diff --git "a/deduped/dedup_0264.jsonl" "b/deduped/dedup_0264.jsonl" new file mode 100644--- /dev/null +++ "b/deduped/dedup_0264.jsonl" @@ -0,0 +1,41 @@ +{"text": "Two major questions were addressed in this paper. Firstly, the cause of DNA periodicity, which was investigated by comparisons between real and simulated coding sequences. Secondly, quantification of DNA periodicity was made using an evolutionary algorithm, which was not previously used for such purposes.The periodic pattern of DNA in exons is a known phenomenon. It was suggested that one of the initial causes of periodicity could be the universal at each location along phase 0 exons were calculated for C. elegans, D. melanogaster and H. sapiens. Two models were used to fit these data, with the key objective of describing periodicity. Both of the models showed that the best-fit curves closely matched the actual data points. The first dynamic period determination model consistently generated a value, which was very close to the period equal to 3 nucleotides. The second fixed period model, as expected, kept the period exactly equal to 3 and did not detract from its goodness of fit.Frequencies of the nucleotides (and the dinucleotide Conclusion can be drawn that DNA periodicity in exons is determined by codon usage frequencies. It is essential to differentiate between DNA periodicity itself, and the length of the period equal to 3. Periodicity itself is a result of certain combinations of codons with different frequencies typical for a species. The length of period equal to 3, instead, is caused by the triplet nature of genetic code. The models and evolutionary algorithm used for characterising DNA periodicity are proven to be an effective tool for describing the periodicity pattern in a species, when a number of exons in the same phase are analysed. Periodicity of DNA in exons, with the period being equal to 3 nucleotides, has been well known for some time -6. This nRNY)pattern , which probably was inherited from the earliest mRNA sequences [The triplet code has undergone evolution itself, from the earliest form of the triplet code to what exists today. The universal DNA periodicity observed in exons suggests a of real species as the only source of information. The computer program GENERATE, which was used in these experiments, composed artificial coding sequences using CUF of several species as the only source of information. Thus despite random choice the frequencies of codons in simulated sequences were very similar to the real CUF.Adenine nucleotides in real Drosophila melanogaster exons (phase 0) and in simulated . In the simulated coding sequences periodicity is also highly pronounced and the periodicity patterns observed in D. melanogaster exons and simulated sequences are nearly identical . Periodicity of other nucleotides was also observed and it shown high similarity in both DNA of real exons and simulated sequences (data are not shown). The obvious conclusion following from this study is that CUF, which was the only source of information for the simulated coding sequences, is the crucial factor determining periodicity.As an example of these experiments, Figure d Figure coding sl Figure &1B. OthAdenine and Thymine (data are not shown) was caused by the fact that 3 stop codons and the corresponding combinations of nucleotides were present in the simulated coding sequences in different and much lesser frequencies than other codons. Cytosine, which is not a component of any stop-codon, does not show periodic pattern at all because frequencies of Cytosine containing codons were equal to frequencies of all other non stop codons. Finally, when frequencies of all codons, including stop codons, were made equal, no periodicity was observed in the simulated sequences with moolution, .AG was run through the analysis for both dynamic period determination best-fit curve, and the static period of 3 best-fit curve. This was done for the three studied species, C. elegans, D. melanogaster and H. sapiens for phase 0 exons. Several other dinucleotide pairs also shown clear periodicity patterns in exons (data are not shown). AG was used in this paper as an example. Introns were only run through the analysis for dynamic period determination and did not show clear and stable periodicity.To test if the above method could identify a quantifiable period in exons, several tests were performed. All phase 0 exons were extracted from the EID database, described in Material and Methods. This procedure dramatically enhanced the visible periodicity compared to exons of all three phases Figure .. Once tAG for C. elegans, D. melanogaster and H. sapiens phase 0 exons. These curves were created using model 1, in an attempt to find a periodicity within the given data. The first few positions of exons are frequently under different selection pressures, which do not always conform to the same pressures as the remainder of the exon. It was for this reason that the algorithm was run starting from position 20 to position 100 in exons.Curves of best-fit were created for the four separate nucleotides and the dinucleotide C. elegans, D. melanogaster and H. sapiens as they were determined by the analysis. The amplitude of the periodicity was measured as the variation from the center-point of the sine curve. As mentioned earlier, the criterion value of goodness of fit is the sum of squared deviations between observed frequencies and frequencies predicted by the model with the prevailing parameters. This means that as the analysis runs through its generation cycles, it finds better fitting curves as it goes along and replaces the previous curve of best-fit. The criterion value is a reflection of this process, in that as it gets closer to zero, the closer the curve of best-fit represents actual data. The data show that in all cases, the determined period is very close to 3 in exons for all three species for all nucleotides and the dinucleotide pair AG. The range of periods goes from a low of 2.990391 in C. elegans nucleotide C, a difference from 3 is ~0.0096, to a maximum of 3.019349 in C. elegans dinucleotide pair AG, a difference from three of ~0.0193. The criterion values of goodness of fit are also very low for exons, with the largest among them at 0.0093573 in H. sapiens nucleotide C.Table A and actual frequencies of nucleotide A in exons of the three studied species can be seen in Figure AG. Best-fit curves for nucleotides C, G and T are not shown. The blue points on the graph represent data points predicted by fitting model 1 to actual data, represented by pink points. As can be seen in the graphs, the blue best-fit curves in both Figure A comparison between the best-fit curves for nucleotide Adenine in C. elegans D. melanogaster and H. sapiens phase 0 exons with the period fixed at three. Figure AG in 0 exons in the same species. In both sets of graphs, pink points represent actual frequencies of nucleotides and the dinucleotide pair, AG, while the blue points represent the optimized curve of best-fit for these frequencies. It is clear from the graph that keeping the period fixed at exactly three in exons does not detract from the accuracy of the curve of best-fit. The curve of best-fit is remarkably similar to the actual data points.The data were then fitted to model 2, keeping the period fixed at 3. With this algorithm, the ideal best-fit curve would remain nearly in the same pattern. Again phase 0 exons were used as sample data. Figure The fact of DNA periodicity in exons, as well as the lack of periodicity in introns, is known for some time -6. \"SuchC. elegans than for the two other species under consideration.The results presented in this paper also demonstrate effectiveness of the evolutionary algorithm and the both models used to identify a periodicity pattern in exons. Although periods, which are seen in Table Introns do not show any specific period that can be determined by the analysis (results are not shown). Although the analysis does produce a period for each data set given, these periods are not consistent with each other, and the predictions do not fit the data well. As introns are not composed from codons, this is an additional indication supporting the conclusion that CUF determine periodicity pattern in exons.Since only exons show a strong periodicity of three, this type of analysis can be in principle used as an additional component of exon finding tools. Such possibility was already considered . UnfortuConclusion can be drawn that DNA periodicity in exons is determined by codon usage frequencies. It is essential to differentiate between DNA periodicity itself, and the length of the period equal to 3. Periodicity itself is a result of certain combinations of codons with different frequencies typical for a species. The length of period equal to 3, instead, is caused by the triplet nature of genetic code. The models and evolutionary algorithm used for characterising DNA periodicity are proven to be an effective tool for describing the periodicity pattern in a species, when a number of exons in the same phase are analysed.C. elegans, D. melanogaster and H. sapiens, was extracted from the exon-intron database (EID), which was compiled in the W. Gilbert laboratory, Department of Molecular and Cellular Biology, Harvard University [C. elegans 14,836 genes and 98581 exons; D. melanogaster 13,361 genes and 58,801 exons, H. sapiens 7150 genes and 47908 exons.Information relevant to iversity . The datThis program calculates frequencies of nucleotides or any combination of nucleotides in a database. exScan align all exons in the database at either the 5' or 3' end. The program then searches the exons for given sequences and give a summary of the sequences found. exScan was used in order to obtain the frequencies for nucleotides and dinucleotide pairs in each position of exons aligned at the 5' end. A summary of the program's operation follows:- Command line for exScan selects the database to be used for searching.- The string(s) to be searched are also entered into the command line.- ExScan then aligns the exons by the 5' end and searches each exon for all matches to the search strings.- The output of the program will provide the number of matches for each search string entered at every position along the aligned exons.- These numbers are then converted into frequencies.ExScan is written in the C++ programming language; its full description and the program itself are available upon requestThe program simulates a required number of coding sequences, using as an input file CUF for a particular species and a generator of random numbers. Inclusion of stop-codon in a coding sequence terminates the gene. There are options, which allow establishing a minimal and a maximal length of genes as well a shape of gene length distribution. GENERATE was used in this study to show how CUF alone could create periodicity, even in randomly created sequences, which do not code for any real protein. The procedure when running GENERATE follows:. Thus, despite random choice the frequencies of codons in simulated sequences were very similar to the real CUF.- GENERATE accepts as input a file containing usage frequencies of all 64 codons. These codon usage frequencies for different species were taken from the database located at - These frequencies are then used to construct a requested number of artificial genes, with the codons chosen randomly based on their frequencies.ATG, and will terminate once a stop codon is randomly chosen.- Artificial genes all start with - The artificial genes can then be used as a separate database for analysis with exScan as above.GENERATE was written in the C++ programming language. Description of the program and program itself are available upon request.The specific method used for fitting the two periodicity models was Differential Evolution (DE). As DE is a widely applicable method of general utility for optimization, the reader is directed to Storn and Price for detab parameters and is characterized by its fitness .- A population of candidate solutions is established. Each population member is constituted by a randomly sampled set of generation. A challenger is constructed as follows:- For each population member, a challenger is constructed. If this challenger has superior fitness, it will replace the population member in the next a, b and c. Each parameter is then addressed in turn. With probability CR (CR = 0.4 was adopted) the parameter is simply taken from the population member that the challenger is challenging. Otherwise, a new parameter value is constructed as the value for member a plus F times the difference of the values for b and c. For this application, F = 0.4, except F = 1 every fourth generation and F = 2 every seventh generation, to help avoid local optima. In addition, mutation independent from differences between other solutions was invoked periodically, also to help avoid local optima.- Three other population members are chosen at random. We can label these as - Successful challengers replace their respective population members, and, together with surviving members constitute a new generation with higher mean fitness. The process continues over sufficient generations to achieve convergence close to an optimal solution, with the most fit solution being chosen.None declared.SE conducted the data analysis and was involved in drafting the manuscript. FE designed and wrote the code for the C++ computer programs. BK assisted with the manuscript and wrote the code for modeling and fitting periodicity. AR drafted the manuscript, performed statistical analysis, conceived the study and participated in its design and coordination. All authors read and approved the final manuscript."} +{"text": "High blood pressure is a well established risk factor for morbidity and mortality acting through heart disease, stroke and cardiovascular disease. Genome wide scans have linked regions of nearly every human chromosome to blood pressure related traits. We have capitalized on beneficial qualities of the Old Order Amish of Lancaster, PA, a closed founder population with a relatively small number of founders, to perform a genome wide homozygosity by descent mapping scan. Each individual in the study has a non zero probability of consanguinity. Systolic and diastolic blood pressures are shown to have appreciable dominance variance components.Areas of two chromosomes were identified as suggestive of linkage to SBP and 5 areas to DBP in either the overall or sex specific analyses. The strongest evidence for linkage in the overall sample was to Chromosome 18q12 (LOD = 2.6 DBP). Sex specific analyses identified a linkage on Chromosome 4p12-14 (LOD in men only = 3.4 SBP). At Chromosome 2q32-33, an area where we previously reported significant evidence for linkage to DBP using a conventional identity by descent approach, the LOD was 1.4; however an appreciable sex effect was observed with men accounting for most of the linkage (LOD in men only = 2.6).These results add evidence to a sex specific genetic architecture to blood pressure related traits, particularly in regions of linkage on chromosome 2, 4 and 18. Hypertension is a common chronic condition in the United States and leads to severe morbidity and mortality through heart disease, stroke, congestive heart failure, end stage renal disease and peripheral vascular disease. Among these, heart disease and stroke are two of the leading cause of death in the United States ,2. Much To attempt to identify genetic causes to blood pressure variation and other complex diseases, we have studied a population of Old Order Amish (OOA) in Lancaster County, Pennsylvania. The OOA are a closed founder population with several beneficial qualities for the genetic study of complex diseases . A relatThe genetic ancestry of the OOA arises from a small number of founders, which reduces the genetic complexity and allows for special statistical analyses to be performed. The founders of the OOA population originated in Western Europe and immigrated to central Pennsylvania in the early 1700s . A recenWe previously capitalized on these advantages to map a quantitative trait locus influencing blood pressure to chromosome 2q31-34 . Our mapThe study sample consisted of 616 individuals, 31 of whom were prescribed anti-hypertensive medication at the time of the study. The age of individuals ranged from 18 to 93 with a mean of 47.4 years. The individuals in the study had a mean BMI of 27.3 (standard deviation = 4.9). There were 336 (54.6%) women included.2 and sex with both additive and dominance variance proportions are given in Table Previous estimates of the heritability of SBP and DBP (0.23 and 0.29 respectively) given for this sample of OOA were of the narrow sense, or the proportion of phenotypic variation due to the additive effect of genes . ResiduaOur HBD mapping identified 2 chromosomal regions associated with SBP with a LOD score of 2.0 or greater in either the total combined sample or men and women separately. Similarly, 5 regions were linked to DBP. These results are given in Table Our highest LOD score was found on chromosome 4p14-12 to SBP (LOD = 3.4). Modest evidence for linkage also exists to DBP in this area among men (LOD = 1.7). The linkage in this area is present in men only, see Figure Our highest LOD score for the combined sample (i.e. both sexes) was on chromosome 18, figure Our previous linkage analysis in this sample identified a region on chromosome 2q 31-34 linked to DBP . The curIsolated populations have been proposed to be particularly valuable to the mapping of complex traits . We haveOur approach to HBD mapping has been used to identify genetically linked loci to fasting serum insulin and triglyceride levels in a population of Hutterites, a closed founder population in South Dakota ,17. ThisWe further investigated the evidence for linkage by plotting the multi-locus probability of HBD against residual trait values (data not shown). Since homozygosity (by state) is observable, we were able to assess the genotypes of the individuals who had high probability of HBD at a locus and extreme phenotypic values. We were unable to identify strong evidence for a founder effect in the data.Our estimates of broad heritability of SBP warrant further investigation. They indicate that the method used to account for hypertension medication may have large effects when estimating variance components of blood pressure variation. Adding a constant to the measured values of medicated individuals is the preferred method of some ,20. Our Estimates of consanguinity and HBD may be underestimated in this analysis. The OOA pedigree available is 12\u201313 generations deep and dates back only to the Amish immigration from Europe to central Pennsylvania. It assumes all founders, defined as those individuals whose parents are not represented in the pedigree, are unrelated. This assumption is conservative, as some of the Amish founders who emigrated together from Europe may in fact have been related.The original ascertainment scheme of our cohort was based upon the identification of diabetic probands of whom family members were recruited into the study. Therefore it is possible that our cohort is enriched for diabetes relevant alleles. Our linkage results presented here could correspondingly be interpreted as identifying genes that are linked to blood pressure particularly in the presence of diabetes susceptibility variants. Interestingly, the p arm of chromosome 4 has previously been linked to SBP, as well as to plasma free fatty acid levels, in a sample of Dutch dyslipidemic families , which pWe have performed genome wide HBD analysis for four blood pressure traits in our sample and in strata defined by sex. These four traits are correlated and the sex strata overlap with the overall sample analysis. Correspondingly, we present here nominal LOD scores and did not correct for multiple comparisons between related traits or overlapping samples.It has been suggested that many complex quantitative traits in humans may exhibit a sex specific genetic architecture . Our resWe have identified a similar region on chromosome 2 as the previously reported identity by descent linkage in this population. We hesitate to term this second finding as a \"validation\" or a \"replication\" of the initial result because these are indeed two different analysis asking slightly different questions. In a traditional identity by descent linkage, regions of the chromosome are identified that related individuals with similar trait values share identical by descent more often than expected by chance. The fundamental analysis in IBD linkage is between individuals. In the HBD linkage, we are looking within an individual to find areas of the genome where an individual's two chromosome are shared identical by descent (thus homozygosity by descent) and then ask whether this region is linked with a trait of interest. Therefore by definition the HBD analysis is designed to map recessive acting genetic effects. So how should we interpret an area of the genome that supplies evidence of linkage by both methods? One possibility is there are multiple genes in the region or perhaps multiple mutations within a single gene that act in different manners and that the two analyses are identifying two different genetic effects in the same region. Alternatively, the two methods may be identifying the same genetic effect, which is strong enough to be detected by the two different approaches.The converse of this question is how to interpret the results that identify a region of the genome by one analysis but not the other. We found this scenario on chromosome 18q. The HBD analysis presented here returned a LOD of greater than 2 to DBP. Our initial linkage results found no such evidence on chromosome 18. It is possible that the genetic effect in this region acts in a purely recessive manner but is not strong enough to be identified by identity by descent linkage. Alternatively, the possibility must also be considered that our HBD linkage in this region is a false positive result or that the identity by descent linkage is a false negative, each of which would lead to drastically different conclusions.How to interpret results from linkage analysis will eventually come to rest upon issues of a practical nature. Ideally resources would be available to track down all suggested areas of linkage with further analysis . In the case of hypertension and blood pressure related traits, this would mean investigating nearly every human chromosome . Since rThe Amish Family Diabetes Study began in 1995 with the goal of identifying susceptibility genes for type 2 diabetes and related traits . The proThe use of anti-hypertensive medication is rare in the OOA community, but it does exist. In our study sample, 31 individuals out of the 616 with blood pressure measurements self-reported anti-hypertension medication use, only 5% of the sample. We accounted for anti-hypertensive medication use in these analyses using two different approaches. First, we removed those on medication from the analysis (annotated bp-med). This method of accounting for medication was used in the previous study of blood pressure in this population and was Participants were genotyped using the ABI Prism Linkage Mapping Set (Perkin-Elmer), a screen set of 357 high polymorphic short tandem repeat markers spaced across the genome at an average distance of 10 cM. The largest gap between markers is 25.4 cM on chromosome 7. The markers used here are identical to those used in the previous linkage study of blood pressure in this population .th, jth element in the matrix gives the probability that individuals i and j share two alleles IBD and neither of the individuals is autozygous. Polygenic additive and dominance variances estimates were made using the SOLAR software package .Variance components were used to estimate heritabilities of the traits. Jacquard's condensed identity coefficients were computed using an algorithm accounting for the large inbred population ,26. A maGenome wide scans were performed using HBD mapping methods and software developed by Abney et. al. and complete statistical methods are described elsewhere . In briewhere Y is a vector of individual phenotype values. X is a design matrix accommodating fixed environmental covariates and \u03b2 is a vector of corresponding effect parameters. The h vector contains the multi-point estimates of HBD at the locus and the \u03b3 term is the effect of interest. The g term is the polygenic component that is distributed multivariate normally with a mean of zero and a covariance equal to two times the kinship matrix (\u03a6) times the expected variance due to the additive effect of genes plus \u03947 matrix times the expected dominance variance.e2.The e term is a normally distributed error component with mean zero and variance equal to \u03c3o: \u03b3 = 0) was assessed at 1 cM intervals across the genome. Because the method computes p-values directly, to obtain equivalent LOD scores the nominal p-values were converted to a corresponding chi-square statistic with one degree of freedom and divided by twice the natural logarithm of 10. Each model included covariate terms for sex, age and age2. The sex specific results presented are obtained by including individuals of one sex only in the analysis.The significance of the HBD effect and the outcome (blood pressure) only makes sense if the covariate is confounding the association. It is just as likely that any potential covariate could be on the causal pathway between the major gene and blood pressure and adjusting for it in the analysis will increase type II error rate . Since sex can be safely assumed to not lie on any casual pathway (e.g. it would be difficult to envision a scenario were a gene \"causes\" sex), stratifying the results by sex could add additional insight into major genes effect on blood pressure. Finally, and of secondary importance, one aim of this paper was to compare the results from the HBD mapping exercise directly with the IBD linkage results previously reported in this sample and thus the same covariates were used so that a direct comparison would be valid.-5 to 0.267 with mean 0.0041. For outbred populations \u03947 is 0.25 for siblings.To construct the required pedigree structures for the HBD calculations, we started with the 616 individuals with measured blood pressure values participating in the AFDS, and then added all possible ancestors present in the Anabaptist Genealogy Database (AGDB) version 3.0 . This prPFM participated in the design of the analysis, performed the statistical analysis and drafted the manuscript. HD contributed to writing the analysis software and in the statistical analysis. JRO assisted in the interpretation of the results and the statistical analysis. ARS designed the study, oversaw the recruitment of subjects and conduct much of the primary data gathering. BDM participated in the design of the study, the interpretation of the results and drafting of the manuscript. MA developed the HBD methods, assisted in the statistical analysis and implementation of the analytic methods. All authors read and approved the final manuscript."} +{"text": "This review was aimed at determining the imaging findings in patients with precocious puberty.Within a period of 8 years (from 2002 to 2010) there were 53 patients diagnosed with precocious puberty. Out of the 53 patients, 37 had undergone diagnostic imaging to detect the possible organic causes of precocious puberty. Imaging findings were positive in 31 patients and out of that, 3 patients had 2 findings each . Of the patients with positive imaging findings, central precocious puberty (gonadotrophin-dependent) was more common and the causes included: tuber cinereum hamartoma (n = 10), glioma (n = 6), pineal gland tumour (n = 4), hydrocephalous (n = 3), arachnoid cyst (n = 2) and others (n = 3). Peripheral precocious puberty (gonadotrophin-independent) causes included: testicular adrenal rest tumour (n = 3), adrenal carcinoma (n = 1), ovarian granulosa thecal cell tumour (n = 1), and tuberous sclerosis (n = 1).Positive imaging findings were observed in 84% (31/37) of the subjects. Hypothalamic hamartoma was the most common imaging finding in central precocious puberty while testicular adrenal rest tumour was the most common imaging finding in peripheral precocious puberty. Precocious puberty is defined as the development of secondary sexual characteristics before the age of 8 years in girls and 9 years in boys \u20133. Two tIn order to understand the two types of precocious puberty, basic knowledge of normal puberty pertaining to the hypothalamus-pituitary-gonadal (HPG) axis is necessary , 3. The CPP, which is also called GnRH-dependent precocious puberty, is caused by early activation of the HPG axis , 3. It iPPP, which is also called GnRH-independent precocious puberty, does not involve the HPG axis. It is caused by release of oestrogen or testosterone into the body from abnormal organs and causes include adrenal hyperplasia, adrenal tumour, and gonadal tumour .This review was aimed at determining the imaging findings in patients with precocious puberty.This was a retrospective review of the radiological findings of patients diagnosed with precocious puberty. The list of patients with precocious puberty from 2002 until 2010 was obtained from the paediatric endocrinologist at the medical centre where this study was carried out. Based on this list, the radiological reports of patients who had undergone radiological investigations were reviewed. These reports were retrieved from the Integrated Radiology Information System (IRIS). The radiological images were reviewed from the Picture Archiving and Communication System (PACS) (Medweb\u00ae) for patients imaged after September 2007. Hardcopy images were reviewed for patients imaged prior to September 2007.The diagnosis of precocious puberty was made based on clinical evaluation, plasma hormonal investigations , and assessment of bone age by the paediatric endocrinologist. Radiological investigations were performed when indicated . The decData were recorded in Microsoft Excel and were analysed using the statistical packages SPSS (version 16) for its descriptive statistics. Statistical analysis was not performed, as this is a descriptive evaluation.From 2002 until 2010, there was a total of 53 patients (35 girls and18 boys) aged between 1 and 15 years (mean age of 6.9 years) with a diagnosis of precocious puberty. Some had been diagnosed before the study period (before 2002) and therefore children older than age 8 and 9 years were included in the sample.Out of 53 patients reviewed, 70% (37/53) had undergone some form of radiological investigation: MRI of the brain, ultrasound of the pelvis/testes or CT of the abdomen. Out of the 37 patients who underwent radiological investigations, 84% (31/37) had abnormal findings. Three of the patients had 2 findings each. These were concomitant intracranial tumour with hydrocephalus. This resulted in a total of 34 abnormalities. Six patients had normal MRI of the brain and were therefore diagnosed with idiopathic CPP. This was more common in girls (n = 5) compared to boys (n = 1). Of the 16 patients who were not imaged, 11 were girls diagnosed with idiopathic CPP, while 4 girls and 1 boy were diagnosed with congenital adrenal hyperplasia.There were 82% (28/34) GnRH-dependent causes detected on imaging as compared to 18% (6/34) GnRH-independent causes. Among the girls with CPP, 45% (13/29) had intracranial pathology and 55% (16/29) were diagnosed as idiopathic CPP . Among tThe most common cause of intracranial tumour in CPP was hypothalamic hamartoma, which was true in both male and female populations. In 4 out of 6 patients with astrocytoma/glioma cases, the location of the tumour was in the supratentorial region. Two of these cases had concomitant hydrocephalus and 7. TThere were 8 patients with congenital adrenal hyperplasia (CAH) in our review. Three had imaging studies performed because they were resistant to steroid therapy. All 3 cases showed testicular adrenal rest tumour (TART) . Other GPrecocious puberty is caused by a heterogeneous group of disorders, which ranges from idiopathic to malignant tumours . There aPremature thelarche or thelarche variant is characterised by isolated premature breast development and is associated with normal growth velocity and bone age advancement within two standard deviations of normal. It is thought to be a self-limiting condition likely to resolve within 6 months to 6 years after diagnosis .Central precocious puberty or GnRH-dependent precocious puberty is more common by far in girls than in boys, where in girls it is usually idiopathic. Central nervous system disorders account for a higher percentage of cases in boys but must also be excluded in girls , 4. ApprThe most common underlying disorders include tumours of the hypothalamic region, especially hamartoma of the tuber cinereum, hydrocephalus and previous central nervous system (CNS) injury from any cause . The prePrecocious puberty and amenorrhoea have been associated with hydrocephalus. The exact pathway by which hydrocephalus disrupts the hypothalamic GnRH system is unknown. However, previous reports postulated that compressive forces, ischaemia, and impairment of the neurotransmitter feedback loop might be the explanation . We had Most tumours of the chiasm and hypothalamus in children are gliomas and the majority are low grade at histology . The autBrainstem gliomas are the second most frequent tumour in NF-1 after optic tract tumour . BrainstArachnoid cysts are relatively uncommon intracranial lesions, usually developmental in origin . The majIt is known that tumours and other pathological processes involving the hypothalamus frequently modify sexual development. These lesions may destroy the posterior hypothalamus, leaving the anterior hypothalamus intact, which leads to increased pituitary function and hence, causes CPP . This alGerm cell tumours most frequently arise in the pineal and suprasellar region and, in general, pineal gland germ cell tumours outnumber suprasellar tumours by a ratio of 2:1 . The mosA previous study had shown that CPP occurred in 3% of their entire population of children with NF-1, which is markedly higher than its incidence in the general population (0.06%) . CPP wasIn peripheral precocious puberty or GnRH-independent precocious puberty, boys develop secondary sexual characteristics from two conditions: secretion of androgens from the testes or adrenal glands, or rarely, secretion of human chorionic gonadotropin (hCG) or LH, which can stimulate Leydig cell production of testosterone . CongeniThere are some patients with unrecognised or poorly-controlled congenital adrenal hyperplasia who present with testicular masses consisting of adrenal rest tissue . TesticuThe most common cause of PPP in girls is ovarian tumour. It affects 11% of all girls with PPP and granulosa thecal cell tumour is the most common type . PPP in A rare cause of precocious puberty in our review was a case of tuberous sclerosis (TS). TS is associated with a number of abnormalities in endocrine tissues, where the adrenal gland is the most frequent endocrine gland affected. Endocrine abnormalities in patients with TS include precocious puberty, which may be due to gonadal activation by the pituitary gland or by gonadotrophin-independent mechanisms .Other rare causes of PPP seen in both sexes that were not present in this review include McCune Albright syndrome, severe hypothyroidism, and iatrogenic or exogenous sexual precocity .This review demonstrated that positive imaging findings were observed in 84% of cases and secondary cause of CPP in girls was higher than previously reported. It is not necessary to image all girls with CPP as there is still a place for clinical assessment. Imaging is mandatory in all boys with CPP. Hypothalamic hamartoma was found to be the most common finding on imaging in CPP while testicular adrenal rest tumour was the most common finding on imaging in PPP."} +{"text": "Each mol\u00adecule contains an intra\u00admolecular N\u2014H\u22efN hydrogen bond, generating an S(5) ring. The crystal structure is stabilized by inter\u00admolecular N\u2014H\u22efS hydrogen bonds.There are four independent mol\u00adecules in the asymmetric unit of the title compound, C For a related structure and background references to thio\u00adsemicarbazones, see: Li & Jian 2010. 11H15N3S2 CM r = 253.38 Triclinic, a = 10.496 (2) \u00c5 b = 15.737 (3) \u00c5 c = 17.542 (4) \u00c5 \u03b1 = 111.07 (3)\u00b0\u03b2 = 91.62 (3)\u00b0\u03b3 = 100.43 (3)\u00b0V = 2645.4 (9) \u00c53 Z = 8 K\u03b1 radiationMo \u22121 \u03bc = 0.38 mmT = 293 K 0.22 \u00d7 0.20 \u00d7 0.18 mm Bruker SMART CCD diffractometer26033 measured reflections12032 independent reflectionsI > 2\u03c3(I)8042 reflections with R int = 0.042 R[F 2 > 2\u03c3(F 2)] = 0.053 wR(F 2) = 0.201 S = 1.31 12032 reflections577 parametersH-atom parameters constrainedmax = 0.68 e \u00c5\u22123 \u0394\u03c1min = \u22120.44 e \u00c5\u22123 \u0394\u03c1 SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536810022920/hb5494sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536810022920/hb5494Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:"} +{"text": "Microhyla which is described here as Microhyla laterite sp. nov. It was delimited using molecular, morphometric and bioacoustics comparisons. Microhyla laterite sp. nov. appears to be restricted to areas of the West coast of India dominated by laterite rock formations. The laterite rock formations date as far back as the Cretaceous-Tertiary boundary and are considered to be wastelands in-spite of their intriguing geological history. We identify knowledge gaps in our understanding of the genus Microhyla from the Indian subcontinent and suggest ways to bridge them.In recent times, several new species of amphibians have been described from India. Many of these discoveries are from biodiversity hotspots or from within protected areas. We undertook amphibian surveys in human dominated landscapes outside of protected areas in south western region of India between years 2013\u20132015. We encountered a new species of The Indian subcontinent supports a rich biological diversity despite high human population density \u20133. This Beddomixalus, Ghatixalus, Indirana, Mercurana, Micrixalus, Nyctibatrachus, Raorchestes) but such discoveries from widespread genera like Microhyla, Hoplobatrachus, Fejervarya and Euphlyctis are uncommon.The Indian subcontinent is one of few regions in the Old World to harbor a rich diversity of amphibians . CurrentMicrohyla Tschudi, 1838 comprises of 38 extant species and is widespread across South and Southeast Asia [M. berdmorei (Blyth 1856), M. butleri Boulenger, 1900, M. chakrapanii Pillai, 1977, M. heymonsi Vogt, 1911, M. ornata , M. pulchra , M. rubra and M. sholigari Dutta and Ray, 2000 [The genus ast Asia . There aay, 2000 .Microhyla did not match descriptions of the eight known species from the region. We undertook further studies to determine its identity and here, we report: 1. the description of Microhyla laterite sp. nov., ascertained using molecular (12S and 16S rRNA genes), morphology and bioacoustic comparisons and 2. Assess the threat status of this species using IUCN Red List criteria.We encountered a species of Microhyla during surveys between years 2013\u20132015 as part of a citizen science initiative, \u2018My laterite: My habitat\u2019 led by one of the authors . This species of M. laterite sp. nov: N = 4). Animals were located and gently picked up by hand and placed in moist cotton bags and transported to field station within 30 min. Individuals were then euthanized using 20% Benzocaine gel, a topical anesthetic. A small volume of the gel (< 0.5 cm3) was squeezed out on a swab and applied on the animals\u2019 ventral region. After the animal ceased to show any signs of movement, a small portion of thigh muscle tissue (ranging between 0.1 to 0.25 cm3) was extracted for molecular analysis. A sterilized stainless steel scissor and forceps were used to incise tissue. Tissue was stored in molecular grade ethanol. Specimens were later fixed in 4% formalin for 24h and then transferred to 70% alcohol. Our animal handling protocols strictly following the guidelines for euthanasia of amphibians and use of Benzocaine 20% is well known to effectively minimize any pain or distress to the animal.Fieldwork and sampling was carried out in Manipal, Udupi District of Karnataka. All specimens were collected with permission from the Principal Chief Conservator of Forests and Chief Wildlife Warden, Karnataka State Forest Department (Permission No. PCCF(WL)/E2/CR-23/2015-16). Specimen collection and tissue sampling protocol followed guidelines for use of live amphibians and reptiles in field research by the American Society for Ichthyologists and Herpetologists and was approved by the Gubbi Labs Internal Committee on Animal Welfare and Ethics . All collections and tissue sampling adhered to the ethical standards put forth by the committee. Minimum samples were collected and used only for scientific work can be resolved and the associated information viewed through any standard web browser by appending the LSID to the prefix \u201cMicrohyla was observed between years 2013\u20132015 in laterite habitats in and around the coastal town of Manipal, Udupi District, Karnataka State, India . The region receives an annual rainfall of about 4000 mm. These laterite formations are a part of the \u2018Deccan Traps\u2019 flood plain and are believed to have originated sometime during the mid-Tertiary [This study was conducted along the West coast of India . The newM. laterite sp. nov: N = 4). Animals were located and gently picked up by hand and placed in moist cotton bags and transported to field station within 30 min. Individuals were then euthanized using 20% Benzocaine gel, a topical anesthetic. A small volume of the gel (< 0.5 cm3) was squeezed out on a swab and applied on the animals\u2019 ventral region. After the animal ceased to show any signs of movement, a small portion of thigh muscle tissue (ranging between 0.1 to 0.25 cm3) was extracted for molecular analysis. A sterilized stainless steel scissor and forceps were used to incise tissue. Tissue was stored in molecular grade ethanol. Specimens were later fixed in 4% formalin for 24h and then transferred to 70% alcohol. Our animal handling protocols strictly following the guidelines for euthanasia of amphibians and use of Benzocaine 20% is well known to effectively minimize any pain or distress to the animal.Fieldwork and sampling was carried out in Manipal, Udupi District of Karnataka. All specimens were collected with permission from the Principal Chief Conservator of Forests and Chief Wildlife Warden, Karnataka State Forest Department (Permission No. PCCF(WL)/E2/CR-23/2015-16). Specimen collection and tissue sampling protocol followed guidelines for use of live amphibians and reptiles in field research by the American Society for Ichthyologists and Herpetologists and was approved by the Gubbi Labs Internal Committee on Animal Welfare and Ethics . All collections and tissue sampling adhered to the ethical standards put forth by the committee. Minimum samples were collected and used only for scientific work of the http://www.technelysium.com.au/chromas_lite.html). Sequence alignment was carried out using the MAFFT algorithm [Microhyla are used for phylogenetic tree construction with Uperodon variegatus as an outgroup (S1 Table).We followed the protocol by Vences et al. for DNA lgorithm and manulgorithm . SequencMaximum likelihood (ML) algorithm and Bayesian inference methods were used for phylogenetic analysis. The ML analysis was executed in RaxML v1.3 with GTRS1 Appendix. Measurements of fingers and toes were made in ImageJ\u00ae from photographs taken using a Nikon\u00ae D90 Digital camera with a Nikkor\u00ae 105 mm micro lens. QGIS\u00ae Pisa Ver. 2.10 was used for illustrating hand and foot.Individuals were measured using a Mitutoyo\u00ae digital caliper to the nearest 0.1 mm. Measurements and terminology follow Seshadri, Gururaja and measFor bioacoustic comparison, a Mann-Whitney U test in R v.3.1.3 was usedM. laterite sp. nov., were used. Call terminology follows Kok and Kalamandeen [\u00ae 4500 pocket weather tracker.Calls were recorded using Sennheiser K6\u00ae unidirectional microphone coupled with a Marantz PMD 660\u00ae solid state recorder. Vocalizations with relatively higher signal to noise ratio were chosen and analyzed using Audacity Ver.1.3 (Beta) and Raven Pro Ver.1.5. Eight calls from two individuals of amandeen . DuratioM. laterite sp. nov. Data was sourced from www.gadm.org for administrative boundary and SRTM 90 m Database (http://srtm.csi.cgiar.org) for elevation. Area under minimum convex hull was computed on occurrence points of frogs to estimate extent of occurrence for IUCN assessment as per existing criteria [QGIS\u00ae Pisa Ver. 2.10 was used to generate maps of range and distribution of criteria .M. laterite sp. nov. was 0.0% (n = 2) and the inter-specific UPGD of M. laterite sp. nov. was lowest with M. sholigari and was most with M. petrigena . The UPGD between the 23 species of Microhyla used in the analysis varied from 4.8% to 14.14% (S2 Table). Microhyla laterite sp. nov. is a sister species of M. sholigari, forming a distinct clade as inferred from the phylogenetic tree (M. laterite sp. nov. was described as a new species and compared with M. sholigari.The intra-specific un-corrected pairwise genetic distance (UPGD) of tic tree . HoweverMicrohyla laterite sp. nov.urn:lsid:zoobank.org:act:321B8493-CD5C-4774-B664-6D6A36EAB0B2Suggested common name: Laterite narrow-mouthed frogth June 2015.Holotype: BNHS 5964, an adult male collected from laterite rocks in Kodanga, Herga village, Manipal, Udupi District by KSS and RS at 19:30\u201320:00 h on 26Paratypes: Two males and one female (BNHS 5967) were collected in same locality, date and time as holotype by KSS and RS.Microhyla owing to the following set of characters sensu Parker (25), Dutta and Ray (26) and Matsui, Hamidy [The new species is assigned to the genus , Hamidy : Small sMicrohyla laterite sp. nov. can be distinguished from all other congeners in the Indian subcontinent by the following suite of characters: (i) A very small sized adult frog ; (ii) snout obtuse in dorsal and ventral view with indistinct canthus rostralis, snout protrudes beyond mouth in ventral view (iii) tongue obovate, margin irregular, without lingual papilla (iv) tympanum hidden; (v) head wider than long; (vi) skin smooth on dorsum and venter; (vii) short, dark horizontal band on dorsum on the same plane as forelimbs. (viii) Throat with dense purplish-black pigmentation, reducing in intensity towards belly; (ix) reduced webbing in feet; (x) discs with circum-marginal groves on fingers and toes.A small sized adult .Fore limb shorter in length than hand . Dermal fringe present on fingers. Webbing between fingers absent. Relative lengths of fingers I 0; that is, the cheater is present initially. Then (P(t), E(t), X1(t), X2(t)) \u2192 ast \u2192 \u221e.ition of is such G = kES, and Monod uptake function F(P) = mP/(a + P). The equations have been scaled such that S0 and D are both constant equal to one. Initial data are as follows: S(0) = 1, P(0) = 0, E(0) = 0.8, X1(0) = 0.2, X2(0) = 0.03. The cooperator peaks early and declines sharply as the cheater continues to thrive, reaching a maximum followed by a rapid decline.g, expressed in rescaled variables . Bor. Bor5). C represents an intermediate complex formed by the action of the enzyme on the substrate. Let us for simplicity assume that the reaction rates are of the mass action type , then the mass balance model for this 2-step biochemical reaction network is:Suppose now that the biochemistry describing the conversion of substrate into processed nutrient takes occurs via an intermediate step:C1, \u2026Cn:Of course, more complicated biochemical reaction networks of the digestion process, with multiple intermediate complexes X2 = 0, and constant operating parameters D and S0, which are both assumed to be positive:EG(S), implying that it is proportional to the enzyme concentration E, and a possibly nonlinear function of the nutrient G(S). We replace assumption H1, by the following assumption, which introduces a monotonicity condition for F, and monotonicity and concavity condition for G:G will be used to limit the number of steady states of this system. The most commonly used choices for the functions for F and G are Monod functions (i.e. F(P) = mP/(a + P), where a and m are positive parameters), which satisfy these assumptions. But note that a linear function G(S) = kS, with k > 0 is allowed as well. In other words, the processing rate of nutrient (per unit of enzyme) does not necessarily have to saturate for large S-values.We have shown that when cheaters are present initially, the total population of cooperators and cheaters, is doomed. Next we investigate what happens when cheaters are absent by considering a special case of the chemostat model \u20135) with with5) wThe following dichotomy -global extinction, or bistability- is proved in Theorem 2Suppose thatH1\u2019holds, and thatIf equation 23 has no solutions, then the washout steady state is globally asymptotically stable for system (r system \u201315)..If equatIf equation 23 has two distinct solutions, then system and two positive steady statesE1andE2. The washout steady state andE2are locally asymptotically stable, andE1is a saddle with a three-dimensional stable manifold, and one-dimensional unstable manifold. The stable manifold is the common boundary of the regions of attraction of the washout steady state andE2. Every solution of system has hasIf eqf system \u201315) con conIf eqN-person Prisoner\u2019s Dilemma [Although the tragedy of the commons is such a pervasive notion in the recent developments of theories about the evolution of cooperation, we were unable to find any mathematical models that have rigorously analyzed an important group-level effect: the collapse of a population as a consequence of the dynamic interaction between cooperating and cheating individuals. The traditional approach to explain the tragedy has been to describe it in a game theoretical context, and attribute it to an Dilemma . For a s Dilemma . Repeate Dilemma , 35. Som Dilemma for exam Dilemma , the traWhile game theory can predict winning strategies, however, it generally does not consider the feedback of individual behavior phenotypes on group productivity. The main purpose of this paper was to offer an alternative, yet complementary approach to explain the tragedy that is not rooted in game theory and thereby avoids the explicit quantification of the payoffs of the various strategists, which appears to be particularly difficult for microbial populations. Our approach is purely mechanistic and our model merely expresses natural mass-balance equations. It incorporates substrate availability via intake from the feed bottle, production of the public good, the enzymatic conversion of substrate to product by the public good, uptake of the product, and cellular growth, and the washout of all chemical and biological compounds in the chemostat via dilution. All model parameters as well as functional forms can be quantified, determined and controlled experimentally, and there is no need to make abstract or ad hoc choices of payoffs. We have proved mathematically that the tragedy of the commons occurs in a chemostat system with cooperators that supply a public good required for growth, and cheaters that do not. The sole difference between cooperators and cheaters in this system is the cost associated with public good production, which is only experienced by the cooperator. While the cooperator diverts a fraction of the ingested nutrient from growth to public good production, the cheater invests everything in growth. We assume that there are no pleiotropic costs to cheating, and that the environment is well mixed, disregarding spatial structure as a major factor that promotes cooperation , 7. Our X2(0) = 0), and suppose that the assumptions of Theorem 2 hold. If the initial condition of system is small), and no initial processed nutrient (P(0) = 0). The cooperator-only population therefore persists. However, if cheaters do suddenly appear -for example by mutation or by invasion into the environment- even in extremely low numbers, Theorem 1 shows that the total population of cooperators and cheaters is doomed, confirming the tragedy of the commons. One of the two proofs of Theorem 1 gives clues on how this happens: The ratio of cooperators to cheaters will always decrease. It may appear as if the cheaters will overtake the cooperators, and at least for a while, this is indeed what happens. However, in the long run there are not enough cooperators around to produce the enzyme levels required for nutrient processing, and this leads to the extinction of cheaters and cooperators alike.To understand how the tragedy of the commons arises in the chemostat, we perform a simple thought-experiment. Assume that initially there are no cheaters (f system \u201315) is is X2(0)ulations show thaTo put our results in the context of Hardin\u2019s original verbal description of the tragedy , we remaAccording to , the expA different, more abstract, type of public good involves individuals restraining from potential conflict. A tragedy arises if the costs invested in compettitive behavior decrease overall productivity. In this case, less emphasis is placed on the depletion of extrinsic resources. A relevant example comes from another chemostat study which investigated the outcome of social conflict between different metabolic strategies in yeast, respiration and fermentation . RespireOur paper provides a simple paradigm of cheater-mediated population collapse. There are surprisingly few empirical reports of this phenomenon in the microbiological literature. To our knowledge, there is not a single example that employed a continuous culture system. It was therefore our intent to establish a null model for both experimentalists and theorists in which obligate cheating always causes population collapse.S is considered to be unwanted, and the role of the microbes is to degrade it. They achieve this by producing an enzyme that targets the substrate for degradation into a form that they can use for their own growth. When all the cells cooperate and contribute to the production of the enzyme, this process can succeed (Theorem 2). But if an even minimal fraction of the cells cheat by not producing the enzyme, this process fails (Theorem 1): The microbial populations go extinct, and the unwanted substrate is not reduced.Our results also have implications for biotechnological processes that rely on the cooperative behaviors among microbes for product synthesis, bioremediation and the treatment of wastewater. In these applications, the substrate As we have proven in this study, population collapse is inevitable in an obligate relationship, because the cooperator to cheater ratio always decreases. Eventually the cheater becomes so dominant that too little public good is produced by the cooperator, leading to the extinction of both types. The differential equation framework presented here will permit the in-depth analysis of mechanisms that promote cooperation. We have seen that if cooperator and cheater have the same yield, and the same per capita growth rate function, the tragedy is inevitable. This suggests that variations in yield constants and/or growth rates between cooperators and cheaters, which may arise via mutations, are necessary to avoid the tragedy in the chemostat. Future research will be conducted to assess if and when such changes do indeed promote cooperation. As mentioned earlier, spatial effects are known to sometimes promote the evolution of cooperation. Although the chemostat studied here is assumed to be well mixed and therefore does not include any spatial effects, it can be readily modified in ways similar to those described in Chapters 5 & 6, and Chapter 10 in , where sS1 Appendix(PDF)Click here for additional data file.S2 Appendix(PDF)Click here for additional data file.S3 Appendix(PDF)Click here for additional data file."} +{"text": "Tranexamic acid prevents blood clots from breaking down and reduces bleeding. However, it is uncertain whether tranexamic acid is effective in traumatic brain injury. The CRASH-3 trial is a randomised controlled trial that will examine the effect of tranexamic acid (versus placebo) on death and disability in 13,000 patients with traumatic brain injury. The CRASH-3 trial hypothesizes that tranexamic acid will reduce intracranial haemorrhage, which will reduce the risk of death. Although it is possible that tranexamic acid will reduce intracranial bleeding, there is also a potential for harm. In particular, tranexamic acid may increase the risk of cerebral thrombosis and ischaemia. The protocol detailed here is for a mechanistic sub-study nested within the CRASH-3 trial. This mechanistic sub-study aims to examine the effect of tranexamic acid (versus placebo) on intracranial bleeding and cerebral ischaemia.The CRASH-3 Intracranial Bleeding Mechanistic Sub-Study (CRASH-3 IBMS) is nested within a prospective, double-blind, multi-centre, parallel-arm randomised trial called the CRASH-3 trial. The CRASH-3 IBMS will be conducted in a cohort of approximately 1000 isolated traumatic brain injury patients enrolled in the CRASH-3 trial. In the CRASH-3 IBMS, brain scans acquired before and after randomisation are examined, using validated methods, for evidence of intracranial bleeding and cerebral ischaemia. The primary outcome is the total volume of intracranial bleeding measured on computed tomography after randomisation, adjusting for baseline bleeding volume. Secondary outcomes include progression of intracranial haemorrhage (from pre- to post-randomisation scans), new intracranial haemorrhage (seen on post- but not pre-randomisation scans), intracranial haemorrhage following neurosurgery, and new focal ischaemic lesions (seen on post-but not pre-randomisation scans). A linear regression model will examine whether receipt of the trial treatment can predict haemorrhage volume. Bleeding volumes and new ischaemic lesions will be compared across treatment groups using relative risks and 95% confidence intervals.The CRASH-3 IBMS will provide an insight into the mechanism of action of tranexamic acid in traumatic brain injury, as well as information about the risks and benefits. Evidence from this trial could inform the management of patients with traumatic brain injury.ISRCTN15088122) 19 July 2011, and ClinicalTrials.gov on 25 July 2011 (NCT01402882).The CRASH-3 trial was prospectively registered and the CRASH-3 IBMS is an addition to the original protocol registered at the International Standard Randomised Controlled Trials registry (The online version of this article (doi:10.1186/s13063-017-2073-6) contains supplementary material, which is available to authorized users. TBI is a leading cause of death and disability worldwide. According to the World Health Organization, TBI will continue to be a major cause of death and disability by 2020 . At leasTBI patients can experience a loss in physical, behavioural or emotional functioning after the injury . Severe The increasing incidence of TBI can be explained by the rising frequency of traffic accidents in developing countries and rapidly motorising middle-income countries . ProjectIntracranial bleeding is common after TBI and the larger the bleed the greater the risk of death and disability , 14. In A meta-analysis of 34 studies that reported the frequency of coagulopathy after TBI found that one third of patients with TBI have laboratory evidence of abnormal coagulation based on parameters such as fibrinogen, fibrin degradation products and antithrombin levels .The risk of mortality in patients with coagulopathy after TBI is nine times higher than in TBI patients without coagulopathy (odds ratio (OR) 9.0, 95% confidence interval (CI) 7.3\u201311.6). The risk of unfavourable outcome as measured by the Glasgow Outcome Scale (score of 1\u20133) is more than 30 times higher in TBI patients with coagulopathy . The higTranexamic acid reduces bleeding by inhibiting the enzymatic breakdown of fibrin blood clots. Plasmin binds to fibrin via lysine-binding sites and then splits fibrin into fibrin degradation products. Tranexamic acid is a molecular analogue of lysine that inhibits fibrinolysis by reducing the binding of plasmin to fibrin.A systematic review of 104 randomised trials of tranexamic acid in surgical patients found that it reduced the number of patients receiving a blood transfusion by one-third and halved the need for further surgery to control bleeding .P\u2009<\u20090.0001) [P\u2009=\u20090.03). There was no apparent increase in the risk of vascular occlusive events with tranexamic acid following acute trauma .A large randomised trial of tranexamic acid treatment within an hour of acute traumatic injury found that it reduced the risk of death due to bleeding by about one-third (relative risk (RR) 0.68, 95% CI 0.57\u20130.82; \u20090.0001) , 23. TreTranexamic acid is able to penetrate the blood\u2013brain barrier and should be able to affect intracranial haemorrhage . If tranHowever, there is also the potential for harm. In particular, tranexamic acid may increase the risk of cerebral thrombosis and ischaemia . Cerebran\u2009=\u2009249) examined the effect of tranexamic acid in patients with extra-cranial bleeding but who also had TBI [n\u2009=\u2009229) examined the effect of tranexamic acid in patients with polytrauma and TBI or isolated TBI [A systematic review identified two completed randomised trials of tranexamic acid in TBI patients . The fir had TBI . The secated TBI . Both trP\u2009=\u20090.03) and mortality with tranexamic acid. In one trial, focal ischaemic lesions occurred in 5% of tranexamic acid-treated patients and 9% of placebo-treated patients [When the two randomised trials were combined in a meta-analysis, there was a statistically significant reduction in intracranial haemorrhage . In the \u2009=\u20091.17) . HoweverThere are three ongoing randomised trials of tranexamic acid versus placebo in patients with isolated TBI . These will evaluate the effect of tranexamic acid on death, disability, vascular occlusive events and other adverse events in TBI. The ongoing trials will inform whether tranexamic acid can be given to those with TBI. To date, the CRASH-3 trial, with a planned sample size of 13,000 patients, will be the largest randomised trial into the effect of tranexamic acid in TBI . The resHowever, these trials will not provide information about the mechanism by which tranexamic acid might exert its effects in TBI. If tranexamic acid reduces mortality by reducing intracranial haemorrhage, we would expect there to be less blood on head CT scans of tranexamic acid-treated patients, particularly those treated soon after injury . If tranThe CRASH-3 IBMS aims to examine the mechanism by which tranexamic acid exerts its effects in patients with isolated TBI. Specifically, we will assess the effect of tranexamic acid on intracranial bleeding and cerebral ischaemia.The CRASH-3 IBMS is a mechanistic randomised controlled trial nested within a larger prospective, double-blind, multi-centre, parallel-arm, randomised, placebo controlled trial. The CRASH-3 IBMS is nested in a cohort of CRASH-3 trial participants NCT01402882) . Other hospitals participating in the CRASH-3 trial will be included to meet the planned sample size; these sites are to be confirmed. All regulatory and ethical approvals will be in place before the trial starts at each site.The CRASH-3 IBMS will be conducted in a cohort of approximately 1000 adult trauma patients enrolled in the CRASH-3 trial. Patients who have a Glasgow Coma Scale score of 12 or less or intracranial bleeding on a CT scan performed before randomisation into the CRASH-3 trial , and fulfil the inclusion criteria for the CRASH-3 trial, are eligible for inclusion in the CRASH-3 IBMS .TBI patients eligible for inclusion into the CRASH-3 trial are randomly allocated to receive tranexamic acid or matching placebo (0.9% sodium chloride) and the trial treatment is started as soon as possible. Patients are randomised by selecting the lowest available numbered pack from a block of eight treatment packs. Randomisation codes are generated with a computer random number generator. There is no need to withhold any clinically indicated treatment in the CRASH-3 trial. Tranexamic acid or placebo is provided as an additional treatment to the usual management of TBI. The loading dose of the trial treatment is administered by intravenous injection immediately after randomisation (within minutes). The maintenance dose (by intravenous infusion) should start as soon as the loading dose is completed.Any untoward medical occurrence affecting a trial patient up to 28\u00a0days after randomisation will be reported in line with the CRASH-3 trial protocol. If the patient develops an adverse event during the treatment phase, the trial drug should be stopped. In this situation, the patient should be treated in line with local procedures and then followed up. The independent Data Monitoring Committee may recommend for the early termination of the trial, and the final decision lies with the Trial Steering Committee.If there are contraindications to tranexamic acid following randomisation, the trial treatment should be stopped and all standard clinical care provided. Unblinding is only necessary if the clinician believes that clinical management depends importantly upon knowledge of whether the patient received tranexamic acid or placebo. In this case, a 24\u00a0hour telephone service is available to confirm whether the patient received tranexamic acid or placebo.The total volume of intracranial bleeding after randomisation, adjusting for total volume of intracranial bleeding at baseline if baseline volume is available.Frequency of progressive haemorrhage \u2013 number of patients with a post-randomisation CT scan with total haemorrhage volume of more than 25% of the volume on the pre-randomisation scan;Frequency of new haemorrhage \u2013 number of patients with haemorrhage on the post-randomisation CT scan when there was not one on the pre-randomisation scan;New focal ischaemic lesions \u2013 ischaemic lesions which appear on a post-randomisation scan but not on the pre-randomisation scan;Total volume of intracranial bleeding after randomisation in patients who undergo surgical evacuation of haemorrhage, adjusting for volume of baseline bleeding.All outcomes will be compared across treatment groups.Patients often undergo one brain CT scan as part of routine medical care prior to randomisation into the CRASH-3 trial. The majority of