theirs aggregated score over 10000 runs. The number to retain, p, is user-specified. In FFS, we tried several p values, with increments of 50 features, beginning at 50 and ending at 550. By gradually increasing the size of feature retention, one can empirically optimize the number of features for classification/prediction. Lastly, a 'global (most important) feature set (SFFS)' is created, which is the union of the retained feature sets from all three settings. These SFFS features are the final product of the FFS process and the only ones included in the construction of the refined input data matrix, XFFS. In summary, SFFS is given by:In each of the three settings, a number, l = 20, 30, 150, and p = the number of features retained in each setting. Note that the number of features in p or p.where In our study, we have selected 361 and 102 features using this FFS process for the 36- and 60-month experiment respectively, from the 594 and 212 features that were selected by CFR.As noted, we compared four separate models' performances based on different data: L-PLS and K-PLS Polynomial Kernel (KPLS-Poly) based on the Coarse Feature Reduced (CFR) data, and on the Fine Feature Selected (FFS) data respectively .\u2022 We sought out to determine which model produced the most accurate prediction of recurrence.\u2022 We also sought to determine whether the data was linear or non-linear, which was determined by which class of model yielded better results: L-PLS or K-PLS with non-linear kernels.PLS weight vector-based Fine Feature Selection method. This was determined by the comparison between the validation AUC values for the same models on the CFR-data and the FFS-data. If the results on the FFS-data are better than the CFR-data, then FFS is effective.\u2022 Finally, we sought to determine the effectiveness of our What we found was that both the 36-month and 60-month data sets were inherently linear in nature, meaning the L-PLS gave better AUC values on validation folds. These results can be seen in Table In addition to these findings, the number of latent variables required to reach optimal performance, by L-PLS and KPLS-Poly when they are applied to the FFS processed data was roughly the same . For 60-months, it was 3.996732(2.828351 and 5.647768 for 95% confidence). These numbers show a significantly increased risk of recurrence over time with being in the poor prognosis group versus the good prognosis group. These two statistics, the K-M curve derived p-values and CHR, are values which can be directly understood by clinicians without further training. In other words, with this framework, any new patient's data could be sent to us by any doctor who reads this article, given a categorization by the system as it is currently setup, and then the doctor can take that knowledge and make decisions on how frequent to make checkups and other treatment decisions.K-M curves for both PLS using 36 and 60 months can be seen in Figures Our microarray analysis and information extraction method comprised three basic components drawing from Statistical Learning Theory: 1.) Coarse Feature Reduction, 2.) Fine Feature Selection and 3.) Classification.In Coarse Feature Reduction, the original 22,282 probes were reduced to 594 for the 3 year cut-off (97.5% reduction) and to 212 for the 5 year cut-off (99.04% reduction) using basic t-test and variance pruning techniques. The Fine Feature Selection was able to further reduce the number of features to 361 for the 60-month and 102 for the 36-month data sets (a further reduction of 39.2% and 51.9%). The FFS process has been demonstrated to reduce the noise in the data by filtering out noisy features from the data set produced by the CFR process. By implementing the FFS process in our analysis, we were able to enhance the performance of our classifier.After utilizing the FFS process, classification comparison is made for the refined data. The optimal classifying performance of L-PLS was observed at 3 latent variables and 2 latent variables for the 36- and 60-month experiments, respectively. Similar results were obtained, a reduction to 3 and 1 latent variables, when using L-PLS on data refined only by CFR. The Area Under the Curve (AUC) measure of performance varied from 0.791 to 0.869, depending upon the particular L-PLS or K-PLS and SVM model used (see Tables p = 4.74e-12) for the 36-month cut-off and a p ~0 for the 60-month cut-off. , which are directly understood by practicing clinicians without additional training and were pre-processed using the PLS and KPLS algorithms, was made possible by the SLT pre-processing we applied in this study.This research also provided a secondary and clinically important result, which is that the improved SLT methods/paradigms can be integrated into the widely accepted and well understood traditional bio-statistical Cox Proportional Hazard model and the K-M methods. For example, using the SLT paradigms as pre-processors for K-M, the resultant probability vs. survival time categories have a very significant difference  statistical learning theory and complex adaptive systems approaches employed in this paper. WSF, DEM, CTP and JFPR were involved in the experimental design used to ascertain the efficacy of these SLT algorithms in assessing the treatment of non-small cell lung cancer. WHL, WSF, DEM, XQ, CTP and JFPR were involved in the results analysis and provided many useful scientific insights. YD coordinated and directed the whole project. YD, JYY and JAB provided the data sets and provided clinical insight/analysis for these data sets. All co-authors participated in the final analysis and reviews of the results of these experiments and agreed on the content of the paper."}
+{"text": "Transsphenoidal neurosurgery is the accepted first-line treatment of acromegaly in the majority of patients. Previous studies addressing preoperative somatostatin analog (SSA) treatment and subsequent surgical cure rates are conflicting, reporting either benefits or no significant differences.The aim of this study, based on a meta-analysis of all published reports, was to investigate whether treatment with SSA before surgery improves the surgical outcome of acromegaly.All studies of preoperative treatment of acromegaly with SSA were systematically reviewed up to December 2011. We searched the Medline, Embase, Cochrane and Google Scholar electronic databases. Study Selection: The primary endpoint was the biochemical postoperative cure rate. We identified 286 studies, out of which 10 studies (3.49%) fulfilling the eligibility criteria were selected for analysis; five retrospective studies with a control group, two prospective non-randomized trials, and three prospective controlled trials. The meta-analysis was conducted using the random-effects model.Data were extracted from published reports by two independent observers. Data Synthesis: A borderline effect was detected in the analysis of all of the trials with control groups, with a pooled odds ratio (OR) for biochemical cure with SSA treatment of 1.62 . In the analysis of the three prospective controlled trials, a statistically significant effect was idenfified OR: 3.62 .Preoperative treatment with SSA og GH-secreting pituitary adenomas shows a significant improvement on surgical results. This meta-analysis suggests that in centers without optimal results all patients with a GH-secreting pituitary macroadenoma should be treated with a long-acting SSA prior to surgical treatment. Acromegaly is a rare but severe endocrine disease due to excess GH production, caused by a pituitary adenoma in the vast majority of cases (around 98%). The incidence of acromegaly is approximately 5 cases per million per year and the prevalence is 60 cases per million Transsphenoidal neurosurgery is the accepted first-line treatment of acromegaly in the majority of patients. Outcome predictors include tumour size, extrasellar extension, cavernous sinus or dural invasion, pretreatment GH and IGF-I levels and surgical expertise Primary or secondary medical treatment of acromegaly with somatostatin analog (SSA) can lead to relief of symptoms Previous studies addressing preoperative SSA treatment and subsequent surgical cure rates are conflicting, reporting benefit The aim of this study, based on meta-analysis of all published reports, was to investigate whether treatment with somatostatin analogs before surgery improves the surgical outcome of acromegaly.All studies on the preoperative treatment of acromegaly with somatostatin analogs were systematically reviewed up to December 2011 . The search strategy was unrestricted. We included studies investigating the effect of preoperative somatostatin analogs treatment on postoperative cure rates, searching the Medline, Embase, Cochrane and Google Scholar electronic databases. With the aim of identifying additional candidate studies, we reviewed the reference list of the eligible primary studies, narrative reviews and systematic reviews. In cases where multiple publications existed from the same study, the article with the most information was included. We identified 286 studies; we then exclude studies that were not original, studies that did not report outcomes of interest, studies whose full text could not be obtained, and studies with insufficient data for meta-analysis. We also excluded studies that did not report the surgical outcome or measure IGF-I. We identified twenty-one studies: eleven prospective or retrospective studies without a control group Data were extracted from published reports by two independent observers (FPG and FC). Discrepancies were resolved by discussion among the authors of this report. The following data were extracted: description of study characteristics, age, gender distribution, number of patients included, postoperative biochemical remission criteria as defined in the different studies , median and range, absolute values and percentage. The main outcome of interest was the percentage of postoperative biochemical cure rate. The odds ratio (OR) was used as a measure of association, with its 95% confidence interval. Statistical heterogeneity was assessed using Galbraith and L\u2019Abb\u00e9 plots, and the Q statistic from DerSimonian and Laird. The meta-analysis was conducted using the random-effects model, because of the marked clinical heterogeneity. The possibility of publication bias was assessed using a funnel plot. Funnel plot asymmetry was evaluated by Begg\u2019s and Egger\u2019s tests, and a significant publication bias was considered if the Data were analyzed by EPIDAT 3.1 software . All reported p-values are two sided, with significance set at p<0.05.Meta-analysis was first performed using all of the studies with a control group (n\u200a=\u200a10) and then with randomized prospective controlled trials (n\u200a=\u200a3).The characteristics of the retrospective or prospective studies with a control group (n\u200a=\u200a10) are shown in table 1. Participants in the trials tend to be middle-aged men or women; the mean age range was 40.6\u201347.5 years, with a percentage range for females of 40\u201354%. The number of patients in each trial ranged from 24 in the study by Kristoff et al The type of SSA used in most of the studies was short acting octreotide (table S1). In the most recent studies-Shen et al Differences in cure rates between treatment groups in the included studies are detailed in table S2. The cure rate was higher in the treatment group in the studies by Stevenaert et al Surgical outcome in published studies varies greatly. We analyzed if there was a relationship between untreated surgical outcome and SSA pretreatment results. Regression analysis of the cured percentage in untreated patients versus the odds ratio of the ten studies analyzed and presented in table S2, revealed a highly significant linear relationship  indicating that centers with good surgical results do not benefit from pretreatment and centers with worse surgical results benefit most from pretreatment. .The mean volume reduction in the treated group was evaluated in several studies. It varied from 40% in the study of Kristoff et al When only the three randomized prospective controlled trials We examined the funnel plot for signs of publication bias . No asymThis systematic review and meta-analysis refines the place of treatment with somatostatin analog before surgery in the surgical outcome of acromegaly. Based on biochemical cure and only including prospective randomized trials, preoperative treatment with somatostatin analog of GH-secreting pituitary adenomas shows a significant improvement on the surgical results, with an odds ratio (random effects) of 3.62 . We have found a highly significant relationship between untreated surgical outcome and SSA pretreatment results. These data indicate that centers with good surgical results do not benefit from pretreatment and centers with worse surgical results benefit most from pretreatment.Transsphenoidal neurosurgery is the accepted first-line treatment of acromegaly in the majority of patients. Even if it is not curative, surgical debulking of pituitary macroadenomas causing acromegaly improves control by SSA There are some clinical data which suggest that the main reason for the improved surgical outcome in the treated group was that drug pretreatment made some of the tumors less invasive When we compare the outcome of the preoperative treatment in the prospective randomized studies with the retrospective studies, the results are clearly better in the former. These results could be due to the fact that, from a clinical practice perspective, there should probably be a tendency to treat preoperatively patients with more biochemically active acromegaly, with greater GH and IGF-I. Patients with more biochemically active acromegaly have a worse prognosis for postoperative cure We analyzed the possibility of publication bias (when only the positive results are published) using a funnel plot . No asymWe could not conduct a specific meta-analysis for adenomas considered to be non-resectable due to a lack of information in most of the articles reviewed. Some studies suggest that presurgical treatment did not improve the results in macroadenomas considered to be non-resectable This study has several limitations. The first is the small number of studies available. To overcome this limitation, we decided to pool the prospective and retrospective studies. In this analysis, although there was a clear trend towards an improvement in the cure rate, the results show a positive borderline significant effect. However, when we only analyzed prospective randomized control studies (n\u200a=\u200a3), we found a clearly significant improvement in the surgical cure with SSA pretreatment. The second limitation is the length of the postoperative evaluation period. An ideal period could be 1 year after SSA withdrawal, in order to exclude any lingering effect of presurgical SSA treatment on the outcome In conclusion, the present meta-analysis suggests that in centers without optimal surgical results all patients with a GH-secreting pituitary macroadenoma should be treated with a long-acting somatostatin analog prior to surgical treatment.Figure S1Preoperative treatment of acromegaly with somatostatin analog on surgical outcome. Literature review.(TIF)Click here for additional data file.Figure S2Forest plot of trials of preoperative treatment of acromegaly with somatostatin analog on surgical outcome.(TIF)Click here for additional data file.Figure S3Regression analysis: Cured percentage in untreated patients versus the Odds Ratio from .(TIF)Click here for additional data file.Figure S4Funnel plot of preoperative treatment of acromegaly with somatostatin analog on surgical outcome.(TIF)Click here for additional data file.Table S1Characteristics of the studies, with control group, evaluating the effect of preoperative treatment of acromegaly with somatostatin analog (SSA) on surgical outcome.(DOC)Click here for additional data file.Table S2Preoperative treatment of acromegaly with somatostatin analog on surgical outcome. Differences in cure rates between treatment groups in the studies included.(DOC)Click here for additional data file.Table S3Preoperative treatment of acromegaly with somatostatin analog on surgical outcome. Sensitivity analysis.(DOC)Click here for additional data file."}
+{"text": "Recent studies have revealed the systematic altering of gene expression in human peripheral blood during the early stages of ischemic stroke, which suggests a new potential approach for the rapid diagnosis or prediction of stroke onset. Nevertheless, due to the difficulties of collecting human samples during proper disease stages, related studies are rather restricted. Many studies have instead been performed on manipulated animal models for investigating the regulation patterns of biomarkers during different stroke stages. An important inquiry is how well the findings of animal models can be replicated in human cases. Here, a method is proposed based on PageRank scores of miRNA-mRNA interaction network to select ischemic stroke biomarkers derived from rat brain samples, and biomarkers are validated with two human peripheral blood gene expression datasets. Hierarchical clustering results revealed that the achieved biomarkers clearly separate the blood gene expression of stroke patients and healthy people. Literature searches and functional analyses further validated the biological significance of these biomarkers. Compared to the traditional methods, such as differential expression, the proposed approach is more stable and accurate in detecting cross-species biomarkers with biological relevance, thereby suggesting an efficient approach of re-using gene biomarkers obtained from animal-model studies for human diseases. With the advent of molecular biotechnology, investigations on the molecular mechanism of cerebrovascular accidents are garnering increasing attention123456791415Nevertheless, sample collection poses a severe challenge to in-depth studies of human stroke genomics. Due to the suddenness of stroke onset, it is difficult to capture the blood sample of patients at the desired stage. Furthermore, for ethical reasons, it is essentially impossible to deliberately control the clinical status of a patient to observe the corresponding gene expression changes. Accordingly, rather than human subjects, animal models are then employed by many studies to infer the genomic mechanism of stroke and discover potential molecular biomarkers1718192021222324In this paper, an approach to extract gene biomarkers and prediction models from the results of animal model experiments that can be reliably replicated on human subjects is proposed. The basic idea is to make use of the gene interaction information revealed in the development of the disease and identify hub genes that are essential in forming the gene interaction systems. In contrast to traditional differential expression analysis, this approach is more robust across platforms because hub genes are key components of the gene regulatory network that reflects the full picture of gene interaction, which is more stable across species as compared to individual genes. The technology is further applied to build a gene diagnosis model from the animal gene expression data and validate it on several human gene expression datasets of stroke patients. Due to the large number of differentially expressed mRNAs and the small number of training samples, it is impractical to construct a complete gene interaction network. In taking advantage of the fact that miRNA has been discovered to play important regulatory roles in stroke developmentThe study involved two types of microarray datasets. The mRNA and miRNA expression profiles from manipulated rat samples were used for identifying stroke gene biomarkers. Then, two human mRNA expression profiles from healthy and stroke patients were used to validate the biomarkers discovered in the first stage.in vivo male wistar rats model (GSE25676) were downloaded from NCBI GEO29Parallel miRNA-mRNA expression profiles of permanent focal ischemia that was induced by permanent occlusion of the left middle cerebral artery (MCA) using a sub-temporal approachThe experimental group was treated as follows: (1) anesthetized rats with ketamine  and xylazine  and (2) exposed the MCA through a subtemporal craniectomy and cauterized it from the point proximal to its origin to the point where it intersected the inferior cerebral vein. Ischemic injury samples with i.c.v. injection of 80% DMSO and 30\u2009mM ZM447439 in 80% DMSO were named as the vehicle and treatment groups, respectively. The sham group was operated in the same way as the experimental group, just without the MCA occlusion. The RNA samples were collected from the right cortex of rats at 2 time-points (8-hour and 24-hour) for 3 experimental conditions .The dataset (GSE25676) was composed of two datasets: mRNA (GSE23651) and miRNA (GSE25556) expression profiles. The mRNA expression profiles (GSE23651) were performed on an Illumina ratRef-12\u2009v1.0 expression beadchip (GPL6101) with 22,524 probes for six conditions  including Sham-8\u2009h (n\u2009=\u20094), Vehicle-8\u2009h (n\u2009=\u20094), Treatment-8\u2009h (n\u2009=\u20094), Sham-24\u2009h (n\u2009=\u20094), Vehicle-24\u2009h (n\u2009=\u20094), and Treatment-24\u2009h (n\u2009=\u20094). The miRNA expression profiles (GSE25556) were performed on a miRCURY LNA microRNA Array, 5th generation - hsa, mmu & rno (GPL11241) with 361 probes for the same samples as the mRNA expression profiles.Two ischemic stroke mRNA expression profiles were downloaded from the NCBI GEO database that involved ischemic stroke patients in either the acute or recovery stage, along with healthy controls. The GSE16561 dataset contained the mRNA expression profiles of 39 acute ischemic stroke patients and 24 control subjects with the total RNA extracted from the whole blood and analyzed on the platform of Illumina HumanRef-8\u2009v3.0 expression beadchip (GPL6883)The systematical analyses were performed according to the following steps , and they were used to construct a miRNA-mRNA interaction network by connecting them with all 279 miRNA profiles. The correlation score between each miRNA-mRNA pair was calculated using the Pearson\u2019s correlation coefficient x represents one miRNA and y represents one mRNA. The range of r was  with 0 indicating no correlation, \u22121 indicating a strong negative correlation, and 1 indicating a strong positive correlation. A statistical test was performed based on the Pearson\u2019s product-moment correlation coefficient, and a p-value was given to show the significance of the r value. All the pairs with a p-value less than or equal to 0.05 and negative correlation scores (p\u2009<\u20090.05 and r\u2009<\u20090) were chosen to construct a weighted network. The nodes in the networks covered miRNAs and mRNAs, and each edge was weighted using the absolute value of the correlation score between the two nodes it connected.where It should be noted that, although only miRNA-mRNA links are considered in the network, due to the nature of statistical correlation, once a miRNA is involved in a signaling pathway, the mRNAs that directly interact with that miRNA as well as all of the mRNAs along the pathway will be assigned a score if the disturbances from other connections can be neglected. Thus, the method proposed in this paper will not only select genes that interact directly with many miRNAs, but it will also select hub genes that participate actively in various miRNA-mediated signaling pathways.The R package \u2018igraph\u2019Because the behavior of informative biomarkers may vary across species or disease stages even when the underlying mechanism is identical, it is not sufficient to directly test the cross-species replicates of the selected biomarkers using a prediction model built from animal samples. In order to validate the performance of the obtained gene biomarkers on human subjects, hierarchical clustering was carried out on the two human validation datasets in order to test whether these biomarkers could clearly separate healthy and stroke-afflicted people. The two test sets (IS expression profiles in human blood) were normalized using median normalization. The average-link hierarchical clustering was performed using function \u2018heatmap.2\u2019 in R package \u2018gplots\u2019 using the selected top-ranked mRNA biomarkers. In the ideal case, stroke patients and healthy people would be clustered into two distinct clusters. The number of incorrectly clustered samples was used to evaluate the quality of the biomarkers.In order to understand the biological role of the obtained gene biomarkers, functional annotation analyses were performed on the top-ranked mRNAs using the DAVID functional annotation tool3941To further demonstrate the gene selection performance, clustering analyses were carried out as proposed in the Methods section using the top three selected features of the two datasets. As is depicted in For comparison, a traditional differential expression (DE) analysis was also employed to select genes, and clustering analyses was performed using the top genes. Among the top 100 genes and all of the 49 miRNAs in the network, 45 genes and 32 miRNAs were identified that have been reported to be involved in stoke through a literature search in NCBI PubMed and Google Scholar. As listed in 43Using DAVID, the gene functions of the top 100 genes were annotated and enrichment analyses were performed, as is shown in 4546474849515657More than half (53) of the top 100 genes were found to be related to phosphoprotein, which is significantly enriched compared with normal backgrounds (p\u2009<\u20090.002). Although previous studies have discovered that some kinds of phosphor-proteins (such as VASP) are involved with brain-blood barrier damage or neural protections following stroke and other cerebral diseasesRecently, there has been a growing interest in investigating the genetic and genomics factors of cerebrovascular and cardiovascular diseases. Genetic factors are suspected to contribute greatly to the onset of stroke since traditional vascular risk factors, such as hypertension, cigarette smoking and diabetes mellitus may account for only about 30% of the population-attributable risk of IS. However, being an acquired disease, the pathology of how genetic risk factors turn into causes of stroke onset has not been well studied. Gene expression patterns may be the key to this question. On the other hand, it has been widely accepted that a prior history of stroke or transient ischemic attack (TIA) increases the risk of secondary stroke even when there is no observable sign of lasting damage. An investigation on the molecular-scale alternations following stroke or TIA would be a necessary step for revealing the underlying cause and exploring better therapeutic solutions. Despite the surging demands and the rapidly declining cost of gene expression profiling, molecular studies on human subjects are still very limited due to both technical and ethical difficulties. Animal models, under sophisticatedly designed experiment conditions, are still not a long-term substitutable platform for stroke genomics studies. An efficient method for translating the findings of animal experiments to human studies is an essential demand because human subjects are still rare, even if only used for validation purposes.In this paper, a method was proposed of discovering cross-platform biomarkers by taking advantage of gene interactions that are relatively stable across species and tissues. The miRNAs can perform their regulatory roles on two molecular levels: the mRNA and protein levels. However, due to the limitations of current datasets, only the mRNA level was considered in this paper. As is demonstrated in the experiment results, the proposed approach not only generates more replicable biomarkers across species and tissues, but it also captures key genes that are actively involved in various biological signal pathways, which is more helpful for in-depth studies of post-stroke pathology. By applying the method to peripheral blood samples collected from human stroke patients of different stages, it was discovered that molecular signals representing stroke-induced damages and responses, which originate from cerebral tissues, propagate into peripheral blood, and the effects persist into the recovery stages. This not only justifies the possibility of an efficient early diagnosis and prognosis of ischemic stroke using peripheral blood sampling, but it also provides some clue for explaining the cause of elevated risk for stroke and TIA patients after recovery, suggesting the need of exploring molecular therapeutic targets that help with rebuilding the gene regulatory patterns and inhibiting detrimental molecular signals.The fact that biomarkers derived from animal models can accurately indicate the stroke status of human subjects further validates the important value of molecular-level animal experiments in stroke studies. Currently, most animal studies are carried out with manipulated acute ischemic injuries, which may have some distinctions from human stroke in the real world. With future developments in experimental technologies, researchers would be able to emulate chronic stroke risk factors to obtain a more comprehensive knowledge of stroke pathology and prevention. In that situation, the present approach will be more advantageous in providing an efficient tool for exploring predictive biomarkers as well as biological pathways that can be easily translated to human patients, while also reducing the cost and time of the entire validation cycle.How to cite this article: Wang, Y. and Cai, Y. Obtaining Human Ischemic Stroke Gene Expression Biomarkers from Animal Models: A Cross-species Validation Study. Sci. Rep.6, 29693; doi: 10.1038/srep29693 (2016)."}
+{"text": "Scientific Reports7: Article number: 44628; 10.1038/srep44628 published online: 03162017; updated: 06212017.In this Article, Henry N. Chapman is incorrectly listed as being affiliated with \u2018Department of Biochemistry, Molecular Biology & Biophysics, University of Minnesota, Minneapolis, Minnesota 55455, USA\u2019 and an additional affiliation was omitted. The correct affiliations for Henry N. Chapman are listed below:Center for Free-Electron Laser Science, Deutsches Elektronen-Synchrotron DESY, Notkestra\u00dfe 85, 22607 Hamburg, GermanyDepartment of Physics, University of Hamburg, Luruper Chaussee 149, 22761 Hamburg, GermanyCentre for Ultrafast Imaging, Luruper Chaussee 149, 22761 Hamburg, GermanyIn addition, this Article contains typographical errors. In the Abstract,\u2018Moreover, the double flow-focusing nozzles were successfully tested with three other protein samples and the first room temperature structure of an extradiol ring-cleaving dioxygenase was solved by utilizing the improved operation and characteristics of these devices\u2019.Should read:\u2018Moreover, the double-flow focusing nozzles were successfully tested with three other protein samples and the first room temperature structure of an extradiol ring-cleaving dioxygenase was solved by utilizing the improved operation and characteristics of these devices\u2019.In the legend of Figure 1,\u2018Diagram of a SFX experiment at LCLS using a double flow-focusing nozzle (DFFN)\u2019.Should read:\u2018Diagram of a SFX experiment at LCLS using a double-flow focusing nozzle (DFFN)\u2019.In the Methods section, the subheading \u2018Double Flow-Focusing Nozzles\u2019.Should read:\u2018Double-Flow Focusing Nozzles\u2019."}
+{"text": "With multi-antenna synchronized global navigation satellite system (GNSS) receivers, the single difference (SD) between two antennas is able to eliminate both satellite and receiver clock error, thus it becomes necessary to reconsider the equivalency problem between the SD and double difference (DD) models. In this paper, we quantitatively compared the formal uncertainties and dispersions between multiple SD models and the DD model, and also carried out static and kinematic short baseline experiments. The theoretical and experimental results show that under a non-common clock scheme the SD and DD model are equivalent. Under a common clock scheme, if we estimate stochastic uncalibrated phase delay (UPD) parameters every epoch, this SD model is still equivalent to the DD model, but if we estimate only one UPD parameter for all epochs or take it as a known constant, the SD  and DD models are no longer equivalent. For the vertical component of baseline solutions, the formal uncertainties of the SD2 model are two times smaller than those of the DD model, and the dispersions of the SD2 model are even more than twice smaller than those of the DD model. In addition, to obtain baseline solutions, the SD2 model requires a minimum of three satellites, while the DD model requires a minimum of four satellites, which makes the SD2 more advantageous in attitude determination under sheltered environments. Attitude determination (AD) is an important branch in navigation for both ground-based and space-based platforms. Traditionally inertial measurement units (IMUs) play a predominant role in AD due to their high short-term precision. Since the direct measurements of an IMU are position acceleration and angular acceleration, systematic error accumulation inevitably affects its long-term precision. On the other hand, the global navigation satellite system (GNSS)-based AD demonstrates stable long-term precision due to its driftless performance, although its short-term precision is not yet comparable with that of a high-end IMU. Its low cost and light maintenance make this new technique more attractive. Previous studies have indicated that the GNSS-based AD was complementary to the IMU-based AD ,2,3,4,5,The double difference (DD) model is the most popular in GNSS data analysis, because the nature of the DD ambiguity is integer and its corresponding ambiguity resolution is much more straightforward ,13,14. TAlthough it has been proved theoretically that the non-common clock SD and DD models are equivalent in the sense of deriving exactly the same position and baseline solutions with same formal uncertainties , the emeThrough experiments,  found thThis paper first revisits the equivalence problem of formal uncertainty between the SD and DD models . We emboFollowing , we simpFor single epoch, the covariance sub-matrix of the baseline vector is:D is the DD operator. And the least squares estimation of baseline vector is given by:For the DD model, after linearization, the DD measurement equation can be expressed as:According to :(6)DT(DThe covariance sub-matrix of the baseline vector and the baseline solutions from the DD are exactly the same as those from non-common clock SD (Equations (2) and (3), respectively). Thus the single epoch DD and SD models are equivalent under a non-common clock scheme .In kinematic mode the single epoch solutions at each epoch are uncorrelated. This case is equivalent to the above single epoch case and the baseline esimations from the DD and SD models are still equivalent. In the static SD mode with multi-epoch joint estimate, the covariance matrix of the baseline vector solution is given by:With the same method used above, it can be proved that the static multi-epoch DD and SD models under a non-common clock scheme are also equivalent. Owing to this equivalency, in the following sections we use the non-common clock SD model to represent the DD model for comparison.u. [Under the common clock scheme, the receiver clock error is canceled out by forming SD, thus only UPD is included in parameter u.  providedThe baseline vector solution and its covariance matrix are:For comparison, we rewrite the Equation (2) of the non-common clock SD model:It\u2019s easy to find that the first term on the right side of Equation (13) is the same as the baseline solution covariance matrix of the common clock SD model (Equation (11)) and the second term represents the formal uncertainty difference between the non-common clock SD model and common clock SD model without UPD. From the theoretical discussion of , the secSubstituting Equations (9) and (11) into Equation (10), we obtain:u (receiver clock error and UPD) and observation errors. Since both the receiver clock error and UPD are satellite independent, it can be proved that:Also, substituting Equations (1) and (2) into Equation (3), the estimation of baseline vector is:u can be omitted from Equation (15). Hence, both the estimated solutions (Equations (14) and (15)) are unbiased estimations of the true value, but their dispersions of solutions are different.Then the parameter i is also expressed in the same coordinate system:i-th satellite and antenna; i-th satellite to the antenna in the local geographical coordinate system. We assume that the priori position vector of the antenna is close to the true value. For convenience, the baseline vector parameters are expressed in a local geographical coordinate system , the corresponding partial derivative matrix Compared with the true value, the deviations of baseline vector solution in Equations (14) and (15) can be regarded as stochastic variables, and are written respectively as:Equations (18) and (19) represent the deviations of the baseline vector solution from the true value in the common clock SD without UPD and the non-common clock SD schemes, respectively. However, it is difficult to derive the analytical formula of the inverse of the normal matrix in these two equations. To get the impression of the dispersion differences between the two models intuitively, we discuss their asymptotic case. Assume that the number of satellites is extremely abundant , and the formal uncertainty of the vertical baseline component (corresponding to the pitch angle) from the common clock SD model without UPD is also equivalent to that of horizontal component, whereas the formal uncertainty of vertical component from the non-common clock SD model is twice as large as that of the horizontal component. These conclusions agree with the results of . We alsoWe now consider the dispersion of baseline solutions. In statistics, the deviation of baseline solution from the common clock SD model without UPD can be denoted by:V denotes the variance operator. Similarly, the deviation of baseline solution from non-common clock SD is:According to the variance formula for the multiplication of two independent stochastic variables:Comparing Equation (25) with Equation (27), statistically, the dispersions of the horizontal component (correspondence to the yaw angle) from both SD models are still equivalent, the dispersion of vertical component from the common clock SD without UPD is also equal to that of the horizontal component, whereas the dispersion of the vertical component from the non-common clock SD is 5.3 times as large as the horizontal component, which is also much more than that of the vertical component from the common clock SD without UPD.j is the index of epoch  and (25) become a 6 \u00d7 6 matrix which consists of two 3 \u00d7 3 diagonal sub-matrices like Equations (21) and (25), thus its formal uncertainty and dispersion are the same as those of the single epoch model. For the non-common clock SD, both Equations (22) and (27) become an 8 \u00d7 8 matrix which consists of two 4 \u00d7 4 diagonal sub-matrices like Equations (22) and (27), and its results are still the same as those of the single epoch model. Based on the above discussions the following conclusions are reached: both for the single epoch and the multi-epoch solution, both in static and kinematic mode, the formal uncertainty and dispersion of horizontal baseline component from the non-common clock SD scheme (and DD) is equivalent to those from a common clock SD scheme without UPD. For the vertical baseline component, however, the formal uncertainty and dispersion from the common clock SD scheme are still the same as the horizontal baseline components, but those from the non-common SD scheme model are much greater than those from the common clock SD scheme without UPD. u. For all the satellites the UPD differences are the same, otherwise the DD ambiguities are no longer integers [u (or UPD) in a common clock SD scheme. Since the integer part of the parameter u is included in the integer ambiguities, which are assumed to be fixed already, so the range of parameter u should be within half a wavelength. If we impose a constraint of a half wavelength on parameters u, then Equation (2) becomes:Although the receiver clock error can be eliminated by the SD under a common clock scheme, the UPD difference still remains in parameter integers . In pracu has a very small influence on the covariance matrix.Usually, the measurement error of the SD carrier phase (GPS L1 band) is within 5 mm, and the UPD constraint is 100 mm, so we have n). Note that in the previous single epoch solution case we estimate many UPD parameters for each epoch, and in this case we estimate only one UPD parameter for all epochs. For m epochs the statistical result of the covariance matrix is:Next, we discuss the kinematic multi-epoch solution case. For simplicity, we treat UPD as a time invariant parameter with no constraint and suppose the satellite number at each epoch is the same , the covariance of the vertical component is n, which is equivalent to Equation (21). Similar to Equations (26) and (27), we calculate the statistical dispersion expression (Equation (34)), which indicates that when the observation number m is large, the dispersion of the vertical component will approach the dispersion of the horizontal components, similar to the common clock SD without UPD case. This multi-epoch case actually represents the kinematic AD case:Equation (33) reveals an interesting phenomenon. In the first epoch  except the n is replaced by nm. For the vertical component dispersion, we can also get the similar proportional relationship between the vertical and horizontal components like Equation (27), except the n is replaced by nm.Two short baseline field experiments (one static and one kinematic) were conducted to compare the performance of the SD and DD models in AD. In these experiments, a multi-antenna synchronized GNSS receiver\u2014a Trimble BD982 GNSS receiver\u2014was used to connect two antennas. Thus the SD observations between the two antennas are able to eliminate clock errors from both the satellite and receiver simultaneously. All SD integer ambiguities have been resolved in advance. Since the integer part of the SD UPD parameter is merged into the ambiguity parameters, the fractional part of the UPD is estimated. The DD integer ambiguities are then obtained and fixed by differencing between satellite integer SD ambiguities. The single epoch (SE) algorithm is adopt for both the SD and DD models. All results are obtained using the software called Real-time Positioning and Attitude Determination (RPAD) developed at East China Normal University. In all the experiments only the GPS L1 carrier phase observables are used.Two antennas were mounted on a concrete pillar on the roof of a building of the East China Normal University campus . The basThe UPD parameter is eliminated in the DD model, while it is estimated in the SD model. Two UPD scenarios are adopted for the SD model. The first scenario that involves estimating stochastic UPD parameters every epoch is called SD1, the second, named SD2, takes the UPD as a time invariant estimated parameter. The formal uncertainties (FU), standard deviations (Std), and mean values of the three components of the baseline vector  from the DD and SD models are listed in To explain the abnormal large vertical Std value in the SD2 experiment in Since FU relates only to the satellite-antenna geometry and not to the actual errors, multipath correction does not alter the FU values. Thus only Std and mean values are given in A vehicle test was conducted in the campus of East China Normal University on 23 March 2015. Two antennas were mounted on the top of a car  with theIn this test, we compared the three models in kinematic mode from two aspects:(1) Dispersion of solutionsThe attitude solutions from the DD and SD1 models are given in The comparisons of attitude results between the DD and SD2 models are shown in To assess the dispersion level of the pitch angle solutions quantitatively, boxplots  of the p(2) Sensitivity to the satellite availabilityIn The results of the stage-2 experiment show that no obvious outliers from both the SD1 and Trimble solutions b in the The emerging multi-antenna synchronized GNSS receiver uses a common clock for the multiple antennas. Its SD observables are able to eliminate both satellite and receiver clock errors simultaneously. Such an advantage has encouraged scientists to reconsider the equivalency problem between the SD and DD schemes and to explore the possibility of further improving the accuracy of AD using this type of receiver ,21. Theoretical discussions and real static and kinematic experiments demonstrate that if estimating clock parameters using the SD observables (non-common clock scheme), the SD and DD models are equivalent for both formal uncertainties and dispersions of baseline solutions even using this type of receiver. If only estimating UPD parameters using the SD observables (common clock scheme), however, the two scenarios shows different results. If we estimate stochastic UPD parameters every epoch, this SD model  is also equivalent to the DD model, whereas if we estimate only one UPD parameter for all epochs or take it as a known constant, this SD model  and the DD model are no longer equivalent. Further investigations indicate that the formal uncertainties and dispersions of the horizontal baseline components of the SD2 model are only slightly smaller than those of the DD model. For the vertical component of baseline solutions, however, the formal uncertainties of the SD2 model are two times smaller than those of the DD model, and the solution dispersions of the SD2 model are even more than twice smaller than those of the DD model, so the yaw angle solutions from the SD2 and DD models are basically the same, but the accuracy and quality of the pitch angle solutions from the SD2 model are significantly improved compared to that from the DD model. Furthermore, the SD2 model requires a minimum of three satellites to obtain the baseline solutions, while the DD model requires a minimum of four satellites. Such a difference makes the SD2 model much more attractive for AD in environments with poor satellite visibility.Our kinematic experiments showed that with the SD2 model the GNSS short baseline (2 m) technique is able to catch even tiny events of 1.5\u00b0\u20133\u00b0 pitch angle variations, while the pitch angle solutions from the DD model seems too noisy to reach this accuracy level. Such progress certainly extends the horizon of GNSS applications, for example for unmanned vehicles and aircraft. To take full advantage of the multi-antenna synchronized GNSS receiver, the SD2 model must be adopted. The SD2 model also imposes new challenges for GNSS data analysis. For the SD2 model the ambiguities are no longer integers because the ambiguity parameters and UPD parameter are highly correlated. There are many proposed approaches to resolve the integer SD ambiguities ,24,31, s"}
+{"text": "Background: Sleep deprivation (SD) plagues modern society due to the professional demands. It prevails in patients with mood and neuroinflammatory disorders. Although growing evidence suggests the improvement in the cognitive performance by psychostimulants during sleep-deprived conditions, the impending involved mechanism is rarely studied. Thus, we hypothesized that mood and inflammatory changes might be due to the glial cells activation induced modulation of the inflammatory cytokines during SD, which could be improved by administering psychostimulants. The present study evaluated the role of caffeine/modafinil on SD-induced behavioral and inflammatory consequences.Methods: Adult male Sprague-Dawley rats were sleep deprived for 48 h using automated SD apparatus. Caffeine (60 mg/kg/day) or modafinil (100 mg/kg/day) were administered orally to rats once every day during SD. Rats were subjected to anxious and depressive behavioral evaluation after SD. Subsequently, blood and brain were collected for biochemical, immunohistochemical and molecular studies.Results: Sleep deprived rats presented an increased number of entries and time spent in closed arms in elevated plus maze test and decreased total distance traveled in the open field (OF) test. Caffeine/modafinil treatment significantly improved these anxious consequences. However, we did not observe substantial changes in immobility and anhedonia in sleep-deprived rats. Caffeine/modafinil significantly down-regulated the pro- and up-regulated the anti-inflammatory cytokine mRNA and protein expression in the hippocampus during SD. Similar outcomes were observed in blood plasma cytokine levels. Caffeine/modafinil treatment significantly decreased the microglial immunoreactivity in DG, CA1 and CA3 regions of the hippocampus during SD, however, no significant increase in immunoreactivity of astrocytes was observed. Sholl analysis signified the improvement in the morphological alterations of astrocytes and microglia after caffeine/modafinil administration during SD. Stereological analysis demonstrated a significant improvement in the number of ionized calcium binding adapter molecule I (Iba-1) positive cells (different states) in different regions of the hippocampus after caffeine or modafinil treatment during SD without showing any significant change in total microglial cell number. Eventually, the correlation analysis displayed a positive relationship between anxiety, pro-inflammatory cytokines and activated microglial cell count during SD.Conclusion: The present study suggests the role of caffeine or modafinil in the amelioration of SD-induced inflammatory response and anxious behavior in rats.Highlights- SD induced mood alterations in rats.- Glial cells activated in association with the changes in the inflammatory cytokines.- Caffeine or modafinil improved the mood and restored inflammatory changes during SD.- SD-induced anxious behavior correlated with the inflammatory consequences. Insufficient sleep is one of the most common and significant health problem worldwide associated with the immune system modulation  of Government of India, in accordance with the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA) guidelines. Animal handling was done regularly to make them habituate to the experimenter. Experiments were conducted during the light period of the day. All efforts were done to minimize the number of rats used and to avoid unnecessary pain to the animal.Adult male Sprague-Dawley rats of 6\u20138 weeks old and approximately 220 \u00b1 10 g body weight were used for the present study. Rats were housed in the clean cages made up of plexiglass material in the animal house at a temperature of 25 \u00b1 2\u00b0C and humidity of 55 \u00b1 2% RH with 12 h light and dark cycles with food and water Analytical grade chemicals were procured from Sigma Chemicals  unless otherwise mentioned. The Enzyme-Linked Immunosorbent Assay (ELISA) kits were purchased from BD Biosciences Laboratory Ltd. (USA) and R and D Systems, Minneapolis, MN, USA. Antibodies (primary and secondary) were procured from Sigma-Aldrich, St. Louis, MO, USA, Abcam, Cambridge, MA, USA and Millipore, CA, USA.Initially, behavioral screening of rats was done, in which the body weight, food intake, aggressiveness and stereotype behavior were evaluated. This was done to ensure that rats were not suffering from any impairment, after that the animals were divided randomly into different groups: cage control with vehicle treatment (CC+Veh); cage control with caffeine treatment (CC+Caf); cage control with modafinil treatment (CC+Mod); sleep deprived for 48 h with vehicle treatment (SD+Veh); sleep deprived for 48 h and caffeine treatment (SD+Caf); sleep deprived for 48 h and modafinil treatment (SD+Mod). The rats underwent the vehicle and drugs treatment during the control and sleep deprived conditions for 48 h. Each group had five rats, and the behavioral study took place between 8:00 AM and 11:00 AM. We used a different set of rats in each behavioral paradigm. Animals were euthanized immediately after the behavioral test during the light period of the day and evaluated for the biochemical and immunohistochemical analyses. The schematic experimental design of the present study is shown in Figure Briefly, the male Sprague-Dawley rats were sleep deprived for 48 h in the automated SD apparatus according to the well-established SD protocol of our lab  and modafinil  dose were based upon our previous study . The food was maintained at a constant amount (150 g) per animal, and every morning (8:00\u20139:00 AM), the remaining food was measured. At the same time, the body weight of each animal was noted down.We utilized a battery of behavioral tests that measure anxiety and depressive-like behavior including the open field , elevated plus maze , forced swim test  and sucrose preference test . Each behavioral analysis was carried out with 15 rats in each experimental group.The EPM test is used to assess the level of anxiety in rodents. The EPM test apparatus consisted of plus shape design with four arms  having an open roof. The apparatus was about 40\u201370 cm elevated from the floor. Briefly, the rat was placed at the junction of the open and closed arms, facing the open arm opposite to the experimenter for 5 min. At the end of the test, rats were removed from the apparatus and placed back to their home cage. The test apparatus was properly cleaned with alcohol and dried with cotton before testing another rat. An overhead camera in association with ANY-maze software  was properly arranged for the tracking and automatically recording the number of entries and time spent by the rat in the open and closed arms. The anxious behavior was evaluated by calculating the proportion of the time spent  and the proportion of the number of entries .OF test is a well-known method to assess the spontaneous locomotor activity in rats. The OF maze was divided into two zones: central and peripheral zone, using the square drawn on the maze. The apparatus consisted of a rectangular area of 81 \u00d7 81 cm surrounded by a 28 cm high wall. The field was lit with white light (23W) fixed 100 cm above the field. The rat was placed in the center of the OF, and its activity during the subsequent 5 min was recorded using ANY-Maze tracking software . The test apparatus was properly cleaned with alcohol and dried with cotton before testing another rat to exclude any cues and smell.The FST was used to assess the depression in rodents. It is based on the assumption that an animal will try to escape, if the rat fails, the animal eventually stops trying and gives up. The FST apparatus is a vertical plexiglas cylinder  filled with 30 cm deep water (24\u201330\u00b0C). Briefly, the rat was placed in a cylindrical container of water from which it cannot escape, for 5 min. The rat was properly dried after removal from the water with a clean towel. The water was replaced regularly with fresh water to avoid the accumulation of the urine and fecal material. ANY-maze software  was used to determine the test parameters.The anhedonia, indicator of depression, means the lack of interest in rewarding stimuli. In this task, we assessed the animal interest in seeking out a sweet, rewarding drink in plain drinking water. This test was carried out in the animal\u2019s home cage. Briefly, rats were initially habituated to the presence of two bottles; one containing 2% sucrose solution and another drinking water for 2 days in their home cage. During this phase, rats had the free access to both bottles. The intake of normal drinking water and sucrose solution was measured daily, and the positions of bottles were regularly interchanged to reduce biases. On the completion of 48 h SD, the rats were presented the same two bottles (one containing water and another containing sucrose solution) and measured the intake of water and sucrose solution. Sucrose preference index was calculated as a ratio of the volume of sucrose intake over the total volume of fluid intake.After the scheduled period of SD exposure and the behavioral assessment, the blood was collected from left ventricle under anesthesia (ketamine 80 mg/kg-xylazine 20 mg/kg) in the vacutainer tube containing the sodium heparin as an anticoagulant. The blood was centrifuged at 3500 rpm at 4\u00b0C for 10\u201315 min, and plasma was separated. The rats were euthanized, and the brain was extracted out immediately. The hippocampi were isolated, washed with cold 0.1 M phosphate buffer saline (PBS) solution. The hippocampus was snap frozen in liquid nitrogen and then stored at \u221280\u00b0C until the time of analysis. Later, the samples were homogenized with the help of Polytron homogenizer (Remi Pvt. Limited) with 1\u00d7 PBS and protease inhibitor cocktail containing inhibitors with broad specificity for serine, cysteine, acid proteases and aminopeptidases. After homogenization, the solution was centrifuged at 10,000 rpm for 10 min at 4\u00b0C, and the supernatant was isolated out for the cytokines assay.The ELISA is a specific and highly sensitive method for the quantification of cytokines. Plasma samples and hippocampal supernatant  were assayed for ILs  and TNF-\u03b1 using commercial ELISA kits. The assays were performed as per the manufacturer\u2019s protocols.2 Profiler inflammatory cytokines and receptor array  using RT2 SYBR\u00ae Green qPCR master mix . The analysis was performed by the comparative 2\u2212\u0394\u0394CT method as previously described. The gene expression analysis was done using software available online at www.sabiosciences.com, after normalization of each gene (Ct) to the housekeeping genes.Isolation of the total RNA from hippocampal tissue was done using TRIZOL reagent  according to the previously described protocol  in 0.1 M PBS (pH = 7.4). Brains were cryosectioned after processing with graded sucrose solution  respectively dissolved in PBS  using cryostat . Coronal sections of 30 \u03bcm thickness were taken in tissue culture plate and stored at 4\u00b0C in sodium azide solution to prevent fungal growth. The sections were processed for immunoreactivity of glial fibrillary acidic protein (GFAP) and ionized calcium binding adapter molecule I (Iba-1) proteins. Briefly, the sections were washed in PBS containing 0.1% Tween-20 or Triton X-100 (PBST) twice for 5 min each, subsequently; the antigen retrieval was done by incubating the sections with sodium citrate buffer for 10\u201315 min in boiling water bath. Sections were incubated with blocking buffer  for Iba-1) diluted in PBS for 2 h at room temperature, followed by washing with PBST. Prior to primary antibody labeling of an Iba-1 protein, there was an additional step of permeabilization in which the sections were treated with 0.25% Triton X-100 for 20\u201330 min followed by PBST washing thrice for 5 min each. The sections were then probed with rabbit anti-GFAP antibody and goat anti-Iba-1 antibody prepared in blocking solution for 40 h at 4\u00b0C. Sections were subsequently incubated with biotinylated goat anti-rabbit and rabbit anti-goat antibody for 2 h at room temperature, followed by three washings in PBST (5 min each). Finally, the sections were developed with diaminobenzidine (DAB) tetrahydrochloride solution.The immune-stained sections were observed under Olympus  BX51TF microscope and images were taken from the DG, CA1 and CA3 regions of the dorsal hippocampus of the brain. We performed sholl analysis for the morphological evaluation of astrocytes and microglial cells. The cell quantification was performed using stereo investigator program. Similarly, immunoreactivity of astrocytes and microglial cells was quantified with the help of ImageJ software.post hoc test with multiple comparisons. Pearson\u2019s correlation test was applied for correlation analysis. Data presented as mean percentage of control value used for graphical representation has been mentioned with graphs. All statistical analysis was done using GraphPad Prism 7.03 Software. The significance level of p < 0.05 was considered to be statistically significant.All the data are expressed as Means \u00b1 SEM. Physiological, behavioral, biochemical, immunohistochemical and molecular data were analyzed by Two-way ANOVA followed by Tukey F;  = 76.28; p < 0.0001; Supplementary Figure F = 0.8429; p = 0.4331; Supplementary Figure To assess the physiological changes in rats during SD, their body weight and food intake were recorded. We did not notice changes in body weight gain in the caffeine or modafinil treated control groups compared to vehicle-treated control rats, but a significant decrease in body weight was observed in vehicle-treated sleep-deprived rats as compared to vehicle treated control group rats. Administration of caffeine or modafinil to SD exposed rats significantly improved the body weight as compared to vehicle-treated SD group  = 17.4; p < 0.0001) and the proportion of the time spent in the open arms  = 25.19; p < 0.0001) compared to SD exposed rats  = 14.91; p = 0.0001; Figure Similarly, in the OF test, the total distance traveled in the OF was significantly reduced in sleep-deprived rats. However, caffeine or modafinil administration significantly improved/increased the total distance traveled in the OF in SD exposed animals compared to sleep-deprived rats  = 1.274; p = 0.2881; Figures A non-significant increase in the immobility time was observed in SD exposed animals compared to control animals. Data showed that caffeine/modafinil treatment during SD non-significantly improved the immobility time in SD exposed rats  = 0.6609; p = 0.5205; Figure Similar to FST, sucrose preference index was non-significantly reduced in rats subjected to SD compared to control, while caffeine/modafinil administration following SD exposure non-significantly improved the sucrose solution intake compared to the sleep-deprived group  = 10.17; p = 0.0001; Figure F = 3.693; p = 0.0290; Figure F = 4.168; p = P = 0.0188; Figure F = 22.09; p < 0.0001; Figure F = 5.933; p = 0.0039; Figure A significant fold increase in the pro-inflammatory cytokines  and decrease in the anti-inflammatory cytokines (IL-4 and IL-10) in the hippocampus of rats subjected to SD as compared to control was observed. However, caffeine or modafinil administered during SD significantly decreased the pro-inflammatory: TNF-\u03b1  = 20.32; p < 0.0001; Supplementary Figure F = 27.67; p < 0.0001; Supplementary Figure F = 15.39; p < 0.0001; Supplementary Figure F = 18.52; p < 0.0001; Supplementary Figure F = 15.2; p < 0.0001; Supplementary Figure Subsequently, in plasma, we found a significant fold increase in the pro-inflammatory cytokines and decrease in the anti-inflammatory cytokines insleep deprived rats as compared to control, that were restored by caffeine or modafinil treatment during SD. The respective figures were: TNF-\u03b1  = 2007; p < 0.0001; Figure F = 27.41, p < 0.0001; Figure F = 28.36; p < 0.0001; Figure F = 153.9; p < 0.0001; Figure F = 76.56; p < 0.0001; Figure Real time PCR study showed that caffeine or modafinil administration during SD significantly down-regulated the mRNA expression of TNF-\u03b1  = 0.6826; p = 0.5081; Figure F = 0.2293; p = 0.7956; Figure F = 0.1089; p = 0.8970; Figure Astrocytes and microglial cells activation were evaluated by studying the immunohistochemical changes in the expression of GFAP and Iba-1 protein in different regions of the dorsal hippocampus. Changes in the expression of astrocytes among different groups in DG, CA1 and CA3 region of the dorsal hippocampus was shown in Figure F = 44.32; p < 0.0001; Figure F = 30.26; p < 0.0001; Figure F = 25.97; p < 0.0001; Figure Similarly, the vehicle and drugs treated rats showed changes in the expression of microglial cell in different hippocampal regions as shown in Figure Representable intersectional and segmented images of the resting, intermediate and activated stage of astrocyte and the microglial cell was shown in Figures Administration of caffeine/modafinil significantly improved the SD-induced changes in the morphology of astrocytes in DG, CA1 and CA3 region of the hippocampus Figures ; Table 1F = 22.65; p < 0.0001; Boia et al., F = 0.1197; p = 0.8874); activated  = 33.82; p < 0.0001); Figure F = 4.741; p = 0.0112); intermediate  = 0.03004; p = 0.9704); activated  = 44.26; p < 0.0001); Figure F = 11.15; p < 0.0001); intermediate  = 0.09492; p = 0.9095); activated  = 3.636; p < 0.0001; Figure We found a significant decrease in resting stage microglial cell in DG and CA3 region of the hippocampus, while the activated microglial cell numbers were significantly increased in DG, CA1 and CA3 region of the hippocampus. No significant change was observed in the intermediate state microglia cell count during SD. Caffeine or modafinil treatment during SD significantly increased the resting stage microglial cell and decreased activated microglial cell count, given during SD in DG  = 0.1095; p = 0.8964; Figure F = 0.5845; p = 0.5597; Figure F = 0.8691; p = 0.4231; Figure Although, trivial increase in total microglial cell count in SD-vehicle group was observed, caffeine or modafinil treatment also showed in consequential improvement in DG . This enhanced GFAP expression relates to the astrocytes activation severity. Astrocytes activation assessed by GFAP expression was increased along with increased cytokine levels during inflammatory stimulation by LPS administration  during SD. Our data suggested that caffeine/modafinil are the effective therapeutic agents against SD-induced neuroinflammation and anxiety behavior.UP and MW designed the study and wrote the manuscript. MW performed the experiments and analyzed the data. KRay, LT, GC, KRoy, SS, SD and VJ helped in the manuscript writing. GC, KRoy and VJ helped in the immunohistochemistry of glial proteins and cytokines level measurement. SS and SD helped in the behavioral and RT-PCR experiments. UP, KRay, KK and LT contributed in procurement and facilitated the instruments and other facilities. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "With the improvement of nanotechnology and nanomaterials, redox-responsive delivery systems have been studied extensivelyin some critical areas, especially in the field of biomedicine. The system constructed by redox-responsive delivery can be much stable when in circulation. In addition, redox-responsive vectors can respond to the high intracellular level of glutathione and release the loaded cargoes rapidly, only if they reach the site of tumor tissue or targeted cells. Moreover, redox-responsive delivery systems are often applied to significantly improve drug concentrations in targeted cells, increase the therapeutic efficiency and reduce side effects or toxicity of primary drugs. In this review, we focused on the structures and types of current redox-responsive delivery systems and provided a comprehensive overview of relevant researches, in which the disulfide bond containing delivery systems are of the utmost discussion. In tumor therapy, developing a safe and efficient drug delivery system is a key factor to the success. With the rapid development of nanotechnology and materials, nano-carriers have been gradually applied in drug and gene delivery . AntitumTumor tissues show different cellular microenvironments  for their unique physiological characteristics . Develop+ and glutathione , both of which have different reduction potentials and capacities , w, w47], wn block with biocompatible phospholipid analog poly(2-methacryloyloxyethyl phosphorylcholine) [p(MPC)] block to create a pH/redox dual stimuli-responsive block copolymer . Tr. Tr47]. opolymer . The bloAt present, micelles assembled by the amphiphilic diblock or triblock copolymer are extensively studied. Due to the complexity of in vivo environment, micelles often have a poor stability in the delivery process, which easily lead to the loss of drugs. Furthermore, unexpected side effects may be caused in this case. To solve this problem, crosslinked micelles are often used to enhance the stability and thus the loss of cargoes could be effectively prevented before reaching cells or other target sites. Meanwhile, the crosslinked structure may also act as barriers to drug release, slowing down the rate of release. Disulfide bonds exist mainly in the core\u2013shell form of micelles as cross-linkers, such as shell crosslinked micelles -b-poly (PEG-b-PLys-b-Ppha) . Re. Re54]. There are some other redox-responsive delivery systems containing disulfide bonds, such as polymeric nanogel with disulfide linkages , 57, lipThe reducing environment in tumor cells has appeared as a natural stimulus for effective intracellular delivery for many years. Redox-responsive drug delivery systems have been recognized as a valuable strategy to achieve efficient intracellular drug delivery with low cytotoxicity. Utilizing the differences between the special microenvironments of tumor cells and normal cells, redox-responsive delivery systems can meet the requirement of targeted therapy in theory. With various reducing structures or functional groups being added, the redox-responsive system is moving in the direction of low toxicity and high efficiency. However, some studies have reported that the reduction of thiolated polymers takes several hours under physiological reducing conditions, which may be a future barrier to overcome , 62.In fact, there exists multiple unique stimuli in tumor microenvironment such as pH, enzymes, and oxidants, while many other external stimuli could also utilized including magnetic field, temperature, light and ultrasound , 63, 64.Therefore, the delivery systems which can respond to multiple stimuli have become a popular strategy of current research, because they are safer and more targeted than delivery systems with one stimulus , 69, 70.Even so, many novel intracellular environment-responsive drug delivery systems have been reported, and their structure and function are constantly being improved. It is believed that with the continuous development of materials science and tumor treatment, problems mentioned above can be effectively solved by the development of \u201csmart\u201d drug delivery systems such as the redox-responsive system."}
+{"text": "This review shall cover the studies that have determined the stereochemistry in many of the reactions involved in polyketide biosynthesis by modular PKSs.Polyketides are a diverse class of medically important natural products whose biosynthesis is catalysed by polyketide synthases (PKSs), in a fashion highly analogous to fatty acid biosynthesis. In modular PKSs, the polyketide chain is assembled by the successive condensation of activated carboxylic acid-derived units, where chain extension occurs with the intermediates remaining covalently bound to the enzyme, with the growing polyketide tethered to an acyl carrier domain (ACP). Carboxylated acyl-CoA precursors serve as activated donors that are selected by the acyltransferase domain (AT) providing extender units that are added to the growing chain by condensation catalysed by the ketosynthase domain (KS). The action of ketoreductase (KR), dehydratase (DH), and enoylreductase (ER) activities can result in unreduced, partially reduced, or fully reduced centres within the polyketide chain depending on which of these enzymes are present and active. The PKS-catalysed assembly process generates stereochemical diversity, because carbon\u2013carbon double bonds may have either  Polyketides are among the most important microbial natural products used in medicine. Members of this diverse family of compounds are used as a wide variety of therapeutics, including antibiotics such as erythromycin, anticancer epothilones, immunosuppressant rapamycin, and cholesterol-lowering lovastatin, to name only a few ,2,3,4. TPolyketides are biosynthesized by plants, fungi, and bacteria from the step-wise condensation of short chain carboxylic acid-derived units. Assembly of complex structures from these simple building blocks is carried out by enzyme complexes known as polyketide synthases (PKSs). Different families of PKSs generate very distinct classes of polyketides. Aromatic polyketides, arising largely from unreduced polyketone chains, comprise one such class. These are distinct from the reduced or complex polyketides, in which many of the carbonyl functionalities have undergone partial or full reduction during biosynthesis by the action of component enzyme activities within the PKS. In contrast to aromatic polyketides, complex polyketides are biosynthesized by the catalytic action of unusually large  multidomain enzymes forming a sort of molecular assembly-line wherein each catalytic step is carried out by a specific domain. The \u201cassembly-line\u201d PKS enzymes that biosynthesize complex polyketides are known as modular PKSs and contain catalytic domains that are usually covalently linked with the domains organized into \u201cmodules\u201d in which the enzyme activities are specific to a given step in chain elongation. In what is described as the \u201cco-linearity rule,\u201d the organization of modules in modular PKSs and the catalytic activities present in each module ultimately determines the structure of the polyketide chain . It is the modularity of these biosynthetic enzymes and the countless ways in which the \u201cassembly-line\u201d can be configured in modular PKSs of different organisms that gives rise to the vast structural and functional diversity of complex polyketides ,6.The biosynthesis of polyketides shares a great deal of similarity to that of fatty acids, and much of our current understanding of PKS enzymes has benefited from extensive studies on the fatty acid synthase (FAS) systems ,3. By thvia a phosphopantetheine cofactor attached in phosphodiester linkage to a unique serine residue, before being passed to the KS . T,3. T1,3]o the KS . In the The modular PKSs (at least those of actinomycete bacteria) typically exhibit what is called co-linearity with their products, that is to say that by examination of the sequence of modules of the PKS, one can make a reasonably accurate prediction about the structure of the resulting product . One exacis or trans geometry. As with other aspects of polyketide biosynthesis, many of the early insights on the stereochemistry of reactions catalysed by PKSs were gained by analogy to the highly related FASs.The modular PKSs are versatile enzymes responsible for the biosynthesis of a very large number of diverse complex or reduced polyketides with varied structure. Erythromycin represents a sub-family of such polyketide compounds known as macrolides, which consist of large  macrocyclic lactone rings bearing unusual deoxy(amino)sugar moieties. The polyethers, which include the ionophoric antibiotic monensin, are formed by the oxidative cyclization of an initially synthesized linear polyketide polyene . Other cAlthough the products of the fatty acid biosynthetic pathway are typically achiral, pioneering studies have elucidated the entire stereochemical course of their assembly. Understanding of the detailed stereochemistry underlying the reaction mechanisms involved in fatty acid biosynthesis has led to important insights into how stereocentres are generated in polyketides.si face of the C-3 carbonyl carbon by the 4\u2032-pro-S hydride of NADPH to give exclusively the (3R)-hydroxyl intermediate (syn elimination of water from the 2-pro-S hydrogen and the (3R)-hydroxyl group generating a trans double bond  and flour beetle (Tribolium confusumon), both of which produce unusual hydrocarbons from fatty acids, an ER activity catalyses the anti-2-Re,3-Re addition in the biosynthesis of these compounds . T. Tsi facble bond C 17]. T. Tsi facble bond D. The ERaddition . The ER of NADPH  at the 3addition . In the -Re face  to give ompounds . Thus, rThe modular PKSs typically generate, within their complex polyketide products, a multitude of stereogenic centres. How the modular PKSs exert control over the configuration of each of these centres has been the subject of intensive study. Stereospecificity is observed in each step in the sequence of reactions in a given cycle of chain extension, controlling not only the configuration of the functionality at the b-carbon-derived centre, from the processing of the nascent b-keto group, but also the configuration at the a-carbon-derived centre in cases where a branched extender unit, such as a methylmalonyl unit, is introduced. in vitro. Also, the use of engineered recombinant hybrid PKSs greatly facilitated studies on many aspects of polyketide biosynthesis including stereochemistry. One such hybrid PKS is the bimodular PKS known as DEBS1-TE, which was engineered by relocating the chain-terminating thioesterase (TE) domain from DEBS3 and fusing it to the C-terminus of the DEBS1 protein, housing the loading module and first two extension modules propionate. From the labelled propionate, two stereoisomers of isotopically labelled methylmalonyl-CoA were generated intracellularly ((2S)-methylmalonyl-CoA and (2R)-[2-13C]methylmalonyl-CoA), with the (2S)- isomer bearing a deuterium label (S)- precursor hampered its incorporation into the polyketide, analysis of the macrolide product resulting from assembly of the deuterated (2S)- extender units showed evidence of deuterium labeling at the C-2, C-4, and C-10 centres, where D-configured methyl substituents were present, indicating that the extender units incorporated at these positions had arisen from (2S)-methylmalonyl-CoA with inversion of a-configuration upon decarboxylative condensation as found for fatty acid biosynthesis succinate (as a diethyl ester), were thwarted due to loss of the deuterium label by exchange processes. Thus the origin of the C-6, C-8, and C-12 positions with L-methyl substituents could not be clearly determined, as it could not be shown whether the extender units incorporated into these positions had arisen from (2R)-methylmalonyl-CoA with inversion of a-configuration, or from (2S)-methylmalonyl-CoA with subsequent a-epimerization (resulting in the loss of a deuterium) following an inverting condensation, or even if they had originated from (2S)-methylmalonyl-CoA (which may have lost its isotopic label through an exchange process) incorporated into the chain by a mechanism that retains a-configuration.In pioneering studies on the stereochemistry of erythromycin biosynthesis, cultures of erythromycin-producing um label  26]. Al. AlS. erynthesis . Meanwhiin vitro. Using radioactively labeled (2R)- and (2S)-[1-14C]methylmalonyl-CoA, it was demonstrated that DEBS1, DEBS2, and DEBS3 were radioactively labeled via acylation by (2S)-[1-14C]methylmalonyl-CoA, whereas no acylation of the proteins by (2R)-[1-14C]methylmalonyl-CoA was observed methylmalonyl-CoA was prepared and fed to DEBS1-TE, knowing that solely the (2S)- isomer is incorporated. Careful analysis showed only a single deuterium label in the product at the C-2 position (corresponding to module 2) bearing the D-configured methyl group, and no labeling at C-4 (corresponding to module 1) bearing the L-configured methyl group (S)-methylmalonyl-CoA in module 2 proceeds with inversion without cleavage of the C\u2013H bond adjacent to the methyl group, while in contrast, the chain extension process in module 1 involves loss of the hydrogen attached to the \u03b1-position of the methylmalonyl-CoA precursor. Generation of the D-configured methyl group in module 2 without loss of hydrogen from the asymmetric centre of (2S)-methylmalonyl-CoA firmly established that the condensation occurs with inversion of configuration as observed in fatty acid biosynthesis, while in module 1, the loss of this key hydrogen from (2S)-methylmalonyl-CoA to produce the L-configured methyl centre implied that an additional obligatory epimerization step takes place in this module. These interpretations are supported by the earlier study in which isotopically labelled precursors were fed to erythromycin-producing cultures of S. erythraea, while the results of the in vitro experiments account for some of the ambiguous observations of that previous study . Thrrelidin , chivazorrelidin , difficirrelidin , and muprrelidin , where tcis double-bond -labeled cis and trans analogues of the \u22062-acyl intermediate [cis analogue was shown to be accepted by the downstream modules to restore phoslactomycin biosynthesis, strongly suggesting that the intermediate produced by the first module is the cis configured intermediate. Meanwhile it has been demonstrated that a cis double bond at another position in phoslactomycin is generated by a post-PKS tailoring enzyme [Direct observation of the formation of rmediate . Only thg enzyme .cis double-bonds contain A-type KRs is seen in the borrelidin PKS, in which modules 2 and 3 contain DH domains that catalyse the formation of the two carbon\u2013carbon double bonds in the polyketide, one in the trans configuration and the other cis. Sequence analysis predicts that the KR domains in these modules both catalyse B-type ketoreduction, generating (3R) alcohols [in vitro using diketide surrogate substrates. Both DH domains had little or no activity towards (3S)-hydroxyacyl substrates and surprisingly were shown to dehydrate only the (3R) diketide alcohols to generate the trans-\u22062-acyl products. In order to reconcile this with the fact that the double-bond formed by BorDH3 is cis in the borrelidin product but trans when assayed in vitro with surrogate substrates, several alternative explanations have been suggested: either the growing polyketide has an all-trans configuration, then subsequently undergoes catalysed trans-to-cis as proposed for the fungal hypothemycin [cis double bond by binding to module 3 of the PKS, similar to the action of AveC during avermectin biosynthesis [vs. an ACP-bound heptaketide substrate.An apparent exception to the observation that PKS modules that perform DH-catalysed formation of alcohols . Recombithemycin ; or an eynthesis ; or the trans arrangement [R or S depending on the face from which reduction occurs. The exact mechanism by which the ER controls the stereochemistry of reduction has yet to be fully elucidated, but recent research has suggested that, similar to the KRs, key amino acids influence the stereochemical outcome.The ERs of modular PKSs and their counterparts in animal FASs belong to the medium-chain NAD(P)H-dependent dehydrogenase/reductase family (MDR) ,73, and angement , as in fangement ,39 whichS-methylacyl intermediate) this residue is systematically conserved as a tyrosine, while in the ER domains of modules that produce a D-configured methyl branch (resulting from a 2R-methylacyl intermediate) a valine  is found at this position. The position corresponds precisely to Tyr52 in the closely related E. coli quinone oxidoreductase and for ease of reference, this position in modular PKS ER domains is labeled 52\u2032 with other residues within the ER domain numbered relative to it. This correlation was shown to hold for the methyl-branched lipids of mycobacteria as well as for complex polyketides. The PKS-biosynthesized waxy cell-wall lipids of many mycobacteria often have methyl branches that are of opposite configuration in closely related mycobacterial species, but otherwise identical. This difference can be traced to the ER domains of the PKSs that biosynthesize these lipids, which differ in the presence or absence of a tyrosine at 52\u2032, but otherwise are very similar [Multiple sequence alignment performed on ER domains from PKS modules in which a propionate unit  becomes fully reduced and gives rise to a methyl branch of known configuration revealed a single amino acid (approximately 90 residues upstream of the NADPH-binding site) that shows excellent correlation with the configuration of the polyketide product . In ER d similar .4, EryDH4, and EryER4) from module 4 of the erythromycin PKS (DEBS) or the full set of reducing domains  from module 13 of the rapamycin PKS (RAPS) resulted in the production of a 2-methyl triketide lactone that was fully reduced at the 3-position [S-methyl product, those swapped from module 13 of the rapamycin PKS resulted in a 2R-methyl product. The results are in agreement with the fact that module 4 of DEBS incorporates an extender unit into erythromycin with an L-configured methyl substituent, consistent with the tyrosine at position 52\u2032 of EryER4, whereas module 13 of RAPS incorporates an extender unit into rapamycin with a D-configured methyl group, consistent with the valine at position 52\u2032 of RapER13. These domain-swapped hybrids provided a relatively simple system by which to study the specific role of key ER residues in stereospecificity using site-directed mutagenesis. In the hybrid PKS derived from DEBS1-TE, in which the KR of the second module was replaced with the KR, DH, and ER of DEBS module 4, the introduced EryER4 was mutated in position 52\u2032, replacing tyrosine with valine (Y52\u2032V), and the resulting mutant produced a triketide with 2R-methyl configuration, in contrast to the parent enzyme which produced a product with a 2S-configured methyl group [13 replacing valine at position 52\u2032 for a tyrosine (V52\u2032Y) resulted in no change in product configuration, yielding the same 2R-methyl triketide product as the parent. These results clearly demonstrated that the residue at position 52\u2032 plays an important role in ER stereospecificity but that other residues must also be involved. This prompted a revised analysis of sequence alignments to identify other amino acid residues that correlate to the ER stereospecificity. In addition to the residue at position 52\u2032, further analysis revealed three other positions that apparently correlate to stereospecificity [In domain-swap studies using hybrid PKSs derived from DEBS1-TE, it was demonstrated that replacement of the KR domain in the second module with either the full set of reducing domains (EryKRposition . Howeveryl group . Howevercificity . S-configured intermediate (yielding an L-methyl group), residues 46\u2032 and 47\u2032 are typically conserved as leucine and isoleucine, respectively, and a proline at position 53\u2032 is also fairly well conserved. On the other hand, in the ERs catalysing enoylreduction to a 2R-configured intermediate (yielding a D-methyl group) positions 46\u2032 and 47\u2032 are more commonly occupied by less bulky valine residues, and proline is not well conserved at position 53\u2032. In the hybrid DEBS1-TE-derived PKS containing swapped KR, DH, and ER from RAPS module 13, several mutations  were simultaneously introduced into these positions as well as the critical position 52\u2032. The resulting mutant produced a small proportion of the 2S-configured triketide product along with the 2R-configured product, which is exclusively produced by the parent enzyme . More recently, aspects of stereochemistry in polyketide biosynthesis are becoming better understood. It is now possible to predict, based on the signature sequences within PKS domains, with relative accuracy, the configuration of many chiral centres within a polyketide product.Along with new insights into the stereochemistry of polyketide biosynthesis comes hope that engineering the stereospecificity of PKSs shall become feasible for generating novel, desirable polyketide products. Indeed, early experiments have shown that engineered stereochemistry can be achieved in model PKS systems with some degree of success. Nevertheless, our current knowledge of the stereochemistry of complex polyketide biosynthesis is still maturing, as new developments shape our understanding of it."}
+{"text": "Aspergillus (A. flavus and A. fumigatus) and three species of Fusarium  were the most common fungi isolated and identified from FK horses. Most (91%) equine FK Fusarium nested within the Fusarium solani species complex (FSSC) with nine genetically diverse strains/lineages, while 83% of equine FK Aspergillus nested within the A. flavus clade with three genetically diverse lineages. Fungal species and evolutionary lineage were not associated with clinical outcome. However, species of equine FK Fusarium were more likely (p = 0.045) to be associated with stromal keratitis. Species of Aspergillus were more susceptible to voriconazole and terbinafine than species of Fusarium, while species of Fusarium were more susceptible to thiabendazole than species of Aspergillus. At the species level, A. fumigatus and A. flavus were more susceptible to voriconazole and terbinafine than F. falciforme. Natamycin susceptibility was higher for F. falciforme and A. fumigatus compared to A. flavus. Furthermore, F. falciforme was more susceptible to thiabendazole than A. flavus and A. fumigatus. These observed associations of antifungal sensitivity to natamycin, terbinafine, and thiabendazole demonstrate the importance of fungal identification to the species rather than genus level. The results of this study suggest that treatment of equine FK with antifungal agents requires accurate fungal species identification.Morphological characterization and multi-locus DNA sequence analysis of fungal isolates obtained from 32 clinical cases of equine fungal keratitis (FK) was performed to identify species and determine associations with antifungal susceptibility, response to therapy and clinical outcome. Two species of  Aspergillus and Fusarium, of approximately equal frequency, followed in incidence by species of Candida, a dimorphic yeast.) and Fusarium (11 of 32 [34%]). In addition, three other fungal species  were identified and associated with equine FK (Bacillus (1), Staphylococcus (2), Streptococcus (2) and Kocuria rosea (1)  more likely to be associated with stromal keratitis.On routine fungal culture, characteristic microconidia oval and 1\u20132 cells) and macroconidia  and >2 cells) and chlamydospores typical of quine FK . Bacteriosea (1) . There w\u20132 cells Fusarium were significantly (Chi-Square p = 0.04) more likely to heal with medical therapy than eyes infected with Aspergillus. But the enucleation level was essentially the same whether the eye was infected with Aspergillus or Fusarium (p = 0.88) because of improved healing with surgery for eyes infected with Aspergillus.Horse eyes infected with Fusarium, sequences were examined using multi-locus EPA placement on the reference tree published by O'Donnell et al. [Fusarium multi-locus haplotypes were based on collapsing of concatenated RPB1 and RPB2 sequence alignments. In our naming convention, multi-locus haplotypes are labeled with the first two uppercase letters for the species  followed by a number for the unique haplotype within each species. Of the Fusarium species isolated from equine FK, 10/11 (91%) samples belonged to the Fusarium solani species complex (FSSC) . An additional isolate of Fusarium proliferatum belonging to the Fusarium fujikuroi species complex (FFSC) was also sampled from equine FK. FSSC haplotypes were labeled FF1\u20138, FP1 and FK 1  or Fusarium spp.   Tables  and 2.In vitro antifungal susceptibility of VRC, NAT, FLC, THB, TRB, and MXF (as a negative control) was evaluated for isolates of Aspergillus and Fusarium from equine FK  to 6.25 \u03bcg/ml for four Fusarium isolates. An isolate of Mucor sp. had an MIC of >156 \u03bcg/ml for VRC. For NAT, MIC ranged from 0.125 \u03bcg/ml  to 32 \u03bcg/ml for five isolates of A. flavus. Minimal inhibitory concentration values for THB ranged from 0.25 \u03bcg/ml against two isolates of Fusarium falciforme to 16 \u03bcg/ml for an A. flavus and three A. fumigatus isolates. For TRB, MIC values ranged from 0.05 \u03bcg/ml from 11 isolates of Aspergillus spp. to 16 \u03bcg/ml for a F. falciforme and F. keratoplasticum isolate. . Aspergillus was more sensitive to VRC and TRB than Fusarium; whereas Fusarium was more sensitive to THB than Aspergillus  was less susceptible than F. falciforme (mean MIC of 14.4 +/- SD 12.4) and A. fumigatus (mean MIC of 4.4 +/- SD 0.5) to NAT. Both species of Aspergillus (with mean MIC of 0.10 +/- SD 0.13 \u03bcg/ml for A. flavus and 1.1 +/- SD 0.11 \u03bcg/ml for A. fumigatus) were more susceptible than F. falciforme (mean MIC of 8.5 +/- SD 3.1) to TRB. For VRC the two species of Aspergillus had mean MIC values of 0.7 +/- SD 0.3 \u03bcg/ml for A. flavus and 0.4 +/- SD 0.1 \u03bcg/ml for A. fumigatus and exhibited greater susceptibility than F. falciforme with a mean MIC of 3.4 +/- SD 1.5 \u03bcg/ml. In contrast, Fusarium falciforme (mean MIC of 2.1 +/- SD 1.6) was more susceptible to THB than both species of Aspergillus (mean MIC of 6.2 +/- SD 0.3 \u03bcg/ml for A. flavus and 16.0 +/- SD 0.0 \u03bcg/ml for A. fumigatus)  differences among species for four antifungal agents, VRC, THB, NAT, and TRB Figs  and 4. TAspergillus for NAT, THB, and TRB. A. fumigatus was more susceptible to NAT than A. flavus (mean MIC of 4.4 +/- SD 0.5 \u03bcg/ml for A. fumigatus and 33.5 +/- SD 16.1 \u03bcg/ml for A. flavus) whereas A. flavus exhibited higher susceptibility to TBH and to TRB than A. fumigatus . These statistically significant species differences in antifungal agent susceptibility within Aspergillus demonstrate the importance of accurate identification of the causal fungal pathogen to the species level. In the case of Fusarium, it was not possible to evaluate interspecies differences because there was only one isolate of F. keratoplasticum and F. proliferatum. However, the pattern of TRB and THB MIC values between the single isolate of F. proliferatum and the 9 isolates of F. falciforme suggest that there may be interspecies susceptibility differences within Fusarium. The median TRB MIC value for F. proliferatum at 1.25 \u03bcg/ml was lower than the TRB MIC values for all 9 isolates of F. falciforme. The median THB MIC for F. proliferatum at 8 \u03bcg/ml was higher than the THB MIC values for all 9 isolates of F. falciforme.There were significant differences in susceptibility between the two species of A. flavus and among different lineages of F. falciforme in antifungal agent susceptibility to TRB, TBH and VRC. Lineage group FF6-7-8 of F. falciforme was more susceptible than lineages FF1, 2, 4, and 5 to NAT. Neither of these lineage groups of F. falciforme differed in susceptibility to the two isolates belonging to lineage FF3 which were classified as intermediate.There were no statistically significant differences in antifungal agent susceptibility between IB and IC lineages within in vitro sensitivity testing, antifungal used, and FK outcome , topical natamycin (n = 3/32), oral fluconazole (n = 7/23), and subconjunctival amphotericin B (n = 2/32) . The sel outcome .in vitro antifungal agent susceptibility, and outcome of equine FK. Analogous to human patients, misidentification of causative agents of filamentous FK and use of inadequate therapy may lead to blindness. Therefore, species-level identification of putative pathogen and antifungal agent susceptibility of the causal fungi is important for successful FK therapy.[FK is a common and aggressive disease in horses. In this study, 25% of equine FK cases were resolved with medical therapy and over 37% of the patients had loss of the eye due to infection. To better understand the pathogenesis and treatment of this disease, we used multi-locus DNA sequence analysis to accurately determine fungal species and evolutionary lineages and to examine associations with  therapy.Aspergillus spp., 34% with Fusarium spp., and 3% were Mucor sp., Byssochlamys sp., or Exserohilum sp. Our results are consistent with previous reports using standard mycological culture techniques in horses where the occurrence and isolation of species of Aspergillus predominate in equine FK, with species of Fusarium sampled and isolated in a lower frequency than Aspergillus.[Fusarium (approximately 28\u201348%) is observed compared to species of Aspergillus (19\u201325%).[A. fumigatus (65%)[A. flavus (42%) as the most common fungal associate in human cases of FK,[In this study of 32 cases of FK in horses, filamentous fungi predominated: 56% of FK cases were associated with ergillus.\u201341 AssocFusarium FK, fungi most commonly isolated belong to the F. solani species complex (FSSC) . Gajjar et al.[et al. [et al. [Fusarium sampled from human eyes nested most commonly into the FSSC. For example, Gajjar et al. [Fusarium placed into the FSSC. Homa et al. [et al. [Fusarium collected from human eyes in India and South Florida, respectively, also demonstrated that 75\u201376% of Fusarium causing FK belonged to the FSSC. O\u2019Donnell [Fusarium isolated from a variety of veterinary sources and found that the most commonly sampled veterinary Fusaria were isolated from eyes of horses (31% of those reported). Furthermore, they deployed a three-locus phylogenetic analysis  of 17 isolates of Fusarium sampled from 17 equine eyes, most of which were from the southeastern US. Similar to our results, O\u2019Donnell reported 14 of 17 (82%) isolates sampled from an equine FK source belonged the FSSC and represented 12 genetically diverse strains/lineages.[Fusarium FK nested within the FSSC and represented nine genetically diverse strains/lineages. Only MLSTs from horse numbers 21, 22 and 29 had cumulative likelihood weights > 0.96 and are considered reliable placements within the FSSC; F. falciforme haplotype FF3 for patient 21 and 22 matched F. falciforme haplotype 4eee from equine eye (NRRL 54964); F. proliferatum FP1 for patient 29 matched rhinoceros horn (NRRL 54994) and equine eye (NRRL 62546); all other strains showed weak placements and hit multiple F. falciforme haplotypes as nearest siblings. It is common for members of the FSSC that share the same multi-locus haplotypes to cause infections in humans, animals and plants.[F. falciforme which was reported as an emerging pathogen on lima bean in Brazil [F. falciforme haplotypes in this study based on phylogenetic placement of a portion of the RPB2 gene (data not shown). Updating the FSSC reference tree with these strains would increase phylogenetic and host diversity of F. falciforme, and improve resolution and reliability of future placements.In both equine and human ar et al., Homa et.[et al.  and Oechr et al.  used a sa et al.  conducte\u2019Donnell  describelineages. In our sd plants. This is n Brazil  and sharAspergillus FK nested within the A. flavus clade, and included three genetically diverse lineages, IA, IB and IC. Only one A. flavus isolate belonged to IA and the other 14 strains were equally split between IB and IC, which is consistent with the frequency of IB and IC isolated from soil in agricultural fields.[A. flavus strains had A. oryzae as their nearest common ancestor in both lineages IB (7/7) and IC (3/7), supporting a close relationship between wild and domesticated A. flavus strains.[A. flavus/A. oryzae harbor characteristics (e.g. metabolites) that serve as effective conduits for equine FK disease. Three additional isolates of Aspergillus were identified as A. fumigatus (17%). Further differentiation of these strains is possible using mating types [A. fumigatus from multi-locus DNA sequence data. There are fewer studies specifically evaluating the genetic diversity of Aspergillus in human FK.[A. flavus and 12% were A. fumigatus.In our study, 15/18 (83%) of equine l fields., 45 Inte strains., 46 Putang types  and micrng types  but we hhuman FK. However,human FK., fungi iA. flavus/A. oryzae and F. falciforme were recovered predominantly from equine FK infected eyes, species, haplotypes, isolates, or evolutionary lineage of Aspergillus or Fusarium were not significantly associated with lesion type or FK outcome in horse eyes in this study. This suggests that FK disease severity or virulence are complex phenotypes determined by multiple factors that are not closely linked to multi-locus markers examined in this study. Additional factors such as initiating injury , delay of owners of horses to seek treatment, and variable treatment prior to examination may determine severity of infection and outcome in equine FK. However, in this study we demonstrated that Fusarium species sampled and cultured from FK horses were significantly more likely to be associated with stromal keratitis compared to Aspergillus.Although Aspergillus was more susceptible to VRC and TRB than Fusarium; whereas Fusarium was more susceptible to THB than Aspergillus. At the species level, A. flavus was statistically less sensitive to NAT than F. falciforme and A. fumigatus. Both species of Aspergillus were more susceptible to TRB than F. falciforme and the two species of Aspergillus were more susceptible to VRC than F. falciforme. In contrast, Fusarium falciforme was more susceptible to THB than were both Aspergillus species. There were no statistically significant differences in antifungal agent susceptibility between IB and IC lineages within Aspergillus flavus. However, within different lineages of Fusarium falciforme, FF6-7-8 was more susceptible to NAT than FF1, 2, 4, and 5. These statistically significant species differences in antifungal agent susceptibilities within Aspergillus demonstrate the importance of accurate identification of the potential fungal pathogen to the species level.Although there was no statistical association among antifungal agent susceptibility and disease severity or outcome, significant differences in susceptibility was observed at the fungal genus, species, and evolutionary lineage levels. Most notably, at the fungal genus level, in vitro sensitivity testing, antifungal used clinically, and FK outcome in these horses . Therefore, larger case numbers, MLST identification, and susceptibility testing are needed.However, we did not find a correlation between e horses . This maAspergillus from human FK demonstrated that A. flavus was susceptible to econazole, clotrimazole and ketoconazole while A. fumigatus was susceptible to amphotericin B, natamycin, voriconazole, and itraconazole.[Fusarium, while species of Aspergillus were sensitive to amphotericin B and itraconazole.[et al. [Fusarium isolates from human FK. As a whole, the results from these published studies support our data, but suggest that amphotericin B and possibly itraconazole are two antifungals that should be evaluated against isolates of Aspergillus and Fusarium from equine FK. O\u2019Donnell et al. [in vitro. In contrast, we found that FSSC complex composed of F. falciforme was susceptible to natamycin and thiabendazole, but less susceptible to voriconazole and terbinafine. MIC values for Aspergillus spp. obtained in this equine FK study match those reported for human FK; as examples, for A. flavus 0.7 and 33.5 versus 1 and 32 \u03bcg/ml [A. fumigatus 0.4 and 4.4 versus 0.5 and 4 \u03bcg/ml [Fusarium spp., there are both similarities and differences between MIC values in this equine FK study with those obtained from human FK studies in part due to the high variability among human FK studies.[Further study of these equine FK isolates against other common antifungal agents is needed, including itraconazole, amphotericin B, clotrimazole, ketaconazole, and econazole. One study of conazole. In anothconazole. Homa et .[et al.  reportedl et al.  showed t32 \u03bcg/ml  for vori 4 \u03bcg/ml  for vori studies., 52Although fungal species and evolutionary lineage were not associated with clinical outcome in this study, associations regarding antifungal agent susceptibility demonstrated the importance of identifying the potential fungal pathogen to the species and lineage levels and not just to the generic level. These results also suggest that antifungal agent treatment of equine keratitis should be tailored to the infecting fungi and that accurate fungal species identification is critical to determine response to therapeutic agents and for developing effective treatment recommendations. Therefore, it is recommended to perform MLST typing routinely in FK to help choose appropriate antifungal therapy based on likely susceptibility and with a large sample size, ultimately, predict outcome.S1 TableThe primers used for Sanger sequencing are underlined.(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file."}
+{"text": "Triple negative breast cancer (TNBC) is an incurable disease where novel therapeutic strategies are needed. Proteolysis targeting chimeric (PROTAC) are novel compounds that promote protein degradation by binding to an ubiquitin ligase. In this work, we explored the antitumoral activity of two novel BET-PROTACs, MZ1 and ARV-825, in TNBC, ovarian cancer and in a BET inhibitor resistant model.nu/nu mice engrafted with MDA-MB-231R cells.OVCAR3, SKOV3, BT549, MDA-MB-231 cell lines and the JQ1 resistant cell line MDA-MB-231R were evaluated. MTTs, colony-forming assay, three-dimensional cultures in matrigel, flow cytometry, and western blots were performed to explore the anti-proliferative effect and biochemical mechanism of action of MZ1 and ARV-825. In vivo studies included BALB/c The BET-PROTACs MZ1 and ARV-825 efficiently downregulated the protein expression levels of the BET protein BRD4, in MDA-MB-231 and MDA-MB-231R. MZ1 and ARV-825 also showed an antiproliferative effect on sensitive and resistant cells. This effect was corroborated in other triple negative (BT549) and ovarian cancer  cell lines. MZ1 provoked G2/M arrest in MDA-MB-231. In addition, a profound effect on caspase-dependent apoptosis was observed in both sensitive and resistant cells. No synergistic activity was observed when it was combined with docetaxel, cisplatin or olaparib. Finally, in vivo administration of MZ1 rescued tumor growth in a JQ1-resistant xenograft model, reducing the expression levels of BRD4.Using both in vitro and in vivo approaches, we describe the profound activity of BET-PROTACs in parental and BETi-resistant TNBC models. This data provides options for further clinical development of these agents in TNBC.The online version of this article (10.1186/s13046-019-1387-5) contains supplementary material, which is available to authorized users. Triple negative breast cancer (TNBC) is a very aggressive tumor for which no curative therapies currently exists . It accoAmong the novel agents that have shown preclinical activity are those targeting the bromo and extra terminal domain proteins (BET) , 4, suchProteolysis targeting chimeric (PROTAC) molecules are a novel family of compounds with the ability to bind their target proteins and recruit an ubiquitin ligase, which promotes the targeted protein degradation . In the In the present study we aimed to explore if BET-PROTACs were able to revert resistance to BET inhibitors in a breast cancer model of TNBC. In addition, we explored their mechanism of action in sensitive and resistant cells. Our results show that BET-PROTACs are very active in both cell models, and are able to diminish tumor growth in an in vivo model of mice xenografted with cells resistant to BETi.2). All cell lines used were provided by Drs. J. Losada and A. Balmain, who purchased them from the ATCC, in 2015. Cells authenticity was confirmed by STR analysis at the molecular biology unit at the Salamanca University Hospital. MDA-MB-231-derived resistant cell line (MDA-MB-231R) was obtained by pulsed exposure to increasing doses of JQ1 (72\u2009h pulses every 2 weeks for 6 months).TNBC and ovarian cell lines, MDA-MB-231 and BT549 and SKOV3, respectively, were cultured in DMEM, and ovarian cells OVCAR3 were cultured in RPMI supplemented with inactivated fetal bovine serum (10%), antibiotics (100\u2009U/mL penicillin and 100 /mL streptomycin) and L-glutamine (2\u2009mM) (Gibco (Thermofisher), Sigma-Aldrich)  and OTX-015 (HPLC: 99.82% purity) and PROTACs-BRD4 (MZ1 (HPLC: 99.5% purity) and ARV-825 (LCMS: 99.37% purity)), together with the inactive form of MZ1, cis-MZ1 (HPLC: 98.6% purity), were purchase from Selleckchem  and Tocris Bioscience .For MTT assay colorimetric assay, after treatments, cell medium was replaced with MTT solution (red phenol-free DMEM with MTT 0.5\u2009\u03bcg/\u03bcL) . DMSO was then used to solubilize the samples. Absorbance values were recorded in a multiwell plate reader (555\u2009nm with a reference wavelength of 690\u2009nm). For synergy studies, we used the Chou-Talalay algorithm, which allows to obtain the combination index (CI) to determined which combinations were synergistic (CI\u2009<\u20091), additive (CI\u2009=\u20091), or antagonic (CI\u2009>\u20091) using Calcusyn 2.0 software.For clonogenic assays, 24\u2009h-treated cells were counted and seeded in triplicates for each condition. After 10\u2009days, cells were fixed with glutaraldehyde  and, then, stained with crystal violet . Colonies were quantified using Image J software. For 3D invasion assays, cells were seeded on 48-wells plates containing a 1\u2009mm layer of Matrigel (Sigma-Aldrich) and treated for 72\u2009h. Matrigel generates a net that mimics the extracellular matrix. Invading 3D structures were evaluated using an inverted microscope and their diameter was quantified using Image J software.For cell cycle analysis, after 12\u2009h of treatment, cells were fixed in 70% ethanol in PBS (15\u2009min). Cell pellets were washed in PBS\u2009+\u20092% BSA and incubated with Propidium iodide/RNAse staining solution .For cell death studies, after 48 or 96\u2009h of treatment, adherent and floating cells were collected and, after a wash with PBS, stained with Annexin Binding Buffer containing Annexin V-DT-634 and Propidium iodide (2\u2009mg/mL) . For caspase assays, cells were pre-treated with the pan-caspase inhibitor QVD  prior drug exposure.All analyses were performed on a FACSCanto\u2122 II flow cytometer using the FACS Diva software.For the evaluation of protein levels, MDA-MB-231 and MDA-MB-231R cells were seeded (500.000 cell/100\u2009mm dish) and, the following day, treated sequentially: first, the 48\u2009h points; the following day, the 24\u2009h points; and finally, the 12\u2009h points. All treatments were collected in parallel 72\u2009h post-seeding together with their common non-treated control.For the evaluation of cell cycle and apoptosis-related proteins, cells were treated for 12\u2009h and 96\u2009h, respectively. Then cells were lysed, and protein extracts (25\u201360\u2009\u03bcg) were used for Western blot analyses with the indicated antibodies . Then, fluorescence was measured (400/505\u2009nm).BALB/c nu/nu mice  mammary fat pads were injected with MDA-MB-231R (2.5\u2009\u00d7\u2009106). Daily treatment with JQ1  was initiated when tumors reached a volume of 80\u2013150\u2009mm3. After 1 week of treatment with JQ1, a group of animals (n\u00a0=\u20096) continued under this compound regime, while another group (n\u00a0=\u20097) received a treatment of MZ1 . Tumor growth was monitored for two more weeks. Then, tumors were collected, weighted, and stored at \u2212\u200980\u2009\u00b0C. For Western blot analysis, tumor samples  were homogenized with a sonicator Dispomix in ice-cold lysis buffer (1.5\u2009mL/100\u2009mg of sample). For protein levels evaluation, 60\u2009\u03bcg of protein were used.p\u00a0\u2264\u20090.05; ** p\u00a0\u2264\u20090.01 and *** p\u00a0\u2264\u20090.001). Software GraphPad Prism and SPSS were used.We used t-test for independent samples non-parametric assay, together with the Levenne test to consider, or not, equal variances or ANOVA assay with Tukey subtype. The level of significance was considered 95% . At the present moment, information about the mechanism of action of this family of compounds in relation to BETi is limited to lymphoma and acute myeloid leukemia , and onlIn our study we observed a significant anti-tumoral activity of BET-PROTACs in TNBC and ovarian cancer, that was higher when compared to BETi that are currently in clinical development. This effect is observed using different approaches, including proliferation, invasion, and clonogenic assays. This data is in line with previous studies in AML and Lymphoma were these compounds showed potent lethality , 18.BET-PROTACs were able to efficiently deplete BRD4 and BRD2 in both sensitive and resistant cell lines, being MZ1 more potent than ARV-825. Of note, the JQ1 resistant cell line showed higher basal levels of BRD4 when compared with its na\u00efve counterpart. This finding is in line with reports that suggest that treatment with BETi do not downregulate the expression of BRD4 . The effIn comparison with agents used in the current clinical setting, MZ1 showed a relevant anti-proliferative activity, and only docetaxel displayed higher efficacy. MZ1 high activity is probably the reason for the lack of synergisms observed when combining MZ1 with chemotherapies. A comparable effect was observed with the approved PARP inhibitor olaparib. BET-PROTACs have shown synergistic interactions with bcl-2 and CDK4/6 inhibitors in lymphoma probably through the activation of compensatory pathways . In addi. Evaluation of the resected tumors showed a reduction of BRD4 in MZ1-treated animals, confirming that the effect was secondary to the reduction of this protein. Conversely, no reduction of BRD2 was identified in contrast to the findings observed in cell lines, probably due to a milder effect of the compound on this protein.Finally, animal studies confirmed the effect of MZ1 on the proliferation of JQ1-resistant tumors. We first confirmed that JQ1 resistant cells were also resistant when injected in nude mice. Next, we observed that administration of MZ1 reduced growth of these tumors in vivoIn this work we describe the efficacy of PROTACs in TNBC and ovarian cancer, and in a BETi-resistant TNBC model. Given the fact that BETi are currently in clinical development in TNBC and that therapeutic options available for this disease are limited, our findings provide evidence for the clinical development of these family of compounds for this indication.Additional file 1:Figure 1. BET-PROTACs exercise more effect than BETi also in other triple-negative and ovarian models. TNBC cells (BT549) (A) and ovarian cells (SKOV3 and OVCAR3) (B) were treated with JQ1, MZ1, OTX-015, and ARV-825 . The inactive stereoisomer Cis-MZ1 was used as negative control of treatment. After 48 or 96\u2009h, viability cell was evaluated by metabolization of MTT. *p\u00a0<\u20090.05; **p\u00a0<\u20090.01; ***p\u00a0<\u20090.001. (PDF 72 kb)Additional file 2:Table 1. Reagents, instruments, sofwares, and buffers used in the study. (PDF 139 kb)"}