patients are scanned again after randomisation into the CRASH-3 trial. In the CRASH-3 IBMS, we will measure the volume of intracranial haemorrhage on pre- and post-randomisation CT scans. A simple validated scale for measuring intracranial haemorrhage volume shows good agreement with the gold standard of computer-assisted volumetric analysis, which requires demarcation of the haemorrhage borders \u201349.3.The ABC/2 method is a quick and easy technique used to estimate the volume of intracranial haemorrhage . This meWhilst some researchers have found that the ABC/2 method overestimates lesion volume compared to computer-assisted methods , 51\u201355, Although the ABC/2 method is a less specific measure of haemorrhage volume and overestimation due to false positives would dilute the effect of the treatment towards the null, its low sensitivity and underestimation due to false negatives would not impact the effect of the treatment on haemorrhage. Furthermore, the more accurate method of estimating haemorrhage would have been more expensive and therefore administered in a smaller number of patients given the limited budget of a clinical trial. Although a more accurate method in a small trial would result in less measurement error, a less accurate method in a larger trial would result in less random error. We believe that the ABC/2 method is sufficiently accurate and therefore chose to use this method in a larger trial. Furthermore, the assessor rating the scans will be blind to treatment allocation and thus the bias from measurement error should be balanced between treatment groups.The total haemorrhage volume on each scan will be calculated by totalling the volumes of intra-parenchymal, intra-ventricular, epidural and subdural haemorrhage.Volume estimation of intracranial haemorrhage is aided by the characterisation of haematomas. The final shape of a haematoma is influenced by its location. Intra-axial haematomas include intra-parenchymal haematomas, which occur in the brain tissue, and intra-ventricular haematomas, which occur in the ventricles of the brain. These haematomas tend to have regular shapes that are clearly definable in every dimension . Extra-axial haematomas occur between the three membranes that surround the brain . Epidural haematomas are a type of extra-axial haematoma and occur between the skull and outer membrane of the central nervous system (dura mater). They have a clear shape that can be measured in every dimension. The ABC/2 method assumes the haemorrhage has an ellipsoid shape and has been validated in intra-parenchymal , intra-vSubdural haematomas are another type of extra-axial haemorrhage and occur between the dura mater and the middle membrane of the central nervous system (arachnoid mater). Subdural haematomas are crescent shaped as they follow the pattern of the brain\u2019s convexity. The exact limits of a subdural haematoma are not clearly definable in any dimension. This type of haemorrhage can theoretically occupy the entire subdural space. Given that the ABC/2 method assumes the haemorrhage has an ellipsoid shape, it would not provide an accurate volume estimation of subdural haemorrhage. Indeed, there have been reports of underestimation in subdural haemorrhage volume when using an adapted version of the ABC/2 method compared with computer-assisted volumetric analysis , 56.Some researchers and clinicians propose that it is more appropriate to estimate subdural haemorrhage volume using a formula which takes the difference between two spheres , divides by two and divide by two again . This method has been tested at the Neurosurgical Trauma Unit at the Queen Elizabeth Hospital in Birmingham (UK) and has been shown to provide more clinically relevant estimates of haemorrhage volume than the ABC/2 method . AlthougSubarachnoid bleeds are another type of extra-axial haemorrhage and occur in the area between the arachnoid membrane and the innermost membrane surrounding the brain (pia mater). The shape of the subarachnoid space resembles a spider\u2019s web and therefore haemorrhage in the subarachnoid space cannot be clearly measured in any dimension. Although there are a number of CT grading scales that include the characterisation of subarachnoid haemorrhage , 61, theIn the CRASH-3 IBMS, the size of a subarachnoid haemorrhage will be characterised as small, medium or large. Each bleed will then be described as focal , multiple or diffuse (widespread). This method is also subjective and may have low sensitivity and specificity, therefore misclassification would bias the effect of the treatment towards the null value. We hope that, by using this method in a large trial, the bias from measurement error would be offset by a reduction in random error.Petechial haemorrhage manifests as a very small dot on a CT scan. CT scans and accompanying radiology reports will be examined to indicate whether petechial haemorrhage is present.Ischaemic stroke is due to the compromise of blood and oxygen flow through either large or small arteries supplying the brain parenchyma. Thrombotic occlusion of intracranial vessels produce wedge-shaped cortical infarctions.Cerebral ischaemia would reliably manifest on a CT scan performed at least 48\u00a0hours after randomisation . HoweverFurthermore, given that CT imaging is the first and most common neuroimaging examination performed for emergency assessment of suspected acute haemorrhage and stroke around the world , 65, theSpace-occupying intracranial lesions can displace brain tissue. The shift of midline structures past the centre line of the brain will be measured in millimetres. We will also record whether mass effect has caused ventricular and sulcal effacement.All scans will be rated according to the Marshall classification \u2013 the most extensively used CT classification scale in TBI . Three mAssuming the average baseline intracranial bleeding volume is 20\u00a0mL and assuming the same average increase (8\u00a0mL), standard deviation (28\u00a0mL) and correlation (rho\u2009=\u20090.6) between baseline and follow-up bleeding volumes as in the control group of the CRASH-2 Intracranial Bleeding Sub-study , a studyThe CRASH-3 trial database will be used to prepare a list of all patients with a Glasgow Coma Scale score of 12 or less or with a pre-randomisation CT scan at participating sub-study hospitals. The list will include unique randomisation (box and pack) numbers, date and time of randomisation, and time between injury and randomisation into the CRASH-3 trial. The randomisation numbers will be used at the participating site to identify the patient using their hospital number. The latter will be used at the participating hospital to identify the patient. The outcome assessor (research fellow with training in brain imaging assessment) will hold a letter of access at the participating hospital and use the patient hospital number to retrieve pre- and post-randomisation scans from the hospital imaging system. The outcome assessor will complete the outcome forms at each site using the relevant scans and accompanying radiology reports. All the data are collected by the same outcome assessor who is blind to treatment allocation.If the patient does not have a pre-randomisation scan, only the post-randomisation scan form is completed. If the patient does not have a post-randomisation scan, only the pre-randomisation scan form is completed. We record whether pre- and/or post-randomisation scans are available such that we can examine missing data by trial arm.In most cases, the post-randomisation scan is the first scan performed after randomisation, which is normally within 72\u00a0hours of randomisation. Furthermore, due to ongoing clinical management, some patients are scanned within minutes of randomisation. Tranexamic acid would not have had sufficient opportunity to effect haemorrhage or infarction in such a way that would manifest on a scan this soon after randomisation. Therefore, for patients scanned within minutes of randomisation, we also measure all the outcomes of interest on the next available post-randomisation scan, which is normally closer to 72\u00a0hours of randomisation. All available brain imaging is examined for evidence of focal ischaemic lesions.The time stamped on the scans will be used to calculate the following time intervals: (1) the time between injury and the pre-randomisation CT scan and (2) the time between randomisation into the trial and the post-randomisation scan. If a patient has undergone neurosurgery following their injury, information on the date and time of neurosurgery will be collected using prospective reports including patient anaesthetic charts. The outcome data is collected for all patients included in the CRASH-3 IBMS (unless consent was withdrawn) irrespective of whether the trial treatment was received . The outcome data is directly uploaded into an electronic database accessed at each sub-study site.A data management plan will be prepared in advance of data collection . Investigators/institutions are required to provide direct access to source data/documents for trial-related monitoring, audits, ethics committee review, and regulatory inspection. All trial-related and source documents must be kept for at least 5\u00a0years after the end of the trial. As all the CRASH-3 IBMS data will be collected directly from source data, additional monitoring will not be carried out for this data.The effective radiation dose from a CT scan is about 2\u00a0mSv, which is approximately the amount received from background radiation in 8\u00a0months. Because CRASH-3 IBMS will mainly use data from CT scans undertaken as part of routine patient care, patients will not be exposed to extra radiation. There is no additional burden or risk to the patient as a result of CRASH-3 IBMS. It is standard care for all patients with TBI and associated clinical signs to have a CT scan. Follow-up CT scans are often conducted for diagnostic purposes around 24 to 72\u00a0hours after the initial scan. Steps taken to minimise the risks associated with handling personal data will be detailed in the Confidentiality section.Only staff with authorised access to the scans, either as clinicians or research contract holders, will be able to retrieve and review them. Completed scan data forms will be uploaded onto a secure database. The scan data forms will contain no patient identifiable data and relevant patient organisations. All participating sites will be credited in key publications.The results from this trial will be published in peer-reviewed medical journals. Dissemination of results to patients will take place via the media, trial website . HoweveFurthermore, if tranexamic acid reduces intracranial haemorrhage in TBI patients and this is detected by the CRASH-3 IBMS, it is still possible that clinical outcomes may not improve. This could be because intracranial haemorrhage is not the mechanism that leads to death in TBI patients. It is also possible that the potential benefit of tranexamic acid in reducing intracranial haemorrhage may be offset by the increased risk of cerebral ischaemia , 30, parThe first patient was enrolled in the CRASH-3 trial on 20 July 2012. Recruitment is currently ongoing. It is anticipated that recruitment for the CRASH-3 trial will be complete by 31 December 2017. Data collection for the CRASH-3 IBMS started in February 2016. All data for the CRASH-3 IBMS will be collected prior to completion of the CRASH-3 trial.Additional file 1:SPIRIT 2013 Checklist: Recommended items to address in a clinical trial protocol and related documents. (DOC 122\u00a0kb)Additional file 2:Data management plan. (DOCX 726\u00a0kb)Additional file 3:CT scan outcome forms. (DOCX 52\u00a0kb)Additional file 4:Confirmation of funding for the CRASH-3 trial from The Moulton Charitable Foundation. (PDF 527\u00a0kb)Additional file 5:Confirmation of funding for the CRASH-3 trial from the Joint Global Health Trials Scheme. (PDF 137\u00a0kb)Additional file 6:Confirmation of funding for the CRASH-3 trial from the National Institute for Health Research. (PDF 82\u00a0kb)Additional file 7:Confirmation of funding for the CRASH-3 trial from the London School of Hygiene and Tropical Medicine. (PDF 264\u00a0kb)Additional file 8:Letter of favourable ethical opinion from the Medical Research and Ethics Committee and Health Research Authority. (PDF 106\u00a0kb)Additional file 9:Letter of favourable ethical opinion from the Observational/Interventions Research Ethics Committee at the London School of Hygiene and Tropical Medicine. (PDF 267\u00a0kb)"} +{"text": "There is considerable interest in tankyrase because of its potential use in cancer therapy. Tankyrase catalyzes the ADP-ribosylation of a variety of target proteins and regulates various cellular processes. The anti-cancer effects of tankyrase inhibitors are mainly due to their suppression of Wnt signaling and inhibition of telomerase activity, which are mediated by AXIN and TRF1 stabilization, respectively. In this review, we describe the underappreciated effects of another substrate, SH3 domain-binding protein 2 (SH3BP2). Specifically, SH3BP2 is an adaptor protein that regulates intracellular signaling pathways. Additionally, in the human genetic disorder cherubism, the gain-of-function mutations in SH3BP2 enhance osteoclastogenesis. The pharmacological inhibition of tankyrase in mice induces bone loss through the accumulation of SH3BP2 and the subsequent increase in osteoclast formation. These findings reveal the novel functions of tankyrase influencing bone homeostasis, and imply that tankyrase inhibitor treatments in a clinical setting may be associated with adverse effects on bone mass. The poly(ADP-ribose) polymerase (PARP) superfamily catalyzes the ADP-ribosylation of target proteins and regulates various cellular processes, including the maintenance of genome stability, mitosis, and signal transduction ,2. TankySeveral tankyrase substrates have been identified, including TRF1 ,9,10, AXOne of the thoroughly studied substrates is AXIN, which is a negative regulator of the canonical Wnt pathway . A previTankyrase has attracted attention as a novel and promising target for cancer treatments . Indeed,In addition, the mechanism of synthetic lethality should be noted. Cancers with mutation of BRCA1/2 are treatable by PARP inhibitors ,30,31. PBecause canonical Wnt signaling is an essential mediator of fibroblast activation and tissue fibrosis ,41, tank50 values of 95, 5, 74, and 27 nM, respectively, because of the highly conserved nicotinamide subsite among PARP family members [Tankyrase inhibitors have been classified into two types. Specifically, one type targets the nicotinamide subsite of the tankyrase protein, which is conserved in various PARPs, and the other type targets a unique adenosine subsite that is more potent and specific to tankyrase . Tankyra members ,47. ThusSH3BP2 gene is responsible for the human genetic disease cherubism (OMIM#118400) [SH3BP2 is an adaptor protein that is predominantly expressed in immune cells, including macrophages/osteoclasts and osteoblasts ,52,53,54#118400) . Cherubi#118400) ,62. Cher#118400) ) prevent#118400) ,64 ,56,57,58Sh3bp2 locus [The mechanisms underlying cherubism were elucidated by analyzing SH3BP2 cherubism mutant mice, in which the P416R mutation was introduced in the murine p2 locus . Analysip2 locus . The mutp2 locus ,65,66,67p2 locus ,57. Addip2 locus ,68,69,70p2 locus .Poly(ADP-ribose) is expressed in bone tissue, especially in the nucleus and cytoplasm of bone cells , suggestBecause we previously reported the importance of SH3BP2 for bone homeostasis ,57, we eTankyrase inhibitors also affect osteoblast differentiation and maturation. Tankyrase inhibitor treatments can suppress Wnt signaling, as indicated by increased AXIN contents and the subsequent suppression of the nuclear translocation of \u03b2-catenin . We reveBone mass is maintained by balancing bone formation and resorption, which is mediated by osteoblasts and osteoclasts, respectively. To evaluate the in vivo effect of tankyrase inhibition, seven-week-old wild-type mice were orally administered G007-LK for four weeks . This trIn our in vivo experiment , the G00Apart from the roles of tankyrase in bone, it should be noted that there is some evidence that another member of the PARP family, PARP1, also affects bone homeostasis. In terms of osteoclastogenesis, PARP1 is reported to be a negative regulator. PARP1 suppresses Tcirg1 gene expression, which encodes the a3 isoform of the V-ATPase subunit, in murine pre-osteoclastic RAW264.7 cells . AdditioIn terms of osteoblasts, PARP1 has a promoting effect on osteoblast differentiation . During SH3BP2 promoter and regulates SH3BP2 gene expression [Sh3bp2 promoter activity and SH3BP2 protein expression are significantly suppressed [Regarding the effect of PARP1 on bone, SH3BP2 might act as a modifier of PARP1-mediated bone homeostasis, not just tankyrase-mediated bone homeostasis. PARP1 is reported to bind the human pression . In PARPppressed . Though Other than the effect of tankyrase inhibitors on bone, we might need to also pay attention to their effect on immune cells. As described in the previous section, SH3BP2 is ubiquitously expressed in various immune cells, such as macrophages and lymphocytes. Previous studies revealed that excessive amounts of SH3BP2 in macrophages enhance the production of inflammatory cytokines ,65,68 anTankyrase inhibitors may be toxic to the intestinal tract. When a tankyrase inhibitor (G-631) was administered in a murine xenograft colorectal cancer model, the inhibitor exhibited an anti-cancer effect, but it simultaneously induced severe intestinal toxicity, characterized by multifocal-regionally extensive necrotizing and ulcerative enteritis . Wnt sigTankyrase inhibitors are widely recognized as Wnt-specific/selective inhibitors because of their regulatory effects on AXIN . HoweverIn conclusion, the characterization of tankyrase-mediated cellular processes, especially the AXIN-regulated pathway, has resulted in advances in preclinical research on the utility of tankyrase inhibitors for treating cancers and fibrotic diseases. The next step will involve a more in-depth examination of the relevant cellular processes regulated by SH3BP2 and other substrates to enable researchers to predict and prevent avoidable adverse events associated with tankyrase inhibitors as well as to discover other potential therapeutic applications via modified tankyrase activity."} +{"text": "The structure was elucidated using a combination of 1D/2D NMR spectroscopy and mass spectrometry data analysis. The absolute configurations of C-3, C-5, and C-7 in 1 were assigned based on its optical rotation and after comparing its NMR chemical shifts with those of its diastereoisomers, katsumain E and katsumain F, which were previously isolated from this plant and characterized. In this study, the stimulatory effects of compounds 1 and 2 were evaluated on heat shock factor 1 (HSF1), heat shock protein 27 (HSP27), and HSP70. Compounds 1 and 2 increased the expression of HSF1 , HSP27 , and HSP70 , without increased cytotoxicity.A new diarylheptanoid containing a chalcone moiety, katsumain H ( Alpinia katsumadai (Zingiberaceae) are used for the treatment of gastric disorders in traditional oriental medicine + in the high-resolution electrospray ionization mass spectrometry (HRESIMS), which is consistent with an elemental formula of C35H35O7. The 1H- and 13C-NMR spectra of 1 exhibited resonances for one mono-substituted phenyl ring and two p-substituted phenyl rings . The signals for four methylenes showed at \u03b4H 2.88 (H-1a) and 2.71 (H-1b)/\u03b4C 32.7 (C-1), 1.83 (H-2)/40.7 (C-2), 2.01 (H-4a) and 1.74 (H-4b)/43.7 (C-4), and 2.30 (H-6a) and 1.97 (H-6b)/35.0 (C-6). Additionally, signals for three methines were also observed at \u03b4H 3.84 (H-3)/\u03b4C 70.6 (C-3), 3.20 (H-5)/28.3 (C-5), and 5.25 (H-7)/75.5 (C-7). The resonances for the four methylenes and three methines suggested the presence of a diarylheptanoid moiety, which was confirmed by the COSY correlations between the consecutively connected protons, H-1 to H-7 was indicative of a methoxyl group, which was positioned at C-4\u2032\u2032\u2032 based on the observed HMBC cross-peaks between the methoxy protons and C-4\u2032\u2032\u2032. Moreover, resonances for a trans-olefinic group were observed at \u03b4H 7.94 (H-8\u2032\u2032\u2032) and 7.80 (H-9\u2032\u2032\u2032), with a large coupling constant of 15.6 Hz. The 1H-NMR spectrum also showed a singlet for a hydrogen-bonded phenolic OH group at \u03b4H 15.32. In the 13C-NMR spectrum, resonance for the carboxyl group was shown at \u03b4C 193.4 (C-7\u2032\u2032\u2032). These observations indicated the presence of a chalcone skeleton. Further analyses of the correlation spectroscopy (COSY), nuclear Overhauser effect spectroscopy (NOESY), heteronuclear single-quantum correlation (HSQC), and HMBC spectra allowed the detailed assignment of the 1H and 13C resonances (1 was the same as that of the previously reported katsumain G (2), a diarylheptanoid fused with a chalcone moiety ) were calculated. As shown in 1 were smaller than those between katsumain E and 1. Furthermore, this evaluation supported the suggestion that the relative configurations of 1 were more similar to those of katsumain F than they were to those of katsumain E . This indicated that the relative configurations of 1 are 3*S,5*R,7*S.These results were further confirmed by comparing the E and F A. The remers see , owing tructures ,18,19. T1 were determined by comparing its optical rotations with those of katsumain F and a synthetic analog, calyxin F . The optical rotations of katsumain F and calyxin F were reported as c 0.1, MeOH) and c 0.175, MeOH), respectively -2-(4-hydroxy-phenyl)-7-methoxy-2H-1-benzopyran-6-yl}-3-(4-hydroxyphenyl)-2-propen-1-one, namely, katsumain H.The results indicate that the structure of 1 and 2 on HSF1 and its transcriptional targets, HSP27 and HSP70, were evaluated using western blotting in NCI-H460 cells collected after a 24-h treatment with the isolated compounds. Celastrol, an HSP inducer, was used as a positive control that did not affect HSF1 expression. As shown in 1 and 2 increased the expression of both HSP27 and HSP70, whereas only compound 2 increased HSF1 expression. These results indicate that the mechanism of compound 2 differed from that of celastrol. Moreover, compounds 1 and 2 did not show any cytotoxicity against NCI-H460 cells (IC50 > 30 \u03bcM). In conclusion, 1 and 2 could be potential leads for development as cytoprotective agents for the treatment of damaged organs through the induction of HSF1, HSPs, or both.The inductive effects of compounds \u03b4). Tetramethylsilane (TMS) was used as an internal standard. Mass spectrometry was recorded using a Waters ACQUITY UPLC system coupled to a Micromass Q-Tof Micro mass spectrometer and an Agilent 6220 Accurate-Mass TOF LC/MS system . Silica gel and Sephadex LH-20 were used for the column chromatography (CC). Thin layer chromatography (TLC) was performed using Kieselgel 60 F 254 and RP-18 F 254s plates, with visualization under UV light (254 and 365 nm) and 10% (v/v) H2SO4 spray followed by heating . Preparative HPLC was carried out using an Acme 9000 system using YMC J\u2019sphere ODS-H80 column.Optical rotation was measured using a P-1010 polarimeter at 25 \u00b0C. UV spectrum was recorded using a U-3000 spectrophotometer . 1D and 2D NMR experiments were performed using the UNITY INOVA 400 MHz FT-NMR instrument , with chemical shifts given in ppm , and were identified by Professor Je-Hyun Lee . A voucher specimen (no. EA299) was deposited at the Natural Product Chemistry Laboratory, College of Pharmacy, Ewha Womans University.The seeds of A. katsumadai seeds and the preparation of fractions Fr.11.1\u2013Fr.11.17 were described in a previous report + .1 and 2 on HSF1 and the HSPs\u2019 expression were evaluated using a previously established protocol [\u03b2-actin antibodies were purchased from Santa Cruz Biotechnology . All of the results represent the mean \u00b1 SD of three independent experiments performed in triplicate 24 h after treatment. Furthermore, p-values < 0.05 were considered statistically significant, comparing the quantitative values of HSP70, HSP27, or HSF1 expression levels between treated and untreated control cells.The modulatory effects of compounds protocol . ProteinThe cells were tested for their cytotoxicity in the 3--2,5-diphenyltetrazoliumbromide test, as previously described ."} +{"text": "This study contributes to the understanding of the mechanisms associated with signs and symptoms of tooth eruption, by investigating the presence of mast cells in pericoronal tissues during the intraosseous (Group 1) and submucosal (Group 2) phases of eruption. We compared findings for these two groups with each other and with those for the oral mucosa (Group 3). In each group, 14 specimens were analyzed microscopically after hematoxylin and eosin staining and immunohistochemical analysis of c-Kit and tryptase expression. Results revealed that the number and density of mast cells is different in follicular tissues according to the eruption phase, which may mean that: 1) masticatory trauma of the oral mucosa and dental follicles in the submucosa may explain why reduced enamel epithelium exposes enamel to the cells of the connective tissue; 2) exposure of antigenic enamel proteins might correspond to the release of sequestered antigens, which may lead to the interaction of IgE and a greater number of mast cells in the region; and 3) the consequent degranulation and the local release of mediators, such as histamine, leukotrienes, prostaglandins, proteases, cytokines and growth factors, contribute to the understanding of signs and symptoms associated with tooth eruption. Tooth eruption may be divided into three phases according to bony crypt movements: 1) pre-eruptive; 2) eruptive, or pre-functional; and 3) post-eruptive, or functional.Fully formed enamel is covered with reduced enamel epithelium. Together with the capsular connective tissue that nourishes it, it forms the dental follicle, or dental sac, which has a fundamental role in tooth eruption, confirmed by the fact that its removal interrupts this process.-Dental follicles have a high concentration of chemical mediators of osteoclasis,a) Prostaglandins;b) Epidermal growth factor (EGF); c) Interleukin-1 (IL-1);d) Bone morphogenetic protein 4 (BMP-4); e) Colony-stimulating factor 1 (CSF-1); f) Transforming growth factor (TGF-\u03b2). ,They act as a cascade of molecular signs, beginning with EGF or TGF-\u03b21, which increases the genic expression of IL-1\u03b1 in the stellate reticulum. IL-1\u03b1 activates CSF-1, which takes part in the influx of monocytes in the pericoronal tissues, which differentiate into the osteoclasts necessary for tooth eruption.Deciduous tooth eruption has already been erroneously associated with several health disorders, such as sleep disruption, ear and cheek itching, primary herpetic gingivostomatitis, cough, croup, bronchitis, diarrhea, fever, convulsions and even deathInflammation of gingival tissues before the full emergence of the crown may cause transient pain for a few days. Other signs and symptoms believed to be associated with this phase of eruption are irritability, sleep disruption, gingival inflammation, salivation, diminished appetite, diarrhea, intraoral ulcers, temperature increase, need to bite objects, itching and earache.Pierce et al.-This local hypersensitivity reaction may explain the frequent clinical signs found during tooth eruption. The tissues that surround the erupting tooth accumulate inflammatory cells, especially lymphocytesMast cells were first described in 1877 by Ehrlich. They derive from pluripotential cells of the bone marrow and reside in connective tissue, predominantly near blood vessels, nerves and subepithelial tissues. A mature mast cell is relatively large, fusiform, polygonal or oval, measuring 15 to 20 \u00b5m, with a cytoplasm slightly eosinophilic and full of granules loaded with mediators. The nucleus is basophilic, slightly eccentric and relatively large, measuring 4 to 7 \u00b5m in diameter and having multiple chromatin agregates.,-The number of mast cells in human skin ranges from 5,120 to 9,472 per cubic millimeterBecause of the great variety of active pharmacological mediators in its granules, mast cells have a fundamental role in both hypersensitivity reactions and inflammation. Mast cells significantly affect independent or IgR-dependent responses, extending its potential as pro-inflammatory effector cells to the regulating components of the immune system and contributing to the development and amplification of specific and unspecific inflammatory responsesThe study conducted by Pierce et alThe tissue specimens examined in this study were collected from 42 healthy patients and divided into three groups: \u00bb Group 1 - dental follicles in the intraosseous phase of eruption: 14 surgical specimens of patients with an indication for extraction of unerupted intraosseous tooth. After osteotomy, the dental follicle was carefully removed before extraction .\u00bb Group 2 - dental follicles in the submucosal phase of eruption: 14 surgical specimens of patients with an indication for gingivectomy. The gingiva and part of the dental follicle were removed .\u00bb Group 3 - oral mucosa: 14 surgical specimens of patients with an indication for removal of inflammatory fibrous hyperplasia. The oral mucosa of the specimen margins was free of any pathological changes . All the specimens were fixed in 10% formalin, embedded in paraffin and sequentially sectioned at a thickness of 4 \u00b5m. Tissue sections were mounted on slides to be stained and immunolabeled. The slides were stained with hematoxylin and eosin (HE) and photographed using light microscopy (Olympus CH2). The criteria for analyses included the morphological aspects of the lining epithelium of the connective tissue and of the odontogenic epithelium of the dental follicle. Tissue sections underwent two types of immunolabeling: \u00bb CD117 or c-Kit : transmembrane protein that belongs to the class III receptor of tyrosine-kinase family. The natural ligand for CD117 has been called mast cell growth factor. CD117 is found in progenitor and precursor cells of all hematopoietic lineage, but not in mature hematopoietic cells, except for mast cells.\u00bb Tryptase : family of trypsin-type neutral serum proteases, predominantly found in mast cells. As active enzymes, tryptases in mast cells are noncovalent tetramers with 132 kDa. The determination of mast cells using tryptases has been useful in the identification of focal or diffuse infiltrates rich in mast cells, as well as of atypical mast cells with little granulation or non-metachromatic. o C for 12 hours. Samples were deparaffinized in four 5-min xylene baths, the sections were hydrated in PBS for five minutes, and endogenous peroxidase was blocked using 3% H2O2 (hydrogen peroxide) for five minutes. Antigen retrieval was performed in a steamer, in a pre-heated solution of 2.1% citric acid, pH 6, for 40 min at a temperature of up to 100o C. The Dako K4001 Envision System HRP labeled polymer antimouse was used for detection. Four-\u00b5m sections were mounted on slides and fixed at 70o C overnight. When removed from the refrigerator, they were rinsed in PBS, and a 0.1% diaminobenzidine (DAB) chromogen was used for five minutes. The sections were washed in distilled water and counterstained with Mayer\u2019s hematoxylin.The slides were incubated in a refrigerator at 4The number of mast cells was determined as the mean number of cells detected in ten different microscopic fields for each specimen, using a 40X objective lens, at 140 fields for each group and for each immunolabelt test was used to compare the two immunolabeling methods (c-Kit and tryptase) in the same group; and ANOVA was used for the comparisons between the three groups. The level of significance was set at 5% for all the analyses.Results are reported as mean number of immunolabeled cells in the microscopic fields. The StudentDental follicles had reduced enamel epithelium with four to five layers and projections that invaded the connective tissue Fig 3A). On the surface, there was a continuous cuboidal cell layer composed of reduced ameloblasts A. On the.The follicle in eleven specimens had reduced epithelium of the enamel organ. The other three specimens had a stratified squamous epithelium with three to five cell layers. Follicular connective tissue was loose in some cases, mainly in the subepithelial and perivascular spaces; in other cases, it was fibrous. Interspersed islands and cords of odontogenic epithelium, remnants of the dental lamina, were regularly observed. No areas of inflammatory infiltrate or exudate were found in teeth in the intraosseous phase of eruption.Dental follicles had an overlying oral mucosa, lamina propria and submucosa that contained follicular connective tissue with fragments of reduced enamel epithelium. In the oral mucosa, stratified squamous epithelium had an average of 15 to 30 cell layers, with discreet to moderate hyperplasia. In the lamina propria and submucosa, there were sporadic polymorphonuclear and mononuclear leukocytes. There were rare and scattered islands of odontogenic epithelium. The number and aspect of blood vessels were normal .On the internal surface of the tissue fragment of dental follicle, the reduced enamel epithelium was not continuous. In four specimens, the internal lining was composed of reduced enamel epithelium; in ten, of stratified squamous epithelium. The fibrous connective tissue of the oral mucosa was continuous with the follicular connective tissue, with no signs of clear borders between them. The connective tissue near the follicular epithelium was looser and less collagenous.Specimens in this group had stratified epithelium with 15 to 30 layers, and lamina propria was free of inflammation. Epithelium was parakeratinized and, in some areas, moderately hyperplastic. In the oral submucosa, fibrous connective tissue had sporadic leukocytes, but their morphology did not indicate inflammation .\u00bb Group 1 - Immunolabeling of follicular tissues in the intraosseous phase using both c-Kit and tryp\u00bb Group 2 - Immunolabeling of dental follicles in the submucosal phase of eruption using c-Kit and tryptase revealed a marked presence of mast cells in the submucosal connective tissue and in the dental follicle. Mean number of mast cells in the microscopic fields was 10.96, with a standard deviation of 2.67 cells . \u00bb Group 3 - In the oral mucosa, mast cells immunolabeled using c-Kit and tryptase were scattered. Mean number of mast cells per microscopic field was 4.4, with a standard deviation of 1.63 .p> 0.05). The evaluation of the same immunolabeling in the different groups, considering Group 1 and Group 2, Group 1 and Group 3, and Group 2 and Group 3, revealed a statistically significant difference (p< 0.05) in all comparisons (Tab. 2). The number of mast cells (mean and standard deviation) in the three groups is shown in ,The presence of IgE in dental follicles in the phase after enamel is secreted may confirm that there is a hypersensitivity reaction during tooth eruption, as reported by Pierce et al.Group 2 represented the moment of tooth eruption, the submucosal phase, during which the epithelium of the dental follicle was no longer continuous, with areas where the enamel was exposed to the extrafollicular connective tissue. Immunolabeling of these follicles using c-Kit and tryptase revealed a large number of mast cells. -Pierce et alThe analysis of mast cells revealed that the three groups had distinct results, with differences that were not markedly significant. Group 1 had few mast cells in only a few specimens. These results could not be compared with others in the literature, because the present search did not retrieve any studies with similar methods to detect mast cells in pericoronal tissues in this phase. The intact epithelium of the dental follicle probably protects the enamel from the action of the cells in the connective tissue, associated with immunopathological reactions.,In contrast, Group 2 had a larger number of immunolabeled mast cells. The ruptured epithelium of the dental follicle and the exposure of enamel to the connective tissue may attract more mast cells to the region, because enamel has proteins that may act as sequestered antigens.In normal oral submucosa (Group 3), the number of mast cells was much smaller than in the connective tissue of the dental follicles during the submucosal phase. Masticatory trauma of oral mucosa and dental follicles in the submucosa may explain why reduced enamel epithelium exposes enamel to the cells of the connective tissue. These traumas may promote the discontinuity of the reduced enamel epithelium, frequently seen in Group 2.Exposure of antigenic enamel proteins might correspond to the release of sequestered antigens.The results of this study suggest that: The amount/density of mast cell is different in follicular tissues according the eruption phase. During the intraosseous phase of eruption, immunohistochemical analyses do not reveal any marked presence of mast cells in follicular connective tissues. In the submucosal phase, the number of mast cells is significantly higher than in the intraosseous phase of tooth eruption, and in the submucosa of the normal oral mucosa not associated with teeth.These results suggest that: Trauma due to mastication on the set of oral mucosa and dental follicles in the submucosa may explain why reduced enamel epithelium exposes enamel to the cells of the connective tissue. Exposure of antigenic enamel proteins might correspond to the release of sequestered antigens that would lead to the interaction of IgE and the greater number of mast cells in the region. The consequent degranulation and the local release of mediators, such as histamine, leukotrienes, prostaglandins, proteases, cytokines and growth factors, contribute to the understanding of signs and symptoms assigned to tooth eruption, such as itching, inflammation, local redness and sialorrhea."} +{"text": "T2:R26eYFP) in which neuroblasts and their progeny are permanently fluorescently labelled. Moreover, neuroblasts differentiated into neurons and astrocytes 35 days post implantation, and the neuroblast-derived neurons were Syn1 positive suggesting integration into existing neural circuitry. In addition, astrocytes co-localised with neuroblasts along the hydrogel tract, suggesting that they assisted migration and simulated pathways similar to the native rostral migratory stream. Lower levels of astrocytes were found at the boundary of hydrogels with encapsulated brain-derived neurotrophic factor, comparing with hydrogel implants alone.Neural stem cells, which are confined in localised niches are unable to repair large brain lesions because of an inability to migrate long distances and engraft. To overcome these problems, previous research has demonstrated the use of biomaterial implants to redirect increased numbers of endogenous neural stem cell populations. However, the fate of the diverted neural stem cells and their progeny remains unknown. Here we show that neural stem cells originating from the subventricular zone can migrate to the cortex with the aid of a long-lasting injectable hydrogel within a mouse brain. Specifically, large numbers of neuroblasts were diverted to the cortex through a self-assembling \u03b2-peptide hydrogel that acted as a tract from the subventricular zone to the cortex of transgenic mice (NestinCreER Brain lesions are a consequence of physical injury, stroke and neurodegeneration residing in the SVZ divide and transit into amplifying cells which consequently differentiate into neuroblasts. The neuroblasts slide as neuronal chains along the rostral migratory stream (RMS) toward the olfactory bulb, where they differentiate into neurons and integrate in the granule and periglomerular layers into neural networks . The peptide self-assembled to form a stable and long-lasting hydrogel which was biocompatible with neuronal cells -\u03b2 K-\u03b2 A-OH), where C14 alkyl chain was attached to the first amino acid by reducing azide -\u03b2 A# (RGD)-\u03b2 K-OH to reach a final concentration of ~0.0083 mg mL\u22121. 0.3 mg of the optimized peptide containing 10% RGD peptide and 90% peptide was added to the BDNF solution to reach a final concentration of 10 mg mL\u22121 to form a hydrogel stock (R&D Systems) with a concentration of 25 \u03bcg mL\u22121 in corn oil) was induced by oral gavage at a dosage of 300 mg/kg. Gavaging was repeated for 4 consecutive days was also added to the hydrogel. With reference to mouse atlas (AP 1.1 mm), the hydrogel should be 2.3 mm long to be able to hit the SVZ. Since a 23 g needle with inner diameter of 0.337 mm was used, the required volume of hydrogel considering the density of hydrogel was calculated to be 2.4 \u03bcL. To ensure that the formed hydrogel is sufficient to cover the whole area from the SVZ to the cortex a final volume of 3 \u03bcL was used. Prior to implantation, 3 \u03bcL of hydrogel was loaded into a modified 23-gauge needle. The loaded hydrogels were implanted 5 min after loading to ensure stable hydrogel formation. To ensure that the needle tip did not cause additional injury to the brain, the needle tip was cut and the needle was polished to yield a round and smooth edge.Hydrogels were formed in a sterile environment with UV sterilized peptide powder and sterile PBS and BDNF. Optimized peptide containing 10% RGD-peptide and 90% C14-peptide was dissolved in PBS to reach a concentration of 10 mg mL41 cells . The opt41 cells . For BDN\u22121 of mouse. Anaesthesia was then induced with the inhalation of 1% isoflurane followed by reducing to 0.5%, which was maintained during the surgery. In order to disrupt the SVZ, the hydrogel implantation was performed at 1.0 mm anterior of bregma, 2.0 mm laterally from the midline of the skull at an injection angle of 25 degrees, with the needle being tilted toward the midline in the coronal plane into the left hemisphere. A needle injury only (sham injection) was created following the same procedure as the hydrogel implantation method. The sham injection served as a control to investigate the cellular response following injury at the same coordinate into the right hemisphere of the animals.Implantation of hydrogel was performed 3 days after the final gavaging. Sixteen adult male transgenic mice (average age of 13 weeks) were divided into four mice per experimental condition. They were used to study the change of astrocyte and microglia in response to hydrogel implants/shame injections and also to investigate neuroblast migration along the hydrogel with and without loaded BDNF. Pre-anaesthesia injection was performed intraperitoneally using 0.1 mL atropine (Pfizer) and 0.2 mL xylazine (Troy Laboratories) in 0.7 mL saline (Baxter); 0.001 mL g\u22121 of animal and perfused first with PBS (0.2 M) and then with 4% PFA in PBS. The brains were removed and fixed in 4% PFA for 2 h and then transferred to a 30% sucrose solution until the brains sank to the bottom of the tube. Brains were then frozen with dry ice and stored at \u221280\u00b0C. The brains were serially sectioned in the coronal plane using a cryostat (Leica) with a thickness of 30 \u03bcm (micron) and then the sections were air dried for 1 h prior to storage in 0.9 mL saline; 0.006 mL g4 \u03bcm were counted within the hydrogel and compared to the sham injection. The centre of the material tracts was estimated and 100 \u03bcm by 100 \u03bcm grids were put along the centre line on both sides for quantification for 1 min at room temperature and then rinsed with PBS for 3 \u00d7 5 min. The brain sections were then permeabilised in 0.3% Triton-X100 for 5 min and washed in PBS for 3 \u00d7 5 min. The non-specific antibody binding was blocked with 10% NGS (Vector Laboratories) including 1% BSA (Sigma) and 0.2% Tween20 in PBS for 1 h at room temperature followed by a PBS wash. Brain sections were then stained with several antibodies: rabbit anti-Iba1 (1:250) (microglia marker), rabbit anti-GFAP (1:1000) (Dako) (astrocyte marker), chicken anti-GFP (1:200) (Abcam), rabbit doublecortin (1:400) , mouse anti-NeuN (1:100) (mature neuron marker) (Abcam), and rabbit anti-synapsin 1 (1:100) (Thermofisher) in 1% BSA in PBS at 4\u00b0C overnight. The sections were rinsed thoroughly with 0.2% Tween 20 in PBS on the following day (3 \u00d7 5 min) and incubated in anti-rabbit Alexa Flour 568 (1:1000), anti-chicken Alexa Flour 488 (1:000) or anti-mouse Alexa Flour 488 (1:000) (Thermo Fisher Scientific) in 0.05% Tween 20 in PBS at 37\u00b0C for 1 h. After thorough washing with 0.2% Tween 20 in PBS (2 \u00d7 5 min), the sections were counterstained with DAPI (1 \u03bcg/ml) (Thermo Fisher Scientific) for 5 min and after additional thorough washing (1 \u00d7 5 min) the slides were mounted by coverslip and prepared for fluorescent imaging using a Leica microscope. Images were captured with three fluorescence channels and were merged using ImageJ software (NIH). The boundaries of hydrogel and sham injection were estimated via the accumulation of cells using DAPI staining, due to high levels of brain tissue response to sham injuries and implants. This was revealed by high density of cells with DAPI staining at these boundaries. For cell quantification, the whole length of the hydrogel from SVZ to the top of the brain was taken into consideration. Microglia cells per 10fication . Cells qpost hoc testing (GraphPad Prism Version 6.01). P < 0.05 was used to determine statistical significance.Statistical analysis was performed on 9 sections for each cell type quantifications. Cell quantifications were expressed as mean \u00b1 standard deviation. Equal variances in different groups were confirmed by Levene's Median Test. The groups were then compared using one-way ANOVA with Tukey's 4 \u03bcm presented in The change of astrocyte and microglia level in response to the \u03b2-peptide hydrogel was assessed by quantifying the astrocyte and microglial responses. A 23 g stainless steel hypodermic needle was injected into the brain as a control to determine the cellular response to injury caused by the injection of the material with the same sized needle. The change of astrocyte and microglia level was examined at 7 d which corresponds to the time period of peak acute activation fluorescence intensity to the uninjured parts of the brain . Astroglse study showed tin vivo, it suppressed the tissue response and subsequently improving tissue-scaffold integration.Overall, the number of microglia and astrocyte found in this study suggest that the hydrogel is biocompatible and integrates well with the parenchyma. While the exogenous BDNF released from the hydrogel is expected to be rapidly released T2:R26eYFP transgenic mice are permanently labelled as GFP+ve cells, regardless of the different developmental stages. Therefore, it is possible to identify the migrating cells and their progeny for the sham injection , were performed in accordance with the National Health and Medical Research Council guidelines.JF, DF, M-IA, MD, PC, and TM conceptualised the ideas. SM, MD, KK, and KZ performed the experiments. SM wrote the first draft of the manuscript. All authors provided revisions, designed the experiments, and analysed the data.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."} +{"text": "Ophthalmolepis lineolatus and Notolabrus gymnogenis only occurring on shallow reefs and schooling species of fish that were unique to each depth category: Atypichthys strigatus on shallow reefs and Centroberyx affinis on mesophotic reefs. While shallow reefs had a greater species richness and abundance of fish when compared to mesophotic reefs, mesophotic reefs hosted the same species richness of fishery-targeted species. Chrysophrys auratus and Nemodactylus douglassii are two highly targeted species in this region. While C. auratus was numerically more abundant on shallow reefs, mesophotic reefs provide habitat for larger fish. In comparison, N. douglassii were evenly distributed across all sites sampled. Generalized linear models revealed that depth and habitat type provided the most parsimonious model for predicting the distribution of C. auratus, while habitat type alone best predicted the distribution of N. douglassii. These results demonstrate the importance of mesophotic reefs to fishery-targeted species and therefore have implications for informing the management of these fishery resources on shelf rocky reefs.The spatial distribution of a species assemblage is often determined by habitat and climate. In the marine environment, depth can become an important factor as declining light and water temperature leads to changes in the biological habitat structure. To date, much of the focus of ecological fish research has been based on reefs in less than 40 m with little research on the ecological role of mesophotic reefs. We deployed baited remote underwater stereo video systems (stereo-BRUVS) on temperate reefs in two depth categories: shallow (20\u201340 m) and mesophotic (80\u2013120 m), off Port Stephens, Australia. Sites were selected using data collected by swath acoustic sounder to ensure stereo-BRUVS were deployed on reef. The sounder also provided rugosity, slope and relief data for each stereo-BRUVS deployment. Multivariate analysis indicates that there are significant differences in the fish assemblages between shallow and mesophotic reefs, primarily driven by The spatial distribution of a species assemblage is strongly determined by habitat and physical conditions ,2, and iMesophotic reefs are those characterised by the presence of light-dependent corals and associated communities often between the depths of 30\u201340 and 150 m in tropical and subtropical regions of the world ,16\u201319. FTemperate mesophotic reefs have important biodiversity, social and economic values ,25, so uAs mesophotic reefs often occur adjacent to inshore shallow reefs, some connectivity across the depth gradient might be expected. It was hypothesised in the late 1990s and early 2000s, for example, that mesophotic reefs provide refuge for some fish species ,39,40. TSurveys of mesophotic reefs have historically been logistically difficult and expensive due to the need for large offshore vessels and the lack of detailed information on their distribution and structure ,42,43. EWhile there has been some assessment of fish assemblages on shallow reefs in temperate eastern Australia \u201356, therThis study took place along a ~40 km length of coastline between Port Stephens and Seal Rocks within the waters of the PSGLMP and HMP in New South Wales, Australia -32\u00b0S; . This reAppropriate ethics (NSW Department of Primary Industries: ACEC REF 10_09) and fieldwork (NSW Department of Primary Industries research activities in NSW state waters: Permit No. P01/0059(A)-4.0 and research activities inside a marine park: Permit No. PSGLMP 2018/010) permits were obtained for this work.In order to evaluate the extent, distribution and structure of rocky reefs in the study region, swath acoustic bathymetry and derived habitat data were collated from previous surveys . In addiAll acoustic surveys were conducted using a 125 kHz Geoswath interferometric swath system. Position and vessel motion for sonar acquisition was provided using a POS MV with Real-time Kinematic height and positional Virtual Reference Station corrections through SmartNet across the Telstra Mobile 3G network using Hypack (Hypack USA) acquisition software. Real-time ephemeris data were saved in POSPac log files for post-processing and calculating a 3 min forward-backward smooth for improved SBET in Single Base Station Mode. Mean SBET positional accuracies were improved to be better than 0.1 for X, Y and Z at nadir. Smoothed best estimates of trajectory were applied to Geoswath data before rough processing using amplitude, box, across-track and along-track filters in GS+. Data were exported as GSF for further data cleaning and cube modelling of soundings and production of a final digital elevation model. Backscatter data were output from GS+ in XTF data and then mosaiced using the Sidescan Solo module within Fledermaus FMGT. Reef extent was hand digitised from hillshaded bathymetry and derived slope layers and identified as \u2018reef with profile\u2019.The Spatial Analyst tool and Benthic Terrain Modeller add-on in ArcGis v10.3.1 were used to analyse the cleaned bathymetric data. 50 m and 100 m radius buffers around individual stereo-BRUVS were used to calculate the mean, standard deviation and range for relief, rugosity, ruggedness, curvature and slope. Due to the 200 m separation between stereo-BRUVS, this ensured there were no overlaps. Pearson\u2019s correlations were used to assess data obtained from the 50 m and 100 m radii for correlation.Stereo baited remote underwater video (stereo-BRUV) was used to sample the fish assemblages at two depth strata, shallow reef (20-40m) and mesophotic reef (80-110m), as per the methodology set out in Langlois et al. . SamplinEach deployment targeted rocky reef, and a deployment was considered successful if the stereo-BRUV landed on or immediately adjacent to rocky reef and when both the reef/benthos and water column could be viewed clearly. If a replicate was located over soft sediment it was moved to the nearest area of reef. Stereo-BRUVs were deployed for a period of 30 minutes which has been determined to be a sufficient time to obtain a representative sample of the fish community .http://www.seagis.com.au). Approximately one kilogram of pilchard (Sardinops sp.) was crushed in a plastic mesh bait bag and attached to the stereo-BRUV frame at the end of a 1.5 m long PVC pole. Due to the low light levels at depths >80m, we used Raytech subsea lights mounted to the centre of the stereo-BRUV frame at sites below that depth. A blue light was used as it is likely that the 450\u2013465 nm wavelength is below the spectral sensitivity range of many fish species and therefore will have minimal effect on the fish behaviour [Each stereo-BRUV unit consisted of two Canon HG25 video cameras with a wide angle lens that were housed in two custom made SeaGIS Lty Ltd housings (ehaviour . On seveChrysophrys auratus (pink snapper) and Nemadactylus douglasii (blue morwong) observed at the time of MaxN was measured as total length . Total length was used as this is how the minimum legal length (MLL) is measured. The MLL for both of these species is 300 mm total length. These two species are considered fishery target species and are often used as indicator species in stereo-BRUV surveys [www.seagis.com). The video footage was also used to categorise substrate type and habitat type as factors in an attempt to relate species and species assemblage data to the environment and habitat (Video imagery collected by stereo-BRUVs was scored using standard metrics including scoring relative abundance (MaxN) as the maximum number of fish occurring in any one frame for each species. MaxN is widely accepted as the best method for estimating relative abundance from stationary video camera footage . All fis surveys . All ste habitat .To examine patterns in species assemblages, we used redundancy analysis (RDA). RDA is related to principal components analyses and is based on Euclidean distance, implying that each species is on an axis orthogonal to all other species, and sites are points in this multidimensional space . Due to a priori and these included species richness, total relative abundance, the most speciose families and species that are either abundant or of fishery interest . We also modelled the relative abundance of all recreationally and commercially targeted species pooled together. Recreationally targeted species were determined from West et al. [To investigate the spatial distribution of the fish assemblage across shallow and mesophotic reefs we used generalised additive mixed models (GAMMs). These can incorporate the non-linear patterns and overdispersion often encountered with spatially structured ecological studies. A suite of response variables was chosen t et al. , while ct et al. . Site, aPrior to any modelling, all data were explored using scatter and boxplots to assess for correlations between covariates and outliers in the response variables. To minimise the risk of overfitting any models, if two covariates had a Pearson\u2019s correlation >0.7, then the variable that made the least \u2018ecological sense\u2019, according to the authors, in explaining the distribution of fish or was less replicable in future studies were removed.A forward stepwise method was used to select the \u2018best\u2019 model based on Akaike information criterion (AIC). The first step ran models with individual predictor variables and the model with the lowest AIC was then selected. Step two ran models including the first predictor variable with all other variables and again selected the variable with the lowest AIC. This was repeated until the difference in the AIC was less than two. Models were limited to three predictor variables to minimise overfitting. Since GAMMs can account for data that are not normally distributed, models were fitted with untransformed data using a Poisson distribution. Once the final model had been decided, the model residuals were assessed for heterogeneity and overdispersion. If a model was considered overdispersed, the process was repeated but this time using the negative binomial distribution. Models with a negative binomial distribution were also assessed using a forward stepwise selection of the k value. All GAMM analyses were performed using the \u2018GAMM4\u2019 package in R .C. auratus and N. douglassi was investigated using boxplots and histograms. A Kolmogorov-Smirnoc two-sample test was used to compare the lengths distributions between shallow and mesophotic reef following the methods outlined in Langlois et al. [The distribution of lengths for s et al. . This prs et al. . We usedA total of 107 stereo-BRUVs were successfully completed, with 64 deployments on the shallow reef and 43 deployments on the mesophotic reef . A totalOphthalmolepis lineolatus (southern Maori wrasse) was the most ubiquitous species, being recorded on 100% of deployments, followed by Notolabrus gymnogenis and C. auratus (92%). In comparison, on mesophotic reefs Centroberyx affinis (eastern nannygai) was the most ubiquitous species, being recorded on 74% of deployments, followed by N. douglasii at 72% and Trachurus novaezelandiae (yellowtail scad) at 60%. Two threatened species were also recorded, Epinephelus daemelii (black cod) on shallow reef and Carcharias taurus (grey nurse shark) on both shallow and mesophotic reef.Labridae and Monacanthidae were the most speciose families with nine species each, equating to 19% of the total species richness. On shallow reefs, 2 = 0.27, F = 5.82, P < 0.001). Permutation tests of each of these constraints gave significant marginal terms . The reef metrics relief, rugosity, ruggedness, curvature and slope were not significant in terms of explaining the transformed species assemblage data. The RDA ordination showed a clear division in stereo-BRUV deployments on shallow reefs and mesophotic reefs and Scorpis lineolate (silver sweep), as well the indicator species C. auratus and O. lineolatus being the most relatively abundant. Only one species of Labridae, Bodianus unimaculatus (eastern pigfish), was recorded on mesophotic reefs. The family Monacanthidae were more equally distributed across reef type was related to depth, latitude and habitat type were found to be distinct from those associated with adjacent shallow rocky reefs 20\u201340 m). Despite the large differences in species richness and relative abundance of all fishes, 30 species occurred across the depth categories that were sampled. This is one of the first studies to compare rocky reef fish assemblages across the 80\u201390 m range in depths at these latitudes, and there are few comparable temperate studies. The vast majority of mesophotic reef research has occurred in tropical systems in Australia, the USA and Caribbean . There a0 m. DespThe transition zone between the shallow and mesophotic species assemblages is unclear in this study as we did not sample between depths of 40\u201380 m. The mesophotic reef that was sampled during this study is disconnected from rocky reefs found in shallow waters as it is separated by large expanses of soft sediment habitats . The curThis study found strong depth related patterns that could be coupled with depth related reef and habitat complexity ,6,26. InApart from light availability and habitat, ocean currents and temperature gradients or thermoclines further separate mesophotic reefs from adjacent shallow reefs . In tempThe physical structure of the reefs is likely to have the greatest influence on the spatial distribution of fishes on rocky reefs. The swath acoustic data were beneficial in selecting reefs to sample, but they can also be used to derive metrics that can possibly predict the spatial distribution of species richness, species of interest and all fishery target species pooled together. The derivation of habitat metrics from swath acoustic data can provide various levels of explanatory or predictive ability relating to fish assemblage composition and distribution ,34,78,79C. auratus is arguably the most important recreational and commercial fishery in this region [C. auratus were twice as abundant on shallow reef, on average C. auratus were larger around mesophotic reefs. In proportion, there were more C. auratus above the MLL for retention and thus considered sexually mature [C. auratus, while deeper mesophotic reef provide additional habitat for larger mature C. auratus. This is possibly due to either or both ontogenetic movement of larger fish to deeper waters or localised fishing pressure removing larger fish from shallow waters [C. auratus are larger in no-take zones indicating fishing pressure does have some impact on the size structure of a localised population [C. auratus are known to have relatively small home ranges, but some individuals move hundreds of kilometres [C. auratus demonstrated small home ranges with strong site fidelity on shallow reefs [At a species level, the explanatory factors varied among the four species that were selected a priori for analysis. s region . While Cy mature on mesopw waters ,25,81,82w waters . Larger w waters . Unfortupulation ,56. In glometres \u201387. Thisow reefs , but theN. douglassi was more influenced by latitude than by depth. They do occur across a range of habitats including soft sediment and rocky reef and mainly feed on soft sediment associated molluscs and crustaceans [N. douglassi are medium to large bodied fish that are targeted by recreational and commercial fishers. On average, the N. douglassi recorded during this study were above the MLL for retention and could be considered sexually mature [N. douglassi are fairly constant across the depth gradient. Similarly, P. dentex was commonly observed on both types of reef, but they were patchier in their distribution. They were often observed in large schools on stereo-BRUV deployments positioned on the edge of reef or over adjacent soft-sediments. They too are targeted and retained by recreational and commercial fishers [M. scaber is the most numerically abundant monacanthid species in eastern Australia and New Zealand, but very little is known of its ecology and biology [M. scaber is well suited to these mesophotic reefs [N. douglassi and P. dentex there doesn\u2019t appear to be any preference for a particular depth of reef and nor is there any clear ecological rationale for one.In contrast, the distribution of staceans ,89. N. d biology . They aric reefs . For N. This study demonstrated that the fish assemblages of rocky reef at mesophotic depths are statistically different to the adjacent shallow reef systems. Despite more than double the total abundances, there were similar relative abundances of fishery target species across both shallow and mesophotic reefs suggesting that, from a fisheries management perspective, these reef systems have the potential for similar social and economic values. Increased knowledge and access to improved technology is now allowing boat-based recreational fishers to target deeper reefs. Swath acoustic data contributed to explaining the spatial distribution of each aspect of the fish assemblage. There is still a research need to investigate seasonal patterns and fine-scale intra-reef variability in fish assemblages on these temperate mesophotic reefs. The use of a complementary method, such as remotely operate vehicle or towed video that passively samples the fish assemblages would provide valuable information on the species not captured through the use of stereo-BRUV sampling . Notwith"} +{"text": "Few studies have examined how food insecurity changes over time when living with severe mental disorders or substance use disorders. This study identifies food insecurity trajectories of homeless adults participating in a trial of a housing intervention and examines whether receiving the intervention and having specific mental and substance disorders predict food insecurity trajectories.We studied 520 participants in the Toronto site of the At Home/Chez-Soi project. Food insecurity data were collected at seven times during a follow-up period of up to 5.5 years. Mental and substance use disorders were assessed at baseline. Food insecurity trajectories were identified using group based-trajectory modeling. Multinomial logistic regression was used to examine the effects of the intervention and mental and substance use disorders on food insecurity trajectories.persistently high food insecurity, increasing food insecurity, decreasing food insecurity, and consistently low food insecurity. Receiving the intervention was not a predictor of membership in any specific food insecurity trajectory group. Individuals with major depressive episode, mood disorder with psychotic features, substance disorder, and co-occurring disorder (defined as having at least one alcohol or other substance use disorder and at least one non-substance related mental disorder] were more likely to remain in the persistently high food insecurity group than the consistently low food insecurity group.Four food insecurity trajectories were identified: A persistently high level of food insecurity is common among individuals with mental illness who have experienced homelessness, and the presence of certain mental health disorders increases this risk. Mental health services combined with access to resources for basic needs, and re-adaptation training are required to enhance the health and well-being of this population. Mental and substance use disorders remain a major public health and social issue among homeless individuals. A recent study conducted in high-income countries found alcohol dependence and drug dependence are among the most common disorders among the homeless population, with a prevalence ranging from 8\u201358% and 5\u201354%, respectively . PrevaleIndividuals with poor mental health are at a greater risk of poverty and job loss ,4, sociaPrior studies indicate homeless individuals disproportionately experience food insecurity more than the general population ,13,28,29To build on existing literature, this paper examines the association of mental and substance use disorders with food insecurity trajectories among a sample of homeless adults enrolled in the At Home Chez Soi (AH/CS) Study, a randomized controlled trial of Housing First in Toronto. Specifically, the objectives of the study were to 1) identify trajectories of food insecurity over a period of 5.5 years, 2) test the predictive effect of the housing intervention on the identified patterns of changes in food insecurity, and 3) analyze how mental and substance disorders predict food insecurity trajectory membership. We hypothesize that having a severe mental or substance use disorder will be strong predictors of a trajectory of persistent food insecurity over the follow up period.This study used data from the Toronto site of the AH/CS study, which was a randomized controlled trial that compared a scattered-site Housing First intervention and support services (HF) to treatment as usual (TAU) . DetailePrior to randomization, participants were stratified by their level of needs for mental health services. Need level was determined based on an algorithm that included the presence of psychotic disorder or bipolar affective disorder with psychotic symptoms 6.0), level of community functioning , presence of a co-morbid substance use disorder, and history of hospitalization and incarcerations ,35. Out The Toronto AH/CS study received approval by the Research Ethics Board of St. Michael\u2019s Hospital in Toronto, Canada. All study participants provided written informed consent to participate in the AH/CS study. The AH/CS study is registered with the International Standard Randomized Control Trial Number Register (ISRCTN42520374).Food security data were collected during in person interviews using the modified version of the US Adult Food Security Survey Module . This inThe following mental health disorders were examined as predictors of food insecurity: depressive episode, panic disorder, mood disorder with psychotic features, posttraumatic stress disorder (PTSD), manic or hypomanic episodes, psychotic disorder, alcohol and substance use disorder. All mental and substance use disorders were identified based on DSM-IV criteria using the MINI 6.0 and were evaluated at the time of screening for study eligibility ,43.Co-occurring disorders were defined as a comorbid condition including at least one alcohol or other substance use disorder and at least one non-substance related mental disorder. ,45We included the factors used to screen or assign participants to the different AH/CS study groups: level of needs (high vs. moderate level of need), gender , self-identified ethnic group (white vs. member of non-white/ethnic groups), and intervention group ,35,46. BGroup-based trajectory modelling was used to identify clusters of individuals who followed a similar pattern of change (trajectory) of food insecurity over time . Using iNext, we used multinomial logistic regression to examine the effect of HF on trajectory group membership. We fit an unadjusted model including only the intervention group and an adjusted model controlling for gender, age, education level, ethno-racial status, levels of need, and lifetime duration of homelessness.We also used multinomial logistic regression to separately assess the effect of having a mental or substance use disorder on food insecurity trajectory membership. For each mental health outcome we adjusted for gender, age, education level, ethno-racial group, levels of need, homelessness lifetime duration, and intervention group. Twenty-five individuals (4.8%) were excluded from the multivariable analysis due to missing values for either education or lifetime duration of homelessness. To evaluate the family-wise error rate due to mutilple inferences, we used Bonferroni to compute a corrected overall critical P-value . All anaCharacteristics of study participants are summarized in 3 = -1579.35, and BIC4 = -1573.34, and BIC5 = 1598.37). The average posterior probability for the 4-group model ranged from 0.75 to 0.81 and the odds of correct classification weighted posterior probability was higher than 5, which also indicate good fit.Based on the Bayesian Information Criterion fit statistics, the model with two quadratic trajectories and two linear trajectories was the best fit model , decreasing food insecurity (from moderate to low), and consistently low food insecurity for a participant assigned to the HF intervention compared to TAU. Assignment to the Housing First intervention was not statistically associated with any of food insecurity trajectory groups.persistent food insecurity trajectory group compared to the group of consistent low food insecurity trajectory (RRR = 1.9 [95% CI: 1.1 to 3.2]) (persistent food insecurity group (RRR = 3.4 [95% CI: 1.6 to 6.9]), decreasing FI group (RRR = 4.1 [95% CI: 2.0 to 8.1]), and increasing FI group (RRR = 2.7 [95% CI: 1.2 to 6.2]). Individuals with substance disorder were also more likely to be part of the group that followed the persistent food insecurity trajectory (RRR = 3.0 [95% CI: 1.7 to 5.2]) and the decreasing FI trajectory (RRR = 2.2 [95% CI:1.3 to 3.8]). In contrast, participants with psychotic disorder were less likely to belong to the persistent food insecurity trajectory group (RRR = 0.5 [95% CI: 0.3 to 0.9]) compared to the group of consistent low food insecurity trajectory. Finally, co-occurring disorders were associated with increased likelihood of being classified in the persistent food insecurity trajectory (RRR = 2.78 [95% CI: 1.60 to 4.83]) and in the decreasing food insecurity trajectory (RRR = 2.45 [95% CI: 1.45 to 4.15]) groups, compared to the group of consistent low food insecurity trajectory. Estimates for Mood disorder with psychotic features, Substance disorder, and Co-occurring disorders remained statistically significant after the Bonferroni adjustement for multiple inferences.Participants with major depressive episode were more likely to be part of the the to 3.2]) . Likewispersistent food insecurity trajectory group, who remained food insecure over the entire study period, 2) consistent low food insecurity trajectory group, who remained low food insecure over the follow-up period, 3) decreasing food insecurity trajectory group, who experienced less food insecurity over time, and 4) increasing food insecurity trajectory group, who experienced more food insecurity over time. These trajectories highlight the diverse experiences of food insecurity among homeless individuals and a need for targeted interventions to reduce food insecurity. For example, individuals within the increasing trajectory group require strategies to stabilize or reverse the increasing food insecurity over time, while the decreasing FI insecurity group requires supports to accelerate the reductions in food insecurity.This study employed a group-based approach to identify trajectories of food insecurity and to examine the predictive effects of a Housing First intervention and mental and substance use disorders on trajectory group membership. We identified four trajectory groups: 1) et al. Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: PartlyReviewer #2: Partly**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1: NoReviewer #2: No**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1: Although the statistical analyses were conducted appropriately and rigorously to the best of my knowledge, the following major concerns prompted me to question the technical soundness of the manuscript:The manuscript cites \u201ca recent study\u201d on food insecurity among homeless individuals (lines 84-85), but does not make it clear in the text that this study is an analysis of data from the same parent study (At Home/Chez Soi) as the current manuscript. Because the research questions of the published 2017 paper on food insecurity among At Home/Chez Soi participants appear related to the research questions of the current manuscript, the authors should acknowledge the previously published paper and explicitly state how the research questions and analyses of the current paper are distinct.The manuscript repeatedly uses the language of impact with reference to substance use disorders and mental disorders, e.g. \u201cthis paper examines the impact of mental and substance use disorders on food insecurity trajectories\u201d (lines 93-94). This does not accurately reflect the paper\u2019s research design and analyses, which demonstrate associations between substance use/mental disorders and food insecurity trajectories, but cannot definitively show that substance use/mental disorders impact food insecurity.The plausible mechanisms suggested (lines 294-306) speak mainly to the general relationship between homelessness and food insecurity and do not match the study's specific findings on food insecurity trajectories. For example, the authors mention lack of food storage and pressures of survival needs (e.g. finding a place to sleep) as explanatory factors in high rates of food insecurity among homeless people, but there was no difference in food insecurity noted between Housing First and treatment as usual participants in this study. Presumably the Housing First residents would have greater access to food storage, and are not faced with the survival need of finding a place to sleep, so the relevance of this mechanism to the study's findings is not clear.The statement that \u201cpolitical and social actions are required to create healthier and more inclusive societies\u201d (lines 321-322) is extremely vague; it would be more helpful for the authors to name specific policy or practice implications related to the study findings. The conclusion \u201cBoth food related and mental health interventions and services are required to enhance the health and well being of this population\u201d (lines 326-328) is also very vague and does not speak to the study\u2019s findings regarding different food insecurity trajectories and the possibility that people with different vulnerabilities are at varying levels of risk for food insecurity and therefore may require different services or interventions.Regarding data availability, the authors state that \u201cData cannot be shared publicly because of ethical restrictions to the data\u201d but do not specify the nature of the restrictions or further elaborate on this.In addition, I noted the following minor concerns:Use of the term \u201calcohol and drug dependence\u201d in line 65 is outdated, as this reflects DSM-IV language.The origin of the definition of food insecurity provided (lines 74-75) is not clear; many current definitions specify that food insecurity is not just about access to food, but access to nutritious food. It is also not clear if the stated prevalence of food insecurity in homeless individuals with mental disorders is referring to the Canadian context, or globally (line 76).The meaning of \u201cethno-racial group (yes or no)\u201d is not clear (line 150).Gender is not listed as a covariate on p. 7-8, but is named as a control variable in Tables 3 and 4.The authors discuss dichotomizing the variable of food insecurity (lines 135-136), but then reference three levels of food insecurity in defining the four food insecurity trajectories (lines 189-191).Reviewer #2: The authors present results of a study of food insecurity over time in homeless individuals in Toronto participating in a randomized trial of a scattered-site Housing First intervention with support services compared to treatment as usual. The authors identify four subgroups of trajectories of food insecurity . They found no association between intervention group and trajectory group, but did identify some mental health disorders at higher risk of belonging to certain food insecurity groups. The manuscript will be strengthened if the authors consider the following points.1. The authors mention that 55 individuals were excluded due to having only 1 food insecurity assessment. This makes sense in the context of the focus on longitudinal patterns in food insecurity. However, I think it will help the reader understand the sample better if the authors include some basic descriptions of those excluded .2. What was the mean (and standard deviation) of the number of food insecurity assessments for the 520 people included in this analysis? Did this differ by intervention group or by key mental health disorders of interest?3. It would be helpful to show Table 1 also broken down by Intervention group. It also would be helpful to have the distribution of need (moderate vs high) by mental and substance disorders presented in a table or in the text (which might help in interpreting the results in later tables).3. Are the quadratic terms really needed for the Increasing FI and Decreasing FI groups? The parameters presented in Table 2 are essentially 0. What is the BIC in the 4 group model with all linear trajectories?4. Under the section starting on line 216, it would be worth reporting the percent randomized to HR in each of the FI trajectory groups to further support the RRR presented in Table 3.5. In some sense, the trajectory groups might be considered ordered, with Persistent FI the worst, then Increasing FI, then Decreasing FI, and then consistently low FI. Why did the authors use a multinomial logistic model rather than an approach that takes into account this ordering? Taking this into account might better capture who is most at risk for the worse trajectories compared to less worse trajectories.6. The authors perform 9 different models in Table 4, but there is no adjustment of multiple comparisons.7. For co-occurring disorders, the authors focus on the results related to persistent FI (lines 239-242), but there was also a finding with increased risk fo decreasing FI.8. How do the authors interpret the fact that substance abuse and mood disorder with psychotic features are at increased risk of both the persistent FI (a bad thing) and decreasing FI (probably a good indicator)? Same for co-occurring disorders. These conclusions may be different if the authors actually take into account the ordering of the groups as I mention above, because as analyzed, these results are confusing to try to interpret.Minor edits:1. line 65: change \"vary\" to \"varies\"2. line 140: there is an extra \".\"3. line 150: there is an extra \",\"4. Table 1: It would be helpful to know what was captured in Ethno-racial group. There are 304 of these individuals in the sample, so I imagine there are further sub-groups that can be listed here with corresponding frequencies to give the reader a better sense of who is represented in this sample.5. Table 2: the percentage for Increasing FI should be 19.0 (not 18.9)6. line 237: what does \"and RRR=1.6 [95% CI: 1.0 to 2.7]\" refer to? This doesn't seem to match anything in Table 4.7. line 258 \"need to for\" should be \"need for\"8. In the Abstract, Discussion , and Conclusion, the authors include PTSD in the list of disorders more likely to be in the persistently FI group, but this finding was not significant (though close). The authors also don't mention this in the text of the Results section.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article digital diagnostic tool, 19 Nov 2019PONE-D-19-21014Mental and Substance Use Disorders and Food Insecurity among Homeless Adults Participating in the At Home/Chez Soi StudyEditorial TeamDear Editor, I am pleased to re-submit the manuscript entitled \u201cMental and Substance Use Disorders and Food Insecurity among Homeless Adults Participating in the At Home/Chez Soi Study\u201d. We would like to extend our sincere gratitude to the PlosOne team and the Reviewers for their positive and constructive feedback. The co-authors and I have carefully reviewed the Reviewers\u2019 comments and provide point-by-point responses to their comments below. In particular, we have addressed the concerns related to the participants excluded, and have also applied the Bonferroni test for multiple comparisons for some of the analyses. We have also changed the statement to the data restrictions and removed all language or expressions that can imply causal relationship. We include a manuscript with the highlighted changes and a clean version, as well as an appendix file with additional tables. We believe that the revised manuscript is greatly improved and has addressed all Reviewer comments. Thank you again for your consideration.Sincerely,Reviewer #1: Although the statistical analyses were conducted appropriately and rigorously to the best of my knowledge, the following major concerns prompted me to question the technical soundness of the manuscript:The manuscript cites \u201ca recent study\u201d on food insecurity among homeless individuals (lines 84-85), but does not make it clear in the text that this study is an analysis of data from the same parent study (At Home/Chez Soi) as the current manuscript. Because the research questions of the published 2017 paper on food insecurity among At Home/Chez Soi participants appear related to the research questions of the current manuscript, the authors should acknowledge the previously published paper and explicitly state how the research questions and analyses of the current paper are distinct.Response: We thank Reviewer #1 for this constructive feedback and appreciate this important point raised. We added more information about this study and explained how is distinct to this manuscript. We state as follows (lines 84-90):Using the At Home/Chez Soi (AH/CS) data, a recent study across 5 Canadian cities examined the effect of a Housing First (HF) intervention on food security among homeless with mental health disorders, and found marginal but inconsistent improvements in food security following provision of housing after 2-year of implementation(31). In this study, mental health disorders were not the main focus, and food insecurity was modelled at specific points in time, which ignores food security trajectories altogether or assumes that they are homogenous within each intervention group. Recent studies suggest this type of analysis may conceal significant heterogeneity of long-term trajectories within groups .In the following paragraph, we explained (line 96-104):To build on existing literature, this paper examines the association of mental and substance use disorders on food insecurity trajectories among a sample of homeless adults enrolled in the At Home Chez Soi (AH/CS) Study, a randomized controlled trial of Housing First in Toronto. Specifically, the objectives of the study were to 1) identify trajectories of food insecurity over a period of 5.5 years, 2) test the predictive effect of the housing intervention on the identified patterns of changes in food insecurity, and 3) analyze how mental and substance disorders predict food insecurity trajectory membership. Reviewer: The manuscript repeatedly uses the language of impact with reference to substance use disorders and mental disorders, e.g. \u201cthis paper examines the impact of mental and substance use disorders on food insecurity trajectories\u201d (lines 93-94). This does not accurately reflect the paper\u2019s research design and analyses, which demonstrate associations between substance use/mental disorders and food insecurity trajectories, but cannot definitively show that substance use/mental disorders impact food insecurity.Response: We changed as follows (lines 96):To build on existing literature, this paper examines the association of mental and substance use disorders on food insecurity trajectories among a sample of homeless adults enrolled in the At Home Chez Soi (AH/CS) Study, a randomized controlled trial of Housing First in Toronto.Reviewer: The plausible mechanisms suggested (lines 294-306) speak mainly to the general relationship between homelessness and food insecurity and do not match the study's specific findings on food insecurity trajectories. For example, the authors mention lack of food storage and pressures of survival needs (e.g. finding a place to sleep) as explanatory factors in high rates of food insecurity among homeless people, but there was no difference in food insecurity noted between Housing First and treatment as usual participants in this study. Presumably the Housing First residents would have greater access to food storage, and are not faced with the survival need of finding a place to sleep, so the relevance of this mechanism to the study's findings is not clear.Response: We have reformulated the entire paragraph in the discussion section (lines 316-327): First, mental disorders impair coping strategies and skills to manage food insufficiency in the face of scarce resources even after being in stable housing. While previous studies identify issues related to food storage or access to a kitchen for meal preparation (23), we hypothesize that mental disorders, mainly Mood disorder with psychotic features and substance disorder, limit adjustment to an environment and lifestyle with better food security related supports and ability to manage resources in a manner that prioritized food security(57). Second, when mental disorders co-occur with (recent or present) homelessness and structural discrimination, an individual\u2019s ability to gain suitable employment and social capital is impaired, which further limits availability of economic resources to support achieving food security(58\u201360). Third, moving to stable housing may eventually increase living costs\u2014transportation, energy bills, household supplies--which result in more competition for scarce resources impacting food security. Reviewer: The statement that \u201cpolitical and social actions are required to create healthier and more inclusive societies\u201d (lines 321-322) is extremely vague; it would be more helpful for the authors to name specific policy or practice implications related to the study findings. The conclusion \u201cBoth food related and mental health interventions and services are required to enhance the health and wellbeing of this population\u201d (lines 326-328) is also very vague and does not speak to the study\u2019s findings regarding different food insecurity trajectories and the possibility that people with different vulnerabilities are at varying levels of risk for food insecurity and therefore may require different services or interventions.Response: We reformulated the entire paragraph as follows to provide more specification (lines 336-345): Since mental health issues and food insecurity are often intertwined chronic conditions, it is necessary to account for the unique impact specific mental disorders can have on food insecurity over a long period of time. This is especially relevant when providing housing, as individual mental health needs and trauma should be taken into account but also to ensure access to adequate social and basic needs, including food security program. Homelessness, food insecurity and discrimination are avoidable social problems that affect thousands of people locally and globally; political and social actions such as greater access to social and transitional housing, skill and job support services, a basic income for low income individuals, and interventions to target implicit bias for employers and service providers can help to create healthier and more inclusive societies. Mental health services combined with access to resources for basic needs, and social and re-adaptation training are required to enhance the health and well-being of this population. (lines 350-352)Reviewer: Regarding data availability, the authors state that \u201cData cannot be shared publicly because of ethical restrictions to the data\u201d but do not specify the nature of the restrictions or further elaborate on this.Response: We changed the statement as followsStephen.Hwang@unityhealth.to . All study proposals and data requests will be further reviewed by the At Home/Chez Soi team at the Toronto site. Data sharing agreements between the requestors and At Home/Chez Soi principal investigators need to be completed before accessing the data.Anonymised participant data, the study protocol, informed consent forms, survey forms, and statistical analysis plan from the At Home/Chez Soi Toronto site study will be available to investigators for studies that have received approval from independent research committees or research ethics boards. Data are available from the publication date of this article onwards. Study proposals and data access requests should be sent to Dr Stephen Hwang at Reviewer: In addition, I noted the following minor concerns:Use of the term \u201calcohol and drug dependence\u201d in line 65 is outdated, as this reflects DSM-IV language.Response: Thank you for the precision. We reformulated it as follows (line 65):While the prevalence of mental disorders vary across studies, alcohol and drug use are the most common disorders among the homeless population, with prevalence ranging from 8-58% and 5-54%, respectively(1)We don\u2019t used \u201calcohol and drug disorders\u201d to avoid too much repetition of the work \u201cdisorder\u201d in the same sentenceReviewer: The origin of the definition of food insecurity provided (lines 74-75) is not clear; many current definitions specify that food insecurity is not just about access to food, but access to nutritious food. It is also not clear if the stated prevalence of food insecurity in homeless individuals with mental disorders is referring to the Canadian context, or globally (line 76).We have added \u201cor to nutritious diet\u201d to the definition (line 75)The meaning of \u201cethno-racial group (yes or no)\u201d is not clear (line 150).We have added it: (line 163). This self-identified ethno-racial was included in Toronto Housing First project not to identify specific (race or ethnicity), but to adapt the services the category. Goering PN, Streiner DL, Adair C, Aubry T, Barker J, Distasio J, et al. The at Home/Chez Soi trial protocol: A pragmatic, multi-site, randomised controlled trial of a Housing First intervention for homeless individuals with mental illness in five Canadian cities. BMJ Open. 2011;1(2):1\u201318.Gender is not listed as a covariate on p. 7-8, but is named as a control variable in Tables 3 and 4.We have it as a covariate: gender line (162)Reviewer: The authors discuss dichotomizing the variable of food insecurity (lines 135-136), but then reference three levels of food insecurity in defining the four food insecurity trajectories (lines 189-191).Thank you. We explained in the methodology how we transformed the original variable presented in the lines 135-136 into the food insecurity trajectory groups (lines 169-177)We sincerely appreciate the constructive feedback from Reviewer #1! Reviewer #2: The authors present results of a study of food insecurity over time in homeless individuals in Toronto participating in a randomized trial of a scattered-site Housing First intervention with support services compared to treatment as usual. The authors identify four subgroups of trajectories of food insecurity . They found no association between intervention group and trajectory group, but did identify some mental health disorders at higher risk of belonging to certain food insecurity groups. The manuscript will be strengthened if the authors consider the following points.We thank Reviewer #2 for these insightful suggestions and recommendations. 1. Reviewer: The authors mention that 55 individuals were excluded due to having only 1 food insecurity assessment. This makes sense in the context of the focus on longitudinal patterns in food insecurity. However, I think it will help the reader understand the sample better if the authors include some basic descriptions of those excluded .Response: We have added a table A1 in Appendix comparing participant\u2019s socio-demographic characteristics collected at the baseline, including age, gender, Intervention group, level of need, ethno-racial group. Let us mention the exclusion is for those who had less than 2 assessments, including no food data at all.We also indicated in the text (line 14-5148):Comparisons of socio-demographics characteristics between participants and the excluded group were conducted using student t-tests or Fisher\u2019s test were conducted and showed statistically significant differences only for the variable level of need (See Table A1 in Appendix), which is included as an adjustment variable in our models. 2. Reviewer: What was the mean (and standard deviation) of the number of food insecurity assessments for the 520 people included in this analysis? Did this differ by intervention group or by key mental health disorders of interest?Response: We added a Table A2 in Appendix presenting the mean : Table A2 of Means (and standard deviation) of the number of food insecurity assessments of the participants included in this analysis by intervention group and by key mental health disorders is shown in Appendix. 3. Reviewer: It would be helpful to show Table 1 also broken down by Intervention group. It also would be helpful to have the distribution of need (moderate vs high) by mental and substance disorders presented in a table or in the text (which might help in interpreting the results in later tables).Response: We have added this comparison table in Appendix Table A3. We do not want to present in the text body since this comparison table has been published in previous papers of AH /Chez-Soi Study (so it could be seen a duplication of published results) and the comparison is not the main purpose of this study. The last one was recently published at the Lancet Psychiatry. https://doi.org/10.1016/S2215-0366(19)30371-2 Stergiopoulos, V., Mejia-Lancheros, C., Nisenbaum, R., Wang, R., Lachaud, J, O'Campo, P., and Hwang, S.W. (2019). The long-term effects of rent supplements and mental health support services on housing and health outcomes of homeless adults with mental illness: outcomes of the extended At Home/Chez Soi randomized controlled trial, The Lancet Psychiatry., 3. Reviewer: Are the quadratic terms really needed for the Increasing FI and Decreasing FI groups? The parameters presented in Table 2 are essentially 0. What is the BIC in the 4 group model with all linear trajectories?Response: We have tested all the possibilities, including 4-group model with all linear trajectories. The BIC for 4 group model with all linear trajectories is -1632.59. In addition, the Average of the maximum posterior probability of assignment, other good-fitness criteria, is better for the model selected. 4. Reviewer: Under the section starting on line 216, it would be worth reporting the percent randomized to HR in each of the FI trajectory groups to further support the RRR presented in Table 3.Response: We have added Table A4 in Appendix which shows Participants\u2019 Characteristics at baseline by Food Security Trajectory Group including the variable intervention and all key mental health to see the percent randomized. 5. Reviewer: In some sense, the trajectory groups might be considered ordered, with Persistent FI the worst, then Increasing FI, then Decreasing FI, and then consistently low FI. Why did the authors use a multinomial logistic model rather than an approach that takes into account this ordering? Taking this into account might better capture who is most at risk for the worse trajectories compared to less worse trajectories.Response: As you mentioned \u201cin some sense\u201d, we also have difficult to accept a strict order when looking at the Trajectory group graph mainly for groups 2 and 3. Hence, that is why we believe that imposing that order might bias the results and the interpretation. 6. Reviewer: The authors perform 9 different models in Table 4, but there is no adjustment of multiple comparisons.Response: We want to thank Reviewer#2 for this insight comment. We computed the Bonferroni Adjustment for multiple testing as suggested. We have added in the methodology: To evaluate the family-wise error rate due to multiple inferences, we use Bonferroni to compute a Corrected overall critical P-value (49). (lines 187-188)The value overall critical p-value is presented at the foot of the Table 4, and the smile plot Fig A1 in Appendix. (lines 267-268)We also explained in the section of Results (lines 257-259): Estimates for Mood disorder with psychotic features, Substance disorder, and Co-occurring disorders remained statistically significant after the Bonferroni adjustement for multiple inferences.7. Reviewer: For co-occurring disorders, the authors focus on the results related to persistent FI (lines 239-242), but there was also a finding with increased risk for decreasing FI.Response: We have added it the analysis. (lines 256-257)8. Reviewer: How do the authors interpret the fact that substance abuse and mood disorder with psychotic features are at increased risk of both the persistent FI (a bad thing) and decreasing FI (probably a good indicator)? Same for co-occurring disorders. These conclusions may be different if the authors actually take into account the ordering of the groups as I mention above, because as analyzed, these results are confusing to try to interpret.Response: The reference category for the analysis is Consistent low food FI, as we added as a footnote to the Table 4 (line 265). Such as, it is a better status compared to the other food insecurity trajectory groups, including Decreasing FI group. Hence, it seems that the estimates for substance abuse and mood disorder with psychotic go to the expected direction, higher than 1, compared to the Consistent low food FI group. Yet again, the fact the estimates for Increasing FI are all not statistically significant expresses our difficulty to impose a strict order between groups 2 and 3. Reviewer: Minor edits:1. line 65: change \"vary\" to \"varies\"We have changed it2. line 140: there is an extra \".\"We have removed it3. line 150: there is an extra \",\"We have removed it 4. Table 1: It would be helpful to know what was captured in Ethno-racial group. There are 304 of these individuals in the sample, so I imagine there are further sub-groups that can be listed here with corresponding frequencies to give the reader a better sense of who is represented in this sample.Response: We have added the definition Ethno-racial . (line 163)This self-identified ethno-racial was included in Toronto Housing First project not to identify specific (race or ethnicity), but to adapt the services the category. Goering PN, Streiner DL, Adair C, Aubry T, Barker J, Distasio J, et al. The at Home/Chez Soi trial protocol: A pragmatic, multi-site, randomised controlled trial of a Housing First intervention for homeless individuals with mental illness in five Canadian cities. BMJ Open. 2011;1(2):1\u201318.5. Table 2: the percentage for Increasing FI should be 19.0 (not 18.9)Thank you. We have corrected it. 6. line 237: what does \"and RRR=1.6 [95% CI: 1.0 to 2.7]\" refer to? This doesn't seem to match anything in Table 4.Thanks. We have removed it7. line 258 \"need to for\" should be \"need for\"We have corrected it.8. In the Abstract, Discussion, and Conclusion, the authors include PTSD in the list of disorders more likely to be in the persistently FI group, but this finding was not significant (though close). The authors also don't mention this in the text of the Results section.We removed PTSD in this list of disorders in the Abstract, Discussion, and Conclusion. We thank Reviewer #2 again for all of these extremely helpful comments! 4 Feb 2020PONE-D-19-21014R1Mental and Substance Use Disorders and Food Insecurity among Homeless Adults Participating in the At Home/Chez Soi StudyPLOS ONEDear Dr Lachaud,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.The manuscript has been evaluated by two reviewers, and their comments are available below.The reviewers have raised a number of minor concerns that need attention. They request further clarification on the terminology used, and suggest some grammar corrections. Could you please revise the manuscript to carefully address the concerns raised?https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.We would appreciate receiving your revised manuscript by Mar 19 2020 11:59PM. When you are ready to submit your revision, log on to If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsTo enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.We look forward to receiving your revised manuscript.Kind regards,Carmen Melatti, PhDAssociate EditorPLOS ONE[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1: (No Response)Reviewer #2: (No Response)**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: YesReviewer #2: Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: YesReviewer #2: Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1: YesReviewer #2: Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: NoReviewer #2: Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1: The authors have addressed most of my concerns noted in the previous review. I have noted a few additional or remaining concerns:In lines 75-77, it is still not clear if the prevalence statistic \u201c and is estimated to affect more than two thirds of individuals who experience homelessness with a mental disorder\u201d is in reference to Canada, or elsewhere.The paper is inconsistent in its terminology with regard to if \u201cmental disorders\u201d includes substance use disorders. The first paragraph of the introduction (starting with line 64) implies that mental disorders does include substance use disorders, but elsewhere throughout the paper (including in the title), the authors use the term \u201cmental and substance use disorders\u201d \u2013 suggesting that mental disorders is not inclusive of substance use disorders. The language should be edited to ensure that it is consistent throughout the paper.In line 146, the authors note a statistically significant difference between study participants and participants excluded from the study dataset. The authors should describe what direction this difference is in, e.g. which group shows a greater level of need?Line 97 should say \u201cwith food insecurity trajectories\u201d instead of \u201con food insecurity trajectories\u201d \u2013 this is a minor change but important in terms of not implying causality.There are grammatical errors throughout the paper, including the word \u201cpeople\u201d missing after \u201chomeless\u201d in line 85. The sentences in lines 145-151 are confusing to read, due to grammatical errors (e.g. the first sentence uses the phrase \u201cwere conducted\u201d twice). The paper should be thoroughly edited to correct such errors.It is confusing to use the generic term \u201cethno-racial group\u201d in Table 1. If this refers to people who do not identify as white, I would rephrase it here as something like \u201cmember of non-white racial or ethnic group.\u201d In their response to reviewers, the authors write \u201cThis self-identified ethno-racial was included in Toronto Housing First project not to identify specific (race or ethnicity), but to adapt the services the category\u201d \u2013 I don\u2019t understand what this means. I would also recommend saying \u201cnon-white\u201d instead of \u201cno-white\u201d in line 163.In line 284, the authors should reiterate that the \u201cprior study by O\u2019Campo et al.\u201d also used the At Home/Chez Soi Trial data. It is not that surprising that two analyses of data from the same study found similar findings about the effects of Housing First on food insecurity. Similarly, line 299 should be rewritten to convey that \u201canother study conducted by O\u2019Campo\u201d is not an independent study, but another analysis of the At Home data.Reviewer #2: The authors have addressed the majority of my earlier concerns. In their response to the reviews (and within the manuscript), authors refer to an Appendix with tables and a figure, but I do not see the Appendix with the submission.There are also a couple of typographical errors:line 44: \"ressources\"line 117: \"symtpoms\"**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article digital diagnostic tool, 5 Feb 2020Comments to the AuthorReviewer #1: The authors have addressed most of my concerns noted in the previous review. I have noted a few additional or remaining concerns: Comment: In lines 75-77, it is still not clear if the prevalence statistic \u201cand is estimated to affect more than two thirds of individuals who experience homelessness with a mental disorder\u201d is in reference to Canada, or elsewhere.Answer: Thank you for asking for this precision. We reformulated it as follows:A recent study conducted in high-income countries found alcohol dependence and drug dependence are among the most common disorders among the homeless population, with a prevalence ranging from 8-58% and 5-54%, respectively(1). Prevalence estimates for mental disorders, such as psychosis, depression, personality disorder, and post-traumatic stress disorder, are also higher than those reported for the general population of those countries. For instance, the prevalence of psychosis among homeless individuals (3-42%) is approximately 3 times higher than the estimate in the general population(1).Comment: The paper is inconsistent in its terminology with regard to if \u201cmental disorders\u201d includes substance use disorders. The first paragraph of the introduction (starting with line 64) implies that mental disorders does include substance use disorders, but elsewhere throughout the paper (including in the title), the authors use the term \u201cmental and substance use disorders\u201d \u2013 suggesting that mental disorders is not inclusive of substance use disorders. The language should be edited to ensure that it is consistent throughout the paper.Answer: The text has been edited to avoid this confusion. Mental and substance use disorders remain a major public health and social issue among homeless individuals. A recent study conducted in high-income countries found alcohol dependence and drug dependence are among the most common disorders among the homeless population, with a prevalence ranging from 8-58% and 5-54%, respectively(1). Prevalence estimates for other mental disorders, such as psychosis, depression, personality disorder, and post-traumatic stress disorder, are also higher than those reported for the general population of those countries. For instance, the prevalence of psychosis among homeless individuals (3-42%) is approximately 3 times higher than the estimate in the general population(1).Comment: In line 146, the authors note a statistically significant difference between study participants and participants excluded from the study dataset. The authors should describe what direction this difference is in, e.g. which group shows a greater level of need?Answer: Corrected as follows:Comparisons of socio-demographics characteristics between participants and the excluded group were conducted using student t-tests or Fisher\u2019s test, and showed a statistically significant different only for the variable level of need. Out of the 520 study participants, 48.9% had a high level of need compared to 32.9% in the excluded group . Therefore, we included this variable as an adjustment variable in our models.Comment: Line 97 should say \u201cwith food insecurity trajectories\u201d instead of \u201con food insecurity trajectories\u201d \u2013 this is a minor change but important in terms of not implying causality. Answer: CorrectedComment: There are grammatical errors throughout the paper, including the word \u201cpeople\u201d missing after \u201chomeless\u201d in line 85. The sentences in lines 145-151 are confusing to read, due to grammatical errors (e.g. the first sentence uses the phrase \u201cwere conducted\u201d twice). The paper should be thoroughly edited to correct such errors.It is confusing to use the generic term \u201cethno-racial group\u201d in Table 1. If this refers to people who do not identify as white, I would rephrase it here as something like \u201cmember of non-white racial or ethnic group.\u201d In their response to reviewers, the authors write \u201cThis self-identified ethno-racial was included in Toronto Housing First project not to identify specific (race or ethnicity), but to adapt the services the category\u201d \u2013 I don\u2019t understand what this means. I would also recommend saying \u201cnon-white\u201d instead of \u201cno-white\u201d in line 163.Answer: line 85 corrected. lines 145-151: Thank you. We reviewed it and removed the words \u201cwere conducted\u201d, which were typed twice. We also reviewed the entire manuscript to be sure such typos errors it doesn\u2019t repeat.Thank you for the suggestion for ethno-racial group. We rephrased as follows: \u201cSelf-identified ethnic group (white vs. member of non-white/ethnic groups)\u201dWe also changed it in the table 1 and the footnotes of the tables 3 and 4. Comment: In line 284, the authors should reiterate that the \u201cprior study by O\u2019Campo et al.\u201d also used the At Home/Chez Soi Trial data. It is not that surprising that two analyses of data from the same study found similar findings about the effects of Housing First on food insecurity. Similarly, line 299 should be rewritten to convey that \u201canother study conducted by O\u2019Campo\u201d is not an independent study, but another analysis of the At Home data.Answer: line 284 corrected. \u201cprior study by..\u201d was replaced by \u201cprior analysis by\u2026\u201d Line 289 \u201canother study conducted by O\u2019Campo\u201d was replaced by \u201cA previous analysis conducted by O\u2019Campo using At Home/Chez Soi two years of follow-up data found that\u201dThank for your insightful comments!Reviewer #2: The authors have addressed the majority of my earlier concerns. In their response to the reviews (and within the manuscript), authors refer to an Appendix with tables and a figure, but I do not see the Appendix with the submission.Answer: added it directly at the end of the manuscriptComment: There are also a couple of typographical errors:line 44: \"ressources\"Answer: CorrectedComment: line 117: \"symtpoms\"Answer: CorrectedThank for ! 7 Apr 2020Mental and Substance Use Disorders and Food Insecurity among Homeless Adults Participating in the At Home/Chez Soi StudyPONE-D-19-21014R2Dear Dr. Lachaud,We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.https://www.editorialmanager.com/pone/, click the \"Update My Information\" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact With kind regards,Markos Tesfaye, M.D., Ph.DAcademic EditorPLOS ONEAdditional Editor Comments :Thank you for addressing all of the latest comments from the reviewers.I see a couple of typos in the document that you might wish to correct.1. Line 168: \"non-white racial or ethnic group\" probably needs to be removed.2. (Appendix) Tables A1 and A4 : you might wish to replace \"ethno-racial group as in table A3.Reviewers' comments: 9 Apr 2020PONE-D-19-21014R2 Mental and Substance Use Disorders and Food Insecurity among Homeless Adults Participating in the At Home/Chez Soi Study Dear Dr. Lachaud:I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. For any other questions or concerns, please email Thank you for submitting your work to PLOS ONE.With kind regards,PLOS ONE Editorial Office Staffon behalf ofProf. Markos Tesfaye Academic EditorPLOS ONE"} +{"text": "Depression is an important complication of chronic obstructive pulmonary disease (COPD), occurring in more than one-third of individuals with COPD, and its severity is closely related to the severity and acute exacerbation of COPD, significantly contributing to the risk of death from COPD. Comorbid depression in COPD can be a burden on COPD-related diseases by reducing quality of life and compliance with treatment. Unfortunately, symptoms of COPD combined anxiety and depression are not properly diagnosed and treated in clinical practice, especially in the early stages of mood changes in patients with COPD, as the symptoms are mild and monotonous, and are overlooked.In this prospective, randomized, placebo-controlled trial, we will assigned 280 eligible patients who had COPD combined depression to receive either Modified Xiaoyao Powder (MXP) or placebo. The primary end point is the change in the Hamilton Depression Scale (17 items) (HAMD-17) score from baseline on weeks 4, 12, and 24.Six months of MXP for COPD combined mild to moderate depression may alleviate the symptoms of depression, reduce the frequency of hospitalizations, the number of exacerbations, and improve the compliance of treatment.ChiCTR2000038741. Chronic progressive dyspnea, cough and sputum, and irreversible airflow limitation are the main clinical manifestations and pathological features of COPD, which may lead to various adverse pulmonary and extrapulmonary effects and complications as the disease progresses, such as cardiovascular disease, skeletal muscle dysfunction, osteoporosis, anxiety and depression, diabetes mellitus, hypertension, lung cancer, etc.,4 Statistically, >50% of COPD patients have 1 to 2 comorbidities, 15.8% have 3 to 4, and 6.8% have >5 comorbidities.Chronic obstructive pulmonary disease (COPD) is defined as chronic progressive and debilitating disease with high morbidity, high disability, and high mortality, and its severity is closely related to the severity and acute exacerbation of COPD,,7 greatly associated with increased risk of mortality related COPD. At the same time, anxiety and depression in combination with respiratory illness can subjectively amplify the true perception of the illness itself, especially dyspnea or cough, leading to higher hospitalization rates and increased use of bronchodilators, inhaled and systemic corticosteroids and antibiotics, as well as the incidence of adverse events. To date, however, COPD guidelines do not provide definitive treatment recommendations for patients with mental disorders such as anxiety and depression. Thus, early identification, diagnosis, and treatment of COPD patients with comorbid depression is crucial.Depression is an important complication of COPD, with a prevalence of up to 80% in the severe phase of COPD, Liver-Qi stagnation is the most common syndrome of TCM of depression, and Xiaoyao Powder is a representative formula for the treatment of Liver-Qi stagnation. Clinical and experimental studies have shown that Xiaoyao Powder has the exact effect of improving and treating depression, with few adverse reactions, and that its antidepressant mechanism is related to neurotransmitters, neurotrophins, hypothalamic-pituitary-adrenal axis, amino acids, lipids, energy metabolism, and inflammatory factors. Therefore, the Modified Xiaoyao Powder (MXP) used in this trial will be made from Xiaoyao Powder.Depression belongs to the category of \u201cdepression syndrome\u201d in traditional Chinese medicine (TCM). There is a more systematic theoretical understanding and rich experience in diagnosis and treatment of depression syndromes, especially for mild to moderate depression. also recommend TCM prescriptions with antidepressant effects for the treatment of mild to moderate depression. So, is it possible to combine the 2 treatments to achieve better clinical effects? Based on this, we designed this study, to evaluate its clinical efficacy and its effect on the prognosis of COPD.Psychotherapy is considered to be the classical treatment for mild to moderate depression and is most accepted by patients. The guidelinesThe aim of this research project has therefore been to assess the efficacy and safety associated with MXP in treatment of mild to moderate depression.22.1This trial will be conducted in Hospital of Chengdu University of Traditional Chinese Medicine from December 2020 through March 2022. We will recruit patients with COPD combined mild to moderate depression and will assign them in 1:1 ratio to the treatment group or the control group. All participants will receive both personalized treatment for COPD according to GOLD 2020 guidelines and psychotherapy advocated by Chinese Expert on the diagnosis and treatment of depression with integrated traditional Chinese and western medicine. In addition, the treatment group will receive MXP and the control group will receive MXP placebo 3 times a day. The primary end point is the change in the HAMD-17 score from baseline at weeks 4, 12, and 24. The secondary end points, which will assessed at weeks 4, 12, and 24, include a reduction of >50% from baseline in the HAMD-17 score, the change from baseline in modified medical research council dyspnea scale score (mMRC score), the change from baseline in COPD assessment test (CAT score), the frequency of hospitalizations, and the number of exacerbations.Safety will be assessed based on the times and severity of adverse events, vital signs, blood, urine and feces routine, laboratory measurements , and electrocardiogram. Adverse events be defined as any adverse events or any deterioration of existing diseases that occurred from the first administration of MXP or MXP placebo to 7 days after the last administration. The flow chart of the study design, see Fig. 2.2 . All participants provided written informed consent. The spirit figure of enrolment, interventions, and assessments is shown below in Fig. The trial registered on September 27, 2020 and was reviewed and approved by Chinese Ethics Committee of Registering Clinical Trials . This trial will be conducted in accordance with the Declaration of Helsinki and the protocol follows the recommendations of the SPIRIT 20132.3We plan to start recruiting 280 participants, who are from the outpatient or inpatient wards of the Hospital of Chengdu University of Traditional Chinese Medicine in December 2020. The researcher takes the initiative to introduce this trial, and the participant voluntarily participate in this project. After being screened by the clinician according to the inclusion and exclusion criteria, they can be enrolled.2.4 the mean HAMD-17 score of the treatment group would be 13.33 and the standard deviation would be 4.21. The mean of the control group would be 11.57 and the standard deviation would be 5.01. We use power\u200a=\u200a0.80, alpha\u200a=\u200a0.05 , a 1:1 ratio, and assuming that the drop-out rate of the trial is 20%, an estimated a total of 280 patients will be needed in this trial. PASS 15 software will be used to calculate the sample size.Date from a previous study indicated that for a trial population with mild to moderate depression treated with TCM prescription with antidepressant effect for 4 weeks,2.5A computer-controlled system implemented by the Sichuan Evidence-based Medicine Center of Traditional Chinese Medicine is randomly grouped, and a random code table corresponding to the serial number 001\u2013280 is generated. After the participants meet the enrollment criteria and sign the informed consent, the random group number of the participants is obtained, and which is placed in a light-proof envelope and sealed. When the participant is accepted, the number is checked and unsealed therefore the participant is assigned to the group, thus, completes the treatment allocation for 280 participants. Participants and researchers cannot predict the specific grouping condition of participants.2.6In this trial, we adopt a double-blind design, the researchers and participants are blinded without knowing the specific grouping. The dosage form, shape, taste, and color of the placebo, which consists of starch without any active ingredient, will be as close as possible to the MXP used in the treatment group. Only in emergency situations, such as a severity adverse event, or when the participant needs emergency rescue, the researcher reports to the supervisor and the principal investigator to decide whether to unblinding. Once the participant is unblinded, the case will be regarded as a dropout case and will not be included in the efficacy analysis.2.7 and mild to moderate depression.Patients must meet the diagnostic criteria for COPDThe syndrome of stagnation of Liver-Qi of depression be defined as: primary symptoms: depressed mood, oppression in chest, sighing, fullness, and distention in hypochondrium.Secondary symptoms: abdominal distention and fullness, belching, poor appetite, breast distention before menstruation, symptoms fluctuate with mood. Tongues and pulses image: thin white coat, stringy pulse.2.82.8.118 to 65 years of age, include men and women.Patients who had received a diagnosis of COPD combined mild to moderate depression (7\u200a\u2264\u200aHAMD-17 score\u200a\u2264\u200a24); and meet the syndrome of stagnation of Liver-Qi of depression.The course of depression does not exceed 3 months.The patients have not taken antidepressants in the past 1 month.Agree to participate and sign an informed consent form.2.9A history of a suicide attempt, treatment-resistant depression, and familial mental illness.Had a recent history of other acute or chronic significant clinical manifestations medical conditions.A history of bipolar disorder, schizophrenia, or schizo affective disorder.Patients who cannot actively cooperate with the treatment.33.1 which include:All participants in this trial will be randomly divided into the treatment group or the control group. Both groups will receive individualized treatment plan for COPD referred to GOLD 2020 guidelines,1)A group : Setropium Bromide Powder Inhalation inhale, one press each time, once a day.2)B group : Setropium Bromide Powder Inhalation inhale, one press each time, once a day.3)C group : Budesonide formoterol powder inhalation inhale, one puff each time, twice times a day.4)D group : Budesonide formoterol powder inhalation inhale, one puff each time, twice times a day; Setropium Bromide Powder Inhalation inhale, one press each time, once a day.Meanwhile, all participants will receive psychotherapy services, provided by psychosocial assistants. Those assistants must receive at least 2 weeks of face-to-face training by a qualified psychoeducation institution before the start of the trial. Only after the training can they be qualified to provide psychological services to the participants. A group mode will be adopted, with 8 to 12 patients in each group and completed by 2 psychosocial assistants. Psychotherapy services provided by psychosocial assistants to patients can be conducted face-to-face or online, 1.5 to 2\u200ahours each time. The content adopts individualized programs based on the participant conditions, with the purpose of alleviating the symptoms of depression. During this period, the psychosocial supervisor provides direct supervision to the psychosocial assistants through telephone or interview, and inspects the work of the psychosocial assistants based on the responses of patients.In addition, the treatment group will be provided for MXP, which produced by the Department of Pharmacy, Hospital of Chengdu University of Traditional Chinese Medicine, 1 frame each time, 3 times a day, mixed in boiled water for oral taking. The main components of MXP see Table 3.2Primary end points: The change in the HAMD-17 score from baseline .Secondary end points: A reduction of >50% from baseline in the HAMD-17 score, the change from baseline in mMRC score, the change from baseline in CAT score, the frequency of hospitalizations, and the number of exacerbations .Follow up: The clinical follow-up will be arranged at weeks 4, 8, 12, and 24 after the treatment. The data collected at each visit will include patient diary, HAMD-17, 9-item Patient Health Questionnaire score (PHQ-9), mMRC, CAT, hospitalization, the number of exacerbations, adverse event records, etc.3.3A dedicated data manager will be assigned for data entry and management. The data administrator will use EpiData software, version 3.1 for data entry and management. To ensure data accuracy, double entry and proofreading should be done by 2 data administrators independently. The data administrator can send queries to the investigator through the clinical supervisor in the case report form (CRF), and the investigator should answer and return the queries as soon as possible. After reviewing and confirming that the database created is correct, the data are locked by the project host unit, principal investigator, and statistical analysts. No further changes will be made to the data or files after the locking. Any problems found after the data lock is confirmed and corrected in the statistical analysis program.3.4t test will be used to compare baseline characteristics between the study groups. Logistic regression analysis will be used to determine factors related to follow-up failure. The repeated measures mixed effects model will be used to analyze the least squares mean changes of HAMD-17, PHQ-9, CAT, mMRC scores from baseline. The generalized estimation equation model will be used to analyze the categorical variable HAMD-17 score for baseline reduction >50%, the number of exacerbations, and the frequency of hospitalizations. Efficacy analysis will be performed in accordance with the principle of intention-to-treat . For missing data, the method of sequence average will be used to replace missing data.Use SAS software version 9.3 for statistical analysis. Continuous variables are expressed as mean and standard deviation, and categorical variables as numerical values and percentages. The chi-square test and P\u200a<\u200a.05 is statistically significant.All hypothesis adopts 2-sided testing, and 4As a chronic pulmonary disease, COPD has a long duration, recurrent episodes, and is often associated with mental states such as anxiety and depression. Patients with COPD and depression often present clinically with depressed mood, lack of interest, fatigue, anorexia, sleep disturbances, and other cognitive, behavioral, and social abnormalities. Increased the number of acute exacerbations and hospitalizations reduce the quality of life of COPD patients. Prevalence studies have shown that patients with COPD are 4 times more likely to suffer from depression than those without COPD. The prevalence is especially high in the severe stage of COPD, making it an important challenge in the treatment of COPD.TCM has a long history and rich experience in treating depression, and is characterized by bidirectional regulation, multitarget, multisystem, and multilevel in antidepressants. Therefore, the combination of TCM with psychotherapy for improving depressive symptoms in patients with mild to moderate depression and achieving the optimal combination with few adverse effects is the most important feature of this trial design, as previous studies have confirmed the clear efficacy of TCM for mild to moderate depression. Although the combined pharmacological and psychological treatment approach is not the first innovation in this trial, the TCM prescriptions and outcome indicators selected in this trial can provide more evidence for the clinical treatment of depression from various aspects and perspectives.Secondly, complications are not conducive to the treatment and prognosis of COPD patients. Therefore, at the beginning of the design of this trial, this factor was taken into consideration, and the specific efficacy of early intervention on the prognosis of patients with COPD will be measured by assessing the number of acute exacerbations, hospitalization rate, and clinical symptoms of COPD.Furthermore, treatment based on syndrome differentiation is the characteristic of TCM. The same disease may manifest itself in multiple syndromes, and the selection of the TCM prescription is also different. Thus, the shortcoming of this trial is that in actual clinical practice, the TCM diagnosis of patients with COPD combined depression is not limited to the single syndrome of Liver-Qi stagnation, so the TCM prescriptions selected in this trial are not applicable to all patients with depression. Besides, due to the single-center design, the sample size of this trial was limited.In a word, in our study, TCM combined with psychotherapy, as compared with single treatment, will be effective in reducing depression and anxiety symptoms and improve COPD patients prognosis.55.1This trial will began from December, 2020, and approximate date of completion is March, 2022. A total 280 participants will be enrolled.5.2The study supported by Sichuan Science and technology program (2020JDRC0114 2020YFH0164). The funder has provided only financial support for the study.5.3Written informed consent will be taken from all participants at the start of recruitment in this study.Thanks to Dr. Chuantao Zhang for his assistance and valuable advice.Conceptualization: Wei Xiao, Yufei Liu.Formal analysis: Yang Yang.Investigation: Wei Xiao.Supervision: Xiaohong Xie.Writing \u2013 original draft: Keling Chen, Keni Zhao.Writing \u2013 review & editing: Keling Chen, Keni Zhao, Wujun Wang, Jing Xiao."