+{"text": "The World Health Organization (WHO) launched the \u201cEnd TB Strategy\u201d, which aims to reduce tuberculosis (TB) mortality by 95% by 2035, Brazil has made a commitment to this, however, one challenge is achieving the goal in the border region, where the TB situation is more critical. The proposal was to analyse the spatial mortality due to TB and its socio-economic determinants in the general population, around the border areas of Brazil, Paraguay and Argentina, as well as the temporal trend in this region.This ecological study considered the cases of TB deaths of residents of Foz do Igua\u00e7u (BR), with its units of analysis being the census sectors. The standardized mortality rate was calculated for each area. Socioeconomic variables data were obtained from the 2010 Demographic Census of the Brazilian Institute of Geography and Statistics (IBGE). The scan statistic was applied to calculate the spatial relative risk (RR), considering a 95% confidence interval (CI). Spatial dependence was analysed using the Global Bivariate Moran I and Local Bivariate Moran I (LISA) to test the relationship between the socioeconomic conditions of the urban areas and mortality from TB. Analysis of the temporal trend was also performed using the Prais-Winsten test.p\u2009=\u20090.033), income  and density of residents . There was an increase in the mortality rate in people of brown skin colour .A total of 74 cases of TB death were identified, of which 53 (71.6%) were male and 51 (68.9%) people of white skin colour. The mortality rate ranged from 0.28 to 22.75 cases per 100,000 inhabitants. A spatial relative risk area was identified, RR\u2009=\u20095.07 (95% CI 1.79\u201314.30). Mortality was associated with: proportion of people of brown skin colour (I: 0.0440, Death due to TB was associated with income, race resident density and social conditions. Although the TB mortality rate is stationary in the general population, it is increasing among people of brown skin colour. Tuberculosis (TB) is a serious public health problem worldwide, with one-third of the global population infected with Mycobacterium tuberculosis, which represents a large human reservoir ; the disIn South America, six countries account for 53.2% of all TB cases in the Americas, with Brazil having the largest percentage (33%), followed by Peru 13%), Colombia (5.6%), Bolivia (4.6%), Argentine (3.5%) and Venezuela (3.5%) [3%, ColomEpidemiologically, the burden of TB is higher among the ethnic minorities, immigrants, people living with HIV, in extreme poverty, diabetics, people using drugs and those with mental disorders , 4\u20136.Brazil is a signatory to the \u201cEnd TB Strategy\u201d, which foresees the elimination of TB by 2050 and a 95% reduction in mortality by 2035. Thus, one of the key issues is the trend of mortality among TB patients, particularly in the border regions where the disease is poorly controlled , 8. StudWith regard to the health systems, Brazil adopts the universalist model that guarantees free diagnosis and treatment for TB patients and is the only country in Latin America to use this model. Argentina and Paraguay, although they have some differences between them, have fragmented health systems, with great importance given to the social insurance model of care for workers and beneficiaries, as well as public sector institutions that attend the uninsured and the private sector , 15. TheLiterature about TB mortality in border regions and its determinants in Brazil is still limited. There are documented differences in socio-economic conditions resulting from cultural, political, language and ethnic variations which can negatively impact disease control and increase the risk of TB mortality. These epidemiological characteristics need to be further explored to better position the country to meet the \u201cEnd TB Strategy\u201d target for this indicator.In this study, we aimed at analysing spatial mortality due to TB and its socio-economic determinants in the general population, around the border areas of Brazil, Paraguay and Argentina, as well as the temporal trend in this region.This was an ecological study .Argentina, Brazil and Paraguay, which constitute the countries of the tri-border area, present the following indicators, respectively: incidence rates of 25, 41, 41 per 100,000 inhabitants and mortality rates of 1.6, 2.7, 4.0 per 100,000 inhabitants .Fig. 1MaThe presence of immigrants and tourists in the city creates a good ground for the transmission of communicable diseases in the population hence the higher demand for good-quality health services in the region .The municipality is composed of 327 census sectors, 320 being urban and seven rural , with a It has 28 Primary Health Care (PHC) units, eight use the traditional model and 20 the Family Health Strategy. These units are administratively divided into five health districts and the municipality also has two emergency care units, two pre-hospital care services and one hospital that was maintained by the municipal administration until the end of 2015, and then started to be managed by the Paran\u00e1 State Health Department in 2016 . The stuThe study population was composed of deaths whose underlying cause was TB  for people living in the municipality of Foz do Igua\u00e7u, Paran\u00e1, Brazil, from 2004 to 2015.The study used two sources of information: The Mortality Information System (SIM) and data from the 2010 Demographic Census of the Brazilian Institute of Geography and Statistics (IBGE).The SIM variables selected were: date of diagnosis; date of birth; sex; municipality of the death; municipality of residence; street; number; neighbourhood; and cause of death. The variables obtained from IBGE were related to the \u201cnumber of residents in the household\u201d, \u201crace/skin colour of the residents\u201d and \u201cper capita income of the residents\u201d .Data were obtained from the SIM of the Health Surveillance Department of the Municipal Health Department of Foz do Igua\u00e7u, BR. The map of the census sectors was obtained from IBGE .Absolute and relative frequency measures were calculated for the categorical variables. For the age variable, position (mean and median) and dispersion (standard deviation) measures were calculated using the R Program version 3.3.2.For each case, from the address of the residents in Foz do Igua\u00e7u (PR), reference values for latitude and longitude were found, using the Google Earth\u2122 Version 7.15 software. Then, the TerraView version 4.2.2 software was used to transform the latitude and longitude information into a shapefile format file of points, with SIRGAS2000 projection.The union of the shapefile of cases with the shapefile of sectors was performed using the QGIS version 2.18 software, making it possible to identify, in addition to the distribution of the cases in the municipality, the census sectors in which they were included. Based on the information from the shapefiles and the 2010 Census, three spreadsheets  were constructed using the Excel software to search for clusters, with the relative risk calculated using the SaTScan version 9.3 software.The sweep spatial analysis technique was used, developed by Kulldorff and Nagarwalla (1995) , in whicFor the identification of risk clusters, since TB deaths are countable variables and rare in relation to the population, the Poisson discrete model was used. The standard configuration applied by the SaTScan software adopted the following criteria: no geographic overlap of the clusters, maximum cluster size equal to 50% of the exposed population, circular-shaped clusters and 999 replications. Considering the low frequency of the event in the scenario studied, clusters with 10 and 5% of the exposed population were tested. This variation of the standard allowed the technique to find small clusters . For theUnder the conditions described, the analyses were purely spatial, spatio-temporal and spatial variation in the temporal trends, with the spatial relative risk (RR) and 95% confidence interval (CI) being calculated.\u03bbZ in the region compared to the risk in all other regions [The RR refers to the analysis of a risk outcome within a geographically limited region  , defined regions .\\documenYZ is the Poisson random variable of the Z-region count, with the expected number given by E(Yz); PZ is the population of region Z; P+ is the total population at risk in an area; and N is the total number of observed cases. In the same way \u03bbA\\Z is defined. Thus, the true relative risk is given as [where given as :\\documen\u03bbZ\u2009=\u2009\u03bbAZ\u2009=\u2009\u03bb, the relative risk is equal to 1. Assuming that Z is selected independently of the observed values, then the estimated relative risk is given by:If both Z and A\\Z have the same Z is the number of cases in cluster Z; EA is the number of expected cases in the region under the null hypothesis; EZ is the number of cases in the Z area under the null hypothesis. For the interpretation of RRS, when equivalent to 1, there is strong evidence that there is no risk cluster on the map; if below 1; tending to zero means low risk or area of protection; and above 1, represents the actual risk area and the likelihood [where N is the total number of cases, Nkelihood .The standardized rate of TB mortality (SRTBM) by sex and age for each census sector was estimated using Microsoft Excel 2010 and the result attached to the shapefile format file by QGIS version 2.18. The rate was calculated according to the following formula:where, \u201cSd\u201d\u2009=\u2009number of study deaths;\u201cPop standard-sector\u201d\u2009=\u00a0the population residing in the census sector of reference for the year 2010;\u201cPop subgroup\u201d\u2009=\u2009the population residing in the census sector divided into sex and age groups according to the median reference for the year 2010.\u201cPop standard\u201d = the standard population of the municipality of reference for the year 2010;T\u2009=\u2009period studied in years. For this study, 12\u00a0years were considered.The spatial dependence of the socio-economic conditions  were tested using the Global Moran Index (Moran I). It is important to highlight that spatial dependence is expressed by the following formula :\\documeni is the value of the attribute considered in the area i; z bar is the mean value of the attribute in the study region; and wi corresponds to the elements of the normalized spatial proximity matrix.where n is the number of areas; zThe Global Bivariate Moran Index was used to test the relationship between the socioeconomic conditions and the mortality rate :\\documenwhere I is a variable-by-variable Moran correlation matrix; Z is a case-by-variable matrix whose elements are z-scored; C is a case-by-case binary connectivity matrix, and 1 is a case-by1 column matrix with all elements being 1\u00a0s.i of the mortality attribute in which [This technique is the mean of the Bivariate Local Index of Spatial Association  statistics. This Bivariate LISA technique is expressed for each area i from standardized values xin which :\\documenFrom the socio-economic conditions that were statistically significant for TB mortality, the Bivariate Local Index of Spatial Association (Bivariate LISA) was used, and Moran Maps were constructed for the study of the local autocorrelation. The bivariate LISA map (Moran Map) allowed the identification of the association of statistically significant values and comparison of local means . The exiIn the bivariate analysis, when the index is positive, the relation is direct and the values are predominantly in quadrants 1 and 3, according to the following interpretation: in quadrant 1 the values are high-high (H-H), indicating, in this study, a region with high (above the mean) mortality rates surrounded by regions with high socio-economic condition values; in quadrant 3 the values are low-low (L-L), indicating a low-mortality rate region, in relation to the mean, surrounded by regions with low values in relation to the socioeconomic conditions studied. When the global index is negative, the relationship is inverted and the values are concentrated in quadrants 2 and 4, with quadrant 2  showing, in this study, regions with mortality values below the mean surrounded by areas with high values in relation to the mean of the social condition analysed, and quadrant 4  indicating regions with mortality values above the mean close to regions with low socio-economic condition values , 31.0\u2009+\u2009b1X. To reduce the heterogeneity of residual variances from the temporal regression analysis, the logarithmic transformation of the Y values [The temporal trend of the TB mortality rate in the general population and by race/skin colour was also evaluated. Considering Y as the values of the temporal series and X as the time scale, the line of fit between the points in the time series that aims to estimate the trend is defined by the equation: Y\u2009=\u2009bY values  was applY values , 33.The Type I error \u03b1\u2009=\u20090.05 was set as statistically significant.A total of 74 cases of TB deaths were identified in residents of Foz do Igua\u00e7u (BR). However, four (5.4%) cases were excluded due to lack of address information and four other cases because the latitude and longitude were incomplete, which resulted in 66 (89.2%) geocoded cases.n\u2009=\u200947; 63.5%); however, the causes of deaths were not confirmed by necropsy , they were just based on medical reports .Regarding the sociodemographic characteristics of the individuals who died from TB Table\u00a0, the mean\u2009=\u200967; 90.5).Table\u00a0Fig.\u00a0When applying the SatScan, a relative spatial risk area for TB mortality of RR\u2009=\u20095.07 (95%CI 1.79\u201314.30) was observed in the Eastern Health District  or more (4B) was analysed, the high-high (H-H) areas were scattered between the Mid-west and North regions, which means that areas with a high TB mortality rate were close to sectors with high proportions of households with the income mentioned. Furthermore, areas with an L-L pattern remained on the periphery and were present in almost all the regions.Regarding the L-H pattern, Fig. In Fig. In Fig. Figure\u00a0The study sought to identify risk areas for TB mortality and how socioeconomic differences affect this event and its temporal trend in a municipality located in a tri-border region. Through the study, it was possible to identify a TB mortality risk area, with this being concentrated in a region with less favourable socio-economic conditions. It was observed that income, race, and density of household residents presented statistically significant spatial associations with TB mortality. Regarding the temporal trend, it was observed that death among TB patients in the general population had not changed significantly over the past 12\u00a0years, therefore, it remained stationary.In relation to the profile of cases of death due to TB in a tri-border municipality, a predominance of males, with elementary education and single individuals was observed, which was also found in other studies performed in Brazil , 34, 35.A risk area for TB mortality of 5.07 (95%CI\u2009=\u20091.79\u201314.30) was observed when compared to the other areas. There is a health unit with a Family Health Strategy  located in the area, however, this result highlights the access to this service for TB patients or the limitations of this unit in overcoming the social inequalities that surround it. Although the Pan American Health Organization (PAHO) has stimulated the renewal of Primary Health Care (PHC) in Latin America, including the border regions, to promote equity and human development , there iIt is worth noting that the risk of mortality in our study matches the difference in socio-economic conditions as previously reported \u201340. We fIn relation to the socioeconomic conditions associated with mortality Table , represeAccording to the Brazilian rules, the Bolsa Familia Programme is a conditional cash transfer programme through which parents receive a fixed monthly stipend  in exchange for sending their children to school and complying with different health checkups . This prAnother study, when discussing social income transfer programmes, considered that, even though they are not specific for TB, their benefits contribute to combating the disease . In BrazA favourable situation observed was the negative association between the per capita income of 10\u00a0MW or more and TB deaths, which evidences protection Table . This reWhile there is a vast amount of literature about the relationship between TB and income, one very peculiar outcome was the identification of the H-H pattern for this association Fig. , which sResearchers have advanced in the discussion of a model of social determinants based on the theory of social capital. They affirm that there is the development of the network of links and support, as well as associations between individuals and groups, even in unequal living conditions . This a The findings showed there was a positive relationship with the condition of brown race/skin colour, which means that as this proportion increased, in a given census sector, the mortality rate due to TB also increased in its neighbours. For the proportions of residents of Asian race and white skin colour, the relationship of the association was inverted. There is no plausible biological relationship in the scientific literature to support this difference, however, the construction of Brazilian society  and moreThere is historical information that shows that at some point in its formation, the city was colonized by people of European descent , which eMore recently, in the 70s, due to the construction of a hydroelectric plant on the Paran\u00e1 River, which separates Brazil from Paraguay, the municipality of Foz do Igua\u00e7u received a large number of immigrants . They weThe analysis of the temporal trend shows that mortality was more prominent among the people of brown skin colour since, while the mortality rate decreased among other groups (white and black) and some did not have any cases recorded in the period (indigenous and Asian), this group showed an increase.The issue of race/skin colour has also been presented in other studies as a trait of social inequality, with marked differences in Brazil in terms of opportunities for white and black or brown people, to the point of needing to establish racial quota policies in order to reduce differences. The population of black or brown skin colour is also generally more affected by violence and suffers most from poverty. These people also have little political representation, less access to education and higher education and have a lower average income than white people .A study performed in Michigan (USA) also highlighted the disparity in the incidence of TB cases when comparing races and nationalities. In this study, black people had a mean incidence rate 25 times higher than whites and Asians had an incidence rate 19 times higher than whites . These dA curious fact is that the black race presented no relationship with mortality due to TB, which may be due to the miscegenation in the region, thus, there are more people of brown colour than black. However, black and brown people, according to a study in the Brazilian context, lived in worse conditions in 2006 than the majority of white people, with them representing 66% of the country\u2019s poverty , which iWhat this association shows, however, is that because of the way social relations are constructed in this community, illness and death do not occur equally among racial groups; that is, the development of social relations between these groups produced inequality between them, which, in turn, produces vulnerability for one or more groups, and in the context studied, leads to TB death. Corroborating, a study conducted in China, the results indicated that residing in a border region and being an ethnic/racial minority had an association with TB mortality .In relation to the number of residents per household, the percentage of households with 3 or 4 residents presented a positive association with socioeconomic status, while the percentage of households with more than 10 residents presented a negative association, which is in disagreement with the studies that reported that the higher the household density, the higher the risk of illness , 54. OneIt is worth noting that social inequality is a phenomenon that mainly affects developing countries, especially marked by diseases of poverty such as TB, where there is no harmony in the standard of living of the population, with regard to the spheres of economics, education, profession, gender, race and/or colour, which impacts their health indicators.In Brazil, greater social inequality is governed by economic inequality, where income is distributed heterogeneously in society, with most of this income being concentrated among some people, to the detriment of others living in extreme poverty, which has a significant impact on the TB mortality rate. However, the study showed that living in extreme poverty had no relation to TB mortality, which can be attributed to government programmes such as the Bolsa Fam\u00edlia Programme, which has helped remove thousands of people from extreme poverty and thus avoided deaths.There are other types of inequalities, such as the social condition discriminated by race/skin colour, which means that some groups have fewer opportunities than others, notably the people of brown skin colour. This was evidenced through its relationship with TB mortality in this border region. Generally, these opportunities relate to basic education and higher education, employment and lack of incentives for social mobility . AccordiWorking with secondary data can be considered a limitation of this study, as there is information bias and incomplete or incorrect data, which is dependent on the quality of the registration by the person. Another gap refers to the death verification system itself, in which there may be underreporting of deaths due to TB. A further limitation is due to the fact that the study considered only urban areas, due to the difficulty of processing rural data and information.In addition, the IBGE database  with theHowever, the study advances knowledge by raising important aspects of TB mortality in a border region. With regard to the aim of reducing TB mortality by 95% by 2035, this proposal should be linked to reducing the inequalities observed in these regions, correcting the inequity in opportunities, notably for people of brown skin colour and those without access to health services.According to our findings it can be concluded that the risk of TB mortality in the tri-border region of Brazil is high with variability among various locations. The socioeconomic conditions associated with TB mortality include income status, resident density and race/skin colour. We may speculate that the inverse relationship between economic status and mortality is due to other confounding factors in the population that mainly target the poor communities such as the programmes of income redistribution conditional to health programmes. The population with brown skin colour were more likely to die compared to their black and white counterparts. Contrary to what has been established elsewhere, the high density of household members was inversely associated with TB mortality."}
+{"text": "We refer to the four components (a\u2013d) and their interactions collectively as the \u201cEvolutionary Arena.\u201d We outline analytical approaches to this framework and present a case study on conifers, for which we parameterize the general model. We also discuss three conceptual examples: the Lupinus radiation in the Andes in the context of emerging ecological opportunity and fluctuating connectivity due to climatic oscillations; oceanic island radiations in the context of island formation and erosion; and biotically driven radiations of the Mediterranean orchid genus Ophrys. The results of the conifer case study are consistent with the long\u2010standing scenario that low competition and high rates of niche evolution promote diversification. The conceptual examples illustrate how using the synthetic Evolutionary Arena framework helps to identify and structure future directions for research on evolutionary radiations. In this way, the Evolutionary Arena framework promotes a more general understanding of variation in evolutionary rates by making quantitative results comparable between case studies, thereby allowing new syntheses of evolutionary and ecological processes to emerge.Understanding how and why rates of evolutionary diversification vary is a key issue in evolutionary biology, ecology, and biogeography. Evolutionary rates are the net result of interacting processes summarized under concepts such as adaptive radiation and evolutionary stasis. Here, we review the central concepts in the evolutionary diversification literature and synthesize these into a simple, general framework for studying rates of diversification and quantifying their underlying dynamics, which can be applied across clades and regions, and across spatial and temporal scales. Our framework describes the diversification rate ( The Evolutionary Arena (EvA) framework for comparative studies on evolutionary radiations, stasis, and biodiversity decline. EvA conceptualizes context\u2010dependent species diversification in concert with lineage\u2010specific traits and abiotic and biotic environmental conditions. In this concept paper, we synthesize recent progress in diversification research into a heuristic framework into which relevant processes can be grouped and parameterized . These developments in (macro)evolution are largely based on the adaptive radiation paradigm , climate change , and orogeny . Including evolutionary changes in genomic structure has led to the recognition that the connections between key innovations, key events, and diversification rate shifts can be complex  and extrinsic  factors that is thought to modulate diversification rates , combined with the temporal sequence of geographic movement and environmental change, estimated across a phylogenetic tree, have led to the recognition of x Erwin,\u00a0, 2017, fx Erwin,\u00a0 or Africecological opportunity for adaptive radiations to occur  and extrinsic  factors provides the r Erwin,\u00a0. Simpsonr Erwin,\u00a0 summarizr Erwin,\u00a0. All thrr Erwin,\u00a0.The evolution of diversity ultimately\u00a0requires the evolution of reproductive isolation, which can be promoted by geographic fragmentation. Geographic isolation can result in stochastic divergence underpinned\u00a0by intensified genetic drift in smaller populations Duret,\u00a0, eventuaVariation in the relative contributions of nonadaptive and adaptive processes to diversification was encapsulated by Simpson  in his dtriggers a radiation, but the establishment/evolution of a complementary state\u2014either the establishment of an environment that fits a pre\u2010evolved trait or an exaptation, or the evolution of the trait that is an adaptation to a preexisting environment  innovative traits, and confluence to describe sequential combinations of a set of traits and events along the stem lineages of radiating clades. The idea that evolutionary radiations are the product of synnovations and confluences of multiple intrinsic and extrinsic factors has gained momentum . In EvA, the diversification (or disparification) rate of a focal lineage is a function of three components into which all macroevolution\u2010relevant processes can be grouped and parameterized:d\u00a0=\u00a0diversification or disparification rate, a\u00a0=\u00a0abiotic environment, b\u00a0=\u00a0biotic environment, and c\u00a0=\u00a0clade\u2010specific phenotypes or traits , interspecific morphological/phenotypic disparity, DNA nucleotide diversity and genetic differentiation , physiological diversity , or niche diversity  and differentiation . This list is not exhaustive, and which expression of d is used depends on the question being investigated. The instantaneous rate of diversification, defined as speciation minus extinction per unit time . Component a can be measured as absolute values, for example, area or niche space, or as the variance in these across space and time, for example, variance in mean annual precipitation, in number of vegetation types or soil types, physiographic heterogeneity, and the functional and structural connectivity. Ideally, the abiotic environment is described by processes that generate this environment, such as erosion or orogeny, or patterns of change, such as climate or vegetation change.b: Biotic environment captures the interactions of the focal lineage with all other species . The interaction(s) can be, for example, mutualistic or commensalistic , antagonistic , or genetic . Note, however, that the capacity to hybridize may be treated as a trait, and so categorized under c. These biotic interactions can also be indirect, if seen as part of the extended phenotype of the focal lineage , anatomical or morphological traits, life\u2010history strategies, pollination strategies, and dispersal modes. Clade\u2010specific traits are part of the phenotype and can be labile or phylogenetically conserved. This is illustrated by the remarkable floral variation in the orchid genus Disa  or negative (\u2010) effect on d, thus causing the diversification rate to increase or decrease, or even show a false absence of change as the summed end result of the three. This process of \u201cnullification,\u201d or less increase or decrease than expected, is sometimes ignored and interpreted as a lack of power by the factors influencing diversification. Statistical approaches comparing different systems could provide insights in cases in which diversification rates are higher or lower than expected.The three components 2.2.2d is related to the total variance in the abiotic environment a, then a=\u2211i=1nai, where ai is the ith variable of a (up to the last variable na) given as a measure of variance. Thus, the abiotic environment a (as well as the other components in EvA) can be decomposed into diverse measures.The framework can be expanded to include any set of variables per component. For example, the abiotic environment could be described by climatic factors such as mean annual precipitation and temperature, and by disturbance factors such as fire frequency. The set of variables selected depends on the hypothesis being tested. If, for example, the hypothesis is that 2.2.3t  and the values after a time interval \u2206t (derived), for example, at time t+\u2206t after an event: \u0394d=a,b,ct+\u0394t-a,b,ct or simply \u0394d\u00a0~\u00a0\u0394a, \u0394b,\u0394c]]>. If we, for example, hypothesize that geographic movement to a new region is a key event, the condition of a varies between t and t+\u2206t.Explanations for shifts in diversification rates can be sought by testing for changes in the EvA component values. This can be done by including initial values at time 2.2.4ac, bc, or abc: d\u00a0~\u00a0a,b,c,ab,ac,bc,abc. This allows us to analyze context dependence: whether the single components or the interactions among them modulate the diversification rate, that is, driving or constraining the evolution of diversity. Such interactions can be exemplified by ecosystem engineers modifying disturbance regimes  as consequences of mega\u2010herbivore extinctions (component b) and climate change  and the predictor variables . Such feedback mechanisms can broadly be summarized by the concept of niche construction , and ability to transform environments by increasing the frequency of fire (component a) and the density of grazers (component b). These scenarios describe feedback systems where through increased diversity and dominance, the diversifying clade increasingly modifies the abiotic and biotic environment.We can incorporate interactions between components, such as 2.3The EvA framework can facilitate the direct testing of competing hypotheses about the diversification of a group, using standard model selection approaches  models (such as BiSSE): a birth\u2013death process where the diversification rates depend on the state of an evolving (binary) character  models is essential for detecting whether a character state\u2010dependent model can explain more of the observed variation than could be expected under random diversification rates  of diversification increase or decrease  can be sought. EvA does not present any new analytical methods, and analyses within this framework can be done using existing packages and software . Particularly important is the central notion that no single factor is a sufficient explanation for an evolutionary rate change, but that the interaction between external and internal factors results in shifts in diversification and/or disparification rates . However, what is still lacking is, as noted by Donoghue and Sanderson , a singlGivnish,\u00a0. OverallFirstly, this framework, similar to a model, predicts which factors may be drivers of evolutionary radiations. This reduces the risk of missing important drivers, and so stimulates the development of comprehensive models, rather than the simple exploration of the effect of a factor on diversification rates. In addition, it encourages taking recent advances in understanding context dependence into account.Secondly, this framework is readily quantified, for example, as a regression model. Quantification both facilitates and encourages data transparency . This transparency becomes more important as the model is expanded to reflect the complexity of the predictor factors.Thirdly, it provides a single, general framework within which to analyze all or any evolutionary radiations. The framework can be applied to any biological organisms, geographical regions, or ecosystems. This facilitates the comparison among taxa and regions as to the processes underlying diversification, even if the studies were by different people. This will ease the progression from case studies to general syntheses.4d\u00a0~\u00a0a,b,c framework. The conifers provide an excellent study clade for comparative analysis: The lineage is rich in species grouped into well\u2010defined clades, geographically widespread, and well studied with excellent distribution data +\u03b5, where sr is the net diversification rate assuming a relative extinction fraction \u03b5\u00a0=\u00a00.9, n the number of extant species, and t the stem age of the clade.anderson  as rs=1ta\u00a0=\u00a0abiotic environment, quantified by the clade's potentially suitable area size: the projected geographical range reflecting the potential niche of all species within the clades. This is calculated per clade as the number of \u00bc\u00b0 grid cells across the globe that at least one species of the clade can occupy, based on the physiological SDM and corrected for clade species numbers  as the product of niche and geographic overlap between species. The metric underestimates competition because it excludes competitive processes with other clades and other indirect competitive processes  are positively affected by the available abiotic environment (a) and the rate of niche evolution (c), and negatively by interspecific competition (b). We fitted the conifers EvA model d\u223cln(a)+b+ln(c) by means of phylogenetic generalized least squares (PGLS), controlling for the nonindependence between cases resulting from phylogenetic structure in the data using the R v3.5.3 , adjusted for the phylogenetic signal in the model residuals. We accessed the standardized coefficients and calculated the variance explained by the full model using the coefficient of determination (R2) to measure goodness\u2010of\u2010fit, and also assessing partial r2  using the R library \u201crr2\u201d v1.0.1 . The predictor variables a, b, and c in the conifer EvA model differentially contributed to explaining d (Table\u00a0a) showed no relationship to diversification rate , neither did the rate of niche evolution . Contrarily, competitive interactions (b) between the species in a clade indicated a significant negative relationship to diversification , supporting our expectation  on diversification (d) indicates higher diversification rates in clades where competition among species is low. This result is consistent with the concept of diversity\u2010dependent diversification  or rates of physiological trait evolution . However, the rates of niche evolution (c) among the conifer clades show a very similar, although inverse, pattern to that of competition (b)  influenced diversification in the conifers, in line with findings by Larcombe et\u00a0al.\u00a0 Figure\u00a0. Estimate et\u00a0al.\u00a0, who shoe et\u00a0al.\u00a0. The twod, b, and c are fixed\u00a0within the 41 clades, which is an oversimplification. It could be interesting to repeat the analysis using species instead of clades, as this allows us to account for phylogenetic structure within the clades, ecologically highly variable species, and diversification stasis. However, there are issues interpreting tip\u2010diversification rates  within the last 1.2\u20133.5\u00a0Ma. The Andean Lupinus radiation has been attributed to a combination of intrinsic evolutionary (trait) innovation and extrinsic ecological opportunity , prompting Hughes and Eastwood  are driving diversification. However, treating the biotic environment (b in EvA) as zero, or empty of competition is clearly an oversimplification, given that there were apparently many plant radiations playing out during the Pleistocene across the high\u2010elevation Andean grasslands, presumably in parallel with each other .A more detailed analysis might indicate what factors of these high\u2010elevation habitats are important for the observed high rates of diversification. Indeed, it is aspects of the abiotic environment that are most often put forward as the central explanation for the numerous rapid recent radiations in the high\u2010elevation Andean grassland. Foremost among these aspects are (i) the large continental\u2010scale extent of the high\u2010elevation Andes; (ii) the extreme physiographic heterogeneity; and (iii) the rapid fluctuation in the extent and connectivity between the north Andean alpine sky islands (p\u00e1ramo) during the Pleistocene glacial\u2013interglacial climate cycles. Physiographic heterogeneity of the Andes, spanning steep and extended environmental gradients , has long been considered as a key factor driving Andean radiations ,\u00a0the island or archipelago,\u00a0has discrete boundaries. While many classic studies have analyzed insular diversification and disparification (d in EvA) in single monophyletic radiations , it needs to be considered that in most cases, there are precursors to current\u2010day islands that have been eroded to the Pleistocene sea level and are now submerged as guyot seamounts. These previous islands may explain the fact that the evolutionary age of lineages can be older than the respective island where they are endemic today  Andrena Fabricius solitary bees as highly specific pollinator species, and by rapid disparification of flowers \u00a0mediate strong reproductive isolation in the absence of any measurable postpollination barriers to gene flow among closely related species , which is predominantly mediated by alkenes , is in stark contrast to the rest of the loci in the genome, where abundant polymorphisms are shared across closely related species  attributable to the highly heterogeneous (dynamic) abiotic environment (a in EvA) providing habitats for plants and pollinators (b in EvA) during the last million years?The high specificity of the pollinators in the s Figure\u00a0. HoweverOphrys may best be assessed not by phylogenetic means, but by within\u2010group pairwise estimates among closely related species, either in terms of genetic differentiation  or phenotypic measurements\u00a0(d in EvA). Among the abiotic measurables (a in EvA) would be estimates of habitat fragmentation  over the estimated age of target clades/species groups. Biotic interactions (b in EvA) can be represented as matrices of interactions at varying levels; in its simplest form, orchid species vs. pollinator species. Due to the occurrence of (i) parallel use of the same pollinators in different lineages and (ii) repeated use of the same pollinators by allopatric orchid species, such an interaction matrix could initially take the shape of a variance\u2013covariance matrix as in comparative analyses . This trait change would ideally be based upon mechanistic molecular knowledge that could then be quantified numerically. As a first step in this direction, it may be possible to construct a statistic that summarizes trait\u2013gene associations derived from genomic/transcriptomic data on gene polymorphisms and/or expression from phenotyped individuals. Overall, although the data to formally test the components of the EvA framework in the Ophrys example are not yet collected, doing so seems at least theoretically straightforward.Potentially, proxies for all components are measurable here. Due to the extensive amount of allele sharing, and gene coalescence times frequently predating \u201cspeciation\u201d times (establishment of reproductive barriers), diversification among very recent groups of O'Meara,\u00a0. Since tO'Meara,\u00a0, such anO'Meara,\u00a0. Clade\u2010sEvA adds a comparative structure to the questions developed above. It may also provide a semantic to bridge micro\u2010 and macroevolution in systems where investigations span different levels, from populations to species and clades.6In this review, we synthesize the central concepts of the evolutionary diversification literature and present the Evolutionary Arena (EvA) framework, a heuristic for exploring the modulators of diversification rates, in terms of the (extrinsic) biotic and abiotic environment and the (intrinsic) traits of the focal lineage Table\u00a0; that isThe framework is very flexible, facilitating the incorporation of detailed variables, interactions among the components, changes in the direction of effect of these components, and interpretation of phylogenetic conservatism and trait lability. EvA advocates a multivariate perspective on radiations and can be readily expanded to accommodate increasing levels of complexity, to test for the interactions among variables, or to rank variables according to their relative influence on diversification rates. Whether the specific results are tallied, or whether the predictors are collapsed, will most likely depend on the type of question being asked, and on the power available in the study system. EvA can be formulated as a hypothesis\u2010testing framework to test whether the likelihood of observing the data under a favorite particular model provides better fit than an appropriate null model, or to compare models of varying complexity. The framework may be particularly useful in parameterizing data\u2010rich, broadscale analyses comparing different systems, such as evolutionary radiations of clades across different regions, or between different clades within the same region, for example, the plant radiations in the north Andean p\u00e1ramos. Applying these analyses within the framework allows us to identify the important components that account for differences in diversification rates between clades and regions. The Evolutionary Arena framework thus encourages a more comparative approach to exploring phylogenetic and geographical variation in the correlates of speciation and extinction.7Adaptation: a trait is an adaptation to a selective regime if it evolved in response to selection by that regime  that a lineage occupies by virtue of a novel trait(s) that confer fitness in these niches.Confluence: the sequential coming together of a set of traits (innovations and synnovations), environmental changes, and geographic movements along the branches of a phylogenetic tree  or genetic trait(s), inherited by the focal lineage.Key event: events that trigger a shift in diversification rates.Key innovation: new trait which facilitates the occupation of a new adaptive zone, or which breaks an evolutionary constraint, that is, a\u00a0\u201cphenotype(s) that allowed a species to interact with the environment in a novel way\u201d . Radiation (diversification / disparification) can be combined with an epithet, such as adaptive, geographical, ecological, or genetical (gene flow) to further describe the nature of the evolutionary forces and situations . We refer to biological radiation most generally as \u201cevolutionary radiation\u201d as the change in diversification / disparification rates has macroevolutionary consequences. In addition, there are two prominent concepts that refer to the process underlying the evolutionary radiations:Adaptive radiation: proliferation of species driven by the evolution of phenotypic  diversity that can be linked to adaptation to an environment. The environment may act as a modulator, driving  speciation and/or slowing extinction.Geographic radiation: proliferation of species driven by enhanced opportunities for allopatric speciation  in a particular region . Also referred to as \u201cnonadaptive radiation\u201d (= geographic), or \u201cclimatic radiation\u201d when differing climates are thought important. Note that the adaptive and geographic categories are simplified: Both adaptive and neutral processes likely play a role in modulating diversification rates in most radiations, but their relative contributions differ. For example, ecological factors may enhance the opportunity for reproductive isolation, and species divergence in adaptive radiations may additionally be promoted by spatial isolation .Synnovation: interacting combination of traits with a particular consequence  that can be observed.Trigger: event or situation starting a radiation.None declared.Nicolai M. N\u00fcrk: Conceptualization (lead); Formal analysis (supporting); Funding acquisition (lead); Project administration (lead); Visualization (lead); Writing\u2010original draft (lead); Writing\u2010review & editing (lead). H. Peter Linder: Conceptualization (lead); Resources (supporting); Visualization (supporting); Writing\u2010original draft (lead); Writing\u2010review & editing (lead). Renske E. Onstein: Conceptualization (supporting); Formal analysis (lead); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Matthew J. Larcombe: Conceptualization (supporting); Formal analysis (lead); Resources ; Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Colin E. Hughes: Conceptualization (supporting); Resources ; Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Laura Pi\u00f1eiro Fern\u00e1ndez: Conceptualization (supporting); Resources (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Philipp M. Schl\u00fcter: Conceptualization (supporting); Resources ; Visualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Luis Valente: Conceptualization (supporting); Resources ; Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Carl Beierkuhnlein: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Vanessa Cutts: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Michael J Donoghue: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Erika J. Edwards: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Richard Field: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Suzette G.A. Flantua: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Steven I Higgins: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Anke Jentsch: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Sigrid Liede\u2010Schumann: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). Michael D. Pirie: Conceptualization (supporting); Writing\u2010original draft (supporting); Writing\u2010review & editing (supporting). https://doi.org/10.5061/dryad.2bvq83bkx.This article has been awarded Open Materials, Open Data Badges. All materials and data are publicly accessible via the Open Science Framework at"}
+{"text": "Although patterns of biodiversity across the globe are well studied, there is still a controversial debate about the underlying mechanisms and their generality across biogeographic scales. In particular, it is unclear to what extent diversity patterns along environmental gradients are directly driven by abiotic factors, such as climate, or indirectly mediated through biotic factors, such as resource effects on consumers.Andes, Southern Ecuador; Mt. Kilimanjaro, Tanzania.We studied the diversity of fleshy\u2010fruited plants and avian frugivores at the taxonomic level, that is, species richness and abundance, as well as at the level of functional traits, that is, functional richness and functional dispersion. We compared two important biodiversity hotspots in mountain systems of the Neotropics and Afrotropics. We used field data of plant and bird communities, including trait measurements of 367 plant and bird species. Using structural equation modeling, we disentangled direct and indirect effects of climate and the diversity of plant communities on the diversity of bird communities.We found significant bottom\u2010up effects of fruit diversity on frugivore diversity at the taxonomic level. In contrast, climate was more important for patterns of functional diversity, with plant communities being mostly related to precipitation, and bird communities being most strongly related to temperature.Our results illustrate the general importance of bottom\u2010up mechanisms for the taxonomic diversity of consumers, suggesting the importance of active resource tracking. Our results also suggest that it might be difficult to identify signals of ecological fitting between functional plant and animal traits across biogeographic regions, since different species groups may respond to different climatic drivers. This decoupling between resource and consumer communities could increase under future climate change if plant and animal communities are consistently related to distinct climatic drivers. Although patterns of biodiversity across the globe are well studied, there is still a controversial debate about the underlying mechanisms and their generality across biogeographic scales. We found significant bottom\u2010up effects of fruit diversity on frugivore diversity at the taxonomic level. In contrast, climate was more important for patterns of functional diversity, with plant communities being mostly related to precipitation, and bird communities being most strongly related to temperature. We measured two female and two male specimens of each species. We measured bill length and bill width using a sliding caliper (\u00b10.01\u00a0mm). We measured bill length as the distance from the commissural point of the upper and lower bill to the tip of the closed bill, and bill width as the external distance between the two commissural points, which is functionally equivalent to gape width . We used the \u201cindependent swap\u201d algorithm  which are able to account for both direct and indirect relationships among variables in complex systems , we fitted a separate SEM. Thus, we considered only corresponding metrics of plant and bird communities in each model   and the comparative fit index (CFI)  and Cecropia (492 visits), and Miconia (32 visits) was equally among the most frequently visited genera at higher altitudes  was the most frequent bird species at lower elevations of the Ecuadorian Andes, while the Lacrimose Mountain\u2010Tanager  was most frequent at higher elevations (see Appendix\u00a0Lannea (307 visits) and Ozoroa (91 visits) were frequently visited at lower elevations, while Schefflera  was most frequently visited by birds at high elevations  was the most frequent bird species at low elevations, while the Montane White\u2010Eye  was the most frequent visitor at high elevations of Mt. Kilimanjaro . Moreover, FD of plant and bird communities varied across both mountain ranges  and 2\u201353 (median\u00a0=\u00a023) species per plot in the Ecuadorian Andes and 5\u201315 (median\u00a0=\u00a07.5) and 7\u201323 (median\u00a0=\u00a012.5) species per plot on Mt. Kilimanjaro, respectively. Species turn\u2010over between plots was high and, on average, 90% of plant species in the Ecuadorian Andes and 88% on Mt. Kilimanjaro, and 80% of bird species in the Ecuadorian Andes and 83% on Mt. Kilimanjaro were replaced between plots \u00a0>\u00a00.05; lower 90% of confidence intervals of RMSEA close to 0; CFI\u00a0>\u00a00.95). Results were consistent across biogeographic regions, with exception of plant functional dispersion . With increasing temperature, species richness in plant communities significantly increased, which in turn caused a significant increase in species richness of bird communities Figure\u00a0. SimilarSES), but these links were not statistically significant  of bird communities increased significantly with mean annual temperature, while FRic of plant communities was strongly positively linked to mean annual precipitation Figure\u00a0. For bot4We compared patterns of taxonomic and functional diversity of frugivorous birds across two major mountain systems of the Neotropics and Afrotropics and simultaneously disentangled direct and indirect effects of climate and resource diversity. The overall diversity of fleshy\u2010fruited plants and avian frugivores was higher in the Ecuadorian Andes than on Mt. Kilimanjaro, which is in line with other studies showing similar differences between the two biogeographic regions  showed signs of functional clustering, which is typically explained by environmental filtering , data curation (lead), formal analysis (lead), funding acquisition , investigation (lead), methodology (lead), project administration (lead), resources (lead), software (lead), supervision (lead), validation (lead), visualization (lead), writing \u2013 original draft (lead), writing \u2013 review and editing (lead). J\u00f6rg Albrecht: Conceptualization (supporting), data curation (supporting), formal analysis , funding acquisition (supporting), investigation (supporting), methodology , project administration (supporting), resources (supporting), software (supporting), supervision (supporting), validation , visualization , writing \u2013 original draft , writing \u2013 review and editing . Katrin B\u00f6hning\u2010Gaese: Conceptualization , data curation (supporting), formal analysis (supporting), funding acquisition (lead), investigation (supporting), methodology (supporting), project administration (lead), resources , software , supervision , validation (supporting), visualization (supporting), writing \u2013 original draft (supporting), writing \u2013 review and editing (supporting). Andreas Hemp: Conceptualization (supporting), data curation (supporting), formal analysis (supporting), funding acquisition (supporting), investigation (supporting), methodology (supporting), project administration (supporting), resources (supporting), software (supporting), supervision (supporting), validation (supporting), visualization (supporting), writing \u2013 original draft (supporting), writing \u2013 review and editing (supporting). Kim M. Howell: Conceptualization (supporting), data curation (supporting), formal analysis (supporting), funding acquisition (supporting), investigation (supporting), methodology (supporting), project administration (supporting), resources (supporting), software (supporting), supervision (supporting), validation (supporting), visualization (supporting), writing \u2013 original draft (supporting), writing \u2013 review and editing (supporting). Laura Kettering: Conceptualization (supporting), data curation (supporting), formal analysis (supporting), funding acquisition (supporting), investigation (supporting), methodology (supporting), project administration (lead), resources (supporting), software (supporting), supervision (supporting), validation (supporting), visualization (supporting), writing \u2013 original draft (supporting), writing \u2013 review and editing (supporting). Alexander Neu: Conceptualization (supporting), data curation (supporting), formal analysis (supporting), funding acquisition (supporting), investigation (supporting), methodology (supporting), project administration (supporting), resources (supporting), software (supporting), supervision (supporting), validation (supporting), visualization (supporting), writing \u2013 original draft (supporting), writing \u2013 review and editing (supporting). Eike Lena Neuschulz: Conceptualization , data curation , formal analysis , funding acquisition , investigation , methodology , project administration , resources , software , supervision , validation , visualization , writing \u2013 original draft , writing \u2013 review and editing . Marta Quiti\u00e1n: Conceptualization (supporting), data curation (supporting), formal analysis (supporting), funding acquisition (supporting), investigation (supporting), methodology (supporting), project administration (supporting), resources (supporting), software (supporting), supervision (supporting), validation (supporting), visualization (supporting), writing \u2013 original draft (supporting), writing \u2013 review and editing (supporting). Vinicio E. Santill\u00e1n: Conceptualization (supporting), data curation (supporting), formal analysis (supporting), funding acquisition (supporting), investigation (supporting), methodology (supporting), project administration (supporting), resources (supporting), software (supporting), supervision (supporting), validation (supporting), visualization (supporting), writing \u2013 original draft (supporting), writing \u2013 review and editing (supporting). Till T\u00f6pfer: Conceptualization (supporting), data curation (supporting), formal analysis (supporting), funding acquisition (supporting), investigation (supporting), methodology (supporting), project administration (supporting), resources (supporting), software (supporting), supervision (supporting), validation (supporting), visualization (supporting), writing \u2013 original draft (supporting), writing \u2013 review and editing (supporting). Matthias Schleuning: Conceptualization (lead), data curation , formal analysis , funding acquisition , investigation , methodology , project administration , resources , software , supervision , validation , visualization , writing \u2013 original draft , writing \u2013 review and editing . Susanne A. Fritz: Conceptualization (lead), data curation (lead), formal analysis (lead), funding acquisition (lead), investigation (lead), methodology (lead), project administration (lead), resources (lead), software (lead), supervision (lead), validation (lead), visualization (lead), writing \u2013 original draft (lead), writing \u2013 review and editing (lead).Figure S1aClick here for additional data file.Figure S1bClick here for additional data file.Figure S2Click here for additional data file.Appendix S1Click here for additional data file.Appendix S2Click here for additional data file.Appendix S3Click here for additional data file."}
+{"text": "Compared with the CO group, early intervention with AM or FMT significantly decreased ileal crypt depth on day 7 and altered gene expression profiles in ileum on days 7 and 21, and especially promoted the expression of chemokines  involved in the toll-like receptor signaling pathway on day 21. FMT changed major immune activities from B cell immunity on day 7 to T cell immunity on day 21 in the ileum. On the other hand, both AM and FMT predominantly downregulated the gene expression of toll-like receptor 4 (TLR4). In summary, both early interventions modulated intestinal barrier function and immune system in the ileum with a low impact on ileal morphology and development.This study aimed to investigate the effects of early intervention with antibiotics and maternal fecal microbiota on ileal morphology and barrier function, and transcriptomic profiling in neonatal piglets. Piglets in the amoxicillin (AM), fecal microbiota transplantation (FMT), and control (CO) groups were orally administrated with amoxicillin solution (6.94 mg/mL), maternal fecal microbiota suspension [>10 The early colonization of the gut microbiota, which is considered to be the major antigen challenge for the newborn, is essential for the maturation of the gut-associated lymphoid tissue and for the developmental regulation of the intestinal physiology ,2,3. In Lactobacillus spp. in the small intestine  at 8:00 am every day, piglets in the amoxicillin treatment (AM) group and the control (CO) group were orally supplemented with the same volume of amoxicillin (6.94 mg/mL) or physiological saline (0.9% NaCl), respectively. All piglets had access to breast milk and water ad libitum and had no other creep feed throughout the experiment period.Five litters of healthy neonatal 0-day-old piglets  were used in this study. Each litter was randomly allocated into the CO, AM, or FMT groups, with three piglets in each group. On days 1\u20136, piglets in the maternal fecal microbiota transplantation (FMT) group were orally administered with 3 ml fecal microbiota suspension [>10At 8:00 am of days 7 and 21 (weaning day), one piglet per group in each litter was randomly selected and then anesthetized and euthanized with a jugular vein injection of 4% sodium pentobarbital solution (40 mg/kg body weight). Blood samples were taken from the anterior vena cava and centrifuged at 3000 rpm for 15 min, the serum was then stored at \u221228 \u00b0C for the analysis of cytokine concentrations. Segments of the distal ileum were removed and fixed by immersion in 10% (v:v) phosphate buffered formalin for histologic study. The ileal mucosa was collected by scraping with sterile glass microscope slides and rapidly stored at \u221280 \u00b0C for further analysis.The gut microbiota of piglets used in this study have been analyzed in our previous study .Ileum tissue samples for the morphometric study were dehydrated and embedded in paraffin wax, sectioned at 4 \u03bcm, and stained with hematoxylin and eosin. Villus height and crypt depth were measured by a NIS-Elements F software in a bright field microscope . Villus height was measured from the top of the villus to the top of the lamina propria. Crypt depth was measured from the base upwards to the region of transition between the crypt and villus.The concentrations of interferon gamma (IFN-\u03b3), interleukin 1 alpha (IL-1\u03b1), interleukin 1 beta (IL-1\u03b2), interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 10 (IL-10), interleukin 12 (IL-12), and tumor necrosis factor alpha (TNF-\u03b1) in the serum were determined with the ELISA kit (the US China Business Association (USCN), USA), according to the manufacturer\u2019s instructions.The RNA was isolated from ileum mucosa with RNAiso Plus Total RNA extraction reagent (Takara) according to the instructions, and the integrity was inspected through an Agilent Bioanalyzer 2100 . Three samples in each group were randomly selected for sequencing for reducing the cost of the experiment. The rRNA of the purified RNA was removed with rRNA removal bead, and then the RNA was divided into fragment and converted to cDNA. The cDNA was purified, and sequencing adaptors were attached to the fragments. Suitable fragments were isolated and amplified by PCR. The libraries outcomes were sequenced by Illumina HiSeq 2500. The average number of reads of samples was 8.54G, and the Q20 ratios were all higher than 90%. Qualified reads were further analyzed. The information of quality control during sequencing is showed in C-C motif chemokine ligand 4 (CCL4) [C-C motif chemokine ligand 5 (CCL5) [C-X-C motif chemokine ligand 9 (CXCL9) [CD19 molecule (CD19) [inducible T cell costimulator (ICOS) [C-X-C motif chemokine receptor 6 (CXCR6) [\u03b2-actin gene with formula 2\u2212\u0394\u0394Ct.Quantitative analysis real-time PCR was performed on ABI 7300  using SybrGreen  according to the manufacturer\u2019s instructions. The expression of inflammatory cytokines genes, tight junction genes, and intestinal development genes were determined. Besides, the gene expression of 4 (CCL4) , C-C mot5 (CCL5) , C-X-C m (CXCL9) , CD19 moe (CD19) , inducibr (ICOS) , and C-X (CXCR6)  was deten = 5. The differences among groups were evaluated using one-way analysis of variance (ANOVA) with p < 0.05 as the criteria to declare significantly different.The data analysis of morphology, quantitative real-time PCR, and serum cytokines was implemented with SPSS (version 20) as a randomized block design. A litter was regarded as an experimental unit, meaning p value < 0.05 and FC > 2 or < 0.5 are thought to be significant differences and are selected for further analysis.Regarding the RNA-seq, the raw data were filtered with Seqtk, and then the preprocessed data underwent genome mapping by spliced mapping algorithm of Hisat2 (version: 2.0.4) . After chttps://david.ncifcrf.gov/tools.jsp, accessed 15 June 2018). The Fisher\u2019s exact test was selected as the statistical method, and false discovery rate (FDR) correct method was the FDR value. The difference was seen as significant when p < 0.05.The gene ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway enrichment analysis was performed on the Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resources 6.8 (p < 0.05). However, no significant difference in ileal morphology was observed in all groups on day 21.As shown in p < 0.05) in plasma compared to the CO group. The concentration of IFN-\u03b3 was significantly declined (p < 0.05) in the AM compared to the FMT and CO. No significant difference in the concentration of IL-2, IL-6, IL-10, IL-12, and TNF\u03b1 was observed among three groups  in the AM group on day 7, while was lower (p < 0.05) in the FMT group on day 21. No significant difference in the mRNA expression of occludin was observed among the three groups (p < 0.05) of toll-like receptor 4 (TLR4) mRNA expression compared to the CO group. No significant difference in the mRNA expression of toll-like receptor 2 (TLR2) was observed among the three groups (IL-8 in the ileum in the AM group was significantly increased (p < 0.05) compared to the CO group. On day 21, for pro-inflammatory cytokine TNF-\u03b1 and anti-inflammatory cytokine TGF-\u03b2, the mRNA expression in the FMT and AM group was significantly lower (p < 0.05) than that of the CO group. No significant difference in the mRNA expression of IL-1\u03b2, IL-10, interferon gamma (IFN-\u03b3), IL-6, IL-18, and histone deacetylase 1 (HDAC1) was observed among the three groups , insulin-like growth factor 1 (IGF-1), glucagon-like peptide 2 (GLP-2), and epidermal growth factor (EGF) in the ileum among three groups  were significantly affected by FMT. Compared with FMT, glutathione metabolism, metabolism of xenobiotics by cytochrome P450, drug metabolism\u2014cytochrome P450, mineral absorption, salivary secretion, the PPAR signaling pathway, and complement and coagulation cascades were significantly affected by AM B.CCL4, CCL5, CXCL9, CD19, ICOS, and CXCR6 by quantitative real-time PCR  were identified to recognize pathogen ligands and regulate the immune response of the intestinal epithelium by transmitting intestinal bacterial signals [TLR4 mRNA expression in the AM group suggested that antibiotics may affect the LPS/TLR4 signal transduction pathway [A complete intestinal barrier can isolate the entry of enteric toxic macromolecules and harmful bacteria and is essential for protecting the gut. The tight junction on the intestinal mucosa is an important part of the intestinal barrier, which prevents the spread of bacteria and other antigens in the epithelium . ZO-1 an signals . TLR4 is pathway . Generally speaking, the total numbers of DEGs between day 7 and day 21 are roughly equal in three comparisons , but actually, the proportion of upregulated and downregulated genes were significantly altered in AM/CO and AM/FMT. Then, GO and KEGG analyses were performed on DEGs in each comparison. The data showed that, in these comparisons, the number of GO terms and enriched KEGG pathways in a pattern of time effect were greater on day 21 than day 7.Streptococcus and Proteobacteria compared to the control group respectively, on day 7 and 21 in neonatal piglet ileums [Proteobacteria is a microbial signature of dysbiosis in gut microbiota [Microbiota colonization after birth is the most important trigger for immune system development  and earlt ileums . Proteobcrobiota . In our crobiota , which wC-C motif chemokine ligand 5 (CCL5), C-X-C motif chemokine ligand 9 (CXCL9), and C-X-C motif chemokine ligand 11 (CXCL11). Furthermore, we looked into the DEGs  enriched in the toll-like receptor signaling pathway in AM/CO and FMT/CO on day 21  enhanced the chemotaxis of NK cells [CXCL9 and CXCL11 strengthened T cell chemotaxis [ZAP70 is a critical cytoplasmic tyrosine kinase involved in multiple T-cell receptor signaling pathways [ZAP70, CD8B, CD3G, and CD3D were all upregulated in the T cell receptor signaling pathway (According to results of KEGG pathway analysis, we observed that the major significant pathways were related to chemokine-mediated pathways both in AM/CO and FMT/CO on day 21, and interestingly, almost all expression of chemokine DEGs were upregulated, such as n day 21 , and triNK cells , and CXCemotaxis . Consequpathways ,45. In A pathway , indicatThis study investigated the effects of two early microbial interventions on intestinal function in ileum in neonatal piglets. The results indicated that early intervention with antibiotics or maternal fecal microbiota significantly altered gene expression profiles in ileum on days 7 and 21, and notably promoted the expression of chemokines involved in the toll-like receptor signaling pathway on day 21. Moreover, these early interventions to some extent changed intestinal barrier function, although there was a low impact on ileal morphology and development. The data of this study could be a valuable reference for the further research on exploring molecular mechanisms for the effects of antibiotic administration on neonatal pig ileum."}