} +{"text": "Despite the inferior patency compared to arterial grafts, a saphenous vein graft (SVG) is widely used for coronary artery bypass grafting (CABG). A lower atherosclerosis rate and higher patency have been reported for SVG obtained via the no-touch technique (NT) than via conventional preparation (CV). Although CV-mediated endothelial dysfunction is implied, the precise mechanism underlying the higher patency with NT is poorly understood.Human residual SVGs during CABG and SVG sections after autopsy were analyzed. The endothelial surface was observed using scanning electron microscopy (SEM) and blindly compared between CV and NT. The endothelial integrity was also analyzed with immunohistochemistry.Unexpectedly, the hyperfine structure on SEM was comparable between CV and NT before grafting, and microvillus, a characteristic of endothelium, was indistinguishable between them. Von Willebrand Factor, an endothelial marker, was equally detected throughout the vascular wall in both groups from residual and postmortem sections.The morphological integrity of the endothelium was successfully preserved in SVG with CV, even at an ultrastructural level. Although its functionality remains to be addressed, other factors than the endothelium may be involved in the high patency obtained by NT. The present findings suggest that the characteristics of NT and surgical methodology should be reconsidered. Coronary artery bypass grafting (CABG) is a standard therapy for ischemic heart disease. Despite the inferior patency compared to arterial grafts, saphenous vein grafts (SVGs) are still widely transplanted for CABG due to their ease of manipulation \u20134. ConseConventional preparation (CV) of SVG, consisting of deprivation of surrounding tissues and distension, has been utilized for decades but is implied to be associated with atherogenesis and a poor patency rate \u20138. SinceBased on the studies comparing CV and NT, it is now broadly accepted that conventional distension injures the endothelium and medial architecture, inducing inflammation and intimal proliferation \u20138. In CVTo clarify the predominant mechanism by which NT provides its salutary effect, we investigated the morphological features of the endothelium in the residual SVG harvested by CV or NT during CABG through scanning electron microscopy (SEM). We commissioned the scans and analyses from unbiased observers. Subsequently, the surprising results reported by them encouraged us to conduct further analyses regarding the endothelial integrity of the SVGs.All saphenous veins were examined by echography before surgery to determine their size, morphology and functionality. Veins with any abnormalies, such as regurgitation, varix or varicose conditions, were excluded from graft candidates. CABG was performed in an on-pump or off-pump fashion by the surgeon\u2019s choice. There were no marked differences in the handling of SVGs between on- and off-pump procedures. In on-pump cases, the surgical procedure was performed under cardiopulmonary bypass with moderate hypothermia (28 to 30\u2009\u00b0C) and cardiac arrest with tepid blood cardioplegia. Vein grafts were mainly bypassed to the right coronary artery (RCA) and left circumflex artery (LCX), and the left anterior descending artery was reconstructed by the internal mammary artery. Vein grafts were anastomosed to the RCA or LCX, followed by perfusion with tepid blood cardioplegia (on-pump) or blood (off-pump) and anastomosis of the other side to the aorta.CV group2)NT groupThe SV was exposed mainly from the lower leg by skipped longitudinal leg skin incisions, wherein the side branches were ligated. The vein was removed from the leg after dissection, connected to the cannula inserted into the femoral artery and dilated with arterial pressure for 10\u2009min with blood mixed solution before the sewing of the anastomoses. The residual part of the vein was cut off from the central side (aortic side) after the anastomosis of the distal side to the RCA or LCX. In CV group, the vein was manually distended with blood mixed solution at <\u2009300\u2009mmHg. The adventitia was stripped off . The harThe SV was exposed via the same skin incisions as used for CV. The vein was isolated along with 5\u2009mm of the surrounding fat tissue, and all visible side branches were ligated. After removal, the vein was connected to the cannula inserted into the femoral artery and dilated with arterial pressure for 10\u2009min with blood mixed solution before the sewing of the anastomoses. The residual part of the vein was obtained as in the CV group. In the NT group, the vein was neither flushed nor distended manually. The adventitia was not removed. The harvested vein was stored and treated as in the CV group thereafter.The residual SVG samples were obtained from Patient No. 1 via CV, Patient No. 2 via NT, and Patient No. 3- No. 5 via both CV and NT. The endothelial surface of SVGs from CV group (No. 1 and No. 3) and NT group (No. 2 and No. 3) was analyzed with SEM. The endothelial integrity of SVGs from CV group and NT group was analyzed with immunohistochemistry.Patient No. 6The patient was a 75-year-old male. He had suffered acute myocardial infarction of the inferior wall. CAG revealed three-vessel disease, and he received CABG with LITA to LAD, SVGs to D1, 14PL, 4PD and 4PL. The CV technique was used to harvest SVGs. He ultimately died on day 8 after surgery due to low-output syndrome. The grafted SVG was harvested at the autopsy. Sample was prepared from the SVG to 14PL.2)Patient No. 7The patient was a 78-year-old male. He had suffered unstable angina. CAG revealed three-vessel disease, and he received off-pump CABG with RITA to LAD, LITA to 14PL, SVGs to D1, D2, 4PD and 4PL. The NT technique was used to harvest SVGs. He ultimately died on day 7 after surgery due to massive pulmonary embolism. The grafted SVG was harvested at the autopsy. Sample was prepared from the SVG to D1 and D2.The patients\u2019 characteristics are summarized below.The SEM analysis was conducted as described previously . A few hImmunohistochemistry was conducted as described previously . A few hThe endothelial integrity of the residual SVG harvested by CV or NT before bypass-grafting was examined. Unexpectedly, the hyperfine structure on SEM was comparable between CV and NT before grafting Fig.\u00a0, and micConsistently, von Willebrand Factor (vWF), a representative marker of endothelial cell, was equally detected throughout the vascular wall in both groups Fig.\u00a0. There wPrevious studies reported that high pressures induce endothelial inflammation after CV , suggestIn the present study, we clarified that the morphological integrity of the endothelium was successfully preserved in SVG with CV, even at an ultrastructural level. Although its functionality remains to be addressed, other factors than the endothelium may be involved in the high patency obtained by NT. The significance of the endothelium in mediating vascular homeostasis is generally well recognized, however, other factors are occasionally overlooked. Our study suggests that the characteristics of NT should be reconsidered, as this may innovatively stimulate the surgical methodology in the future.One of the novel findings in this study is that the endothelial surface with microvillus was indistinguishable between CV and NT. To our knowledge, this is the first study comparing the hyperfine structure of the endothelial surface and microvillus between these procedures. Several previous studies used transmission electron microscopy (TEM) to observe SVG , 20; ourAnother novel point is our assessment of the endothelial integrity using postmortem sections. An early study with a large animal model noted that endothelial regeneration takes place as early as 7 days after denudation . This fiHowever, the present study possibly provides another hypothesis. Our data suggest that the endothelium after CV may be well preserved or only marginally damaged during CABG, showing a similar extent of damage to that after NT. Consequently, the remaining endothelium (rather than the regenerated tissue) may have been detected around the SVG wall in the postmortem sections.There have been conflicting results regarding whether or not the endothelial integrity is preserved after pressure-mediated distension. In an earlier study involving the SEM analysis of the veins of monkey, distending pressure exceeding 700\u2009mmHg induced morphological injury to the endothelium, while a lower pressure of 300\u2013400\u2009mmHg did not . The endWhile CD31 primarily localizes to the plasma membrane by exposing six extracellular domains on the cellular surface, vWF forms multimers in the endoplasmic reticulum and Golgi apparatus and is expressed in the cytosol before secretion \u201323. As sSince long-term patency is the ultimate goal of CABG, endothelial damage in the very acute phase may not be a critical for it. However, endothelial damage after distension is often discussed as if this is the predominant cause of poor patency in the CV group. The findings of the present study suggest the opposite due to the fact that there may be factors other than endothelium underlying the difference in the long-term patency between CV and NT.Since the immunoreactivity in the postmortem section is generally reduced during long-term storage, our ability to collect useful sections for analyses was limited. We therefore examined only a single postmortem section in each group.This study provides evidence that the endothelial hyperfine structure is well-preserved in SVGs harvested with CV. Other factors than the endothelium may play a pivotal role in protecting NT-harvested SVGs from atherosclerosis. Further investigations regarding the endothelial function and surrounding tissues will be required to elucidate the mechanism in detail."} +{"text": "Due to its rarity, coupled to a multifactorial and very heterogeneous nature, the molecular etiology of Arnold-Chiari (AC) syndrome remains almost totally unknown. Its relationship with other neuropsychiatric disorders such as Tourette syndrome (TS) is also undetermined. The rare comorbid status between both disorders (ACTS) complicates the framework of diagnosis and negatively affects the patients' quality of life. In this exploratory study, we aimed to identify serum microRNA expression profiles as molecular fingerprints for AC, TS, and ACTS, by using a high-throughput approach. For this aim, 10 AC patients, 11 ACTS patients, 6 TS patients, and 8 unaffected controls (NC) were recruited. Nine miRNAs resulted significantly differentially expressed (DE): let-7b-5p (upregulated in ACTS vs. TS); miR-21-5p ; miR-23a-3p ; miR-25-3p ; miR-93-5p (upregulated in AC vs. TS); miR-130a-3p (downregulated in ACTS and TS vs. NCs); miR-144-3p ; miR-222-3p (upregulated in ACTS vs. NCs); miR-451a . Altered expression of miRNAs was statistically correlated to neuroimaging and neuropsychological anomalies. Furthermore, computational analyses indicated that DE miRNAs are involved in AC and TS pathomechanisms. Finally, we propose the dysregulation of the miRNA set as a potential molecular tool for supporting the current diagnosis of AC, TS, and ACTS by using liquid biopsies, in an unbiased and non-invasive way. Arnold-Chiari syndrome (AC) is a group of four types of anomalies sharing a malformation of the cerebellum and brainstem. In particular, Chiari malformation type I (CM-I) is characterized by caudal displacement of cerebellar tonsils, which can either be both or singularly herniated, 3 or 5 mm, respectively, below the foramen magnum (FM) Chiari, .CM-I is the most common type of anomaly affecting from 1/5,000 to 1/1,000 individuals, affecting females more than males (1.3\u20131) , HDC, and FLT3 have been identified as associated with TS , which cause worse functional outcomes have attracted increasing attention for several reasons. MiRNAs are small non-coding RNAs, ranging from 18 to 25 nucleotides, which negatively regulate gene expression through post-transcriptional mechanisms. Numerous studies have shown that miRNAs affect cellular pathways and biological processes , aiming to identify a differential expression among groups. We then evaluated the existence of a molecular relationship between serum miRNA profiles and the scores clinically assigned through a neuropsychological and neuroimaging assessment. Finally, through pathway enrichment analyses, we explored the biological functions of the differentially expressed miRNAs, and thus their potential etiological role in AC, ACTS, and TS pathogenesis.All experiments were approved by the local ethical committee \u201cComitato Etico Catania 1\u201d (ID: 0024-36-19) prior to sample collection and in accordance with the Helsinki Declaration and its later amendments or comparable ethical standards. Written, informed consent was obtained from parents of all minor age participants (range age 12\u201313).Twenty-seven Caucasian patients were consecutively recruited from July 2017 to December 2018 at the Section of Child and Adolescent Psychiatry .n = 10), ACTS (n = 11), and TS (n = 6). They were studied and compared to NCs recruited from local schools (n = 8).Patients were affected by AC >3\u20135 mm below the FM; absence of other neurological or metabolic conditions; absence of movement disorders and comorbid conditions such as obsessive-compulsive disorder (OCD) and/or attention deficit/ hyperactivity disorder.ACTS group: clinical diagnosis of Tourette Syndrome, according to the criteria of the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition ; the presence of Arnold Chiari type I malformation is based on brain magnetic resonance imaging (MRI): this malformation is defined by cerebellar TP >3\u20135 mm below the FM.TS group: clinical diagnosis of Tourette Syndrome, according to the criteria of the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition ; the absence of other neurological or metabolic conditions such as AC.Unaffected controls (NCs) were considered neurologically intact children and adolescents, without any history of movement disorder and normal position of cerebellar tonsillar and without chronic neurological, psychiatric, metabolic or genetic diseases. To avoid confounding factors, we did not include either children with minor neuropsychiatric disease or with minor neurological signs.A medical history was obtained from all participants and their parents with a focus on neurological and psychiatric conditions. Moreover, all participants underwent a physical and neurological examination and weight, height, head circumference were measured. Venous blood samples were collected. Patients and controls underwent a brain MRI with measurements of posterior fossa (PF) to evaluate the position of cerebellar tonsils.T1 weighted sagittal brain MRI images were used. All measurements were taken for right and left herniation. Particular attention was paid to the measurements of the following areas: upper posterior cranial fossa, lower posterior cranial fossa, and total posterior cranial fossa; finally, basal, Boogaard, occipital, and tentorial angles were measured were assessed by child and adolescent neurologists and psychiatrists with the following instruments:Wechsler scale (WISC-III), applied to evaluate Intelligence Quotient (IQ), is a test used to evaluate the intellectual ability of children ranging from 6 to 16 years. To this aim, the assessment provides full-scale intelligence quotient (IQ) scores, as well as Performance IQ and Verbal IQ, two secondary scores is an 11-item clinician-rated interview, which is able to evaluate motor and phonic tic severity, considering not only the number and frequency, but also the impairment that tics provoke in the patient. The score of the YGTSS is 0\u2013100, including the impairment section. Higher scores indicate higher severity of symptoms and impairment is a semi-structured interview, conducted principally with parents, even if patients are encouraged to participate. This interview is able to assess the severity of obsessive-compulsive symptoms in children. The total score of CY-BOCS ranges between 0 and 40. It is possible to evaluate an obsession and a compulsion score separately. Again, higher scores indicate higher severity of symptoms and impairment is a questionnaire that provides an overview of child and adolescent impairments. Conners is a multi-informant assessment of children and adolescents across multiple settings, with rating forms for parents, teachers, and patients. It is a validated, self- and proxy-rated scale used with 12\u201318-year-olds. It is used to diagnose ADHD and can allow discrimination between subtypes is a report form, which evaluates behavioral problems in children. The CBCL is a validated, parent-rated scale assessing the frequency and intensity of behavioral and emotional difficulties shown by a child over the preceding 6 months. It contains eight syndrome scales and two composite scales . Collection tubes were treated according to current procedures for clinical samples. Tubes were rotated end-over-end at 20\u00b0C for 30\u2032 to separate serum from blood cells. Subsequently, they were centrifuged at 3,500 rpm at 4\u00b0C for 15\u2032 in a Beckman J-6M/E, supernatants were distributed into 1.5 ml RNase-free tubes, and finally stored at \u221280\u00b0C until analysis , according to Qiagen Supplementary Protocol for purification of total RNA from serum and plasma .Circulating miRNA expression profiling from serum was performed through the NanoString nCounter system assays by using nCounter Human v3 miRNA Expression Assay Kits and the NanoString platform, according to the manufacturer's instructions. MiRNA profiling was performed on 3 \u03bcl (~150 ng) of isolated RNA of 10 AC, 11 ACTS, 6 TS patients, and 8 NCs. RNA samples were processed and immobilized in a sample cartridge for quantification and data collection by using the nCounter Prep Station and Digital Analyzer, respectively. Data analysis was performed using nSolver 3.0 software. Quality of raw data was assessed through an evaluation of imaging, binding density, positive control linearity, and positive control limit of detection parameters. A code-set normalization was applied to minimize technical noise , according to the nSolver analysis software protocol. For each comparison, SAM statistical analyses were computed with MeV (Multi experiment viewer v4.8.1) statistical analysis software. A two-class unpaired test, based on 100 permutations and with a False Discovery Rate (FDR) < 0.05, was computed. We obtained fold change (FC) values, calculating the ratio between the normalized count mean of each group. The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus ; verbal intelligence quotient (VIQ); performance intelligence quotient (PIQ); Total YGTSS; motor and phonic Yale Global Tic Severity Scale separately; Total CYBOCS; Children's Yale Brown Obsessive Compulsive Scale for obsession and compulsion, separately; Conners scale; Child Behavior Check list internalizing (CBCL-Int); Child Behavior Check list externalizing (CBCL-Ext); total Child Behavior Check list . Neurological parameters referred to measurements of right and left protrusions (mm), upper posterior cranial fossa area, lower posterior cranial fossa area, total posterior cranial fossa and basal area, Boogaard, occipital, and tentorial angles.p-values. Statistical significance was established at p \u2264 0.05.Correlation analyses were performed by GraphPad Prism v8.01 . Since data were not distributed normally, the Spearman's test was used, applying two-sided t-test with FDR correction and Hypergeometric test (p \u2264 0.05) were used for enrichment analysis.To investigate the biological functions of all the DE miRNAs and their potential etiological involvement in AC, ACTS, and TS, the DIANA-mirPath v.3 web server (M:F = 6:4), mean age 13.1 (\u00b13.1) (age range 9\u201317); 11 affected by Arnold Chiari Syndrome and comorbid Tourette Syndrome (ACTS) (M:F = 9:2), mean age 12.3 (\u00b12.7) (age range 8\u201316 years); 6 affected by Tourette Syndrome (TS) (M:F = 6:0), mean age 13.8 (\u00b12) (age range 11\u201316); 8 unaffected controls (NCs) (M:F = 8:0), mean age 12.6 (\u00b12.6) (age range 9\u201316 years), recruited from local schools. Demographic and neuropsychological characteristics of the clinical sample are shown in p-value = 0.005).Intelligent quotient: with regards to the intelligence quotients , measured with Wechsler scales, the TS group showed the highest mean value; no statistically significant differences were found in the comparison between clinical groups, except AC vs. TS . TS presented higher scores compared to ACTS, but these differences were not statistically significant in any subscale .Obsessive compulsive disorder: with regards to the evaluation of obsessions and compulsions, performed by CYBOCS, AC, and NC presented statistically significant lower scores compared to TS and ACTS. These scores are not able to identify, by themselves, an obsessive-compulsive disorder, but could be the expression of obsessive and/or compulsive behavior that does not interfere with the normal life of the patient. Comparing TS and ACTS groups, TS presented the higher scores, and these scores are identifiable with OCD disorder. No statistically significant differences were found, even if the disorder in ACTS is less severe than in TS.Behavioral Problems: with regards to behavioral problems measured with CBCL and Conners' scales, we found the following results: ACTS presented higher scores , but no statistically significant differences were found with the TS score group. The scores presented in the AC and NC groups were statistically significantly lower compared to the other clinical groups.Finally, with regards to the Conners' score, the TS group presented the highest statistically significant score compared with the other clinical groups and the NC group. In the comparison between AC and ACTS, no statistically significant differences were found; on the other hand, the score of the NC group was statistically significantly lower compared to the three clinical groups.t tests, statistically significant differences were found between the areas of total PCF between ACTS and NC ; AC and TS ; AC and NC groups. No statistically significant differences were found in all the other comparisons.Patients and unaffected controls underwent MRI and all the measurements described in methods section were performed. All measurement details are reported in A high-throughput expression analysis of 800 microRNAs in sera of 10 AC, 11 ACTS, 6 TS patients, and 8 NC subjects was computed by using nCounter NanoString technology.We identified 9 miRNAs as significantly differentially expressed in sera from the different groups . More spp-values, the normalized counts of serum miRNAs were correlated with neuropsychological and neurological scores for each comparison , as well as between VIQ and miR-130a-3p (r = \u22120.65) by comparing TS and NC groups and a positive correlation between TIQ, PIQ and miR-23a-3p , in AC vs. TS comparison. We also found a negative relationship between Conners' scale and (i) miR-144-3p (r = \u22120.5) by comparing ACTS and AC groups and (ii) miR-451a (r = \u22120.8), miR-93-5p (r = \u22120.79), miR-144-3p (r = \u22120.79) comparing AC and TS groups. CBCL-ext scores were found positively correlated with miR-21-5p levels (r = 0.51) and negatively correlated with miR-451a (r = \u22120.52), miR-93-5p (r = \u22120.66), miR-25-3p (r = \u22120.50) in AC vs. TS comparison. From the same comparison, total CBCL scores were found negatively correlated with miR-93-5p (r = \u22120.67) and miR-144-3p (r = \u22120.50). On the other hand, neuroimaging measurements were found positively correlated with miR-23a-3p (r = 0.63) by comparing AC and TS groups and let-7b-p (r = 0.53) by comparing ACTS vs. TS groups. From the same comparison, we found a negative correlation between Basal and Boogard angle measurements and miR-23a-3p . Finally, we found negative correlations between occipital angle measurements and miR-130a-3p (r = \u22120.56) by comparing TS vs. NC groups; tentorial angle and miR-93-5p (r = \u22120.63) by comparing AC vs. TS groups.By comparing ACTS and NC groups, we found a negative relationship between intelligent quotient scores and miR-130a-3p , pre-NOTCH expression and processing signaling pathway (p = 0.0000106), NGF signaling via TRKA from the plasma membrane (p = 0.000293), signaling by NGF (p = 0.00053), NOTCH1 intracellular domain regulated transcription (p = 0.000551), signaling by NOTCH1 (p = 0.00391), constitutive signaling by NOTCH1 HD+PEST Domain Mutants (p = 0.00729), signaling by NOTCH2 (p = 0.0315), and signaling by Wnt (p = 0.0108), through which neuronal function and development are regulated. Moreover, we found pathways that mediate fear conditioning and behavior signaling by ERBB2 (p = 0.00000711) and ERBB4 (p = 0.0000106), also involved in the development of neurodegenerative diseases. Additionally, the PI3K/AKT activation pathway (p = 0.0000169) was also pinpointed, which is a major regulator of neuron survival, as well as FGFR1/2/3/4 (p = 0.0000106), signaling by FGFR1/2/3/4 (p = 0.0000106), downstream signaling of activated FGFR1/2/3/4 (p = 0.0000624), FoxO signaling pathway (p = 3.22E-07), Hippo signaling pathway (p = 1.58E-05), neurotrophin signaling pathway (p = 0.04106071) and recycling pathway of L1 (p = 0.0187), involved in neural development, including axon outgrowth and neuronal migration.Among the most interesting terms, we found signaling by NOTCH (p = 0.0123), Ca2+ pathway (p = 0.0438), TGF-beta receptor signaling activates SMADs (p = 0.00053) and transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer (p = 0.00491). These pathways are intriguing since they are related to disorders in bone tissue, muscle contraction, embryonic skeletal development, postnatal bone homeostasis dorsoventral polarity, which analyzed together suggest that the differential expression of these miRNAs could cause the developmental impairments leading to AC pathogenesis.Other molecular signaling pathways were revealed, such as signaling by BMP subjects. Results showed the identification of nine serum miRNAs as significantly differentially expressed in different groups of comparison . InteresThe nine DE miRNAs identified in this study, had been previously identified as dysregulated in cellular and extra-cellular frameworks of other neurological and/or bone disorders, suggesting a critical role in developing cognitive functions and bone morphogenesis can be found in the article/The studies involving human participants were reviewed and approved by Comitato Etico Catania 1. Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin.RR, MR, and MP conceived the project and planned the experiments. MG and MCa carried out patient recruitment. RR performed the clinical diagnosis. SP performed magnetic resonance scans and neuroimaging measurements. FM, GL, and MCi performed the experiments. FM, GL, MCi, DB, and MS performed the bioinformatics analysis and data statistics. MR and FM wrote the manuscript. RR, MR, MP, and CDP revised the manuscript. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."} +{"text": "Ovis canadensis nelsoni). We sought to identify over-represented microbial clades and understand how landscape variables and host traits influence microbiome composition across the host metapopulation. To address these questions, we performed 16S sequencing on fecal DNA samples from thirty-nine bighorn sheep across seven loosely connected populations in the Mojave Desert and assessed relationships between microbiome composition, environmental variation, geographic distribution, and microsatellite-derived host population structure and heterozygosity. We first used a phylogenetically-informed algorithm to identify bacterial clades conserved across the metapopulation. Members of genus Ruminococcaceae, genus Lachnospiraceae, and family Christensenellaceae R7 group were among the clades over-represented across the metapopulation, consistent with their known roles as rumen symbionts in domestic livestock. Additionally, compositional variation among hosts correlated with individual-level geographic and genetic structure, and with population-level differences in genetic heterozygosity. This study identifies microbiome community variation across a mammalian metapopulation, potentially associated with genetic and geographic population structure. Our results imply that microbiome composition may diverge in accordance with landscape-scale environmental and host population characteristics.Studies in laboratory animals demonstrate important relationships between environment, host traits, and microbiome composition. However, host-microbiome relationships in natural systems are understudied. Here, we investigate metapopulation-scale microbiome variation in a wild mammalian host, the desert bighorn sheep ( Studies in humans and laboratory animals have demonstrated that the composition of host-associated gut microbiomes is largely determined by a complex interaction of environment, nutrition, and genetics8, suggesting that the microbiome could mediate relationships between environmental variation and health in natural populations. Laboratory studies are well-suited to experimental manipulation of the microbiome while controlling for the vast majority of genetic and environmental variation that exists in natural populations of mammals, often by using isogenic lines of rodents. It is often challenging, however, to apply results from laboratory studies toward understanding the natural patterns of microbiome composition and structure in genetically diverse host populations exposed to spatial and temporal variability. Additionally, laboratory animals do not generally harbor microbiomes found in their wild counterparts, making it difficult to study the ecology and evolution of many host-microbe relationships9. Human studies can span a somewhat wider range of genetic and environmental variation, but these studies are often limited in depth due to the difficulty of collecting important covariates from healthy individuals. In order to understand broad patterns and processes underlying variation in microbiome structure, we need to move beyond controlled laboratory systems and expand to studying microbiomes in natural mammalian populations.Mammals depend on microbial symbionts for extracting and synthesizing nutrients14. Wild populations often exhibit strong spatial structuring; some naturally-fragmented populations can be described as metapopulations in which populations experience local extinction and recolonization via dispersal16. Understanding metapopulation-level microbiome variation in wild hosts has the potential to clarify the ecological and evolutionary processes driving microbiome variation across host scales18. For example, microbial taxa that are ubiquitous across a metapopulation (i.e. \u201cconserved\u201d microbiota) may be more likely to share an ecological or evolutionary relationship with the host species, or could reflect microbial distribution or dispersal ability8. Additionally, metapopulation structure provides multiple population replicates across which to study spatial, demographic, and environmental processes driving microbiome variation between conspecifics19.Host-associated microbiomes can be shaped by processes at a range of spatial and temporal scales, influenced by factors such as diet, elevation, climate, and microbial dispersal14 and humans3, and several studies in wild mammals have also demonstrated microbiome variation across spatial and seasonal ranges of nutritional variation. Other environmental factors that may interact with diet to influence the microbiome include altitude21 and climate22. Host factors, such as genetic variation, have been shown to play a role in filtering particular microbes from the environment, thereby influencing the composition and relative abundances of resident microbial communities24. In addition to genetically-determined host factors, vertical transmission from mother to offspring could also maintain microbiome homogeneity between related hosts25. Microbial dispersal between hosts is also thought to drive variation in microbiome diversity and composition. Previous studies have linked microbiome similarity with degree of social interaction within primate populations28. Some microbes may be environmentally derived rather than directly transmitted between hosts29, and in these cases spatial variation in the pool of environmental microbes available to hosts could mediate microbiome stratification between geographically separate host populations. Yet, how microbiome variation and transmission scale across host metapopulations is unknown. Comparing microbiomes across host metapopulations could reveal patterns of variation that clarify mechanisms of selection and dispersal.Environmental variation, host traits, and microbe dispersal ability have been identified as potential drivers of microbiome variation. Host diet is a primary environmental driver of microbiome variation in controlled laboratory studiesOvis canadensis nelsoni) in the Mojave Desert of Southern California, which was composed of seven demographically independent and geographically separate populations linked by infrequent dispersal events. This study system enabled us to measure the effects of environmental heterogeneity, geographic proximity, and host genetic diversity and structure on microbiome variation at the metapopulation scale. We framed this study on five central hypotheses & predictions:Here, we examine microbiome variation across a metapopulation of wild mammals, allowing us to address microbiome variation at a scale previously unexplored. We used gut microbiome data from a naturally fragmented metapopulation of desert bighorn sheep ((1) A subset of microbial lineages is conserved across the metapopulation. Microbes are necessary for nutrient extraction in ruminants30, so we hypothesized that host selection would result in the success and ubiquity of certain symbiotic microbiota.(2) Environmental differences among habitat patches alter gut microbiome composition. Previous studies demonstrate shifts in the gut microbiome related to short-term environmental resource fluctuation31. We hypothesized that the relationship between microbiome communities and environmental heterogeneity would also manifest on a longer time scale. We compared microbiome community differences with decade-scale summary metrics of three patch-level environmental variables: forage production during the growing season, long-term rainfall levels, and elevation. Decade-scale heterogeneity in vegetation greenness has been shown to correlate with fecal nitrogen levels among Mojave desert bighorn sheep populations32, and has been linked to survival in Sierra Nevada populations. Elevation is highly correlated with temperature and forage quality in this desert ecosystem34, and previous research has suggested that elevation gradients can mediate the relationship between host nutrition and variation in the microbiomes of other mammalian species20.(3) Population genetic diversity associates with gut microbiome composition. In our study system, genetic diversity correlates with both elevation and connectivity35, so we hypothesized that populations with high genetic diversity would differ in terms of presence and abundance of microbial clades relative to low genetic diversity populations.(4) Genetically related individuals share similar microbiomes. Genetic divergence has been previously shown to correlate with microbiome structure among fragmented host populations24. We predicted that closely-related individuals would harbor similar gut microbial communities due to host selective processes and vertical transmission.(5) Geographic proximity between hosts predicts microbiome similarity. We hypothesized that spatial proximity of hosts would mediate exposure to similar microbial sources and allow indirect transfer of microbes between hosts27, resulting in microbiome convergence between spatially proximate animals.36, thus reducing the potential effects of different sample ages. DNA was extracted from samples as described previously37. Briefly, DNA was extracted from 30\u2009mg of pellet scrapings using a modified version of the AquaGenomic Stool and Soil protocol that included 15-minute bead-beating step for cell lysis and the addition of 12 mAU proteinase K to degrade contaminating proteins and nucleases. We added 150 microliters of AquaPrecipi solution to cell lysate to remove PCR inhibitors present in fecal samples, and rehydrated DNA pellets overnight in 115 microliters of 1x TE buffer to increase DNA recovery37. Duplicate samples from the same individual were excluded from downstream analysis based on genotyping results37.Fecal samples were collected from seven bighorn sheep populations . Although these three loci were shown to behave neutrally47 we chose to exclude these markers from the expected heterozygosity analysis to avoid any cryptic selective influences on heterozygosity metrics. Heterozygosity estimates using a similar number of microsatellite loci have been shown to correlate with population isolation35, elevation34, and NDVI32 in the Mojave Desert bighorn sheep metapopulation.We used pairwise and point measures to describe connectivity and genetic diversity within the bighorn sheep metapopulation in this study. Populations were defined as locally-distributed, demographically-independent groups of bighorn sheep separated from other groups by areas of unsuitable habitat, e.g. flat desert areas lacking escape terrain and suitable food33 and genetic heterozygosity34. We interpret this correlation as resulting from the higher water availability and vegetation cover observed at high elevations, which in turn is linked to greater population persistence33, and presumably also reflects fewer population bottlenecks during times of drought34. Precipitation is likewise correlated with population persistence33, as forage growth in this system is strongly precipitation-driven. To define patch-level potential for forage production, we used normalized difference vegetation index data collected from 2000\u20132011 and integrated over the growing season32: briefly, 8-day composite, 250-m resolution NDVI data from the Moderate Resolution Imaging Spectroradiometer (MODIS) data for the years 2000 through 2011 were obtained for all pixels with center points within the boundary of each patch. The median pixel NDVI value was calculated for each patch at every 8-day time point throughout this time period, and the area under the median NDVI curve for each growing season (October 1\u2013June 30) was calculated. This measure of growing season integrated NDVI was shown by Creech et al.32 to explain the majority of season-level variation in median fecal nitrogen (a proxy for nutrition) in the Marble Mountains and Old Dad Peak populations from within this study system. In this study, we used median integrated NDVI levels from across the 11-year Creech et al. study32 as a proxy for forage production potential within each patch. In addition to representing forage potential, these values have been demonstrated to correlate with genetic diversity in this system, reflecting multi-generational differences in population size and stability32. Geographic distances between individuals were calculated from GPS coordinates of each sample collection site. Elevation for each patch was defined as the highest point occurring in that range, as this indicates the potential for each range to trap precipitation and provide thermal refuges34.We used decade-scale, patch-level measures of environmental variables previously shown to correlate with bighorn sheep population persistence and diet Table\u00a0. ElevatiWe amplified a 450\u2009bp region of the V3/V4 region of the bacterial 16\u2009S gene. Extracted DNA was subject to a first round 16S PCR amplification using the following primers: 16S Forward Primer 5\u2032-TCGTCGGCAGCGTCAGATGTGTATAAGAGA CAGCCTACGGGNGGCWGCAG-3\u2032 and 16\u2009S Reverse Primer 5\u2032-GTCTCGTGGGCTCGGA GATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3\u2032. PCR reactions were amplified with GoTaq Hot Start Polymerase following manufactures suggested use. PCR cycling conditions were as follows: an initial melt of 94\u2009\u00b0C for 3\u2009minutes followed by 35 cycles of amplification with a 94\u2009\u00b0C for 30\u2009seconds, 55\u2009\u00b0C annealing step for 1\u2009minute, and a 68\u2009\u00b0C extension step for 1.5\u2009minutes. A final, 5-minute extension step was included following the last cycle. Amplicons were cleaned, indexed, and normalized by the Oregon State University Center for Genome Research and Biocomputing prior to sequencing on the Illumina Miseq v2 platform, resulting in 250\u2009bp paired-end reads.48. Raw sequence data were processed through the dada2 pipeline using the following trimming parameters: trimLeft = c, truncLen = c, maxN = 0, maxEE = 2, truncQ = 2. Default parameters were used for estimating error parameters using learnErrors, and chimeras were removed using removeBimeraDenova (method\u2009=\u2009\u201cconsensus\u201d). Full-length 16S ribosomal RNA sequences were downloaded from the All Species Living Tree Project (SILVA)49 and aligned to ASVs obtained above using mothur version 1.39.3. ASVs that did not align well were discarded from further analysis. The Silva database contains a set of highly curated quality rRNA sequences that were used to guide phylogenetic reconstruction of 16S reads. A generalized time-reversible phylogenetic model was constructed from the combined reference and ASV sequences using FastTree version 2.1.10. The phylogenetic tree was midpoint rooted, and reference sequences pruned from the tree. Prior to statistical analyses, samples were rarified to the 11971 reads per sample, deemed appropriate via collector\u2019s curves was used to identify amplicon sequence variants (ASVs), trim adapter sequences, and remove chimerasves Fig.\u00a0.8 to identify clade-based taxonomic units. In brief, this algorithm identifies conserved monophyletic clades of taxa among groups which displayed higher prevalence across the group of interest than expected by chance, based on that clade\u2019s position in a phylogenetic tree. The computational procedure traverses a phylogeny assembled from 16S rRNA gene sequences generated from multiple communities. It then quantifies each clade\u2019s prevalence across a defined subset of the communities, where the clade\u2019s prevalence is based on the occurrence of the subtending lineages in the subset of communities. A permutation test quantifies whether the observed prevalence of the clade is likely due to chance. The algorithm then assigns taxonomic labels to each node in the phylogeny by determining the most specific taxonomic assignment that is shared between all subtending lineages of that clade. We used this algorithm with n\u2009=\u20091,000 permutations to identify monophyletic clades of gut bacteria that were more prevalent than expected by chance within individual host populations and across all individuals in the entire metapopulation (referred to hereafter as \u201cconserved\u201d) based on false discovery-rate adjusted p-values (FDR). Conserved microbiota within and between populations were visualized using ggtree version 1.12.750 and R version 3.5.0.Many wildlife microbiome studies have sought to identify conserved microbial taxa based on prevalence or abundance thresholds, but this approach risks spuriously misclassifying clades that are widespread simply due to their ancestral position in the bacterial lineage, or are highly derived and do not meet arbitrary prevalence or abundance cutoffs. We applied a recently-developed bioinformatic algorithm51. The adonis function in the R vegan package (version 2.5.5) was used to conduct pairwise permutational multivariate analysis of variance (PERMANOVA) testing for significant compositional differences between populations, and the betadisper function was used to test differences in multivariate dispersion between populations52. Nonmetric multidimensional scaling (NMDS) of weighted unifrac distances was performed with the vegan function metaMDS and used to visualize compositional differences between individuals and populations.ASV richness was calculated from rarefied count data. A Kruskal-Wallace test was used to compare ASV richness between populations. Weighted unifrac and Jaccard distances were calculated between all samples to be used for downstream multivariate analyses53. To test our hypotheses, we compared increasingly reduced versions of models To assess how microbiome similarity correlated with geographic/genetic distances and environmental variables, we used the lmer function in the lme4 package to run linear mixed-effects models comparing pairwise weighted unifrac and Jaccard (presence/absence) distances with (1) pairwise individual-level geographic distances and Rousset\u2019s a, and (2) pairwise differences in population-level traits as fixed effects, and population memberships as random effectsRuminococcaceae , Ruminococcaceae UCG 005 , Ruminococcaceae UCG 010 , Christensenellaceae R7 group , and Lachnospiraceae .We found that 894 out of 13474 total clades (6.6%) were conserved across the host metapopulation, meaning that they were more frequently observed among hosts than would be expected based on their position in the bacterial phylogeny (FDR\u2009<\u20090.01). These conserved clades corresponded to 80 unique bacterial taxa . Conserved clades tended to be \u201cnested\u201d meaning that a conserved clade was likely to also have a descendant sub-clade in the phylogeny that was also conserved. We considered that this pattern of nested conserved clades could result from propagation of the signal of clade conservation between such directly related clades, which would have the effect of artificially inflating the number of apparently conserved clades. We corrected for this possibility by only considering the most ancestral conserved clade among a set of directly related clades that were consistently identified as being conserved. This correction for nestedness resulted in a conservative set of 270 clades corresponding to 67 unique taxa Fig.\u00a0. The taxLachnospiraceae, and contained only 3 descendent ASVs. Eleven clades were conserved in five or more populations, including members of family Lachnospiraceae, family Ruminococcaceae, genus Bacteroides, order Lactobacillales, and genus Coprococcus and 1(b) yielded different results based on the microbiome distance used Eq.\u00a0,b.4a\\docJaccard distance was significantly associated with geographic proximity but not Rousset\u2019s a, whereas weighted unifrac distance was significantly associated with Rousset\u2019s distance . The total proportion of bacterial clades that associated positively with geographic proximity was 49.2%, including nested clades host heritability58, we propose that family Ruminococcaceae, family Lachnospiraceae, and genus Christensenellaceae R7 group are conserved across bighorn sheep populations due to an adaptive relationship with their host.We identified microbial clades that were overrepresented across the metapopulation, supporting the hypothesis that host selection results in the success and ubiquity of certain symbiotic microbiota. The bacterial taxa containing the largest numbers of conserved clades belonged to family 27. Moreover, the significant positive relationship between weighted unifrac distance and inter-individual genetic distance implies that genetically similar (and thus closely-related) individuals exert similar selective pressures on their gut microbes, resulting in similar abundances of phylogenetically related microbes among closely-related hosts. Alternatively, closely-related individuals may share similar microbiomes due to vertical transmission from mother to offspring, or because related individuals tend to associate in social groups. Although this observational study included a limited number of populations and cannot fully disentangle the influences of geographic and genetic distance on microbiome variation, the observed association between geographic proximity and microbiome similarity indicate that dispersal limitation could play an important role in microbiome divergence between populations. Studies in humans have demonstrated microbiome variation across large scales between geographically distinct populations62. Wildlife studies27 demonstrated spatial patterns of gut microbiome composition within wildlife populations, and our study suggests that this pattern holds true at the metapopulation scale. Further research is needed to fully parse the relative roles of genetics, vertical transmission, and spatial/social structure on microbiome assembly.The positive association observed between geographic distance and shared presence/absence of microbial ASVs supports the hypothesis that that spatial proximity of hosts mediates exposure to similar microbial sources and allows indirect transfer of microbes between animals65 and other environmental conditions such as elevation21 as primary drivers of microbiome community structure among conspecifics. However, the temporal or spatial scales at which we measured environmental variation may not have been fine enough to detect correlations with microbiome variation, or possibly sample sizes for each population were insufficient to detect relationships between patch-level environmental variables and microbiome structure. Our study used decade-long, patch-scale measures of forage production and rainfall, and patch-level elevation maxima, but future studies should include finer-scale environmental data. The relationship we observed between microbiome divergence and difference in population-level genetic heterozygosity also may have been limited by a relatively small number of populations. Previous studies in laboratory and wildlife studies have shown microbiome differences related to MHC genotype diversity68, but larger scale assessments are necessary to elucidate the role of neutral genetic heterozygosity as a potential driver of metapopulation-scale variation in the microbiome in bighorn sheep.At the host population level, we found a positive, significant relationship between microbiome divergence and differences in population-level genetic heterozygosity, suggesting alternative patterns of microbial composition in populations with high versus low heterozygosity. However, we found no relationship between microbiome beta diversity and long-term measures of patch-scale environmental variation. This result was somewhat surprising, as a growing body of literature points to nutritional resource availability16, therefore future studies should seek to further disentangle the metapopulation-scale effects of environmental variation, microbial dispersal, and host selection on the microbiome, and evaluate links between the gut microbiome and infectious disease susceptibility. The small number of samples from some populations may have limited the number of conserved clades we were able to detect in this analysis, thus future studies that seek to define conserved microbial clades should include more samples from each population. Additionally, increased depth of sequencing could improve detection of low-abundance conserved clades. Broadly, our findings contribute to understanding the underlying variation of host-associated microbiomes at the metapopulation scale, and specifically inform our understanding of gut microbiome communities of a culturally iconic herbivore species.Our findings demonstrate that microbiome variation aligns with host genetic and spatial structure in a wild mammalian metapopulation. In addition to the broad implications for understanding the ecology of mammalian microbiomes, this is also the first study to describe the bighorn sheep gut microbiome, or to identify potential drivers of gut microbiome composition and diversity in this culturally iconic species. Ultimately, understanding the dynamics and ecology of the bighorn sheep gut microbiome could have implications for population health and conservationSupplementary Information."} +{"text": "We demonstrate that ethnic HLA-allele differences between populations have influenced HIV-1 subtype diversification as the virus adapted to escape common antiviral immune responses. The evolution of HIV Subtype B (HIV-B), which does not appear to be indigenous to Africa, is strongly affected by immune responses associated with Eurasian HLA variants acquired through adaptive introgression from Neanderthals and Denisovans. Furthermore, we show that the increasing and disproportionate number of HIV-infections among African Americans in the USA drive HIV-B evolution towards an Africa-centric HIV-1 state. Similar adaptation of other pathogens to HLA variants common in affected populations is likely.Pathogen-driven selection and past interbreeding with archaic human lineages have resulted in differences in human leukocyte antigen (HLA)-allele frequencies between modern human populations. Whether or not this variation affects pathogen subtype diversification is unknown. Here we show a strong positive correlation between ethnic diversity in African countries and both human immunodeficiency virus (HIV)-1 p24 Differences in human leukocyte antigen (HLA) frequencies between geographically dispersed populations are primarily the result of pathogen-driven selection and pastThe cross-species transmission of simian immunodeficiency virus that gave rise to the HIV-1 group responsible for the majority of the global HIV-1 epidemic (Group M), likely occurred \u223c1900 in Cameroon or the Democratic Republic of the Congo DRC; . HoweverHIV-1 subtypes are defined using phylogenetic analyses and the genetic distance between them is comparable; they are labelled alphabetically, and each subtype consensus sequence carries distinct combinations of subtype-specific amino acids in conserved subtype-specific positions in every viral protein in addition to changes at other positions . These sThe highest number of HIV-1 subtypes and circulating and unique recombinant forms (CRFs and URFs) of various HIV subtypes is found within Africa . WhereasUpon infection, HLA Class I (A\u2013C) molecules on the cell surface present peptide fragments (epitopes) from viral proteins that have been digested by intra-cellular proteasomes. This presentation is a central point in the interplay between HIV-1 and the host\u2019s immune system as it triggers CTL and Natural Killer cell responses that can kill HIV-infected cells. The HLA genes are highly polymorphic, and an HLA molecule has specific binding motifs that allow only some of the produced epitopes to be presented by each HLA variant. Because the combination of HLA variants (or the HLA profile) varies between individuals, the selective pressures on the virus vary accordingly . The varHLA-associated polymorphisms have primarily been examined within distinct HIV-1 subtypes in combined Canadian/US HIV-B sequence sets after BhWe experimentally identified a second form of HLA-associated selection which occur at subtype-specific positions in p24Gag and affects proteasomal production of all epitopes encoded in epitope-clusters up- and down-stream of the subtype-specific position and subtype diversity, respectively, and observed robust positive linear relationships. Second, we explored the HLA profile patterns in all HIV-B and HIV-C-infected patients with linked HLA information using an HLA-based principal component analysis (PCA). We found that the most influential drivers in principal component (PC)1 were Eurasian HLA variants introgressed from archaic humans, whereas HLA variants associated with the two major haplotypes in South Africa strongly influenced PC2. Third, we estimated which of the >80 epitope-presenting HLA variants in the clinically important HIV-B and HIV-C p24Gag regions had the most substantial effect on the evolution of the five subtype-specific sites within these regions. Fourth, we examined if the continuously increasing proportion of African Americans in the USA HIV-B infected population over time affected the evolution of these subtype-specific sites. We found that the subtype-specific sites in HIV-B-p24Gag in the USA over time increasingly incorporated amino acids more commonly found in African HIV-1 subtypes than in the HIV-B consensus sequence.Collectively, our results suggest a modified model for HIV-1 subtype diversification. We propose that variation at subtype-specific sites in HIV-1 p24Gag results from a combination of global HIV-1 spread through random founder events and the subsequent continuous granular viral adaptation to the HLA profile of the infected population.We hypothesized that HLA-mediated selection drove HIV-1 p24Gag diversification and that subtype-specific amino acid differences were the result of selection for HIV-1 sequences that limited or abrogated processing of the epitopes presented by the most common HLA variants in each population. If HLA-mediated selection drove HIV-1 diversification, we should find greater HIV-1 diversity in countries with greater HLA diversity.To investigate, we examined HIV-1 diversity within Africa where modern humans originated and have maintained relatively large effective population sizes for \u223c300,000\u2009years resulting in a high level of genetic diversity within and between the \u223c2000 distinct African ethnic groups . UnfortuUsing this measure of ethnic diversity as a proxy for HLA diversity is justified by multiple studies that have demonstrated that African population structure largely mirrors linguistic and geographic similarity , 2017 anTo further justify using ethnic diversity of African countries as a proxy for HLA diversity, we performed simulations showing a linear relationship between different mixtures of fictive ethnic groups and HLA diversity using the HLA A, B, and C data from the eight Sub-Saharan African populations/ethnic groups .R2 = 0.41, F1, 1,748 = 1,190, P\u2009<\u20092 \u00d7 10\u221216). Furthermore, this result held for subsets of the data comprising simulations of populations from a given number of ethnicities. Collectively, these simulations underscored that ethnic diversity in Africa is a valid proxy for HLA diversity.Pooling our results across all replicates and numbers of ethnic mixing populations, we found a strong and statistically significant relationship between ethnic diversity and HLA diversity . The totgag variability (P\u2009=\u20090.0134) and subtype diversity (P\u2009<\u20092 \u00d7 10\u22125)) indicating that the timing of the epidemic in each African country was not the sole determinant of HIV-1 diversification. Collectively, these results suggest that the association between a country\u2019s HIV-1 diversity and its ethnic diversity might be driven by the granular adaptation of HIV-1 to the HLA variants common in particular ethnic groups as countries with more ethnic groups end up with greater HIV-1 variation.To further test robustness, we excluded Cameroon and the DRC where HIV-1 first circulated , which sGeographically, the highest concentration of ethno-linguistic , ethnic P\u2009=\u20090.037). Niger-Congo non-Bantu language groups reside in West Africa where CRF_02AG and HIV-G predominate, and HIV-C is rare. Nilo-Saharan, Afro-Asiatic and Bantu language groups predominate in East Africa where HIV-A, -D, and -C are frequently found or HIV-C , and HLA-A30:01-HLA-B*42:01-HLA-C*17:01, linked with slow progression through the accumulation of fitness-reducing CTL escape-mutations . Currently, African and Hispanic Americans account for \u223c42 and 20 per cent of all new infections despite making up only about 13 and 16 per cent of the US population, respectively and used these in a Hierarchical Bayesian multi-level model that incorporated phylogenetic information from BEAST to prevent phylogenetic relationships from biasing the analysis, thereby correcting for viral population structure and neutral evolution . The posCollectively, our analyses demonstrated that the subtype-specific positions in HIV-B over the last 20\u2009years in the USA have evolved away from the original HIV-B consensus sequence and increasingly incorporate amino acids found in African HIV-1 subtypes . These rIn this study, we found that HLA Class I allelic frequency differences and archaic HLA Class I variants combine to create population-specific HLA-associated selective pressures that uniquely shape HIV-1 p24Gag variation and subtype diversification. This observation suggested that these population-specific HLA-associated selective pressures might also shape the evolution of other novel pathogens in emerging epidemics, for example, Zika virus and Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and might be partly responsible for the subtype diversification of viruses that have a longstanding infection history in humans . Similarly, these population-specific selective pressures could affect the evolution of old pathogens when these spread into previously na\u00efve populations in new geographical locations due to human activities, and/or climate change (e.g. dengue virus and West Nile virus). This granular adaptation of pathogens to a population-specific HLA composition mirrors the already accepted granular adaptation of human populations to different combinations of infectious challenges .The adaptive introgression of Neanderthal and Denisovan HLA variants in Eurasians, and of HLA B*73:01 (a unique major histocompatibility complex (MHC)-BII allele more closely related to chimpanzee and gorilla MHC-B alleles than to other modern human B alleles; In Africa, we found significant positive relationships between ethnic diversity and HIV-1 p24Gag sequence and subtype diversity, respectively. These robust associations suggested that ethnic diversity, and by extension HLA diversity and differences in HLA-associated selective pressures, helps drive HIV-1 evolution and might result in subtype diversification. It will be important to confirm and extend the findings reported here across other antigenic regions of HIV-1. The spread and adaptation of HIV-1 to different ethnic groups might initially have been facilitated by, for example, a combination of the socioeconomic and cultural changes induced by the colonization of the DRC in the early 1900s, for example, the rise of cities, extended transport networks, and centralized camps for treatment of sleeping sickness .Our results, and previous experimental work , 2014, sBetween 1962 and 1970, HIV-1 spread beyond Africa as a Haitian aid-worker returned from the DRC . WhetherOur results, and the many HIV-1 vaccine trial failures , suggestn\u2009=\u20098; detailed in To investigate the relationship between ethnic diversity and HLA diversity we compiled HLA data from all available African populations/ethnic groups that had been HLA typed to a \u2018Gold standard\u2019 (2 p24 sequence (GenBank K03455))) using the integer patient ID tool. Subsequently, we removed all sequences from HIV-1 Groups N, O, and P, and URFs and CRFs thereof, as well as sequences without a unique patient ID to avoid oversampling individual patients. We screened the remaining sequences for those originating from uncultured peripheral blood mononuclear cells, and those originated from cultured virus by examining all paper references. All sequences originating from cultured virus were discarded because culturing likely obscures the sequence footprints of the intra-host immune response. The remaining 2,274 sequences were aligned using the LANL HIV Align program, after which the sequences were stratified by country. Minor manual corrections were made to each country\u2019s alignment as needed, and the mean amino acid Shannon Entropy of each of these alignments was calculated using the R (version 3.4.3) package bio3d (version 2.3-3).To calculate the Shannon entropy (diversity) of HIV-1 group M p24Gag for each country we searched the LANL HIV database for one n indicates the number of ethnicities recorded with the database, and i within the country\u2019s population.As a proxy for each country\u2019s HLA diversity, we used \u2018ethnic diversity\u2019, which was based on the combined measure of ethnic, linguistic, cultural, and religious fractionalization defined by Ethnic diversity was plotted against the mean HIV-1 p24Gag amino acid entropy, weighted by the number of p24Gag sequences per country, using ggplot2 (version 2.2.1). The size of each dot was scaled logarithmically by the number of sequences to indicate graphically how this weighting was occurring. A weighted linear model was fit in R (version 3.4.3) to assess statistical significance.www.ethnologue.com). For ease of analysis we dichotomized this variable using 50 per cent as a threshold value. Similarly, we divided the African countries into two groups by the prevalence of HIV-C in their HIV-infected population.We searched the LANL HIV database for all n\u2009=\u2009318) and HIV-C (n\u2009=\u2009704), the only subtypes for which there were enough patients to perform our analyses.To study potential HLA driven selection on HIV subtype-specific motifs, we searched the LANL HIV database for all n\u2009=\u20091,022), and the columns the HLA Class I variants . The entries were 1 when a patient was annotated with an HLA variant in the LANL database, and 0 otherwise resulting in an HLA profile for each patient (the table is available upon request).We generated a binary HLA presence\u2013absence matrix; the rows represented patients and amino acid position (j) combination. Every column in this matrix (representing the phylogenetic effect for one subtype-specific position) was modelled by a multivariate normal distribution over patients using a phylogenetically informed covariance matrix, thereby representing the similarity between patients through the relatedness of their viruses. This phylogenetic correction was necessary because, for example, antenatal transmission could lead to closely related viruses (with very similar amino acids in the subtype-specific positions) in patients with similar HLA variants even in the absence of HLA-associated selection. We chose to use a separate phylogenetically informed multivariate normal for each subtype-specific position because using just a single multivariate normal would fail to capture the independence of each subtype-specific position.In our statistical model, we explicitly accounted for the phylogenetic covariance between individuals infected by closely related viruses by including a parameter and that the FPR increased with increasing numbers of simulated amino acids. The FPR in the model with a separate phylogenetical multivariate normal distribution for each amino acid was stable. Stan code is available upon request.We used simulations to justify our choice for an independent phylogenetically informed multivariate Gaussian prior for each amino acid position. We simulated each amino acid separately using a Bernoulli distribution where For each subtype, we built manually curated alignments with a single representative sequence per patient and used the LANL HYPERMUT tool to remove hypermutated sequences. To avoid biasing the analysis by including HLA selective effects in the correlation matrix C, which could occur since CTL responses can drive convergent evolution leading to clustering in phylogenetic trees , we remol best-correlating HLA types for every subtype-specific position and used the inferred parameters to predict the excluded validation sets. From these predictions, we calculated the area under the curve (AUC) of the receiver operator characteristic curves (ROC) values for each subtype-specific position we performed a 5-fold cross-validation procedure . This prposition . We chosposition .l until all HLA variants were included in the model. After 10 replications, to reduce cross-validation error, a LOESS curve of the results was calculated for each subtypes-specific site. In the cross-validation model fitting procedure on the training set, all This procedure was repeated for every j according to the cross-validations. We then fitted a multilevel Bayesian model using these predictors and refitted it after removing any HLA types where the associated OR 80 per cent BCI failed to exclude 1. We obtained posterior distributions from the model using the Stan MCMC sampler . We examined the effect of HLA selection on HIV-1 evolution in two ways. First, we used the HLA ORs estimated from the HIV-B HLA regression dataset and evaluated how these would affect the modelled amino acid frequencies and secoWe assumed a human population of a fixed size into which an initial infection of an HIV-C-like virus was introduced to a small subset of the population at time zero. The infection subsequently spreads stochastically through the population according to the following processes:Random mating between an infected person and one of the susceptible individuals alleles for each of the HLA A, B, and C with associated ORs. We recognize that in real life, an individual will possess two alleles for each of the three HLA classes. In our model, if an individual has, for example, zero HLA A variants associated with HLA ORs, then this means that their two HLA Class A alleles are not amongst those we model .For a given amino acid position In the simulations, we first created a population of Determine the time step Implement the event.For each infected individual in the population evolve each HIV amino acid position as a continuous time Markov Chain for time We used the parameters shown in n\u2009=\u20099,729 HIV-B sequences from 437 patients). This limitation was necessary to avoid pseudo-replication through the inclusion of multiple sequences from the same patient as unique data points. In contrast to the compilation of the worldwide HIV-infected patient sequences, we also included patients without HLA information and allowed for multiple sequences to be used per patient rather than taking the majority rule amino acid.To assess HIV-1 evolution over time in the USA, we searched the LANL HIV sequence database for all We ran 10 BEAST chains for 100 million steps using a single representative sequence per patient and a GTR+G model of nucleotide evolution, using a log-normal clock and a logistic coalescent; this has previously been shown to be appropriate for similar data . To promWe also used the posterior distribution of trees to perform some exploratory analyses. It was not possible to use BEAST to analyse multiple sequences sampled from a patient. Instead, we limited our analysis to whichever sequence was most recently sampled from the patient, to allow the virus the most time to adapt to its host. We treated the amino acids as binary traits, which can be either positive if the amino acid in the patient\u2019s subtype-specific position is the same as the HIV-B consensus, or negative if it is different. We fitted four models of Discrete Trait evolution, varying the parameter configuration. Because we estimated that most transitions would occur from the HIV-B consensus amino acids to non-HIV-B consensus amino acids, we investigated if a unidirectional model, which did not allow the reverse transition, would fit better than a bi-directional model. Because we believe that these four subtype-specific positions are undergoing roughly the same process, we specified a hierarchical prior on their transition rates. Implementing the hierarchical prior was trivial in the unidirectional case, as there we could set the B\u2192non-B transition rates to 1, and the non-B\u2192B transition rates to 0, and put a hierarchical prior on the clock rates. The bi-directional models were parameterized by setting the B\u2192non-B transitions to 1 and allowing the non-B\u2192B transitions to vary as a relative rate; this model was made hierarchical by allowing the clocks to vary freely and independently, while hierarchical priors were placed on the relative rate for each subtype-specific site. We used the stepping stone sampling procedure implemented in BEAST to obtain estimates of the marginal likelihood for each of the four models, which were converted to Bayes Factors for model comparison by taking the difference between the marginal likelihoods of two models on the log scale , 2013. XTo estimate the ethnic demographics of the HIV-infected population in the USA, we converted existing estimates of the ethnic demographics of HIV incidence (new infections) to prevalence (number of living hosts infected). We obtained incidence data from the literature and usedIn the beginning of the epidemic (when no drugs were available) the average survival time was 10 years.Starting from 1996 the availability of combination therapy increased the survival time to at least 25 years.Starting from 2002 further improvement in the standard of care extended this to at least 32 years.These assumptions were the same for all ethnic groups.We then calculated the fraction of African Americans in the US HIV-1 infected population at each time point.To smooth the data and to incorporate uncertainty in the estimates, we performed a Bayesian regression of time on the estimated African American proportions of HIV-1 infected Americans . Initialp change-point parameter , because the approximate position of the change-point is clearly between 1996 and 2000, and the likelihood function precision parameter (gamma with shape\u2009=\u20090.001 and rate\u2009=\u20090.001). To stabilize the variance and thereby ensure homoscedasticity, a regression model was fitted, which was weighted by the total number of patients alive according to the simple population model; this had the further advantage of allowing some uncertainty around the earlier time points. The calculated frequency of African Americans in the US HIV-infected population was standardized, and 1980 was taken as Year 0. Because the model uses latent binary variables to distinguish between the f and g functions we used the JAGS Gibbs sampler (x\u2013p) polynomials), it was necessary to run JAGS for 100,000 steps. The median fitted values from this regression were used as the explanatory variable in the subsequent Bayesian Multi-level Model.We used normal priors of mean 0 and standard deviation 10 on all parameters, except the sampler . BecauseWe included a phylogenetic signal in much the same way as in the previous analysis, by fitting parameters for every position/patient combination. These parameters were sampled from a single multivariate normal distribution for every subtype-specific position, using the phylogenetic correlation matrix to relate patients according to the evolutionary history of the virus. This can be expressed as follows:The (hyper-)priors are:This creates a multi-level model where each data point informs both the estimated probability of HIV-B-likeness for a subtype-specific position in an individual patient (through the testing . As in tx' as the inferred African American frequency in every year between 1982 and 2009 and used the following formula, which only included the population level parameters in the multilevel model and left out the patient-specific adjustments:Using our multilevel model, we reconstructed the population-level proportion estimates of the HIV-B consensus amino acid over time. We set By plotting these population-level estimates (estimate .The data were obtained from publicly available databases (the LANL HIV sequence database and the Virus Evolution online.A. K. N. I. conceived and designed the overall study. N. C. K. and P. L. conducted the phylodynamic analyses. N. C. K., D. L., B. L, S. C., and A. K. N. I. performed data analyses and modelling and A. K. and P. L. contributed intellectual input. A. K. N. I. and N. C. K. wrote the paper; all authors commented on and approved the final article.veaa085_Supplementary_DataClick here for additional data file."