+{"text": "These research tools offer unprecedented insights into the functionality of probiotics and prebiotics in the host ecosystem. Young scientists need to acquire these diverse toolsets, or form inter-connected teams to perform comprehensive experiments and systematic analysis of data. This will be critical to identify microbial structure and co-dependencies at body sites and determine how administered probiotic strains and prebiotic substances influence the host. This and other strategies proposed in this review will pave the way for translating the health benefits observed during research into real-life outcomes. Probiotic strains and prebiotic products can contribute greatly to the amelioration of global issues threatening society. The intent of this article is to provide an early career researcher\u2019s perspective on where the biggest opportunities lie to advance science and impact human health.The opportunities in the fields of probiotics and prebiotics to a great degree stem from what we can learn about how they influence the microbiota and interact with the host. We discuss recent insights, cutting-edge technologies and controversial results from the perspective of early career researchers innovating in these areas. This perspective emerged from the 2019 meeting of the International Scientific Association for Probiotics and Prebiotics - Student and Fellows Association (ISAPP-SFA). Probiotic and prebiotic research is being driven by genetic characterization and modification of strains, state-of-the-art  Trillions of microbes inhabit the human body, collectively forming the human microbiota. These microbes create complex, organ-specific and adaptive ecosystems, which continually impact the host\u2019s physiology. The microbiota and its overall genetic material (the microbiome) consist of bacteria (bacteriome), archaea (archeome), fungi (mycobiome), viruses (virome), and parasites (parasitome). Together they play a pivotal part in human and animal physiology through influencing digestion, immune development, vitamin production, and likely behavior and mental wellbeing . Beneficin vitro and in vivo models  is available at a reasonable cost, we advise that qualitative WGS and rigorous annotation should become the standard practice prior to marketing new probiotic strains. Newly sequenced genomes should be deposited and made publicly available via standard central databases . A rigorous sequence quality control and annotation should be carried out , has resulted in greater emphasis on untargeted metabolome analysis . Microbistanding . Provingabolites .For those pursuing prebiotic research, this multi-dimensional approach should uncover how these compounds function within the diverse gut microbiome or at other sites.in vivo benefits and safety of probiotics  from clinical trials. The readouts should focus on functional interactions with the host and how they are influenced by additional factors . This can be reasonably well achieved with a combination of proaches . Preciseproaches . Responslunteers .Approaches like this provide avenues for understanding the individual-specific effects of different probiotic strains and facilitate their rationally designed clinical application. An exciting future goal would be to develop personalized probiotics and prebiotics. However, given there is no single healthy microbiome , the perin vivo microbiome sampling of difficult to access niches in the gut , have proven that populations in low-income regions derive benefits beyond probiotic-mediated health, as seen by facilitating economic development and fighting malnutrition with local resources  will become standard when going for a physical examination in the future.Novel sampling systems will elucidate how an applied probiotic or prebiotic interacts with the host at various levels, including the immune system, metabolism and all components of the microbiome. Ultimately, an integrative approach will support a form of personalized medicine to establish dose-response relationships for treatment, but moreso attempt to align what enters our system, how it is processed, and which probiotics or prebiotics deliver the best desired effects. Mechanistic insights into effector molecules will pave the way for emerging concepts, such as postbiotics.As early career scientists, we want to be part of a society that uses beneficial microbes to help solve global problems, such as reducing the risk and impact of disease (including viruses and pandemics) and removing drugs and toxins from our food and environment. These will be exciting times with many career paths open for probiotics and prebiotics research in the sciences and applied to many other disciplines.All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.GR acknowledged providing advice to several companies that sell probiotic products. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Recombinant human bone morphogenetic protein 2 (rhBMP2) is a powerful osteoinductive biologic, used for the treatment of vertebral fractures and critically-sized bone defects. Although effective, the use of rhBMP2 has limitations due its recombinant morphogen nature. In this study, we examined the comparison between two osteoinductive agents: rhBMP2 and the innovative strontium-substituted hydroxyapatite nanoparticles. To test their effectiveness, we independently loaded Gelfoam sponges with the two osteoinductive agents and used the sponges as agent-carriers. Gelfoam are FDA-approved biodegradable medical devices used as delivery system for musculoskeletal defects. Their porous structure and spongy morphology make them attractive in orthopedic field. The abiotic characterization of the loaded sponges, involving ion release pattern and structure investigation, was followed by in vivo implantation onto the periosteum of healthy mice and comparison of the effects induced by each implant was performed. Abiotic analysis demonstrated that strontium was continuously released from the sponges over 28 days with a pattern similar to rhBMP2. Histological observations and gene expression analysis showed stronger endochondral ossification elicited by strontium compared to rhBMP2. Osteoclast activity was more inhibited by strontium than by rhBMP2. These results demonstrated the use of sponges loaded with strontium nanoparticles as potential bone grafts might provide better outcomes for complex fractures. Strontium nanoparticles are a novel and effective non-biologic treatment for bone injuries and can be used as novel powerful therapeutics for bone regeneration.The osteoinductive property of strontium was repeatedly proven in the last decades. Compelling  Bone tissue constitutes the rigid scaffold that is the skeleton, which provides structural support for vertebrates and confers protection to the most delicate vital organs. The extraordinary regenerative capability of bone tissue to repair and heal without the formation of a fibrotic scar was recognized by Imhotep (2630\u20132611 BC) and Hippocrates (460\u2013370 BC)  with the aim of assisting and accelerating osteogenesis  to calcium hydroxyapatite nanoparticles and rhBMP2 (HAn-BMP2) using Gelfoam sponges as carriers with both treatments. An extensive characterization was performed including an abiotic study on the implant structure, as well as analysis of ions and rhBMP2 release patterns. The in vivo study was performed, on a healthy, bone damage-free mouse model to analyze the effectiveness of the described implants in targeting bone tissue. The sponges were implanted adjacent to the periosteum and gene expression of markers of osteocytes and OCs maintenance, MSCs recruitment, osteogenic and chondrogenic differentiation were evaluated, in order to analyze the responses at the periosteal bone. The experimental scheme is shown in The aim of this work is to compare the 2. The sponge absorbance capacity of 200 \u03bcL was defined as the volume of water completely absorbed by each sponge. The sponges were loaded with a HCl-acidified MilliQ water solution (pH 5) containing 30% (w/v) of calcium hydroxyapatite nanoparticles (HAn) or with a MilliQ water solution containing 27% (w/v) of HAn and 3% (w/v) of strontium hydroxyapatite nanoparticles (SrHAn). For abiotic characterization unloaded sponges were hydrated with acidified MilliQ and defined as the control (CTRL). For rhBMP2 loaded-sponges, 3 \u03bcg of human recombinant BMP2 (R&D Systems) were added to the HAn suspension before the sponge absorption phase (HAn-BMP2). Acidified MilliQ was used to increase nanoparticles solubility, buffer pH suspension  and to prevent rhBMP2 precipitation  were cut into 1 cmA second set of sponges was prepared exactly as the first set of samples but with an additional step of lyophilization in order to check the system stability. Exception made for HAn-BMP2, which was not prepared in the second set. This second set was labeled with an \u201cs\u201d for \u201cstability\u201d  and collectively defined as \u201ctreated\u201d sponges. Following the second incubation period carried out in 800 \u03bcL of acidified water, all samples were frozen O/N at \u221220\u00b0C and lyophilized for 4 h . Following lyophilization samples were re-hydrated with 200 \u03bcL of acidified MilliQ. For both sets of sponges, water solutions were poured off and fresh non-acidified MilliQ water was added on day 1, 2, 3, 7, 14, 21, and 28.2+ and 407,771 nm for Sr2+. Time zero corresponds to the acidified water before the introduction of the sponges. Statistical evaluation was performed with one-way ANOVA. 95% confidence intervals showing the differences between averaged values were plotted in separated charts, reported as , treated sponges  and from sponges loaded simultaneously with HAn and rhBMP2 (HAn-BMP2). For the analysis, each sample replicate (1mL) was diluted 1:10 and acidified with suprapur nitric acid  at the final concentration of 0.5% (v/v), centrifuged and filtered with 0.45 \u03bcm membranes. Acidified water was used as blank  and on the nanoparticles loaded-sponges.FT-IR (Fourier Transform-Infra Red) spectra were obtained using a Nicolet FT-IR iS10 Spectrometer  equipped with attenuated total reflectance sampling accessory (Smart iTR with diamond plate) by coadding 32 scans in the 4,000\u2013650 cm2, Oxford Instruments, Oxford, UK). Images were acquired at a lower magnification and energy dispersive microanalysis was performed in order to map phosphorus (P), calcium (Ca) and strontium (Sr) and quantify carbon (C), oxygen (O), P, ca and Sr.Untreated  and treated  sponges collected at time 0 days (T0) and time 28 days (T28) were frozen O/N at \u221220\u00b0C and lyophilized for 3 h . Microscopic structure was investigated using a scanning electron microscope (SEM) Zeiss EVO-MA10 . Images were acquired at different magnifications (150x and 350x) and at an accelerating voltage of 20 kV. CTRL, HAn and SrHAn sponges were also investigated with SEM Zeiss EVO-MA10  coupled to an electron dispersive spectroscopy (EDS)  and percentage weight loss was calculated for each point. The calculation performed is the following: [(Wi-Wt)/Wi]All animal studies were approved by the Institutional Animal Care and Use Committee at Boston University (BU). Animals enrolled for these studies were crosses of the B6.Cg-Gt(ROSA)26sortm14(CAG-tdTomato)Hze/J  mouse strain with either B6.CG-Pax7tm1(cre/ER2)Gaka/J  or Prx1CreER-GFP  were used for After fixation in paraformaldehyde (4%), the right limbs were decalcified in 14% w/v EDTA (pH 7.2) for 1 week at 4\u00b0C. Limbs were dehydrated and embedded in paraffin for histology and 5 \u03bcm-thick sections were cut across the samples. Fast green and Safranin-O (American Mastertek Inc.) staining was performed on the 5 \u03bcm-thick sections for the investigation of ectopic bone formation . Means are plotted and standard deviations (SD) of means, or standard error means (SEM) are represented by error bars. One-way ANOVA corrected by Tukey's honestly significant difference (THSD) test was used to analyze data, if not otherwise specified. A significance level of 0.05 was used for all statistical analyses, unless noted differently.Untreated sponges  were prepared and physical-chemically characterized for degradation rate, ion release properties by ICP-OES, sponge-nanoparticles interactions by FT-IR and morphology by SEM. Furthermore, a stability assessment was performed on the treated (lyophilized) sponge samples .2+ release was reported for samples HAn and SrHAn  at 1,624 cm\u22121; N-H bending band (amide II) at 1,528 cm\u22121; C-N stretching (amide III) at 1,232 cm\u22121. FT-IR spectra (\u22121) and OH\u2013  vibrations of hydroxyapatite lattice as reported before  to 1,650\u20131,631 cm\u22121, and 1,531\u20131,535 cm\u22121, respectively. After lyophilization treatment .The degradation rate was determined by measuring the sponge weight throughout 28 days in aqueous solution . A slow 2+ and Sr2+. They are biodegradable and their morphology fits the golden standard parameters for osteoconductive scaffolds. Although lyophilization partially changed the morphology of the sponges at T28, there was no significant change in calcium and strontium release.A reduction in the quantities of calcium and strontium on the sponge surfaces was recorded at day 28, in accordance with ICP-OES data. Taken together these results indicated the SrHAn loaded sponges are a stable system for a constant and prolonged release of Cain vivo implantation to determine the osteogenic ability of the nanoparticles. Radiography, macroscopic observations and histological staining of bone tissues and implanted sponges were carried out to analyze the sponge integration and surrounding tissue adaptation at post-operative day 16 and 33. Gene expression analysis from the implants and femurs were also performed at corresponding times to determine the molecular responses.Next, sponges prepared following the standard protocol  were utilized for The radiographic images support the macroscopic observation that strong integration underwent between the femur, sponge, and surrounding tissue . Within More extended Safranin-O positive regions  and stem cell recruitment (Nanog) markers. While Runx2, Sp7, Ibsp, BGlap, and Dmp1), osteocytes (Sost) and OCs activity . Acan (Aggrecan core protein), Col10A1 (Type 10 collagen) and Sox9 expression was analyzed as chondrogenesis and endochondral ossification markers , Ibsp , and Sp7 (Osterix) was observed in the femur of mice that received the SrHAn implant compared to HAn-BMP2 and to HAn samples alone  was upregulated by strontium with respect to the control HAn. A similar trend of expression was also detected at 33 days, where Ibsp in the bone  expression was analyzed as marker for osteocyte differentiation. After 16 days, Sost was upregulated in the strontium samples only with respect to the control HAn, both in the bone and sponge samples (Acp5 (Tartrate-resistant acid phosphatase type 5), Rankl (Tumor necrosis factor ligand superfamily member 11) and Ctsk (Cathepsin K) expression were analyzed as markers for OCs differentiation and activity. At 16 days, Acp5 and Rankl , the loaded sponges did not show significant variation from the untreated samples and all physical-chemical properties were conserved. The biodegradability and biocompatibility of the system was proven Bone tissue engineering application in the orthopeadic surgical field is becoming increasingly relevant. In the last decades, rhBMP2 was extensively studied for its osteoinductive potential. Although several successful applications have been achieved, this recombinant morphogen was proven to be not always suitable and safe  or calcium hydroxyapatite nanoparticles and rhBMP2 (HAn-BMP2) in order to compare their physical-chemical properties. The HAn sponges were loaded only with calcium hydroxyapatite nanoparticles and used as control. A second set of samples were treated with an additional lyophilization step and characterized.The hydroxyapatite nanoparticles amount on each sponge was 30% (w/v) of the volume absorbed by the sponge and 3 \u03bcg of rhBMP2 per sponge were used for HAn-BMP2. For the SrHAn loaded-sponges, the calcium/strontium hydroxyapatite nanoparticles ratio was 9:1 w/w  and type X collagen (Col10A1) were upregulated  was shown both in OBs and osteoclasts (OCs), resulting in improved anabolic processes and reduced catabolic pathways, respectively , indicating OBs differentiation at early and late stage . Increased expression of the ECM proteins BGlap, Ibsp, and Dmp1 was attributed to mature osteoblasts activity . The use of sponges loaded with strontium hydroxyapatite nanoparticles might also provide better outcomes for complex fractures. Results from these studies can provide novel therapeutic options for active duty personnel and can be beneficial to anyone suffering from trauma, bone defects or severe bone injuries. Future studies shall also evaluate the efficacy of SrHAn loaded sponges for the treatment of spinal fusion.Many studies have been conducted to investigate rhBMP2 suitability as treatment for spinal fractures and critically-sized bone defects. Although its indisputable osteoinductive potential, rhBMP2 also showed adverse effects. On the other hand, strontium has already been tested as a treatment for osteoporosis and its activity was demonstrated in a patient population. The biggest advantage of strontium over rhBMP2 however, is that the former is a chemical and not a biologic. Herein, following the abiotic characterization, we presented the results of a comparative All datasets generated for this study are included in the article/All animal studies were approved by the Institutional Animal Care and Use Committee at Boston University (BU).GM and FC: conceptualization, validation, formal analysis, investigation, writing\u2014original draft and review and editing, and vaisualization. GB and LC: validation, formal analysis, investigation, resources, writing\u2014review & editing, and visualization. LF and AK: conceptualization, validation, formal analysis, writing\u2014review & editing. PD: conceptualization, formal analysis, resources, writing\u2014original draft & review & editing, visualization, supervision, project administration, and funding acquisition. BB: validation, formal analysis, investigation, writing\u2014original draft & review & editing, visualization, supervision, and project administration. LV and LG: conceptualization, resources, writing\u2014original draft & review & editing, visualization, supervision, project administration, and funding acquisition.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The transforming growth factor type-\u03b2 (TGF-\u03b2) has been demonstrated to play an important role in the development of atherosclerosis through binding to the serine/threonine kinase transmembrane type I and type II receptors. However, as a key type I receptor for TGF-\u03b2, the exact role and the underlying mechanism of Activin receptor-like kinase 5 (ALK5) on macrophage activation involved in atherogenesis remain unclear. In the present study, enhanced ALK5 expression was found in bone marrow derived macrophages (BMDMs) upon OX-LDL stimulation tested by RT-PCR and Western blot, which was further verified by co-immunofluorescence staining. Next, the loss-of-function of ALK5 used AdshALK5 transfection was performed to test the effect of ALK5 on macrophage activation. We observed that ALK5 silencing inhibited pro-inflammatory but promoted anti-inflammatory macrophage markers expression. Moreover, decreased foam cell formation was found in ALK5 knockdown macrophages accompanied by increased cholesterol efflux. Mechanistically, ALK5 knockdown significantly increased KLF4 expression that was responsible for the attenuated macrophage activation induced by ALK5 knockdown. Collectively, these findings suggested that neutralization of ALK5 may act as a promising strategy for the management of atherosclerosis. Atherosclerosis is well recognized as a chronic inflammatory disease  and accoThe present study exhibited that ALK5 expression was significantly up-regulated in BMDMs with OX-LDL administration and primary located in cytoplasm of macrophages. Loss-of-function study demonstrated that ALK5 silencing dramatically inhibited inflammatory response and foam cell formation. Mechanistically, we found that ALK5 knockdown significantly promoted KLF4 expression and the effect of ALK5 silencing on macrophage activation was largely reversed by KLF4 inactivation.TGF-\u03b2 family members are implicated in the regulation of growth control, positional information and cardiac organogenesis, which has emerged to play an important role in cardiovascular diseases . In whic7 nucleated bone marrow cells from the femurs and tibias of each mouse were collected and then cultured in 10 ml of RPMI with 10% fetal bovine serum and MCSF (50 ng/ml). To knockdown ALK5 expression, ALK5 specific short hairpin RNA (shRNA)-expressing (shALK5) construction was mediated by pENTR/U6-shRNA vector and homologous recombination of adenovirus skeleton plasmid, while adenoviral short hairpin RNA (AdshSCR) served as controls. The BMDMs were transfected with the above adenovirus according to the manufacturer\u2019s protocol and treated with OX-LDL at the individual concentration (25 or 50 ng/ml). The animal study protocols were performed according to Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health. The Animal Care and Use Committee of The First Hospital of Nanchang approved all study protocols.The 8- to10-week-old ApoE deficiency mice received intraperitoneal anesthesia with pentobarbital sodium (50 mg/kg), then were killed in random order. Approximately 5 \u00d7 10Total mRNA was isolated using TRIzol reagent and extracted from cultured BMDMs. Subsequently, the mRNA was performed for reversely transcription into cDNA with a Transcriptor First Strand cDNA Synthesis Kit  according to the manufacturer\u2019s protocol. First-strand cDNA was subjected to real-time PCR with SYBR green on a LightCycler 480 QPCR System (Roche Diagnostics). Gene expression was normalized to GAPDH.Western blots were performed following standard protocols as previous described . BrieflyThe BMDMs were fixed with 3.7% formaldehyde in PBS for 15 min at room temperature and permeabilized with 0.1% Triton X-100 in PBS for 40 min. After incubating with primary antibodies at 4\u00b0C overnight, the slices were rewarmed at 37\u00b0C for half an hour and washed with PBS before incubation with appropriate fluorescence-labeled secondary antibody for 1 h. DAPI was performed for cell nuclei detection.t test or one-way ANOVA followed by a Bonferroni post hoc test or Tamhane\u2019s T2 post hoc test. All statistical analyses were performed using SPSS, version 22.0. Differences were considered significant at a value of P < 0.05.Data were represented as the means \u00b1 SD. Data were analyzed with a two-tailed Student\u2019s Alk5 mRNA expression was dramatically up-regulated in BMDMs treated with OX-LDL in a manner following increased OX-LDL concentration compared with the baseline level obtained with PBS treatment  were utilized to investigated the possible regulation of ALK5 on macrophage inflammation and foam cell formation implicated in atherogenesis. The efficiency of ALK5 knockdown in BMDMs was verified with Western blot analysis A. The ba and Il6 B. By conand Mrc1 B. The upand Mrc1 C. AdditiAdshALK5 D.Pparg, Klf4, Nr4a, Nrf2 and Stat6 [Dozens of evidences have demonstrated that the regulation of macrophage polarization and foam cell are controlled by various genes, the represented markers including nd Stat6 . The resNext, we transfect BMDMs with AdshKLF4 to test the functional regulation of KLF4 knockdown on the effect of macrophage polarization and foam cell formation mediated by ALK5 knockdown. We observed a significant down-regulation of KLF4 expression in BMDMs infected with KLF4 knockdown followed with OX-LDL treatment A. Importin vitro attenuated pro-inflammatory but promoted anti-inflammatory macrophage markers expression. Moreover, ALK5 silencing inhibited foam cell formation accompanied by increased cholesterol efflux but decreased cholesterol uptake. Furthermore, KLF4 expression was accelerated by ALK5 knockdown and the down-regulated KLF4 largely reversed the effect of ALK5 silencing on macrophage activation. On the basis of the results, we exhibited a novel role of ALK5 on macrophage activation involved in atherogenesis that was partially through attenuated KLF4 activation.In the present study, we first demonstrated that an up-regulation of ALK5 expression was found in activated macrophage and co-located in cytoplasm with OX-LDL administration. The loss-of-function of ALK5 in vitro [Atherosclerosis is recognized as a complex multifactorial process and a chronic inflammatory disease contributed to severe cardiovascular event, which can be triggered by various stimuli . Among tin vitro , while tin vitro . ALK5 isin vitro  and TGF-in vitro . Moreovein vitro  and is rin vitro . Althougin vitro , while iin vitro . ConsistIn seeking the effectively underlying mechanism mediated of the effect of macrophage polarization switching and foam cell formation in BMDMs transfected with AdshSCR, we performed RT-PCR analysis of the represented regulator involved in macrophage activation in atherogenesis and the result suggested that KLF4 was the markedly altered target. KLF4 acts as a novel important regulator for the macrophage behaviors implicated in the chronic inflammatory diseases, especially atherosclerosis ,27. It hIn conclusion, we demonstrated that the down-regulated ALK5 expression in macrophage significantly inhibited M1 but promoted M2 polarized macrophages. Additionally, ALK5 knockdown attenuated foam cell formation characterized as enhanced cholesterol efflux than uptake. The up-regulation of KLF4 expression was partially responsible for the protective role of ALK5 silencing on macrophage activation. Our current study provided that neutralization of ALK5 may act as a promising therapeutic approach for the treatment of atherosclerosis."}
+{"text": "Prostate adenocarcinoma (PRAD) is a common malignant tumor in elderly men. Our research uses The Cancer Gene Atlas (TCGA) database to find potential related genes for predicting the prognosis of patients with PRAD.  We downloaded gene expression profiles and clinical sample information from TCGA for 490 patients with PRAD (patient age: 41-78 years). We calculated stromal and immune scores using the ESTIMATE algorithm to predict the level of stromal and immune cell infiltration. We categorized patients with PRAD in TCGA into high and low score arrays according to their median immune/stromal scores and identified differentially expressed genes (DEGs) that were significantly correlated with the prognosis of PRAD. Then, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed. The association between DEGs and overall survival was investigated by weighted Kaplan\u2013Meier survival analysis and multivariate analysis. Furthermore, the protein-protein interaction network (PPI) of DEGs was constructed using the STRING tool. Finally, the hub genes were identified by analyzing the degree of association of PPI networks.  We found that 8 individual DEGs, C6, S100A12, MLC1, PAX5, C7, FAM162B, CAMK1G, and TCEAL5, were significantly predictive of favorable overall survival and one DEG, EPYC, was associated with poor overall survival. GO and KEGG pathway analyses revealed that the DEGs were associated with immune responses. Moreover, 30 hub genes were obtained using the PPI network of DEGs: ITGAM, CD4, CD3E, IL-10, LCP2, ITGB2, ZAP-70, C3, CCL19, CXCL13, CXCL9, BTK, CCL21, CD247, CD28, CD3D, FCER1G, PTPRC, TYROBP, CCR5, ITK, CCL13, CCR1, CCR2, CD79B, CYBB, IL2RG, JAK3, PLCG2, and CD19. These prominent nodes had the most associations with other genes, indicating that they might play crucial roles in the prognosis of PRAD.  We extracted a list of genes associated with the prostate adenocarcinoma microenvironment, which might contribute to the prediction and interpretation of PRAD prognosis. Prostate cancer is the second leading cause of cancer deaths in American men . With inTumors have an extremely complex microenvironment comprising stromal cells, immune cells, inflammatory mediators, and extracellular matrix (ECM) , 11. PreIn this study, for the first time, we used TCGA data of patients with PRAD to identify a set of tumor microenvironment-related genes, which are predictive of poor prognosis in these patients. The results revealed a list of genes, thus providing a better understanding of this disease and further clarifying the relationship between prognosis and the tumor microenvironment in patients with PRAD.https://tcga-data.nci.nih.gov/tcga/), and their clinicopathological information was extracted from the atlas data portal. The ESTIMATE algorithm was applied to the downloaded data to calculate the immune and stromal scores [The clinical information of patients with PRAD was downloaded from TCGA  is a well-known network of tools for examining PPIs [The Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database (ing PPIs . All thehttps://www.r-project.org/) [p value < 0.05.GO and KEGG pathway enrichment analyses were performed using the R Project for Statistical Computing   to charap values were extracted from the proportional hazards model. p value less than 0.05 was considered statistically significant.Pearson correlation was used to analyze the association between T clinical stage and immune or stromal scores. Considering the confounders such as age and sample size might affect the correlation analysis, we used the linear regression model to analyze the association between immune scores and cancer stage as well as possible confounders age and sample size. Weighted Kaplan\u2013Meier survival analysis was performed using the svykm function of R package of survey . Differep < 0.05). Similarly, the median stromal scores were the highest for clinical stage T3 among all the clinical stages, followed by T4  and immune score .We downloaded gene expression profile and clinical sample information from TCGA for 490 patients with PRAD (patient age: 41\u201378 years). All the cases of PRAD with complete gene expression data and clinical information in TCGA were analyzed  than that in the high immune score group. Consistently, the median overall survival was similarly prolonged in the low stromal score group : 0.86, 95% Confidence Interval (CI): 0.24\u20133.08 for immune score, p = 0.28, OR: 0.46, 95% CI: 0.11\u20131.89 for stromal score).To explore the potential correlations of overall survival with immune and/or stromal scores in patients with PRAD, the patients were divided into high and low immune score groups based on the median immune and/or stromal scores. Weighted Kaplan\u2013Meier survival analysis  revealedp < 0.05). Similarly, 1240 genes were upregulated in the low immune score group, whereas 4 genes were downregulated. In addition, as shown in Figures To determine whether global gene expression profiles are related to the immune and/or stromal scores, we compared the Affymetrix microarray data of 490 patients. The gene expression profiles of the high and low immune and stromal score groups are presented as heat maps in Figures To explore the potential functions of DEGs, we analyzed the functional enrichment of GO terms for 935 upregulated genes in the high immune score group. Regarding BP, DEGs were enriched in the regulation of leukocyte activation, T-cell activation, lymphocyte activation, leukocyte proliferation, lymphocyte proliferation, and mononuclear cell, as well as in the proliferation positive regulation of cell activation, positive regulation of leukocyte activation, regulation of T-cell activation, and leukocyte cell\u2013cell adhesion. For CC, DEGs were enriched in the external side of the plasma membrane, side of the membrane, secretory granule membrane, plasma membrane receptor complex, and receptor complex. For MF, DEGs were enriched in cytokine receptor activity, cytokine activity, receptor ligand activity, receptor regulator activity, immunoglobulin binding, and cytokine binding. Our results suggest that the functional clusters of genes exhibit strong correlations with immune responses . We alsoKEGG pathway analysis revealed that 30 pathways were significantly enriched. Regarding the top five most enriched pathways, 59 DEGs were enriched in cytokine\u2013cytokine receptor interaction pathways and 34 DEGs were enriched in viral protein interaction with cytokine and cytokine receptor pathways. In addition, 31 DEGs were enriched each in hematopoietic cell lineage and chemokine signaling pathways, whereas 30 DEGs were enriched in tuberculosis-related pathways . These rC6, S100A12, MLC1, and PAX5, were positive prognostic factors, and EPYC was a negative prognostic factor for overall survival , discovering that the T clinical stage of PRAD is closely related to the tumor microenvironment. The sample size for T4 is far low than other T stages in our study; more comprehensive analysis and further exploration with large sample sizes are needed in the future studies. Immune and stromal cells have been proposed to be valuable for tumor diagnosis and prognosis evaluation. As indicated by the GO enrichment analysis, the function of immune cells and ECM is involved in the construction of the tumor microenvironment in patients with PRAD. Furthermore, the enriched KEGG pathways of the DEGs included cytokine\u2013cytokine receptor interaction, viral protein interaction with cytokine and cytokine receptor, hematopoietic cell lineage, and chemokine signaling. KEGG pathways of infectious diseases such as malaria, toxoplasmosis, and Chagas disease were also correlated with DEGs in PRAD. It has been known that viral infection such as human papillomavirus increases the risk of PRAD . The virNext, we constructed PPI modules, all of which were related to immune/inflammatory responses. ITGAM, CD4, CD3E, IL-10, LCP2, ITGB2, ZAP-70, C3, CCL19, and CXCL13 were the top 10 hub genes in the PPI analysis, suggesting that these genes have a large number of interactions with other genes. Therefore, these genes may act as key genes in the PPI network. Moreover, these genes may play important roles in promoting tumor angiogenesis , tissue remodeling (ITGAM and ITGB2), and immunosuppression (CD4 and IL-10) in cancer cell lines or samples \u201330. In rResearch on gene expression and the overall survival rates of patients with PRAD has been conducted on a large scale, obtaining breakthrough results. We successfully extracted 9 genes involved in protein and immune responses by analyzing patients according to high and low immune scores. Patients with PRAD who carried these genes had significantly predictive overall survival, suggesting they may become potential prognostic biomarkers in PRAD. Many of these experiments were performed using in vitro tumor cell lines, animal tumor models, and a small number of patient tumor samples. However, PRAD and its microenvironment are extremely complex, requiring more comprehensive analyses and further exploration, including studies with larger sample sizes. Fortunately, the rapid development of TCGA provides us with a platform and foundation for further analysis.The interaction between PRAD and its tumor microenvironment has serious effects on tumor evolution, further affecting tumor resistance, recurrence, and overall prognosis. Wang et al.  have proIn summary, we used TCGA for functional enrichment analysis. Using the relationships of the immune score, based on the ESTIMATE method, with the T clinical stage and prognosis of PRAD, we extracted a list of genes related to the microenvironment of PRAD. These genes may be helpful for explaining the prognosis of PRAD. Some previously neglected genes may emerge as biomarkers for PRAD. Finally, further studies of these genes can provide a more comprehensive understanding of the potential relationship between the prognosis of PRAD and the tumor microenvironment."}
+{"text": "A Vickers indentation was introduced, and the cracks were healed between 600 \u00b0C and 800 \u00b0C in air. Cracks could be healed completely in air above 700 \u00b0C. The ceramic composite had the best healing performance at 700 \u00b0C for 30 min, recovering flexural strength of up to 94.2% of the original. Good crack-healing ability would make this composite highly useful as it could heal defects and flaws autonomously in practical applications. The healing mechanism was also proposed to be the result of the oxidation of B4C.Self-healing ceramics have been researched at high temperatures, but few have been considered at lower temperatures. In this study, SiC-Al Ceramics have been widely used in some important and complex environments due to their high hardness and bending strength, etc.; however, their main shortcoming is their brittleness. Researchers have studied various toughening systems and mechanisms, such as whisker-reinforced and toughened materials , self-to3N4 and new ternary MAX family ceramics [3N4/Y2O3, Si3N4/SiC/Y2O3 and Si3N4/Y2O3/Al2O3 ceramics and studied the effect of healing conditions on their oxidation behavior, and found good crack-healing ability. Due to the requirements of the high temperature applications, some high temperature healing agents are emerging, such as MoSi2 [2 [2SiO5 [4 [2-MoSi2 on the SiC-coated C/C ceramic composite by using an ultrasonic plasma spraying technology, which showed good self-healing performance at 1450 \u00b0C. However, there is little research on the healing agent at low temperatures less than 800 \u00b0C. Bei et al. [2O3 composite loaded with the Ti2Al0.5Sn0.5C MAX phase repair filler. When cracks occurred in the matrix, the strength recovered by 107% at 700 \u00b0C for 48 h, and TiO2, SnO2 and \u03b1-Al2O3 was detected in the cracks. Yoshioka et al. [4C reacts with oxygen at high temperatures to generate B2O3, which has a melting temperature of 450 \u00b0C to be fluidic and a volume expansion rate of about 250% to fill up the cracks. In order to ensure that the oxidation product B2O3 plays a role in healing and that the inflow cracks are healed, the healing temperature must be in the range of 600 \u00b0C to 800 \u00b0C.The self-healing mechanism of ceramic materials have been proposed generally to be of two types; one is diffusive healing , the othceramics ,12,13. Nceramics  preparedas MoSi2 , HfSi2 [MoSi2 [2 , Y2SiO5 2 [2SiO5 , ZrSiO4 2SiO5 [4 . Wang et2SiO5 [4  sprayed i et al.  examineda et al.  reporteda et al.  could ac4C with 15% mass fraction on the crack healing behavior in SiC/Al3O2 base ceramics was investigated. The healing behavior was studied on the micro-structure and macro-properties, and the healing mechanism was also explored.In order for ceramics to heal themselves in the actual application, it is very important to perform thermal oxidation at a low temperature within a short period. In this paper, the effect of the healing temperature and healing time of B2O3, B4C and glass powder , 3 \u03bcm in average particle size and 99.9% in purity, was weighed at the mass ratio of 70%SiC-30%Al2O3:B4C:glass powder = 65%:15%:20%. The powders were mixed and ball-milled with a little ethanol for 6 h, and then dried at 90 \u00b0C in a vacuum for 10 h. The mixed powder was put into a graphite die 25 mm in diameter and compacted by spark plasma sintering in a vacuum at sT = 1350 \u00b0C with the heating rate of 100 \u00b0C/min under a pressure of 30 MPa for the soaking time of 10 min. The sintered sample was cut into rectangular strips with a precision cutting machine, and ground on both sides of the sample. The two sides were polished to a mirror finish to remove the scratches produced during the sample preparation and cutting process. The four edges also need be chamfered at 45\u00b0 to reduce the residual stress on the surface of the specimen during processing. Finally, the size of the standard sample is 3 \u00d7 4 \u00d7 20 mm.The raw materials of SiC, Alht = 0\u2013300 min) and temperatures (hT = 600\u2013800 \u00b0C) with a heating rate of 10 \u00b0C/min in air.A Vickers hardness test was used to prefabricate the cracks in order to simulate the cracks on the surface of ceramic materials, and the length of the cracks was determined by controlling the load. The cracks in this experiment were prefabricated under a load of 98 N for 15 s. The position of the indentation is located at the center of the sample. The healing of the cracks is conducted for various times  with the span of 20 mm at a loading rate of 0.5 mm/min. The phase composition of the ceramic composite was identified by X-ray diffraction  using Cu K\u03b1 radiation. The surface morphology of the cracks was observed using a field emission scanning electron microscope . Energy dispersive X-ray spectroscopy (EDS) analysis was conducted by using a spectrometer attached to this SEM. The chemical compositions of surface oxides were studied by X-ray Photoelectron Spectroscopy . The thermodynamic data for stoichiometric phase was calculated using the HSC Chemistry thermodynamic software.2O3 only can be observed, indicating that there are no other side reactions during the high temperature sintering. Since the peak of B4C is very weak and overlaps with other peaks, it is difficult to be detected in XRD, whereas B4C was identified by EDS as shown in 4C. Meanwhile, the healing agent B4C is evenly dispersed in SiC/Al2O3 matrix, providing a prerequisite for cracks healing. 2O3 hardly changed at each temperature, suggesting that they did not participate in the oxidation process. The peak intensity of B4C was too weak to be detected out. In addition, the oxidation product of B2O3 was not detected in the XRD patterns due to the possible non-crystalline phase [ne phase ,24.4C was oxidized to produce a gaseous product CO2. Many micro-pores produced on the surface of the material became a new crack source when the gas pressure was large enough to escape.In order to evaluate the healing effect of the ceramic composite, a three-point bending test was carried out; the schematic diagram is shown in 4C and SiC in air as a function of temperature. The Gibbs free energy (\u0394G) of B2O3 and SiO2 is negative, which provides a theoretical bases to understand the appearances of B2O3 for healing and filling cracks. The Gibbs free energy of B2O3 is lower than SiO2, thus B2O3 should be generated preferentially. B4C can effectively provide self-healing behavior at 700\u2013800 \u00b0C, whereas it has a low oxidation rate below 600 \u00b0C and is easy to form borate to volatilize above 900 \u00b0C [4C occurred mainly at 600\u2013800 \u00b0C.e 900 \u00b0C . The heae 900 \u00b0C . Therefo4C and its oxidation product B2O3, as non-crystalline phases cannot be detected in the XRD patterns, the healing mechanism was not well explained.As crack healing was attributed to the oxidation reaction of the healing agent, the recovery of performance depended mainly on the healing time and temperature. The samples were observed before and after heat treatment at 700 \u00b0C in air; it was observed that the crack disappeared, and bend strength improved. For the weak diffraction peaks of the healing agent B2O3 [2O3 and Al2O3, respectively [2O3 by the analysis of XPS, indicating that B4C participated in oxidation-induced crack healing.In order to further explore the crack healing mechanism, the chemical composition of the oxidized surface was investigated by XPS. 2O3 . The O 1ectively ,30. On a4C after heat treatment at 700 \u00b0C for 30 min in air. There were no signs of cracks around the indention observed in 4C as a healing agent had a good healing effect to repair the cracks; in addition to healing of the artificial indent cracks, closure of the residual porosity in the composite might also contribute to the strength recovery. 2O3-B4C self-healing ceramic composite was prepared by SPS technology, and the effects of healing temperature and healing time on the damaged SiC-Al2O3-B4C ceramic composite were studied. The crack was completely healed at 700 \u00b0C for 30 min, and the bending strength was restored to 94.2% of the original sample, i.e., 358 \u00b1 11.8 MPa. The healing mechanism of SiC-Al2O3-B4C ceramic composite shows that B2O3, the oxidation product of B4C, flows into the cracks as liquid phase. After cooling, its volume expands to fill the cracks and recover the strength of SiC-Al2O3-B4C ceramic composite.SiC-Al"}
+{"text": "Self-healing cement composites are generally produced by using materials such as inorganic powders, bacteria pellets, and microcapsules. Among them, inorganic powder-type healing materials tend to decrease in healing performance over time because they react relatively quickly. Accordingly, this study encapsulated self-healing inorganic reactive powders in solid capsules (SC) in order to delay their reaction. The capsule surface was coated with a membrane to prevent moisture from permeating it. SC were utilized to provide the self-healing effect to the repair mortar. SC were mixed at three rates  by the binder mass of the repair mortar. The fundamental properties, including rheology, table flow, strength, and length change, and the self-healing performance of the self-healing repair mortar mixes were investigated. It was found that the rheological and mechanical properties of the repair mortar decreased slightly as the amount of SC increased. On the other hand, for a crack width of 0.25 mm and crack inducing age of 28 days, the healing performance of repair mortar specimens containing SC was at least 20 pt% better than that of plain repair mortar after a healing period of 28 days. Recently, smart self-healing materials have emerged worldwide in the construction industry. Cracks occur in most concrete structures due to a variety of causes, such as shrinkage and mechanical loading, which decrease functionality, accelerate degradation, and reduce service life and sustainability of the structure . Cracks 2+ [2 generated by their metabolic activity forms CaCO3 crystals through reaction with Ca(OH)2 in a hardened cement paste [Materials such as minerals , bacteri2+ , or the 2+ . The sel2+ . When a 2+ . Bacterint paste ,8.Self-healing technology using capsules, which can contain a large amount of self-healing substances, has the advantage of selectively reacting to cracks. Self-healing capsules can be classified into solid capsules (SC) coated with a film, which are made by agglomeration of the powdery material ,16, and The use of mineral admixtures as self-healing agents in cement-based composites has been studied extensively. However, if minerals are added directly to the cementitious matrix without any protection, they can immediately react, leading to a decrease in self-healing efficiency with additional side effects on the mechanical properties of cementitious composites. In order to overcome such a problem, several kinds of methods have been proposed. Choi et al.  fabricatIn this study, self-healing SC were manufactured by combining a core production process, in which a powdered expansive agent is granulated, with a coating process to protect the surfaces of the granulated particles. Hydration of the core materials can be delayed by maintaining the moisture barrier performance of the wall material until SC are broken by cracking of the concrete, so that it is possible to retain healing performance even after significant aging. SC mixed with repair mortars might be destroyed during re-cracking after repairing, causing a hydration reaction with the surrounding moisture, and can induce a crack healing reaction through the hydration product. Therefore, the utilization of optimal dosages of SC could have great potential for applications in repairing cracked concrete under the water leakage of water reservoirs, underground structures, and tunnels.The quality and self-healing performance of repair mortar using SC were evaluated through the experiment. Concrete mixed with SC made by using expansive agents as core materials was tested to evaluate its fundamental properties such as rheological properties, strength, and length change. In addition, cracks were induced in self-healing repair mortar specimens at 28 days and 91 days, and the healing performance of the specimens was evaluated throughout the 28-day healing period. Through the experimental results, the optimal mixing ratio of SC for self-healing repair mortar was suggested.4). The healing material used in the SC is an inorganic reactive powder mixture that reacts by hydration. The inorganic reactive powder used for producing SC consisted of mixing a hauyne-based expansion material, which was calcium sulfoaluminate , and general anhydrite  and calcium hydroxide (Ca(OH)2).Equation (1) shows the reaction mechanism of the healing materials. CSA generates ettringite or calcium hydroxide by hydration reaction, which induces expansion, and CaSO4 was 70:30, following the previous study [The manufacturing process of the SC consists of three steps: mixing healing materials a, granulus study , and SC us study ,16. The 3. The three sizes of silica sand are 1.5\u20132.4 mm (#3), 0.7\u20131.2 mm (#5), and 0.35\u20130.7 mm (#6). In addition, short polymer fibers  with 0.1% of the total volume of the repair mortar were used to improve tensile strength and to reduce drying shrinkage of the mortar. The PVA fibers used were approximately 6\u20138 mm in length and consisted of single yarn fibers with a tensile strength greater than 450 MPa. SC accounted for 0%, 5%, and 10% by mass of the binder in Plain, SC5, and SC10 mixes, respectively.The mixing proportions of the repair mortar with a target compressive strength of 40 MPa were W:B:S = 0.4:1.0:1.5, as shown in The rheology of the repair mortar was evaluated by referring to the results of previous studies because there is no related regulation ,24. The In general, the fluidity of mortar is determined through a flow test, but the flow test results have difficulty expressing the rheological properties of the semi-plastic mortar. The rheological properties are related to the workability and viscosity of the mortar. In general, the viscosity of fluid, such as water and oil, is characterized using a Newton model, as shown in The flow and air content of the repair mortar were measured according to ASTM C1437  and ASTMThe compressive strength of the repair mortar was measured at 3, 7, and 28 days of age according to ASTM C109 . For theA constant water head permeability test was adopted to measure the water flow rate of the crack-induced specimen and to evaluate the self-healing performance of repair mortars . For theOnce the cracking age was attained, a cylinder was sliced into three disc specimens (\u00d8100 \u00d7 50 mm) and then split into two semi-circular sections, as shown in The cracked specimens were cured in a water bath at 20 \u00b0C during the healing period. As there is no specific standard for the water temperature during the healing period, a water curing temperature of 20 \u00b0C was adopted ,31. The qSH, can be calculated using the water flow rate reduction ratio as follows [q0 is the initial water flow rate measured just after the specimen is cracked, without any healing effect, and q(t) is the water flow rate after a healing period, t.Through the water permeability test, the healing index,  follows ,31,32,33Crack monitoring was performed at 100\u00d7 magnification using a microscope . The crack closing level of the crack surface by the reaction product was monitored according to the healing period. Healing product samples were collected for healing product analysis, which was performed using a scanning electron microscope . When the crack inducing age was 28 days and the healing period was 7 days, the healing indices of SC5 and SC10 with the crack width of 0.25 mm were 72% and 79%, respectively, improved by 19 pt% and 26 pt% compared to Plain\u2019s healing index of 53%. The healing index of SC10 increased by 7 pt% compared to that of SC5, confirming that SC had a significant healing effect. Under the same crack inducing age, the healing indices of SC5 and SC10 with the healing period of 28 days were 91% and 96%, respectively, representing improvements of 20 pt% and 25 pt% compared to Plain\u2019s healing index of 71%. The healing index of SC10 increased by only 5 pt% compared to SC5, so the difference in the healing performance between SC5 and SC10 was not much when a crack was induced at 28 days. When the crack width increased from 0.20 mm to 0.25 mm and the healing period was 28 days, the healing indices of SC5 and SC10 decreased only 3 pt% and 1 pt%, respectively, while the healing index of Plain decreased 11 pt%. This means that even if the crack width increases, the healing effect of SC could be maintained.When the crack induction age was 91 days and the crack width was 0.25 mm, the healing index of Plain after a healing period of 7 days was only 31%, and those of SC5 and SC 10 were 39% and 54%, respectively. Accordingly, the healing index of SC5 and SC10 increased by 8 pt% and 23 pt% compared to Plain ,16,31. MAs shown in However, if a large amount of SC is added to the repair mortar as a self-healing material, the quality of the repair mortar tends to be changed considerably, so it is necessary to determine the optimal amount of SC in order to satisfy not only the required quality and the target healable crack width but also the economic efficiency.In terms of the rheological properties of the repair mortars containing SC, the plastic viscosity and yield stress decreased with the addition of SC, and the flow tended to decrease as well. The strength of the repair mortar tended to decrease with the addition of SC. The effect of SC on the air content was not significant.Through the water permeability test on repair mortars containing SC, it was found that the healing performance increased rapidly during the initial seven days of the healing period and increased more gradually thereafter. The healing performance of repair mortars containing SC increased as the amount of SC increased, indicating that the addition of SC could significantly increase the healing performance.When cracks were induced after 91 days of age, the healing performance of repair mortars was improved by adding SC. Accordingly, it was confirmed that SC can preserve healing performance even after a long time because they are coated with a membrane material to delay the hydration of core materials.Consequently, it is necessary to determine the optimal SC amount for self-healing repair mortar by considering not only the healing parameters, such as the target crack width, healing period, and healing index, but also the quality of the repair mortar, including rheological and mechanical properties. Through these results, the optimal mixing ratio of SC considering the fundamental properties and healing performance of the repair mortar might be 5% by mass of binder.This study investigated the rheological and mechanical properties and self-healing performance of repair mortars containing SC made using an inorganic reactive powder. The conclusions are as follows:"}