} +{"text": "Introduction: Closed-loop ventilation modes are increasingly being used in intensive care units to ensure more automaticity. Little is known about the visual behavior of health professionals using these ventilation modes. The aim of this study was to analyze gaze patterns of intensive care nurses while ventilating a patient in the closed-loop mode with Intellivent adaptive support ventilation\u00ae (I-ASV) and to compare inexperienced with experienced nurses.Materials and Methods: Intensive care nurses underwent eye-tracking during daily care of a patient ventilated in the closed-loop ventilation mode. Five specific areas of interest were predefined . The main independent variable and primary outcome was dwell time. Secondary outcomes were revisits, average fixation time, first fixation and fixation count on areas of interest in a targeted tracking-time of 60 min. Gaze patterns were compared between I-ASV inexperienced (n = 12) and experienced (n = 16) nurses.Results: In total, 28 participants were included. Overall, dwell time was longer for ventilator settings and numeric values compared to the other areas of interest. Similar results could be obtained for the secondary outcomes. Visual fixation of oxygenation Intellivent and ventilation Intellivent was low. However, dwell time, average fixation time and first fixation on oxygenation Intellivent were longer in experienced compared to inexperienced intensive care nurses.Discussion: Gaze patterns of intensive care nurses were mainly focused on numeric values and settings. Areas of interest related to traditional mechanical ventilation retain high significance for intensive care nurses, despite use of closed-loop mode. More visual attention to oxygenation Intellivent and ventilation Intellivent in experienced nurses implies more routine and familiarity with closed-loop modes in this group. The findings imply the need for constant training and education with new tools in critical care, especially for inexperienced professionals. Owing to a high number of machine user interfaces, challenging and often time-critical processes, the management of critically ill patients involves a high risk of error. Unintentional human errors and lack of situation awareness are among the leading causes of adverse events, not only in the medical setting \u201312. Unintilation , 17.When ICU patients are ventilated with closed-loop modes, the specific role allocation and associated tasks of the nurses responsible shift from active, manual machine handling to a rather machine-supervisory role . HoweverThe aim of this study was thus to analyze gaze patterns of ICU nurses using eye-tracking while ventilating a patient in the closed-loop mode Intellivent adaptive support ventilation (I-ASV)\u00ae and to compare the patterns of inexperienced with those of experienced ICU nurses.The Local Ethics Committee approved the study protocol, guaranteeing accordance with the declaration of Helsinki. Written informed consent was given by all participating ICU nurses and the patients involved, or the patients' legal representatives in cases of incapacity of judgement.This was a prospective, observational, real-life eye-tracking study conducted at the ICU of the University Hospital Zurich . The interdisciplinary ICU treats about 4,500 patients per year in 64 ICU beds. All specialized ICU nurses working in the ICU were eligible for participation, provided there were no exclusion criteria. Exclusion criteria were visual disturbances or withheld informed consent. The respirators used were \u201cHamilton S1\u00ae\u201d respirators . Independently of this study, all nurses underwent a standardized training program in Intellivent adaptive support ventilation before bedside application of the closed-loop ventilation mode. During the first year of I-ASV application after professional training, the ICU nurses are constantly supervised by senior/teaching nurses while ventilating their patients, whereas after this period they work without supervision. Thus, for the design of this study, nurses who had worked <1 year with I-ASV were considered inexperienced, whereas nurses who had worked for more than 1 year with I-ASV were considered experienced. Participation in this study was free of charge and voluntary. If a calibration of the eye-tracker was possible, the participant was included. All recordings were performed in the early afternoon in order to avoid biases due to the regular morning rounds with the treating physicians or due to nightshifts, which might impair standardization of data. Further, all recordings were scheduled in order that they did not coincide with special circumstances such as interventions or patient transports.For study purposes, participating nurses were responsible for one patient. All patients, with various medical conditions, were invasively mechanically ventilated in I-ASV. Patients were only included if the presumed duration of mechanical ventilation was longer than 24 h. Short-term postoperative patients were not included. Patients with severe acute respiratory distress syndrome (ARDS) were not eligible . No patient was intubated only for the purposes of this study. Non-intubated patients were not eligible for participation.Prior to the recordings, demographics and data with possible influence on eye-tracking, such as workload of participants were gathered . To avoiTo provide a study setting as close to reality as possible, no advise was given to the participants on how to use and handle their respirator. Participants were free to use the respirator in the way they considered useful and to look at the respirator as often as they wanted.After the eye-tracker recordings, a post-experiment questionnaire was completed. Using validated scales, workload and subjective stress during the tracking were assessed . ConcernTo address the aim of the study, only gaze patterns relating to the user interface of the respirator and fixations on the ventilator were analyzed . All other visual fixations were not subject to analysis and thus excluded.For our analysis, five areas of interest were defined by the study team prior to the recordings . Three AThe primary outcome was dwell time for the specific AOIs.Secondary outcomes were revisits (the frequency of revisiting a particular area of interest after gazing at other areas), average fixation time, first fixation (duration of the first fixation of an AOI) and fixation count (the cumulated number of gaze fixations on a particular AOI) to all AOIs.In subgroup analyses, inexperienced nurses were compared with experienced nurses.The SMI Eye-tracking Glasses 2 Wireless system was used. Gaze-tracking was executed at a sampling rate of 60 Hz. Over all distances, the angle of view was measured with an accuracy of 0.5\u00b0. The scene video was recorded with a resolution of 960 \u00d7 720 pixels at 30 fps. To record audio data, an integrated microphone was used. Eye-tracking data were processed using the SMI BeGaze 3.6 software and the SMI algorithm for fixation determination. Each ocular fixation during the handling of the respirator was manually assigned to the above-mentioned AOIs.p-value of < 0.05 (two-sided p) was considered statistically significant.No power calculation was performed due to the absence of preliminary tests and partial descriptive statistics. Based on valid data from other eye-tracking studies in the critical care setting , a partiStatistical analysis was performed using SPSS Version 23 and Graphpad prism 7 .Of a total of 30 ICU nurses assessed, two could not be included owing to exclusion criteria. The remaining 28 agreed to participate in this study and were divided into two groups (inexperienced and experienced groups), with 12 nurses assigned to the inexperienced group and 16 to the experienced group. Median age was 39.5 years; 86% of all participants were female. The subjective mental and physical workloads assessed by the validated NASA-TLX scale before aCompared to the total tracking time, median fixation of the respirator was 13% and did not differ between the study groups.Overall, dwell time was significantly prolonged for the settings compared with the other AOIs , 2. SimiP-values for multiple comparisons are provided in Overall, visual attention to the AOIs oxygenation Intellivent and ventilation Intellivent were low for all outcome parameters. Visual attention to the ventilation curves was lowest compared with the other AOIs evaluated. The absolute values for dwell time, revisits, average fixation time, first fixation and fixation count are indicated in p-values for all group comparisons are provided in Dwell time, average fixation time and first fixation on oxygenation Intellivent were significantly higher in experienced participants, and showed a trend toward being elevated for ventilation Intellivent. For the AOI settings, the revisits, average fixation time and first fixation were higher in the experienced group. The The aim of this study was to analyze gaze patterns of specialized ICU nurses while their patients were undergoing ventilation in the closed-loop mode Intellivent adaptive support ventilation\u00ae (I-ASV) and to compare inexperienced with experienced nurses.The main results of this study imply that, despite the use of a closed-loop ventilation mode, both inexperienced and experienced ICU nurses' gaze patterns were predominantly linked to conventional control and monitor panels . As an eOverall visual attention to oxygenation Intellivent and ventilation Intellivent for the primary and secondary outcomes was markedly lower, despite the use of a closed-loop ventilation mode. Closed-loop ventilation modes such as I-ASV have emerged as new ventilation strategies, but have not been consistently adopted in critical care medicine to date. Our results demonstrate that information displayed by closed-loop ventilation might not be visually presented or mentally processed to a sufficient extent. The frequent visual focus on classic ventilation parameters such as numeric values could also be a sign of a lack of trust in new ventilation modes, especially for less experienced nurses, who reported a significantly higher level of anxiety associated with the use of I-ASV. Furthermore, the question about the subjective safety of I-ASV was answered with a neutral value of 3 on a scale from 1 to 7 , which mThe sub-analysis of the two professional experience levels revealed that there were differences in gaze behavior between inexperienced and experienced participants. The dwell time and average fixation time on oxygenation Intellivent were significantly longer in experienced nurses. For the AOI settings, the revisits, average fixation time and first fixation were higher. On the one hand, these differences might mirror the greater importance of these AOIs. Research on performing skills among differently trained groups has shown that experts in particular try to focus their attention on critical areas, which is called \u201ctarget locking\u201d , 36. ThiOne advantage of closed-loop modes could be the enhanced automaticity with less manual adaptation needed to adhere to lung protective ventilation. This implies that frequent visual focus on the conventional AOIs of ventilator curves or numeric values is probably no longer necessary. However, the use of closed-loop systems requires familiarity, ongoing training and a different understanding of one's own supervisory role . NonetheVentilation curves had only low visual importance among the participants in the two groups, probably because ICU nurses are mainly trained to keep an eye on numbers in their professional formation. Another possible reason might be the higher degree of abstraction of ventilation curve shapes, leading to visual disregard. Further, it could be more difficult to cognitively draw conclusions about the patient's respiratory condition by fixating ventilation curves as compared to numeric values or to infer ventilation strategies from the shape of abstract ventilation curves.This study illustrates that eye-tracking is a useful tool in measuring and quantifying the distribution of visual attention of critical care nurses using a closed-loop system and to reveal differences between inexperienced and experienced participants. Biases due to differences in nurses' workload were minimized, as it proved to be similar among participants.A main strength of this study is its pragmatic, non-simulated, real-life design. Further, the long tracking time of ~1 h gives a realistic picture of the handling of the respirator, reflecting everyday situations in the ICU. To our knowledge, no comparable real-life studies in an ICU exist. Eye-tracking within such a framework might also assist in designing further novel and innovative studies.The study has limitations. First, it was a single center study with probable biases due to the specific training of the nurses in I-ASV. Second, the participant number was relatively low. Nevertheless, we found comparable and homogenous distribution of data across dwell time, revisits, average fixation time, first fixation and fixation count among the participants, which adds to the credibility of the data. Third, the patients were from different medical fields, which might mean they had different pulmonary conditions, making distinct ventilation strategies necessary and leading to biases. Moreover, no specific study task was given to the participants, probably making comparisons more difficult. However, the study was explicitly designed to address ICU nurses' everyday behavior in their normal environment and the implementation of a specific task might itself have led to biases . A further limitation of the eye-tracking technology is the difficulty of linking gaze patterns with cognition. Thus, the technology of eye-tracking should be seen as a complementary tool helping to objectively evaluate visual behavior and the visual interaction between humans and machines. This might provide further insights into the significance of visual situation awareness. Further studies with higher participant numbers are needed as well as randomized studies addressing similar questions in nurses with longer professional experience with closed-loop systems. Owing to the probable limitations of classic performance assessment and questionnaire-based human factors analyses in determining individual expertise on ventilation, a neuroscience approach with newer technologies such as eye-tracking could offer more objective and sensitive insights into human factors and human-machine interactions. As a consequence, eye-tracking might also contribute to improved patient safety, enhanced incidence reporting or the detection of factors leading to erroneous behavior in the ICU.In conclusion, this study demonstrates that the visual fixations of nurses using I-ASV largely remained focused on traditional ventilation parameters. However, experienced nurses fixated AOIs related to the closed-loop system more often than did inexperienced ones, implying the need for constant training and education with new tools in critical care, especially for inexperienced professionals.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Kantonale Ethikkommission Zurich BASEC ID REQ 2017-00798. The patients/participants provided their written informed consent to participate in this study.PB, AH, and DH conceived and designed the study, recruited the patients, collected the data, and drafted the report. PB did the ethics submission. PB, AH, NB, SK, SW, PW, MK, QL, ES, RS, and DH analyzed and interpreted the data and contributed to reviewing it. All authors read and approved the final manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."} +{"text": "Recent research shows the important role of these cytokines in gastric cancer (GC) progression. (2) Methods: 21 gastric cancer patients and 19 healthy controls were included in the study. SDF-1, HGF and VEGF levels were evaluated in sera by ELISA. Patients and control sera were used to stimulate CRL-1739 GC cell line, and chemotaxis, adhesion and proliferation potential were assessed. (3) Results: Concentrations of SDF-1, HGF and VEGF were significantly higher in patients than in controls. Chemotaxis and adhesion assays revealed a significant response of GC cells to patients\u2019 serum. Furthermore, significant relationships were seen between chemotactic/adhesion response and tumor stage. Serum from intestinal early GC patients produced significantly stronger chemotactic response when compared to patients with metastatic spread. In turn, serum from patients with distal metastases significantly increased the adhesion of GC cells when compared to sera from the patients with no distal metastases. We also observed that HGF strongly stimulated the proliferation of CRL-1739 cells. (4) Conclusions: We observed that the sera from GC patients, but also SDF-1, HGF and VEGF used alone, have a strong pro-metastatic effect on CRL-1739 cells. We also demonstrated that the concentration of these cytokines is specifically elevated in the sera of patients in an early stage of malignancy. Our results indicate that SDF-1, HGF and VEGF are very important molecules involved in gastric cancer progression. Despite recent progress in diagnostic techniques, gastric cancer (GC) remains a clinical problem and a challenge for clinicians and scientists. It is the second most common cancer-related cause of death in the world. In 2018, gastric cancer accounted for 782,685 of the deaths that occurred globally ,4,5,6. PIn the present study, we report that the serum from GC patients, SDF-1, HGF and VEGF, have pro-metastatic effects on the GC CRL-1739 cell line. The concentration of these cytokines is elevated in GC patients from an early stage of malignancy. Our results indicate that SDF-1, HGF and VEGF may promote gastric cancer progression.A total of 21 gastric cancer patients were included in the study. All cases had adequate clinical and pathologic information. At the time of inclusion, none of the patients was undergoing chemotherapy, had received any cytotoxic agents/drugs within the last 12 months before the study nor presented signs of an active infectious disease. The histological type and the stage of GC were assessed by routine histopathologic examination of material obtained after endoscopic or surgical treatment and by the results of computed tomography of the abdomen and chest. Histological types were classified according to the Lauren classification . TNM andPeripheral blood samples were collected before surgery or chemotherapy. The blood samples were centrifuged at 1800 rpm for 15 min at 4 \u00b0C, and the serum was transferred to tubes and stored at \u221280 \u00b0C until the time of analysis. 2 at an initial cell density of 2.5 \u00d7 104 cells/flask , and the medium was changed every 48 h.We used human gastric adenocarcinoma cell line CRL-1739 (ATCC). Gastric cancer cells used for experiments were cultured in Dulbecco\u2019s Modified Eagle\u2019s Medium , supplemented with 100 IU/mL penicillin and 10 \u00b5g/mL streptomycin in the presence of 10% heat-inactivated fetal bovine serum . The cells were cultured in a humidified atmosphere at 37 \u00b0C in 5% COThe preoperative serum SDF-1, HGF and VEGF levels were determined by a SDF-1, HGF or VEGF enzyme-linked immunosorbent assay according to the manufacturer\u2019s instructions.ncbi.nlm.nih.gov/geo/) (accessed on 16 February 2022) including human gastric cancer specimens and normal tissue were used. GSE13911, GSE19826 and GSE54129 microarray databases were based on GPL570 platform ((HG-U133_Plus_2) Affymetrix Human Genome U133 Plus 2.0 Array). The databases contained a total number of 228 specimens . The genetic expression of SDF-1, HGF and VEGFA was analyzed with the use of the GEO2R online analysis tool (ncbi.nlm.nih.gov/geo/geo2r) (accessed on 16 February 2022). Survival analysis was performed with use of the Kaplan\u2013Meier plotter [p-values were calculated. Three GEO databases . The lower chambers were filled with SDF-1\u03b1 (300 ng/mL), HGF (10 ng/mL), VEGF-A (10 ng/mL), 1% serum from 21 gastric cancer patients, 1% serum from 19 healthy controls or 0.5% BSA in DMEM (negative control). The concentration of SDF-1, HGF and VEGF were chosen on the basis of dose-response experiments (data not shown) and are higher than physiological. The doses were estimated based on a dose-response assay. After 24 h, the inserts were removed from the Transwell supports. The cells remaining in the upper chambers were stained by HEMA 3 according to the manufacturer\u2019s instructions and were scraped off with cotton wool, and cells that had transmigrated were counted on the lower side of the membrane. Polycarbonate membranes (8 \u00b5m) were covered with 50 \u00b5L of 0.5% gelatin. The cells were detached with 0.5 mmol/L ethylenediaminetetraacetic acid (EDTA), washed in PBS, resuspended in DMEM with 0.5% BSA and seeded at a density of 3 \u00d7 104 in 100 \u00b5L and seeded into 96-well fibronectin-coated plates. The cells were stimulated with optimal doses of SDF-1\u03b1 (300 ng/mL), HGF (10 ng/mL), VEGF-A (10 ng/mL), 1% serum from 21 gastric cancer patients (1%) and 1% serum from 19 healthy controls for 5 min at 37 \u00b0C. Afterwards, the stimulation cells were washed twice in DMEM with 0.5% BSA and counted under a microscope. The cells were resuspended in DMEM with 0.5% BSA. After 4 h, the cells were divided at a concentration of 2.5 \u00d7 103 cells/well in the presence or absence of SDF-1\u03b1 (300 ng/mL), HGF (10 ng/mL), VEGF-A (10 ng/mL), 1% serum from 2 gastric cancer patients, 1% serum from healthy controls and 1% FBS. The cell number was calculated at 24, 48 and 72 h after culture initiation. At the indicated time points, the cells were harvested from the culture flasks by trypsinization, and the number of cells was determined using a Navios flow cytometer (Beckman Coulter). The cells were plated in culture flasks at an initial density of 5 \u00d7 10t test, with p < 0.05 considered significant. Statistical comparisons were performed with Fisher\u2019s exact and X2 test for nominal variables, as needed. The Mann\u2013Whitney U test was used to analyze the continuous variables (cytokines level and age at diagnosis). IQR: interquartile range. Statistical calculations and visualization were made with commercial software and GraphPad Prism 9.3.1 (471). All results are presented as the mean \u00b1 standard error of the mean (SEM). Statistical analysis of the data was performed using the unpaired Student\u2019s-There were 11 males and 10 females, with a mean age of 64.8 years in the cancer group and 19 cancer-free, healthy controls . The cancer group consisted of 10 intestinal and 11 diffuse GC patients. According to the Tumor Node Metastasis (TNM) classification, 5 patients had stage I gastric cancer, 3 had stage II, and 12 patients presented with metastasis (stage IV). Histological analysis revealed \u201cintestinal\u201d type gastric cancer in 10 patients and \u201cdiffuse\u201d type in 11 patients. Among the patients with adenocarcinoma, 3 patients showed low-grade I stage tumors and 4 patients showed a moderate/high grade of malignant potential (stage II and III).The serum SDF-1, HGF and VEGF-A levels were analyzed in 21 GC patients and 19 healthy controls . The distribution of serum SDF-1, HGF and VEGF-A levels in GC patients and normal individuals is shown in p = 0.03), diffuse III, IV-IVB (p = 0.01) and total diffuse (p = 0.006) gastric cancer. The statistical relevance was also shown for age at diagnosis (median years) and intestinal IA-IB patients (p = 0.01), data shown in There was no significant correlation between serum SDF-1, HGF, VEGF-A levels, GC histology and stage A,B. Furtp < 0.05), SDF-1 vs. Age , SDF-1 vs. VEGF-A (0.31), HGF vs. Age (0.26) and HGF vs. VEGF-A (0.31), which are shown in In addition, we found a strong positive correlation between SDF-1 vs. HGF in GSE13911 or GSE19826. Interestingly, when we used the GSE54129 database, which included 111 GC samples and normal gastric mucosa from 21 volunteers who underwent gastroscopy for health examination, it was noted that SDF-1 (probe ID: 203666_at) and HGF (probe ID: 210998_s_at) were significantly upregulated . VEGF-A expression was also significantly different, but the change (logFC = 0.439 for probe ID: 210513_s_at) was minimal. In the bioinformatics study, three microarray databases were screened for differences in expression between GC and normal specimens. The analysis indicated a relatively uniform increase in the genetic expression of SDF-1, HGF and VEGFA in GC samples when compared to normal adjacent tissue; however, these differences did not reach statistical significance with 95% confidence intervals (CIs) and log-rank tissues .SDF-1, HGF and VEGF have been reported to promote the directional migration and invasion of human cancer cells ,37,38. FAs shown in The proliferation assay showed that SDF-1 and HGF stimulate the proliferation of CRL-1739 cells . VEGF haIn this study, we demonstrated that the SDF-1, HGF and VEGF-A are elevated in GC patient serum and CG CRL-1739 cells characterize with significant chemotactic and adhesive responses. Interestingly, the levels of these cytokines are increased from an early stage of malignancy, including tumors invading mucosa, in both intestinal and diffuse types. The comparison of the activity of the serum from GC patients and controls showed a significantly higher chemotactic response and cell adhesion. An interesting observation from our study is the significant decrease of GC cells\u2019 chemotactic response with increasing tumor stage. Thus, sera from patients with early intestinal GC, when compared to sera from patients with metastatic spread (IVB), was the strongest chemotactic attractant for GC CRL-1739 cells. In contrast, in diffuse gastric cancer, the lowest chemotactic response was observed in the early stage. These observations should be confirmed on a bigger study group; however, it seems that this finding is not accidental. The differences may result from the distinct etiology of both histological types and the mechanisms of their formation, as well as the cell biology. This may indicate an important role of SDF1/HGF/VEGF in early intestinal gastric cancer spread. What is more, with the use of GEO database analyses and Kaplan\u2013Meier plotting, we noted that the high expression of the three evaluated factors is related to a decreased overall survival of GC patients.Many studies have shown that the axis of SDF-1/CXCR4 plays a crucial role in the peritoneal and lymph node metastasis of GC ,38,39,40HGF is one of the better-known factors in gastric cancer biology. HGF in the gastrointestinal tract is responsible for the modulation of cell proliferation, as well as the migration of intestinal epithelial cells, and may, therefore, directly influence the affected tissue, promoting processes associated with rapid tumor growth ,22,23. TTumor angiogenesis and lymphangiogenesis play an essential role in the growth, invasion and metastatic spread of solid neoplasms by facilitating the delivery of oxygen, nutrients, and growth factors to tumor cells . VEGF isThe analysis of cells\u2019 adhesion showed results converse to chemotaxis. The adhesive potential was increased in the serum from the patients with distal metastases (IVB) in intestinal gastric cancer, which is the opposite of a chemotactic response. This interesting observation may result from the gastric cancer cells\u2019 biology, their strong motility and their spread potential. We conclude that HGF may be one of the most important factors regulating gastric cancer metastasis. Not only does it promote cell migration and adhesion, but it also plays an important role in gastric adenocarcinoma proliferation and survival. Gender differences in incidence, mortality, overall survival and cancer-specific survival have been observed in several types of cancer . In our It should be emphasized that the observed significant chemotactic, adhesive and proliferative serum potential is an additional effect of SDF-1, HGF, VEGF and also other substances participating in the regulation of the metastasis process. The chemotaxis of cancer cells is dependent on the tumor microenvironment and is a primary element to determine metastatic spread . In conclusion, SDF-1, HGF and VEGF may promote gastric cancer progression. Cytokines and serum from patients with GC, including early cancer, have strong chemotactic properties that promote the migration, adhesion and proliferation of GC cells. However, this study has some important limitations that refer to the number of patients included in the study and the single cell line used herein. The replication of this research on a larger cohort of patients is certainly needed to improve the applicability of the results in diagnostics and clinical practice."} +{"text": "The expression of Ras\u2010specific guanine nucleotide\u2010releasing factor 2 (RasGRF2) in lung adenocarcinomas was examined using immunohistochemistry in relation to clinicopathological characteristics and prognosis. In comparison to low expression, high expression of RasGRF2 was more closely associated with poor prognosis. Interestingly, expression of phosphorylated epithelial cell transforming 2 (pECT2), which \u2013 like RasGRF2 \u2013 is also a guanine\u2010nucleotide exchange factor, was also associated with prognosis, and patients with high expression of both RasGRF2 and pECT2 had a much poorer outcome than those who were negative for both. Cdc42Cell division control protein 42ECT2epithelial cell transforming 2GEFguanine\u2010nucleotide exchange factorMMP9Matrix Metalloproteinase\u20109NMDAN\u2010Methyl\u2010d\u2010AspartatepECT2phosphorylated epithelial cell transforming 2RasGRF1Ras\u2010specific guanine nucleotide\u2010releasing factor 1RasGRF2Ras\u2010specific guanine nucleotide\u2010releasing factor 2et al. as a novel GEF for Ras.et al. have demonstrated that RasGRF2 also plays a role in modulating tumor cell movement and invasion by inhibiting the activation of cell division control protein 42 (Cdc42), a key component of actomyosin\u2010contractility\u2010dependent tumor cell movement.Ras family oncoproteins are activated by proteins known as guanine\u2010nucleotide exchange factors (GEFs). Ras\u2010specific guanine nucleotide\u2010releasing factors 1 and 2 (RasGRF1 and RasGRF2) are both mammalian Ras GEFs.et al. have reported that RasGRF2 promotes the migration and invasion of colorectal cancer cells by modulating the expression of matrix metalloproteinase\u20109 (MMP9) through the Src/Akt/NF\u2010kB pathway.With regard to the role of RasGRF2 in carcinogenesis and cancer progression, aberrant methylation and reduced expression of RasGRF2 have recently been observed in non\u2010small cell lung cancers,In the present study, we examined that the expression of RasGRF2 in lung adenocarcinoma using immunohistochemistry. We also compared the expression of RasGRF2 with one of the other Ras GEFs, phosphorylated epithelial cell transforming 2 (pECT2) and showed that overexpression of both GEFs had a synergistic effect on patient outcome.Samples of 179 lung adenocarcinomas were obtained from patients who had undergone surgical resection at the University of Tsukuba Hospital between 1999 and 2007. All tissue specimens had been fixed with 10% formalin and embedded in paraffin. All cases were classified histologically according to the World Health Organization (WHO) classification (4th edition) and tumor\u2013node\u2013metastasis (TNM) staging was performed in accordance with the Union for International Cancer Control (UICC) system (8th edition). This research was approved by the ethics committee of University of Tsukuba Hospital.For immunohistochemistry (IHC), we used 3\u2010\u00b5m\u2010thick sections cut from formalin\u2010fixed, paraffin\u2010embedded blocks. IHC staining was performed using the Autostainer Link 48 platform . Deparaffinization, rehydration and target retrieval were performed in Dako PT Link using EnVision FLEX High pH Target Retrieval Solution (Agilent Technologies). The slides were incubated with a rabbit polyclonal antibody against RasGRF2 and with a rabbit polyclonal antibody against ECT2 . The sections were subsequently incubated with the secondary antibody and detected using DAB .H\u2010score,H\u2010score, RasGRF2 staining was classified as high staining (HS) or low staining (LS) for statistical analysis.For assessment of RasGRF2 immunoreactivity, we evaluated RasGRF2 in the cytoplasm on the basis of the For assessment of pECT2 immunoreactivity, 1000 tumor cells were evaluated for the most intense cytoplasmic staining (hot spot) and evaluated as reported previously.We performed Western blot analysis (WB) using six fresh surgical specimens including three HS cases and three LS cases based on the results of IHC. Protein samples extracted from the fresh tissues were separated by SDS\u2010PAGE.\u03c72 test. The Kaplan\u2013Meier method was used for calculation of survival curves, and the log\u2010rank test was performed for comparisons. Multivariate analysis was performed using the Cox proportional hazards model. Differences were considered statistically significant at P \u2264 0.05.For all statistical analyses, SPSS 26 was used. For RasGRF2 expression, receiver operating characteristic (ROC) curve analysis was performed and the best cut\u2010off points were determined at a coordinate of 100 for both disease\u2010free survival (DFS) and overall survival (OS). Correlations between clinicopathological features and RasGRF2 expression were analyzed by Among the 179 lung adenocarcinomas, 100 showed high staining (HS) and the other 79 showed low staining (LS) . Multivariate analysis using the Cox proportional hazards model indicated that lymphatic permeation and vascular invasion were independent factors predictive of poor survival in patients with lung adenocarcinoma, whereas RasGRF2 expression was not . As was the case for RasGRF2, multivariate analysis showed that pECT2 expression was not an independent prognostic factor is localized in the cytoplasm and cellular membrane like RasGRF2 and functions as a Rho\u2010GEF. Using the same 179 cases of lung adenocarcinoma, we examined the level of pECT2 expression in the subcellular region using IHC Fig.\u00a0. The cliP = 0.004).Interestingly, the expressions of RasGRF2 and pECT2 were weakly correlated and cases that were positive for both RasGRF2 and pECT2 showed a much worse outcome than cases that were negative for both and reported that the concordance rate between the gene expression of RasGRF2 and its aberrant methylation was 65% (11/17). They stressed that RasGRF2 expression was suppressed in lung carcinoma by aberrant methylation. In the present study, however, we found that 56% (100/179) of the lung adenocarcinomas we examined showed HS with anti\u2010RasGRF2 antibody. This discrepancy may have been due to the very limited number of cases examined for both expression and aberrant methylation. Furthermore, Chen et al. did not indicate the exact number of adenocarcinomas among the NSCLC cases they examined. Future studies will be necessary to investigate the molecular mechanisms involved in overexpression of RasGRF2 protein.In this study, we examined the expression of RasGRF2 in lung adenocarcinoma. Calvo in situ or minimally invasive adenocarcinoma. Furthermore, high expression was associated with sex, pathological stage, T factor, lymph node status, pleural invasion and vascular invasion, and consequently correlated with poor outcome.The apparent association of RasGRF2 expression with the clinical characteristics of patients with lung adenocarcinoma is interesting. Expression was higher in invasive and advanced carcinoma than in adenocarcinoma In this study, we also examined one of the other Rho\u2010related GEFs, pECT2, using the same lung adenocarcinoma cases. Both RasGRF2 and pECT2 activate Rho, thus triggering various signaling pathways associated with tumor invasion and mobility of lung adenocarcinoma. pECT2 expression was significantly associated with poor outcome of lung adenocarcinoma Fig.\u00a0.It is interesting that cases positive for both GEFs had significantly worse outcomes than cases negative for both Fig.\u00a0. As RasGNone declared.Conception and design of the study: TN, YK, MN, NS. Acquisition and analysis of data: TN, JK. Drafting the manuscript and figures: TN, JK, MN, NS. Administrative, technical or material support: YM, ZK.Additional Supporting Information may be found in the online version of this article at the publisher's website.Figure S1 Immunohistochemistry for RasGRF2 in lung adenocarcinoma. RasGRF2 was stained in the cytoplasm of non\u2010neoplastic bronchial epithelium (A) and the tumor cells (B\u2013D). The H\u2010Score is defined as the summed percentage of cells at a specific intensity of staining ((B) negative: 0, (C) weak: 1+ and (D) strong: 2+), calculated using the formula: [1\u2009\u00d7\u2009(% area 1+)\u2009+\u20092\u2009\u00d7\u2009(% area 2+)]. RasGRF2 staining was classified as high or low expression with the H\u2010score for statistical analysis.Click here for additional data file.Figure S2 Western blotting of RasGRF2 in lung adenocarcinomas. The target bands were probed with the anti\u2010human RasGRF2 primary antibody used in the IHC or with anti\u2010human \u03b2\u2010actin mouse monoclonal antibody (Sigma\u2010Aldrich Co.). HRP\u2010conjugated anti\u2010goat or \u2010mouse IgG (Agilent Technologies) was used as the secondary antibody, respectively. All procedures were performed in accordance with the manufacturers\u2019 instructions. Immunoreactivity was detected by chemiluminescence and captured using ChemiDoc Touch . Protein expression is strong in tissues of cases showing high RasGRF2 staining by IHC (high) and weak in cases showing low staining (low). Human glioblastoma U251MG cells and pure water were used as positive (PC) and negative (NC) controls, respectively.Click here for additional data file.Figure S3 The relationship between RasGRF2 expression and Kras mutation in lung adenocarcinoma was analyzed using TCGA database. There was no significant relationship between them.Click here for additional data file.Table S1 Relationship between RasGRF2 expression and EGFR mutation in patients with lung adenocarcinoma.Click here for additional data file.Table S2 Cytoplasmic ECT2 (pECT2) expression and clinicopathological features in patients with lung adenocarcinoma.Click here for additional data file."} +{"text": "Blood-derived concentrated growth factors (CGFs) represent a novel autologous biomaterial with promising applications in regenerative medicine. Angiogenesis is a key factor in tissue regeneration, but the role played by CGFs in vessel formation is not clear. The purpose of this study was to characterize the angiogenic properties of CGFs by evaluating the effects of its soluble factors and cellular components on the neovascularization in an in vitro model of angiogenesis. CGF clots were cultured for 14 days in cell culture medium; after that, CGF-conditioned medium (CGF-CM) was collected, and soluble factors and cellular components were separated and characterized. CGF-soluble factors, such as growth factors (VEGF and TGF-\u03b21) and matrix metalloproteinases (MMP-2 and -9), were assessed by ELISA. Angiogenic properties of CGF-soluble factors were analyzed by stimulating human cultured endothelial cells with increasing concentrations of CGF-CM, and their effect on cell migration and tubule-like formation was assessed by wound healing and Matrigel assay, respectively. The expression of endothelial angiogenic mediators was determined using qRT-PCR and ELISA assays. CGF-derived cells were characterized by immunostaining, qRT-PCR and Matrigel assay. We found that CGF-CM, consisting of essential pro-angiogenic factors, such as VEGF, TGF-\u03b21, MMP-9, and MMP-2, promoted endothelial cell migration; tubule structure formation; and endothelial expression of multiple angiogenic mediators, including growth factors, chemokines, and metalloproteinases. Moreover, we discovered that CGF-derived cells exhibited features such as endothelial progenitor cells, since they expressed the CD34 stem cell marker and endothelial markers and participated in the neo-angiogenic process. In conclusion, our results suggest that CGFs are able to promote endothelial angiogenesis through their soluble and cellular components and that CGFs can be used as a biomaterial for therapeutic vasculogenesis in the field of tissue regeneration. Over recent decades, numerous efforts have been made in the field of regenerative medicine; however, clinical applications of tissue engineering constructs are still scarce .Major limitations in this field are related to the inadequate blood vessel network, which is crucial to ensure oxygen diffusion and nutrient supply and critical for the successful implantation of the tissue graft . TherefoTherapeutic angiogenesis is required both for rapid vascularization of tissue-engineered constructs and for the treatment of ischemic conditions. While ischemic tissues are already vascularized and proangiogenic therapy aims to expand the microvascular networks to promote collateral artery remodeling and restore physiological blood flow, tissue-engineered grafts are avascular upon implantation and need to attract vascular in-growth. In order to rapidly guide sprouting of new vessels and their migration toward the graft core, it is desirable that the graft matrix presents an optimized microenvironment of angiogenic cues. This can be achieved through several strategies, including the functionalization of biomaterials with pro-angiogenic factors, nucleic acids, and angiogenic cells, by predecorating a suitable material (such as fibrin or collagen) with optimized doses and combinations of angiogenic factors and/or by employing a decellularized extracellular matrix enriched in morphogens by suitable progenitor cell lines ,19.However, the exogenous application of angiogenic growth factors in tissue engineering does not always achieve success in vivo due to their rapid diffusion, short half-life time, and rapid proteolysis . The faiThus, proper delivery systems are essential to stabilize growth factors and provide long-term sustained and controlled release for in vivo efficacy.Considering the multistep process of angiogenesis, systems to control the delivery of multiple angiogenic mediators in a spatiotemporal manner are necessary .Various strategies have been performed for the controlled release of growth factors, including encapsulated VEGF in alginate hydrogel or conjugating VEGF into a collagen scaffold. Another approach was the pre-encapsulation of growth factors into microspheres, followed by the incorporation of the microspheres into scaffolds. The first system capable of providing multiple growth factors in a space-time manner, developed by Mooney et al. , attemptHowever, as therapeutic vasculogenesis has failed to be translated clinically, there is a clear need for the design and development of new systems to allow for the translation of safe and efficacious treatments to induce angiogenesis.Recent advances in regenerative medicine have increased the shift from heterologous to autologous therapies. In this context, various techniques have been developed to process peripheral blood in order to obtain useful hemoderivative products for wound healing and therapeutic angiogenesis .Depending on their contents of platelets leucocytes and fibrin architecture, hemoderivative products are commonly classified as platelet rich plasma (PRP), platelet poor plasma (PPP), and platelet rich fibrin (PRF) . ConcentThe CGF, as a fibrin scaffold, is considered a reservoir of natural growth factors, which can be released gradually over a period of time and play a crucial role in hard and soft tissue repair .Several studies have investigated the effects of CGFs on tissue regeneration of alveolar and sinus bone, fracture repair, and implant stability, displaying a good tissue regenerative property ,33,34,35In this study, we aimed to determine the role of CGFs in neo-angiogenesis, evaluating the contribution of soluble factors and CGF-released cells. To this aim, we cultured CGFs for appropriate time periods to pursue the highest content of released growth factors. The effects of CGF-soluble factors on the migration and tubular structure formation of human endothelial cells, as well as on endothelial expression of pro-angiogenic factors, were evaluated. At the same time, CGF-released cells were characterized by assessing the expression of stem cells and mature endothelial cells markers, and their contribution to angiogenesis was explored.The cell culture medium, gelatin, fetal bovine serum, glutamine, penicillin and streptomycin were obtained from Merck . Human enzyme-linked immunosorbent assay (ELISA) kits were obtained from Cusabio for determination of VEGF and TGF-\u03b21 and from R&D for determination of BMP-2 and metalloproteinases MMP-2 and MMP-9. Primary antibodies against CD34, eNOS, and VE-cadherin were purchased from Santa Cruz Biotechnology, as well as biotinylated anti-mouse IgG and biotinylated anti-rabbit IgG antibodies. The primary antibody against VEGFR-2 was purchased from Cell Signaling . Extravidin peroxidase and diamminobenzidine were obtained from Merck, as well all other reagents, unless otherwise indicated.2 for 14 days. Then, CGF clot was removed, and CGF-conditioned medium (CGF-CM) was collected and centrifuged at 1500 rpm for 10 min. Then, the supernatant was stored at \u221280 \u00b0C until use, and the pellet was used for the CGF cell culture. In particular, CGF-CM was analyzed to evaluate the content of growth factors and metalloproteinases and its effects on the angiogenesis of human endothelial cells (Venous blood (8 mL) from 5 healthy, non-smoking adult donors, two females and three males, aged between 27 and 50 years old, was collected and immediately centrifuged by a Medifuge device , at 25 \u00b0C, using a program with the following characteristics: 30 s acceleration, 2 min 2700 rpm, 4 min 2400 rpm, 4 min 2700 rpm, 3 min 3000 rpm, and 36 s deceleration and stop, to obtain CGF clot, as previously described . Informeal cells .CGF-released cells were suspended in M199 medium complete, containing 10% FBS, 2 mM glutamine, 100 U/mL penicillin, and 100 \u03bcg/mL streptomycin and seeded in appropriate cell plate coated with 1% gelatin. In our experimental conditions, CGF-derived cells adhered to the culture plate and grew until they reached the confluence. CGF-derived cells were phenotypically characterized by hematoxylin\u2013eosin staining and immunostaining analysis . CGF celHuman umbilical vein endothelial cells (HUVEC) were obtained from discarded umbilical cords and treated anonymously, conforming to the principles outlined in the Declaration of Helsinki, after specific permission was granted by the local health authority. HUVECs were grown on cell plates, pre-coated with 1% gelatin, in M199 medium containing 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 \u03bcg/mL streptomycin, as described in , and uti5 cells/well until confluence, and then a scratch wound was performed with a sterile microtip. After washing with PBS to remove detached cells, the first series of photos were taken with an attached digital output Canon Powershot S50 camera (0 h). Monolayers were incubated with increasing concentrations of CGF-CM or 3% FBS (control) for 16 h and then washed and again photographed (16 h). Cell repair of the wound was determined by measuring the width (\u03bcm) of the denuded area along the scratch (at five different levels) using the Optimas Image analysis software .To evaluate cell migration, endothelial cells were seeded into 6-well plates at the density of 2 \u00d7 104 cells per well in the presence of CGF-CM or 3% FBS (control) and then incubated for 16 h at 37 \u00b0C.The formation of vascular-like structures by endothelial cells was assessed on the growth factor-reduced basement membrane matrix \u201cMatrigel\u201d , as previously described ,41. The 4 CGF-derived cells were loaded with DilC18 vital fluorescent dye and seeded on Matrigel together with mature endothelial cells (3 \u00d7 104). After 16 h, tube formation was monitored by light microscopy and fluorescence microscopy. Fluorescence images were captured by NIS-Elements F 3.0.Tube formation was monitored by inverted phase-contrast microscopy , and pictures (\u00d7100 magnification) were taken with an attached digital output Canon Powershot S50 camera. Tube formation was quantified by counting the tubule branching points in three randomly selected fields per well and was expressed as branch points per field. To evaluate the contribute of CGF-derived cells in tube-like formation, 1 \u00d7 10CGF-CM as well as the supernatants of CGF-derived cells and CGF-CM-treated endothelial cells were collected, and the growth factors VEGF and TGF-\u03b21 and the metalloproteinases MMP-9 and MMP-2 were quantified using commercial human ELISA kits, according to the manufacturer\u2019s instructions. To detect the total amount of TGF-\u03b21, the latent form of TGF-\u03b21 was first converted into the active form according to the manufacturer\u2019s instructions. Specifically, endothelial cells were incubated with CGF-CM (10%) for 16 h, and then the culture media were replaced with fresh medium. After 48 h, supernatants were collected and analyzed. CGF-derived cells were grown until confluence in M199 complete; then, the culture media were replaced with fresh medium and incubated for 48 h; later, supernatants were collected and analyzed.All results are expressed as ng of angiogenic factors per mL volume of supernatants/conditioned medium.Total RNA was isolated from CGF-derived cells and CGF-CM-treated endothelial cells using the TRIzol reagent (Invitrogen) according to the manufacturer\u2019s protocol. For quantitative polymerase chain reaction, total RNA (1 \u03bcg) was converted into first-strand cDNA using the High-Capacity cDNA Reverse Transcription Kit . The quantitative RT-PCR was performed in the Bio-Rad Biosystems CFX384 Touch Real-Time PCR Detection System using SYBR Green PCR Master Mix. The human cDNA fragments were amplified using primers synthesized by Thermo Fisher and are reported in t-test. Multiple comparisons were performed by one-way analysis of variance (ANOVA), and individual differences were then tested by Fisher\u2019s protected least significant difference test after the demonstration of significant intergroup differences by ANOVA. Differences between means from at least three independent experiments with p < 0 05 were considered statistically significant.Values are expressed as mean \u00b1 SD for the number of experiments indicated in the legends of the figures. Differences between two groups were determined by unpaired Student\u2019s In an attempt to mimic the natural release of factors by CGFs that could occur in vivo, we cultured CGF in M199 medium for an appropriate time. According to previous studies showing 14 days as the best time to obtain the highest growth factor content ,43, we cIn order to analyze the pro-angiogenic effects of soluble factors released by CGFs in culture medium, we analyzed the CGF-CM content of angiogenic factors by ELISA. As reported in Since CGFs released factors boosting the angiogenic process, we determined the effects of CGF-CM on the endothelial angiogenic response, evaluating cell migration and tube-like structure formation in human endothelial cells. For this purpose, endothelial cells, HUVECs or HMEC-1, were treated with CGF-CM at different concentrations for 16 h. The representative scratch wound healing images A and theIn order to explore the mechanisms underlying the CGF action on endothelial angiogenesis, we analyzed the effects of CGF-CM on the expression of the pro-angiogenic factor in endothelial cells. In particular, we analyzed the mRNA levels and protein release of VEGF, MMP-2, and MMP-9 by qRT-PCR and ELISA, respectively. The expression and release of VEGF in CGF-CM-treated endothelial cells were significantly up-regulated compared to those of untreated control cells A,B. In eTo enhance the pro-angiogenic mechanisms of CGFs, we analyzed the effect of CGF-CM on the endothelial expression of other pro-angiogenic factors, including Ang-1, Ang-2, and PDGF-B. As shown in In addition to providing soluble components, CGF also released numerous and heterogeneous cells, some of which were able to adhere to cell culture plates and to propagate A. We perTo explore the role of these cells in the angiogenic potential of CGF, we analyzed the release of pro-angiogenic factors. As shown in To further characterize CGF-derived cells, we investigated the expression of stem cell and endothelial markers. Using immunocytochemistry, we found that CGF-derived cells were positive for the hematopoietic stem cell marker CD34 and for endothelial markers eNOS, VEGFR-2, and VE-cadherin A. These Finally, in EPC-like CGF-derived cells as well as in mature endothelial cells, we investigated the expression of CXCL-12 and CXCR-4, key regulators of the angiogenic process ,45,46. WIn the present study, we reported novel properties of CGF in promoting neo-angiogenesis by releasing multiple soluble angiogenic factors and EPC-like cells.It is well known that the formation of new blood vessels, crucial in tissue growth and repair, occurs through a complex process that requires the cooperation of several angiogenic factors responsible for multiple events, such as the budding of pre-existing resident endothelial cells and the recruitment of bone marrow derived EPC .Currently, platelet concentrates are widely used to regenerate damaged tissues in the field of orthopedic and oral surgery ,49,50,51In addition to growth factors, we found, for the first time, that CGFs released large amount of matrix metalloproteinases, such as MMP-2 and MMP-9, which play an essential role in angiogenesis. MMPs are extracellular endopeptidases that selectively degrade components of the extracellular matrix and allow endothelial cells to migrate and invade into the surrounding tissue and contribute to new vessel formation. Moreover, MMP-9 is involved in mobilizing EPCs and other progenitor cells from the bone marrow niche . MMPs alIn order to evaluate the functional properties of CGF-released factors, we analyzed the effects of CGF-CM on the angiogenic response of mature endothelial cells, HUVECs and HMEC-1. We found that CGF-CM promoted the angiogenic potential of endothelial cell stimulation in a concentration dependent manner, cell migration, and tubule-like structure formation. The angiogenic response of endothelial cells induced by CGF can be, at least in part, explained by the presence of pro-angiogenic growth factors, such as VEGF and TGF-\u03b21, which promote cell proliferation, migration, and differentiation in endothelial capillary structures.MMPs, degrading extracellular matrix, also contribute to cell migration and vessel development. The endothelial angiogenic response was maximal when the concentrations of CGF-enriched medium reached 10%; higher concentrations did not guarantee stronger effects, as reported in other previous studies ,42,65. ASoluble factors exerted an optimal effect on angiogenesis at low concentrations, which could correspond to those obtained in application of CGFs as a fibrin scaffold in vivo. Our results confirm and expand on a previous study reporting that CGFs, as extract, were able to induce endothelial cell proliferation, migration, and tubular structure formation . Other sHere, we discovered that CGF-CM significantly increased the expression and release of VEGF, MMP-9, and MMP-2 in cultured endothelial cells. Furthermore, CGF-CM up-regulated the expression of Ang-2, BMP-2, and PDGF-B, thus amplifying pro-angiogenic signals.It is known that platelet concentrates could provide a supportive matrix for circulating stem/progenitor cells ,69, whicOur findings showing the ability of CGF to deliver CXCR-4 positive cells and to induce CXCL-12/CXCR-4 expression in mature endothelial cells reveal an additional mechanism in CGF-induced angiogenesis, which may have relevance in the neovascularization at the damage/ischemic site.To date, there are no literature data regarding the implications of EPC-like cells present in CGF in clinical applications; thus, future studies should focus on this topic.In our experimental conditions, based on the CGF culture, without any manipulation and preservation of its microenvironment, we have shown that CGFs are able to promote the process of neo-angiogenesis due to the synergistic action of multiple angiogenic mediators and EPCs, which, together with mature endothelial cells, could contribute to the vascularization at the site of CGF application.In a previous study, we showed that VEGF was released from titanium dental implant surfaces permeated with CGFs and containing fibrin, which is fundamental to accommodate the cellular network . The preSome limitations are involved in the present study. We evaluated the angiogenic properties of the CGF-conditioned medium, which may be related to the synergy of multiple mediators. Notwithstanding, the role of the specific angiogenic factor and its mechanism of action needs further investigation. In this study, we determined the angiogenic properties of non-manipulated CGFs, dissecting the role of soluble factors and, for the first time, also highlighting the contribution of EPC-like released cells. However, more studies are needed to further our understanding of the characteristics of CGF-released stem/progenitor cells and their role in the neo-angiogenesis. Moreover, our study was conducted in a preclinical model represented by HUVEC and HMEC-1 cultures, known as a reliable and versatile tool for studying in vitro angiogenesis. Despite this, the in vitro experimental results do not necessarily translate directly into the in vivo situation. Therefore, further investigations, including human trials, are needed to confirm and further evaluate the in vivo efficacy of CGFs in promoting vasculogenesis and tissue regeneration.In the present study, our results suggest that CGFs represent not only a reservoir of multiple pro-angiogenic factors able to induce a pro-angiogenic phenotype in mature endothelial cells, but also a cell niche for EPC-like cells. Our in vitro model provides the first evidence that CGFs release EPC-like cells, which contribute to neo-angiogenesis producing pro-angiogenic factors and taking part in the formation of endothelial tubular structures.CGFs function as a complex milieu that regulates, by means of a dense fibrin scaffold and multiple bioactive factors, the survival, growth, differentiation, and migration of immature cells, which could be a valid strategy to facilitate healing processes in tissue regeneration.In conclusion, CGFs, with a direct effect on neo-angiogenic response, could represent a very promising biomaterial for therapeutic vasculogenesis and tissue healing, offering new and interesting perspectives for the use of CGFs in regenerative medicine.However, our study was performed using an in vitro system, and therefore caution is required in translating these research findings in vivo."