+{"text": "ObjectiveThe population's ever-growing concern with genital aesthetic dysfunctions reflects an increasing demand in the field of intimate aesthetics. For this reason, as well as the lack of a standardized evaluation, this paper aims to develop a form that facilitates the initial investigation of aesthetic genital dysfunctions.\u00a0MethodsAn evaluation form for female and male genital dyschromia was developed\u00a0between July and November 2018. Following initial development, the form was evaluated for quality and was updated by a panel of specialists  via email and through a content validity questionnaire. The face validity of the form was assessed by five physiotherapy and medical students who were randomly selected. The students answered a questionnaire evaluating the proposed form. The reliability of the form was established through the test-retest procedure by evaluating its reproducibility over time.ResultsThe \u201cGenital Dyschromia Evaluation Form''  was approved by the specialist panel. They suggested questions to be added in the anamnesis  and physical examination  sections. As for the image analysis, an increase in quality, resolution, and sharpness was suggested. Lastly, for the cutaneous phototype evaluation, the DoctorSkinFototipo\u00ae digital analyzer device was chosen since it is small, portable, easily positioned on the genital area, and can be readily cleaned between patients.\u00a0ConclusionThe \u201cGenital Dyschromia Evaluation Form\u201d is a questionnaire approved by specialists and could represent a suitable option for health professionals. The population's concern with genital aesthetic dysfunctions grows continuously. Female intimate aesthetic complaints appear due to new depilatory habits, exposing the genital area more than before. In addition, media and social networks spread the idea of\u00a0bodily perfection, not just as desirable, but as integral to normative femininity\u00a0-4. It haGenital dyschromia is an aesthetic disorder that can affect both female and male genital regions and it may develop in the external genitalia or the perianal region\u00a0, 8. It iGenital dyschromia represents one of the most distressing concerns for patients\u00a0-13\u00a0and cNew research provides therapeutic options for diverse genital aesthetic complaints\u00a0. These tSince both female and male genitalia discoloration are frequent aesthetic complaints in clinical practice, this study aims to develop an evaluation form for genital dyschromia.The development of an evaluation form for female and male genital dyschromia occurred between July and November 2018.\u00a0The study followed the precepts of the Declaration of Helsinki, with approval of the Ethics and Research Committee of the Bahiana School of Medicine and Public Health, under reference number 99473018.2.0000.5544. All participants signed the informed consent form.Literature research was conducted to identify existing related surveys on the topic. Specialists in intimate aesthetics were contacted and asked to provide any relevant surveys or previously discussed information.\u00a0A workshop was held by local health professionals specialized in intimate aesthetics to identify and finalize criteria, prioritize issues, and define suitable items/scales for inclusion in the form.\u00a0To analyze and improve the evaluation form, five health professionals and researchers from the Pelvic Floor Care Center at the Bahiana School of Medicine and Public Health were consulted and formed an expert panel, as well as applied a content validity questionnaire with each other\u00a0. The groFollowing the workshops and consultations, the feedback was gathered a draft questionnaire version was generated by the research team.To check the face validity, five physiotherapy and medical students were randomly selected. The students answered a questionnaire that evaluated the proposed form. The questionnaire was composed of questions to be answered on a three-point Likert scale  and questions requesting yes-or-no answers as follows: questionnaire application date, typographical errors, form length, font size, whether the image was sharp and satisfactory, question and answer options were clear, questions followed a sequence, whether the form's layout was considered to be good, and its final evaluation.The reliability of the form was established through the test-retest procedure by assessing its reproducibility over time.The specialists judged as relevant all the information previously contained in the evaluation form; they contributed suggestions for questions to be added in the anamnesis section and physical examination section of the form. The panelists' suggestions are shown in Table\u00a0Content validityAs a result of the feedback from the content validity questionnaire, it was determined that questions needed to be added to the anamnesis section: such as the presence of dermatological lesions or fungal and bacterial infections. Similarly, for the physical examination section, it was recommended that hyperemia and edema investigations be added, as well as perianal and internal thigh region examinations. As for the image analysis, improvements in their quality, resolution, and sharpness were suggested.\u00a0Face validityOf the five students who completed the questionnaires, only one considered the format's layout to be regular and two considered the images to not be sharp enough. The results of the face evaluation questionnaires answers are summarized in Table\u00a0The genital dyschromia evaluation form: final versionThe form was denominated as the \u201cGenital Dyschromia Evaluation Form\u201d; the following sections are present in it.Identification It contains questions about the name, address, age, date of birth, occupation, telephone, marital status, education, family income of the pa,tient and by whom the patient was recommended.\u00a0AnamnesisIt starts with questions about the main complaint and is followed by questions about the current disease history, clinical information, and pathological antecedents, gynecological and obstetric history, medicines in use, and life habits.Physical Examination: To Analyze the Dyschromia and the Cutaneous PhototypeFor the cutaneous phototype evaluation, the digital analyzer device DoctorSkinFototipo\u00ae was used since it presented the possibility of use on the genital region Figure\u00a0. For theTo define what intimate region location the equipment should be pressed to the skin, it is necessary to use a disposable ruler so that skin tone measurements before and after therapy are standardized and tested in the same area.\u00a0To verify skin tone, the patient is positioned in the supine position, with their lower limbs and feet resting on the hospital bed.\u00a0For the cutaneous phototype measurement of the mons veneris and labia majora, the upper margins were selected as the starting point.Mons veneris: the ruler's zero mark is placed on the starting point, and the measurement is made at a distance of 2 to 6 centimeters above the zero mark  were added as question items in the evaluation form, since it is known that different mechanisms actions in the organism may cause different hormonal actions\u00a0-27.\u00a0In the physical examination, suggestions to be modified by the specialists through the panel and content validity as described: the presence of edema and hyperemia on the vulva, replace the current image for its lack of good resolution and include perianal and internal thigh region evaluations. Hyperemia and edema signs were relevant because they may be associated with gynecological or skin pathologies\u00a0. In the The evaluation form update was done from the clinical practice, selecting what items approach best the signs and symptoms presented by patients. It is suggested the evaluation form be applied in patients who present genital dyschromia\u00a0complaints.\u00a0This research was carried out in a single reference center and face validity was composed only by undergraduate students. For future perspectives, it is hoped this validation can be gathered from different populations.The \u201cGenital Dyschromia Evaluation Form\u201d could represent a suitable option for health professionals. A standardized and dedicated evaluation method for diagnosing patients with genital dyschromia makes it simple to gather reliable data with adequate construct validity for use by health professionals."}
+{"text": "The height, peak velocity, and RFD of CMJ, height of SPJ, and muscle soreness showed no interaction effects (p > 0.05) groups x time. AEL seemed capable to maintain force production in IMTP, but not in CMJ and SPJ. It is recommended the use of accentuated eccentric loading protocols to overcome the fatigue.The purpose of this study was to investigate the benefit of post-activation performance enhancement (PAPE) after accentuated eccentric loading (AEL) compared to traditional resistance loading (TR). Sixteen male volleyball athletes were divided in AEL and TR group. AEL group performed 3 sets of 4 repetitions  of half squat, and TR group performed 3 sets of 5 repetitions (eccentric & concentric: 85% of 1RM). Countermovement jump (CMJ), spike jump (SPJ), isometric mid-thigh pull (IMTP), and muscle soreness test were administered before (Pre) exercise, and 10 min (10-min), 24 h (24-h), and 48 h (48-h) after exercise. A two-way repeated measures analysis of variance was used to analyze the data. Peak force and rate of development (RFD) of IMTP in AEL group were significantly greater ( Vertical jumping is a critical ability in volleyball and is related to serving, spiking, or blocking. It is widely recognized that muscular strength underpins several motor performances, included jumping , hence tA phenomenon known as Post-activation potentiation (PAP)  indicateThe use of AEL could be considered a conditioning activity to induce PAPE and, therefore, to enhance a subsequent performance. A few studies have demonstrated the enhancement of performance induced by AEL training , but without rest between each repetition ,21,22. CA randomized clinical trial was used for the comparison between an AEL and a TR exercise protocol to evaluate whether the AEL, as a form of conditioning activity to induce PAPE, could induce greater and longer potentiating effects on subsequent performances of muscle power. To avoid misunderstandings but considering the controversy in the use of terminology and understanding of concept ,25, in tAfter the execution of a 1-repetition maximum (1RM) test, participants were randomly assigned to the AEL or TR group for the execution of the exercise protocol, consisting of a half squat. Pre- (Pretest) and post- (Posttest) exercise protocol measurements included Countermovement Jump (CMJ), Spike Jump (SPJ), Isometric Mid-Thigh Pull (IMTP), and muscle soreness. Posttest measurements were repeated at 10 min (10-min), 24 h (24-h ), and 48 h (48-h ) .This study was approved by the University of Taipei Institutional Review Board . All participants gave their informed written consent, and all the experimental procedures were conducted in accordance with the Declaration of Helsinki .n = 8, age = 21 \u00b1 1.6 years, height 178.1 \u00b1 8.2 m, body mass = 77.2 \u00b1 13.1 kg, training experience = 10.4 \u00b1 1.8 years, relative 1RM 146.3 \u00b1 35.2 kg) and TR group .Sixteen male volley players were recruited from the men\u2019s volleyball team from University of Taipei, according to the following inclusion criteria: (a) age 18\u201325 years; (b) experience in resistance training for at least two years. Exclusion criteria were: (a) presence of known cardiovascular, pulmonary, metabolic, bone, or joint diseases; (b) muscle and joint injuries during the last six months, (c) being a setter or libero, and (d) use of ergogenic aids and supplementations in the last six months. They were requested to maintain their normal nutritional habits for the entire duration of the study without the use of ergogenic aids and supplementation. Therefore, they were randomly assigned to the AEL group (Participants reported to the laboratory on five occasions at the same time of the day (10:00 \u00b1 30 min), with temperature and humidity kept consistent at 23 \u00b1 1\u00b0 C and 55 \u00b1 5%, respectively. They were required to abstain from exercise during the 72 h prior the second and third experimental session. After ascertaining the inclusion criteria, participants were familiarized with all the experimental procedures during the first experimental session. The second experimental session was aimed at evaluating the lower limb maximal strength. During the third experimental session, the entire exercise protocol with the Pretest and Posttest measurements was executed, whilst the fourth and fifth experimental session was used to perform only the Posttest measurements at 24-h and 48-h. For all the experimental sessions, participants were required to avoid any form of exercise, to maintain their normal nutritional intake and hydration levels, and to abstain from alcohol and caffeine consumption during the 12 h prior to the sessions.\u22121). According to standard procedures [Lower limb maximal strength was determined by the 1RM back squat relative to body mass (BM) in kilograms . Two spotters helped participants to remove and add the load before and after the execution of the eccentric phase of each repetition. The TR group performed 3 sets of 5 repetitions (eccentric and concentric load with 85% 1RM). Participants were asked to lift the barbell upward to complete the concentric phase. Repetitions were interspersed by 3 seconds of recovery, required to reload the barbell for the following eccentric phase of each repetition for the AEL group, whilst a 3-min rest interval between sets was allowed. The experimental session was executed 72 h after the previous session for the determination of 1RM. Participants executed a standardized general warm up with 5-minute running activity on a treadmill followed by dynamic stretching exercises and a specific warm up including a set of 5 repetitions with 20% of 1RM followed by 3 repetitions at 50% of 1RM.Participants performed the CMJ test on a dual force-plate  with a sampling frequency of 1000 Hz, at Pre, 10-min, 24-h, and 48-h after the exercise protocol. Each participant performed two trials, with a three-minute rest interval in between. Each CMJ trial began with the participant standing upright, then descending to a depth of approximately 90\u00b0 knee angle, and then immediately jumping upward with maximum effort . All parParticipants performed the SPJ test using the vertec device  at Pre, 10-min, 24-h, and 48-h after the exercise protocol . Each paParticipants performed the IMTP on a dual force-plate  with a sampling frequency of 1000 Hz, at Pre, 10-min, 24-h, and 48-h after the exercise protocol. Participants performed three maximal IMTP trials, with a three-minute rest interval in between. They were secured to the immovable bar by using lifting straps and athletic tape to prevent their hands from slipping, and the bar placed equidistant at the mid-point between the iliac crest and patella . The kneThe muscle soreness test was performed at Pre, 10-min, 24-h, and 48-h after the exercise protocol. Participants were required to rate the quadriceps and hamstring soreness perception after one trial of the test. The Visual Analog Scale (VAS) consisted of a 100-mm continuous line with \u201cno pain at all\u201d on one side (0 mm) and \u201cextremely painful\u201d on the other side (100 mm) . Each pap \u2264 0.05. The normality assumption for each variable was verified using the Shapiro\u2013Wilk test, which confirmed the normal distribution of data. To avoid individual variation, CMJ height, peak velocity, and RFD, SPJ height, and IMTP peak force and RFD were normalized to the percentage of the premeasurement (posttest/pretest) \u00d7 100% for comparison. The results were shown in percentage (%) \u00b1 standard deviation (%). A prior evaluation of homogeneity of variance and sphericity was conducted using Levene\u2019s test and Mauchly\u2019s test, respectively. Consequently, a mixed analysis of variance (ANOVA) was applied to examine the changes of each variable over time between the two groups, considering the within-subjects factor time  and the between-subjects factor group (AEL and TR). Effects sizes for main effects were calculated as partial eta squared (\ud835\udf02\ud835\udc5d2) and interpreted as small (0.01\u20130.06), medium (0.06 < \ud835\udf02\ud835\udc5d2 < 0.14), and large effects (>0.14) [Mean \u00b1 SD was used to describe all dependent variables. All statistical tests were conducted using the Statistical Package for the Social Sciences, version 25.0  with statistical significance set at  (>0.14) . In case (>0.14) ,36 were Descriptive statistics (Mean \u00b1 SD) for the investigated variables are presented in p = 0.003, \ud835\udf02\ud835\udc5d2 = 0.335). Post hoc analysis maintained differences for Pre compared with 24-h  and 48-h , and between 24-h and 48-h . Similarly, only a main effect of time emerged for SPJ height   and 24-h .For CMJ height and peak velocity, no main effects of time, group, and interaction emerged A-B. Rega= 0.351) D. Post hp = 0.042, \ud835\udf02\ud835\udc5d2 = 0.175) emerged for IMTP peak force. Pairwise comparisons with Bonferroni correction (p < 0.0083) showed that peak force significantly decreased from Pre to 48-h post  in TR group only. Peak force for TR group was significantly lower than that for AEL group at 48-h  (A time by group interaction (= 1.479) E. p = 0.005, \ud835\udf02\ud835\udc5d2 = 0.265) was found for IMTP RFD. Pairwise comparisons with Bonferroni correction (p < 0.0083) showed that RFD significantly decreased from Pre to 10-min , from Pre to 24-h post , and from Pre to 48-h post  in TR group. RFD for TR group was significantly lower than that for AEL group at 10-min , 24-h , and 48-h  (A time by group interaction (= 2.002) F.p = 0.1809) and hamstring (p = 0.9016) muscle soreness, no main effects of time, group, and interaction emerged  . FurtherMuscle soreness of quadriceps and hamstring was not significantly elevated compared with baseline for both AEL and TR exercise protocol. This result is contrary to the findings from Hackney et al. where a peak muscle soreness at 24 h after exercise was found . HoweverDespite promising results, this study has some limitations that need to be addressed and can serve as guidance for future research. The limited number of participants and only male gender is relative to the availability of the sole collegiate men\u2019s volleyball team. The inclusion of athletes from different teams would have increased the sample heterogeneity in terms of training and competitions scheduled. This study aimed to investigate the long-lasting potentiating effects 10 min after the conditioning activity, hence the change of the PAP effect that occurred within 10 min could not be investigated. A single AEL protocol has been proposed, having potentiating effects only on IMTP peak force and RFD. Therefore, further research should compare AEL protocol with different eccentric loadings and different combinations of the training protocols to balance the coexistence of potentiating and fatigue effects. The cluster sets designed by Wagle et al. were considered to allow athletes more resting time to overcome the fatigue . BesidesThe main finding from this study is a retention of the ability to produce a high amount of force in a short period of time by accentuated eccentric loading. The effects of PAPE could last not only 10 min but also 48 h, which could be translated into implications for the training prescription (possibility to increase the training volume) and return to play (anticipate) strategies. The different dose and relative differences between the eccentric and concentric load should be further analyzed to overcome the accumulation of fatigue."}
+{"text": "Adhesive skin materials have increasingly been used in orthopedic surgery. We aimed to compare the efficacy and safety of skin adhesive  and interrupted polypropylene sutures for wound closure in patients undergoing total ankle arthroplasty (TAA).We prospectively enrolled 107 consecutive patients (108 ankles) undergoing TAA and divided them into two groups: skin adhesive group (36 ankles) and suture group (72 ankles). The primary outcome assessment included wound complications and patient satisfaction for wound cosmesis. The secondary outcome assessment included duration of surgery, length of hospital stay, and the Ankle Osteoarthritis Scale (AOS) pain and disability score.p\u2009=\u20090.001). There was no statistically significant difference between the groups in terms of secondary outcomes (p\u2009>\u20090.05).There was one case of allergic contact dermatitis, three cases of wound dehiscence, and one case of superficial surgical site infection in the skin adhesive group. Among them, one case each with allergic contact dermatitis and wound dehiscence finally progressed to deep surgical site infection. Three cases of wound dehiscence were also reported in the suture group; however, there was no case of surgical site infection. Patient satisfaction for wound cosmesis was significantly higher in the skin adhesive group than in the suture group (Although the use of Dermabond Prineo showed better patient satisfaction for wound cosmesis, it showed significantly high wound complication rates and no other clinical benefits compared to interrupted polypropylene suture in TAA. Our results suggest that awareness of the possibility of wound complications is necessary when Dermabond Prineo is used in TAA. Total ankle arthroplasty (TAA) has been steadily developed while overcoming the drawbacks of the past and is widely performed as a primary treatment for end-stage ankle arthritis \u20139. WoundSkin adhesive materials have become increasingly popular in elective orthopedic surgery , 22, 23.Previous studies have reported the superiority of Dermabond Prineo skin adhesive in terms of cosmetic outcomes, lesser wound discharge, cost-effectiveness, and shorter length of hospital stay when used in hip and knee arthroplasty , 22, 23.Literature search showed no previous studies have evaluated the efficacy and safety of Dermabond Prineo as wound closure material in TAA. Thus, our study aimed to compare wound complication rate, duration of surgery, length of hospital stay, and clinical outcomes between Dermabond Prineo and interrupted polypropylene sutures used for wound closure in patients undergoing TAA.This study was approved by the institutional review board of our hospital. Between January 2016 and December 2018, 108 consecutive patients (111 ankles) underwent primary TAA using the mobile-bearing HINTEGRA prostheses . All operations were performed by one surgeon with experience of over 200 TAA.The indication for primary TAA included end-stage ankle arthritis in patients with good general conditions, including well-controlled diabetes, good bone stock, and normal neurovascular status. The inclusion criteria for this study were symptomatic end-stage ankle osteoarthritis or rheumatoid arthritis with a minimum follow-up of 12\u00a0months after TAA. We excluded patients with hemophilic arthropathy and gouty arthritis of the ankle joint.Finally, 107 patients (108 ankles) were enrolled and divided into two groups according to the method of wound closure. For the first half of the study period (from January 2016 to June 2017), 2-octyl cyanoacrylate and polymer mesh (Dermabond Prineo) were used in the skin adhesive group , and interrupted polypropylene suture was used during the second half of the study period from (July 2017 to December 2018) in the suture group .All TAA were performed through the anterior longitudinal approach between the extensor hallucis longus and tibialis anterior tendon under general or spinal anesthesia. Distal tibial and talar dome resections were performed perpendicular to the mechanical axis of the tibia. After the medial, lateral, and posterior talar cuts, appropriately sized prostheses were implanted. If necessary, concomitant bony or ligamentous procedures were performed to achieve neutral hindfoot alignment and ligamentous balance.In all patients, the anterior joint capsule and extensor retinaculum were repaired using 1\u20130 braided absorbable sutures . The subcutaneous layer was repaired using 2\u20130 monofilament absorbable suture . For skin closure, Dermabond Prineo was applied, followed by air drying for 1\u00a0min in the skin adhesive group, while 3\u20130 nonabsorbable polypropylene  horizontal mattress sutures were performed in the suture group. Subsequently, a compressive dressing and posterior short leg splint were applied in neutral ankle position. All skin closure materials were removed between 10 and 12\u00a0days after surgery. Particularly, for the removal of Dermabond Prineo, petroleum jelly  was applied to loosen it, and then it was carefully peeled off from the skin. After removing suture materials, the patients were allowed to begin a range-of-motion exercise. Four weeks after surgery, the patient was instructed to begin progressive weight-bearing by wearing an ankle\u2013foot orthosis. Full weight-bearing ambulation without orthosis began 6 to 8 weeks after surgery.Clinical assessment included the wound complications, patient satisfaction for wound cosmesis, duration of surgery, hospital stay, and Ankle Osteoarthritis Scale (AOS) pain and disability score. The incidence of wound complications and patient satisfaction for wound cosmesis were the primary assessment parameters. Wound complications were evaluated during hospitalization or at the outpatient clinic 4\u00a0weeks after surgery, and the satisfaction survey was conducted at least 12\u00a0months after surgery. The wound complications were subdivided into allergic contact dermatitis (ACD), wound dehiscence, and surgical site infection (SSI). The appearance of an eczematous eruption or blister at the suture area or the area where the skin adhesive mesh was attached was classified as ACD\u00a0 . The wouThe secondary assessment included duration of surgery, length of hospital stay, and functional outcomes. Functional outcome was evaluated before surgery, at 6 and 12\u00a0months after surgery, and every year thereafter by AOS pain and disability score, which was reliable and validated for ankle joint-specific outcome .t test was used to analyze the differences between the groups for normally distributed continuous variables; else, Mann\u2013Whitney U test was used for comparing variables that were not normally distributed. For the categorical variables, Chi-square or Fisher\u2019s exact tests were used to analyze the differences. All statistical analyses were reviewed by a statistician, and a p-value\u2009<\u20090.05 was considered significant.Data were analyzed using SPSS . Descriptive statistics were calculated using the standard formulae. Kolmogorov\u2013Smirnov test was used to verify the normal distribution of data variables. An independent p\u2009>\u20090.05) between the groups.The information of patients in each group is shown in Table p\u2009=\u20090.04). There was one case of allergic contact dermatitis, three cases of wound dehiscence, and one case of superficial surgical site infection in the skin adhesive group. Two cases of wound dehiscence were also reported in the suture group; however, there was no case of surgical site infection.The incidence of wound complications is shown in Table One case of ACD and 3 cases of SSI were seen in the skin adhesive group, whereas these complications did not occur in the suture group Fig.\u00a0. Among tRegarding patient satisfaction for wound cosmesis, 34 (94.4%) of 36 patients in the skin adhesive group reported that they were \u2018very satisfied\u2019 or \u2018satisfied,\u2019 and there was a significant difference compared to the responses in the suture group (Table p\u2009>\u20090.05). In terms of the functional outcomes, there were no significant intergroup differences in the AOS pain, and disability scores at the final follow-up (p\u2009>\u20090.05).The comparison of duration of surgery, length of hospital stay, and AOS pain disability score is shown in Table To our knowledge, this is the first study to evaluate the efficacy and safety of Dermabond Prineo for skin closure after TAA. The most important finding of this study is that the use of Dermabond Prineo showed a significantly high rate of overall wound complications and did not show any other benefits in terms of duration of surgery, length of hospital stay, and clinical outcomes.In recent times, skin adhesive materials, including Dermabond Prineo, are widely used in elective orthopedic surgery due to various advantages \u201322, 33. In this study, there was a case of full incisional dehiscence, which did not occur in the suture group. We assumed that tension around the entire wound might have led to the occurrence of full wound dehiscence. In the case of a skin suture, the tension is applied focally around the skin through which the thread passes; however, the tension is applied to the wide area of the entire wound when skin adhesive is used. Other previous studies have also described that increasing tissue tension can lead to superficial skin damage by shearing the skin when the skin adhesive material was used . FurtherBased on our experience of wound complications in the skin adhesive group, we have discontinued the use of Dermabond Prineo for wound closure in TAA. Since there are not many studies on the use of Dermabond Prineo in ankle surgery, it is too early to conclude that its use increases the rates of wound complication and SSI. However, it has been frequently reported that the constituents of Dermabond Prineo induce allergic reactions. These can lead to ACD or wound dehiscence and can cause critical complications such as deep SSI , 39\u201342. There is still no established method for the prophylaxis of ACD after the use of Dermabond Prineo. According to previous reports, patch testing for Dermabond Prineo glue or polyester mesh has been known to be useful to identify the patient who may have allergenic reactions postoperatively . Bulky oThis study had several weaknesses. First, the sample size of both groups was small. This limited our ability to evaluate the safety of Dermabond Prineo. Second, we did not measure the time skin taken for closure separately and evaluated the cosmetic outcome by the objective wound score. Finally, we did not perform preoperative testing for other allergens that could cause skin complications. We use chlorhexidine for preoperative skin preparation, which is also known to be an allergen.In conclusion, although the use of Dermabond Prineo showed better patient satisfaction for wound cosmesis, there was a significantly high rate of overall wound complications, and there were no other benefits in terms of duration of surgery, length of hospital stay, and clinical outcomes compared to those with the use of interrupted polypropylene suture in TAA. Our results suggest that careful vigilance is necessary when using Dermabond Prineo in TAA. Further studies with larger samples are necessary to determine the effect of Dermabond Prineo in wound closure."}
+{"text": "As a secondary endpoint, we evaluated 18F-FACBC PET/CT\u2019s impact on patients management. Clinical records of 81 patients submitted to 18F-FACBC PET/CT due to PC BCR in two Italian Nuclear Medicine Units were retrospectively assessed. DR was gauged in the whole cohort and stratifying patients by discrete intervals of PSA levels. PET/CT\u2019s impact on clinical management was scored as (1) major if it entailed an intermodality change ; (2) minor if it led to an intramodality change . PET/CT\u2019s DR resulted in 76.9% in the whole cohort, with a positive predictive value of 96.7%. Stratified by PSA quartile intervals, PET/CT\u2019s DR was 66.7%, 71.4%, 78.9% and 90% for PSA 0.2\u20130.57 ng/mL, 0.58\u20130.99 ng/mL, 1\u20131.5 ng/mL and >1.5 ng/mL without significant difference among groups (p = 0.81). The most common sites of relapse were prostate bed and pelvic lymph nodes (59.3%). PET/CT impacted on clinical management in 33/81 cases (40.7%), leading to a major change in 30 subjects (90.9%). 18F-FACBC PET/CT localized recurrence in patients with BCR, with meaningful DR also at low PSA levels and significantly impacted on clinical management.Our aim was to assess the detection rate (DR) of positron emission computed tomography (PET/CT) with anti-1-amino-3-[ Prostate cancer (PC) is a leading cause of cancer-related death worldwide . In pati18F) or 11-carbon (11C) radionuclide. Radiolabeled choline represents a surrogate biomarker of phospholipids\u2019 biosynthesis in tumor cells and has been used for the imaging of several malignancies other than PC such as multiple myeloma and hepatocellular carcinoma [Imaging plays a crucial role in BCR management, since determining whether it reflects local or distant recurrence is of utmost importance and has relevant clinical implications. In this scenario, positron emission computed tomography (PET/CT) has been successfully applied for the detection of metabolically active tumor tissue through the radiopharmaceutical choline, labeled with 18-fluorine  is an L-leucine analogue showing high tumor accumulation by addressing amino acid transports, which are up-regulated in PC [68Ga-PSMA-11) show a meaningful accumulation in bladder; thus, the identification of loco-regional relapse might deserve particular attention and require dedicated protocols [The synthetic amino acid anti-1-amino-3-[ed in PC . On the ed in PC . Howeverrotocols .18F-FACBC PET/CT presented pooled sensitivity for the overall detection of recurrence of 0.68 (95% CI: 0.63\u20130.73), and specificity of 0.68 (95% CI: 0.60\u20130.75) [18F-FACBC PET/CT in PC patients with BCR and low PSA levels are still limited. In a cohort of 126 subjects, Wang et al. reported a positivity rate of 33% at low (<1 ng/mL) and of 0% at very low (<0.3 ng/mL) PSA values [In a recently published meta-analysis encompassing 283 studies and 697 patients, 60\u20130.75) . HoweverA values .18F-FACBC PET/CT has been reported to have a relevant impact on the clinical management of patients with PC BCR, both for the choice of the most appropriate therapeutic approach  and the delineation of RT fields [Furthermore, T fields .18F-FACBC PET/CT in PC patients showing BCR after surgery or RT, stratified by different PSA levels; (2) to determine PET/CT\u2019s clinical impact on the therapeutic management of PC patients included in the analysis.The aims of this retrospective study were: (1) to analyze the detection rate of 18F-FACBC  PET/CT between December 2019 and July 2021 at the following Italian Nuclear Medicine Units: S. Maria Goretti Hospital, Latina, and Cattinara University Hospital ASUGI, Trieste, as a part of their diagnostic work-up.We retrospectively reviewed clinical data of patients affected by PC BCR who were submitted to 18F-FACBC PET/CT performed due to evidence of BCR, defined as a PSA of 0.2 ng/mL or higher measured more than 6 weeks after prostatectomy or a PSA rise of 2 ng/mL or higher above nadir after RT [18F-FABC PET/CT performed in a clinical setting different from BCR; (3) ongoing androgen deprivation therapy (ADT).Inclusion criteria were: (1) adult male above 18 years; (2) histologically proven PC; (3) previous prostatectomy  or RT/brachytherapy as a radical therapy; (4) after RT . Exclusi18F-FACBC PET/CT in all the enrolled patients. Furthermore, PET/CT\u2019s DR for PC recurrence was assessed stratifying patients by different intervals of PSA. As a secondary endpoint, PET/CT\u2019s impact on clinical management was assessed.Primary endpoint of study was to define the diagnostic performance  of For the primary endpoint, standard of reference to finally categorize PET/CT\u2019s results  was clinical and imaging follow-up data.For the secondary endpoint, in each participating clinical center patients\u2019 follow-up was analyzed together with the referring physicians during the multidisciplinary disease management team (DMT), who was asked to provide information on how clinical management was influenced by PET/CT\u2019s results . In particular, PET/CT\u2019s impact was scored as (1) major if it entailed a change in the treatment modality  with respect to the intended approach , (2) minor if it led to an intramodality change ; (3) not significant if the intended therapeutic approach was not changed.The change management was considered to be adequate if the PSA serum level declined by more than 50%  following treatment modification.This was a retrospective study on data available for clinical practice in which clinical records of all patients in follow-up for PC were reviewed. Data were anonymously collected in each center and were cumulatively gathered in an electronic database for analysis. Patients were not required to give informed consent to the study because the analysis used anonymous data that were obtained after each patient agreed to being followed up and to collect clinical records by institutions. No experimental procedures, novel devices, or experimental drugs were used, and no findings were received. The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki.18F-FACBC according to present imaging guidelines [18F-FACBC.All the enrolled patients underwent PET/CT with idelines . Each ofmax) was registered and compared with the reference value  measured on blood pool or bone marrow [Images were interpreted by well-trained local readers: any area with an uptake intensity greater than background uptake that could not be identified as physiological activity was considered to be potentially pathological, and its grade of uptake , pelvic lymph nodes (N1) , extrapelvic lymph nodes (M1a) , bone (M1b), and visceral organs (M1c) [Images were then classified according to an image-based TNM staging system  originally developed for the reporting of PSMA-ligand PET/CT\u2019s results and adapted by the authors for the reading of ns (M1c) .18F-FACBC PET/CT in all patients. Fisher\u2019s exact test was applied to examine the differences in PET/CT\u2019s DR (primary endpoint) among different groups stratified by PSA values, significance was established at 2-tailed p < 0.05. Receiver Operating Characteristic (ROC) analysis was used to identify the optimal cut-off PSA for predicting a 18F-FACBC PET/CT positive result. Multivariate logistic regression analysis was used to estimate the association of International Society of Urological Pathology (ISUP) Grade Group, PSA and PSA doubling time (PSA DT) with positive 18F-FACBC PET/CT.Data are presented as mean \u00b1 standard deviation, median, or number (percentage). Statistical analysis was performed using dedicated software . DR values were calculated for 18F-FACBC PET/CT performed in a clinical setting different from BCR and nine due to ongoing ADT or incomplete medical history .Concerning ISUP grading, thirty-three patients were classified as ISUP4, twenty-seven as ISUP3, sixteen patients were ISUP1-2 and five were ISUP5.18F-FACBC PET/CT-positive results, while 19 (23.4%) had negative PET/CT scans. Final diagnosis was established by follow-up  or follow-up and confirmatory imaging . Of the 81 examined PET/CT scans, 60 were found to be true-positive, 1 true-negative, 2 false-positive, and 18 false-negative. PET/CT showed good accuracy (75.1%) for the detection of PC BCR relapse, with an overall DR of 76.9% and a positive predictive value (PPV) of 96.7%.Among the enrolled patients, 62 (76.5%) presented 18F-FACBC PET/CT execution, by using discrete intervals as follows: group 1 , group 2 , group 3  and group 4 . PET/CT DR was 66.7%, 71.4%, 78.9% and 90% for groups 1, 2, 3 and 4, respectively. No significant differences were found among groups (p = 0.81). PET/CT\u2019s DR was further evaluated by stratifying patients into four different groups, according to the PSA value measured prior to p = 0.07 and 0.39, respectively. At ROC analysis, the optimal cut-off value for PSA at the time of PET/CT for the prediction of a positive scan was shown to be 1.1 ng/mL .ROC curves, generated both for PSA and PSA DT, showed the highest AUC for PSA  with respect to PSA DT  for predicting a PET positive scan, although neither of these parameters reached the threshold of statistical significance, with .1 ng/mL . PSA valAmong the enrolled patients, final staging classified according to PROMISE showed positive results for local relapse (Tr/N1) in 48 patients (59.3%), detected extrapelvic lymph nodes (M1a) in eight patients (9.9%) and distant metastases to bone or visceral organs  in six cases (7.4%). PET/CT was negative (T0N0M0) in the remaining 19 subjects (23.4%), as shown in Among the enrolled patients, change in therapeutic management occurred in 33/81 patients (40.7%). In 30 cases (90.9%), PET/CT\u2019s clinical impact was classified as major, since it entailed an intermodality change, leading from an intended systemic therapy (androgen deprivation therapy or 2nd-generation anti-androgens) to a loco-regional PET-guided treatment consisting of SBRT on prostate bed/pelvic lymph node in 23 cases (76.6%) or on abdominal nodes in four patients (13.3%), while in three subjects (10%) the intended management plan (ADT) was revised to RT on bone lesions  or SBRT on a lung pulmonary nodule .18F-FACBC-avid pelvic lymph nodes in the RT field. p = 0.9.In three patients, PET/CT presented a minor impact, since it led to the inclusion of missing 18F-FACBC PET/CT determined significant changes in management.According to the defined criteria, PET/CT\u2019s impact on clinical management was considered adequate in 29 out of 33 cases (87.8%).18F-FACBC PET/CT in patients with BCR from PC. These data are substantially in line with those reported in a previously published meta-analysis encompassing nine clinical studies, indicating at per-patient analysis a sensitivity and specificity of 86.3% and 75.9%, respectively, for PC recurrence detection [18F-FACBC PET/CT may also represent a valuable tool in patients with low (0.58\u20130.9 ng/mL) or very low (0.2\u20130.57 ng/mL) PSA levels, with DR of 71.4% and 66.7%, respectively.Our retrospective analysis indicates meaningful DR  and a positive predictive value  for 18F-FACBC PET/CT has been implemented in clinical practice in many centers, its DR in subjects with low PSA has not been fully investigated yet. The results of the FALCON clinical trial, which collected patients from six different UK centers and aimed to assess 18F-FACBC PET/CT\u2019s impact in patients with BCR from PC after radical treatment, found positive lesions in 58 out of 104 subjects (DR = 56%), mainly located in the prostate bed and pelvic lymph nodes. Of note, DR strongly correlated with PSA levels, since lymph node and skeletal positivity ranged from 8.9% and 3.6%, respectively, at PSA \u2264 1 ng/mL, to 50% and 13%, respectively, at >10 ng/mL [Although 10 ng/mL . Further18F-FACBC a DR of 57% in the whole cohort, with an increasing sensitivity for higher PSA values. It is worth mentioning that DR resulted in 31% and 50% among patients with PSA values ranging 0\u20130.5 ng/mL and 0.5\u20131 ng/mL, respectively [Similar results have been obtained in the clinical trial LOCATE, including a larger number of patients (n = 213) collected from 15 US centers: the authors report for ectively . It has 18F-FACBC PET/CT\u2019s DR was 67.7%, with prostate bed and pelvic lymph nodes being the most frequent sites of disease localization. Of note, DR was meaningfully lower (41.4%) in subjects in the lowest quartile of PSA levels . If has to be underlined that, among the enrolled patients, 143 (23.9%) PET/CT scans were correlated with histology as a standard of truth [In a retrospective multicenter study, including a large cohort (n = 596), of truth .18F-FACBC for the detection of BCR at low PSA levels and are partially in disagreement with other recently published papers. Armstrong et al. retrospectively analyzed 115 patients with BCR submitted to 18F-FACBC and stratified results by different intervals of PSA: at PSA levels of less than 0.5, 0.5 to 2.0, and greater than 2, lesions were detected in 55.5%, 70.6% and 91.5% of patients, respectively [18F-FACBC PET/CT\u2019s DR in a group of patients presenting very low PSA levels , reporting positivity rates of 43.8%, 60.0% and 65.2% for PSA < 0.1 ng/mL, 0.1\u2013<0.2 ng/mL and 0.2\u2013\u22640.3 ng/mL, respectively [These preliminary data ,20,21 suectively . More reectively .18F-FACBC PET/CT showed an increased DR with increasing PSA values and, in fact, PSA values were significantly different among patients with positive and negative scans, it was demonstrated to also be effective in detecting PC recurrence in half of our patients (51.8%) presenting PSA values < 1 ng/mL.Our data are substantially in line with those published by Marcus\u2019s and Armstrong\u2019s group. Although 18F-FACBC PET/CT\u2019s DR. Second, histology was only available in a small number of papers as a standard of truth. However, it has to be underlined that biopsy for recurrence verification or histology after the \u201cso-called\u201d salvage-surgery is not common in clinical practice and is not exempt from controversy [The discrepancies of results among different research groups might be explained by several factors. First of all, patient selection might play a relevant role. It is still debated, in fact, whether or not ongoing ADT might influence PET/CT\u2019s sensitivity . In our troversy ; therefo68Ga-PSMA-11, DR is strongly influenced by the technology used [18F-FACBC PET/CT\u2019s diagnostic performance.Another relevant issue to be considered is related to differences in available technologies for PET/CT acquisition. Preliminary data have indicated that, regarding PET/CT with ogy used ,27. In o18F-FACBC PET/CT, as previously demonstrated by Salavati et al. [18F-FACBC PET/CT might offer advantages with respect to some PSMA-ligands, such as 68Ga-PSMA-11, which presents meaningful bladder accumulation potentially harming the detection of pathological focuses in pelvis, therefore requiring specific protocols, such as forced diuresis and late imaging [18F-choline, 18F-FACBC and 68Ga-PSMA-11) for the detection of PC BCR [18F-choline, 18F-FACBC and 68Ga-PSMA-11, respectively. Of note, 68Ga-PSMA-11 substantially outperformed the other two tracers in patients presenting PSA level < 1 ng/mL. Nevertheless, it has to be underlined that in the aforementioned study [18F-FACBC PET/CT\u2019s DR for low and very low PSA values [In our cohort of patients, we classified PET/CT images through the TNM-based PROMISE reading system, which was developed by Eiber et al.  for PSMAi et al. . We foun imaging . In thisf PC BCR : the auted study , the autA values ,22,29.18F-FACBC PET/CT\u2019s impact on patients\u2019 clinical management. Our results are substantially in line with those previously reported [18F-FACBC PET/CT in patients with BCR and PSA levels less than those fixed by the Phoenix criteria. The authors reported a DR of 79% in the whole cohort and 62% in subjects with PSA values below the aforementioned criteria. Of note, in line with our analysis, neither pre-scan PSA nor PSA DT were found to present a significant predictive value on a positive 18F-FACBC PET/CT scan.A further consideration has to be made regarding reported ,20, indireported . In our reported , which areported  must be 18F-FACBC PET/CT\u2019s sensitivity in patients with BCR at different PSA levels, we think that our data might be worthy of consideration.Our study presents several limitations: first of all, as previously stated, the lack of histological confirmation. Furthermore, the retrospective nature of the study might have introduced bias in patients\u2019 selection and data interpretation. Finally, another limitation is represented by the relatively small number of subjects in our analysis, although not meaningfully different from that included in other published papers. However, also taking into account the aforementioned limitations, given the relatively few studies focusing on 18F-FACBC PET/CT may also represent a useful diagnostic tool in patients with BCR at low PSA levels, with meaningful impact on patients\u2019 clinical management. Further studies with large cohorts, collected through multicenter cooperation, are needed to better define how much patients\u2019 selection and technological facility might impact 18F-FACBC PET/CT\u2019s diagnostic performance.Our results indicate that"}
+{"text": "We performed a systematic review and meta-analysis about the detection rate (DR) of 18F-PSMA-1007 PET/CT or PET/MRI in BRPCa patients.  Prostate-specific membrane antigen- (PSMA-) targeted agents labeled with fluorine-18  values. The DR of 18F-PSMA-1007 PET/CT or PET/MRI was dependent on PSA serum values. The pooled DR was 81.3%  with statistical heterogeneity. A significant reporting bias (publication bias) was not detected.  Fifteen articles (853 patients) were selected and included in the systematic review, and ten were included in the quantitative analysis. Most of the studies reported a good DR of 18F-PSMA-1007 PET/CT or PET/MRI showed a good DR in BRPCa patients in line with other PSMA-targeted agents. The DR of 18F-PSMA-1007 PET/CT or PET/MRI is influenced by serum PSA values. These findings should be confirmed by prospective multicentric trials. Between 27% and 53% of all patients with prostate cancer (PCa) undergoing radical prostatectomy (RP) or radiation therapy (RT) develop a biochemical recurrence (BCR) defined as rising prostate-specific antigen (PSA) serum levels after curative treatment for PCa . MetabolPSMA is a protein overexpressed in PCa tumor cells, and this is the rationale for using PSMA-targeted agents in the diagnosis and therapy of PCa , 7. Howe18F), Gallium-68 (68Ga), or Copper-64 (64Cu) for PET imaging [68Ga-PSMA-targeted agents are the most widely diffused PSMA-targeted radiopharmaceuticals. However, radiolabeling PSMA-targeted agents with 18F may provide several advantages compared with 68Ga radiolabeling for PET imaging, including a longer radiotracer half-life and a better PET images resolution [To date, different PSMA-targeted agents are available for diagnostic evaluation of PCa \u201312. In psolution .18F-PSMA-1007 has been introduced in clinical practice. This biodistribution of this PET radiopharmaceutical is similar compared to other PSMA-targeted agents [18F-PSMA-1007 compared to other PSMA-targeted radiopharmaceuticals is its predominant excretion via the hepatobiliary rather than urinary system, allowing an excellent assessment of the pelvic region owing to the reduced interference of the urinary radioactivity [After successful preclinical studies , 18F-PSMd agents \u201316. The activity \u201316.18F-PSMA-1007 PET/CT in staging PCa [18F-PSMA-1007 in BRPCa.A recent systematic review demonstrated the good detection rate of ging PCa . Our aimThe Preferred Reporting Items for a Systematic Review and Meta-Analysis of Diagnostic Test Accuracy Studies\u201d (PRISMA-DTA) statement and other specific guidelines , 18 were18F-PSMA-1007 PET/CT or PET/MRI in patients with BRPCa?\u201d. Based on the review question, the authors independently performed a literature search using several bibliographic databases  to find articles related to the review question. The search string was \u201cPSMA\u201d AND \u201c1007\u201d. No filters about date and language were used. The last update of the literature search was 17 May 2021. The authors also screened the references of the retrieved articles to find further eligible studies.First, the following review question was created: \u201cWhich is the DR of 18F-PSMA-1007 PET/CT or PET/MRI in BRPCa patients were eligible for inclusion in the qualitative (systematic review) and quantitative analysis . The exclusion criteria for the systematic review were as follows: (a) articles not within the field of interest of this review ; (b) review articles, editorials, comments, letters, and conference proceedings related to the review question; and (c) case reports or small case series related to the review question (less than 5 BRPCa patients included). For the quantitative analysis, the articles with data overlap or without sufficient data to calculate the DR on a per scan-based analysis were excluded from the meta-analysis but included in the qualitative analysis (systematic review).Studies or subsets of studies investigating the DR of Two researchers (MF and GT) independently reviewed abstracts, titles, and full-text of the retrieved studies. The abovementioned inclusion and exclusion criteria were applied, and disagreements were discussed and solved in an online meeting.18F-PSMA-1007 PET/CT or PET/MRI, mean/median age, PSA serum values and PSA kinetics, Gleason score). Furthermore, data on technical aspects were extracted . For articles included in the analysis, information was collected about DR values of 18F-PSMA-1007 PET/CT or PET/MRI  on a per scan-based analysis, mean PSA serum values in patients with positive and negative 18F-PSMA PET/CT, and percentage of change of management by using 18F-PSMA-1007 PET/CT or PET/MRI in BRPCa patients.Two researchers (MF and GT) independently extracted the data from the selected articles. For each article, several pieces of information were collected in particular about basic study characteristics , characteristics of patients included  .18F-PSMA-1007 PET/CT or PET/MRI was performed using data retrieved from the included studies. A random-effects model (as suggested by DerSimonian and Laird) was used for the pooled analysis [I-square index (I2) or inconsistency index was used to estimate the statistical heterogeneity [The DR was defined as the ratio between the number of scans with at least one suspected lesion detected and the total number of scans performed. Pooled analysis about DR of ogeneity , whereasogeneity . The opeLiterature search results are reported in 1Through the literature search using the selected bibliographic databases, 15 full-text articles (853 BRPCa patients) were selected \u201336. All 18F-PSMA-1007 uptake higher than the local background activity, excluding physiological uptake areas or known pitfalls of 18F-PSMA-1007 PET, were considered positive for PCa. In one study, PET reviewers used the criteria for harmonization of PSMA PET/CT interpretation [Technical aspects of the included studies are reported in retation .18F-PSMA-1007 were reported in the included studies [First of all, no significant adverse effects/side effects after the injection of  studies \u201336.18F-PSMA-1007 PET/CT or PET/MRI in BRPCa patients was described [18F-PSMA-1007 PET/CT or PET/MRI was dependent on PSA serum values: in other words, higher PSA values were associated with a higher DR, with excellent DR for PSA values >1\u2009ng/ml [18F-PSMA-1007 PET/CT or PET/MRI may be able to detect BRPCa lesions even in patients with low PSA serum levels (<0.5\u2009ng/ml) [18F-PSMA-1007 PET in BRPCa [Overall, a good DR of escribed \u201336. The >1\u2009ng/ml , 33, 35.>1\u2009ng/ml , 35 or s>1\u2009ng/ml , 31, 35.5\u2009ng/ml) , 33, 35.5\u2009ng/ml) . Antiandin BRPCa .18F-PSMA-1007 PET in BRPCa patients were controversial. In one study, in PCa patients with a higher Gleason score of the primary tumor (\u22658), the DR of 18F-PSMA-1007 PET trended higher compared to those with lower Gleason score (<8) but without a statistically significant difference [18F-PSMA-1007 PET/CT [18F-PSMA-1007 PET/CT was independent of the Gleason score [The results about the correlation between the Gleason score and DR of fference . In one 7 PET/CT . In two on score , 35.18F-PSMA-1007 PET/CT or PET/MRI [Regional and distant lymph nodal metastases (even with short-axis diameter less than 1\u2009cm), local relapse, and bone metastases were the most frequent sites of metastatic lesions detected by  PET/MRI \u201336. Howe PET/MRI \u201331, 36.18F-PSMA-1007 PET was very high [When evaluated, the interreader agreement for ery high , 36.18F-PSMA-1007 PET/CT [When compared to CT, a significantly higher number of positive findings for PCa were detected by using 7 PET/CT .18F-PSMA-1007 PET imaging; to this regard, the very low urinary activity in 18F-PSMA-1007 PET scans, due to the minimal clearance via the urinary pathway, seems to be a clear advantage in favor of 18F-PSMA-1007 [18F-PSMA-1007 PET [68Ga-PSMA-11 PET/CT, 18F-PSMA-1007 PET/CT detected a higher number of benign lesions without a significant difference in DR of BRPCa lesions among these imaging methods [18F-DCFPyL and 18F\u2010PSMA-1007 PET/CT was found even if 18F-PSMA-1007 PET/CT detected suspected local relapse in a higher proportion of BRPCa patients whereas 18F-DCFPyL PET/CT showed less equivocal skeletal lesions [When compared to PET/CT with renally excreted PSMA ligands, the interpretation of locoregional PSMA-positive lesions was increased by using SMA-1007 , 30, 36.1007 PET . Further18F-PSMA-1007 PET/CT in BRPCa patients was significantly higher compared to 18F-choline PET/CT with a higher number of BRPCa lesions detected and a lower number of negative and equivocal results [DR of  results .18F-PSMA-1007 PET/CT or PET/MRI in BRPCa was reported and it ranged from 64% to 79% of cases [In some studies, the change of management by using of cases , 26, 33.18F-PSMA-1007 PET/CT or PET/MRI on a per scan-based analysis ranged from 47% to 95%, and the pooled estimate was 81.3% (95%CI: 74.6\u201388%) (I2\u2009=\u200983%). Conversely, a publication bias was not detected by Egger's test (p=0.2) and visual analysis of the funnel plot  . Signifinel plot .18F-PSMA-1007 PET/CT or PET/MRI based on the different serum PSA values [Only five articles included in our meta-analysis (430 BRPCa patients) provided sufficient data to calculate the DR of A values , 31, 35.18F-PSMA-1007 PET/CT or PET/MRI in BRPCa patients. In a previous meta-analysis, data from different 18F-labeled PSMA tracers used in BRPCa patients were pooled together [18F-labeled PSMA radiopharmaceutical, as performed in this manuscript, should be preferred because each PSMA-related radiopharmaceutical has different characteristics which can lead to different DR.Our report is the first systematic review and meta-analysis specifically focused on together . We beli18F-PSMA-1007 PET/CT or PET/MRI in BRPCa patients [18F-PSMA-1007 PET/CT or PET/MRI in BRPCa patients [18F-PSMA-1007 PET/CT or PET/MRI [18F-PSMA-1007 PET/CT or PET/MRI in BRPCa patients. Notably, 18F-PSMA-1007 PET/CT or PET/MRI may be able to detect PCa lesions even in some patients with low serum PSA levels; in these subgroup of patients, morphological imaging methods usually fail to detect the site of PCa recurrence [Recently, several studies have evaluated the DR of patients \u201336. Overpatients \u201336. Howe PET/MRI , 33, 35.currence , 33, 35.18F-PSMA-1007 PET/CT in BRPCa [PSA velocity may be a significant predictor of positivity at in BRPCa , and thiin BRPCa .18F-PSMA-1007 PET/CT results in some BRPCa patients [18F-PSMA-1007 PET [Beyond the PSA serum values, low PSMA expression caused by tumor heterogeneity might be responsible for false-negative patients \u201336. Conv1007 PET .18F-PSMA-1007 PET/CT or PET/MRI clearly showed a higher DR than conventional cross-sectional imaging with CT. This finding is not surprising, as functional abnormalities detected by functional imaging techniques usually precede morphological abnormalities detected by morphological imaging. Overall, CT alone seems insufficient for restaging of BRPCa patients [Compared to other imaging methods, patients .18F-PSMA-1007 PET/CT or PET/MRI in BRPCa is similar compared to 68Ga-labeled PSMA PET/CT or PET/MRI [18F-labeled PSMA tracers should allow higher lesion uptake, superior clearance of background activity, and higher quality images of PET with 18F-labeled PSMA tracers compared to PET with 68Ga-labeled PSMA tracers [18F than 68Ga theoretically provides an improved spatial resolution [The pooled DR of  PET/MRI . However tracers , 16. Fursolution .18F-PSMA-1007 and 68Ga-PSMA-11 PET/CT in BRPCa patients [18F-PSMA-1007 and 68Ga-PSMA-11, whereas a significantly higher number of benign lesions were detected using 18F-PSMA-1007 [18F-PSMA-1007 compared to 68Ga-PSMA-11 could be the large-scale production by a cyclotron and supply to PET centers due to the longer half-life of 18F (110\u2009min) compared to 68Ga (68\u2009min) [Only two studies compared patients , 30. A s(68\u2009min) , 16.18F-labeled PSMA tracers, 18F-PSMA-1007 may provide a better interpretation of lesions adjacent to the urinary tract but may decrease the interpretability of skeletal lesions due to the higher frequency of focal areas of unspecific radiotracer uptake in the bone [18F-PSMA-1007 compared to other PSMA-targeted PET tracers is its reduced urinary clearance allowing an excellent assessment of the pelvic region owing to the reduced interference of the urinary radioactivity [18F-PSMA-1007 PET seems a frequent finding , and it should be interpreted carefully to avoid PCa overstaging [Compared to other the bone , 36. Theactivity , 16. On rstaging , 40.18F-choline, DR of 18F-PSMA-1007 PET/CT in BRPCa patients was significantly higher with a higher number of BRPCa lesions detected and a lower number of negative and equivocal results [Compared to  results . This is results .18F-PSMA-1007 PET/CT or PET/MRI in BRPCa [Only three articles evaluated the change of management using in BRPCa , 26, 33.in BRPCa .18F-PSMA-1007 PET/CT or PET/MRI. In this regard, a standardized interpretation of PSMA-ligand PET has been recently proposed [The main limitations of our systematic review and meta-analysis are the limited number of studies included, the verification bias in the included studies , and the heterogeneity among studies. Furthermore, the different interpretation criteria could have an influence on the DR of proposed .We have detected statistical heterogeneity among the included studies in our meta-analysis, and unfortunately, there were insufficient data to perform meta-regression and several subgroup analyses. Only a small subgroup analysis taking into account a PSA cut-off value of 0.5\u2009ng/mL was performed. On the other hand, we did not find a significant publication bias.18F-PSMA-1007 PET/MRI in comparison to 18F-PSMA-1007 PET/CT.The hybrid imaging modality used in the included studies was PET/CT in most of the articles and PET/MRI only in one study; therefore, we need more data to further evaluate the DR of 18F-PSMA-1007 to other PET radiopharmaceuticals are warranted to confirm these findings.Lastly, large prospective multicentre studies and, in particular, cost-effectiveness analyses comparing 18F-PSMA-1007 used PET/CT instead of PET/MRI.Most of the published articles on 18F-PSMA-1007 PET demonstrated a good DR in BRPCa (similar results compared to other PSMA-targeted agents).18F-PSMA-1007 PET is related to PSA serum values .The DR of 18F-PSMA-1007 with other PET tracers in the BRPCa setting. More studies on 18F-PSMA-1007 PET/MRI in BRPCa are warranted.Prospective multicentric trials and cost-effectiveness analyses are needed to confirm these findings and to compare"}
+{"text": "In https://www.hsph.harvard.edu/pgda/data/.Further, the posted code treats income using ranked categories. Code has been updated to treat income using the mid-points of income categories or the lowest value for the highest category and is available at"}
+{"text": "Microalga was grown in two different media. The highest rate of CO2 fixation (0.130\u00a0g/L/day) was observed at a CO2 concentration of 2%. The pyrokinetics of the biomass was performed by a thermogravimetric analyzer (TGA). Thermogravimetric (TG) and derivative thermogravimetric (DTG) curves at 5, 10 and 20\u00b0C/min indicated the presence of multiple peaks in the active pyrolysis zones. The activation energy was calculated by different model-free methods such as Friedman, Flynn-Wall-Ozawa (FWO), Kissinger-Akahira-Sunose (KAS), and Popescu. The obtained activation energy which are 61.7\u2013287\u00a0kJ/mol using Friedman, 40.6\u2013262\u00a0kJ/mol using FWO, 35\u2013262\u00a0kJ/mol using KAS, and 66.4\u2013255\u00a0kJ/mol using Popescu showed good agreement with the experimental values with higher than 0.96 determination coefficient (R2). Moreover, it was found that the most probable reaction mechanism for G. pectorale pyrolysis was a third-order function. Furthermore, the multilayer perceptron-based artificial neural network (MLP-ANN) regression model of the 4-10-1 architecture demonstrated excellent agreement with the experimental values of the thermal decomposition of the G. pectoral. Therefore, the study suggests that the MLP-ANN regression model could be utilized to predict thermogravimetric parameters.This study investigates CO Microalgae can be cultivated in a closed photobioreactor located on non-arable land or in an open vast pond. It is a cost-effective source of carbon dioxide (CO2) mitigation through photosynthesis  curve records the derivative of weight change with respect to temperature. The rate of the thermochemical reaction is represented by the peak of the DTG curve. The elevation of the DTG curve detects the potential to release volatile substances from a reaction during the slow process of pyrolysis . HoweverSo far, commercialization of microalgae pyrolysis has been tested only on a bench scale although microalgae pyrolysis has been used since the early 1990s. TGA was extensively used to show the kinetics of the degradation process and to simulate the slow pyrolysis process . Much research on pyrolysis of microalgae was conducted using a slow pyrolysis approach, while only a few studies were conducted using fast pyrolysis. Fast pyrolysis with a heating rate greater than 10\u00b0C/s can be performed in the fluidized bed reactor .G. pectorale is reported. Fewer studies on the genetic transformation of G. pectorale microalgae are available  Estimate its total energy content through higher heating value (HHV), and 3) Kinetic analysis of the conversion process using model-free and model-fitting methods, and 4) The conversion of G. pectorale was modeled using an artificial neural network (ANN) to predict the pyrolysis behavior. The input data were time, temperature, and weight loss, while the output data was the change in weight loss with respect to time.The objectives of this study were to 1) Investigate the potential of the 3COOH) while the latter does not. Stock solutions for the growth medium were prepared in a 250\u00a0ml volumetric flask. After that, the stock solutions were combined in a 2\u00a0L flask for the growth medium. Each prepared medium was autoclaved at 121\u00b0C for 4\u00a0h to eliminate bacterial contamination and then allowed to cool to room temperature before microalgae inoculation.The microalga was cultivated in two different growth mediums, namely Tris-Acetate-Phosphate (TAP) medium and Modified Bold 3N medium (3NBBM). To test whether this microalga prefers organic carbon or not, the first medium contains an organic carbon compound  was grown under continuous light  in 50\u00a0ml of modified Bold\u2019s 3N medium   . The Erlnt light . Then, b2 bio-fixation rate can be measured using the equation of the reference . The harvested samples were dried in the drying oven at 60\u00b0C for 24\u00a0h. The dried biomass samples were weighted (0.75\u20131.5\u00a0mg) in clean tin capsules . The capsules were then heated to 975\u00b0C using oxygen gas as the combustion gas feed and helium gas as the purging gas in a furnace. The instrument was calibrated with different criteria of \u00b13.75 for hydrogen, \u00b10.15 for carbon and \u00b10.16 for nitrogen. Furthermore, the oxygen content was found by difference.C, H, N, O, and S represent carbon, hydrogen, nitrogen, oxygen, and sulfur contents, respectively.The higher heating value (HHV) was calculated from the equation of reference .HHV\u00a0 are 1.01 \u00b1 0.05, 1.10 \u00b1 0.07, and 0.98 \u00b1 0.08 for control, 0.1 and 0.2% glucose, respectively. For the same supplementation concentration and conditions, Chlamydomonas reinhardtii, strain CC1010 , Friedman (61.7\u2013287\u00a0kJ/mol), Popescu (66.4\u2013255\u00a0kJ/mol) and KAS (35.0\u2013262\u00a0kJ/mol), respectively. The estimated values of activation energies from different models at multiple heating rates of 5, 10 and 20\u00b0C/min are in close agreement with each other and agree with the reported literature. (Parachlorella kessleri HY-6 using KAS and Friedman methods as 241.91 (\u00b153.05) kJ/mol and 253.54 (\u00b158.81) kJ/mol, respectively. In another study, the authors calculated activation energy for Spirulina pyrolysis using KAS method in the range of 160\u2013335\u00a0kJ/mol . A slight decrease in the activation energy value was observed at conversion rates of 0.4\u20130.6, which showed cellulose decomposition in the temperature range (326\u00b0C\u2013393\u00b0C). Pyrolytic degradation of lipid compounds required higher activation energy values conversion rates of 0.6\u20130.9, in a higher temperature range of 377\u00b0C\u2013484\u00b0C . Similar\u22121. \u2206G refers to the increase in the energy of the system towards an equilibrium by forming activated complex. \u0394G values range from (61.2\u2013250\u00a0kJ/mol), (168\u2013384\u00a0kJ/mol), (176\u2013214\u00a0kJ/mol), and (121\u2013162\u00a0kJ/mol) for the Popescu, KAS, FWO, and Friedman methods, respectively. These \u0394G values indicate the increase in total energy available in G. pectorale pyrolysis and the formation of an activated complex. Furthermore, these values are higher compared to the values of waste red peppers (139.0\u00a0kJ/mol)   and rice\u00a0kJ/mol) . \u2206S indi correct .G. pectorale under slow pyrolytic conditions with three different heating rates. At 10 and 20\u00b0C/min, the heating rates yielded near-straight lines that fit the experimental curve. However, at 5\u00b0C/min, the line produced differs from the experimental curve.MLP based ANN regression models were trained and five better performing models were retained. The most suitable model was selected on the basis of the highest correlation coefficient and lowest sum of squared errors during training, testing and validation of the data sets. The structure of the best performing network at different heating rates was MLP 4-10-1. MLP based ANN model containing 10 hidden layers with exponential function in the hidden layers and sine function in the output layer returned excellent correlation coefficient. MLP 4-10-1 was therefore used to understand the microalgae biomass conversion process through pyrolysis. The BFGS algorithm for the said model reached optimal outcomes after 62 cycles.The regression graph in 2 value reached to 0.999. MLP based ANN performed better than ANN results reported in a recent study on the thermal degradation of green river shale , derivative thermogravimetric analysis (DTG), and elemental analysis to estimate its energy content. Growth was carried out under different culture conditions in two different media, reporting the highest biomass productivity, and the CO2 fixation rate was obtained from TAP culture and 3NBBM with a concentration of 2% CO2, respectively. The highest biomass concentration achieved after 14\u00a0days of cultivation was 1.08\u00a0g/L. As a result, TAP is considered a better medium compared to 3NBBM for the cultivation of G. pectorale. This shows that G. pectorale prefers organic carbon over inorganic carbon (CO2). TG-DTG curves at 5, 10, and 20\u00b0C/min indicated the presence of multiple peaks and active pyrolysis zones due to the multicomponent biomass of microalgae . In addition, the kinetics of G. pectorale was studied using model-free and model-fitting methods. The predicted activation energy values of the Friedman, FWO, KAS and Popescu models indicated excellent agreement with the experimental values (R2 > 0.96). The higher values of 200\u00a0kJ/mol of Ea obtained suggest that algal lipids are more difficult to decompose in the N2 atmosphere. Moreover, it was found that the most probable reaction mechanism for the pyrolysis of G. pectorale was the third-order function. Also, the F3 model-fitting method gave a good prediction. The study showed the effectiveness of MLP based ANN regression model for the prediction of activation energy at different heating rates. Further investigations must be conducted on the heterotrophic and mixotrophic cultivation using different organic molecules for lipids production. Detailed characterization of the strain with respect to its biomolecules is also recommended. As this microalga showed a preference for organic carbon, it is recommended to use this strain for treatment of high organic load wastewater."}
+{"text": "HD volunteers showed increased T-cell counts, higher CD4/CD8 ratio, and expanded na\u00efve T-cell population compared with patients with multiple myeloma. After anti-BCMA CAR T-cell production, patients with relapsed multiple myeloma had lower frequencies of CAR+ T cells, decreased central memory phenotype, and increased checkpoint inhibitory markers compared with HD-derived products, which compromised their expansion and cytotoxicity against multiple myeloma cells in vitro. Importantly, HD-derived CAR T cells efficiently killed primary multiple myeloma cells within the BM microenvironment of different multiple myeloma genomic subgroups and their cytotoxic activity could be boosted with gamma secretase inhibitors. In conclusion, allogeneic anti-BCMA CAR T cells are a potential therapeutic strategy for patients with relapsed multiple myeloma and should be further developed in the clinic.Multiple myeloma remains an incurable plasma cell malignancy despite the rapidly evolving treatment landscape. Chimeric antigen receptor T cells targeted against BCMA have recently shown great promise in relapsed refractory multiple myeloma; however, all patients ultimately still progress from their disease. Lack of CAR T-cell persistence, impaired T-cell fitness in autologous CAR T-cell products and the presence of an immunosuppressive bone marrow (BM) microenvironment are contributory factors to treatment failure. We generated anti-BCMA CAR T cells from healthy donors (HD) and patients with multiple myeloma at different stages of disease to compare their T-cell profile, fitness, and cytotoxic activity in preclinical studies. We also used an Multiple myeloma is an incurable cancer of the plasma cells. A new therapy with anti-BCMA CAR T cells \u2014 the patient's own T cells genetically engineered to find and kill myeloma cancer cells \u2014 has shown encouraging results. Unfortunately, patients still relapse. In this study, we propose to use T cells from HD volunteers, which have a stronger T-cell fitness, higher cancer killing capacity, and are ready to be administered when needed. Multiple myeloma is a plasma cell malignancy with a heterogeneous genomic profile that remains incurable despite the use of therapies such as alkylating agents, proteasome inhibitors, immunomodulatory drugs, and anti-CD38\u2013targeted mAbs . Whilst Chimeric antigen receptor (CAR) T cells have recently emerged as a very promising therapeutic strategy in cancer with anti-CD19 CAR T cells now approved for the treatment of relapsed diffuse large B-cell lymphoma, mantle cell lymphoma, and pediatric/young adult B-cell acute lymphoblastic leukemia . The maiWhile the mechanisms of CAR T-cell resistance in multiple myeloma are still under investigation , downregIn this study, we compared the T-cell profile and activity of anti-BCMA CAR T cells derived from HDs with those generated from patients with multiple myeloma of different genomic subtypes and disease stages, including patients who were eligible for CAR T-cell clinical trials. The cytotoxicity of anti-BCMA CAR T cells was evaluated in primary bone marrow (BM) cultures from patients with multiple myeloma enabling the potential immunosuppressive effects of the BM microenvironment to be explored. In addition, the effects of enhancing BCMA expression, using a gamma secretase inhibitor (GSI), on CAR T-cell cytotoxicity were investigated.Peripheral blood and BM samples from HD volunteers and patients with multiple myeloma were obtained from the Haemato-Oncology Tissue Bank at King's College London under the terms of the research ethics protocol reference HR-17/18\u20135515 in accordance with the Declaration of Helsinki and after approval by an institutional review board and with the Human Tissue Authority license number 12223. Written informed consent forms were signed by all the patients prior to sample collection.Peripheral blood mononuclear cells (PBMC) were isolated using Histopaque 1077 density gradient media  and centrifuged at 2,000 rpm for 30 minutes without any brake. PBMCs present in the cellular buffy coat were collected, washed twice with sterile PBS, and frozen down for future processing and analysis.On day 0 of production, PBMC samples were thawed and T cells isolated using the EasySep Human T Cell Enrichment Kit . Enriched T cells were plated in complete X-Vivo 15 media , supplemented with recombinant human IL2 IS premium grade  and activated with human magnetic CD3/CD28 beads . After 48 hours, activated T cells were transduced with a lentiviral construct encoding the BCMA-5 R2 CAR , anti-CD38 FITC , anti-TIM3 PerCP-Cy5.5 , anti-CD4 Pacific Blue , anti-CD45RO Brilliant Violet 605 , anti-TIGIT Brilliant Violet 605 , anti-PD1 Brilliant Violet 650 , anti-CD3 Brilliant Violet 711 , anti-CD101 PE , anti-LAG3 PE Dazzle , anti-CD62 L PE Dazzle , anti-CD8 PE-Cy7 , and the anti-BCMA CAR idiotype APC (Allogene Therapeutics). T cells were then washed with PBS and stained with the e780 fixable viability dye  for 30 minutes at 4\u00b0C. All the samples were fixed using BD stabilizing fixative  for further FACS analysis.l-glutamine) and stored in the tissue culture incubator at 37\u00b0C, 5% CO2. Overall cell viability and multiple myeloma cell percentage were then measured by FACS as described below. BM samples were always used fresh and the available volume varied from sample to sample, which limited the number of samples used in specific assays.Fresh BM samples were transferred into 50 mL Falcon tubes and incubated with Pharm lysis buffer  for 15 minutes at room temperature. The samples were then centrifuged and washed twice with sterile PBS, before passing through a 100-\u03bcm mesh (Miltenyi Biotec). The samples were then incubated in RPMI1640 complete media , anti-BCMA PE , anti-CD19 PE-Cy7 , anti-CD138 APC , and anti-CD38 APC-Cy7 , and anti-CD45 FITC . The samples were incubated with e450 Viability Dye  and fixed using the BD stabilizing fixative for further FACS analysis.On the basis of the number of multiple myeloma primary cells present in each BM sample, HD-derived anti-BCMA CAR T cells or UT cells were cocultured with BM at effector:target (E:T) ratios of 10:1, 5:1, 2.5:1, and 1:1, in RPMI1640 complete media. BM on its own was used to quantify the spontaneous multiple myeloma cell lysis. The human acute lymphocytic leukemia cell line REH and the BCMA-expressing isogenic cell line (REH-BCMA) were used as negative and positive controls respectively. After 4 hours of coculture, samples were stained with the multiple myeloma antibody panel as described above. For the combination studies, the GSI PF-03084014 hydrobromide  was used. The BM samples were pretreated with the GSI drug for 1 hour at 37\u00b0C before anti-BCMA CAR T cells or UT cells were added to the cocultures.Mycoplasma using the EZ-PCR Mycoplasma Test Kit . On days 0 and 4, the T cells were challenged with U266 multiple myeloma cells at an E:T ratio of 1:10. On day 8, cocultures were collected and stained with the multiple myeloma antibody panel before further analysis of U266 cell viability and T-cell expansion by FACS.Anti-BCMA CAR T cells and UT cells produced from HD volunteers and patients with late relapsed multiple myeloma were thawed and incubated overnight in complete RPMI1640 media supplemented with human IL2 IS premium grade . The human multiple myeloma cell line U266 was kindly supplied by Dr. Kwee Yong from University College of London  in May 2017. FISH has been conducted to confirm U266 myeloma karyotype. No further cell line authentication has been performed. The cell line was thawed and maintained in culture for a maximum period of 24 passages and tested regularly for Samples were run on a BD Flow Cytometer  using the BD FACSDiva software  for data acquisition. FlowJo v10.7 software  was used for FACS data analysis and GraphPad Prism 8  was used for data presentation and statistical analysis.pos/CD38high, CD38high/CD45low and CD56/CD19neg. The anti-BCMA CAR T-cell killing percentage was quantified as: [(% multiple myeloma cell lysis cocultured with anti-BCMA CAR T cells \u2212 % multiple myeloma cell lysis cocultured with UT cells)/% spontaneous multiple myeloma cell lysis].Multiple myeloma primary cells present in patient BM samples were identified using the following gating strategy: side scatter/CD45, CD138The data generated in this study are available upon request from the corresponding author.n = 8), and late relapsed multiple myeloma . Details of treatment regimens received by patients with relapsed multiple myeloma are shown in PBMCs were collected from 9 HDs and 16 patients with multiple myeloma, their immune profile assessed by flow cytometry and the antitumor efficacy of anti-BCMA CAR T-cell products generated from them compared. The median age of HDs was 26.7 years in contrast with 61.3 years for patients with multiple myeloma . Patient4 PBMCs compared with 2,898 \u00b1 853, 1,945 \u00b1 416 and 2,190 \u00b1 552 T cells per 104 PBMCs (P < 0.005) for patients with newly diagnosed multiple myeloma, early relapsed multiple myeloma, and late relapsed multiple myeloma, respectively, as shown in P < 0.005; Following PBMC isolation, HD volunteers had the highest T-cell counts with a mean of 4,993 \u00b1 523 T cells per 10P < 0.05) or patients with relapsed multiple myeloma  in HDs (17.5 \u00b1 2.8%) compared with newly diagnosed multiple myeloma  or patients with relapsed multiple myeloma . No significant differences were seen in the percentages of central memory (CM) or effector memory (EM) T cells between the different groups. Analysis of the CD8 T-cell population (P < 0.05) with no significant differences for the other T-cell populations.T-cell memory phenotype, a surrogate marker of T-cell fitness , was chapulation  also shoP < 0.05), although CAR expression as measured by mean fluorescence intensity (MFI) was similar between the different groups (P < 0.05) which may have an impact on their cytotoxic capacity. The proportions of stem cell memory, effector memory, and effector cells did not appear to be significantly different between HD, newly diagnosed multiple myeloma and relapsed multiple myeloma CAR T-cell products . Coexpression of immune checkpoints on T cells was also compared between HD and late relapsed multiple myeloma CAR T-cell products. Trends toward higher double positivity were noted, only achieving significance for PD-1+LAG3+ cells (46.57 \u00b1 5.1%) in late relapsed multiple myeloma compared with HD CAR T cells  and greater expansion against U266 cells , the specific tumor lysis of HD-derived anti-BMCA CAR T cells ranged from 6.9% to 72.8%  between BM samples shown to have low versus high tumor lysis , ranged from 121 to 1,184 with a median of 549 . No direTreatment with autologous anti-BCMA CAR T cells results in high overall response rates and deep remissions in relapsed refractory MM with a median duration of response between 8.8 and 22 months . Impairein vivo  and CD52 genes to prevent graft-versus-host disease and allow the use of an anti-CD52 antibody as part of lymphodepletion to prevent CAR T-cell rejection, respectively (TCRKO/CD52KO HD-derived anti-BCMA CAR T cells (ALLO-715) in patients with multiple myeloma, there was evidence of CAR expansion in blood and encouraging clinical responses (NCT04093596)  in relapsed refractory B-acute lymphoblastic leukemia demonstrated significant CAR expansion and impressive clinical responses  . TCRKO H T cells . Furtheresponses  supportiesponses . Graft-vin vitro, we evaluated the efficacy of HD-derived anti-BCMA CAR T cells in a clinically relevant model using ex vivo whole BM biopsies from patients with multiple myeloma, to take into account the genomic complexity and immunosuppressive cellular environment seen in these patients. We showed that HD-derived anti-BCMA CAR T cells specifically target multiple myeloma primary cells ex vivo demonstrating activity against primary multiple myeloma cells with a range of different genomic abnormalities. No differences were seen among the genomic risk subgroups, which corroborates what has been described across anti-BCMA CAR T-cell clinical trials (Another important factor that may contribute to multiple myeloma relapse is the presence of multiple myeloma niches within the immunosuppressive environment of the BM. Multiple myeloma cells are known to be highly dependent on the BM microenvironment and the physical interaction between multiple myeloma cells and BM cells is known to promote cancer resistance against different therapeutics . Having l trials . With thl trials .ex vivo BM model, we explored whether the presence of other BM microenvironmental cells affects anti-BCMA CAR T-cell activity. An interesting observation in our study was the finding of significantly higher granulocyte numbers in BM samples where low CAR T-cell cytotoxicity was seen compared with BM samples with high cytotoxicity, although a direct correlation between granulocyte numbers and cytotoxicity was not observed. Neutrophils, a subset of granulocytes, have been associated with cancer progression, metastasis, and poor prognosis in solid tumors (Taking advantage of our d tumors . Tumor-ad tumors , and a dd tumors . In addid tumors . FurtherBCMA gene (ex vivo BM assay, combination treatment of multiple myeloma with allogeneic anti-BCMA CAR T cells and a GSI in an attempt to transiently increase BCMA expression at the cell surface of multiple myeloma cells and make them more amenable to targeting by CAR T cells. With this strategy we were able to show upregulation of BCMA expression on primary multiple myeloma cells in a majority of samples and, importantly, higher cytotoxicity. This combination strategy has been used by others in the context of autologous anti-BCMA CAR T cells (ref. BCMA loss has also been shown to be a mechanism of relapse post anti-BCMA CAR T-cell therapy due to clonal selection of low antigen\u2013expressing cells, allelic deletion or mutations of the CMA gene . BCMA exCMA gene . We invein vitro activity compared with relapsed multiple myeloma\u2013derived CAR T cells. Our data lend support to the use of allogeneic HD CAR T cells as an alternative therapeutic option especially for patients with relapsed multiple myeloma with poor T-cell counts following multiple lines of treatment and in the setting of autologous CAR T-cell manufacturing failure. Clinical trials with allogeneic anti-BCMA CAR T cells in relapsed multiple myeloma are ongoing.In summary, we have shown that HD-derived anti-BCMA CAR T cells have a distinct immune phenotype and superior long-term"}
+{"text": "Multiple myeloma is the most prevalent hematological cancer, and further treatments for this disease are required. Despite progress in the development of treatment regimens, multiple myeloma is still an incurable disease because of its poor response to therapy and high rate of resistance to treatment. However, anti-BCMA (B-cell maturation antigen) has shown promise in the treatment of multiple myeloma, and it may have the potential to be a new first-line treatment for patients. Thus, in this review, we objectively discussed the treatment potential of anti-BCMA, its mechanisms, and its future clinical implications for multiple myeloma patients.Over the past few decades, treatment options have become more advanced for multiple myeloma (MM), one of the most prevalent hematological cancers; however, multiple myeloma remains an incurable disease due to its poor response to therapy and high rates of resistance, which cause relapsed/refractory or multiple myeloma. Researchers have described anti-BCMA (B-cell maturation antigen) as a promising treatment regimen that targets the BCMA biomarker in the affected plasma cells. BCMA is a protein that is specifically expressed in plasma-cell neoplasms by using several mechanisms, such as CAR T cells (Chimeric Antigen Receptor T cells), antibody-drug conjugates, and bispecific T-cell engagers, thus allowing for a rapid response in the treatment of resistant or relapsed/refractory multiple myeloma patients. Anti-BCMA treatment is novel and specific in its mechanisms of action, with noninferior complete responses, higher overall survival rates, and fewer reported adverse events compared to other currently available treatment of MM. In this review, we compared anti-BCMA mechanisms with those of previously available therapies, such as those using immunomodulators and proteasome inhibitors, and discussed the advantages of using anti-BCMA as a potential first-line treatment for multiple myeloma patients. Multiple myeloma, a proliferative clonal plasma-cell neoplasm, is one of the most prevalent hematological cancers in the world ,2,3. DueThe treatment modalities of multiple myeloma have advanced over the past four decades, especially because the use of proteasome and histone deacetylase inhibitors, immunomodulatory imide drugs, and monoclonal antibodies has been approved ,5, whichDespite advancements in therapy, multiple myeloma remains an incurable disease due to its high rates of resistance to treatment, which can result in relapsed/refractory multiple myeloma ,4,5. ThePatients younger than 65 years can be eligible for a stem cell transplant, which decreases early mortality rates in the three years after diagnosis, produces a longer duration of complete response, and decreases relapse rates compared with chemotherapies . HoweverNovel approaches to multiple myeloma therapy are still needed to provide better treatment responses and decrease morbidity and resistance to therapy in long-term use. A potential target molecular biomarker for MM therapy is the B-cell maturation antigen (BCMA), which is expressed in normal mature B cells and not in other tissues, overly expressed in multiple myeloma, and plays a role in disease severity, progression, and relapse ,5,6. PreTherefore, we conducted a thorough literature review to provide better comparisons between the potential of BCMA-targeted and standard therapy, especially in their mechanisms of action, clinical efficacy, and safety.Multiple myeloma is characterized by an abnormal increase in monoclonal antibodies. It is the second most prevalent hematological cancer in the world, with an incidence of 1.8 cases per 100,000 persons and a mortality rate of 1.1 per 100,000 persons due to its specific end-organ damage ,3. In soThe etiology of multiple myeloma is possibly genetic abnormalities in oncogenes  associated with other external factors ; however, its exact causes are still unknown. Differences in molecular and genomic profiles exist in the tumor clones of MM. Hypodiploidy and 14q32 translocations are two of the most commonly observed cytogenetic abnormalities in MM. The affected chromosome contains \u03bb light-chain regions and \u03ba light-chain genes [Cytogenetic abnormality during an immune response to abnormal antigenic challenge results in abnormal asymptomatic premalignant clonal plasma-cell growth and monoclonal antibody production, termed monoclonal gammopathy of undetermined significance (MGUS) ,10. NextSix classes of pharmacological therapy are currently available for the treatment of MM, namely, proteasome  and histone deacetylase inhibitors (panobinostat), monoclonal antibodies (daratumumab and elotuzumab), immunomodulatory drugs , DNA-alkylating agents, and glucocorticosteroids . Mono orBCMA is a transmembrane glycoprotein expressed on normal B cells and is abundantly found in malignant plasma cells. It is a 184-amino-acid chain with a conserved pattern of six cysteines in the extracellular N terminus, and it is encoded by a 2.92 kb TNFRSF17 gene in the short arm of chromosome 16 (16p13.13) . BCMA isThe superiority of BCMA compared with other TNFR superfamily members (BAFF and TACI) lies in its specificity in expression: it is only expressed on plasmablasts and plasma cells ,14. MemoThe results of previous studies have also shown the potential of BCMA in monitoring disease progression, treatment response, and the prognostication of MM. Regarding disease progression, a linear increase in BCMA levels was observed during its progression from MGUS and SMM to overt MM . SolubleB-cell maturation antigen (BCMA) is one of the promising targets for immunotherapy in the management of relapsed/refractory multiple myeloma. Researchers have hailed BCMA (tumor necrosis factor receptor superfamily member 17 (encoded by the TNFRSF17 gene)) as one of the most prominent factors in the survival of B cells, alongside the commonly used B-cell-activating factor receptor (BAFF-R) and the responsible proliferation-inducing ligand (APRIL). Early trials of the role of BCMA were conducted in vivo, where the overexpression of BCMA in MM cell lines activated the protein kinase pathway, which led to a promotion in MM-cell growth. An overexpression of BCMA levels in MM cell lines also positively correlated with its interactions with factors involved in cell proliferation. In a study of the KMS12 MM cell line, BCMA co-immunoprecipitated with interferon regulatory factor 4, which mediates cell survival. APRIL and BAFF also promoted cell growth and survival when binding with BCMA and the transmembrane and cyclophilin ligand activators and calcium modulator (TACI), which further activated the NF\u03baB pathways and increased the expression of antiapoptotic proteins  that protect the MM cells from serum-deprivation-induced cell death and dexamethasone. Both APRIL and BAFF are critical factors in the survival of plasma cells in multiple myeloma because their levels considerably increase in both ligands and receptors in MM patients compared with normal subjects. Thus, creating novel therapies that target BCMA and the influential factors it interacts with are useful developments in treating multiple myeloma .The growing awareness of the BAFF/APRIL/BCMA axis has popularized BCMA as one of the major targets in the management of multiple myeloma. Three main immunotherapy treatments now exist, namely, antibody-conjugated drugs (ACD), the bispecific T-cell engager (BiTE) or the anti-BCMA antibody, and chimeric antigen receptor (CAR) T-cell therapies, as shown in BCMA-ADC is mainly used to enhance antibody-dependent cellular toxicity (ADCC). Binding BCMA-ADC to the BCMA receptor disrupts BAFF and APRIL signaling, which consequently decreases the number of NF\u03baB pathways and the expression of anti-apoptotic proteins. Antibody-drug conjugates also bind with FcyIIa receptors in natural killer (NK) cells, inducing ADCC, which directly causes MM cell apoptosis. Belantamab mafodotin (GSK2857916), which works by being coupled to the microtubule inhibitor monomethylauristatin F (MMAF) using the protease-resistant maleimidocaproyl linker, is the most prominent type of ADC used. MMAF is a byproduct of the monoclonal antibody backbone of the drug after it is proteolytically degraded upon exposure to lysosomes released from MM cells undergoing ADCC-induced apoptosis. MMAF is then able to bind with tubulin in MM cells, which is involved in the assembly of microtubules, halting the G2/M checkpoint of the cell cycle and preventing the proliferation of MM cells ,20.Clinicians have used T-cell-based antibody therapy in recent years, including T-cell-engaging bispecific antibodies (T-BsAbs) or BiTEs. BiTEs use a dual-targeting antibody mechanism to enable each arm of the antibody to bind to another receptor. The mechanism of action involves one arm of the antibody binding to the CD3 coreceptor complex on T cells, while the other arm binds to the tumor cells through the tumor-associated antigen, namely, BCMA. The binding of the T cell produces the cytolytic-initiating protein (perforin) to induce the cytotoxicity process, which produces transmembrane pores on the tumor cells to initiate apoptosis ,20.CAR T cells are also therapeutic agents that use the T cell-based antibody mechanism. In recent years, the use of CAR T cells has increased in cancer immunotherapies, including in the treatment of multiple myeloma. The manufacturing of CAR T cells involves the use of adoptive cell transfer (ACT) to convert patient-derived cytotoxic T cells into specific killers of cancer cells. Patient-derived cytotoxic T cells become CAR T cells when they undergo recombinant DNA mutation, so that they express a chimeric receptor against the antigens of targeted cancer cells. The single-chain variable fragment (ScFv) on the CAR T cells\u2019 chimeric receptor is specific to BCMA, which enables its binding only to BCMA-expressing plasma cells, leading to the activation of the CAR T cells and the release of cytotoxic cytokines that target the MM cells to which they bind .CAR T cells are commonly used in the management of multiple myeloma; however, the therapy itself, due to the limited quantities of trial results, is now being used as a fourth-line treatment for relapsed/refractory multiple myeloma. In particular, monoclonal antibodies or ADC are only provided if the patient is considered unresponsive to chemotherapy . ResearcWe highlight the potential of anti-BCMA therapy through a comparison with the mechanisms of other therapies for multiple myeloma, as described in Regarding the mechanisms of action in other classes, proteasome inhibitors induce malignant plasma cell death through the inhibition of NF\u03baB-signaling pathways, especially by preventing the degradation of the kappa B (I\u03baB\u03b1) inhibitor in proteasomes, which leads to the failure of p50/p65 NFkB transcription-factor activation and its translocation to the nucleus ,22. ProtImmunomodulators act by reversing the immunoparesis caused by MM, enhancing the adaptive immune response targeting cancer cells . ImmunomMonoclonal antibodies act through their identification of various antigens, usually specific proteins expressed by malignant cells, and induce cell death through direct cytotoxic effects and cellular cytotoxicity mediated by antibodies (ADCC) and complements (CDC) ,29. DaraCompared with the proteasome inhibitors, immunomodulators, and other monoclonal antibodies mentioned above, the novelty of anti-BCMA lies in its specificity toward target antigens in target cells and in its more direct response toward plasma cells. This is because anti-BCMA has a mechanism that targets BCMA on the surface of malignant plasma cells while also binding to other immune effectors to provide a direct response and induce cellular death. It takes a different approach compared with other multiple myeloma therapies, such as proteasome inhibitors, which work on modulating the endoplasmic reticulum of the MM cells; immunomodulators (IMIDs), which modulate T cells; NK cells, which identify MM cells; or other drugs, such as daratumumab, which causes MM cells to be easily recognized by immune cells. Furthermore, anti-BCMA targets an earlier phase of MM pathogenesis before the activation of the NF\u03baB-signaling pathway. Depending on the type of anti-BCMA, the reaction of the targeted pathway varies from direct cytotoxicity to the stimulation of a cancer-specific immune response, providing more alternatives to battle the mechanisms of drug resistance.The use of anti-BCMA in the management of multiple myeloma has been incorporated into the current guidelines, which entail the use of this treatment, combined with the nonresponsive use of triple therapy beforehand, for relapsed/refractory multiple myeloma . Trials In the clinical trial utilizing monoclonal antibodies or ADC, belantamab mafodotin showed a considerably high overall response rate (60%) in phase 1. In phase 2 (DREAMM-2), different doses of belantamab mafodotin were compared (2.5 vs. 3.4 mg/kg) and produced an overall response rate of 31% and 34%, respectively, which showed the limited effectivity of the drug. The drug also increased the rates of adverse events in the subjects, who reported keratopathy (27%), thrombocytopenia (20%), anemia (20\u201347%), and corneal events (blurry vision and dry eyes) . BelantaTrials using bispecific antibodies on T cells, with an overall response rate of 70% and a median response time of one month, reported the use of AMG420 with a recommended dose of 400 ug/kg as an effective bispecific antibody for BCMA and CD3. However, serious adverse events, such as polyneuropathy and cytokine-release syndrome, hospitalized 18 patients (out of 42), and the researchers also reported patients suffering from edema . AnotherOn the development of CAR T cells as an anti-BCMA, several therapies showed considerable efficacy in the early phases of clinical trials. While some had similarities, most of the CAR T cells differed because of the costimulatory domains and species used to generate the anti-BCMA domain on the T cell. The recorded overall response rate ranged from 48% to 86%, which showed the considerable effectivity of CAR T cells in the treatment of patients; furthermore, while several adverse effects were reported (mostly neuro- and nephrotoxicity), no serious complications were reported as related to the therapy itself. The CAR T cells currently being evaluated in clinical trials can be further classified into various CAR T products ,38,39,406 cells [The classical anti-BCMA CAR T cells are commonly represented by bb2121, which contains an anti-BCMA single-chain fragment, a CD8 hinge, and transmembrane domains, which consist of a single transduction region composed of a CD3 chain and the costimulatory molecule 4-1BB . The tri6 cells . In thes6 cells ,38,39,40CAR T cells can also be classified as bispecific anti-BCMA CAR-T products, which means that they can modify T cells, with one CAR molecule containing two distinct binding domains that commonly target both BCMA and APRIL receptors. The products under development are APRIL-based CAR, such as ACAR, TriPRIL CARm, and LCAR-B38M CAR T cells (bi-epitope anti-BCMA CAR-T cells). Bispecific CAR T cells showed an improvement in the complete response rate (68% complete response with LCAR-B38M) . The dua6 [The currently developed humanized CAR T cells, such as anti-BCMA CD19 and MCARH171 (human-derived CAR T cells), have also undergone phase-1 clinical trials. The overall response rate was 64%, with CRS observed in 6/11 patients and 1 diagnosed with encephalopathy. A dose\u2013response relationship was also evaluated, with promising clinical efficacy for CAR T cells at dose levels \u2265 450 \u00d7 106 ,44.The use of anti-BCMA has shown considerable efficacy in the management of multiple myeloma, while the monotherapy of CAR T cells has shown low complete response rates; however, the therapy has the potential to be used in combination with another immunotherapy available for multiple myeloma. Although no direct comparison was made between the use of anti-BCMA and the usual regimen of multiple myeloma, the regimen using rituximab, lenalidomide, and bendamustine showed a complete response rate of 64%, which was higher compared with anti-BCMA . HoweverThe expression of BCMA in MM cells highlights the potential for improvements in diagnosis, disease prognosis, and treatment\u2013response control. Anti-BCMA could provide an alternative therapy for MM and alleviate the current challenges posed by inadequate treatment response and disease treatment intolerance and resistance. We showed anti-BCMA to be novel and specific in its mechanism of action and found it to produce a noninferior complete response and an improvement in overall survival rates, as well as a decrease in the numbers of reported adverse events. Based on our review, we determined that anti-BCMA has the potential to be used as a combination therapy in conjunction with currently available therapy, for both initial MM and RRMM."}
+{"text": "Measuring vital signs plays a key role in both patient care and wellness, but can be challenging outside of medical settings due to the lack of specialized equipment.In this study, we prospectively evaluated smartphone camera-based techniques for measuring heart rate (HR) and respiratory rate (RR) for consumer wellness use. HR was measured by placing the finger over the rear-facing camera, while RR was measured via a video of the participants sitting still in front of the front-facing camera.In the HR study of 95 participants (with a protocol that included both measurements at rest and post exercise), the mean absolute percent error (MAPE)\u2009\u00b1\u2009standard deviation of the measurement was 1.6% \u00b1 4.3%, which was significantly lower than the pre-specified goal of 5%. No significant differences in the MAPE were present across colorimeter-measured skin-tone subgroups: 1.8% \u00b1 4.5% for very light to intermediate, 1.3% \u00b1 3.3% for tan and brown, and 1.8% \u00b1 4.9% for dark. In the RR study of 50 participants, the mean absolute error (MAE) was 0.78\u2009\u00b1\u20090.61 breaths/min, which was significantly lower than the pre-specified goal of 3 breaths/min. The MAE was low in both healthy participants (0.70\u2009\u00b1\u20090.67 breaths/min), and participants with chronic respiratory conditions (0.80\u2009\u00b1\u20090.60 breaths/min).These results validate the accuracy of our smartphone camera-based techniques to measure HR and RR across a range of pre-defined subgroups. Accurate measurement of the number of times a heart beats per minute  and the number of breaths taken per minute  is usually undertaken using specialized equipment or training. We evaluated whether smartphone cameras could be used to measure HR and RR. We tested the accuracy of two computational approaches that determined HR and RR from the videos obtained using a smartphone. Changes in blood flow through the finger were used to determine HR; similar results were seen for people with different skin tones. Chest movements were used to determine RR; similar results were seen between people with and without chronic lung conditions. This study demonstrates that smartphones can be used to measure HR and RR accurately. Bae et al. prospectively evaluated smartphone camera-based techniques for measuring heart rate and respiratory rate. They found measurements were accurate across a range of pre-defined subgroups. In particular, the recent COVID-19 pandemic has accelerated trends towards telehealth and remote triage, diagnosis, and monitoring5. Although specialized devices are commercially available for consumers and have the potential to motivate healthy behaviors6, their cost and relatively low adoption limit general usage.Measurement of heart rate (HR) and respiratory rate (RR), two of the four cardinal vital signs\u2014HR, RR, body temperature, and blood pressure\u2014is the starting point of the physical assessment for both health and wellness. However, taking these standard measurements via a physical examination becomes challenging in telehealth, remote care, and consumer wellness settings7, up to 3.8 billion individuals already have access to a myriad of sensors and hardware  that are changing the way people interact with each other and their environments. A combination of these same sensors together with novel computer algorithms can be used to measure vital signs via consumer-grade smartphones12. Indeed, several such mobile applications (\u201capps\u201d) are available, some with hundreds of thousands of installs13. However, these apps seldom undergo rigorous clinical validation for accuracy and generalizability to important populations and patient subgroups.On the other hand, with smartphone penetration exceeding 40% globally and 80% in the United States14. In the second algorithm, we leverage upper-torso videos obtained via the front-facing smartphone camera to track the physical motion of breathing to measure RR. Herein, we describe both the details of the algorithms themselves and report on the performance of these two algorithms in prospective clinical validation studies. For the HR study, we sought to demonstrate reliable and consistent accuracy on diverse populations , whereas for the RR study, we aimed to demonstrate robust performance in subgroups with and without chronic respiratory conditions. This study confirms our smartphone camera-based techniques are accurate in measuring HR and RR across a range of predefined subgroups.In this work, we present and validate two algorithms that make use of smartphone cameras for vital sign measurements. The first algorithm leverages photoplethysmography (PPG) acquired using smartphone cameras for HR measurement. PPG signals are recorded by placing a finger over the camera lens, and the color changes captured in the video are used to determine the oscillation of blood volume after each heart beatWe conducted two separate prospective studies Table\u00a0 to valid15, ballistocardiographic movements from fingertips16, red-channel PPG from fingertip videos17, and the relationship between RGB channels18.Prior work in computer vision to extract heart rate from RGB (red-green-blue) video signals has leveraged manually extracted features in PPG signals from the finger for arrhythmia detection19. Our method simultaneously analyzes different ROIs to identify one with the greatest SNR.Our method estimates HR by optically measuring the PPG waveform from participants\u2019 fingertips and then extracting the dominant frequency. First, several rectangular regions of interest (ROI) were manually selected from the video frames (linear RGB at 15 frames per second and at a resolution of 640\u2009\u00d7\u2009480 pixels). The chosen ROIs were the full-frame, the left half, the right half, the top half, and the bottom half of the frames. Since camera pixels are illuminated non-homogeneously, signal strength can have spatial variations across pixels18. The pulsatile blood volume changes were present as the AC components in these smoothed signals. We then weighted the three RGB waveforms to predict a single PPG waveform  for each ROI.Pixels in each ROI were averaged per channel to reduce the effects of sensor and quantization noise, similar to prior workThe resulting PPG waveforms were bandpass filtered to remove low- and high-frequency noise unlikely to be valid HR. Filter cut-off frequencies corresponded to a low of 30 beats/min and a high of 360 beats/min. Next, large amplitude changes in PPGs due to motion were suppressed by limiting maximum allowed changes in amplitudes to 3\u00a0times of\u00a0the moving average value. Then, frequency-domain representations of PPGs were computed using the Fast Fourier Transform (FFT), from which we identified the dominant frequencies with maximum power. Because the PPG signals are periodic with multiple harmonics, the powers of the base frequencies were computed by summing the powers of their first, second, and third harmonics. SNRs were estimated for each ROI by computing the ratio between the power of the dominant frequency and the powers of non-dominant frequencies on a logarithmic scale. ROIs were filtered to only those with a SNR \u22650\u2009dB, and the dominant frequency of the ROI with the highest SNR was reported. If no such ROI existed, no HR was reported. Further details are provided in\u00a020; see Supplementary Table\u00a021, and that medical devices using optical sensors may be less accurate in those individuals24. Therefore, the darkest skin-tone subgroup was intentionally oversampled to ensure the algorithm\u2019s unbiased performance over various skin tones. Informed consent was obtained from all study participants in accordance with the tenets of the Declaration of Helsinki. The study protocol was approved by Advarra IRB . The clinical research site followed standard safety precautions for COVID-19 in accordance with the Centers for Disease Control and Prevention guidelines.We performed a prospective observational clinical validation study to assess the accuracy of the study algorithm in estimating HR in individuals of diverse skin tones  held directly over the study phone camera. Three of the 30-s episodes were collected at rest under various ambient brightness/lighting conditions: (1) with camera flash on and under normal ambient light, (2) with the flash off and under normal ambient light, and (3) with the flash off and under dim light. The fourth episode was collected post-exercise. In the original protocol, participants were instructed to ride a stationary bicycle for 30\u2009s as strenuously as possible against light to medium resistance. After enrolling 37 participants, the exercise protocol was modified (with an IRB amendment) to achieve higher participant HR: participants were encouraged to achieve 75% of their maximal HR, which was calculated by subtracting the participant\u2019s age from 220 beats/min. The exercise was completed either when the goal HR was achieved or when the participant asked to stop. The data were collected with the flash off and under normal ambient light. Lighting conditions were controlled using two overhead and one front light-emitting diode (LED) lights. The brightness level of the study environment was measured by a Lux meter  prior to each study. Measured brightness values were between 160 and 200 Lux for normal ambient light, and between 95 and 110 Lux for dim light.\u00ae , which is US Food and Drug Administration-cleared for fingertip measurement of pulse rate25. The measurements were conducted in accordance with the manufacturer\u2019s manual and taken at the end of each episode.The study was conducted using a mobile app deployed to a Pixel 3 smartphone running Android 10 . HR estimation using the app was generally completed by the study participants following the in-app instructions, with the coordinators providing feedback on usage when needed. The reference HR was measured simultaneously during each data collection episode using a Masimo MightySatEach participant contributed up to three HR measurements at rest (with different lighting conditions), and up to one post-exercise. Measurements were paired observations: the algorithm-estimated HR and the reference HR from the pulse oximeter. For each algorithm measurement, up to three tries were allowed, and the number of tries required was recorded. The baseline characteristics of the participants in whom a valid measurement for HR could not be obtained were compared to those of participants for whom a valid measurement was obtained using Fisher\u2019s exact test. A paired measurement was dropped if either the algorithm estimation or reference measurement failed. The absolute error of each paired measurement was calculated as the absolute value of the difference between the algorithm-estimated and reference HR values. The MAE was the mean value of all absolute errors. Similarly, the absolute error from each paired measurement was divided by the reference value for that measurement and multiplied by 100 to produce the absolute percentage error. The MAPE was the mean value for all absolute percent error values. The standard deviation of MAPE was calculated; no adjustment for multiple observations was made since the effects of clustering were negligible.26. We also computed the standard deviation and 95th percentiles. Sign tests were used to determine whether the absolute percentage errors were significantly <5%, both for the entire group of participants and the three skin-tone subgroups; data from individual data windows were analyzed separately. Bland\u2013Altman plots were used to visualize the agreement between the estimated values and the reference measurements and assess for any proportional bias 27. The mean differences were derived from the random-effects model considering the repeated measurement nature of the samples. For samples that did not follow a normal distribution based on a Shapiro-Wilk test, the 2.5th and 97.5th percentiles were provided as the limits of agreement. The subgroup analysis across the three skin-tone subgroups was pre-specified.The MAPE was the primary study outcome, as recommended by the current standards for HR monitoring devicesHR data collection was planned for ~100 participants. Enrollment up to a maximum of 150 participants was allowed as we anticipated that some enrolled participants would be excluded prior to contributing HR data because they failed to meet the required skin tone distribution or because they were not able to exercise. Requirements for participant enrollment termination included \u226560 paired HR measurements in the dark skin tone subgroup and \u226520% of the post-exercise reference HR >100 beats/min. The study hypothesis was that MAPE was <5% in all of the three skin-tone subgroups. To estimate the sample size required for the study, we first conducted an IRB-approved feasibility study with a different set of 55 participants and similar measurements both at rest and post-exercise. In that study, the MAPE\u2009\u00b1\u2009standard deviation was 0.91\u2009\u00b1\u20093.68%. Assuming double the mean and SD , a minimum of two paired measurements per participant, a skin-tone subgroup of ~25 participants, and some dropout from incomplete data, the power to detect a MAPE >5% was >0.8.29, tracking head motions31, estimating optical flow along image gradients32, or factorizing the vertical motion matrix33.Prior work in computer vision and sensors to extract RR from RGB video signals relied on changes in color intensities at specific anatomical points34 is used to obtain a set of face landmarks defining the contour of the face, and the bounding box for the face is computed from the face contour. Subsequently, an ROI around the upper torso is computed by extrapolating from the bounding box of the face. A simple extrapolation method that uses just constant coefficients was shown to be robust to variations in head and torso size. The height and width of the torso ROI is set to 1.4 and 2.5 times the face ROI height and width, respectively. At this point, the upper torso ROI is an RGB image. To attain a frame rate of 15 frames per second this RGB image is converted to a luma-only image and resampled to a size of 15k pixels while maintaining the same aspect ratio.Our contactless method estimates RR by performing motion analysis in an ROI of the video stream and requires that the face and upper torso be in the video frame. A previously described face detector35 that is particularly suited for analyzing subtle motions. In each video frame, the position at each pixel was represented by the phase of spatially localized sinusoids in multiple scales (frequencies). To aggregate the information across scales and to obtain an intuitive representation of motion, we then transformed the spatial phases into optical flow by linearly approximating the position implied by each phase coefficient and averaging across scales. Using the Halide high-performance image library36, we were able to speed up the phase and optical flow computation to achieve real-time processing (1\u20134\u2009ms per frame on Pixel 3a and Pixel 4 mobile devices).The main challenge was that variations in the video due to respiratory motions are hard to distinguish from noise. We build on Eulerian, phase-based motion processingIt turns out that for estimating the respiratory rate it is sufficient to analyze only the vertical component of the optical flow, so only the vertical component was processed in the subsequent steps. Ensembling was then used to improve the predictive performance. A spectral-spatial ensemble was built in the following way. The respiratory ROI, together with the four quadrants obtained by equally subdividing the ROI defined five regions over which the vertical component of the optical flow was averaged. This resulted in five respiratory waveforms. Next, frequency-domain representations for each of these respiratory waveforms were computed via FFT, from which power spectra were computed. The number of samples in the rolling FFT transform is 900 which provides sufficient resolution for the respiratory rate in the  breaths/min range at a video rate of 15 frames per second. The power spectra corresponding to the five regions were then aggregated (added) to obtain a final ensembled power spectrum. Bandpass-filtering was performed to remove low and high frequencies unlikely to represent valid RRs. Filter cut-off frequencies corresponded to a low of 6 breaths/min and a high of 60 breaths/min. The maximum power frequency and the corresponding SNR value were computed from the ensembled power spectrum. The waveform corresponding to the entire ROI is used for displaying the breathing pattern to the user in the mobile app.Often there was insufficient periodicity in the respiratory waveform . To increase the robustness of RR estimation, the algorithm falls back on a time-domain estimation method based on counting zero crossings of the waveform corresponding to the entire ROI whenever the SNR obtained via the FFT-based method was lower than a certain threshold. We tested two versions of the algorithm, differing only in terms of this threshold: SNR <\u22126.0\u2009dB (version A) and SNR <\u22124.0\u2009dB (version B). The higher value for the threshold in version B invoked the time-domain estimation method more often, which was hypothesized to improve accuracy by improving robustness to irregular breathing.We performed a prospective observational clinical validation study to assess the accuracy of the study algorithm in measuring the RR in healthy adults and patients with chronic respiratory conditions . The two algorithm versions (A and B) were tested sequentially. The participants followed the study protocol via instructions from the study app, without intervention from the study staff. Participants were prompted to prop the study phone on a table using provided common household items, such that the upper body was centered in the video capture . The mean of the two human-measured RRs rounded off to the nearest integer, was taken to be the reference RR.t-test.Each participant contributed a single pair of measurements for each algorithm version, and the MAE was used as the primary evaluation metric. The study hypothesis was that MAE would be <3 breaths/min. One-sample t-tests were done to determine whether the MAE was statistically significantly <3 breaths/min. A prespecified subgroup analysis was also performed, stratified by history of chronic respiratory conditions. In addition, post hoc subgroup analyses were performed for age and race/ethnicity subgroups. Bland\u2013Altman plots were used to analyze further for any trends in errors; for Bland\u2013Altman analyses of differences that were not normally distributed the limits of agreement were based on the 2.5th and 97.5th percentiles of the distribution. Differences between the two algorithm versions were compared using a paired To estimate the sample size required for the study, we first conducted an IRB-approved feasibility study with 80 healthy adults. Based on that MAE\u2009\u00b1\u2009standard deviation (0.96\u2009\u00b1\u20090.72 breaths/min), a sample size of 50 participants was estimated to provide a power of >0.99 to detect an MAE <3. The power was also >0.99 for both the subgroup of ten healthy participants and the subgroup of 40 with chronic respiratory conditions. If the MAE and standard deviation were doubled, the power would be >0.99, 0.71, and >0.99, respectively, for the full sample, healthy participants, and those with chronic respiratory conditions.The participants were surveyed about their experience using the app. The questions covered their ease of setting up the phone at the desired angle to capture their face/torso; the clarity of the instructions; their comfort in using the app to assess their general wellness; their comfort in teaching someone else how to use the app; and their expected comfort in using the app several times a day  in 361 cases (95.3%). The success rate increased with retries up to three times: 316 measurements 83.4%) were successful on the first try, another 31 measurements (cumulative 91.6%) on the second try, and another 14 measurements (cumulative 95.3%) on the third try. The baseline characteristics of the 14 participants for whom HR values were not successfully reported by the study app for at least one measurement (due to low SNR) did not differ significantly from the remaining participants . The MAPE showed a left-skewed distribution with a long tail . The MAPE by skin-tone subgroup was 1.77% for subgroup 1, 1.32% for subgroup 2, and 1.77% for subgroup 3. The MAPE values by skin-tone subgroups were all significantly <5% for each data window   of the overall study population was 1.63%. The MAPE values for all four data collection windows (including three at rest and one post-exercise measurement) were significantly lower than the prespecified study target of 5%  or asthma (Supplementary Table\u00a0p\u2009<\u20090.001 for both). Each subgroup also showed MAE values significantly lower than the threshold: algorithm version A, 0.60\u2009\u00b1\u20090.52 breaths/min (p\u2009<\u20090.001) for the healthy cohort and 0.90\u2009\u00b1\u20091.05 breaths/min (p\u2009<\u20090.001) for the cohort with chronic respiratory conditions; algorithm version B, 0.70\u2009\u00b1\u20090.67 breaths/min (p\u2009<\u20090.001) and 0.80\u2009\u00b1\u20090.60 breaths/min (p\u2009<\u20090.001), respectively. No statistically significant differences across age and race subgroups were seen  in the overall study population was 0.84\u2009\u00b1\u20090.97 and 0.78\u2009\u00b1\u20090.61 breaths/min for algorithm versions A and B, respectively Fig.