} +{"text": "HPV infection is the primary cause of cervical cancer, a leading cause of cancer among women in Kenya and many sub-Saharan African countries. High coverage of HPV vaccination is a World Health Organization priority to eliminate cervical cancer globally, but vaccine supply and logistics limit widespread implementation of the current two or three dose HPV vaccine schedule.We are conducting an individual randomized controlled trial to evaluate whether a single dose of the bivalent (HPV 16/18) or nonavalent (HPV 16/18/31/33/45/52/58/6/11) HPV vaccine prevents persistent HPV infection, a surrogate marker for precancerous lesions and cervical cancer. The primary objective is to compare the efficacy of immediate, single-dose bivalent or nonavalent vaccination with delayed HPV vaccination. Kenyan women age 15\u201320\u2009years old are randomized to immediate bivalent HPV and delayed meningococcal vaccine (group 1), immediate nonavalent HPV vaccine and delayed meningococcal vaccine (group 2), or immediate meningococcal vaccine and delayed HPV vaccine (group 3) with 36\u2009months of follow-up. The primary outcome is persistent vaccine-type HPV infection by month 18 and by month 36 for the final durability outcome. The secondary objectives include to (1) evaluate non-inferiority of antibody titers among girls and adolescents (age 9 to 14\u2009years) from another Tanzanian study, the DoRIS Study (NCT02834637), compared to KEN SHE Study participants; (2) assess the memory B cell immune response at months 36 and 37; and (3) estimate cost-effectiveness using the trial results and health economic models.This study will evaluate single-dose HPV vaccine efficacy in Africa and has the potential to guide public health policy and increase HPV vaccine coverage. The secondary aims will assess generalizability of the trial results by evaluating immunobridging from younger ages, durability of the immune response, and the long-term health benefits and cost of single-dose HPV vaccine delivery.NCT03675256. Registered on September 18, 2018ClinicalTrials.gov The online version contains supplementary material available at 10.1186/s13063-021-05608-8. The order of the items has been modified to group similar items , is a leading cause of incident cancer cases among women in Africa . HPV vacKenya\u2019s national immunization program, launched in October 2019, offers two doses of the HPV vaccine to 9\u201310-year-old girls. Further, the Global Alliance for Vaccines and Immunization (GAVI) endorses multi-age cohort vaccination to age 14\u2009years . A gap eDemonstration projects support the feasibility of high coverage of single-dose HPV vaccination in Kenya. Between 2013 and 2015 and 2016\u20132018, demonstration projects of the quadrivalent HPV 16/18/6/11 vaccine offered to girls age 9\u201310\u2009years in a school-based setting achieved >\u200985% coverage of the first dose with lower coverage of subsequent doses; 64% uptake of the second dose and 39% of the third doses . FurtherThe rationale for a single-dose HPV vaccine study among young Kenyan women age 15\u201320\u2009years is threefold. First, cervical cancer is the leading cause of new cancer cases among women in Africa and HPV vaccine scale-up has the potential to dramatically decrease cervical cancer cases. Second, replacing the two or three dose HPV vaccine schedule with the single-dose strategy, efficacy of which is supported by observational data \u201311, woulSPIRIT guidance: specific objectives or hypotheses.Test the efficacy of immediate single-dose bivalent or nonavalent HPV vaccination to prevent incident persistent HPV 16/18 infection compared to delayed HPV vaccination for young women age 15\u201320\u2009yearsTest the efficacy of immediate single-dose nonavalent HPV vaccination to prevent incident persistent HPV 16/18/31/33/45/52/58 infection compared to delayed HPV vaccination for young women age 15\u201320\u2009years.Single-dose bivalent or nonavalent HPV vaccination will prevent 75% of combined incident persistent HPV-16/18 infections among young women who are HPV 16/18 na\u00efve at enrollmentSingle-dose nonavalent HPV vaccination will prevent 75% of combined incident persistent HPV 16/18/31/33/45/52/58 among young women who are 16/18/31/33/45/52/58 na\u00efve at enrollment.Determine whether vaccine-type HPV antibody responses after single-dose bivalent or nonavalent vaccination are noninferior in 9\u201314-year-old girls versus 15\u201320-year-old young womenAssess cost, cost-effectiveness, and budget impact of single-dose HPV vaccination to support implementation strategies for single-dose HPV vaccination following WHO recommendation in high cervical cancer burden settingsEvaluate B cell markers as a proxy for central immune memory following single-dose bivalent and nonavalent vaccinationAssess vaccine efficacy with the exclusion of infections first detected at month 6, as these may represent prevalent infections not detected at baseline rather than incident infectionsAntibody responses to vaccine-type HPV after receiving a single-dose of bivalent or nonavalent HPV vaccine will be noninferior in 9\u201314-year-old girls and adolescents compared to 15-20-year-old adolescents and young women..Single-dose bivalent and nonavalent HPV vaccination will be cost-effective per cervical cancer case avertedSingle-dose HPV vaccination will induce potent memory with B cells producing neutralizing antibodies..Single-dose bivalent or nonavalent HPV vaccination will prevent 75% of combined incident persistent vaccine-type HPV infections among young women who are vaccine-type HPV na\u00efve at enrollment, month 3, and month 6The KEN SHE Study is an individual, blinded, prospective randomized trial among 2250 adolescent girls and young women with potential exposure to high-risk HPV in Kenya to test the efficacy of single-dose HPV vaccination to prevent incident persistent HPV infection. This is a superiority trial. Participants are randomized 1:1:1 to either (1) immediate nonavalent HPV vaccination and delayed meningococcal vaccination, (2) immediate bivalent HPV vaccination and delayed meningococcal vaccination, or (3) immediate meningococcal HPV vaccination and delayed HPV vaccination.The study is conducted at three locations in Kenya: (1) Thika, a town in Kiambu County, northeast of Nairobi Thika), (2) KEMRI clinic at the Center of Clinical Research (CCR) in Nairobi (KEMRI Nairobi), and (3) Kisumu, in western Kenya (KEMRI Kisumu). The Nairobi site is urban, while the Thika and Kisumu sites are peri-urban. Participants are young, HIV-negative women, age 15\u201320\u2009years, who report 1\u20135 sex partners in their lifetime. We estimated that approximately 9000 women would be screened to enroll 2250 eligible participants for the study.The study clinical personnel reviewed the screening questionnaire, clinical history, and the HIV testing results to determine study eligibility.Female sex assigned at birthAge 15 to 20\u2009yearsSexually active: defined as history of 1-5 lifetime sex partnersResident within study area without plans to move away in the next 37\u2009monthsThe study eligibility criteria are:Positive HIV rapid serologic test resultHistory of HPV vaccinationAllergies to vaccine components or latexCurrent pregnancyHysterectomyAutoimmune, degenerative, or genetic diseasesInvestigator discretionIneligibility criteria for the study are:Participants receive their screening results and counseling regarding clinical management as indicated. Participants who are eligible receive an appointment for follow-up at the study clinic to conduct the enrollment procedures.The study is implemented according to the principles stated in the Declaration of Helsinki and the principles of the International Conference on Harmonization (ICH) Guideline for Good Clinical Practice (GCP). Study staff from all collaborating institutions are trained in GCP prior to study start. The laboratory staff are trained in Good Clinical Laboratory Practice (GCLP). The study staff conduct the informed consent or assent procedures.All participants, and their parents/guardians in the case of minors, go through an informed assent/consent process. Information is provided on sexual and reproductive health services including cervical cancer prevention services available outside the study. All potential clients read or have read to them the consent form by the study team. The consent form is available in both the local language and English, and participants select which language they prefer to be consented in. Each participant, and their parent/guardian, has an opportunity to ask questions about study participation. Once a participant agrees to participate in the study, the study staff obtains written consent. After consenting to participate, a participant can voluntarily withdraw from the study at any time and can choose not to have their responses submitted to the study team.Participants separately provide consent for storage of blood and genitourinary swabs at the Thika, Nairobi, and Kisumu KEMRI sites and at the University of Washington and the Fred Hutchinson Cancer Research Center for future research. Specifically, participants consent to samples being shipped to a central laboratory at the National Cancer Institute for immunobridging analyses and comparison of other trial results to the KEN SHE Study findings. Further, samples and data could be used for research related to HPV vaccines, HPV, bacterial vaginosis (BV), HIV, HIV-related diseases, and other sexually transmitted infections (STIs).Neisseria meningitidis outbreaks which occur every 5\u201312\u2009years, meningitis incidence can be as high as 1000 cases per 100,000 population per year ). The log rank test stratified by site will be used to calculate the Immunobridging sub-study:Sample size calculation: Using the same assumptions as the main study, we anticipate 70% of young, sexually active women in Kenya will be HPV 6/11/16/18/31/33/45/52/58 na\u00efve (as documented by baseline serology and HPV DNA).Total sample size: Using the same assumptions as the main study, we estimate that 300 women from each arm would need to be enrolled in the sub-study.t test will have 91% power to reject the null hypothesis that the test is inferior to the standard in favor of the alternative hypothesis that the treatment is non-inferior, assuming that the expected difference in log means is 0 , a non-inferiority margin of log (0.67) and the common standard deviation is 1.2.Power: When the sample sizes in the groups are 150 and 300, a two group 0.025 one-sided Immunobridging analysis:Bivalent vaccine: The cohort for primary analysis of non-inferiority includes 15\u201320-year-old women from this trial and 9\u201314-year-old girls from the Tanzania trial who received single-dose HPV 16/18 vaccination and who were HPV 16/18 DNA negative and HPV 16/18 seronegative at baseline .Nonavalent vaccine: The cohort for primary analysis of non-inferiority includes 15\u201320-year-old women from this trial and 9\u201314-year-old girls from the Tanzania trial who received single-dose HPV 6/11/16/18/31/33/45/52/58 vaccination and who were HPV 6/11/16/18/31/33/45/52/58 DNA negative and HPV 6/11/16/18/31/33/45/52/58 seronegative at baseline .For each vaccine group , noninferiority of antibody GMTs at 1\u2009month and 24\u2009months after single-dose vaccination will be tested using a 2-sided 95% CI for the ratio of antibody GMTs in 9\u201314-year-old girls relative to antibody GMTs in 15\u201320-year-old young women. Noninferiority will be tested for each vaccine type. Noninferiority will be declared if the lower limit of the ratio is above 0.67. The statistical criterion for non-inferiority requires that the lower bound of two-sided 95% confidence interval of GMT ratio (girls vs. young women) be greater than 0.67 for each HPV type. To facilitate robust analysis of immune-bridging and account for the durability of vaccine efficacy, the 24-month analysis will be the primary analysis with the month 1 analysis providing additional information.p value of <\u20090.05 will be considered significant.For the bivalent and nonavalent vaccine vs. the meningococcal vaccine and for the bivalent vs. nonavalent vaccines we will compare (1) the percent of plasmablasts from PBMCs, (2) the percent of plasmablasts from purified B cells, (3) the percent of HPV 16 specific B memory cells, and (4) number of HPV 16 B memory cells per 10^6 live cells. We will use the ANOVA test for pairwise comparison and the ANOVA for more than two groups. Differences with a Cost effectiveness analysis: We will assess cost, cost-effectiveness, and budget impact of single-dose HPV vaccination to support implementation strategies for single-dose HPV vaccination following WHO recommendation in high cervical cancer burden settings.Overall approach: Using activity-based micro-costing data and outcome data from aim 1, we will define the costs and model the cost-effectiveness of single-dose HPV vaccination for optimized cervical cancer prevention. We will work closely with the Kenyan Ministry of Health to determine the package of evidence necessary for implementation of single-dose HPV vaccination including budget impact and strategies for mass single-dose vaccination and incorporation of HPV vaccination into health services for young women.Health economic modeling: We will adapt our existing South African HPV transmission model to explicitly include single-dose bivalent and nonavalent HPV vaccination and parameterize a transmission model for the Kenyan HPV transmission and progression to cervical cancer .Model outcomes: We will estimate the impact of single-dose bivalent and nonavalent HPV vaccination on the change in (1) cervical cancer incidence, (2) cervical cancer related deaths, and (3) disability-adjusted life years (DALYs). The model simulates the intervention impact and projects the effect on health outcomes over 10\u2009years. For all key inputs and outputs, we will follow standard practices [ractices , includiractices . We willThe analyses will be repeated on the mITT sensitivity cohort and the extended sensitivity cohort. The analyses will be repeated on the ITT cohort as an exploratory analysis.These final analyses will be the same as the primary analysis with the outcome defined until 36\u2009months instead of 18\u2009months.Interim analyses are not planned for the study.Analyses will be conducted for the following prespecified subgroups based on baseline covariates: presence of co-infections , self-reported condom use, number of self-reported sex partners in the last 3\u2009months (0\u20131 vs. 2+), contraception method, and PrEP use.Some participants may have a single positive HPV DNA test without another test in the required timeframe to determine persistent HPV. The primary efficacy analysis above will be repeated twice: once assuming all missing tests would have been positive and a second assuming all missing tests would be negative.The full protocol will be made available. Data cannot be shared publicly because this study was conducted with approval from the Kenya Medical Research Institute (KEMRI) Scientific and Ethics Review Unit (SERU), which requires that data from studies (including de-identified data) are released only after SERU have provided written approval for additional analyses. A complete de-identified dataset sufficient to reproduce the study findings will be made available upon written request after approval from SERU. To request these data, please contact the KEN SHE Scientific Committee at icrc@uw.edu.Our multi-disciplinary University of Washington (UW)-Kenya Medical Research Institute (KEMRI) Coordinating Center team consists of clinical trialists , HPV experts , biostatisticians , an immunologist , obstetrician gynecologists (Drs. Mugo and Bukusi), and an economic modeler (Dr. Barnabas) who have experience with translational science and implementation. The Coordinating Center capacity is strengthened by collaborative work between scientific operations and implementing partners. The co-PIs and investigators have weekly calls to track the study progress and ensure fidelity to the study design, timeline, and budget. An endpoint adjudication committee (Drs. Barnabas and Winer) will meet to review study endpoints.The Data Safety and Monitoring Board (DSMB) is independent and consists of six members: global expert clinical trial statistician, clinical trialists, experts in adolescent health including HPV infection, experts in cervical cancer treatment and prevention, and policy experts. The DSMB meets every 6 months to review the available study data. The DSMB evaluates participant safety , available endpoint data, and reviews the operational factors, specifically participant enrollment and follow-up, to assess safety, study execution, and provide feedback for investigators on areas for attention.We will plan a formal primary analysis to evaluate study outcomes after 18\u2009months of follow-up. We will follow the policy recommendations for single-dose vaccination, given the expected emerging evidence from this and other clinical trials. Both the magnitude and durability of the effect through 36\u2009months of the single-dose HPV vaccine are critical outcomes of this study.The three sites monitor adverse events (AEs) according to the local guidelines of the KEMRI\u2019s Scientific and Ethics Regulatory Unit (SERU), which is the site local regulatory authority. Adverse events are reported in the study data on eCRFs. Additional information about these AEs, including copies of outpatient records, hospitalization summaries, pathology reports, operative reports, and laboratory reports, are included in the reports as applicable. The SERU reporting process includes reporting all study-defined SAEs to SERU via email (seru@kemri.org) within 48\u2009h after the PI becomes aware of the event. The hard copies of the report are forwarded to the SERU Secretariat within three working days of the initial notification. Follow-up reports are submitted as soon as more information becomes available. The written safety report is addressed to the SERU Chairperson and submitted to the SERU Secretariat. The reporting includes the PI\u2019s opinion on the relationship of the adverse event with participation in the study.Although study sites make every effort to protect participant privacy and confidentiality, it is possible that participants\u2019 involvement in the study could become known to others and that social harms may result. The three sites assess for study-related social harm at each scheduled follow-up visit; reports can also be filed at interim visits if study-related social harms are discovered between visits. Information regarding social harms related to study participation is recorded into the study database. Participants who report social harms are referred to speak with a study counselor and, if appropriate, a study clinician and the site investigator/designee. The three sites refer participants to appropriate additional resources for safety as needed. If the site investigator/designee judges a social harm related to study participation to be serious and unexpected, the study safety monitor and SERU is notified within 10\u2009days of site awareness.The trial is being monitored by an independent study monitor every six months, which includes 100% quality checks of the vaccine randomization.Prior to implementation of this protocol, and any subsequent full version amendments, the three sites had the protocol and the protocol consent forms approved by SERU and Poisons and Pharmacy Board (PPB). Prior notice was given and written consent was sought and obtained from all study participants. All study participation is strictly voluntary, and participants can refuse specific procedures, or further study participation at any time.If changes are needed to the protocol, the protocol implementation team (in accordance with the protocol design team) handles all changes centrally. Once the changes are finalized, the protocol is submitted and approved by the appropriate IRBs and regulatory agencies prior to implementation. Version control is maintained centrally and sites will be trained on any changes.Our team of investigators is fully committed to rapid and multi-pronged dissemination of study results, regardless of the results. Through our previous HIV prevention trials , we The three sites will carry out dissemination meetings in Kenya bringing together international, regional, and local stakeholders to discuss findings and their implications for national policies. Since the results may directly influence national policies and recommendations, results will also be shared and discussed with the National Kenya Division of Family Health, Vaccine Program, and stakeholders\u2019 forum and the Adolescent Sexual Reproductive Health Technical Working Group of which the site PI (NM) is a member. At the local level, the results will be shared and discussed with the County specific Kenya Division of Family Health, Vaccine Program, and Adolescent Working Groups of which KEMRI is represented.This randomized, double-blind, controlled trial will provide data on single-dose HPV vaccine efficacy among adolescent girls and young women age 15\u201320\u2009years. While observational evidence supports the efficacy of single-dose HPV vaccination , 10, 12,The final results of the KEN SHE study are expected in early 2023 and the primary results in Q1 2022. Other trials evaluating single-dose protection are ongoing in Costa Rica , the Gambia , and Tanzania , with results available at the end of 2021 or later . These tThe study conduct has encountered and addressed challenges raised by the COVID-19 pandemic. During the global coronavirus (COVID-19) pandemic, as of May 17, 2021, Kenya has reported 165,465 cases, 3003 COVID-19 deaths, and a current case fatality rate of 1.8% . ApproxiThe KEN SHE Study data will contribute to the Global Strategy towards Eliminating Cervical Cancer as a public health problem led by the World Health Organization (WHO) . CervicaThe trial has several strengths including the randomized controlled blinded design, testing two vaccine types, and testing vaccine efficacy over a short time frame to support policy decisions. Further, the secondary objectives will evaluate immunobridging to younger trial participants, assess central memory for vaccine durability, and estimate the population-level impact on cervical cancer incidence and cost-effectiveness, building on the primary study results. A potential limitation of the study is not recruiting participants prior to sexual debut which may limit the number of HPV na\u00efve participants eligible for assessment of vaccine efficacy.In summary, the KEN SHE Study will evaluate single-dose HPV vaccination and provide robust estimates of vaccine efficacy against persistent HPV infection among adolescent and young women in sub-Saharan Africa. These data combined with other ongoing trials will provide evidence for policy makers on strategies to increase HPV vaccine coverage as a key component of cervical cancer elimination interventions.Protocol version 1.0, November 15, 2018Protocol version 2.0 includes the provision to delay analysis with COVID-19 delays in study procedures and clarifies the primary and secondary objectives.Protocol version 2.0, January 7, 2021.Participants were recruited between December 20, 2018, and November 15, 2019. Participants will continue follow-up in the study until December 2022, with analysis and dissemination of results in Q1-2 in 2023. Protocol submission was delayed due to the COVID-19 pandemic.Additional file 1. SPIRIT 2013 Checklist: Recommended items to address in a clinical trial protocol and related documents."} +{"text": "Enterococcus faecium and Enterococcus faecalis are opportunistic pathogens that can cause a vast variety of nosocomial infections. Moreover, E. faecium belongs to the group of ESKAPE microbes, which are the main cause of hospital-acquired infections and are especially difficult to treat because of their resistance to many antibiotics. Antimicrobial photodynamic inactivation (aPDI) represents an alternative to overcome multidrug resistance problems. This process requires the simultaneous presence of oxygen, visible light, and photosensitizing compounds. In this work, aPDI was used to resensitize Enterococcus spp. isolates to antibiotics. Antibiotic susceptibility testing according to European Committee on Antimicrobial Susceptibility Testing (EUCAST) recommendations was combined with synergy testing methods recommended by the American Society for Microbiology. Two clinical isolates, E. faecalis and E. faecium, were treated with a combination of aPDI utilizing rose bengal (RB) or fullerene (FL) derivative as photosensitizers, antimicrobial blue light (aBL), and 10 recommended antibiotics. aPDI appeared to significantly impact the survival rate of both isolates, while aBL had no significant effect. The synergy testing results differed between strains and utilized methods. Synergy was observed for RB aPDI in combination with gentamycin, ciprofloxacin and daptomycin against E. faecalis. For E. faecium, synergy was observed between RB aPDI and gentamycin or ciprofloxacin, while for RB aPDI with vancomycin or daptomycin, antagonism was observed. A combination of FL aPDI gives a synergistic effect against E. faecalis only with imipenem. Postantibiotic effect tests for E. faecium demonstrated that this isolate exposed to aPDI in combination with gentamycin, streptomycin, tigecycline, doxycycline, or daptomycin exhibits delayed growth in comparison to untreated bacteria. The results of synergy testing confirmed the effectiveness of aPDI in resensitization of the bacteria to antibiotics, which presents great potential in the treatment of infections caused by multidrug-resistant strains. E. faecalis and E. faecium [E. faecalis is known as an etiological agent of opportunistic infections including bacteremia, endocarditis, meningitis, and urinary tract and bloodstream infections [Enterococcus species, especially E. faecalis, are also associated with persistent endodontic infections. The most important antibiotics against which these microorganisms express resistance are \u03b2-lactams (penicillin), cephalosporines, lincosamides, streptogramins, and aminoglycosides, whereas they can also acquire resistance to glycopeptides or macrolides. The first occurrence of resistance to VAN was observed in 1980, and to date, this resistance has spread massively among E. faecium isolates. This urgent problem of resistance is associated with an increasing number of nosocomial infections linked with VAN-resistant E. faecium. These reasons explain why this organism belongs to the group of ESKAPE microbes, which are the main cause of hospital-acquired infections and are especially difficult to treat because of their resistance to many antibiotics [E. faecium strains to handwash alcohols is another problem that requires additional procedures to prevent transmission of this pathogen in the hospital setting [Acinetobacter baumannii [Enterococcus clinical isolates to routinely used antibiotics.Most Enterococci cause a vast variety of nosocomial infections of soft tissues, abscesses, urinary tract infections or even endocarditis, which overall are caused by faecium . E. faecfections . Enterocibiotics . It is wibiotics ,5,6. Mor setting . Antimic setting . Such praumannii . In the 2) was able to reduce E. faecium viability by approx. 2.5 log10 CFU/mL (10 reduction with the same light dose (6.4 J/cm2) it required 0.5 \u03bcM concentration. Similar results were obtained for the second isolate when RB was present at a concentration of 0.1 \u03bcM, and the highest reduction (approx. 6 log10 CFU/mL) was detected after the application of 6.4 J/cm2 of green light with a dose of green light irradiation [Adequate synergy testing required the preliminary characteristics of the studied MP, DAP) , coverinFor all of the antibiotics as well as for the photoinactivation conditions, the MIC values for both tested clinical isolates were determined. In the next set of experiments, the MIC values were used to evaluate the synergy between tested monotreatments, which was performed with the recommended methods for synergy testing .E. faecalis became more sensitive to STR and TGC; thus, the zones of inhibition increased by greater than or equal to 2 mm, whereas the MIC values from the E-test decreased by a minimum of 2-fold in comparison to the control, confirming the synergistic effect between aPDI and antibiotics. aPDI treatment also influenced changes in susceptibility to DOX and to IPM and AMP . In contrast, E. faecium did not respond in a similar manner to aPDI treatment. Synergy was observed for aPDI (RB) treatment with GEN and TGC (the inhibition zone increased from 28.5 mm to 32.6 mm). For aPDI (FL) treatment, synergy was indicated only for DOX based on a reduction in the MIC value for the E-test from 32 to 16 \u03bcg/mL. Differences resulting from the obtained results indicate the necessity of applying multiple approaches for synergy testing; thus, one method is not sufficient to confirm the research assumptions. In addition, as light alone treatment (with no PS administration) as well as PS alone (with no light excitation) exerted no change in microbial antibiotic susceptibility, these control conditions were not included within the The results indicated that in the case of both phototreatments, the employment of sublethal aPDI conditions influenced the susceptibility to numerous routinely used antimicrobials, resulting in larger growth inhibition zones (in the case of the disk diffusion assay) and decreased MICs (for the E-test). The results regarding synergy testing with diffusion methods are presented in E. faecalis. aPDI (FL) indicated synergy only with IMP (FICI = 0.25). For E. faecium, it was observed that aPDI (RB) has an antagonistic effect when combined with VAN/DAP. The FICI value was 8.5 and 5.25 for VAN and DAP, respectively, whereas for combined treatment with CIP and GEN, it was estimated to be 0.5, indicating synergy with aPDI (RB). A similar conclusion for E. faecium could also be drawn for aPDI (FL) combined with LZD. All results from the checkerboard assay are presented in The checkerboard assay method indicated that aPDI (RB) has a synergistic effect with GEN, CIP, and DAP. This conclusion was based on the FICI, the value of which was estimated as 0.38, 0.38, and 0.16 for GEN, CIP, and DAP, respectively, for E. faecium and E. faecalis, a synergistic effect was observed for all of the tested antibiotics (with the exception of AMP and Q-D) when combined with aPDI (FL). A characteristic \u201cshift\u201d of the growth curve was detected both for FL and RB aPDI and most of antibiotics; however, only four representatives were used for visualization, i.e., aPDI (FL)/GEN , represented another method to investigate the synergy or other interactions between aPDI (RB)/aPDI (FL) and antibiotics. For both (FL)/GEN A, aPDI ((FL)/GEN B, aPDI ((FL)/GEN C and aPD(FL)/GEN D. In addE. faecium, the prevalence of synergy was indicated for GEN with aPDI (RB) and for DOX combined with aPDI (FL) . E. faec methods .2. Increased concentrations of all compounds are associated with a higher resistance of biofilm cultures to the treatment conditions. aPDI of E. faecalis biofilm culture with RB reduced the bacterial viability by 3.1 log10 CFU/cm2, and when combined with 3\u00d7 MIC of STR, the reduction increased to 4.4 log10 CFU/cm2. The addition of 5\u00d7 MIC of CIP with a PS reduced the viable cell count by 2.9 log10 CFU/cm2 images of stained biofilm cells before and after mono- and combined aPDI therapy. The images of coupons than that in the planktonic culture, whereas STR and CIP were applied at concentrations of 3\u00d7 MIC and 5\u00d7 MIC, respectively. Coupons with biofilms were irradiated twice from each side with a dose of green light of 7.95 J/cm CFU/cm2 . The res coupons A\u2013D with coupons B or STR coupons C led to 2 determination and confocal microscopy analysis. We were able to observe the bactericidal effect (approx. 4 log10 CFU/cm2 viability reduction) of the aPDI (RB) and STR combination on biofilm cells.This is the first report of a resensitization of cells growing as a mature biofilm to antibiotic treatment upon photoinactivation. These important results were confirmed by CFU/cmp-Aminophenyl) fluorescein (APF), is associated with different fluorescence responses of these compounds to ROS. Specific ROS lead to different levels of fluorescence for each probe. From the literature data, it is well known that many antibiotics can exert their bactericidal activity due to stimulation of ROS formation [E. faecalis eradication. Another fluorescent probe that was used in the experiment is also strictly associated with the production of various ROS. APF was tested with the same antimicrobials as described above under the same experimental conditions. The results of this experiment did not confirm any increased ROS production upon treatment with aPDI (RB) and GEN, CIP, or TGC (data not shown). For the detection of singlet oxygen, a SOSG probe was used to test the synergy between TGC or CIP and aPDI and 3\u2032-(ormation . To inveand aPDI B. This eTo investigate whether aPDI (RB) can lead to permeabilization of the bacterial membrane, SYTOX Green was used. Increased permeabilization could result in more efficient antibiotic penetration into bacterial cells, leading to increased damage and cell death, thus explaining the phenomenon of synergy. For this purpose, SYTOX Green was used as a high-affinity nucleic acid compound that can interact with intracellular DNA . The leaE. faecium, Streptococcus mutans, Porphyromonas ginvigalis, and Lactobacillus gasserii\u2014leading to the development of intraoral diseases. It is worth mentioning here that E. faecalis is commonly detected in persistent infections after failed endodontic treatments, and E. faecium is mainly associated with infections caused by the use of indwelling medical devices, e.g., central venous and urinary catheters [Disturbance of oral human microflora can rapidly influence the growth and spread of nosocomial pathogens\u2014e.g., atheters ,16. Befoatheters ,18.Enterococcus spp. strains resistant to VAN appeared in the literature in 2013 [Galleria mellonella with E. faecium. The application of VAN with light and methylene blue (MB) increased the survival rate of infected caterpillars in comparison to treatment with only aPDI or VAN alone. Another example of successful application of aPDI against this microorganism was described by Kang et al. in 2019. Light treatment of E. faecium planktonic culture in the presence of curcumin and protoporphyrin IX significantly reduced bacterial growth [The first case of the significant potential of aPDI in sensitizing in 2013 . This stl growth .Enterococcus, E. faecalis, was also eradicated by phototreatment of the biofilm cultures. For example, it was proven that aPDI can simultaneously affect biofilms via damage to bacterial cells and the extracellular matrix. Photoinactivation with MB was reported to reduce the E. faecalis biofilm surface by 89% in comparison to the samples incubated only with the PS. In multispecies biofilms , aPDI with MB reduced the biofilm-covered area by 59.3% [E. faecalis in the root canal was shown to be possible with the application of MB with red light (660 nm) [10 CFU/mL. The same effect was observed when biofilm cells were treated with RB aPDI. Moreover, Shrestha et al. described the efficacy of RB-conjugated chitosan, used as a PS, which led to eradication of planktonic culture of E. faecalis and reduced the bacterial viability count in biofilms by approx. 3 log10 CFU/cm2 [The second representative of the genus by 59.3% . Moreove(660 nm) . The pot CFU/cm2 . These eEnterococcus spp. show greater sensitivity to RB than to FL. This finding may be related to the mechanism of action of both PSs. In the case of FL, it has been described that apart from the production of singlet oxygen in polar solvents, an important mode of action of this PS is the permeabilization of cell membranes. Research conducted by our team has shown that FL accumulates mainly in cell sheaths [E. faecalis was demonstrated by flow cytometry [Enterococcus spp. The results of our experiments highlight the effectiveness of aPDI with RB or FL against two multidrug-resistant (MDR) isolates: E. faecalis and E. faecium. A high level of resistance was observed against antibiotics such as STR, DAP, and AMP, which was reduced after aPDI treatment, especially in the case of E. faecalis. Synergy testing between aPDI and antimicrobials was performed with multiple methods regarding the data presented in our published review paper [E. faecalis isolate was reduced after application of aPDI (RB and FL) (the inhibition zone increased by 2.9 mm). Additionally, after application of STR with the aPDI (RB and FL) combination, a delay in bacterial growth was detected. The checkerboard assay is an excellent method to investigate the combinations of two factors; however, this method revealed synergy or even antagonism between aPDI and antimicrobials for only a few combinations. GEN and CIP exhibited synergistic effects with aPDI (RB) when applied against both Enterococcus species. Individual synergy in the case of E. faecium occurred for antibiotics DAP, IPM, or LZD with aPDI (RB and FL), and antagonism was revealed for DAP and VAN when combined with aPDI with FL. Moreover, the PAE results revealed that bacterial growth can be significantly disturbed after combined treatment application in comparison to monotherapies. For most of the combinations, the PAE was positive or partially positive. It is also worth mentioning that for each photoinactivation treatment, regarding the presence of RB and FL, MICs were determined for both strains and PSs. The concentrations or treatment doses presented in E. faecalis isolate to STR, resensitization and synergy with aPDI (RB) were confirmed for planktonic culture and biofilm cells. The combined treatment successfully reduced the bacterial load for biofilm culture from 7.1 to 2.7 CFU/cm2. One could ask whether the sequence of treatments, i.e., starting with aPDI or antimicrobials, may affect the results. The sequence treatment studied within the current work included the application of aPDI as a first step of experimental procedure, nevertheless, the alternative sequence has also been studied (data not shown). The performed analysis revealed that similar synergies could be demonstrated regardless the sequence used. Obviously, when studying tetracyclines, that could also serve as standard PSs and be excited with appropriate wavelength irradiation, one could assume that starting with antibiotic application followed with light treatment should enhance the bactericidal outcome, nevertheless, using our experimental conditions, the expected increase in killing efficacy was not observed (data now shown). To investigate the mechanism of the obtained synergy, multiple fluorescent probes were used to detect the potentially increased production of singlet oxygen or other ROS. DCF revealed increased radical production in combination with aPDI (RB) and GEN, but the fluorescence level was quite low when compared with that of the APF probe. The second indicator (APF) confirmed a high fluorescence level for all tested antimicrobials when combined with aPDI (RB); however, this level was slightly lower than that for the monotherapy (aPDI RB); thus, the APF results did not confirm the increased production of ROS in the combined treatment. SOSG, which is suited to the detection of singlet oxygen, confirmed increased production of this radical when aPDI (RB) was combined with CIP. The last experiment trying to explain the occurrence of synergy employed the intracellular DNA probe SYTOX Green. This compound efficiently binds to nucleic acids after they leak out of cells through the permeabilized membrane. aPDI treatment leads to increased permeabilization of the cells which may be the most important reason of observed synergy. The increased membrane permeabilization may result in increased antibiotic uptake and lead to enhanced killing efficacy.In the current study, the differences in the response of both isolates to various PSs were demonstrated. sheaths . Howeverytometry , which mew paper . The resDespite demonstrating that aPDI leads to significant membrane permeabilization which could partially explain the observed synergy, the mechanism of synergistic effect remains poorly understood. Resensitization of microbes to a particular antibiotics after exposure to sub-lethal aPDI could primarily result from the following reasons: (i) aPDI inactivation of the microbial agents responsible for drug resistance mechanisms; (ii) aPDI caused increased cell envelopes permeabilization leading to increased diffusion of antibiotic into the microbial cell; (iii) aPDI mediated disruption of membrane components leading to the change in membrane potential which may further affect PS uptake or its binding to cell envelope; and (iv) increased ROS production resulting from antimicrobial ROS generation.Enterococcus spp. display a variety of enzymes and proteins being key factors of drug resistance mechanisms, i.e., acetyl-, phospho-, and adenyltransferases, transpeptidases, or proteins building efflux pumps [aPDI leads to inactivation of multiple cellular components, i.e., proteins, lipids or genetic material, thus, it exerts deleterious effects against numerous virulence factors and enzymes responsible for antimicrobial resistance mechanisms. ux pumps ,28,29,30ux pumps . In addiux pumps ,32,33; tThe most intriguing aspect of the observed synergy is providing explanation why the synergy could be demonstrated only for few antibiotics and what factors determine that specific antimicrobials may exert its increased efficacy upon sub-lethal aPDI treatment. Nevertheless, this explanation is still being undiscovered and worthy further investigations. We have made an effort to identify some chemical features of tested antimicrobials regarding its molecular weight, polar surface area, formal and physiological charge, complexity, water solubility, pKa, or mechanism of action that could potentially group studied antibiotics according their synergistic cooperation with aPDI; however, none of tested feature was demonstrated to be corelated with the observed synergy.The results of the synergy testing experiments confirm the effectiveness of aPDI in sensitizing bacteria to antibiotics. This modality holds great potential for treating infections caused by multidrug-resistant strains that are mainly acquired in hospitals. A great advantage of aPDI is the nonspecific mechanism of action allowing comprehensive cell destruction. This approach prevents bacteria from developing resistance against this type of treatment, representing a significant advantage of aPDI treatment despite the risk of increased tolerance development, as presented by our team in two recently published articles ,35. HoweE. faecium EU87 and E. faecalis EU92. Strains were kindly provided with dr Valentina Ebani . Tryptic Soy Broth with 1.5% agar plates were used for colony forming unit (CFU) enumeration and tryptic soy broth (TSB) was used for overnight planktonic cultures and batch and flow phase of biofilm culture.In this study there were two clinical isolates used: 2O) and kept in the dark at 4 \u00b0C. Fullerenopyrrolidine was purchased from ProChimia . A stock solution of the compound was prepared in dimethylsulfoxide (DMSO)/ddH2O solution and kept in the dark at 4 \u00b0C.4,5,6,7-Tetrachloro-2\u2032,4\u2032,5\u2032,7\u2032-tetraiodofluorescein disodium salt (RB) powder was purchased from Sigma Aldrich . The stock solution was prepared in double-distilled water (ddHGentamycin (GEN), doxycycline (DOX), streptomycin (STR), ciprofloxacin (CIP), imipenem (IPM), vancomycin (VAN), and ampicillin (AMP) were purchased from Sigma Aldrich. Daptomycin (DAP), linezolid (LZD), and tigecycline (TGC) were purchased from Cayman Chemicals . Stock solutions at concentrations of 10 mg/mL were prepared in the recommended solvent and stored at \u221220 \u00b0C.max 522 nm light with a radiosity of 10.6 mW/cm2 34 nm) .The custom constructed LED-based light source was used: emitting \u03bbE. faecium and E. faecalis were adjusted to 0.5 McFarland (McF) units in phosphate-buffered saline (PBS) , which corresponds to a cell density of approx. 107 CFU/mL. Working solutions of RB were prepared in ddH2O or in the case of FL in a mixture of distilled water:DMSO (9:1 v/v). The bacterial suspension and PS solution were mixed and incubated in the dark at room temperature (RT) for 15 min. Then, the samples with PSs (100 \u03bcL) were illuminated. Afterwards, the samples were serially diluted in PBS and transferred onto tryptic soy agar (TSA) plates. After 18\u201320 h of incubation at 37 \u00b0C, colonies were counted, and the CFU/mL values were determined. Samples with RB and FL were illuminated with 522 nm light.Overnight culture (1 colony transferred into 5 mL of tryptic soy broth (TSB) and incubated for 18 h at 37 \u00b0C with shaking at 150 rpm) of 10 CFU/mL) were calculated based on the survival rate of bacteria treated with aPDI in comparison to untreated bacteria. The lethal dose was determined as a \u2265 3 log10 CFU/mL reduction in viability.Bacterial overnight cultures were suspended to obtain an optical density of 0.5 McF. Next, probes for the green light were mixed with PS solutions in 96-well plates and incubated for 15 min in the dark. Bacteria were irradiated with various light doses and then serially diluted, streaked on TSA plates and incubated at 37 \u00b0C for 16 h. After 16 h, colonies were counted, and the CFU/mL values were estimated. In addition, two control samples were prepared: 1, with no PS and with light to check bacterial growth; and 2, with PS and incubation in the dark to check the possible toxicity of PS. Sublethal doses and then diluted 10-fold. The experiment was not performed in Mueller-Hinton medium (MHE) due to the very weak growth of Overnight cultures of both strains were adjusted to 0.5 McF in BHI and then diluted 10-fold. Next, probes were administered with antibiotics to reach the tested range of concentrations (from 1024 to 0.03125 \u03bcg/mL) in 96-well plates. Afterwards, the plates were incubated at 37 \u00b0C for 16\u201320 h. Bacterial growth was assessed optically in microtiter wells. The experiment was conducted in three independent replicates.Overnight cultures were diluted in PBS to obtain 0.5 McF. For the light-treated probes, sublethal doses of PSs were added. Next, the probes were incubated in the dark for 15 min and then exposed to sublethal doses of light. The next steps were the same for the treated and untreated probes. Then, 15 min after preparing the 0.5 McF suspension for untreated probes or immediately after light exposure for treated probes, the suspensions were streaked on MH agar plates . After another 15 min, E-tests and disks with the tested antibiotics were placed on the plates. After 15 min of incubation at RT, the plates were placed in an incubator for 16\u201320 h at 37 \u00b0C. For antibiotics in disks, a synergistic effect was identified when the difference between the untreated and treated inhibition zones was greater than or equal to 2 mm. In the case of E-tests, synergy was confirmed if the minimum inhibitory concentration (MIC) of the treated probe was at least 2-fold lower than of the untreated probes (control).A + FICB). FICA/B = MIC of factor A/B in combination/MIC of factor A/B alone. Synergistic effects were observed when FICI \u2264 0.5, and antagonism was observed when FICI > 4; 4 < FICI > 0.5 means no interaction.Overnight cultures of both strains were diluted to obtain 0.5 McF in BHI and then diluted 10-fold. Bacterial suspensions were placed in 96-well plates combined with different concentrations of antibiotics: 2 MIC, MIC, 1/2 MIC, 1/4 MIC, 1/8 MIC, 1/16 MIC, 1/32 MIC, and 0 MIC. Next, the wells in columns were diluted 2-fold with PS to obtain final PS concentrations with MICs as follows: MIC, 1/2 MIC, 1/4 MIC, 1/8 MIC, 1/16 MIC, 1/32, 1/64 MIC, 1/128 MIC, 1/256 MIC, 1/512 MIC, and 0 MIC. All cells were incubated in the dark for 15 min and then exposed to irradiation at MIC doses. Next, the plates were incubated for 16\u201320 h at 37 \u00b0C. Bacterial growth was assessed, and the fractional inhibitory concentration index (FICI) coefficient was calculated . PAE \u2265 3 h indicates a synergistic effect, and 1.5 h \u2264 PAE < 3 h indicates partial synergy.Overnight cultures of both strains were diluted in BHI (1:20). A few combinations of agents were prepared: A, 1/2 MIC aPDI; B, MIC of antibiotic; C, 1/2 MIC of antibiotic; D, MIC of antibiotic + 1/2 MIC aPDI; and E, 1/2 MIC of antibiotic + 1/2 MIC aPDI. All probes were incubated in the dark for 2 h in an orbital incubator at 150 rpm. Next, the agents were removed by two washing steps, and bacteria were finally suspended in fresh BHI. Probes A, D, and E were exposed to irradiation in 1/2 MIC aPDI. Control samples were not exposed to any agents. Next, all samples were transferred to 96-well plates and placed in an EnVision multilabel plate reader for 16 h, which monitored the optical density (\u03bb 600 nm) of cultures every 0.5 h. All data were normalized, and the postantibiotic effect (PAE) was calculated on the basis of the formula PAE = T \u2013 C purchased from Thermo Fisher Scientific , was prepared according to the manufacturer\u2019s guidelines. Bacteria were mixed with PS and antibiotics (MIC) in different combinations and transferred to black sterile 96-well plates. To 100 \u03bcL of total volume, 1 \u03bcL of SOSG solution was added to estimate the final concentration of 5 \u03bcM. Then, the probes with PS were incubated for 15 min in the dark and exposed to light at MIC and 1/2 MIC doses. Next, fluorescence was measured using an EnVision plate reader at excitation/emission wavelengths of 488/525 nm. The experiment was performed in three independent replicates.An experiment was conducted for p-Aminophenyl) fluorescein (APF) is a specific probe for hydroxyl radicals (\u2022OH) and 2\u2032,7\u2032-dichlorodihydrofluorescein diacetate (DCF) is specific also for (\u2022OH), but also for other oxygen radicals. Experiments were conducted for E. faecalis and RB with TGC, GEN, or CIP. Overnight cultures were diluted in PBS to 0.5 McF. Bacteria were mixed with PS and antibiotics (MIC) in different combinations and transferred to black and sterile 96-well plates. To 100 \u03bcL of full volume, 1 \u03bcL APF solution or 5 \u03bcL of DCF solution was added. Then, probes with PS were incubated for 15 min in the dark and exposed to light at MIC and 1/2 MIC doses. Next, fluorescence was measured using an EnVision plate reader at excitation/emission wavelengths of 490/515 nm for APF and 492\u2013495/517\u2013527 nm for DCF. The experiment was performed in three independent replicates.3\u2032- and transferred to 96-well plates. To 100 \u03bcL of full volume, 1 \u03bcL of SYTOX Green solution was added. Then, the probes with PS were incubated for 15 min in the dark and exposed to light at MIC and 1/2 MIC doses. Next, fluorescence was measured using an EnVision plate reader at excitation/emission wavelengths of 488/523 nm. The experiment was performed in three independent replicates.SYTOX Green has high affinity for DNA released from cells with permeabilized membranes. An experiment was conducted for the E. faecalis. The reactor was placed onto a magnetic stirrer with a heater set at 80 rpm and 37 \u00b0C for 24 h, referring to a batch phase. Before starting the flow phase, 1 L of 20\u00d7 concentrated sterile TSB was added to a 20 L carboy containing 19 L of distilled water autoclaved for 2 h at 14.7 psi. The final concentration of broth was 30 g/L TSB with 10 g/L glucose. The carboy was connected to the reactor by silicone tubing and connected to a peristaltic pump . The flow rate was set to 12.9 mL/min, and the reactor volume was 335 mL, which resulted in a residence time of 26 min, consistent with the E. faecalis generation time. The time of the flow phase was 24 h.For biofilm culture, a CDC biofilm reactor , presented in 2 values of the coupon were calculated. The experiment was conducted in three replicates.Coupons with biofilm layers were incubated with RB (5 \u03bcM) and STR or CIP in PBS for 15 min and then exposed to aPDI. The coupons were irradiated for 12.5 min, turned around and irradiated again. Four control groups without irradiation were prepared: (1) with no factor; (2) only with RB in the dark; (3) with CIP; and (4) with STR. After treatment, the coupons were placed in Falcon tubes with 10 mL of PBS. Then, biofilm layers were dispersed by sonication with 40% amplitude. Each probe was sonicated for 1 min, vortexed for 1 min and incubated on ice for 1 min. The procedure was repeated three times. After this procedure, the samples were vortexed again, and 100 \u03bcL of each sample was serially diluted in PBS, streaked on TSA plates and then incubated at 37 \u00b0C for 16 h. The CFU/cmBiofilm growth on coupons was also visualized using confocal microscopy. Visualization of biofilms was performed with a BacLight Live/Dead viability kit. Coupons without or after aPDI/antibiotic treatment were transferred to a 12-well glass-bottom plate and incubated in the presence of SYTO 9 and propidium iodide (PI) dissolved in PBS for 15 min in the dark at RT, according to the protocol described previously . Specime"} +{"text": "Postnatal mental health problems affect 10\u201315% of women and can adversely impact on mother-infant interactions and bonding, the mother\u2019s mood, and feelings of competence. There is evidence that attending performing arts activities, such as singing, dancing, and listening to music, may improve maternal mental health with potential for an effect on postnatal depression.A systematic review will be conducted to assess the effect of mother-infant group music classes on postnatal depression compared to standard care, no control or wait list control. Studies will be included that report on postnatal depression. Further outcomes of interest include anxiety, stress, parenting competence, confidence and self-efficacy, perceived social support and mother-infant bonding. Infant and child outcomes measuring cognitive development, behaviour and social and emotional development will be included.Search databases to be used will be Medline, EMBASE, CINAHL, PsycINFO, Scopus, CENTRAL, Web of Science, Maternity and Infant Care and discipline-specific journals for music.The Cochrane\u2019s Template for Intervention description and replication (TIDieR) checklist and guide will be utilised to aid a detailed description, standardised assessment and quality assurance. Risk of bias will be assessed by the authors using the Cochrane Handbook for Systematic Reviews of Interventions risk of bias tool.If sufficient studies are available, meta-analyses will be conducted to combine, compare and summarise the results of the studies for more precise estimates of effects. Where meta-analysis is not possible, results for each individual study will be reported through qualitative narrative data synthesis.This systematic review will identify and synthesise evidence of the measured effect of postnatal mother-infant interventions involving music on maternal psychological and psychosocial outcomes and infant/child outcomes.https://www.crd.york.ac.uk/prospero/display_record.php?ID=CRD42021283691.This protocol was registered with Prospero on 18 October 2021 (registration number CRD42021283691). Postnatal mental health problems, occurring after the birth of the baby, affect between 10\u201315 in every 100 women . The posMental illness is also associated with several types of health inequalities between people with different demographic, socioeconomic and geographical factors with these groups of postnatal mothers more likely to be vulnerable to postnatal depression . These iPostnatal mental health problems can often go unidentified, undiagnosed, and untreated for many women or they do not meet the eligibility threshold for specialist mental health services after the birth of their baby . Women rStudies investigating the effect of poor postnatal mental health have found an adverse impact on attachment and bondThe arts are fluid and diverse and have traditionally been difficult conceptually to define. It has been proposed that the arts comprise of five categories; performing arts; visual arts, design and craft; literature; culture; and online, digital, and electronic arts, all of which combine active and receptive engagement and flexibility for development . Arts acMusic falls under the category of performing arts . ReporteThe term \u2018music\u2019 is used within the literature to refer to a wide spectrum of activities ranging from listening to music which could be intentional or receptive on an individual basis, music listening that is shared with others, playing music using an instrument, composition of music, singing and musical movement such as dance . TherefoResearch suggests the cause of postnatal depression has a multifactorial aetiology with biological and psychosocial risk factors . The bioA significant established psychosocial risk factor of postnatal depression is low, or lack of, social support . A key iThe purpose of reviewing the effect of mother-infant group music classes on postnatal depression through a systematic process, is to evidence the measured effect on maternal and infant outcomes. Following searches of Prospero and the Cochrane library for completed or ongoing reviews, no systematic review addressing the effect of mother-infant group music classes on postnatal depression were found and we therefore seek to bring evidence together within this systematic review to inform practice and future research within postnatal mental health. The added benefit of including qualitative studies in the review is to have the opportunity to consider existing research that has explored women\u2019s perceptions, experiences, and perspectives of attending group music classes with their infant, which will allow further understanding of their feasibility and acceptability.Systematically search and review research evidence that assesses the effect of mother-infant group music classes on postnatal depression for women \u2264 12 months post-partum with an infant aged \u2264 12 months (at enrolment), compared to women who have received standard care, a comparative intervention, no care or included a wait list controlReview process evaluations and qualitative studies conducted alongside studies eligible for inclusionInterpret findings to inform future research and practiceThis systematic review protocol has been developed according to the preferred Reporting Items for Systematic Reviews and Meta-Analyses Protocols (PRISMA-P) . A PICOSWe will include studies that recruited women \u2264 12 months post-partum with an infant aged \u2264 12 months at enrolment. We will also include women who were enrolled in the antenatal period, but the intervention phase commenced in the postnatal period. We will include studies whether or not study eligibility criteria required women to be screened and meet a given threshold for outcomes of interest on recruitment, such as postnatal depression or anxiety.We will focus on studies that consist of a mother-infant group intervention lasting between 6\u201312 weeks in duration, that comprises of an intervention including music only or in a multi component format where a significant proportion of the intervention includes music.Comparators will include groups of women who have received standard care, a comparative intervention, no care or included a wait list control.Postnatal depressionWe will include any outcome measure for postnatal depression, including but not limited to clinically validated assessment tools, such as the such as the Diagnostic and Statistical Manual of Mental Disorders, fifth edition (DSM-5), and self-reported measurement tools.Maternal outcomes:Maternal stress/anxietyParenting stressParenting competence, confidence, or self-efficacyPerceived social supportMaternal-infant interaction/bondingInfant/child outcomes:Cognitive developmentBehaviourSocial and emotional developmentRecruitment rateAdherence and participation ratesAttrition and retention rates and reasons for dropoutMothers\u2019 satisfaction with the interventionWomen >12 months postpartum with an infant >12 months at enrolmentInterventions that contain only one song, one episode of music listening or one episode of music making as it will not represent the majority of the intervention formatStudies without a control groupStudies will be included that use standardised measurement tools that provide continuous or dichotomous outcome data for all maternal and infant/child outcome measures.The timing of the first outcome assessment must be < 3 months post-intervention. There will be no limit on the timing of the final follow up to allow longer follow up durations to be included in the review. However, for the purposes of the meta-analysis, we will extract outcome data at, or nearest to, the following time points: immediately post-intervention, at 3, 6, 12, 18 and 24 months post-intervention.We will include randomised controlled trials (RCTs) and non-randomised controlled trials. The Canada\u2019s Drug and Health Technology Agency (CADTH) search filter will be utilised which is sensitive to searching for non-randomised controlled trials, as well as RCTs.Process evaluations and qualitative studies conducted alongside studies eligible for inclusion will also be reviewed to provide useful insight on the feasibility and acceptability of the intervention and study in terms of recruitment, adherence, attrition, retention, and satisfaction with the intervention. For example, the timing and setting of the intervention in included studies; level of adherence to the intervention by those randomly assigned to the experimental group and reasons for adherence/non-adherence.Due to its multi-disciplinary nature, one of the many challenges within arts in health research is the many fields in which it is spread; arts, public health, medicine, wellbeing, and psychology . TherefoMedical subject headings (MeSH) were used to develop the list of search terms supplemented with text word terms to capture as wide a range of records as possible. Search terms include\u2014Women, Mothers, Infant, Mother-infant, Postpartum period, Postnatal care, Music, Music therapy, Dancing, Randomized Controlled Trials, Random Allocation, Systematic review. An example of search terms and syntax used for MEDLINE . DatabasWe will use the Covidence online software platform for importing eligible studies, removing duplicates, screening titles and abstracts, and for full text review. Following removal of duplicates, two authors (CC and FL) will independently screen titles and abstracts for 10% of records and assess level of agreement. This process will continue in increments of 5% until at least 80% agreement is reached, after which the lead reviewer (CC) will continue to screen the remaining titles and abstracts. At full text stage, each record will be independently screened by two authors. Any disagreements will be resolved by discussion and consensus of the review team. To ensure the transparent reporting of identified studies, we will include a PRISMA flow chart in the systematic review, which will illustrate the article selection process . This flA standardised data extraction form will be agreed prior to commencement to ensure data extraction is consistent. Data from multiple reports from the same study will be extracted using a single data extraction form. Data extraction for each study will be conducted independently by two authors (CC and FL/JM) using Covidence software. Extracted data will include the title, authors, year of publication, location of study, population , intervention type and dosage, control group type and dosage, outcomes , type of analysis, results, recruitment rates, adherence rates, attrition/retention rates, and reasons if given. Outcome data will be exported to Review Manager 5 software for analysis. Any unreported outcome data will not be requested from the study investigators due to the time constraints of the primary author\u2019s PhD studies.To comprehensively describe each intervention analysed within the systematic review, the Cochrane\u2019s Template for Intervention Description and Replication (TIDieR) checklist and guide will be Risk of bias will be independently assessed by two authors using the Cochrane Handbook for Systematic Reviews of Interventions Risk of Bias tool for randFor continuous data, the mean and standard deviation (SD) for each group and group size will be extracted and mean differences calculated. For dichotomous data, the number with each event and sample size will be extracted and odds ratios calculated.If sufficient studies of similar interventions are available, we will use meta-analysis to combine, compare and summarise the results of the studies so more precise estimates of the effects can be made in terms of the population, intervention, comparator, and outcomes. We will prioritise RCT data for the meta-analysis. If non-randomised controlled trials are identified, they will be synthesised separately through a narrative summary. The studies used must compare the same type of intervention and measure the same outcomes. When outcomes are measured on the same scale, the mean difference (MD) will be calculated and if studies use different scales to measure the same outcome, we will calculate the standardised mean difference (SMD) and corresponding 95% CI for continuous outcomes. In addition to this, differences between duration of intervention, type of setting, group size, and type of facilitator between studies will be assessed via subgroup analysis to establish what has yielded the most significant retention and satisfaction outcomes.Where meta-analysis is not possible, results will be reported through qualitative narrative data synthesis following the principles of thematic analysis . Papers 2 statistic, which represents the percentage of effect estimate variability that is due to heterogeneity instead of sampling error Reviewers' comments:Reviewer's Responses to Questions Comments to the Author1. Does the manuscript provide a valid rationale for the proposed study, with clearly identified and justified research questions? The research question outlined is expected to address a valid academic problem or topic and contribute to the base of knowledge in the field.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 2. Is the protocol technically sound and planned in a manner that will lead to a meaningful outcome and allow testing the stated hypotheses? The manuscript should describe the methods in sufficient detail to prevent undisclosed flexibility in the experimental procedure or analysis pipeline, including sufficient outcome-neutral conditions to test the proposed hypotheses and a statistical power analysis where applicable. As there may be aspects of the methodology and analysis which can only be refined once the work is undertaken, authors should outline potential assumptions and explicitly describe what aspects of the proposed analyses, if any, are exploratory.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 3. Is the methodology feasible and described in sufficient detail to allow the work to be replicable? Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 4. Have the authors described where all data underlying the findings will be made available when the study is complete?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception, at the time of publication. The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above and, if applicable, provide comments about issues authors must address before this protocol can be accepted for publication. You may also include additional comments for the author, including concerns about research or publication ethics.You may also provide optional suggestions and comments to authors that they might find helpful in planning their study. Reviewer #1:\u00a0Review: The effect of mother-infant group music classes on postnatal depression \u2013 a systematic review protocolAltogether, I think this is an interesting research proposal with direct impact on clinical and societal practice. The authors propose a thorough systematic review that follows all relevant guidelines, and I believe that it is a well thought-out setup. I also appreciate the intersectional approach of the proposed analysis, where the authors propose to also look at mothers who are socially disadvantaged.However, I do think there are some concerns that the authors should address in their study. These are mainly concerned with the inclusion criteria regarding postpartum depression and the risk of selection bias and drop-outs in the studies that are included in the review, which could skew the overall results. I believe that taking these factors into account could improve the quality and generalizability of this study.- One of the main outcomes of the study is postnatal depression. Could the authors maybe specify which kind of outcomes they will include? Will they only include studies that conducted clinical interviews or clinically validated questionnaires, or will they also include studies that used other questions to measure postpartum depression?- I see that the inclusion criteria also do not contain a \u201cthreshold\u201d or criterium for postpartum depression. Do the authors propose to include all studies that look at effects of music classes on postnatal depression, even when the studies only included women without postpartum depression? Or do they plan to only include studies which included women with postpartum depression, and if so, what are the diagnosis criteria?o A short note on the reporting of the participant demographics:I think it is also important to report participants\u2019 level of postpartum depression before the onset of the study, so that it is clear to which postpartum depression group the results can be generalized.- I see that the authors propose to include all studies on group music classes, regardless of the setting in which the class is organized. This might induce a possible \u201cinterest bias\u201d, where mothers who are actively seeking out music classes are more likely to participate and benefit from the classes. Do the authors plan on addressing a form of \u201cinterest bias\u201d, meaning women who are more interested in the classes might join the classes?o This form of interest bias could be accounted for through only including studies which have a control group or \u201cregular care\u201d group as comparison group, but the authors propose to also include studies that have no control group. Do they plan on conducting separate meta-analyses or comparisons for studies with or without a control group?- My other concern in the included studies is the amount of time and effort it will take the participating mothers to participate in the music classes. These classes could take quite some time, maybe during the day on work days, meaning that maybe mothers with more time on their hands and mothers who feel more motivated and \u201cup for it\u201d might be more likely to complete the study. This could introduce a form of selective drop-out bias, where mothers who have less time or energy might be more likely to drop out.o How do the authors plan on addressing drop-out participants per study, and the possible bias this introduces in the results?- Motherhood and maternity leave are also very dependent on national contexts. The authors do propose to do a subgroup analysis for studies which include socially disadvantaged mothers, but do they plan on accounting for or reporting other international differences, such as national policies on maternity leave or the amount of involvement of the other parent?o It could be interesting to report the setting in which participating mothers are in, for example, do the music classes take place in the evenings or during maternity leave so that they do not have to take time off work?Altogether, I appreciate the rather practical approach of the proposed review. I believe that this study could be an interesting starting point to consider the feasibility of music classes for women with postpartum depression, especially considering the possible improvement of social support and maternal-infant bonding for participating women. I wish the researchers the best of luck with this interesting line of research!Reviewer #2:\u00a0I thank the Editor and authors for the opportunity to review a manuscript. The paper has overall a very good technical content and it\u2019s easily readable. I congratulate the authors on a very interesting proposal of a systematic review with a meta-analysis. I also believe the importance of this review paper. I offer the following minor comments.1. The authors provided information for the review in the context of what is already known. However, they wrote that \u201care not aware of any systematic reviews specifically addressing the effect of mother-infant group music classes on postnatal depression\u201d. It was not clearly stated in the manuscript that a search of resources for existing or ongoing reviews was taken. I recommend to add information what kind of resources/databases have been checked to ensure the current review is justified.2. I would recommend to consider the piloting the study selection process by applying the inclusion criteria to a sample of papers in order to check that they can be reliably interpreted and that they classify the studies appropriately.3. Please state how extracting data from multiple reports of the same study will be done 4. Please expand all abbreviations used in the manuscript. eg, EPDS, GAD 7, PHQ-9 was not explained while WHO abbreviation was introduced two times.5. I found that a searching strategy is dedicated to RCTs, and since the authors plan to include non-randomized studies as well, it might be wise to not add keywords as \u201cRandomized Controlled Trials\u201d or \u201cRandom Allocation\u201d.6. At the same time, I would be pleased if the authors could consider to restrict the eligibility criteria to RCTs only for the reliability of the data. And if so, my previous comment (no 5) would be not relevant then.********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1:\u00a0NoYes:\u00a0\u0141ucja BieleninikReviewer #2:\u00a0https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0AttachmentPeer review PLOS one _complete.docxSubmitted filename: Click here for additional data file. 1 Jul 2022Please see attached document 'Response to Reviewers' for all required actions.AttachmentResponse to Reviewers .docxSubmitted filename: Click here for additional data file. 12 Aug 2022The effect of mother-infant group music classes on postnatal depression \u2013 a systematic review protocolPONE-D-21-35789R1Dear Dr. Colella,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Jianhong ZhouStaff EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to Questions Comments to the Author1. Does the manuscript provide a valid rationale for the proposed study, with clearly identified and justified research questions? The research question outlined is expected to address a valid academic problem or topic and contribute to the base of knowledge in the field.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 2. Is the protocol technically sound and planned in a manner that will lead to a meaningful outcome and allow testing the stated hypotheses? The manuscript should describe the methods in sufficient detail to prevent undisclosed flexibility in the experimental procedure or analysis pipeline, including sufficient outcome-neutral conditions to test the proposed hypotheses and a statistical power analysis where applicable. As there may be aspects of the methodology and analysis which can only be refined once the work is undertaken, authors should outline potential assumptions and explicitly describe what aspects of the proposed analyses, if any, are exploratory.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 3. Is the methodology feasible and described in sufficient detail to allow the work to be replicable? Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 4. Have the authors described where all data underlying the findings will be made available when the study is complete?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception, at the time of publication. The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. The Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** 6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above and, if applicable, provide comments about issues authors must address before this protocol can be accepted for publication. You may also include additional comments for the author, including concerns about research or publication ethics.You may also provide optional suggestions and comments to authors that they might find helpful in planning their study. Reviewer #1:\u00a0I think the authors provided very well-thought out and thorough answers to the reviewer comments, and their clarifications have improved the proposal strongly. I wish them the best of luck conducting this interesting review!Reviewer #2:\u00a0Dear authors,thank you for your careful revision of your manuscript. It was a pleasure to read this revised manuscript, and I appreciate the author\u2019s consideration of my previous feedback. This manuscript is stronger since the initial submission. All comments have been addressed satisfactorily.Best regards!********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1:\u00a0NoReviewer #2:\u00a0No********** 23 Aug 2022PONE-D-21-35789R1 The effect of mother-infant group music classes on postnatal depression \u2013 a systematic review protocol Dear Dr. Colella:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Astrid M. Kamperman Academic EditorPLOS ONE"} +{"text": "A. odontolyticus include thoracic, abdominal, pelvic, and central nervous system disease. In the four decades following its isolation, more than 20 cases of invasive infections were reported in multiple geographic locations including the United States and Europe. As such, A. odontolyticus is an emerging bacterium and related research is encouraged for further characterization of its prevalence and clinical significance. Our case series represents the first case series about A. odontolyticus bacteremia in the state of Qatar.Manifestations of infection by A. odontolyticus positive blood cultures at Hamad Medical Corporation, State of Qatar from 1/Jan/2016 to 1/Nov/2020. Electronic health records (EHR) of patients who were identified to have positive blood cultures were accessed and the demographics and other clinically related data were collected and mentioned in this manuscript, after obtaining the appropriate approval from the Corporation Medical Research Council (MRC).We are reporting 15 cases with isolated A. odontolyticus positive blood cultures at Hamad Medical Corporation, State of Qatar from 1/Jan/2016 to 1/Nov/2020.We are reporting 15 cases with isolated 12 of the 15 reported cases were considered significant and received a complete course of antimicrobial therapy. The patients presented with a wide variety of clinical pictures and were of variable age. \u2022odontolyticus is an emerging bacterium with increasingly reported cases.A. \u2022It is an anaerobic, filamentous gram-positive bacterium.\u2022It is associated with cervical, thoracic, abdominal, and pelvic infections.\u2022It can affect a wide spectrum of patient population. It colonizes oropharynx, urogenital and gastrointestinal tracts. Actinomyces is associated with a wide range of infections including dental caries, abscesses, intraabdominal and bloodstream infections. Recognized risk factors for the development of actinomycosis are Immunosuppression and local tissue damage. Actinomycosis is more common in men, except for pelvic disease in women as it is associated with intrauterine devices (IUDs) . More th species . It was y Israel . Since tActinomyces odontolyticus (A. odontolyticus) was isolated in 1958, from persons with advanced dental caries [A. odontolyticus was identified in 5 of them, two cases of A. meyeri and one case of A. israelli [A. odontolyticus; Thirteen of them had pulmonary, cardiopulmonary or mediastinal disease, three had bacteraemia two of which were immunocompromised patients and one was a previously healthy patient [l caries ,4. Datta patient .Traditionally, isolation of actinomyces from any sterile specimen is always considered significant. However, in 21 reported cases of blood stream infections, only six cases received appropriate prolonged treatment . ActinomA. odontolyticus positive blood cultures at Hamad Medical Corporation, State of Qatar from 1/Jan/2016 to 1/Nov/2020. We aim to describe the characteristics, clinical significance, risk factors and treatment outcome. Up to date, there has been no case series or epidemiologic studies describing the clinical significance or characteristics of A. odontolyticus bacteremia in the state of Qatar. We hope that our manuscript will serve as a bridge to further research on this subject and will help in building both a national and international epidemiologic database for Actinomyces odontolyticus.We are reporting 15 cases with isolated 22.1MRC-01-20-1119 and in accordance with the Declaration of Helsinki.This research was registered in and approved by Hamad Medical Corporation Medical Research Council (MRC) with unique number 2.2This is a multi-center, retrospective case series and the cases are non-consecutive.2.3The patients were managed in in-patient wards inside three hospitals affiliated with the Hamad Medical Corporation in Qatar.A. odontolyticus blood cultures from 1/Jan/2016 to 1/Nov/2020. Follow up period included six months post-discharge from the inpatient wards.Data collection timeframe include patients with positive 2.4The patients were followed for six months after discharge from the in-patient wards. Follow up methods included both telephone consultation and outpatient clinic visits.This case series has been reported in line with the PROCESS Guideline.33.1A. odontolyticus bacteremia between 1/Jan/2016 and 1/Nov/2020. Nine of the patients were females (60%). Median age of diagnosis was 45 years. 11 patients (73%) had comorbid conditions, five out of which had both hypertension and diabetes mellitus. 12 patients had fever (80%). Three patients (20%) had orofacial abnormalities . 12 patients (80%) received full courses of antibiotics, positive cultures for the remaining two were considered as contamination and therefore they did not receive a full course. The infectious disease team was consulted for six patients. Most of the patients received B-lactam antibiotics (60%). Maximum duration of antibiotics was 60 days and minimum duration was three days. One patient underwent surgical treatment in the form of incision and drainage for submental and mediastinal collections.We present the data of 15 patients from our facilities who were found to have 3.2There was no deviation from the initial management plans.One patient passed away while the other 14 recovered uneventfully with a case fatality rate of 6.6%.3.3The patient adhered to the prescribed antibiotic regimens during their in-patient stay and after discharge. This was confirmed directly with the patients, and their surrogates where applicable.3.4No complications were reported during the follow-up period and the patients tolerated the prescribed antibiotics with no remarkable adverse events.44.1A. odontolyticus which was sensitive to amoxicillin/clavulanate. The patient received two days of intravenous ceftriaxone and was discharged on oral amoxicillin/clavulanate for a total course of two weeks of antibiotics and her recovery was uneventful.A 37-year-old lady, five months pregnant, with background of sickle cell disease presented to the hospital in September 2016 with fever and right sided facial pain for three days\u2019 duration. Her home medications were folic acid and as needed paracetamol. Aside from a temperature of 38.9\u00a0\u00b0C, vital signs were normal. Physical examination revealed right sided maxillary tenderness. Examination of the oral cavity, chest, heart, and abdomen was normal. No dental abnormalities were appreciated. White blood cell count was significantly elevated at 34.8\u00a0\u00d7\u00a0103/\u03bcL (Reference range 5\u201313\u00a0\u00d7\u00a0103/\u03bcL) and C-reactive protein was 81\u00a0mg/L (Reference range 0\u20135\u00a0mg/L). Chest X-ray was normal. Two out of four bottles of blood cultures were positive for 4.2A. odontolyticus which was sensitive to amoxicillin/clavulanate. She was started on intravenous amikacin awaiting the results of repeated blood cultures which were negative for any growth. The antibiotic was discontinued after three days, and she was discharged after completing her post-natal care uneventfully. Further follow up at two weeks post-discharge was unremarkable.A 1-day-old female neonate delivered uneventfully in March 2017 through low-segment Cesarean section, with no apparent congenital anomalies or dysmorphic features was found to have foul smelling meconium-stained amniotic fluid post-delivery. Her mother did not have any medical issues. Physical examination was normal, and her Apgar score was nine and ten at five and 10\u00a0min respectively. White blood cell count and C-reactive protein were normal. One bottle of pediatric blood culture was positive for 4.33/\u03bcL. One bottle of blood culture was positive for A. odontolyticus which was sensitive to penicillin. She received three days of intravenous antibiotics which included ceftriaxone and azithromycin. She was prescribed oral amoxicillin/clavulanate for four more days and was discharged home. Her recovery was uneventful.A 76-year-old lady with background of heavy smoking, hypertension and chronic obstructive pulmonary disease presented in April 2017 with fever and cough productive of brownish sputum for three days. Her home medications included amlodipine, simvastatin, and fluticasone/salmeterol inhaler. Her temperature was 38.2\u00a0\u00b0C and her other vital signs were normal. Physical examination and X-ray of the chest revealed an area of consolidation in the right middle lobe. Oropharyngeal examination revealed poor oral hygiene and multiple dental caries; however, there was no evidence of a dental abscess. White blood cell count was 12\u00a0\u00d7\u00a0104.43/UL. Ultrasound of the abdomen showed a trace of right perinephric fluid. Blood culture was positive for A. odontolyticus. Urine culture was positive for Escherichia coli and Klebsiella pneumoniae. The patient received eight days of intravenous ceftriaxone and recovered without any major sequelae.A 58-year-old lady with background of spinocerebellar ataxia presented in August 2017 with fever and vomiting. Her home medications were pregabalin and mirtazapine. Her temperature was 38.2\u00a0\u00b0C and other vital signs were normal. Physical examination revealed tenderness in the right flank. White blood cell count was 13.2\u00a0\u00d7\u00a0104.53/UL and C-reactive protein 16\u00a0mg/L. Two bottles of blood cultures were positive for A. odontolyticus. Chest X-ray was normal. She received intravenous ceftriaxone for two days and was discharged on oral amoxicillin/clavulanate for seven days. Her recovery was uneventful.A 73-year-old lady with background of hypertension, diabetes mellitus and Alzheimer's dementia presented in November 2017 with fever, chills, and fatigue for two days. Her home medications included metformin/sitagliptin, enalapril, and rosuvastatin. Vital signs were normal except for a temperature of 37.9\u00a0\u00b0C and a heart rate of 107 beats per minute. Physical examination of the chest and abdomen was normal. A detailed oropharyngeal examination was not documented. White blood cell count was 4\u00a0\u00d7\u00a0104.63/UL and C-reactive protein was 149\u00a0mg/L. One bottle of blood culture was positive for A. odontolyticus. Ultrasound of the abdomen revealed acute acalculous cholecystitis. The patient received seven days of intravenous ciprofloxacin and metronidazole. Her recovery was uneventful.An 81-year-old lady with background of hypertension, diabetes mellitus and asthma presented in January 2018 with abdominal pain and vomiting for three days. Her home medications were metformin, amlodipine and salbutamol inhaler as needed. Vital signs were normal. Physical examination was remarkable for tenderness in the epigastric area. White blood cell count was 11.4\u00a0\u00d7\u00a0104.73/UL and C-reactive protein was 186\u00a0mg/L. Two bottles of blood culture were positive for A. odontolyticus. He received an intravenous renal-adjusted course of ciprofloxacin and clindamycin for ten days. He had an uneventful recovery and was discharged from the hospital after completion of antibiotics.A 64-year-old gentleman with background of aortic stenosis, hypertension and diabetes mellitus complicated by diabetic foot status post recent surgical debridement and end-stage renal disease on regular hemodialysis presented in March 2018 with fever and lethargy which occurred during his dialysis session. His home medications were amlodipine, gliclazide and bisoprolol. His initial vital signs were remarkable for blood pressure of 80/64\u00a0mmHg and temperature of 38.4\u00a0C. Physical examination of the right foot revealed a deep ulcer in plantar aspect 4\u00a0\u00d7\u00a03 cm in size covered by sloughed tissue. Other systems were normal. White blood cell count was 13. 9\u00a0\u00d7\u00a0104.83/\u03bcL. One bottle of pediatric blood culture grew A. odontolyticus. He received five days of intravenous ceftriaxone and recovered uneventfully.A 1-month-old male infant with no chronic medical issues presented in April 2018 with fever and dry cough. He was delivered vaginally with no pre- or post-delivery complications. He was not receiving any medications at home. Vital signs were unremarkable except for a temperature of 38.1\u00a0\u00b0C. Physical examination of the oropharynx, chest and abdomen was normal. White blood cell count was 7.7\u00a0\u00d7\u00a0104.93/\u03bcL. One bottle of pediatric blood culture was positive for A. odontolyticus. He received seven days of oral amoxicillin/clavulanate and recovered uneventfully.An 11-year-old male with background of chronic sinusitis presented in February 2018 with fever and headache. His temperature was 38.5\u00a0\u00b0C and other vital signs were normal. Physical examination was positive for erythema and congestion in the throat. Examination of other systems including the urogenital was normal. White blood cell count was 10.8\u00a0\u00d7\u00a0104.103/\u03bcL and C-reactive protein was 31\u00a0mg/L. One bottle of blood culture was positive for A. odontolyticus. As the patient did not have clinical signs of infection, she was not started on antibiotics. Repeated blood cultures were negative. The patient was discharged home after improvement in serum sodium.A 74-year-old lady with background of hypertension, diabetes mellitus, heart failure and chronic kidney disease presented in June 2018 with reduced level of consciousness and was found to have severe hyponatremia with serum sodium of 109\u00a0mmol/L (Reference range 136\u2013145\u00a0mmol/L). Home medications included gliclazide, perindopril, metoprolol, and atorvastatin. Vital signs including the temperature were normal. Physical examination revealed a Glasgow coma scale of 13/15. Other systems were normal. White blood cell count was 7.6\u00a0\u00d7\u00a0104.113/\u03bcL and C-reactive protein was more than 500\u00a0mg/L. Computed tomography scan of the neck with contrast revealed a submental abscess with extension to the mediastinum and abscess formation with signs of mediastinitis. The largest mediastinal pocket was sized as 7\u00a0\u00d7\u00a04 cm. The patient underwent incision and drainage of the submental abscess and mediastinoscopy with drainage of superior and anterior mediastinal abscesses. Blood cultures were positive for A. odontolyticus. Pus cultures from the submental and mediastinal abscesses were positive for A. odontolyticus. The isolates were sensitive to amoxicillin/clavulanate. He initially received piperacillin/tazobactam for three days which was later changed to intravenous clindamycin. He received antibiotics for a total duration of 28 days. He recovered successfully with no major sequelae.A 32-year-old gentleman with no previous medical history, presented in September 2018 with fever and right-sided facial swelling. The patient had undergone removal of wisdom tooth #48 seven days prior. Vital signs were remarkable for a temperature of 38.2\u00a0\u00b0C. Physical examination revealed swelling and fluctuance in the right submental area. White blood cell count was 22\u00a0\u00d7\u00a0104.123/\u03bcL and C-reactive protein was 249\u00a0mg/L. Blood cultures were positive for A. odontolyticus which was sensitive to amoxicillin/clavulanate. The patient was diagnosed as ascending cholangitis and was initially started on piperacillin/tazobactam which was later escalated to meropenem and vancomycin due to clinical and laboratory deterioration. Ten days later, the patient's status deteriorated further, and he developed cardiac arrest. Unfortunately, the patient passed away. He received ten days total duration of antibiotics.A 56-year-old gentleman with metastatic pancreatic carcinoma admitted in December 2018 with persistent abdominal pain. Last dose of chemotherapy was two weeks prior to his presentation. He had received gemcitabine and paclitaxel. He underwent celiac plexus block for his abdominal pain. Two days later, the patient developed signs of sepsis with fever of 38.9\u00a0\u00b0C and hypotension. Physical examination revealed a cachectic gentleman with scleral and cutaneous icterus. His labs revealed deterioration in serum bilirubin and alkaline phosphatase. White blood cell count was 14.9\u00a0\u00d7\u00a0104.133/\u03bcL. One bottle of pediatric blood culture was positive for A. odontolyticus. She received four days of intravenous ceftriaxone which was stopped after fever had resolved. Her vomiting stopped and she was discharged home. The patient remained stable and asymptomatic at two weeks follow up.A 2-year-old female baby with background of D-2-hydroxyglutaric aciduria and seizure disorder presented in February 2019 with vomiting. Her home medications included levetiracetam, phenobarbitone and prednisolone. Vital signs were remarkable for a temperature of 38.2\u00a0\u00b0C. Physical examination was otherwise normal. White blood cell count was 8.9\u00a0\u00d7\u00a0104.143/\u03bcL and C-reactive protein was 32\u00a0mg/L. One out of four bottles of pediatric blood culture was positive for A. odontolyticus. She was diagnosed as roseola infantum and was not started on antibiotics. Fever and rash subsided with ibuprofen and the patient was discharged home uneventfully. The patient remained stable and asymptomatic at three weeks follow up.A 2-year-old male baby with no chronic medical issues, presented in May 2019 with fever and truncal rash. His temperature was 38.9\u00a0\u00b0C. Other vital signs were normal. Physical examination revealed erythema and congestion in the throat and pink-colored confluent patches on the torso. Other systems were normal. White blood cell count was 6.4\u00a0\u00d7\u00a0104.153/\u03bcL and C-reactive protein was 80\u00a0mg/L. Blood culture was positive for A. odontolyticus and urine culture was positive for extended-spectrum beta-lactamase producing Escherichia coli. The patient received two weeks of intravenous ertapenem, followed by two weeks of intravenous ceftriaxone which was subsequently switched to oral amoxicillin/clavulanate to complete a total duration of antibiotics of 60 days. She recovered successfully.A 45-year-old lady with background of hypertension, diabetes mellitus and chronic kidney disease admitted in December 2019 due to urinary tract infection and worsening in her kidney function. Three days after finishing her seven-day course of intravenous ertapenem, the patient developed fever of 38.4\u00a0\u00b0C. Other vital signs were normal. Physical examination revealed tenderness in the hypogastric region. Oropharyngeal examination by a dentist revealed several decayed dental roots. White blood cell count was 7.6\u00a0\u00d7\u00a0105A. odontolyticus normally a commensal organism found in the mouth, was first isolated from dental caries in 1958 [A. odontolyticus culture-positive infections have been documented in the literature. However, less commonly recognized as a pathogen than A. israelli. Most cases with invasive disease have presented with pulmonary, cardiopulmonary or mediastinal pathology [Actinomyces odontolyticus bacteremia is less common. As with all other actinomycotic diseases, A. odontolyticus infections are endogenous, originating from mucous membranes and tend to grow predominantly on the surface of the tongue in supra and subgingival regions [Actinomyces bacteremia, once rare is now more commonly reported due to modern culture techniques. Not all positive cultures are clinically significant and relevant, as they can present as transient bacteremia or contamination as encountered in some of our patients . We report 15 cases with positive A. odontolyticus blood cultures at Hamad Medical Corporation, State of Qatar. Our patients with bacteremia fall into one of two groups. The first group consists of pediatric patients with unremarkable co-morbidities apart from two children one of whom had chronic sinusitis and the other suffered from a neurometabolic disorder. The second group includes older adults, often with co-morbidities that pre-dispose to infection, such as diabetes mellitus or hypertension ..Approval from the Hamad Medical Corporation Medical Research Council was obtained prior to submission of this manuscript. Manuscript reference MRC-01-20-1119Written informed consents were obtained from the patients for publication of this case series and the accompanying information. Copies of the written consents are available for review by the Editor-in-Chief of this journal on request.MA and AR performed literature review and wrote the original draft of the manuscript. HZ supervised the writing process and revised the manuscript. All authors approved the final version for submission.MRC-01-20-1119 and in accordance with the Declaration of Helsinki.This research was registered in and approved by Hamad Medical Corporation Medical Research Council (MRC) with unique number Dr. Almurtada Razok.None to be declared."} +{"text": "BackgroundIn this study, we aimed to determine the diagnostic performance of optic nerve head (ONH), macular, and circumpapillary retinal nerve fiber layer (cpRNFL) thickness measurements of wide-field maps (12 \u00d7 9 mm) using swept-source optical coherence tomography (SS-OCT) compared to measurements of the ONH and RNFL parameters measured by Heidelberg Retina Tomograph (HRT3).MethodologyThis case-control study included 39 eyes of 39 glaucoma patients and 36 eyes of 36 normal subjects (control group). All participants underwent standard automated perimetry (SAP) as well as structural measurements by SS-OCT and HRT3 . The abilities of the continuous parameters to discriminate between glaucoma and control groups were assessed using areas under the receiver operating characteristic curves (AUCs). To assess the glaucoma diagnostic abilities of each of the categorical variables, sensitivity, specificity, positive predictive value, and negative predictive value were tested.ResultsThe highest sensitivities were achieved by the DRI-OCT categorical parameters of Superpixel-200 map and cpRNFL (12 sectors) thickness analysis. The best performing HRT3 continuous parameter was rim volume = 0.735-0.922), and the best continuous parameter for DRI-OCT wide-field was vertical cdr , followed by total cpRNFL thickness . AUCs for disc area, rim area, linear cdr, and RNFL thickness were not significantly different between the two technologies. Using either the most or the least specific criteria, SuperPixel-200 map always showed the highest sensitivity among the categorical parameters of both technologies . The highest sensitivity among HRT3 classification parameters was shown by MRA and GPS classification algorithms.ConclusionsBoth wide-field DRI-OCT maps and HRT3 showed good diagnostic performance in discriminating glaucoma. Although DRI-OCT thickness values and normative diagnostic classification showed the best performance, more studies are required to determine the clinical role of wide-field DRI-OCT scan in glaucoma diagnosis. Glaucomatous optic neuropathy involves characteristic optic disc as well as\u00a0retinal nerve fiber layer (RNFL) structural damage and related functional defects . Even thThe HRT3 is a confocal scanning laser tomography (CSLO) device that uses a diode laser 670 nm) to scan the retinal surface at multiple consecutive parallel focal planes and produces repeatable and reproducible three-dimensional (3D) topographical images of the ONH and peripapillary RNFL . After i70 nm to Deep range imaging OCT is a recently introduced swept-source OCT\u00a0(SS-OCT) that uses a center wavelength of 1,050 nm and a bandwidth of approximately 100 nm compared to the fixed 850 nm wavelength of spectral-domain OCT (SD-OCT) ,15. The Recently, several investigators have reported similar glaucoma diagnostic abilities of SS-OCT and SD-OCT standard macula and disc scans as well Our study aimed to assess the ability of the 3D Wide Glaucoma Report, which is generated using wide-field DRI-OCT scans, to distinguish glaucoma from healthy eyes. The diagnostic ability of the wide-field-based automatic classification was compared with that of the six main HRT3 stereometric parameters as well as the GPS and MRA analyses in the discrimination of glaucomatous and healthy eyes. Glaucoma diagnostic abilities of wide-field DRI-OCT and HRT3 thickness measurement values were also compared.Study participantsThis was a case-control study that included 36 eyes of 36 normal subjects (controls) and 39 eyes of 39 glaucoma patients who visited the Glaucoma Clinic of 401 Army General Hospital of Athens between August 2019 and July 2020. The study protocol complied with the Declaration of Helsinki and was approved by the Institutional Review Board of 401 Army General Hospital of Athens . Informed consent was obtained from all participants.Each participant underwent comprehensive ophthalmic tests, including medical history review, best-corrected visual acuity (BCVA) by Snellen digital chart, slit-lamp biomicroscopy, intraocular pressure (IOP) measurement by Goldman applanation tonometry, gonioscopy, dilated fundus examination, and fundus stereophotographs. Standard automated perimetry (SAP) using SITA 24-2 strategy , wide-field SS-OCT imaging, and CSLO imaging using the HRT3 were also performed on the same day as the ophthalmic examination.Inclusion criteria included a BCVA of 20/40 or better, spherical equivalent refractive errors between +6.0 and -6.0 D, cylinder correction of <3.0 D, and an open angle of the anterior chamber. All DRI-OCT images had a minimum image quality value (IQV) of 60. The recommended IQV is 40 according to the manual of the device . All HRTEyes were classified either as healthy (control group) or glaucomatous (glaucoma group) based on the VF test results and the ONH appearance . VF testControl group consisted of subjects who satisfied all the following criteria in both eyes: (1) no previous intraocular surgery, (2) IOPof \u226422 mmHg, (3) clinically normal disc appearance, (4) a normal VF result defined as a mean deviation (MD) and pattern standard deviation (PSD) within 95% confidence limits (CIs) and a glaucoma hemifield test (GHT) result WNL, and (5) no other signi\ufb01cant ophthalmic \ufb01ndings.Eyes were categorized as glaucomatous when there was glaucomatous structural damage and associated repeatable (\u22652 consecutive) VF defects. Glaucomatous VF defect was defined by a GHTHRT3The most recent version of HRT technology, the HRT3 was used to perform CSLO imaging. Briefly, a 3D topographic image consisting of 384 \u00d7 384 \u00d7 16 up to 384 \u00d7 384 \u00d7 64 pixels was constructed from multiple focal planes axially along the ONH. A mean topography image was created by averaging and aligning three consecutive scans of the ONH and RNFL. An experienced glaucoma specialist (DK) reviewed all images for the imaging score and the overall quality score and outlined the ONH margin on the mean topographic image. After the contour line was delineated, all the ONH stereometric measurements were automatically calculated.The HRT3 OU report provides arithmetic (continuous) measurements of the six main ONH stereometric parameters , rim area, rim volume, height variation contour, mean RNFL thickness) Figure .In addition to stereometric parameters, the HRT3 offers two different automatic classification algorithms of the ONH morphology, the MRA which requires the placement of the contour line and the contour line-independent GPS. Stereometric parameters and classification algorithms of the ONH were compared to the values of the normative dataset and between the eyes and were consequently designated as WNL, borderline, or ONL. The HRT3 normative database contains 733 healthy Caucasian eyes and 215 healthy African American eyes [DRI-OCTDRI-OCT is a recently introduced SS-OCT with a longer wavelength of 1,050 nm and a sweeping range of approximately 100 nm compared to the fixed 850 nm wavelength typical of SD-OCT ,15 that 2 peripapillary area (RNFL) and 30 \u00d7 30 grids within a 6.0 \u00d7 6.0 mm2 macular area (GC layer + IPL + RNFL). This wide-field RNFL deviation map provides a significance map by comparing the patient\u2019s RNFL/RNFL + IPL + GC data with a built-in normative database. In the normative data color-coded maps, the green sectors indicate normal thickness measurement ranges, whereas yellow indicates borderline values of 1-5%, and red-colored sectors indicate values outside the normal range . The DRI-OCT Triton normative database includes 410 healthy eyes from a wide range of ethnicities including Asian, Caucasian, Hispanic/Latino, African American, and others [Automated segmentation of the retinal layers by the built-in software is a crucial tool for quantitative and qualitative tissue evaluation. The thickness measurements of retinal layers (circumpapillary (cp)RNFL, RNFL, and macular layers) are compared to a normative data and a single-page wide-field report (3D wide glaucoma report) Figure is generd others .Definitions of glaucomatous structural change on wide-field DRI-OCTscanGlaucomatous structural change on the categorical parameters of cpRNFL (four sectors), cpRNFL (12 sectors), mGCIPL (six sectors), and mGCC (six sectors) was defined as follows: (A) a WNL classification required all sectors to be WNL (green-colored), (B) a borderline classification occurred when at least one of the sectors was borderline (yellow-colored), and (C) an ONL classification occurred when at least one sector was ONL (red-colored).Glaucomatous structural change on the SuperPixel-200 map was decided when 20 or more contiguous pixels (>20 pixels) with statistically significant change (yellow/red pixels) were identified within the scanned peripapillary and/or macular area.Statistical analysisStudent\u2019s t test was used to compare continuous thickness parameters between normal subjects and glaucoma patients, and the chi-square test was used for categorical parameters.The abilities of the continuous parameters to discriminate between glaucoma and control groups were assessed using areas under the receiver operating characteristic curves (AUCs). We also calculated sensitivities at fixed specificities (80% and 90%) for each of these parameters. AUCs of the continuous parameters that are common to both technologies underwent paired comparisons using the method described by DeLong et al. . To asseFor categorical parameters, borderline classification could be considered either as WNL and then the classification was assessed as \u201cmost specific criteria\u201d (resulting in increased specificity/decreased sensitivity), or borderline classification could be considered as ONL, and then the classification was assessed as \u201cleast specific criteria\u201d (resulting in a decreased specificity/increased sensitivity). Statistical analyses were conducted using SPSS version 26 . For all tests, the level of statistical significance was set at P < 0.05.Initially, 96 consecutive Caucasian patients were recruited in this case-control study. All participants visited the Glaucoma Clinic of 401 Army General Hospital in Athens from May 2019 through May 2020. After applying the inclusion criteria, 10 candidates were excluded for unreliable VF results, seven candidates for poor OCT image quality, and four candidates for poor HRT3 image quality. A total of 75 eyes of 75 patients were included in this study; 39 eyes were glaucomatous and 36 were healthy. All 75 eyes had undergone DRI-OCT wide scan, HRT3 ONH scan, and Humphrey VF testing. Glaucoma subjects were significantly older than healthy subjects with a mean (\u00b1SD) age of 64.36 \u00b1 11.59 years and 53.11 \u00b1 15.01 years, respectively (<0.001). The difference in gender and eye between the two study groups was not statistically significant. No difference was found in disc size and imaging quality between the study groups. The demographics and clinical characteristics of each study group are shown in Table The best performing HRT3 continuous parameter based on receiver operating characteristic (ROC) curves and AUCs was rim volume , and the best continuous parameter for wide-field DRI-OCT was vertical cdr , followed by total cpRNFL thickness were higher than the sensitivities of the main stereometric HRT3 parameters Table . The besThe AUCs of the continuous parameters that are common to both DRI-OCT and HRT3 are shown in\u00a0Figure The values and pairwise comparisons of the above-mentioned AUCs are shown in Table The sensitivity and specificity of the categorical variables for discriminating between healthy and glaucomatous eyes are presented in Table When the least specific criteria were used, the two highest sensitivity values among HRT3 categorical parameters were those for the GPS classification (82.1%) and MRA classification (79.5%). Similarly, the two highest sensitivity values among DRI-OCT categorical parameters were observed for the Superpixel-200 map (89.7%) and the cpRNFL (12 sectors) thickness analysis (87.2%) Table .Our data also showed that DRI-OCT and HRT3 use different methodologies to perform measurements and classify their measurements using different databases, which may also contribute to the manifestation of false-positive and false-negative results. Two examples are provided below for illustrative purposes Figures , 5.In this study, we evaluated the diagnostic ability of wide-field DRI-OCT thickness measurements to differentiate glaucomatous from healthy eyes and compared them with the six main ONH stereometric parameters as well as with the GPS and MRA classification algorithms of the HRT3. To our knowledge, this is the first report to compare the ability of wide-field DRI-OCT maps with the well-established technology of HRT3 to detect glaucomatous damage. Our results indicate that the diagnostic abilities of the wide-field DRI-OCT maps were better than the six main HRT3 stereometric parameters and comparable to HRT3 automatic classification algorithms (MRA and GPS) for the discrimination of glaucomatous from healthy eyes.The imaging technologies that we compared are commercially available in clinical practice, and each provide both numerical values and automated glaucoma status classification for the examined ONH, RNFL, and macular parameters. The automated outputs provide useful and attractive characteristics to clinicians who are not glaucoma experts as they minimize the necessity to interpret a large amount of information in the form of images and measurement values and thus facilitate glaucoma diagnosis.HRT3 is the most recent version of an established imaging diagnostic tool that provides objective and quantitative ONH and RNFL measurements. HRT is a CSLO device for ONH assessment that was first commercially introduced in 1991 and became the standard of care for diagnosing\u00a0,9,28 andContinuous advancements in imaging technology have led to the development of SD-OCT, which has enabled the objective and quantitative assessment of not only ONH but also RNFL and macular GC thickness. Available literature on SD-OCT proved the glaucoma diagnostic abilities of cpRNFL, RNFL thickness deviation map, and macular GC analysis for glaucoma detection -37 and rWe believe our study is the first to compare ONH and RNFL measurements from the long-accepted HRT3 and wide-field DRI-OCT maps. We compared these instruments for the glaucoma diagnostic performance of both categorical classification and thickness measurement values. Additionally, the four shared continuous parameters of the two technologies were directly compared (paired measurements).The three highest values of sensitivity at a similar specificity were achieved by DRI-OCT continuous parameters Table . When thSimilar to our results, several investigators have compared thickness measurement values between HRT3 and the previous modality of SD-OCT, including Shin et al.\u00a0 who founIn clinical practice, glaucoma detection by imaging technologies such as DRI-OCT and HRT3 also relies on the normative-based classification and not only on the actual thickness values, therefore providing a useful automated tool that aids glaucoma diagnosis. Using either the most or the least specific criteria, SuperPixel-200 map always showed the highest sensitivity among the categorical parameters of both technologies , followed by cpRNFL thickness (12 sectors) Table . The higA few studies compared the diagnostic performance of normative-based classification between HRT3 and SD-OCT technology to distinguish normal from glaucomatous eyes. The Glaucoma Automated Tests Evaluation (GATE) study was a large, prospective, comparative diagnostic accuracy study that assessed the diagnostic performance of four imaging tests in identifying glaucoma ,50. HRT3Our data show that the wide-field maps of DRI-OCT can be useful imaging modalities because they show the RNFL status in a wider area with better diagnostic ability than ONH and RNFL stereometric parameters provided by HRT3. What is becoming apparent, however, is that the two instruments use different methodologies to perform measurements and classify their measurements using different databases, with a definite practical impact on their ability to diagnose pathology. DRI-OCT results interpretation is made easier and quicker by color labeling, which provides the statistical significance of structural loss in comparison to the underlying normative database. Nevertheless, it may also contribute to the manifestation of red-green disease\u00a0,54.Green classification may be falsely reassuring in selected cases where glaucoma is present, resulting in green disease, as shown in Figure On the other hand, red labeling can result in false-positive results and diagnosis, that is, red disease.\u00a0Figure This study had several limitations. First, the sample size was relatively small. This did not allow a meaningful subanalysis for the effect of possible confounding factors on the diagnostic performance of wide-field DRI-OCT protocol. More data from larger studies are needed to assess the usefulness of wide-field protocol in real-world clinical settings. Second, the normal group was younger than the glaucoma group. Given the fact that RNFL thickness significantly decreases with age\u00a0,62, thisAs noted above, this is the first study to compare the diagnostic performance of wide-field DRI-OCT maps and HRT3 ONH measurements for the same population. Our results suggest that Superpixel-200 map of DRI-OCT showed better glaucoma diagnostic performance than HRT3 automated diagnostic classification. Therefore, shows the advantage of DRI-OCT wide-area scan and stresses the importance of gathering thickness data beyond the peripapillary area. This study also shows that, while different imaging modalities become more readily available, ONH analysis with HRT3 still provides valuable diagnostic information that also allows for long-term monitoring of glaucoma.Our results suggest that wide-field DRI-OCT automatic classification is a fast and effective diagnostic tool that is easy to read and interpret. However, relying solely on wide-field DRI-OCT imaging (as used in this study) as a diagnostic test is not recommended as some patients may be misclassified. Clinicians should be familiar with the limitations of the wide-field DRI-OCT protocols and possible scanning artifacts. We encourage clinicians rather implement a multimodal imaging approach that includes the anatomical examination of both ONH (HRT3) and RNFL/GC (DRI-OCT wide-field) in combination with functional and clinical evaluation of ONH and RNFL to improve glaucoma diagnosis and management. Future studies are needed to further assess the clinical value of wide-field DRI-OCT imaging modality and its role in diagnosing, monitoring, and treating glaucoma."} +{"text": "However, in freshwaters with low sulfate concentrations, gypsum\u2010released sulfate may pose a threat to the biota. To assess such risks, we performed a series of sulfate toxicity tests in the laboratory and conducted field surveys. These field surveys were associated with a large\u2010scale pilot exercise involving spreading gypsum on agricultural fields covering 18% of the Savijoki River (Finland) catchment area. The gypsum amendment in such fields resulted in approximately a four\u2010fold increase in the mean sulfate concentration for a 2\u2010month period, and a transient, early peak reaching approximately 220\u2009mg/L. The sulfate concentration gradually decreased almost to the pregypsum level after 3 years. Laboratory experiments with Unio crassus mussels and gypsum\u2010spiked river water showed significant effects on foot movement activity, which was more intense with the highest sulfate concentration (1100\u2009mg/L) than with the control. Survival of the glochidia after 24 and 48\u2009h of exposure was not significantly affected by sulfate concentrations up to 1000\u2009mg/L, nor was the length growth of the moss Fontinalis antipyretica affected. The field studies on benthic algal biomass accrual, mussel and fish density, and Salmo trutta embryo survival did not show gypsum amendment effects. Gypsum treatment did not raise the sulfate concentrations even to a level just close to critical for the biota studied. However, because the effects of sulfate are dependent on both the spatial and the temporal contexts, we advocate water quality and biota monitoring with proper temporal and spatial control in rivers within gypsum treatment areas. Environ Toxicol Chem 2022;41:108\u2013121. \u00a9 2021 The Authors. Environmental Toxicology and Chemistry published by Wiley Periodicals LLC on behalf of SETAC.Gypsum (CaSO The divalent calcium and sulfate ions effectively increase the ionic strength of the soil solution, which enhances the aggregation of soil particles, making them less prone to erosion. The phosphorus losses are reduced not only by the lower erosion and lesser transport of the phosphorus bound to the soil particles but also by the reduced desorption of phosphorus from the soil particles in southwestern Finland Figure\u00a0. The cat2 of agricultural fields, translating to 2780 tons of sulfate. Water samples were taken from three sites in the Savijoki River representing the reference area was monitored 34 times in the first 2 years after the amendment. To complement the manual water sampling, online sensors that recorded the turbidity and electric conductivity at hourly intervals, among others, were deployed at the three uppermost sites. A nonlinear mixed effects model was made for the relationship between the hourly electric conductivity observations given by the sensors and the sulfate concentrations determined from the manually taken samples (see the Supporting Information). The use of a power relationship is theoretically justified by the increase in divalent calcium and sulfate ions at the sites and in periods during which gypsum had an effect on the electric conductivity. Other anions and cations were also measured from grab samples before and after the amendment. The runoff was measured at the outlet of the reference area using a calibrated V\u2010notch weir that was used in the pilot study was also used in the risk assessment experiments. The gypsum is a byproduct of the manufacture of phosphoric acid from apatite mineral. The water that was used in the laboratory experiments was from the Savijoki River reference area.Fontinalis antipyretica Hedw., the unionid clam U. crassus Philipsson), through in situ assays , and by field surveys (mussels and fish).The toxicity of sulfate was assessed for several organisms at different trophic levels in the laboratory experiments and were acclimatized for 3 days to the test conditions (the Savijoki water with aeration at 18\u2009\u00b0C room temperature and in a 16:8\u2010h light:dark cycle). A part of the collected moss was retained in the water from the Muuramenjoki, which served as the second control for the experiment. The waters were stored at 5\u00b0C for 3 days before the experiments. The gypsum was dried at 60\u00b0C overnight and was then mixed in with the test waters that had been sieved with a 38\u2010\u00b5m mesh to remove the excess particles. The natural sulfate concentrations in the control waters of the Muuramenjoki and the Savijoki, respectively, were 3.9 and 13\u2009mg/L. The nominal test concentrations were 30, 200 , 400, 600, and 1200\u2009mg/L (saturated gypsum solution). The measured concentrations were 42, 220, 453, 650, and 1200\u2009mg/L and were based on the samples pooled from the replicates. Each concentration was tested in 100\u2010ml glass jars in 10 replicates.We conducted a laboratory experiment to test the effect of gypsum on the length and biomass growth of F. antipyretica were cut and kept in the Savijoki water during the test preparation. Three randomly taken shoots were then tapped on paper tissue to remove the surficial water, and their combined fresh mass was taken with a microbalance before they were placed in the test vials. The 21\u2010day experiment was conducted at a constant temperature of 18\u00b0C and in a 16:8\u2010h light:dark cycle. The test waters were changed at 3\u2010day intervals. Water samples were taken on days 0, 8, and 16 for sulfate analysis. Sulfate was analyzed in the laboratory of the Finnish Environment Institute according to the ISO 10304\u20101:2007 standard, using ion chromatography. The oxygen concentration, pH, conductivity, and temperature were measured at 3\u2010day intervals (using a WTW Multi 3430 multiparameter meter). At the end of the experiment, the lengths and the fresh weights of the shoots were determined again. For measuring the dry mass, we dried the shoots overnight in an oven at 105\u00b0C, in aluminum cups.The test broadly followed the protocol described by Davies . Two\u2010cenU. crassus in acute 24\u2010 and 48\u2010h static exposure, applying the ASTM International (R. subcapitata), and the water was partially changed three times a week. After 3 weeks, all the mussels were alive, and we returned them to their native river.We tested the effects of sulfate from gypsum on the survival of the glochidia larvae of national guidelin4 were used. We placed 15\u201320 glochidia into each glass vial with 20\u2009ml of test water using a glass Pasteur pipette, and covered the vials with parafilm. The exact total number of glochidia/treatment level, as counted after the exposures, was 74\u201381 in the 24\u2010h test and 41\u201361 in the 48\u2010h test. Water samples were taken three times for sulfate concentration analyses. We measured the oxygen concentration, pH, conductivity, and temperature at 3\u2010day intervals.At the onset of the testing, the containers were searched daily, and the glochidia were collected where the gravid mussels had released them. Their viability was tested with saturated NaCl solution. The viability was over 90%. The glochidia that were used in the tests were less than 24\u2009h old. The test water transported from the Savijoki and the water from Perni\u00f6njoki served as additional controls and were stored at 5\u00b0C before the experiments. The gypsum was dried at 60\u00b0C overnight and was mixed in with the test waters that had been sieved with a 38\u2010\u00b5m mesh to remove the excess particles. The toxicity testing included eight treatments with four (24\u2010h test) or three (48\u2010h test) replicates each at 15\u2009\u00b1\u20091\u00b0C in a 20:4\u2010h light:dark cycle. The natural sulfate concentrations in the Savijoki and the Perni\u00f6njoki control waters were 19 and 10\u2009mg/L, respectively. The nominal test concentrations of 40, 60, 120, 250, 500, and 1000\u2009mg/L SOThe survival (%) was examined using a dissecting microscope, by pipetting a drop of saturated NaCl solution next to the glochidia in a Petri dish with a black background. The individuals whose valves were closed before NaCl addition and that did not respond to our gentle knocking on their shells were considered dead. Those that snapped shut their open shells in response to NaCl addition were considered alive, and those that remained open were counted as dead.U. crassus during 4\u2010day sulfate exposure. Thirty\u2010six mussels were collected from the Perni\u00f6njoki on October 6, 2016. The mussels were transported to the laboratory in insulated boxes with aeration, and were acclimatized to the test room conditions for 3 days. At the end of the first day, the mussels were fed with green algae (R. subcapitata). The exposure was conducted in the Savijoki water, in 2\u2010L beakers with aeration for 4 days in the test room. The 13\u2010mg/L natural sulfate concentration of the Savijoki served as a control for the experiment. The nominal test concentrations were 30, 200, and 1200\u2009mg/L SO4, and the measured concentrations were 43, 210, and 1100\u2009mg/L SO4 on average. Eight mussels were randomly chosen for each treatment and were individually held in the aerated exposure beakers. In addition, three beakers containing only the Savijoki water served as a negative control for the food consumption measurements. The test waters were changed once (after 2 days) during the 4\u2010day experiment. We fed each mussel with the same amount of R. subcapitata after the water change and at the end of the experiment.We studied the effects of sulfate on the behavior of adult The behavior of the mussels was monitored five times every day: at 8\u2009a.m., 10\u2009a.m., 12\u2009p.m., 2\u2009p.m., and 4\u2009p.m. Three different types of behavior were recorded: opening of the shell (open/closed), filtering activity (siphons in/out), and foot movement (foot out/in). The mussels gained 1 point/mode of activity. In uncertain cases, 0.5 point was given. For each individual, the points for every mode of activity and for all modes of activity were summed up and were then averaged within a treatment group. At the end of the experiment, we checked the survival of the mussels by knocking gently on the shell. The individuals that did not react by closing their shells were considered dead.To study the food consumption of the mussels, we took water samples from the beakers right after and 2\u2009h after the last feeding, for algal cell counting. The samples were preserved with Lugol's solution and stored at 5\u00b0C for microscope counting. The samples were first homogenized with a vortex mixer, and the number of algal cells in 1\u2009ml water was then determined using a B\u00fcrker chamber and a microscope. We calculated the food consumption of each mussel as the difference between the initial cell concentration and the final cell concentration after 2\u2009h.Water samples were taken from the test waters three times for sulfate concentration analysis. We also monitored the oxygen concentration, pH, conductivity, and temperature thrice during the experiment, simultaneously with water sampling.After the 4\u2010day exposure and visual monitoring, the mussels' behavioral responses were measured with a Multispecies Freshwater Biomonitor (MFB\u00ae) device and after the gypsum amendment (2017), at a site downstream of the gypsum spread area using the single\u2010pass removal method, and we measured the sampling area. We identified the species to which the captured fish belonged, measured their lengths, counted them to estimate the densities, and then released them back to the river. The pure catch was used in estimating the density; no catchability value was used.The trout eggs were incubated in situ at three sites after the gypsum treatment. In the Savijoki, a test site filled with water. On the same day, the bottles were transported on ice to the study sites, where 50 eggs were poured into each incubation cylinder. The cylinder, baskets, gravel, and the exact method that was used were obtained from Harris and SyrjThe exact incubation sites were selected based on the knowledge of the microhabitat conditions in real trout redds was placed in one of the baskets at each site. The loggers measured the water temperature four times a day, and the degree days were calculated according to the daily mean temperature was calculated as /initial FM. This and other growth variables of the treatment groups were compared using analysis of variance (ANOVA), followed by Tukey's post hoc test to localize the significant differences. However, we also used Dunnett's t\u2010test to specifically evaluate the differences between the test concentrations and the control.To control for the dependence of the absolute mass increment of \u03b1\u2009=\u20090.05; two\u2010sided test). If significant differences were found, pairwise comparisons with Bonferroni correction were performed. The differences in the food consumption of the mussels among the treatment levels were tested using one\u2010way ANOVA and Tukey's post hoc test.The proportion of survived glochidia and the data from both the visual and MFB measurements of the behaviors of the adult mussels were not normally distributed even after arcsin transformations, according to the Shapiro\u2013Wilk test. The nonparametric Kruskal\u2013Wallis test was thus used to test the differences among the treatments was tested with two\u2010way ANOVA, using time (before/after) and site (reference/impact) as factors, where the interaction (site\u2009\u00d7\u2009year) indicates the effect of the gypsum treatment.U. crassus and the total mussel abundance were compared only by study year, using repeated\u2010measures ANOVA.Because we did not have a reference site in the mussel survey, the abundance of t\u2010tests. The F1 reference had no previous fishing data and was used only for the contemporary comparison of the catches after gypsum treatment. The trout egg survival rate (%) for each cylinder was calculated as the proportion of living embryos in relation to the original number of eggs (50 eggs). Arcsin transformation was used for this purpose. The proportion of living embryos between the sites and the field rounds was tested with two\u2010way ANOVA. The length is given as the mean body length of the measured individuals in each cylinder.The estimated total fish densities and the densities of the most common species before and after gypsum treatment were compared with paired Gypsum amendment increased the sulfate concentration in the Savijoki from a level of less than 20\u2009mg/L to a short\u2010lived maximum of approximately 220\u2009mg/L and moderately hard water conditions (80\u2013100\u2009mg/L CaCO3) using sublethal responses. The species sensitivity distribution approach yielded 129 and 644\u2009mg/L SO4, respectively, and the assessment factor approach yielded 75 and 625\u2009mg/L SO4. Sahlin and \u00c5gerstrand and 94\u2009mg/L CaCO3 at the outflow of the lower gypsum area (W3). Hence, a comparison of the measured sulfate concentrations in the river , being approximately 31% smaller on average. The Tukey test showed a significant (p\u2009=\u20090.047) difference only between the highest and the lowest spiked test concentration (42\u2009mg/L).All the measured growth variables differed among the treatment groups. The length growth declined with increasing sulfate concentration Figure\u00a0. HoweverF. antipyretica will grow 41\u2009mm/year on average with the pregypsum sulfate concentration (13\u2009mg/L) of the Savijoki, and 13\u2009mm (31%) less with the highest test concentration (1200\u2009mg/L). With the test concentration (453\u2009mg/L) closest to the short\u2010lived sulfate peak observed in the Savijoki (220\u2009mg/L), the annual growth will be 9\u2009mm (22%) less than with the natural sulfate concentration. However, such high sulfate peaks were only sporadic, and because gypsum amendment was applied in fall, outside the main growing season, these peaks will probably not significantly affect the length growth of mosses, if at all.In nature, many seasonally varying factors affect the growth of aquatic mosses and the dry mass (p\u2009<\u20090.001) were greater with the highest sulfate concentration than with the control . Some precipitation of solids on the moss leaves was visually witnessed during the experiment. This attached material, which could not be removed without damaging the moss, might have been either gypsum or calcium carbonate. In addition to causing the increase in mass, it might have hindered the length growth. For further studies, we would recommend using carbon sequestration as the parameter for measuring F. antipyretica growth value (greater than 2522\u2009mg/L) estimated by Elphick et al. value from our study would be 650\u2009mg/L sulfate, which is within the 603\u2013654\u2009mg/L range estimated by Elphick et al. and after 48\u2009h of exposure and 92.6% after 24\u2009h of exposure and 86.1% (\u00b113.4%) and 88.6% (\u00b16.9%) after 48\u2009h of exposure. There were no differences in the proportion of survived glochidia among the tested sulfate concentrations after 24\u2009h of exposure varied from 1338 to 2709\u2009mg/L SO4 among the juveniles of five bivalvian species . Gypsum amendment in fall should also reduce the potential exposure because in this region, U. crassus release their glochidia in spring and early summer, when the runoff and sulfate losses from the fields are also low.The aforementioned results are in line with those of previous experiments with invertebrates. Calcium sulfate was not acutely toxic below the saturation concentrations to the crustacean water flea p\u2009=\u20090.021; Figure\u00a0\u03c72\u2009=\u200913.980; df\u2009=\u20093; p\u2009=\u20090.003) in the MFB measurements after the laboratory exposures. However, pairwise comparisons indicated that there were no differences between the treatment concentrations and the control value was 696\u2009mg/L SO4 . At high biomasses (when the laboratory method indicated more than 3\u2009\u00b5g/cm2), however, the in situ BenthoTorch measurements indicated lower biomass values than the conventional laboratory method. In the present study we report the results based only on the laboratory biomass estimates were highly correlated with each other , and higher in 2016 than in 2017 and hence no sign of gypsum treatment effect on benthic algal accrual.There were considerable differences in algal biomass accrual between the sites and years. The algal accrual was higher in the middle reach, A2, than in the upper reach, A1 (We anticipated that gypsum treatment could either decrease periphyton growth (via decreased dissolved nutrient concentrations) or increase it (via increased light). The study result was expected because the sulfate concentrations remained lower than the previously reported effective concentrations for algae , and the total density was also clearly higher there than in the upper reaches. There were no differences in total density by year, even though in the three sites below and closest to the treatment area, the density seemed to increase consistently after the treatment in the lower reaches, where the species was found. Even though the present survey data do not unequivocally show a lack of effect, the apparent effects were positive rather than negative. Signs of positive effects on the mussels can be expected due to the decreased concentration of inorganic suspended solids was found in all the samples and was the only species encountered in the F1 reference site, where it was more abundant than in the other sites. European bullhead (Cottus gobio) was also common and relatively abundant both before and after the gypsum treatment, but fewer brown trout (S. trutta) were found and gudgeon (Gobio gobio) were sporadically captured only before the gypsum treatment and in the densities of C. gobio and S. trutta before and after the gypsum spread, although the density of C. gobio tended to be greater after the gypsum treatment . In F3, the estimated density of S. trutta was substantially smaller after the gypsum treatment than before the gypsum treatment .There were no significant differences in total fish density .The estimated fish densities before and after the gypsum treatment were broadly similar. Even if we cannot completely rule out the negative effects of gypsum treatment on fish populations, the effects in the Savijoki are likely to be marginal or nonexistent because the average and even peak sulfate concentrations in the Savijoki have been substantially lower than those previously suggested as harmful to freshwater fish or between the sampling rounds .The mean embryo survival rate was 78% (range: 62%\u201388%) in E3 in March, but it was 13% (0\u201338), 7% (0\u201332), and 26% (0\u201376) in E2, E1, and E3 in April, respectively for rainbow trout embryos was either 175 or 300\u2009mg/L depending on the hardness of the test water will likely benefit from the increased light availability, although this was not observed in the present study.In our pilot study, the effect of gypsum on the phosphorus load was monitored in two sites along the main river channel, where the effect was diluted by the water from the unamended fields and lands of other use types. Estimating the effect on loads differs from estimating the effect on ecological response. When one is estimating the effect on loads, the use of a flow\u2010weighted mean concentration results in more correct estimates than the use of arithmetical means due to the positive correlation between concentration and flow. The arithmetical means, however, are more relevant in describing the environment of biota. There were only minimal changes in the arithmetic mean turbidity and phosphorus concentration Table\u00a0. HoweverThe Finnish government currently aims to amend at least 50\u2009000 hectares of agricultural fields in southwestern Finland with gypsum. Such gypsum treatment can have pronounced potential benefits to the coastal waters. This may also apply to the ecological state of the riverine environment provided that a sufficiently large area of the upstream catchment will be treated. The threats posed by sulfate, however, need to be considered. In our pilot study, gypsum treatment did not raise the sulfate concentrations to a level that is even just close to critical for the biota included in the risk assessment. However, we cannot rule out the possible adverse effects of gypsum treatment on other species based on the ecotoxicity analyses of Sahlin and \u00c5gerstrand and the https://doi.org/10.1002/etc.5248.The Supporting information are available on the Wiley Online Library at Jukka Aroviita: Conception and design of experiments; writing; technical and editorial assistance. Petri Ekholm: Conception and design of experiments; writing; technical and editorial assistance. Heikki H\u00e4m\u00e4l\u00e4inen: Conception and design of experiments; writing; technical and editorial assistance. Rami Laaksonen: Conception and design of experiments; performance of experiments. Matti T. Lepp\u00e4nen: Conception and design of experiments; writing; technical and editorial editing. Johanna Salmelin: Conception and design of experiments; performance of experiments. Jukka T. Syrj\u00e4nen: Conception and design of experiments; writing; technical and editorial assistance. Hanna Arola: Performance of experiments. Maija Hannula: Performance of experiments. Tiina Laamanen: Performance of experiments. Krista Rantamo: Performance of experiments; writing; technical and editorial assistance. Jarno Turunen: Performance of experiments. Antti Taskinen: Writing; technical and editorial assistance.This article includes online\u2010only Supporting Information.Supporting information.Click here for additional data file."