\u00a0, which wp\u2009=\u20090.70).Figure\u00a0Supplementary Fig.\u00a0We report the results of two prospective clinical studies validating the performance of smartphone algorithms to estimate HR and RR. Both algorithms showed high accuracy compared to the reference standard vital sign measurements, with the mean MAPE for HR <2% and the mean MAE for RR <1 breaths/min (both significantly below the prespecified targets). In addition, the HR estimation was robust across the full range of skin tones, and the RR estimation generalized to participants with common chronic respiratory conditions: COPD and asthma.37. The accuracy of the HR algorithm in this study is especially notable. An MAE less than 5 beats/min or a MAPE less than 10% are standard accuracy thresholds for HR monitors39. The MAE of 1.32 beats/min in HR is lower than that reported for smartphone apps (2.0 to 8.1 beats/min)37 and for contemporary wearable devices (4.4 to 10.2 beats/min at rest)40, albeit with several differences in study design and population. The MAPE of 1.63% is comparable to the performance of current wearable devices. Shcherbina et al. tested six wrist-worn devices and reported a median error <5% for each across various activities and a median error of 2.0% for the best-performing device41. Because skin tone can be a potential source of bias in medical devices24, and the accuracy of PPG-based HR estimation can be affected by melanin\u2019s light-absorbing property42, we enrolled participants with diverse skin tones to validate the robustness of our HR estimation algorithm across skin tones.Only a limited number of previous smartphone apps have undergone clinical evaluation for HR measurement43. For consumer-grade RR monitoring devices, there is no well-accepted accuracy standard26. Our MAE of 0.78 breaths/min is comparable to that of professional healthcare devices, which have reported accuracy of \u00b12\u20133 breaths/min47. One important strength of our approach is determining RR from direct measurement of respiratory motion, rather than trying to derive RR from the variation of PPG-based interbeat interval, which has limitations. The MAE found in this study could be a helpful reference point for future studies. In this study, we tested two algorithm versions for RR estimation that differed only in the SNR threshold. Our results suggest that this parameter had little impact on the accuracy or error rates.The authors are unaware of any smartphone-based RR measurement apps that have undergone rigorous clinical validation. One previous study tested an algorithm with a similar concept to ours but enrolled only ten healthy subjects49. Evidence suggests the use of direct-to-consumer mobile health technologies may enhance positive lifestyle modification such as increased physical activity, more weight loss, and better diabetes control52. Tracking one\u2019s own health-related parameters over time by the general public can potentially increase motivation for a healthier lifestyle by providing an objective, quantifiable metric6. Additionally, there exists strong evidence that regular physical activity is key to improving one\u2019s health independent of age, sex, race, ethnicity, or current fitness level for maintaining cardiovascular health53. Monitoring one\u2019s HR is also an easy and effective way to assess and adjust exercise intensity or enable smartphone-based measurement of cardiorespiratory fitness56.This work supports the use of consumer-grade smartphones for measuring HR and RR. One application of these measurements is in fitness and wellness for the general consumer user. Specifically, an elevated resting HR or slower heart rate recovery after exercise has been linked to lower physical fitness and higher risk of all-cause mortality58. Though patients can in principle count their own HR or RR, this can be error-prone due to factors such as biases that acute awareness of the self-examination can cause60. Because the demand for remote triage, diagnosis, and monitoring is burgeoning in the wake of the COVID-19 pandemic, there is increased attention being paid to accurate remote physical examination23.With further clinical validation across broad populations, such smartphone-based measurement could also be useful in various settings, most notably telehealth where vital sign measurement is challenging due to the remote nature of the patient encounter61. Future evaluations using an electrocardiogram measurement may be helpful in this regard. Our HR algorithm is similarly subject to such errors because it relies on the pulsatile movement of blood in the fingertips. Further, awareness of self-measurement may affect users\u2019 RR. A study demonstrated that people may have slightly lower RR when they are aware that they are monitored by observers62. It is yet unclear how awareness would affect user-triggered RR measurements using apps in the absence of human-to-human interaction, and creative study designs may be needed to better understand this. In addition, though the study enrollment was optimized for diversity, this impacted the sample size in each subpopulation and the number of covariates that can be analyzed. We did not collect other clinical information such as body mass index, which may potentially affect the accuracy of the algorithms. Larger real-world validation that also measures the effect along such axes will be helpful. Also, these clinical validation studies aimed to evaluate the algorithms at a steady-state; the mean HR post-exercise was 93 beats/min. Further work will be needed to investigate scenarios where HR and/or RR are more elevated and under a broader array of participants, activities, and environments. Though the sex ratio was balanced for the RR study, the female:male ratio was skewed in the HR study. Last but not least, although both HR and RR estimation algorithms met the predefined goals, observations with high deviation from the reference values were still produced by the algorithms . Future work to reduce errors is needed.There are several limitations to this work. First, our quantitative results focused on specific study devices (Pixel 3 and 4) and quantitative data on generalization to other devices will be needed. The current studies were also conducted in a controlled setting with structured study protocols. Though the participants used these features without significant study staff assistance, their ease of use in a general population will need further study. For the broad population, there also exists an inherent accessibility/cost and convenience tradeoff between needing to trigger measurements via a camera-equipped smartphone they likely already own, versus receiving passive ongoing measurements via a dedicated wearable wellness tracking device. Next, our reference HR comes from a clinical PPG device instead of an electrocardiogram. There may be infrequent instances of electromechanical dissociation , in which a pulse rate measured at the periphery may not be the same with the reference electrical \u201cheart\u201d rateIn addition to the clinical validation studies reported in this work, these HR and RR algorithms are currently undergoing additional broad usability testing across users, different Android devices, and different environments as we make the algorithms more widely accessible for consumers, beginning by incorporating into the Google Fit app.To conclude, we developed HR- and RR-measurement algorithms for smartphones and conducted two clinical studies to validate their accuracy in various study populations. Both algorithms showed acceptable error ranges with a MAPE under 2% for HR and MAE under 1 breath/min for RR. These algorithms may prove useful in wellness settings such as fitness monitoring. Additional research is warranted before consideration for any future use in clinical settings, such as remote physical examination.Supplementary InformationPeer Review FileReporting Summary"}
+{"text": "This cross-sectional study investigates the association of dominant SARS-CoV-2 variants with COVID-19\u2013related croup. The study included children aged 3 months to 8 years with International Statistical Classification of Diseases and Related Health Problems, Tenth Revision (ICD-10) diagnoses of COVID-19 and croup between January 1, 2021, and March 26, 2022, using data from 43 US children\u2019s hospitals in the Pediatric Health Information System. We excluded children with croup-mimicking  or complex chronic conditions.4 SARS-CoV-2 variant predominance  was determined from the Centers for Disease Control and Prevention (CDC) COVID Data Tracker and defined as more than 50% of SARS-CoV-2 diagnoses attributable to a particular variant. CDC data report estimated variant proportions based on genomic surveillance and account for longitudinal sampling between and within states. The primary outcome was encounters for COVID-19\u2013related croup, summarized by week and variant predominance. Secondary outcomes included hospital and ICU admissions and RE treatment. We used mixed-effects logistic regression to evaluate the association of variant predominance with hospitalization and RE use after adjusting for age, sex, race and ethnicity, insurance, and census region. Analyses were conducted using Stata statistical software version 16 (StataCorp), and 2-sided P values\u2009<\u2009.05 were considered statistically significant.This cross-sectional study was approved by the Children\u2019s Minnesota Institutional Review Board with exemption of informed consent and adhered to the P\u2009<\u2009.001)  . The pro\u2009<\u2009.001) . Odds of\u2009<\u2009.001) .2 showing that hospitalizations for COVID-19\u2013related croup increased after the onset of the Omicron variant. A more recent national investigation3 found that the percentage of children diagnosed with SARS-CoV-2 hospitalized with upper-airway infections increased significantly from pre-Omicron (1.4%) compared with Omicron (4.1%) periods. The hospitalization rate was higher in our study, which may be associated with use of ICD-10 codes rather than positive SARS-CoV-2 test results for COVID-19 data.The results of this cross-sectional study expand on recent single-center studies5 The overall ICU admission rate in our sample was lower than a rate described prior to COVID-19,5 which may be associated with constraints on ICU capacity or, alternatively, less severe illness.Findings for association with COVID-19\u2013related croup severity were mixed in our study. We noted a significant increase in the proportion of children requiring RE during Alpha or other variant and Omicron periods compared with the period of Delta predominance. However, we also observed no difference in the median number of RE doses, which was comparable to an estimate prior to COVID-19.Our study has several limitations. Hospital practice changes, including limitation of aerosol-generating procedures early in the pandemic, may have influenced RE administration. It is also possible that conditions other than croup influenced hospitalization rates.Given that COVID-19 is likely to become endemic, our findings suggest that pediatric health systems should consider variation in SARS-CoV-2 phenotypes and their association with patient care. This may be especially true when other viral infections lead to surges in patient volume."}
+{"text": "Fusobacterium nucleatum (Fn), a pathobiont of the oral microflora, has recently emerged as a CRC-associated microbe linked to disease progression, metastasis, and a poor clinical outcome; however, the primary cellular and/or microenvironmental targets of this agent remain elusive. We report here that Fn directly targets putative colorectal cancer stem cells (CR-CSCs), a tumor cell subset endowed with cancer re-initiating capacity after surgery and chemotherapy. A patient-derived CSC line, highly enriched (70%) for the stem marker CD133, was expanded as tumor spheroids, dissociated, and exposed in vitro to varying amounts (range 100\u2013500 MOI) of Fn. We found that Fn stably adheres to CSCs, likely by multiple interactions involving the tumor-associated Gal-GalNac disaccharide and the Fn-docking protein CEA-family cell adhesion molecule 1 (CEACAM-1), robustly expressed on CSCs. Importantly, Fn elicited innate immune responses in CSCs and triggered a growth factor-like, protein tyrosine phosphorylation cascade largely dependent on CEACAM-1 and culminating in the activation of p42/44 MAP kinase. Thus, the direct stimulation of CSCs by Fn may contribute to microbiota-driven colorectal carcinogenesis and represent a target for innovative therapies.Intestinal bacterial communities participate in gut homeostasis and are recognized as crucial in bowel inflammation and colorectal cancer (CRC).  Colorectal cancer (CRC) represents the third-most-commonly diagnosed cancer and the second leading cause of cancer death worldwide . AlthougFusobacterium nucleatum (Fn) [Streptococcus gallolyticus (Sg) [Fn also promotes the chemoresistance of colon cancer cells, and Fn presence predicts lower patient survival [Fn modulates E-cadherin/\u03b2-catenin signaling via its FadA (Fusobacterium adhesin A) so as to promote oncogenic and proinflammatory responses in CRC cells [Fn binding to the T lymphocyte inhibitory receptors TIGIT and CEACAM-1   and Strecus (Sg) , as potesurvival . CRC-asssurvival . AdditioRC cells ; the samRC cells , and hosRC cells . Moreoveectively ) suppresectively ,13. Impo lesions , suggestOver the last few years, intense research has highlighted the presence, in several solid malignancies, including CRC, of a unique subset of \u201cstem-like\u201d cells endowed with tumor-initiating capacity that are arguably responsible for cancer metastatic spreading and local recurrence after surgery. These colorectal cancer stem cells (CR-CSCs) may truly descend from intestinal stem cells undergoing oncogenic transformation, or rather reflect the de-differentiation of more mature or even fully differentiated enterocytes; either way, they can be identified by the expression of molecular markers  and the activation of intracellular signaling pathways   [Fn-derived metabolite formate enhances the stemness and self-renewal capacity of patient-derived colorectal tumor organoids [While several studies have investigated the molecular determinants and downstream functional consequences of the interaction between oncomicrobes and colon cancer epithelial and stromal/immune cells, little information is available on whether such interactions also or even preferentially involve CSC. It is, however, known that colorectal-tumor-initiating cells exploit autocrine cytokine-triggered circuitries to resist chemotherapy-induced cell death , and thaon (EMT) , and therganoids .Fn in vitro. Our results demonstrate that Fn avidly binds to colonsphere-derived cells and triggers intracellular proinflammatory and oncogenic cascades superimposable to those previously described in mature CRC cells. Additionally, we highlight the role of the cellular CEACAM-1 and its associated tyrosine phosphatase SHP-2/PTPN11 in mediating early phosphorylation responses downstream of cell\u2013pathogen interactions. These findings provide original information on the role of Fn in CRC and suggest a novel paradigm of bacterial carcinogenesis centered on the direct bacterial targeting of cancer-initiating cells.In the present work, we set out to address the microbe\u2013CSC interaction by exposing CSC-enriched primary spheroidal cultures of colorectal tumors to Cell lines. The primary spheroidal colon cancer cultures CSC-P and SA-22 used in the present study were initially derived at Istituto Superiore di Sanit\u00e0, Rome, Italy, and made available to GBP under a Material Transfer Agreement. The procedure of isolation and characterization is described in detail in ref. [\u00ae, SP Bel-Art, Wayne, NJ, USA; cat. #136800070) and re-seeded at 1.5 \u00d7 105 cells/mL in 25 cm2 ultralow-attachment tissue culture flasks. In order to induce intestinal differentiation, the cells were dissociated and cultivated for 7\u201310 days in regular (attachment-permissive) tissue culture plates in CSC medium supplemented with 2% FBS and 10 mM sodium butyrate (Sigma Aldrich). in ref. . Brieflyv/v) and antibiotics. Both lines were periodically checked for mycoplasma infection.The colorectal carcinoma cell lines CaCo-2 (cat. HTB-37\u2122) and HT-29 (cat. HTB-38\u2122) were obtained from the American Type Culture Collection (ATCC) and routinely grown in Dulbecco\u2019s Modified Eagle\u2019s Medium (DMEM) supplemented with 10% FBS  was obtained from ATCC and maintained in anaerobiosis according to the accompanying instructions. The Streptococcus gallolyticus (Sg) used in the present study was a clinical strain isolated from a patient hospitalized at IRCCS Fondazione Policlinico A. Gemelli\u2014Universit\u00e0 Cattolica del Sacro Cuore (Rome). Sg was grown at 37 \u00b0C in brain\u2013heart infusion (BHI) broth with shaking or on BHI agar  [Escherichia coli strain C43 expressing the fusobacterial adhesin CbpF (variant 1) and the relative control strain are described in ref. [E. coli strains were grown in LB broth (Difco) or on LB agar plates (Difco) containing 100 \u03bcg/mL of ampicillin at 37 \u00b0C under aerobic conditions. CbpF1 expression was induced with 0.4 mM of isopropyl-b-d-thio-galactoside  at 22 \u00b0C overnight.m Knorr 2586\u2122 was  in ref. . RecombiAntibodies. The mouse monoclonal antibodies anti-CEACAM-1 , anti-GFP , and anti-p-(Ser 32) IkB-\u03b1 , as well as the polyclonal anti-SHP-2 and anti-SHP-1 rabbit antibodies , were obtained from Santa Cruz Biotechnology. The mouse/rat monoclonal antibodies anti-\u03b2-actin , anti-E-Cadherin , anti-GSK3\u03b2 , and anti-p(Ser 9) GSK3\u03b2 , and the polyclonal rabbit antibodies anti-p(Thr202-Tyr204) p44/42 MAPK (cat. #9101) and anti-p(Tyr 542) SHP-2 (cat- #3751) were purchased from Cell Signaling Technology. The rabbit polyclonal antiserum anti-p42/44 MAP Kinase \u00bd (Erk1/2) was obtained from Millipore/Merck (cat. #06-182). The PE-conjugated anti-hCD133/1  and anti-hCEACAM1/CD66a , used for flow cytometry, were from Miltenyi Biotec and R&D Systems, respectively.Plasmids. The double-color lentiviral Wnt-reporter TOP-GFPmC was a gift from Ramesh Shivdasani ; RRID:Addgene_35491) [e_35491) . This th\u00ae pLKO.1-puro non-target shRNA control vector (cat. #SHC016) were purchased from Sigma/Merck. The NF-kB-responsive Firefly luciferase reporter construct and the CMV-driven Renilla internal control  were from QIAGEN. The IPTG-inducible plasmid encoding the two SHP-2 SH2 domains  fused with GST (pGEX SHP-2(NC)-SH2) was a gift from Bruce Mayer ; RRID:Addgene_46499) [E. coli strain was amplified, purified, and transformed into the protease-deficient BL21 strain to maximize GST-fusion protein recovery.The pre-designed shRNA lentiviral construct directed against human CEACAM-1 (cat. #SHCLNG clone TRCN0000377692) and the MISSIONCSC infection and Luciferase reporter assays. Lentiviral supernatants were produced according to Tiscornia et al. [6 packaging cells) were used to infect 2 \u00d7 105 CSC cells in 2 mL of complete CSC medium. To increase the infection efficiency, cells were co-centrifugated with lentiviral particles at RT for 2.5 h at 2500 g (\u201cspinoculation\u201d) in presence of 8 \u03bcg/mL of polybrene .a et al. , with miluc reporter plasmids, 2.5 \u00d7 105 cells from freshly dissociated spheroids were seeded in 0.5 mL of complete CSC medium without Heparin (found to interfere with transfection) and left to recover for 8 h. Plasmid DNA  was transfected using the Lipofectamine 3000 reagent  in 24-well ultralow-attachment cell culture clusters. After overnight incubation, stimuli were applied as needed. Following an additional 24 h, the normalized reporter activity (Firefly/Renilla) was measured by luminometry using a dual luciferase assay kit  according to the manufacturer\u2019s instructions.For the transfection of Flow Cytometry. For FC analysis, spheroid cultures were dissociated with trypsin, and cell suspensions were filtered through a 70 \u03bcm cell strainer. For surface staining, cells (5 \u00d7 105 in 75 \u03bcL) were incubated in PFA buffer (PBS + 1% FBS + 0.05% Azide) with 0.5\u20131 \u03bcg of primary antibody for 60 min on ice, followed by two washes in cold PFA. Labeling with a secondary reagent, if necessary, was performed sequentially following an identical procedure. For cell staining with FITC-labeled peanut lectin , 2.5 \u00d7 105 cells were incubated in 100 \u03bcL PFA buffer with 2 \u03bcg/mL lectin for 30 min on ice.Samples were analyzed with either a three-laser, 12-fluorescence Cytoflex cytometer  or with a single-laser (488 nm), 3-fluorescence MCL-XL Epics (Coulter) instrument. Dead cells were excluded by staining with propidium iodide or based on their position in the forward-scatter/side-scatter plot.Detection of Nitric Oxide by DAF-FM. Dissociated CSC-P cells (2.5 \u00d7 105) were seeded in ultralow-attachment 24-well clusters in 500 \u03bcL of complete CSC medium without antibiotics and incubated for 24 h with 200 or 500 MOI Fn. DAF-FM diacetate  was added at 10 \u03bcM for the last 60 min of incubation. Cells were then washed in cold PBS, re-dissociated with trypsin, and immediately analyzed by flow cytometry.Bacterial pull-down assay (Bactoprecipitation). In order to isolate CSC proteins potentially involved in cell interaction with bacteria, 0.5\u20131 \u00d7 106 cells were lysed in 100 \u03bcL of PBS containing 1% Triton X-100 and protease inhibitors, incubated on ice for 10 min, and spun down at 14,000 rpm, 4 \u00b0C to remove unlysed cells, nuclei, and cell debris. Next, the supernatant was mixed with 900 \u03bcL of PBS containing 109 bacterial cells  and incubated at 4 \u00b0C for 45 min on a rotating wheel. Bacteria were then centrifuged at 3000\u00d7 g for 10 min, washed twice in cold PBS, and finally resuspended in 60 \u03bcL of 1\u00d7 SDS Laemmli sample buffer , briefly sonicated, and boiled for 5 min to elute bacteria-adsorbed cellular proteins. After a brief centrifugation step, the supernatants were used for regular Western blot analysis.Fn fluorescent labeling and CSC\u2013bacteria binding assay. Fn and other bacterial strains were fluorescently labeled using the Bac-Light\u2122 Red  or the BactoView\u2122 Live Green  bacterial stains according to the manufacturer\u2019s indications. After two washes in PBS to remove the unbound dye, bacteria were mixed with CSC in a 100:1 ratio and incubated at 37 \u00b0C for 30 min in 500 \u03bcL of RPMI, with occasional agitation. Samples were then briefly centrifuged  to separate cells from unbound bacteria, washed once in RPMI, and analyzed by flow cytometry. Labeled bacteria were also separately analyzed to identify and gate out the corresponding population on the FS-SS plot. Comparable labeling intensities among different strains  were also verified.Confocal microscopy imaging. The binding of Red-Fn after 30 min of CSC co-incubation with fluorescent bacteria was qualitatively assessed by confocal microscopy imaging [2. Fluorescence emission, excited with a single-photon laser (excitation wavelength: 561 nm), was collected in the wavelength range of 570\u2013620 nm using a 60\u00d7 oil-immersion objective (1.4 NA). Brightfield images, collected along with fluorescent images, were used to highlight the distribution of red-stained bacteria. imaging ,25. ImagCell stimulation. CSCs from dissociated spheroids were counted with a hemocytometer, spun down at 14,000 rpm for 20 s, and resuspended in RPMI without additives at 0.5\u20131 \u00d7 107 cells/mL in 100 \u03bcL (short-term stimulation) or 1 \u00d7 106/mL in 500 \u03bcL (16\u201324 h stimulation). Bacterial liquid cultures were spun down at 3000 g (3900 rpm) for 10 min, washed once in PBS, and quantified by spectrophotometry at 660 nm (1 OD = 109 cells/mL) [ells/mL) . The desWestern blotting. Protein samples in Laemmli buffer were heated at 95 \u00b0C for 5 min, subjected to SDS-PAGE, and electroblotted onto a nitrocellulose membrane. Immunocomplexes were visualized by enhanced chemiluminescence  with the Alliance Q9\u00ae advanced chemiluminescence imager . Digital images were quantified using the Image J software .Cell lysis and immunoprecipitation. For co-immunoprecipitation studies, cell pellets (3\u20135 \u00d7 106 cells) were lysed in 1 mL of cold lysis buffer  containing 1% (v/v) Triton-X100, and protease and phosphatase inhibitors. After 15 min of incubation on ice, the tubes were spun down  to remove cell debris and unlysed nuclei, and the supernatants were precleared with empty Protein A/G sepharose beads (100 \u03bcL of a 10% v/v slurry) for 1 h at 4 \u00b0C on a rocking plate. After centrifugation, 1/20 of the supernatant was kept for Western blot analysis (input) and 19/20 was incubated with 1 \u03bcg of antibody (anti-CEACAM-1 or anti-SHP-2) and 100 \u03bcL of protein A/G slurry for 16 h in rotation at 4 \u00b0C. Sepharose-bound immunocomplexes were collected by centrifugation , washed 4\u20135 times in lysis buffer with inhibitors, eluted in Laemmli buffer and analyzed by Western blotting.GST-pull down assay. To obtain the immobilized GST-2SH2-SHP2 fusion protein, the encoding pGEX plasmid (Addgene #46499) was transformed into the low-protease E. coli strain BL21; overnight bacterial cultures were diluted 1:10, incubated until OD > 0.6, and induced for 3 h with 1 mM isopropyl \u03b2-D-1-thiogalactopyranoside (IPTG). Pellets were lysed in PBS/Triton-X100 1%/PMSF, and the GST fusion protein was affinity-purified with Glutathione-Sepharose  in batch, extensively washed, aliquoted, and frozen. For the pull-down assay, Sepharose-bound GST-2(SH2)-SHP2  was incubated with CSC lysates, obtained as for a conventional immunoprecipitation, for 2.5 h at 4 \u00b0C in rotation. The following washing and elution steps were conducted as for immunoprecipitation. After protein blotting, equal amounts of the GST fusion proteins throughout the samples were verified by membrane-reversible Ponceau S staining.Multiplex cytokine screening of CSC supernatants. Cells (2 \u00d7 106 in 2 mL CSC medium) were stimulated for 24 h with 100 MOI Fn or left untreated. Supernatants were overlaid on twin membranes of a semi-quantitative, sandwich-based, antibody array kit  and incubated for 16 h at 4 \u00b0C on a rocking plate. Subsequent steps for chemiluminescent immunocomplex detection were conducted according to the manufacturer\u2019s instructions.Quantitative Real-Time PCR. For RNA extraction, undissociated CSC spheroids or plastic-adherent (differentiated CSCs or HT-29 and CaCo2 cultures) cell clusters were washed once in PBS and processed using a Direct-zol RNA Miniprep kit  according to the manufacturer\u2019s instructions. The amount and purity of RNA were determined by NanoDrop\u2122 (Thermo Fisher Scientific). SensiFAST\u2122 cDNA Synthesis Kit  cDNA was used for RNA retro-transcription. Real-time PCR was performed using a SensiFAST\u2122 SYBR\u00ae No-ROX Kit (Meridian Bioscience) with a CFX96 qPCR Instrument . Primer sets for human NANOG (amplicon size 129 bp), human OCT4/POU5F1 (amplicon size 154 bp), and the human housekeeping gene LDHA (a.s. 130 bp) were from the Human Stem Cell Pluripotency Detection qPCR Kit . The reaction conditions were as per the manufacturer\u2019s recommendations.Fn DNA in CSC-P cultures, genomic DNA was obtained from cell pellets (106 cells) following a standard procedure. A 244 bp fragment from the Fn  16S ribosomal RNA gene was amplified using the following primer pair: F: AAAGCGCGTCTAGGTGGTTA and R: GTTTACGGCGTGGACTACCA.To detect Cell viability assay. CSC-P cells were seeded in complete medium at 2.5 \u00d7 104/100\u03bcL in 96 flat-bottom well plates and treated for 4 days with the alkylating agent Oxaliplatin  at 250\u20137.5 \u03bcM or left untreated. A total of 250 heath-killed MOI  were added immediately after seeding where needed. Cell survival was measured by the CellTiter-Glo\u00ae Luminescent Cell Viability Assay  according to the manufacturer\u2019s instructions. In each sample group (control and H-K Fn), the average RLU reading (background-subtracted) of the untreated wells (No Oxa) was assumed as 100% survival, and cell viability throughout the treatments was calculated as (RLU well/average RLU of untreated wells) \u00d7 100. RLU readings from wells containing H-K Fn without CSC-P cells were not different from the background.Statistical analysis. Differences between two sample means were evaluated by a two-tailed Student\u2019s t-test for independent or correlated samples, where appropriate. One- or two-way ANOVA followed by Tukey Honest Significant Difference post hoc analysis were used for multiple comparisons. Experimental measurements from independent experiments  were grouped and analyzed pairwise by the Wilcoxon signed rank test, or by ANOVA for correlated samples if k > 2. Where data were reported as the fold induction (compared with untreated control), relevant statistical tests were performed for row values or stimulation indexes (treated/untreated). The single-sample Student\u2019s t-test (two-tailed) was used to compare the mean fold induction value with the null hypothesis = 1 (no effect). The threshold for statistical significance was set at p < 0.05 (two-tailed). Calculations were performed on the online Vassar Stats platform .Fn infection on commercial colorectal tumor cell lines , grown in 2D culture [Fn has been shown to increase the expression of stem cell markers in HCT-116 cells [Fn can also target immature, stem-like CRC cells, we took advantage of a patient-derived CSC line (CSC-P) cultivated in defined serum-free medium and previously characterized for its tumorigenicity in vivo [Nanog and POU5F1/Oct4 was 4\u20135-fold more abundant in these cells than in the broadly used CRC lines HT29 and CaCo2  and cell-bound fluorescence was quantified by flow cytometry. Near-100% spheroid-derived cells appeared to bind red-labeled Fn after 30 min of incubation at room temperature  [Fn adhesin FadA) [A number of l Fap-2) , E-cadhein FadA) , and thein FadA) . We confFn, bacteria were incubated with whole homogenates from GFP-expressing CSCs, washed, and subjected to Western blot analysis for putative surface-adsorbed mammalian docking proteins (\u201cbactoprecipitation\u201d). By this procedure, we readily detected CEACAM-1, but not E-cadherin  or Sg, but bound to a recombinant E. coli strain expressing the Fn adhesin CbpF [Fn on colorectal CSCs.To gain further insight into the molecular interactions between our stem cell population and cadherin  or GFP -dependent inflammatory cascades in CRC cells [Fn displayed early phosphorylation of the nuclear factor kB inhibitor IkB-\u03b1, an event heralding NF-kB activation  , a gaseous vasoactive and inflammatory mediator also involved in colorectal CSC identity and malignancy [Fn  B, while sor NOD2 A. Additilignancy  , while having no effect on proliferative capacity in standard medium .Along parallel lines of investigation, the activation of Wnt/\u03b2-catenin signaling by fusobacterial FadA binding to E-Cadherin has been shown to promote CRC cell growth and survival . The conytometry B and conytometry C,E. Moreytometry C,D, an u adhesin . Finallyd medium F. AlthouFn signaling to CSCs, we focused on CEACAM-1 as an established Fn docking protein abundantly expressed in this malignant cell population  increase in tyrosine-phosphorylated protein species, as revealed by anti-phosphotyrosine immunoblotting  and SHP-1 (PTPN6) were abundantly expressed in CSCs  expression of CD133 in the majority of CSC-P cells, (b) downregulation of the pluripotency factors Nanog and Oct4 in differentiative culture conditions, and (c) constitutive activation of the Wnt pathway as revealed by the fluorescent reporter TopGFP clearly argues in favor of this cell model being representative of the CRC stem cell subset. Additionally, experiments of cell\u2013bacteria interactions with fluorescent Fn to CSC, presented in Fn, not only at primary CRC sites, but also in distant metastatic colonies [Fn docking molecules , they may not be easily accessible for microbial contact when confined to their hypoxic niche in vivo. Nevertheless, spontaneous or therapy-induced tumor necrosis may occasionally expose CSCs so as to infringe their isolation. Additionally, Gal-GalNac expression  and CXCL-8 (IL-8) [Fn-elicited generation of nitric oxide, a gaseous mediator involved in microbicidal responses in macrophages, but also previously linked to colorectal CSCs\u2019 malignant capacity [Fn or other pathogens. This possibility, which entails far-reaching implications for microbe-driven colorectal carcinogenesis, deserves further investigation by systematically comparing innate immune responses in stem versus differentiated cancer cells.The molecular analyses displayed in 8 (IL-8) ; while icapacity . Along aFn reportedly activates Wnt signaling [Fn in CSC, as revealed by the increased inhibitory phosphorylation of the \u03b2-catenin destruction factor GSK3\u03b2 [Fn, although not directly demonstrated in the present work, is consistent with enhanced stem-like features downstream of Wnt activation. Of note, Vermeulen et al. elegantly showed that Wnt signaling in CSCs can be triggered by extrinsic cues, such as HGF secreted by stromal myofibroblasts [Fn to the list of \u201cenvironmental\u201d stemness-promoting factors, our observations align perfectly with this idea. Nevertheless, changes in cells transduced with TCF-driven GFP were relatively modest, with a slight fluorescence increase in GFP+ cells and no detectable cell shift from the GFP- to the GFP+ population  cytosolic tail, harbored by the L isoforms, to recruit tyrosine phosphatases (via the ITIM domain) and Src-like kinases [Fn, by engaging CEACAM-1 through CbpF, could impact the supramolecular organization of CEACAM-1-L aggregates so as to tilt the phosphorylation\u2013dephosphorylation balance in favor of the former. In keeping with this view, the co-immunoprecipitation studies presented in Fn-CEACAM-1 signaling in T lymphocytes and NK cells, whereby bacterial engagement leads to CEACAM-1 dimerization/activation, and possibly the phosphatase-dependent downregulation of antigen-triggered activation signals [The analysis of protein tyrosine phosphorylation events elicited by molecule . Accordiand CbpF ,20 elici kinases . Notably kinases . Thus, F signals .Fn binding remains elusive, although the dephosphorylation of the CEACAM-1 ITIM at positions Y493 and Y520, the putative SHP-2 docking sites, represents a plausible explanation. This idea is consistent with the reduced CEACAM-1 recovery from Fn-stimulated CSC lysates in pull-down experiments, where the two SHP-2 SH2 phosphotyrosine binding domains were used as bait (Fn challenge (The mechanism leading to SHP-2 dissociation from CEACAM-1 upon  as bait E. Unforthallenge ; future Fn in T and NK cells, the data presented here underscore the relevance of this pathogenic interaction on the cancer cell side. Relevant to this aspect, CEACAM-1 has been recognized as playing a dual role in colorectal cancerogenesis, possibly tumor-suppressive in the early phases, and supportive for malignant progression and metastasis in advanced disease [Fn dissociating CEACAM-1 from its inhibitory effector SHP-2 is consistent with the well-established paradigm whereby microbial carcinogenesis targets tumor suppressor mechanisms [Fn\u2013CEACAM-1\u2013SHP2 axis qualifies well to link bacterial infection with cancer progression and dissemination. In keeping with this attractive hypothesis, CEACAM-1 is highly expressed in EpCAM+ liver CSCs [Fn, vary across spheroidal cell subsets in a fashion that correlates with stemness and Wnt signaling capacity. Likewise, further studies aimed at better dissecting the role of the CEACAM-1\u2013SHP axis in the proinflammatory and Wnt-related responses elicited by Fn in CSCs (In a broader perspective, our results carry significant implications for CRC biology. While recent works have focused on the immunomodulatory and immunosuppressive consequences of CEACAM-1 engagement by  disease ,40. The chanisms . On the ver CSCs , and itsver CSCs . Additiover CSCs . While t in CSCs  are warrFn, a pathogen involved in colorectal carcinogenesis, and tumor spheroid cultures highly enriched in colon CSCs. Furthermore, our data not only confirm, in CSCs, previously described proinflammatory and protumorigenic activities of Fn, but also identify a signaling axis involving CEACAM-1, SHP-2, and the downstream tyrosine phosphorylation cascade as potentially relevant for CSCs\u2019 biological response to the pathogen. Thus, although in part preliminary, these observations entail broad implications for microbial carcinogenesis in the intestine and outline novel actionable mechanisms for preventive and therapeutic interventions. Additionally, by revealing Fn\u2019s capacity to bind CSCs, our findings support the idea of exploiting this tumor-associated microbe as an engineerable platform to target CRC and other common malignancies [In conclusion, the present work provides evidence for a direct interaction between gnancies ."}
+{"text": "Herein, a novel glycoside hydrolase (GH) family 46 chitosanase (SlCsn46) from marine Streptomyces lydicus S1 was prepared, characterized and used to controllably produce COSs with different DP. The specific activity of purified recombinant SlCsn46 was 1,008.5 U/mg. The optimal temperature and pH of purified SlCsn46 were 50\u00b0C and 6.0, respectively. Metal ions Mn2+ could improve the stability of SlCsn46. Additionally, SlCsn46 can efficiently hydrolyze 2% and 4% colloidal chitosan to prepare COSs with DP 2\u20134, 2\u20135, and 2\u20136 by adjusting the amount of SlCsn46 added. Moreover, COSs with DP 2\u20134, 2\u20135, and 2\u20136 exhibited potential application value for prolonging the shelf-life of pre-packaged Tofu. The water-holding capacity (WHC), sensorial properties, total viable count (TVC), pH and total volatile base nitrogen (TVB-N) of pre-packed tofu incorporated with 4 mg/mL COSs with DP 2\u20134, 2\u20135, and 2\u20136 were better than those of the control during 15 days of storage at 10\u00b0C. Thus, the controllable hydrolysis strategy provides an effective method to prepare COSs with desired DP and its potential application on preservation of pre-packed tofu.Chitosan oligosaccharides (COSs) are widely applied in many areas due to its various biological activities. Controllable preparation of COSs with desired degree of polymerization (DP)  N-acetyl-D-glucosamine (GlcNAc)  are linear co-oligomers which are composed of D-glucosamine (GlcN) and (GlcNAc) . Compare(GlcNAc) . As repo(GlcNAc) . Based o(GlcNAc) . It is p(GlcNAc) . Some pr(GlcNAc) . On the Bacillus mojavensis SY1 decomposes 92.3% of 4% colloidal chitosan into COSs with DP from 2 to 6 is only 15 min  and various edible coating, also have been tried to delay the spoilage of tofu (2) extended the shelf life of Asian sea bass slices by at least 12 days  from GH46 family was cloned, bioinformatics analyzed and heterologously expressed. Meanwhile, the recombinant SlCsn46 was purified and characterized. Furthermore, controllable preparation of COSs with different DP by purified SlCsn46 was performed. Finally, the potential application of COSs on preservation of tofu was investigated. The results of this study will provide an efficient chitosanase for controllable preparation of COSs and give some clues on the potential application of COSs on preservation of pre-packaged tofu.\u00ae HS (Premix), Ex Taq\u00ae DNA polymerase and T4 ligase were purchased from Takara Biotechnology . Substrates, such as chitin, xylan, microcrystalline cellulose, soluble starch, and powdery chitosan with 85%, 90% and 95% degrees of deacetylation (DA), were from Yuanye Biotechnology . Chitosan oligosaccharides with different degree of polymerization (DP 1\u20136) were purchased from Qingdao BZ Oligo Biotech . Non-GMO soybeans (protein content 38%) were originally produced in Canada and supplied by Jinzai Food Group Co., Ltd. . All other chemical reagents were of analytical grade and purchased from the Guangzhou Chemical Reagent Co., Ltd. .The PrimeSTARS. lydicus S1 was isolated from shrimp shell waste, identified by 16sRNA sequencing and stored at \u201360\u00b0C. The E. coli Dh5\u03b1 and competent cell BL21 (DE3) were purchase from Tiangen Biotech . The plasmids pMD20T and pET-22b were purchased from Takara Biotechnology  and General Biotechnology , respectively. Media for E. coli was Luria-Bertani with ampicillin (LBA) (LB with 25 \u03bcg/mL ampicillin).The S. lydicus S1 was extracted for gene cloning of slcsn46. According to the hypothetical chitosanase sequences from S. lydicus A02 , S. lydicus 103 , and S. lydicus M01 , one pair of primers  was designed and used to PCR amplification of slcsn46. The obtained PCR product was ligated to pMD20T and transformed to E. coli competent cell. The transformants were plated on LBA plates. The positive colonies were checked by colony PCR and DNA sequencing. BLASTn and BLASTx were used to analysis the identity of slcsn46 and SlCsn46 against to chitosanases from different sources. The prediction of signal peptide and tertiary structure of SlCsn46 were performed by SignalP 5.0 server and SWISSMODEL, respectively. Molecular docking of SlCsn46 with chitohexaose was performed by Autodock vina.The genomic DNA of slcsn46s without signal peptide was obtained by PCR amplification using pMD20T-slcsn46 as template, slcsn46-fw (TAATTCGGATCCGGAAGACCGGGCC CCCGCCCGC), and slcsn46-rev (TGGTGCTCGAGGCCGAT GTGGAAGCTCTCCCC) as primers. Then, slcsn46s was ligated to pET-22b to form expression vector pET-22b-slcsn46s. The expression vector pET-22b-slcsn46s was transformed to E. coli BL21 (DE3) to construct recombinant strain containing slcsn46s, which was confirmed by DNA sequencing. The recombinant strain containing slcsn46s was firstly cultivated in 10 mL LBA medium in 150 mL flasks and incubated at 37\u00b0C, 200 rpm until the OD600 reached 1.0. Then, 1 mL seed solutions were transferred into 100 mL LBA medium in 500 mL flasks and incubated at 37\u00b0C and 200 rpm. As the value of OD600 reached 0.6, 1 mM Isopropyl-beta-D-thiogalactopyranoside (IPTG) was added to culture solution and cultivated at 16\u00b0C and 200 rpm for 2 h. Finally, the recombinant strains was collected by centrifuging at 8,000 \u00d7 g and 6\u00b0C for 10 min and disrupted by sonication. The method for purification of recombinant SlCsn46 was similar to previous studies  was optimized, synthesized, and ligated to pGAPZ\u03b1A by General Biotechnology . The obtained expression vector pGAPZ\u03b1A-slcsn46opt was linearized with BlnI and electrotransformed into P. pastoris X33. The method for isolation the recombinant strains was same as previous study (The process for efficient secreted expression of SlCsn46 in  studies . Accordius study  and the The recombinant strain with highest activity was cultivated in 7 L bioreactor. The method for high cell density fermentation was same as previous study  and the Preparation of COSs by purified SlCsn46 was similar to previous researches . DiffereThin layer chromatography and high performance liquid chromatography (HPLC) were used to determine the composition of hydrolyzates. The method for HPLC was same to previous studies . MeanwhiThe fermented yellow whey tofu was manufactured according to Each tofu sample was placed in a single polyethylene container and randomly divided into four groups. Then, four groups of samples were added into each of the four solution (60 mL) at room temperature, including: (1) COSs-2\u20134 group (COSs with DP 2\u20134); (2) COSs-2\u20135 group (COSs with DP 2\u20135); (3) COSs-2\u20136 group (COSs with DP 2\u20136); (4) control group (sterile distilled water). The concentration of all COSs solutions were 4 mg/mL. All samples were pasteurized (85\u00b0C) for 30 min after packaging, and then refrigerated at 10\u00b0C for 15 days and analyzed every 3 days for microbial, physicochemical, and sensorial properties.Total viable count (TVC) was determined using the plate count agar method, as per the GB 4789.2\u20132016 of the Chinese standard. Briefly, 25 g of tofu samples were blended with 225 mL of sterile saline (0.85%). The mixture with appropriate dilutions was inoculated on plates and incubated at 36 \u00b1 1\u00b0C for 48 h.For pH, tofu samples (25 g) were homogenized with 225 mL of distilled water. The pH value was measured by a pH meter  at 25 \u00b1 1\u00b0C.The semimicro-quantitative nitrogent method was employed to determine the total volatile base nitrogen (TVB-N) of tofu, as per the GB 5009.228\u20132016 of the Chinese standard.The water-holding capacity (WHC) of tofu was characterized using the method of Sensory evaluation of tofu was performed by a sensory panel of twelve trained members . Panelists were requested to give a liking score for quality attributes like appearance, color, odor, and texture of the sample using a 9-point hedonic scale  . PanelisAll the measurements were done in triplicate. The data were analyzed by the Statistical Package for the Social Sciences (SPSS) software  and are expressed as mean \u00b1 standard deviation (SD). Mean comparisons were performed by the Duncan\u2019s Multiple Range Test (DMRT).S. lydicus A02, followed by hypothetical chitosanase from S. lydicus 103 (83.2%) and S. lydicus M01 (82.9%). The obtained fragment was named as slcsn46 and the open reading frame of slcsn46 was 882 bp, which encodes 293 amino acids. The sequence of slcsn46 was deposited on National Center of Biotechnology Information (NCBI) with accession number ON929883. The results of NCBIblastp analysis demonstrated that SlCsn46 was a chitosanase from GH46 family. Alignment SlCsn46 with already crystallized chitosanases indicated that Glu and Asp were catalytic residues  deposition: 1chk.1], homology modeling was used to obtain the overall structure of SlCsn46. Similar to already crystallized chitosanases from GH46 family . The result of SDS-PAGE analysis showed that the purified recombinant SlCsn46 was about 30 kDa 3 were not decompose and transformed to smaller products even though the reaction time reached 120 min. In addition, as DP of COSs was larger than 3, the hydrolysis efficiency of purified recombinant SlCsn46 increased quickly (4 was decomposed and converted to (GlcN)2 revealing that the smallest substrate of SlCsn46 was (GlcN)4. Different from (GlcN)4, (GlcN)5, and (GlcN)6 were completely cleaved and transformed to smaller COSs with DP 2 to 4 as the reaction time reached 40 and 20 min, respectively (The purified recombinant SlCsn46 exhibited no activity toward COSs with DP below 4 . The (Gl quickly . As showectively . Further6 were composed of (GlcN)2, (GlcN)3, and (GlcN)4, which are involved with \u201c4 + 2\u201d and \u201c3 + 3\u201d splitting mode, respectively. For \u201c3 + 3\u201d splitting mode, the (GlcN)6 enters into the active region of SlCsn46 and the six sugar units of (GlcN)6 are located at the \u20133 to + 3 subsites (6 are formed some hydrogen bonds with the amino and group hydroxyl of (GlcN)6. For example, the amino group at the C\u20132 position of +1 subsite may form two hydrogen bonds with the side chain of E39 and Y51. The hydroxyl group at the C\u20136 position of +2 subsite may form three hydrogen bonds with the side chain of E39, N40, and S41  with the highest activity was isolated and cultivated in 7 L bioreactor. As shown in 79SSL). As depicted in The codon usage analysis indicated that the codon usage between pastoris . The optSalmonella of (GlcN)4 is about 2-fold higher than (GlcN)2. Similarly, a previous study revealed that the antimicrobial activity against Staphylococcus aureus is also related to DP and the COS with DP below than five showed no antibacterial activity 5 when the amount of purified recombinant SlCsn46 was 2 U/mL (2 to (GlcN)4 4, and (GlcN)5 were 4.25, 7.62, and 3.35 mg/mL, respectively, which dominated 81.9% of the total COSs (2 to (GlcN)6 and the concentrations of those COSs were 3.25, 8.15, 9.25, 8.95, and 6.48 g/L, respectively (2 to (GlcN)5. As the amounts of SlCsn46 above 5 U/mL, the final products mainly included (GlcN)2 to (GlcN)4  of colloidal chitosan with 95% DA addition with different amounts of recombinant SlCsn46 (2\u201320 U/mL) were used to prepare COSs with desirable DP. The results of 2% colloidal chitosan added with 2\u201320 U/mL SlCsn46 were shown in s 2 U/mL . As the  (GlcN)4 . Meanwhital COSs . Furthertal COSs . As the tal COSs . For 2 Uectively . For 5 U (GlcN)4 . In addi (GlcN)4 .B. mojavensis SY1 could decompose 91.2% of colloidal chitosan  into COSs with DP 2\u20136 after 1 h reaction in the presence of 5 U/mL of CsnBm . The results indicated that COSs could inhibit the growth of microorganism in tofu. Numerous studies have shown that the antibacterial activity of COSs is largely associated with the interaction between its positively charged . The findings were in agreement with those of The change of the pH value on tofu samples during the storage of 15 day at 10\u00b0C are presented in P < 0.05) of almost 31.4\u201350.8% were observed in COSs treatment groups. Total volatile base nitrogen, a vital index of food spoilage, is mainly attributed to the influence of the spoilage microorganisms . In FiguWater is one of the main components of tofu, and plays a key role in maintaining quality stability and structure of tofu . As an eP > 0.05), indicating that no negative effect of COSs addition on the sensory quality of tofu. Thereafter, sensory scores of all parameters for each group were decreased with storage time extension. Among them, the odor scores of control dramatically declined from the 9th day (P < 0.05), and were all lower than the threshold of sensory unacceptability, which was basically consistent with the results of TVC evaluation. In contrast, the scores for all sensory attributes in COSs treated groups were always higher than five (acceptable score) throughout the storage period, indicating that COSs with DP 2\u20134, 2\u20135, and 2\u20136 all have the potential to extend the shelf life of tofu. Higher sensory scores in COSs treatment group were more likely due to the lower TVB content, which resulted in a reduction in off-flavor and offensive odor production  from ON929883.The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI with accession number: HC contributed to gene clone, construct recombinant strain, and bioinformatics analysis of SlCsn46 and writing. BL contributed to potentionl application of COSs in preservation of pre-packaged tofu. RZ contributed to characterization, purification, and kinetic parameters of SlCsn46. ZG contributed to preparation and COSs treatment of pre-packaged tofu. MW contributed to hydrolytic pattern of SlCsn46. JZ contributed to large scale production of SlCsn46. WS contributed to project administration. LZ contributed to funding acquisition. JW contributed to gene cloning, signal peptide optimization, efficient secreted expression, and experiments planning. All authors contributed to the article and approved the submitted version."}
+{"text": "The Research Topic of this Research Topic aims to gather the Proceedings of \u201cProteine 2022\u201d meeting  organized by the Protein Group of the Italian Society of Biochemistry (SIB). This Research Topic is focused on protein-protein and protein-ligand interactions in order to obtain new relevant knowledge about the discovery, design and the rational development of drugs for the treatment of particular diseases.Iacobucci et al., focuses on the viral glycoprotein Spike S which is involved in the recognition and interaction of viral particles with surface host receptors as well as in the fusion of the viral capsid with the host cell membrane. Authors investigated the Spike S1 subunit interactomes looking for potential additional Spike human receptors that could possibly be involved in other intracellular processes in non-pulmonary systems. Shotgun proteomics approaches were used for protein identification and several bioinformatics approaches were performed for functional data analysis. The proteomic experiments allowed the authors to identify many host protein targets and ascertain the role of the S1 domain in all steps of the interaction between the pathogen and the different host cell lines used in this research. Their data suggest the role of S1 not only in receptor recognition but also in vesicle formation; an interplay between S1 domain and human proteins associated with energetic cell metabolism in almost all analysed cell lines has been highlighted. In the manuscript of Dos Santos et al., Authors showed a strong correlation between enhanced in vivo proteolysis and mortality in patients with septic shock caused by a bacterial infection as well as by COVID-19-induced bacterial superinfection. They used a peptidomic-based approach in order to estimate the magnitude of in vivo proteolysis by assessing the abundance and count of peptides in the plasma sample. The analysis of the circulating proteome and peptidome was reinforced by the quantitation of the proteolytic activity of proteases that are activated during the acute form of the disease in order to obtain more information on the role of proteases in the regulation of the balance between coagulation and fibrinolysis in the systemic intravascular proteolysis observed during acute illness. The correlation between proteolytic activity and protease expression patterns in plasma during bacterial superinfection can provide pathophysiologically and clinically valuable information that could be useful to anticipate the signs of possible coagulation disorders and aid in early diagnosis providing useful devices for a timely therapy.In this Research Topic new important data regarding the Coronavirus Disease 2019 (COVID-19) caused by the severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2) are presented. The manuscript of This Research Topic also reports data on protein-protein and protein-ligand interactions related to the search for antibacterial drugs and the understanding of key cellular signaling pathways in cell migration.Kabongo et al., deals with the drug discovery related to the enzyme malate:quinone oxidoreductase (MQO), a peripheral membrane protein essential for the survival of several bacteria and parasites such as C. jejuni which is the most common cause of bacterial foodborne diseases worldwide. The increasing incidence and antibiotic resistance of this bacterial infection require the adoption of new strategies in order to counteract the infection spread. The MQO enzyme catalyses the oxidation of malate to oxaloacetate and is also involved in the reduction of the quinone pool in the electron transport chain thereby contributing to cellular bioenergetics. For these reasons the enzyme is an attractive drug target as it is not conserved in mammals. Authors optimized the overexpression and purification of MQO from Campylobacter jejuni (CjMQO), conducted an optimization of CjMQO assay conditions with a determination of enzyme steady-state kinetic parameters and reaction mechanism and finally, investigated the inhibition mechanism of two CjMQO inhibitors of plant origin, ferulenol and embelin. These molecules strongly inhibit the CjMQO enzymatic activity as well as the growth of C. jejuni, and hence offer promising perspectives as an antibacterial tool.The manuscript of Vacchini et al. applies a quantitative SILAC-based phosphoproteomic analysis coupled to a systems biology approach with network analysis to investigate the signaling pathways downstream to ACKR2, an atypical chemokine receptor which is structurally uncoupled from G proteins and is unable to activate signaling pathways used by conventional chemokine receptors to promote cell migration. ACKR2 regulates inflammatory and immune responses by shaping chemokine gradients in tissues via scavenging inflammatory chemokines. The analysis was carried out on a HEK293 cell model expressing either ACKR2 or its conventional counterpart CCR5. The model was stimulated with the common agonist CCL3L1 for short (3\u00a0min) and long (30\u00a0min) durations. As expected, many of the identified proteins are known to participate in conventional signal transduction pathways and in the regulation of cytoskeleton dynamics. However, the analyses revealed unique phosphorylation and network signatures, suggesting roles for ACKR2 other than its scavenger activity providing an unprecedented level of detail in chemokine receptor signaling and identifying potential targets for the regulation of ACKR2 and CCR5 function.Lastly, the paper of In addition to the contributions to the Research Topic, the Congress itself had a good participation offering an overview of the state of the art of Italian research in the field of proteins.Furthermore, we were particularly pleased to see the significant participation of many of the younger generation scientists presenting their work both as posters and in oral communications."}
+{"text": "Butyrylcholinesterase (BChE) activity has been associated with obesity, lipid concentrations, and CHE2 locus phenotypes. This, the aim of this study was to evaluate the effects of an energetic restriction diet intervention on anthropometrical and biochemical variables and on absolute and relative BChE activity in CHE2 C5+ and CHE2 C5- individuals. One hundred eleven premenopausal obese women from Southern Brazil participated in an energetic restriction diet intervention (deficit of 2500 kJ/day) for 8 weeks. Their anthropometric and biochemical parameters were evaluated before and after the intervention. Plasma BChE activity was measured, and BChE bands in plasma and CHE2 locus phenotypes were detected by electrophoresis. The dietetic intervention decreased anthropometric and biochemical parameters as well as absolute BChE activity and relative activity of the G4 band. The CHE2 C5+ phenotype presented a different effect when compared with the CHE2 C5- phenotype. The CHE2 C5+ phenotype showed an effect in absolute BChE activity and in the relative activity of the G4 form, maintaining higher BChE activity regardless of the metabolic changes. In our study, 8 weeks was not sufficient time to lower the body mass index to normal, but it was enough to significantly reduce the absolute BChE activity, which became similar to the levels in nonobese individuals. CHE2 C5+ individuals were resistant to the decrease in BChE activity compared to CHE2 C5- individuals. This shows that the diet did not affect the CHE2 and G4 fraction complex and that the products of the CHE2 locus in association with BChE have a role in energy metabolism, maintaining high levels of enzymatic activity even after dietary intervention. BCHE gene (3q26.1-q26.2)  is an esterase encoded by the E gene 3q6.1-q26.2.1.1.8 is1-q26.2) .Chemically, G2 is formed by a disulfide bond between 2 G1 monomers , and G4 CHE2 locus). CHE2 C5+ individuals show mean BChE activity approximately 30% higher than CHE2 C5- individuals , under registration 0005306/11.Women living in Curitiba and neighboring cities were invited to participate in this study via local radio and television ads, with the aim to reduce weight. Initially, we had a group of 199 obese women; at the end of the study, 111 completed the dietetic intervention. Only this group was statistically analyzed.All the women in the study had a BMI \u2265 30, being an inclusion criterion, along with being 20 years old or older, being in their reproductive period (not in menopause), not being pregnant, and not lactating. The women were excluded when they were already participating in a diet; using weight control medicaments; had a confirmed diagnosis of diabetes I, noncontrolled hypertension, hypothyroidism, or renal chronic disease; had undergone stomach reduction surgery; had been a vegetarian; and did not have the availability to attend the meetings at PUC-PR on Saturdays. The women who agreed to participate and who were in agreement with the study criteria read, accepted, and signed the terms of informed consent (IC).The 111 women who started and concluded the study had predominantly Euro-Brazilian ancestry (self-declared). Their ages ranged from 20 to 50 years , and the predominant age range was 30-39 years (45% of participants). During the study, 70.4% of the women were employed .2), 24.8% were class II obese (35-39.9 kg/m2), and 19.2% were class III obese (\u2265 40 kg/m2) , high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C), and triglycerides (TG) were obtained by standard automated methods.Weight and height were measured with an accuracy of 0.1 kg and 0.1 cm, respectively. BMI, waist circumference (WC), and abdominal circumference (AC) were also measured. The abdominal-stature ratio (ASR) and waist-stature ratio (WSR) were obtained from these measurements.CHE2 locus phenotypes were identified by acid agar gel electrophoresis (pH: 6.40) (Plasma BChE activity was measured using the protocol of Dietz and cols.  modifiedH: 6.40) .The detection of BChE bands in plasma was made according to Boberg and cols. . The relt test (parametric variables) or by Mann-Whitney test (nonparametric and independent variables). Multiple regression analysis was performed to verify the interaction between variables. The probability value for the comparative tests was considered significant at p < 0.05 (5%).The phenotype frequencies of CHE2 C5- and CHE2 C5+ were obtained by direct counting. The comparisons between means  were performed by The anthropometric variables WC, AC, and BMI suffered a significant decrease after the intervention, as did the mean plasma absolute BChE activity .HDL-C was the only fraction that showed a significant decrease; the values of the other biochemical variables  showed no significant changes .Multiple regression analysis was performed to verify the independent effect of BChE molecular forms , before and after dietetic intervention, on the lipid profile  and anthropometrical parameters . Before the intervention, G2 acted independently in the determination of TC levels and WSR. After the intervention, G2 showed an independent effect on ASR. G1-A showed an independent effect on WSR before the intervention and on TC levels after. G1 showed an independent effect on WSR before the intervention .The phenotype frequencies of CHE2 C5- and CHE2 C5+ were, respectively, 90.84% \u00b1 2.53 and 9.16% \u00b1 2.52. The comparison of mean absolute BChE activity between CHE2 C5+ and CHE2 C5- phenotypes before the intervention did not show a difference in the sample of studied women. After the intervention, only the CHE2 C5- phenotype suffered a significant decrease, and CHE2 C5+, besides not showing a decrease, presented approximately 23% higher activity than CHE2 C5- .Before the intervention, there was no difference between the RA of G4 of CHE2 C5+ and of CHE2 C5- individuals. After the intervention, CHE2 C5+ individuals maintained their RA of G4, while it decreased in CHE2 C5- individuals . The anaAnthropometrically, this 8-week diet was efficient, leading to a reduction of WC, AC, and BMI, however, not enough to decrease the BMI to the normal range, but it was sufficient to decrease the mean plasma absolute BChE activity significantly. These results suggest that there is a significant influence of the diet intake on plasma BChE activity, supporting the role of BChE in lipid metabolism and obesity ,18,28-30It has been suggested that the role of BChE in lipid metabolism could be the hydrolysis of choline esters, which are results of the nonesterified fatty acid metabolism and liver lipogenesis -30. ConsThe fact that the HDL-C levels decreased after the intervention can be explained by a possible lack of physical exercise (PE) during the dietetic intervention, although this is only a nontestable hypothesis since we do not have systematized data that allow inference of the level of physical activity of the women who composed our sample. The lack of PE may cause an excessive formation of ammonia that leads to fatigue and therefore an even greater decrease of PE habits  Possiblyp = 0.02) and after  the intervention are mainly due to its relation with lipid metabolism, BMI, and WC, as related before and in other studies   . Previou = 0.89)  and BMI  = 0.89) . The res = 0.89) ,18 and aCHE2 locus products and BChE concerning the response to metabolic changes. These data helped to increase the knowledge about the role of BChE in obesity, showing how much the levels of enzyme activity are influenced by diet, independent of BMI entering in normal threshold.Among the limiting factors of our study was the relatively small sample size, which diminished the power of the study and may have contributed to the nonidentification of effects, especially of smaller magnitudes. Another limiting factor may be that we did not combine dietary intervention with an exercise program to maximize some results. However, our study presents original and specific data about the CHE2 C5 phenotype\u2019s influence on the dietetic intervention\u2019s effect on total and relative BChE activity. Other studies are still required for a full understanding of the interaction between the CHE2 locus holds a strong biochemical relation with increased BChE activity, maintaining its elevated level even after the energetic restriction.In conclusion, after the 8-week diet, a decrease in the BMI, WC, AC, and HDL-C was observed, establishing a relation between the dietetic intervention and the decrease of plasma absolute BChE activity. However, CHE2 C5+ individuals were resistant to this decrease in enzyme activity, maintaining a high level of the RA of G4, which provides the major portion of BChE\u2019s active form, suggesting that the Diagn\u00f3sticos do Brasil (DB) clinical laboratory performed the automated measurements of biochemical parameters.Acknowledgements: Coordena\u00e7\u00e3o de Aperfei\u00e7oamento de Pessoal de N\u00edvel Superior (Capes).Financing statement: grants and scholarships were received by Araucaria Foundation and"}
+{"text": "We explored affecting parameters in hot casting of BA2PbI4 layers, and proved that oxygen plasma treatment prior to hot casting plays a significant role to achieve high quality close packed polycrystalline RPP layers at lower hot cast temperatures. Moreover, we demonstrate that crystal growth of 2D BA2PbI4 can be dominantly controlled by the rate of solvent evaporation through substrate temperature or rotational speed, while molarity of the prepared RPP/DMF precursor is the dominant factor that determines the RPP layer thickness, and can affect the spectral response of the realized photodetector. Benefiting from the high light absorption and inherent chemical stability of 2D RPP layers, we achieved high responsivity and stability, and fast response photodetection from perovskite active layer. We achieved a fast photoresponse with rise and fall times of 189\u00a0\u00b5s and 300\u00a0\u00b5s, and the maximum responsivity of 119\u00a0mA/W and detectivity of 2.15\u2009\u00d7\u2009108 Jones in response to illumination wavelength of 450\u00a0nm. The presented polycrystalline RPP-based photodetector benefits from a simple and low-cost fabrication process, suitable for large area production on glass substrate, a good stability and responsivity, and a promising fast photoresponse, even around that of exfoliated single crystal RPP-based counterparts. However, it is well known that exfoliation methods suffer from poor repeatability and scalability, which make them incompatible with mass production and large area applications.Here, we achieved pinhole-free 2D Ruddlesden\u2013Popper Perovskite (RPP) BA Moreover, RPP layers benefit from a significantly enhanced stability in their optoelectronic operation, which entitles them as one of the solutions for the stability challenge in bulk perovskite layers5. Up to now, promising realizations of photodetectors, LEDs, and lasers have been reported based on RPP materials10, so that they seem attractive candidates for future optoelectronic applications11. In the Ruddlesden\u2013Popper phase a spacer molecule (barrier) isolates certain number of perovskite layers (well) along the z axis, serving as a surrounding capsule that improves stability by preventing penetration of humidity and other species to the perovskite layers13. The general formula of organo-metal halide perovskite Ruddlesden\u2013Popper phase is (R-NH3)2(A)n\u22121MnX3n+1, where R-NH3 is a hydrophobic large aliphatic or aromatic alkylammonium spacer cation. A is a monovalent cation sitting at the center of perovskite cubic structure and can be occupied with MA and FA. M stands for metals like Pb, Sn, and Ge, making ionic bond with halogens like I, Br, and Cl at the X site, and forming octahedrons with metal at the center and halogens at each corner that are responsible for high photo-absorption coefficient in RPP layers15. n is the number of octahedral layers between the spacer molecules, which determines the well width in the quasi-two dimensional structures of RPP layers. Multiple layers of metal halide octahedral can be formed with a cubic lattice structure with A atoms at the center and the aforementioned octahedrons at each corner of the cube. The barrier width between the layers in these quantum cascade structures is determined with the size of the spacer molecule and the width of alkyl ligand18.Two dimensional Ruddlesden\u2013Popper organo-metal halide Perovskite (RPP) layers are quantum well-structured materials, which have been applied first in solar cells in 2015, leading to an efficiency of 4%. Then, following research groups have pursued this field and enhanced the efficiency of RPP-based solar cells up to 21% in 2021nH2n+1NH3)2PbI4, which was attributed to the quantum confinement, and dielectric confinement in these 2D layers22. Regarding the dielectric confinement in RPPs, smaller dielectric coefficient of barriers than the wells reduces the screening effect of barriers, leading to stronger electron\u2013hole Columbic interactions all over the wells, and stronger exciton binding energy consequently23. Considering the attractive optoelectronic properties of RPPs, numerous research groups have reported different applications for them. In this line of research, Kondo et al.24 reported biexciton lasing in (C12)2PbI4. Scompus et al. reported a complete investigation of (BA)2(MA)n\u22121PbnI3n+1 from n\u2009=\u20091 to \u221e, and studied their performance in solar cells, while Dehghani et al. investigated nonlinear optics properties of RPP layers with n\u2009=\u20091,213. Tsai et al. deposited RPP layers by hot casting, which improved power conversion efficiency (PCE) of RPP-based solar cells from 4 to 12%5. Besides, they proved that layer thickness plays a key role in PCE of solar cells with vertical configuration and vertical carriers transport, due to barriers effect on carrier recombination27. In optoelectronic devices with lateral configuration, carriers transport through corner sharing octaherdas, without experiencing the barrier layers, leading to a superior charge transport expectation. However, this expectation did not occur in practice, because of the carrier scattering at the crystal grain boundaries with high trap densities29. Zhou et al. reported a lateral photoconductor, based on spin coated (BA)2(MA)n\u22121PbnI3n+1 with n\u2009=\u20091, 2, and 3, using Au contacts30, resulting in responsivities of 3, 7.31, and 12.78\u00a0mA/W and rise  times of 28.4 (27.5) ms, 8.4 (7.5) ms, and 10 (7.5) ms, for n\u2009=\u20091, 2, and 3, respectively. Loi et al. fabricated lateral phototransistors, based on hot cast (PEA)2(MA)n\u22121PbnI3n+1 with vertical heterostructures of RPP layers, wherein n gradually changes from 1 at the bottom to \u221e at the top of the film. They achieved outstandingly high responsivity of 149 A/W, and rise  time of 69 (103) ms31. Hwang et al. utilized hot casting method to fabricate RPP-based photodetectors, using (C4H9NH3)2(CH3NH3)Pb2I7, and achieved responsivity of 8.4 A/W, and detectivity of 1.2\u2009\u00d7\u20091012 Jones32. To date, all reported poly crystalline RPP layers suffer from low crystalline quality and pinholes or defects, which have led to photoresponse times of ms-scale, well below the reports based on exfoliated single crystal RPPs. However, it is well known that exfoliation methods suffer from poor repeatability and scalability, which make them incompatible with mass production and large area applications.Regarding the optoelectronic properties of RPPs, Ishihara et al. reported an extraordinary exciton binding energy of about few hundred meV for  BA2 for hot casting at 100\u00a0\u00b0C. This improved crystal growth is also observable in the relating PL spectra  to the surface bound excitons. It is obviously observed in Fig.\u00a041. The recorded absorption spectra of the investigated samples . Now, we spin coated a 1.8 molar solution of RPP/DMF with rotational speed of 3000\u00a0rpm for 40\u00a0s on the substrates. Figure\u00a02PbI4 layers, spin coated with 1000\u00a0rpm, 3000\u00a0rpm, 5000\u00a0rpm, and 7000\u00a0rpm, respectively. Considering that bright regions and dark regions correspond to crystalline grains and amourphous regions, we can assume the bright to dark surface area ratio as crystallization ratio, which is evidently increased from part (a) to part (d) of Fig.\u00a02, and the relating PL peak intensity is maximized simultaneously, indicating less probable Shockley\u2013Read\u2013Hall recombination due to less surface roughness and defects. From the photodetection aspect of view, as our main objective in this work, better grain interfaces in the prepared layer improves carrier transport, and photodetection performance consequently42.Then, we studied the effect of rotational speed in spin coating of a 1.8 molar RPP/DMF solution, at a fixed hot cast temperature of 100\u00a0\u00b0C. Figure\u00a043. Spreading enhancement of the precursor solution on the substrate, being exposed to the air environment, leads to solvent evaporation and supersaturation, crystal nucleation and enhanced crystal growth with aligned orientations in the layer44. Our presented characterizations prove that the substrate temperature, rotational speed and plasma treatment in hot casting affect the crystallization and grain size of the resulted RPP layers significantly, the observation which is attributed to the affected solvent evaporation rate and consequent supersaturation degree. Our observations are in agreement with previous reports, wherein higher degree of supersaturation at intermediate saturation range, has led to higher nucleation and crystal growth rate45; however, further increasing the crystallization rate has led to RPPs with smaller crystal grains44.As the next stage, we have studied the effect of oxygen plasma treatment (PT) of substrate prior to hot casting. Figure\u00a046. The isolated crystal islands, achieved from molarities lower than 0.1 molar are not suitable for the active layer in photodetection applications. Hence, we concentrated on precursor molarities higher than about 0.1 molar in the present work. Figure\u00a05\u00a0cm\u22121, 4.75\u2009\u00d7\u2009104\u00a0cm\u22121, and 8.87\u2009\u00d7\u2009104\u00a0cm\u22121 at wavelengths of 515\u00a0nm, 475\u00a0nm, and 420\u00a0nm, respectively, which are approximately consistent with previous reports5.To investigate the effect of RPP/DMF solution molarity on the achieved hot cast layers, we use different molarities for spin coating at the fixed rotational speed of 5000\u00a0rpm and hot cast temperature of 100\u00a0\u00b0C. We present the results of four different cases in Fig.\u00a013, and the spacing between the crystal planes is measured d\u2009=\u200913.6\u00a0nm (Table S1). Regarding these, we propose the periodic band diagram across the layer thickness of our prepared RPP layers (n\u2009=\u20091) in Fig.\u00a06 monolayers. The proposed periodic potential well is consistent with the relating previous studies47. The spacing between the crystal planes or the thickness of one stack in our RPP layer equals the summation of thicknesses of a single PbI6 monolayer and a single barrier (BA) layer. Since there is one layer of PbI6 octahedra in our prepared RPP layers (n\u2009=\u20091), the well width equals the sum of two Pb-I ionic bonds (6.4\u00a0nm), and the barrier length is achieved 7.2\u00a0nm\u2009=\u2009d-6.4\u00a0nm18. Moreover, the lowest unoccupied and highest occupied states of BA (barrier) correspond to 1.5\u00a0eV and 6.5\u00a0eV, respectively47. On the other hand, the electron affinity and ionization energy of MAPbI3, as the bulk limit case (n\u2009\u2192\u2009\u221e) of RPP layers (BA)2(MA)n\u22121PbnI3n+1, correspond to 3.6\u00a0eV and 5.2\u00a0eV, respectively. Regarding these bulk energy levels, Silver et al. have used Kronig-Penney method to calculate the ground states of conduction and valence bands in the RPP layer with n\u2009=\u20091 equal to 3.1\u00a0eV and 5.8\u00a0eV. Moreover, they calculated the exciton binding energy (EB) and exciton energy level as 300\u00a0meV and 3.4\u00a0eV, respectively47. Here, we have used the previously reported energy levels in band diagram of Fig.\u00a0B\u2009=\u20092.4\u00a0eV (\u2248\u2009517\u00a0nm). The latter absorption peak is consistent with our previously described free exciton PL peaks  is plotted versus different illumination power densities (Pin) for three different wavelengths, at the same bias voltage of 15\u00a0V. This plot indicates the highest photocurrents for blue illuminations, while the most linear Iph\u2013Pin characteristic corresponds to green illumination in the fabricated device. The photodetection responsivity is calculated by A is the active area of the photodetector (A\u2009\u2248\u2009600\u00a0\u00b5m\u2009\u00d7\u20091800\u00a0\u00b5m) and Idark is the dark current57. The achieved blue responsivity is plotted versus the applied voltage for various illumination power densities in Fig.\u00a0C and EV in this band diagram correspond to the conduction band and valence band of PbI4 well in Fig.\u00a0F stands for Fermi energy level of metal contacts, q and V correspond to the electron charge and the applied voltage between the metal contacts. Figure\u00a064.Then, we utilized and studied two different metal contacts, Au and Al, in our metal/RPP/metal photodetector. Figure S2 shows the I\u2013V characteristics of the fabricated Au/RPP/Au photodetector at the dark and green-illumination conditions. The measured linear I\u2013V characteristics reveal an ohmic contact between Au and RPP layer that is in agreement with the relating previous reports6 layers.To prove our expectation about the best photodetection behavior from the optimized precursor molarity of 0.5 molar, we present the photoresponse characteristics of a similar Al/RPP/Al configuration, but using precursor molarity of 1.5 molar in Figure S3. Moreover, Fig. S4 display the optoelectronic characteristics of RPP-based photodetector with precursor molarity of 0.5 molar. It is observable that the achieved responsivity for molarity higher than 0.5 molar is well below the optimum molarity, which is in agreement with our previous assumption of weaker carrier transport through thicker stack of alternating BA/PbI2. It is observable that the maximum responsivity is achieved for the RPP layer thickness of about 800\u00a0nm, which is consistent with our previous discussions about the device design parameters including RPP layer thickness  and 1500\u00a0nm (black-dashed curve), while confirms the maximum photoresponsivity to 450\u00a0nm for the RPP layer thickness of 800\u00a0nm (black-solid curve). Hence, RPP layer thickness of 300\u00a0nm (or 1500\u00a0nm), corresponding to precursor of 0.17 molar (or 1.5 molar), can be used to realize a broadband Al/RPP/Al photodetector with a nearly uniform responsivity in the 400\u2013520\u00a0nm wavelength range. The detectivity is also defined as q is the electron charge, and A is the active area57. The calculated detectivities reveal similar behaviors to the responsivities, as shown by red curves in Fig.\u00a08 Jones) for incident wavelength of 450\u00a0nm at layer thickness of 800\u00a0nm and power density of 0.5\u00a0mW/cm2. Similarly, detectivity proves an approximate wavelength independent behavior for 300\u00a0nm (and 1500\u00a0nm) layer thickness. To explain the observed responsivity behavior in Fig.\u00a02PbI4) can be estimated by 6), and 23. Considering the utilized bottom electrode configuration in our photodetector 3NH3I (BAI) is added to the PbI2 solution, initially producing a black precipitate, which is subsequently dissolved by continuing heating at 180\u00a0\u00b0C. Stirring is stopped after 5\u00a0min, and the solution is left to cool down to room temperature, during which orange rectangular-shaped crystalline flakes are formed. Then, using vacuum filtering BA2PbI4 flakes are separated from the solvent, and dissolved in DMF at 70\u00a0\u00b0C subsequently to achieve an appropriate and homogeneous precursor solution for hot casting step. It is well known that perovskite layers are incompatible with the processes that involve aqueous solutions, such as optical lithography. Thus, to fabricate the proposed metal/RPP/metal photodetector, we utilized the bottom electrode configuration, and first realized the metal interdigital electrodes on glass substrate. For this purpose, we cleaned the glass substrate by sonication in deionized water and 2-propanol, then exposed it to oxygen plasma for 10\u00a0min. As the next step, an Al layer with a thickness of 100\u00a0nm was deposited on the substrate by physical vapor deposition (PVD), and patterned to 30 pairs of interdigital electrodes with a length of about 600\u00a0\u00b5m. Spacing between the fingers and the fingers width are equally 20\u00a0\u00b5m, so that the whole dimensions of the electrodes pattern is about 1800\u2009\u00d7\u2009600\u00a0\u00b5m2. Then, to hot cast the RPP layers, the sample is heated, and transferred immediately on the spin coater to spin the prepared RPP/DMF solution for about 40\u00a0s.To synthesize the RPP layer, 500\u00a0mg of PbO powder is dissolved in a mixture of HI solution , and H3PO2 solution , while heating at 180\u00a0\u00b0C and stirring for about 5\u00a0min, which leads to a bright yellow solution product of PbISurface morphologies of all the samples are characterized with optical microscopy and scanning electron microscopy (SEM). X-ray diffraction (XRD) is used to study the crystalline structure of the prepared layers. UV\u2013Vis absorption and photoluminescence (PL) spectra are acquired to study the optical properties, while an excitation wavelength of 380\u00a0nm has been used for PL. To measure the response time of the realized photodetector, a 1\u00a0M\u03a9 resistor is applied in series with the investigated photodetector, while it is exposed to ON/OFF illuminating cycles.Supplementary Information."}
+{"text": "Multiple anatomical variations in the nasal cavity are well-described in the literature. We describe a rare case of pneumatization of the frontal sinus in the nasal septum that we term \"Septo-Frontal Cell\". To the best of our knowledge, this pattern of nasal septum pneumatization has not been described in the literature before. We have discussed the clinical\u00a0and radiological findings and management of this patient. Identifying and understanding the complex three-dimensional structures of the nasal cavity and paranasal sinuses (PNS) along with their frequent anatomical variations is crucial for otolaryngologists in the planning of sino-nasal, nasal, and other skull-base surgeries . MultiplA 39-year-old Middle Eastern male patient, not known to have any comorbidities, presented to our ENT clinic with a complaint of long-standing, left-sided nasal obstruction, associated with recurrent episodes of headache. The patient had no history of rhinorrhea, facial pain, reduced smell sensation, recurrent sneezing, nasal itchiness, nasal trauma, or previous nasal surgeries.The general physical appearance revealed a healthy-looking adult with no craniofacial abnormality and the nasal examination showed severe right-sided columellar dislocation\u00a0and left-sided septal deviation with bilateral moderately enlarged inferior turbinate more on the right side. Internal nasal examination using a zero-degree endoscope showed a left nasal septal spur touching the left inferior turbinate; otherwise, the remaining nasal examination was within normal limits.A CT scan of paranasal sinuses showed a left nasal septal spur contacting the left inferior turbinate with a pneumatized bony nasal septum continuous with the left frontal sinus and a pneumatized crista galli\u00a0Figure .The patient underwent septoplasty with bilateral submucosal diathermy of the inferior turbinate, intra-operative findings showed an S-shaped nasal septum with columellar dislocation to the right side, severe left-sided septal spur, and deviated maxillary crest to the left. The pneumatized part of the nasal septum was not obstructing the airway and hence was not corrected Figure . The patAnatomical sino-nasal variations, such as the deviated nasal septum, the presence of agger nasi, Haller and Onodi air cells, concha bullosa, and paradoxical middle turbinate, are commonly seen among the population ,3. PneumThe preoperative CT scan sinus in our patient shows in addition to the nasal spur, which is causing the patient\u2019s symptoms, an over-pneumatized frontal sinus along with bilateral agger nasi, a pneumatized crista galli, and a frontal septal cell. These findings are not uncommon, agger nasi cells are seen anterior to or just above the insertion of the middle turbinate in the lateral wall, and their reported prevalence ranges from 10% to 90% \u00a0while thThe pneumatized nasal septum, when present, is usually related to the sphenoid sinus \u00a0and is nGiven the patient's complaint of nasal obstruction secondary to the deviated nasal septum, the patient opted for nasal septoplasty.\u00a0A tailored approach for the septoplasty was crucial to avoid a potential anticipated complication, as the inadvertent opening of this cell can lead to either frontal sinus fistula in the septum or recurrent frontal sinusitis. Therefore, intraoperatively, we carefully corrected the nasal septal deviation by removing the left nasal septal spur while avoiding over-resection of the nasal septum; the Septo-Frontal Cell remained intact.To the best of our knowledge, this is the first case that describes a pneumatized anterior nasal septum continuous with the frontal sinus while a rare anatomical variation, shedding light on the possibility that the condition can lead to potential complications in a patient undergoing nasal surgeries. The role of routine preoperative PNS CT scans in patients undergoing septoplasty is controversial given the adverse effect of radiation and the increased cost ,11. HoweThis unique case highlights the previously unreported pneumatized anterior nasal septum continuous with the frontal sinus, which we have termed the \"Septo-Frontal Cell\", and its potential complications that may arise during nasal surgeries. The routine use of preoperative PNS CT scans remains a topic of debate. Our case underscores the potential value of such scans in assessing nasal anatomy and identifying variations to reduce avoidable surgical failures and complications."}
+{"text": "There are many methods and types of equipment for measuring the nasal airway, but there is no consensus regarding the results of various clinical studies on nasal obstruction. In this review, we discuss the two major methods of objectively assessing the nasal airway: rhinomanometry and acoustic rhinometry. The Japanese standard of rhinomanometry in Japanese adults and children was established by the Japanese Standardization Committee on Rhinomanometry in 2001 and 2018, respectively. However, the International Standardization Committee has proposed different standards because of differences in race, equipment, and social health insurance systems. The standardization of acoustic rhinometry in Japanese adults is making progress in several Japanese institutes, but the international standardization of acoustic rhinometry has not yet begun. Rhinomanometry is the physiological expression of nasal airway breathing, whereas acoustic rhinometry is the anatomic expression. In this review, we introduce the history and methods of the objective assessment of nasal patency and the physiological and pathological issues regarding nasal obstruction. Nasal obstruction is a well-known manifestation of many nasal diseases, such as allergic, infectious, hypertrophic, and atrophic rhinitis; acute and chronic sinusitis; nasal polyps; nasal septal deviation and perforation; nasal and paranasal sinus tumors; stenotic malformations; and psychiatric nasal obstruction. Nasal obstruction induces mouth breathing, causing dryness of the mouth; dysosmia or anosmia with taste problems; nasal speech; headache; reduced attentiveness; snoring; daytime sleepiness; and obstructive sleep apnea (OSA). How do we objectively evaluate nasal obstruction? How do objective and subjective nasal congestion relate to each other? Are there any human racial differences in nasal patency?4 and the Japanese Standardization Committee on Objective Assessment of the Nasal Airway (JSCOANA),6 we have been dedicated to the development of this field since each committee was established. In this review, we discuss many of our major achievements, including studies on the objective assessment of nasal obstruction.The Department of Otolaryngology at Fujita Health University has conducted many investigations in an effort to answer these questions. As active members of the International Standardization Committee on Objective Assessment of the Nasal Airway (ISCOANA)2. 7 placed a cold mirror immediately under the nostril and observed the mirror for fogging by expiratory nasal airflow. In 1895, Kayser8 used the aerodynamic concept to assess nasal airflow. Rhinomanometry was developed as a superior method of objectively assessing nasal patency. Rhinomanometry is classified as either active or passive, and these two types are further divided into anterior and posterior techniques.9 The use of passive rhinomanometry has been gradually declining because of its unnaturalness and instability.10 Active rhinomanometry is a well-established method of objectively evaluating nasal patency (3/s) and the differential transnasal pressure between the anterior nostril and the posterior choana  of quiet nasal breathing. Nasal resistance  is calculated as an objective expression of nasal patency:T) (see Section 3.1). In recent decades, however, this method has been somewhat neglected because of its failure to measure postnasal pressure via the oral cavity.12 Active anterior rhinomanometry samples the postnasal pressure in one nasal cavity with the nostril occluded instead of the oropharynx. Several researchers have found this method to be easier than active posterior rhinomanometry for many clinicians and recommend it as a standard method.14In the early phase of the objective assessment of nasal patency, Zwaardemaker patency . PneumotR), commonly calculated using Eq. 1, is applied to laminar flow. However, the actual alternating nasal airflow is considered nonlaminar, even under resting conditions.17 Despite the efforts of many investigators,19 this anomaly between empirical measurement and Eq. 1 remains subject to discussion.Nasal resistance . The time-averaged R was almost identical to that obtained from Eq. 1 at peak flow, and R at 150\u00a0Pa was smaller than that obtained from the former two methods.30Some researchers31 estimated the area under the pressure\u2013flow curve (integrated R), and Broms et\u00a0al.32 measured the angles at which the curves crossed circles at predetermined radii. Unfortunately, these two methods do not seem able to logically represent the true R.Naito and Unno33 Additionally, racial differences are an international 36problem. ISCOANA was established to recommend standardized methods of measuring and expressing rhinomanometric results 4.1\u20134 In 1993, JSCOANA of the Japanese Rhinologic Society was established to focus Japanese opinions in the ISCOANA meeting.5 Naito, the first author of this review, attended international meetings from 2008 to 2019 as a representative of JSCOANA.5 In 2011, our department was a main sponsor of an international meeting on objective assessment of nasal airflow in Tokyo, Japan  and patients\u2019 perception of nasal congestion should also be discussed.In 1989, acoustic rhinometry was developed. This technique depicts consecutive sectional areas of the nasal cavity and intranasal volume measured by sound reflection from the equipment.3. 3.1. 10 Active rhinomanometry, in which \u0394P and R13; however, this method has been somewhat neglected because of failure to measure postnasal pressure via the oral cavity. It is much easier to measure R using active anterior rhinomanometry, which has been recommended as a standard method of rhinomanometry by ISCOANA and JSCOANA. Unfortunately, however, this method cannot measure R in patients with septal perforation and complete unilateral nasal obstruction.38Passive anterior and posterior rhinomanometry is not physiological because artificial air is forcibly compressed into the nose from the anterior nostril or, conversely, from the oropharynx to the nasal cavity, and the grades of the air forced through the nose are evaluated.T), only unilateral R can be measured. T can be calculated using the following equation of Ohm\u2019s law for parallel resistors:R is nasal resistance on the right side and L is nasal resistance on the left side.39Although active posterior rhinomanometry can measure instantaneous bilateral nasal resistance  through the nasal cavity to the nasopharynx instead of applying a mouth tube.40 This method can measure R much more easily than using a mouth tube, and the R values obtained from the mouth and nasal catheter are almost identical. However, although the catheter is fine, we still need to consider irritable stimulation by the catheter; this is especially true in patients with allergic rhinitis, who usually have hypersensitivity of the nasal mucosa.As mentioned previously, active anterior rhinomanometry cannot be performed on patients with septal perforation or complete unilateral nasal obstruction.R measured by this instrument is not affected by masks or nozzles placed on the nose.41 However, a body plethysmograph is a large device that requires a large space, and many clinicians hesitate to use it. Miljeteig et\u00a0al.42 found almost identical R values measured by a head-out body plethysmograph with or without a mask. Thus, ISCOANA has recommended active anterior rhinomanometry with a mask as a standard method.4 In contrast, we compared R values measured by a head-out body plethysmograph with and without a mask or a nozzle on the nostril.43 There was a significant difference between the two groups with and without a mask but no significant difference with and without a nozzle.43 JSCOANA also applied a nozzle instead of a mask for active anterior rhinomanometry as a standard technique in Japan.6Active rhinomanometry requires a mask , a nozzlR values and nostril sizes and shapes in normal adult Whites, Asians, and Blacks and found significant differences among them.34 Further discussions are still required for better international agreement.The inconsistencies in these measurements might be caused by anatomical differences among human races. We compared 3.2. \u0394P during spontaneous nasal breathing, and R can be calculated using Eq. 1. The equation describes the relationship between \u0394P and 44 This discrepancy between empiric measurement and the equation is still unresolved.Most researchers in nasal physiology and pathology simultaneously determine R at \u0394P=150\u00a0Pa,4 whereas JSCOANA has recommended measuring R at 100\u00a0Pa in Japanese adults.6 In practice, even in Whites, we found that 24% of 285 measurements did not reach the point of \u0394P=100\u00a0Pa.23 To measure R at these points, voluntary hyperventilation is required instead of quiet breathing in many cases; however, voluntary hyperventilation is neither quiet nasal breathing nor physiologically normal.ISCOANA has recommended measuring 45 suggested the formulak1 is the coefficient of laminar flow and k2 is the coefficient of turbulent flow.Therefore, equations can be adjusted to fit a pressure\u2013flow curve. R\u00f6hrerR values at 150\u00a0Pa from Eq. 5 with actual measurements at the same point to determine the usefulness of the method.38 The relationship between calculated and measured R values at 150\u00a0Pa on expiration wasWe compared R values from Eq. 5 were almost identical to the actual measurements on both expiration and inspiration. We considered the calculated R values at 150\u00a0Pa from Eq. 5 to be comparable with the actual measurements; additionally, we were able to estimate R at any predetermined points regardless of whether the pressure\u2013flow curve attained the point .23The 46 revealed that the pressure\u2013flow curve for defining R is better described byn is the coefficient of nonlaminar flow.Fischer16 demonstrated n to be 1.85, and Dallimore and Eccles47 assumed n=2. They believed that most airflow through the nose during spontaneous breathing should be turbulent. In our further studies of Japanese normal adults,23 we presented the exact relationship and coefficient as48 demonstrated that n=1.5 for occidental normal adult individuals and found that the characteristics of airflow through the nose are transitional and not laminar or turbulent. However, these complex equations and coefficients are not used in the clinical setting.Eichler and LenzR in adults. The current Japanese and international standards for adults are shown in 6Further international discussions are required to establish a proper standard, even for R values in children worldwide has been conducted.49 JSCOANA proposed the standard values of R in Japanese children in 2018  to cool (7\u00b0C) significantly increased R in patients with allergic rhinitis but not in healthy subjects, regardless of whether the air was dry or moist. Additionally, R in patients with perennial allergic rhinitis increased after heated (42\u00b0C) aerosol inhalation through the nose, whereas no changes occurred in healthy subjects with hyperthermal stimulation.73 An allergic nasal mucosa responds more strongly to various ambient or local irritants than does a healthy mucosa. We also observed markedly reduced R74 and more pronounced effects of exercise on the nasal mucosa in patients with allergic rhinitis than in healthy subjects.75No studies have focused on the nasal airway under completely controlled environmental temperature and humidity. We measured 76 There is no significant change in the total resistance of the combined nasal cavities in a healthy nose. Although severe unilateral obstruction has been noted in both recumbent and sleeping subjects, an increase in resistance of the congested nasal cavity does not exert a major effect on total resistance.77 The nasal cycle and its modifications are sensitive indicators of widely distributed, reciprocating neuroautonomic activity, and although an interesting source of speculation, these vascular responses do not necessarily perform a functionally useful role in the nose.44Autonomic alternative changes in nasal congestion and decongestion occur in healthy humans. The apparently spontaneous nasal cycle is irregular in frequency and amplitude, and reciprocity between sides is fairly constant. The term \u201cnasal cycle\u201d is well established and widely recognized.6 to prevent this possible influence, subjects must relax in the sitting position for 10 min before R measurement under ordinary room temperature and humidity , whereas in the Japanese patients, the reasons for nasal obstruction were related to indirect factors . Therefore, these differences may be related to nationality and anthropological characteristics.The relationship between subjective and objective nasal patency in Canadian patients differs from that in Japanese patients.R might be important. To express the salient features of nasal breathing behavior, we measured the acceleration of nasal airflow86:A is acceleration, t is the time from the commencement of breath to the peak flow point  is then calculated aspiration .86 The nasal airflow acceleration and the PFI are useful as objective indicators of the sensation of nasal congestion and can complement the diagnosis of subjective nasal obstruction.During quiet nasal breathing, the nasal breathing behavior in subjects without congestion tended to exhibit higher acceleration and a smaller PFI on inspiration through a wide range of R values.The relationship between objective evidence of nasal patency and subjective symptoms is still unclear, and further studies are needed to define useful subjective criteria in patients with nasal obstruction.3.5. 37 Acoustic rhinometry can assess the narrowest part in the nasal cavity without difficulty. The underlying principle88 is as follows. An audible sound  propagating in a tube is reflected by local changes in acoustic impedance. Assuming no losses and no changes in acoustic impedance, the sound travels forever in the tube. In a tube with an alternating diameter or in the nasal cavity, the sound is reflected by changes in acoustic impedance due to the alternating cross-sectional area. If the signals of the incident and reflected waves are recorded in a time domain, we can determine the distance to the local impedance change; additionally, by comparing the incident and reflected waves, we can determine the size of the change in the cross-sectional area. We can then measure consecutive cross-sectional areas and volumes in the nose using acoustic rhinometry.In 1989, acoustic rhinometry was developed as another method of objectively assessing nasal patency .37 Acous89 were the first to determine the actual sound direction in the nasal cavity using an acoustic rhinometer and the exact cross-sectional area angles in the nasal cavity using an adult-size artificial nasal model scanned by three-dimensional computed tomography and acoustic rhinometry. The most identical values of the cross-sectional areas between those measured by computed tomography and by acoustic rhinometry were the combined line between the top and bottom of the nasal cavity equivalently deferred from the anterior nostril. Consequently, the most feasible direction of sound waves in the nasal cavity was the sequence of 90\u00b0 to these cross-sectional area inclinations. The cross-sectional areas (cm2) at the I-notch (isthmus nasi) and C-notch (head of the inferior turbinate)  and volumes (cm3) from the nostril to the posterior 4\u00a0cm (0\u20134\u00a0cm) and the posterior 7\u00a0cm (0\u20137\u00a0cm) are representative evaluating expressions of acoustic rhinometric measurements. Acoustic rhinometric measurements only demonstrate width; they do not explain the shapes of the nasal cavity or the aerodynamic physiology.90 We feel that rhinomanometry and acoustic rhinometric measurements are valuable as objective indicators of the nasal airway, but we should consider the characteristics of the two methods.In 2004, Saito et\u00a0al.88 demonstrated that the minimum cross-sectional area was not correlated with the sensation of nasal obstruction in patients with hay fever, while Roithman et\u00a0al.91 found a significant relationship between the unilateral minimum cross-sectional area and the sensation of nasal obstruction. However, they found no simple relationships between rhinomanometry and acoustic rhinometry.91 This is why the two methods probably do not reveal simple mathematical relationships.88 We compared the perception of nasal obstruction by rhinomanometric and acoustic rhinometric assessments before and after nasal or sinus surgery in 50 Japanese patients.90 Before surgery, there were significant relationships between the R values on expiration or inspiration and the perception of nasal obstruction and nasal volume (0\u20134 and 0\u20137\u00a0cm). Subjective nasal congestion, R, and acoustic rhinometric expression  significantly improved after surgery. Acoustic rhinometry facilitates static and anatomic evaluation of the nasal cavity, while rhinomanometry facilitates dynamic and physiological assessment. However, these 3 factors of nasal patency relatively coincided with each other in the 50 Japanese patients. The relationship between objective and subjective nasal patency in patients from different countries may be associated with nationality and anthropological characteristics. These factors make mutual relationships more difficult to identify.Lane et\u00a0al.ISCOANA has still not established international standards for how to evaluate and average acoustic rhinometric values. JSCOANA is currently trying to finalize standard values for normal Japanese adults. After finalization, we can discuss the differences in the standards of acoustic rhinometry between Japan and other countries.3.6. 92 Many Japanese people have nasal obstruction due to allergic rhinitis. Bilateral nasal resistance (T) due to cedar pollen in patients with pollinosis moderately coincides with floating pollen counts.96 Furthermore, in patients with hay fever, OSA is aggravated during the pollinating season.97 Patients with allergic rhinitis are treated with oral or topical medicines or surgery. Determining the grades and sites of nasal obstruction may be important for accurately diagnosing and treating allergic rhinitis. How do we, as clinicians, accurately evaluate the grades and sites of nasal obstruction in patients with allergic rhinitis? How do we objectively evaluate the effectiveness of treatment? Can exposure of the nasal mucosa to antigen or histamine in patients with allergic rhinitis help to objectively evaluate the severity? Several investigators have compared the subjective sensation of nasal congestion using a visual analog scale (VAS), intranasal inspection, and objective assessments of nasal obstruction by rhinomanometry or acoustic rhinometry before and after exposure of the nasal mucosa to antigen or histamine.99 The recent European Academy of Allergy and Clinical Immunology (EAACI) position paper on nasal antigen provocation tests in patients with allergic rhinitis reported how to evaluate perceptive nasal obstruction, rhinoscopic findings, and objective measurements by rhinomanometry or acoustic rhinometry.100 We can use this position paper for suitable evaluation of patients with allergic rhinitis in daily practice.In recent decades, the number of individuals in Japan with specific immunoglobulin E to mites or pollen has significantly increased.R in patients with complete nasal blockage after antigen exposure. This is a disadvantage of active anterior rhinomanometry in antigen challenge tests. Therefore, we believe that acoustic rhinometry is preferable in antigen or histamine challenge tests of the nasal mucosa because few patients are excluded after stimulation.101 Wakabayashi et\u00a0al.102 used acoustic rhinometry to evaluate the effectiveness of pranlukast dry syrup in children with cedar pollinosis before and after pollen exposure.Active anterior rhinomanometry, the standard method of objectively assessing nasal patency recommended by ISCOANA and JSCOANA, cannot measure 103 We compared nasal R values in two groups of patients with perennial allergic rhinitis: those treated with hyperthermia and those who were untreated. We found that the R values after a house dust challenge to the nasal mucosa were significantly lower in the hyperthermia group than in the untreated group.72 Furthermore, in another study, the R values after a histamine challenge showed no significant differences between the treatment group and healthy subjects.73 Local heated aerosol inhalation therapy may suppress both antigen-specific and antigen-nonspecific hypersensitivity of the nasal mucosa in patients with allergic rhinitis.Using intranasal heated aerosol inhalation to cause local hyperthermia is an effective and safe treatment, especially for pregnant women with allergic rhinitis. Determining the underlying local hyperthermia in patients with allergic rhinitis is important.3.7. 104 found no significant differences in R values measured by active anterior rhinomanometry between patients with OSA and healthy subjects. However, some investigators doubt the conclusion of this single report and emphasize that nasal obstruction can cause impaired quality of sleep and contribute to OSA.107Nasal obstruction may accompany OSA. In 1992, Miljeteig et\u00a0al.108 compared high- and low-R groups of patients with symptoms suggestive of OSA and found that the high-R group had a significantly higher snoring index and that a unilateral high R was significantly correlated with the respiratory disturbance index, which is an indicator similar to the apnea\u2013hypopnea index. Zwillich et\u00a0al.109 showed that apneas, sleep arousals and awakenings, and loss of deep sleep occur during nasal obstruction. Friedman et\u00a0al.110 reported that most patients with OSA are aware of improvement in nasal and sleep symptoms after correction of nasal airway obstruction, but nasal surgery alone does not consistently improve OSA. They also noticed that nasal airway reconstruction may contribute to a decrease in continuous positive airway pressure levels and improvement in oxygen saturation. Nakata et\u00a0al.111 showed that nasal surgery helps to improve sleep quality and daytime sleepiness.Li et\u00a0al.112 showed that patients with rhinitis are significantly more likely to report habitual snoring or chronic excessive daytime sleepiness and that habitual snorers have significantly lower nasal airflow than nonsnorers. Colas et\u00a0al.113 found that sleep quality is worse in patients with severe allergic rhinitis and that nasal obstruction is associated with poorer sleep quality. Hara et\u00a0al.114 discovered that 4 weeks of pranlukast administration in patients with perennial allergic rhinitis improves sleep disorder symptoms and is significantly correlated with improvement in nasal congestion.In their study of 911 participants, Young et\u00a0al.Overall, nasal obstruction is significantly associated with not only snoring, daytime somnolence, and sleep quality but also OSA. Rhinologists must consider the possibility that nasal obstruction can accompany sleep disorders.115 found that the rhinomanometric and acoustic rhinometric results in children with OSA significantly improved after adenoidectomy or tonsillectomy for OSA treatment. Satisfactory sleep after surgery may regulate their physical conditions and secondarily increase their nasal patency.Kihara3.8. 118 In Japan, no such research has been performed. We studied 150 Japanese patients with chronic rhinosinusitis and found that 60% of the patients had headache or facial pain; additionally, rhinoscopic inspections, rhinomanometric results, and sinus X-rays revealed no consistent relationships with the presence, site, or severity of craniofacial pain.119 Neurotic factors might play a significant role in causing headache and facial pain. Therefore, we used the Cornell Medical Index-Health Questionnaire (CMI)120 to assess neurotic tendency in the following series.121 Although no significant differences in CMI grading were found between the headache and pain-free groups, individual variability could not be excluded. In the same study, 85% of the patients noted cure or improvement of headache or facial pain after surgery. However, no significant differences were found in the postoperative reduction rate in R values between the headache and pain-free groups, indicating that increased R alone is not sufficient to cause pain in most patients. Further investigations are still needed to determine the cause of this pain.In Europe and North America, several reports have discussed chronic headache and facial pain due to chronic rhinosinusitis that was treated by surgery.3.9. 123 After palatal closure surgery in these children, speech therapy is required to achieve proper articulation. However, hypernasality remains in some cases despite the appropriate performance of postoperative speech therapy,124 and pharyngeal flap construction surgery is therefore required. However, attention must be paid to complications such as mouth breathing, snoring, OSA, underdevelopment, otitis media with effusion, bradycardia, and cardiac arrest after these surgical procedures.124 The indication for pharyngeal flap construction surgery should be strict and impartial. To appropriately evaluate velopharyngeal incompetence in these children, rhinomanometry is used to detect airflow leakage through the nose during articulation of \u201ca,\u201d \u201cshi,\u201d and \u201cnu\u201d.124 We detected airflow leakage through the nose during articulation of \u201ca\u201d or \u201cshi\u201d in children with velopharyngeal incompetence and during articulation of \u201cnu\u201d in healthy children, and competent and incompetent children    has been4. 125 Nasal patency or obstruction is pathophysiologically important. We hope this review is regarded as the current landmark of research on the objective assessment of nasal obstruction.Objective assessment of nasal patency is well established, but several minor problems remain to be resolved . Thus, continuous research is required to develop more appropriate and simplified methods and equipment for objective assessment of nasal patency. Furthermore, this superior procedure of objective assessment of nasal passage should be expanded into the domain of the relationship between nasal breathing and sports because exercise and nasal or mouth breathing are important in the field of sports medicine."
\ No newline at end of file