} +{"text": "In this mixed-methods study, we examine the relationship between provider communication and patient health literacy on HIV continuum of care outcomes among women living with HIV in the United States. We thematically coded qualitative data from focus groups and interviews (N=92) and conducted mediation analyses with quantitative survey data collected from Women\u2019s Interagency HIV Study participants. Four qualitative themes related to provider communication emerged: importance of respect and non-verbal cues; providers\u2019 expressions of condescension and judgement; patient health literacy; and unclear, insufficient provider communication resulting in diminished trust. Quantitative mediation analyses suggest that higher health literacy is associated with higher perceived patient-provider interaction quality, which in turn is associated with higher levels of trust in HIV providers, improved antiretroviral medication adherence, and reduced missed clinical visits. Findings indicate that enhancing provider communication and bolstering patient health literacy could have a positive impact on the HIV continuum of care. In the United States, women of color, who are disproportionately represented within the community of WLHIV, routinely report receiving poor healthcare and having worse health outcomes than their racial minority counterparts.19Poor provider communication may exacerbate feelings of low self-worth among populations that routinely experience intersectional stigma , such as WLHIV who may experience stigma related to being a woman (misogyny and sexism), being a person of color (racism), socioeconomic status (classism) and living with HIV .20 enhancing provider communication continues to be an unmet clinical and public health goal. In 2003, the Institute of Medicine issued a report stressing the importance of appropriate communication between providers and patients, as a mechanism to improve the healthcare quality for patients of color.21 Yet, eighteen years later, gaps in communication persist, and patients of color often experience stressful encounters in healthcare settings related to poor, insensitive, abrupt, or insufficient communication.24Considering that negative stereotypes associated with WLHIV and people of color may have been long held by providers, and that the healthcare financing system rewards quick visits and efficient clinical delivery,26 Within this construct is the patient\u2019s ability to understand her diagnosis , make appropriate decisions about her health , and includes her comprehension of her disease and necessary treatment.27Low patient health literacy is a barrier to effective patient-provider communication. Health literacy is the extent to which a patient has the capacity to understand (and obtain) relevant health information.28 a national cohort study in the United States designed to better understand the impact of HIV disease on women.Considering the potential interplay between provider communication and patient health literacy on the delivery of quality healthcare and achievement of optimal health outcomes, we conducted a mixed-methods study to elucidate this relationship among WLHIV. In this study, we utilized data collected from women enrolled in the Women\u2019s Interagency HIV Study (WIHS),28 Data collection for the WIHS occurrs via interviews, standardized surveys, physical assessments, and laboratory tests. This sub-study leverages a convergent parallel mixed methods design;29 and data for this sub-study were collected between November 2017 and December 2018.Established in 1993, the WIHS is a multi-site, prospective longitudinal cohort study that captures the experiences of WLHIV and women who are at risk for HIV acquisition to investigate the clinical progression of HIV infection as well as conduct epidemiological and behavioral studies of high public health priority.We conducted twelve focus groups with minority (African American and Latina) WLHIV, each with 5-11 participants, supplemented with a small set of 3 interviews for exclusively Spanish-speaking participants (N=92) across six WIHS sites in Georgia, Alabama, New York, North Carolina, Illinois, and Mississippi. Using the focus group format as our primary mechanism for data collection enabled us to collect data that benefitted from intergroup discussion regarding topics of interest and allowed study participants to expand upon one another\u2019s comments and shared experiences, revealing areas of commonality as well as personal experiences where views diverged.All study participants were 25 years of age or older. Written informed consent was obtained from all focus group and interview participants. Participants received a $50 incentive. The study was approved by Institutional Review Boards at all participating sites.8Once participants were consented, trained female focus group moderators conducted all sessions. Focus group guides were informed by prior WIHS findings and academic literature on the experiences of WLHIV; topics covered in these guides included patient-provider communication, experiences of stigma, and resilience. Focus groups were conducted in English; interviews were conducted in Spanish. Focus groups and interviews were conducted at research sites where WIHS study visits occurred. Both focus group discussions and interviews utilized the same semi-structured guide, enabling us to merge findings. At the beginning of all sessions, the interviewer or moderator provided this definition of healthcare provider: \u201cBy a healthcare provider, I mean a doctor, nurse practitioner, nurse, physician\u2019s assistant, social worker, pharmacist, dentist, or other person that provides you with services at a doctor\u2019s office, hospital, clinic, or pharmacy.\u201d The guides were designed to elucidate experiences and opinions related to provider communication, patient health literacy, and patient engagement in HIV care. Women were encouraged to talk about their different healthcare providers during the sessions, including both HIV care and non-HIV providers, with some questions specifying their \u201cmain HIV care provider\u201d. Findings regarding other aspects of quality of care discussed by the participants are presented elsewhere.Focus groups and interviews were audio recorded; an independent transcription company professionally transcribed these recordings verbatim. Spanish language interview transcripts were translated into English for analysis. Transcripts were analyzed using a two-stage inductive thematic analysis process. In stage 1, a team of five researchers collaboratively developed a codebook that included broad and fine codes to classify data that aligned with patterns that emerged during initial review, reflected the data collection objectives from the study\u2019s aims, and considered prior relevant research. Once this baseline set of codes were finalized, a sub-set of the study team coded the transcripts in the NVivo 12 qualitative analysis software. A set of transcripts were first double coded, then coded transcripts were compared for congruence and inconsistencies, and finally, the full team reconciled and resolved discrepancies through facilitated discussion to improve reliability. In stage 2, the team refined the codebook and applied it to all of the transcripts. The researchers reviewed coded transcripts to identify emergent themes from the data, and their findings were presented to senior investigators for feedback prior to finalization.We employed a cross-sectional design for the quantitative portion of this study; study participants were WLHIV who were enrolled across the nine WIHS sites located in New York, Washington DC, Illinois, California, Georgia, Alabama, Mississippi, Florida, and North Carolina . All participants were adults aged 18 years and older and were English speaking. The Institutional Review Board at each site approved study procedures. All participants provided written informed consent.Validated self-administered measures assessed health literacy, patient-provider interaction quality, trust in HIV care providers, HIV visit adherence, and antiretroviral medication adherence.30 rated on a five-point scale , with higher scores indicating higher health literacy (The first item was reversed). In the present study, Cronbach\u2019s alpha was .75.Health literacy was assessed with three questions from the Brief Health Literacy Screen31 Items are rated on a five-point scale ranging from 1 (never) to 5 , with higher scores indicating more positive (better) interaction with HIV care providers . Sample items include the following: \u201cHow often did HIV care providers speak too fast?\u201d, \u201cHow often did HIV care providers take your health concerns very seriously?\u201d, and \u201cHow often did you and your HIV care providers work out a treatment plan together?\u201d In the current study, Cronbach\u2019s alpha was .90.This was assessed using the 16-item Interpersonal Processes of Care Survey.32 Items are rated on a five-point scale (strongly disagree to strongly agree), with higher values indicating higher trust in HIV care providers. In this study, Cronbach\u2019s alpha reliability coefficient was .82.We assessed trust in one\u2019s HIV care provider using the 8-item Safran Physician Trust Subscale of the PCAS.34ART adherence was assessed with the single question asking participants to report \u201cHow often they took antiretrovirals as prescribed over past 6 months\u201d which includes the following response options: \u201c100% of the time\u201d, \u201c95-99% of the time\u201d, \u201c75-94% of the time\u201d, \u201c<75% of the time\u201d, and \u201cI didn\u2019t take medications as prescribed.\u201d As in previous studies using this measure, we employed the 95% cutoff as less than perfect adherence versus perfect adherence. Prior research has confirmed that this measure is a valid measure for treatment adherence.35This was assessed with a single question asking participants whether they \u201cmissed a regular HIV care appointment in the past 6 months.\u201d We used it as a dichotomized variable, with 0 (missed at least one visit) versus 1 . This measure has been shown to be a valid measure for HIV care engagement.In order to examine the associations between health literacy and patient-provider interaction quality, trust in HIV care providers, ART adherence, and HIV primary care adherence, three mediation analyses were conducted using the PROCESS macro for SPSS with 95% percentile confidence intervals (CIs) and 2,000 bootstrapping resamples. In these analyses, health literacy was the predictor, patient-provider interaction quality the mediator, and trust in HIV care provider, ART adherence, and visit adherence the outcomes. Covariates included the following: age, education, income, patient race, primary provider race, and illicit drug use (in past six months).Participants identified as African American (89%) and Latina (11%). Over half (57%) were older than 50 years, reflecting the average age of the WIHS cohort. Sixty-five percent had been aware of their HIV diagnoses for over ten years; for 52%, the highest educational attainment was high school graduation. Half of participants (50%) were from Alabama, Mississippi, and Georgia. Over half (53%) had an annual income below the Federal Poverty Line for a single individual, which is $12,760 in 2021 .Key emergent themes related to patient-provider communication and health literacy were: 1) importance of respect and non-verbal cues; 2) providers\u2019 expressions of condescension and judgement; 3) patient health literacy; 4) unclear, insufficient provider communication resulting in diminished trust.\u201cCommunication is the key. Don\u2019t look down at us or question us as to why and this. No. Let\u2019s be honest with one another. If you feel that you don\u2019t wanna touch me or whatever, then that\u2019s not your field.\u201d\u2013New York\u201cThis lady came in here. I asked her a question, and she said something. I said, \u2018Excuse me?\u2019 She said, \u2018I\u2019ll be right back,\u2019 and when she came back in, my whole body was frozen, like there was nothing -- because when I came in, and I said, \u2018Hello,\u2019 to her and I gave her my hand, and she didn\u2019t take my hand. I was frozen after that. I didn\u2019t like her.\u2013New York\u201cOkay, when he walked in the room\u2026 we shook hands, which I always do\u2026 He wiped his hand on his pants, and then sat down. Whether it\u2019s cuz I\u2019m HIV positive, I\u2019m black, you think I\u2019m nasty, whatever it was. Every thought that went through my mind was negative. It was all inclusive. You are a Caucasian male. I\u2019m an African American female. I\u2019m HIV positive. You know my status. I don\u2019t know yours. You wanna come in here and present yourself as being better than me? All of that went through my mind.\u201d\u2013AlabamaWhen WLHIV were asked about communicating with their providers, several identified cues that they perceived as discriminatory, disrespectful, or unsettling. Study participants consistently reported the importance of touch as a form of communication:\u201cOne of my providers shook my hand, actually said, \u2018Hi, [name]. How are you? How is your son [son\u2019s name]?\u2019 Those kinds of\u2026those personal things, that really makes a big difference on your whole outlook when you\u2019re going right to the doctor\u2026 you know what I\u2019m saying?\u201d\u2013New YorkIn contrast, when providers used touch and other ways to connect with patients, they were perceived to be more capable, compassionate, and empathetic.\u201cI had a provider to actually tell me if it weren\u2019t for people like us, y\u2019all wouldn\u2019t get this care. I told her, \u2018If it weren\u2019t for people like us, y\u2019all wouldn\u2019t have a job.\u2019\u201d\u2013Georgia\u201c\u2026Don\u2019t tell me to turn around and be still and hold your head straight, \u2018cause I\u2019m finna stop you and I\u2019m finna leave. You don\u2019t talk to me like that. I\u2019m your patient, you\u2019re supposed to make me feel comfortable. I like to be comfortable, especially \u2018cause I can\u2019t see you in my mouth. I wanna be able to see what you\u2019re doing to me. Don\u2019t talk to me like I\u2019m a child. I\u2019m 40-years old, address me as such.\u201d\u2013Mississippi\u201cI had unprotected sex again, caught something. I don\u2019t know. [The provider] was just rude about it, about me catching something and not being careful. It was just the way she was talking to me, like she was downgrading me, so it just felt uncomfortable. After that, I wind up catching something again. Yeah, I thought I was being safe, but I wound up catching something again. It took me a while to actually go back to my doctor because I was scared I may get her, or they was gonna judge me\u2026\u201d\u2013IllinoisWhile the focus group guide did not include specific questions about power dynamics, multiple examples and stories emerged that were illustrative of how providers exert their power and authority upon their patients through expressions of condescension and judgement.\u201cIt\u2019s all [providers] talk about, your viral load, your CD4 count, all that stuff. You need to break it down.\u201d\u2013AlabamaWe found some evidence that patients\u2019 health literacy may affect communication and understanding between patients and providers. This participant noted that she needed providers to \u201cbreak down\u201d the meaning of different laboratory tests for her.\u201cLike I said, far as my healthcare provider, she is wonderful. Anything I wanna talk about and I can ask her about, she takes her time. She explains it. She break it down for me in layman term, so I can understand the way she\u2019s talking to me. I love her.\u201d\u2013Mississippi\u201cNow, my doctor\u2026 I love her, cuz she will break it down to the smallest term for me, and\u2026 she\u2019s the one that taught me, when I go to the doctor\u2019s office, what I should ask for. And I should remember the things that I need to ask for, you know\u2026 and just explain to me about the different medicine procedures, whatever I ask about. And stuff like that, so her and I, we communicate, we communicate real good.\u201d\u2013GeorgiaIn comparison, we found that our study participants took note of when their providers spent extra time to explain health conditions, new diagnoses, and medication considerations.\u201cOkay, I remember one time I came for labs. She didn\u2019t tell me that I had to fast, so I came here for nothing, had to call the cab to go back home and make another -- reschedule another appointment. Then I told her, \u2018Do I have to fast? Because you didn\u2019t tell me that I have to fast. Do I have to fast?\u2019 She goes, \u2018Oh, yeah. You have to fast.\u2019 Okay, thank you for sharing that with me.\u201d\u2013New York\u201cThe person that\u2019s in charge forgot to tell me. I needed one more 40-minute appointment to be on the transplant list, but my doctors and all the surgeons thought I was on the list. It\u2019s things like that when you can\u2019t trust a facility\u2026\u201d\u2013North CarolinaOn the other hand, our participants commented frequently on lapses in or insufficiency of provider communication, which diminished trust in their providers:\u201cSome of the things are -- well, some of the doctors, it\u2019s like if I\u2019m not saying anything is wrong, then they just take it that nothing\u2019s wrong. Sometimes, I wanna know -- I want the doctors to tell me. I have to question everything. Like, \u201cHas my blood pressure been good? Does my liver look good? Does my kidneys look good?\u201d I find myself trying to think of questions to ask them, that I feel like they\u2019re not tellin\u2019 me.\u201d\u2013AlabamaWhile previous statements illustrate communication gaps that may have been due to an oversight or a provider assuming a level of health literacy, the quotation below indicates that this woman living with HIV felt her providers were deliberately hiding her medical information from her. This led her to mentally prepare for her clinical visits, armed with a series of questions to elicit information sharing.Participants included 1,455 WLHIV aged between 28 and 83 years with a mean of 51.34 years (SD=9.13); 1,071 (73.6%) were African American, 211 (14.5%) White, and 146 (10.0%) other race/ethnicity, with the majority identifying their HIV providers as White (54.6%), reporting an average household income of $6,001-12,000 (35.3%), with nearly a third having completed high school (31.6%).We tested three mediation models depicted in The total effect of health literacy on trust in HIV care providers was significant , suggesting that higher health literacy is associated with higher trust in HIV providers. The indirect effect of health literacy on trust in HIV care providers was also significant , suggesting that higher health literacy leads to higher perceived patient-provider interaction quality, which in turn leads to higher trust in HIV care providers. The total effect of health literacy on ART adherence was also significant , suggesting that higher health literacy is associated with higher ART adherence. The indirect effect of health literacy on ART adherence was also significant , indicating that higher health literacy leads to higher patient-provider interaction quality, which in turn leads to higher levels of ART adherence. Similarly, the total effect of health literacy on HIV primary care visit adherence was significant , suggesting that higher health literacy is associated with greater visit adherence. The indirect effect of health literacy on visit adherence was also significant , indicating that higher health literacy is associated with higher patient-provider interaction quality, which in turn leads to fewer missed visits.The quantitative mediation analyses presented in the three figures complement the qualitative thematic findings. Themes 1 and 2 focused on aspects of the quality of provider communication, specifically the positive effects of respect and non-verbal cues and the negative effects of providers\u2019 expressions of condescension and judgement. Theme 3 centered on impacts of patient health literacy. Theme 4 focused on how provider communication influences trust. Quantitative mediation analyses indicated that higher health literacy (Theme 3) is associated with higher patient-provider interaction quality , which in turn is associated with higher levels of trust in HIV providers (Theme 4), as well as continuum of care outcomes, namely improved antiretroviral medication adherence and reduced missed visits. While the qualitative data reflect the importance of good provider communication and their own health literacy as important aspects of care for women\u2019s care satisfaction and well-being from their own perspectives, the quantitative results also link these factors to important HIV-related health behaviors. Qualitative and quantitative findings together suggest that improving provider communication and patient health literacy could have a positive impact on provider trust and women\u2019s outcomes along the HIV continuum of care.36 Through our qualitative analysis, we uncovered gaps in communication that may lead to serious medical consequences, particularly as experienced by people of color living with HIV. Through our quantitative analysis, we statistically substantiated the effects of health literacy on patient\u2019s trust of their providers, their ART adherence, and their HIV visit adherence, and suggest that these relationships work through the pathway of improving patient-provider interaction quality. While our sample only included WLHIV, these findings may also have application for patients who are not living with HIV, including those with lower health literacy and patients living with other stigmatized health conditions such as substance use disorders.Clear, unambiguous, and respectful provider communication, as well as improved health literacy are essential to quality healthcare.37 In contrast, we found that when patients experienced positive communication, they expressed greater trust toward their provider. This is noteworthy, because prior studies have shown that improved trust is associated with better patient outcomes across the HIV continuum of care,39 which was also evident in our quantitative analysis.Our findings are consistent with the existing literature on patient-provider communication and people living with HIV in that we found gaps in communication related to the use of stigmatizing language.40 Since, our sample had low health literacy and reported examples of poor provider communication, adopting the shared decision making model in HIV care settings \u2013 where providers and patients actively engaged with one another to determine the ideal care plan \u2013 could address the effects of both provider communication and patient health literacy.One pathway to address these gaps in communication and health literacy may be to promote shared decision-making in the delivery of HIV-related care. The topic of shared decision-making is becoming more prominent in discourse related to improving provision of care for underserved populations. Shared decision-making occurs when patients and providers collaborate to determine the best course of action for the patient\u2019s care, using clear respectful communication and sharing information that considers patient health literacy level. Evidence has shown that the practice of shared decision making in clinical settings improves communication between providers and patients.Qualitative data collected from focus groups and interviews can be subject to social desirability biases. Participants were recruited from a longitudinal cohort study, meaning that participants were already familiar with research and may have been more actively engaged in HIV care as compared to their peers. Since our sample was older, with an average age over 50 years, their reported experiences may be more common among older adults rather than young adults, with many having lived with HIV for a number of years. This is important, because these women may have been more comfortable with and knowledgeable about their diagnosis, and yet, they still expressed frustrations with poor communication in their healthcare settings. Our quantitative analyses were based on cross-sectional data and thus cannot provide evidence of directionality or causality.44Study findings underscore the need for more effective provider communication, identification of ways to enhance and accommodate patient health literacy, and both constructs\u2019 effects on patient\u2019s trust in her provider and her HIV continuum of care outcomes. Guidelines, recommendations, and interventions, such as the adoption of shared decision-making in clinical settings, can be used to promote higher quality provider-patient interactions potentially leading to improved clinical outcomes."} +{"text": "Previous studies have demonstrated that CorA showed distinct magnesium bound closed conformation and Mg2+-free states. In addition, CorA is regulated by cytoplasmic magnesium ions and its gating mechanism has been investigated by electron paramagnetic resonance technique and molecular dynamic simulations. Here, we report a study of the putative CorA-type channel Bpss1228 from Burkholderia pseudomallei, which has been shown to be significantly associated with pseudomallei infection. We expressed and purified the Bpss1228 in full-length. Subsequently, electrophysiological experiments further investigated the electrical characteristics of Bpss1228 and revealed that it was a strictly cation-selective channel. We also proved that Bpss1228 not only possessed magnesium-mediated regulatory property a remarkable ability to be modulated by magnesium ions. Finally, we observed the three-step gating behavior of Bpss1228 on planar lipid bilayer, and further proposed a synergistic gating mechanism by which CorA family channels control intracellular magnesium homeostasis.Magnesium is an essential element to sustain all forms of life. Total intracellular magnesium content is determined by the balance of magnesium influx and efflux. CorA is a divalent selective channel in the metal ion transport superfamily and is the major Mg Accordingly, the automated comparative protein structure homology modeling server SWISS-MODEL (http://www.swissmodel.expasy.org), was employed to produce a 3D model of Bpss1228 based on the Cryo-EM structure of CmaX from Pseudomonas aeruginosa that was extracted from the Protein Data Bank (http://www.rcsb.org). The molecular graphics system PyMOL v0.99 (http://www.pymol.org) was used to analyze the 3D model and generate the figure.The analysis of the amino-acid sequence homology and the multiple alignments of protein sequences were achieved using BLASTP database, Bioedit program. Furthermore, the alignment depiction was realized using ESPript 3.0 using gene-specific primers. The genes were inserted into the plasmid (pET22b-6His) by using ClonExpress II One Step Cloning Kit (Vazyme). E. coli BL21 (DE3) cells, containing pET22b-Bpss1228-6His, were cultured in Luria\u2013Bertani (LB) medium in presence of 50\u00a0\u03bcg/ml ampicillin at 37\u00b0C. When the OD600 reached 0.8\u20131.0, protein expression was induced with 0.4\u00a0mM isopropyl-\u03b2-D-thiogalactoside (IPTG) for 16\u00a0h at 16\u00b0C. Bacteria were collected by centrifugation at 4,000 \u00d7g for 15\u00a0min and resuspended in lysis buffer A . The cells were disrupted and lysed by high-pressure with 1\u00a0mM phenylmethylsulfonyl fluoride (PMSF). After that, the supernatant was obtained by centrifugation at 8,000 \u00d7g for 30\u00a0min and added 1% (wt/vol) n-Dodecyl-\u03b2-D-maltopyranoside (DDM) to extraction for 2\u00a0h. The supernatant was obtained by centrifugation at 18,000 \u00d7g for 30\u00a0min and then co-incubated with Ni-NTA resin (Qiagen) for 1\u00a0h. The mixture was washed with buffer B and the target protein was eluted with lysis buffer C , pH 7.8, 1\u00a0mM ethylenediaminetetraacetic acid (EDTA). The protein was further purified with size-exclusion chromatography Superose 6 Increase 10/300\u00a0GL , which was pre-equilibrated with solution buffer D . Peak fractions were determined by SDS-PAGE analysis.The gene of E. coli Polar Lipid Extract (AVANTI) dissolved in decan. All solution were buffered by 10\u00a0mM HEPES (pH 7.5). Bpss1228 proteins were added in cis-chamber to form a single channel. Titration experiments were used to examine the ability of different ions to pass through the CorA channel. After the protein was added to asymmetric solutions , the protein was embedded in the phospholipid membrane to form a channel. The membrane potential was then changed to the equilibrium potential of sodium ions. Next, a chloride solution containing 20\u00a0mM analyte ions was added to the trans-chamber. If the addition of one type of ion causes a step-like current, it indicates that the channel is permeable to that type of ion. In titration experiments, the currents induced by the addition of divalent ions were normalized to compare their ability to penetrate CorA channels. The signal was filtered with a low-pass Bessel filter at 5\u00a0kHz. Clampfit and Origin software were used to analyze the data. All representative current traces were filtered with 800\u00a0Hz.The currents of purified Bpss1228 were recorded by on a HEKA patch clamp amplifier (HEKA USB10) with a sampling frequency of 10\u00a0kHz at 25\u00b0C. Planar lipid bilayers were prepared using T. maritima. TmCorA primary structure is divergent, but we also note the presence of negatively charged residues in the cytoplasmic regions of all CorA homologs. It is likely that these residues are conserved due to the specific nature of CorA binding to divalent cations. Furthermore, multiple but slightly different magnesium binding sites were identified in both TmCorA and MjCorA, which are the molecular basis for intracellular Mg2+ sensing and allosteric gating regulation. This is consistent with the widespread of negatively charged residues in Bpss1228, suggesting that it is also regulated by magnesium ions.To investigate the properties of Bpss1228, we performed a sequence alignment with . TmCorA , E. coli. EcCorA , Methano. MjCorA , and Arc. AfCorA and purified by Ni-chelating chromatography. Based on the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and gel filtration (n = 62), and the fitted curve shows three distinct peaks at 0.61\u00a0nS (53/62), 1.25\u00a0nS (6/62) and 1.82\u00a0nS (3/62), which is obviously due to the different number of Bpss1228 channels inserted in membranes, as these values increase in approximately equal proportions. With this statistical method, we consider the conductance of a single CorA-channel is 0.61\u00a0nS in an asymmetric 30/300\u00a0mM (trans/cis) NaCl buffer condition.The planar lipid bila protein , phi29 c protein , PANX1 + could permeate through the Bpss1228 channel, as gluconate is an impermeable anion, whose dimension is much larger than 4\u00a0\u00c5 at the narrowest constriction of the CorA channel (To better study the channel activity and ion selectivity of the Bpss1228 protein, we conducted single-channel measurements in symmetrical or asymmetrical buffer conditions . In the channel . When we channel . This re2+, Zn2+, Co2+, Ni2+, and Ca2+. The order of the relative cation permeability of CorA channel is as follows: current change IMg > IZn > ICo > INi > ICa (Ion specificity is a basic property of ion channels. To evaluate ion specificity of Bpss1228 channel, we calculated the selectivity of Bpss1228 channel for various divalent cations by titration assays Sun et . In the Ni > ICa . Taken t2, the step-wise gating was observed at 100\u00a0mV, but not observed at \u2212100\u00a0mV (2 (2, the channel gating occurred at either 100 or \u2212100\u00a0mV (2+ though the channel, and the gating was affected by Mg2+ rather than the sequence of applied voltages.Numerous studies have shown that the CorA protein is gated by magnesium ions . In orde \u2212100\u00a0mV . From th \u2212100\u00a0mV , it can 00\u00a0mV (2 and, uns \u2212100\u00a0mV . In thes2+-free solutions (2+ complexes (To further demonstrate the channel gating induced by magnesium ions and describe the channel gating behavior, we recorded representative current traces of the Bpss1228 channel under two different buffer conditions at 150\u00a0mV . The Bpsolutions . In elecolutions . This deomplexes . In concin vitro. We confirmed that the Bpss1228 has channel activity and uniform conductance, based on these results, we confirmed the Bpss1228 protein is cation-selective channel. Although the current study identifies CorA as a cation-selective channel and little has been reported about its permeability to anions, it will be very interesting to study various other anions. Furthermore, the Bpss1228 channel is permeable to a variety of divalent cations tested including Mg2+, Zn2+, Co2+, Ni2+, and Ca2+. Finally, we found that Bpss1228 is not only selectively permeable to magnesium ions in electrophysiological experiments, but also exhibits a specific gating behavior when encountering magnesium ions. Generally, we demonstrated a stepwise gating behavior of Bpss1228 on planar lipid bilayers and further confirmed the gating mechanism of CorA family proteins regulated by magnesium ions. Our results indicate that the gating behavior induced by magnesium ions is sequential, suggesting that magnesium ions act as ligands to progressively stabilize adjacent subunits of CorA.CorA family channels play an indispensable role in most biological magnesium homeostasis. In this study, we characterized the Bpss1228 protein as a typical CorA-type channel by sequence comparison and homology modeling. Subsequently, we purified the Bpss1228 protein and further reconstituted it into a planar lipid bilayer"} +{"text": "Gliomas are amongst the most common primary brain tumours in adults and are often associated with poor prognosis. Understanding the extent of white matter (WM) which is affected outside the tumoral lesion may be of paramount importance to explain cognitive deficits and the clinical progression of the disease. To this end, we explored both direct and indirect approaches to quantifying WM structural disconnections in a cohort of 44 high- and low-grade glioma patients. While these methodologies have recently gained popularity in the context of stroke and other pathologies, to our knowledge, this is the first time they are applied in patients with brain tumours. More specifically, in this work, we present a quantitative comparison of the disconnection maps provided by the two methodologies by applying well-known metrics of spatial similarity, extension, and correlation. Given the important role the oedematous tissue plays in the physiopathology of tumours, we performed these analyses both by including and excluding it in the definition of the tumoral lesion. This was done to investigate possible differences determined by this choice. We found that direct and indirect approaches offer two distinct pictures of structural disconnections in patients affected by brain gliomas, presenting key differences in several regions of the brain. Following the outcomes of our analysis, we eventually discuss the strengths and pitfalls of these two approaches when applied in this critical field.The online version contains supplementary material available at 10.1007/s00429-022-02494-x. Gliomas constitute the most common malignant primary brain tumours in adults, and are associated with significant morbidity and mortality is the instrument of choice, as it allows to extract the state and directional information of WM fibres through modelling the random motion of water molecules occurring in the different brain regions. Through dMRI, patterns of WM structural disconnections can be derived exploiting the so-called indirect or direct approaches:Given the intrinsic difference between direct and indirect approaches, the aim of this study is to propose a quantitative comparison between them. We apply simple but effective image analyses to evaluate benefits and criticalities of both, highlighting points of agreement and divergence in terms of WM disconnection information that can be derived. Moreover, as the oedematous tissue appears to play a crucial role in defining tissutal regions which are subject to inflammation, favourable pathways for tumour spreading, we additionally investigate how patterns of structural disconnections are quantified when the oedematous tissue is included in the definition of pathological lesions.Forty-four patients suffering from de novo brain tumours have been recruited and acquired at the University Hospital of Padova from July 2017 to March 2021. All procedures were in accordance with the ethical standards of the institutional research committee and with the 1964 Helsinki declaration plus later amendments. All participants provided informed, written consent in accordance with the local University Hospital Institutional Review Board.3; FOV 220\u2009\u00d7\u2009220 mm2; 68 slices; multiband accelerator factor\u2009=\u20092): 10 images at b\u2009=\u20090\u00a0s/mm2, 30 DWIs at b value\u2009=\u2009710\u00a0s/mm2 and 60 DWIs at b value\u2009=\u20092855\u00a0s/mm2. This High Angular Resolution Diffusion Imaging (HARDI) protocol is the optimized two shells Neurite Orientation and Dispersion Density Imaging (NODDI) protocol as described in , two 3D T1-weighted (T1w) magnetization-prepared rapid acquisition gradient echo acquired both before and after contrast agent injection and a T2w image .In addition, the acquisition protocol included anatomical imaging, which comprised a 3D T2-weighted (T2w) Fluid Attenuated Inversion Recovery (FLAIR) image by an expert neuroradiologist with more than 5\u00a0years of experience. The first mask, the T, included the tumour core (contrast agent enhancing and non-enhancing regions) and the necrosis, where present. The second mask, the T\u2009+\u2009O, was created by adding the oedema area to the T mask. In addition, each tumour was labelled by the same neuroradiologist as left, right, or bilateral according to the location of its core and to the mainly involved hemisphere. A detailed description of how the segmentation was performed is provided in Supplementary Material Sect.\u00a02.2 and Supplementary Table 1.The anatomical images of each patient were linearly registered to the patient na\u00efve T1w image with the Advanced Normalization Tools to the symmetric MNI152 atlas. The last step was performed excluding the T\u2009+\u2009O area from the computation of the cost function as suggested in for B0 inhomogeneity, eddy current, and motion joint correction.T1w segmentation results were registered to the na\u00efve B0 volume using ANTs, by applying an affine transformation previously estimated on the patient\u2019s na\u00efve T1w image.Diffusion tractography specifications The reconstruction of patient\u2019s whole brain tractogram was performed in its entirety within the MRtrix3 software. We first performed multi-shell multi-tissue spherical deconvolution the manually segmented lesion mask. Individual fibre tracking was performed with a second-order Integration over Fiber Orientation Distributions (FOD) algorithm . The number of generated streamlines for each patient initially amounted to 100\u00a0M, which were quantitatively reduced to 10\u00a0M via the Spherical-deconvolution Informed Filtering of Tractograms framework and the second related to the lesion mask (T\u2009+\u2009O mask). The computation consisted in the following two steps:T and with T\u2009+\u2009O masks).We identified the subset of the streamlines in the tractogram that featured a non-null overlap with the tumoral lesion maps these voxel-wise frequency maps.We used in-house MATLAB scripts to perform the creation of the dSD maps.Similarly to the dSD map quantification, we computed for each subject in the dMRI space a voxel-wise track-density map the obtained map, summing the flipped and non-flipped maps, and dividing by 2.Using the same transform as in 2, we projected back the population-averaged track-density map to the T1w space of each subject. We referred this resulting map as AvgDensity.x,y,z) as significant if the following criterion was met: dSD/AvgDensity\u2009>\u200910%.Finally, we considered the structural disconnection value of voxel with coordinates .Hence, for each patient, we obtained a mask of significantly disconnected voxels.Indirect structural disconnection (iSD) maps were quantified with the BCB Toolkit v. 4.2 in the MNI152 space were registered to each control na\u00efve space using affine and diffeomorphic deformations and subsequently used as seed for the tractography in TrackVis (http://trackvis.org). Tractographies from the lesions were transformed in visitation maps, binarized and brought to the MNI152. Finally, the percentage overlap map was computed by summing at each point in the MNI152 space the normalized visitation map of each healthy subject. Hence, in the resulting disconnectome map , the value in each voxel considers the tracts\u2019 interindividual variability and indicates a probability of disconnection from 0 to 100% for the given lesion.In summary, using the BCB Toolkit, for each patient, the lesion masks .T and T\u2009+\u2009O), we wanted to compare them both intra-methodology and inter-methodology . Before comparing the maps obtained through the two methodologies, the SD maps were masked, using the lesion mask (T or T\u2009+\u2009O) employed to generate the SD maps. The analyses described hereafter are based on the masked SD maps.Having obtained a total of four different SD maps This metric allowed us to quantify the difference in the extension of alteration which is detected by two disconnection maps.The Dice Similarity index (Dice) The S\u00f8rensen-Dice similarity index is a well-known metric of comparison between digital images and is defined by the following formula:where A, B are the two binary matrices for which the similarity needs to be tested. The Dice index quantifies how similar the shape of structural alterations is between two different approaches.The correlation at the intersection (Corr) We computed the Pearson correlation in a region of interest defined by the intersection of the two matrices in exam. Unlike the Dice index which evaluates only the similarity between shapes, the correlation analysis considers where the hotspots of alteration are in the two SD maps and measures their spatial agreement.The framework we employed for their comparison had three simple metrics, useful to quantify different similarity features:While the \u0394Vol and Dice metrics were calculated using the binarized disconnection maps, the Corr index was computed using the thresholded SD maps.The Dice and the \u0394Vol indexes were computed both considering the entire disconnection maps and subdividing them into their ipsilateral and contralateral components .To summarise the obtained indexes, we computed the median value and the 25th/75th percentiles across all subjects for each metric of comparison., both considering intra-method and inter-method results at the whole brain or considering only the ipsilateral or contralateral hemisphere, a Wilcoxon rank sum test (significance level \u03b1\u2009=\u20090.05) was employed.To test for statistically significant differences in the \u0394VolT and T\u2009+\u2009O masks. To test the sensitivity of the comparison metrics to the set of thresholds used for the dSD/iSD maps, we defined their normalized range of variation (nRV) asTo assess whether there was a linear relationship between the comparison metrics and the extension of the input mask, we performed a correlation analysis between the three indexes and the volume of the input mask, separately for T\u2009+\u2009O mask ranged between 5.7 and 191.6 cm3 , whereas the extent of the T mask between 0.4 and 155.9 cm3 .Patient's main demographic and clinical information are summarized in Table T (first two rows) and to the T\u2009+\u2009O masks (second two rows). The distribution is sparse with tumours involving predominantly the right frontal and temporal lobes, with a low spatial overlap .Figures T+O,dSDT+O)\u2009=\u2009\u2212 28.05 cm3; \u0394Vol\u2009=\u2009\u2212 4.8 cm3; Dice\u2009=\u20090.51; Dice\u2009=\u20090.51; Corr\u2009=\u20090.45; Corr\u2009=\u20090.43)). While the displacement of fibres is less visually appreciable in panel B, differences between approaches are still present \u2009=\u2009\u2212\u00a021.1 cm3; \u0394Vol\u2009=\u2009\u2212\u00a04.1 cm3; Dice\u2009=\u20090.59; Dice\u2009=\u20090.51; Corr\u2009=\u20090.41; Corr\u2009=\u20090.33)). Looking at the SD maps intra-methodology, i.e., comparing between T and T\u2009+\u2009O maps, the difference is less self-evident and, apart from a few areas where T\u2009+\u2009O maps show more extensive structural disconnections, we find analogous behaviours and morphological features. While \u0394Vol remains high, suggesting the presence of volumetric differences between the maps, this is well reflected by the Dice and Corr metrics being sensibly higher, both in A. \u2009=\u200925 cm3; \u0394Vol\u2009=\u200915.17 cm3; Dice\u2009=\u20090.74; Dice\u2009=\u20090.84; Corr\u2009=\u20090.79; Corr\u2009=\u20090.89)) and in B. \u2009=\u200939.36 cm3; \u0394Vol\u2009=\u200922.40 cm3; Dice\u2009=\u20090.75; Dice\u2009=\u20090.85; Corr\u2009=\u20090.92; Corr\u2009=\u20090.86)).Figure\u00a0T\u2009+\u2009O is used as input mask . In addition, we obtained a good agreement between the compared maps highlighted both by Dice and by Corr indices, suggesting that in both cases, analogous spatial patterns of disconnection were detected. On the other hand, the inter-method comparison revealed that: (1) the detected volume of disconnection is significantly lower at the whole brain and ipsilateral level for the indirect method when the T\u2009+\u2009O mask is used overall, there is a decrease in the agreement of the disconnection location with a median Dice value of 0.57; (3) there is a poor agreement of the disconnection pattern with a median Corr value of 0.45 and 0.39, respectively, for the T and T\u2009+\u2009O input masks.Generalizing Fig.\u00a0As shown in Supplementary Fig.\u00a08, no significant linear relationship was found between the extension of the input map and the similarity of dSD/iSD maps.T+O(\u0394Vol)\u2009=\u2009280.34%, nRVT(\u0394Vol)\u2009=\u2009210.34%). Morphology similarities were more consistent (nRVT+O(Dice)\u2009=\u200935.58%, nRVT(Dice)\u2009=\u200929.53%), as well as the agreement of hotspot locations (nRVT+O(Corr)\u2009=\u200926.58%, nRVT(Corr)\u2009=\u200931.32%). Shifting to intra-methodology comparisons (blue circles and purple squares in the figure), as expected, we found a more stable situation. Again, volumetric measures were the most variable across thresholds (nRVT+O(\u0394Vol)\u2009=\u200952%, nRVT(\u0394Vol)\u2009=\u200948.24%), and an even higher consistency was found considering the Dice (nRVT+O(Dice)\u2009=\u20094.79%, nRVT(Dice)\u2009=\u20092.45%), and Corr indexes (nRVT+O(Corr)\u2009=\u20094.79%, nRVT(Corr)\u2009=\u20093.91%).Figure\u00a0Throughout the recent years, several warnings have been raised against the use of indirect approaches to investigate the disruption of structural connectivity in neoplastic pathologies, as physio-pathological phenomena such as tissue displacement .The sensitivity analysis to the thresholds for indirect and direct disconnection maps revealed that volumetric indexes are moderately dependent on such choice, potentially altering the interpretation of its results.We are aware there are some limitations to our work. First and foremost, the structural disconnection maps must be thresholded to make any inference regarding the volume and shape of the detected disconnections. This choice is non-trivial, and while there are some literature indications for indirect methodologies /false-positive (FP) connections are well-known issues in the field, and both indirect and direct methodologies may be affected by them with various degrees Below is the link to the electronic supplementary material."} +{"text": "Restoratively driven implant planning in the posterior maxilla requires a comprehensive understanding of the anatomical and physiological changes of the alveolar bone following tooth extraction and sinus augmentation. As a part of restoratively driven planning, alveolar bone, inter-arch relationships, proposed crown-implant ratio and anticipated non-axial loading should be assessed pre-operatively. This helps determine the prosthodontic and surgical aspects of implant treatment, such as prosthesis design, implant number, implant angulation, implant length and the necessity for additional bone grafting procedures. However, currently no implant planning classification is restoratively driven and include these important prosthodontic considerations. Therefore, a new index - the Posterior Maxilla Prosthodontic Index - is defined to encourage restoratively driven implant planning in the posterior maxilla. This review describes the clinical aspects that influence prosthodontic planning in the atrophic posterior maxilla.Assessment of anatomical and biomechanical factors affecting prosthesis and implant design in the posterior maxilla are discussed.The Posterior Maxilla Prosthodontic Index proposed in this article identifies the prosthodontic aspects of clinical examination and treatment planning required for restoratively driven implant planning in the posterior maxilla. The design of the planned prosthesis should be ascertained first and all stages of prosthesis design, implant placement and tissue augmentation should be determined with the definitive prosthesis in mind. Most classifications relevant to implant planning in the posterior maxilla assess the severity of bone resorption, which in turn helps determine case complexity. However, the majority primarily focus on the surgical aspects of treatment, such as implant position, implant placement protocols and adjunctive bone augmentation. Very few include details of prosthodontic planning, and none focus primarily on restoratively driven planning.2 A new classification, the Posterior Maxilla Prosthodontic Index (PMPI), is proposed to promote restoratively driven planning for implants in the posterior maxilla.The aim of this paper is to promote restoratively driven planning by describing the prosthodontic considerations to plan implants in the posterior maxilla, with a focus on augmented maxillary sinuses. It is not in the remit of this article to describe the surgical stages of maxillary sinus augmentation or implant placement in detail; therefore, further reading in these areas is encouraged.1 decisions for the implant rehabilitation of the posterior maxilla can begin. Planning restorations in the posterior maxilla requires comprehensive knowledge of how alveolar anatomy and interocclusal functional forces will influence prosthesis design, implant planning and any adjunctive surgical procedures. Surgical decisions, such as implant position, angulation and length, will influence the dissipation of occlusal forces through the prosthesis, implant and surrounding bone. Prosthetic factors, such as prosthesis height and cantilevered design, will affect the degree of non-axial loading and it is important to understand the associated biological and biomechanical consequences with such restorations. Augmentation procedures, such as maxillary sinus or alveolar ridge augmentation, can help overcome certain surgical and prosthodontic constraints to improve final prosthesis delivery and thus should be considered as part of restoratively driven planning. Following intra-oral bone assessment (Part 1),3 Likewise, it is important to assess the degree of horizontal bone loss and how this may impact treatment planning. As most resorption occurs buccally, the resulting maxillary ridge is often sited palatal to its original position. Thus, the ideal positioning of teeth and implants in relation to the opposing occlusion can be compromised. Impressions, accurately mounted study models and a diagnostic wax-up of the definitive tooth position should be performed at the earliest convenience to identify the pattern of alveolar resorption and identify suitable prosthetic or surgical treatment options.Sinus grafting provides adequate bone height within the sinus to place dental implants; however, it does not correct compromised vertical or horizontal inter-arch relationships. It is essential to assess the IAD to establish whether the vertical height discrepancy can be accounted for in the prosthesis design, or whether vertical ridge augmentation is indicated. However, it must be stressed that the outcome of vertical ridge augmentation is unpredictable and therefore accounting for the vertical height defect through prosthetic design is often necessary.4 However, an implant has significantly different anatomy to natural maxillary molar teeth. Implants are conical in shape, with the coronal portion positioned in cortical bone and the apical portion in highly cancellous and/or grafted bone. Furthermore, with the absence of a periodontal ligament, the implant-bone interface absorbs all the occlusal forces. Occlusal forces transfer from the prosthetic components to the implant, the implant-bone interface and finally, the surrounding bone, mostly at the crestal bone, with some dissipating at the middle and apical thirds.5 Depending on magnitude and direction of occlusal forces, it is possible for the maxillary native and/or grafted bone to become overloaded with insufficient prosthodontic and surgical planning, with the crestal bone being most at risk of pathological overload.Teeth are naturally shaped to dissipate occlusal forces axially through the tooth into the alveolar bone. Maxillary molars typically have three roots which extend up the buccal cortices of the maxillary alveolar process. The buccal cusp of the mandibular molars occludes with the central fossa of the maxillary molars, directing occlusal forces axially. Axial forces are dissipated favourably through the tooth, periodontal ligament and alveolar bone.Increased inter-arch distance following post-extraction resorption can typically be overcome through prosthesis design: vertical discrepancies are overcome using an increased crown-implant ratio (C:I) and horizontal discrepancies can be overcome using cantilevered restorations or tilted implants. However, the resulting prosthesis risks transferring non-axial forces through the implant into the surrounding bone. It has been theorised that non-axial occlusal forces have the potential to cause biologic and technical complications. This is particularly relevant in the posterior maxilla considering the less favourable bone anatomy and strength.6 Traditional prosthodontic principles suggest a minimum C:I of 1:1 for abutment teeth.7 To avoid overloading of implants, these traditional prosthodontic principles have been applied to the C:I of implant-retained prostheses. The C:I defines the relationship between the length of the crown and the length of the implant. The C:I can be defined in two ways: 1) prosthodontically, whereby the crown-implant boundary is between the crown margin and the implant platform; and 2) clinically, whereby the crown-implant boundary is between the crown/abutment/implant collar and the level of the bone. For the purpose of this article, the clinically defined boundary is used to define C:I. Unfavourable C:Is cause non-axial loading as the longer crown acts as a lever arm, creating bending moment and transfer of occlusal forces to the peri-implant crestal bone , most occlusal stress is transferred to the native cortical bone and high levels of stress transfer to the immature graft.10,11 When the graft becomes a similar stiffness (mature graft) to the native bone, there is a more equitable stress distribution between native and grafted bone, therefore suggesting early loading could lead to overloading of the native and grafted bone.10,11 Furthermore, non-axial loading causes 11 times more stress in the surrounding bone compared to axial loading, and when the crown height is increased from 10 mm to 20 mm, forces can increase up to 200%.12 These photoelastic models suggest early loading and non-axial loading risk of overload of native and grafted bone. Unfortunately, due to a lack of clinical evidence, it is unknown whether these findings are accurate in vivo. However, systematic reviews have determined that unfavourable C:Is do not have any discernible negative clinical effects on marginal bone levels.13,14 Likewise, recent systematic reviews have suggested that peri-implant bone loss is not influenced by cantilever extensions of implant-supported prostheses or tilted implants.15,16 It is important to note that these studies have been conducted on short or tilted implants in native bone and further research is required to establish the clinical effects of non-axial loading for implants in augmented maxillary sinuses.In vitro evidence suggests that increased crown height does not influence the stress distribution on implant screws during axial loading; however, during non-axial loading, crown heights over 12.5 mm caused statistically significant increase to the stress distribution and potential damage to implant screws.17 Furthermore, increased crown height has shown to negatively affect the resistance of internal implant connections to external occlusal forces and can lead to a reduction of performance and resistance to the connection system in vitro.18 There is currently no evidence to confirm whether these observations are true clinically for unfavourable C:Is, cantilevered restorations or tilted implants.16Considering the limited evidence, it is prudent that fixed implant-retained prostheses are designed to reduce non-axial loading to protect native and grafted bone and prosthetic components. The design features listed in in situ determines the appropriate implant position, number, length and diameter to support the planned prosthesis. In the posterior maxilla, certain additional factors are considered with regards to implant planning.The stages of restoratively driven planning, including impressions , diagnostic tooth set-up and cone beam computed tomography scanning with a radiographic guide in vitro.19 However, a recent systematic review showed no clinical difference between intentionally tilted versus straight dental implants in the medium- to long-term (>5 years).20 It is important to note that the maxillary tilted implants included were in native bone in the premolar region with the aim to avoid the maxillary sinus region. Thus, it is unknown if implants placed more posteriorly or in augmented sinuses would have the same clinical outcome.Ideally, implants should be planned in a straight configuration in relation to the prosthesis. Multiple implants should be placed parallel to one another. This ensures that the majority of occlusal load transfers down the long axis of the prosthesis and implants, thus reducing the risk of non-axial loading. Significantly increased microstrain has been detected around tilted straight and offset implant placement under axial and non-axial loads in implant-supported prostheses implants placed compared to a straight configuration Currently, no studies have evaluated the optimum number of implants required to support fixed restorations replacing multiple teeth in relation to success and survival of implants in the posterior maxilla or augmented maxillary sinuses. Therefore, recommendations for the number of implants required are based on expert opinion and clinical experience. When it comes to planning such cases, the number of implants required to support multiple teeth is dependent on the bone strength and volume, which is often compromised in the posterior maxilla and augmented sinuses. Therefore, it is sensible to place a minimum of one implant per missing tooth for fixed implant-supported restorations when restoring short-span edentulous spaces (\u22643 teeth).21 Therefore, implant length beyond this measurement does not counteract the effect of a reduced C:I. Encouragingly, recent high-quality systematic reviews comparing short implants (\u22648 mm) in native bone to longer implants in augmented sinuses report that short implants placed in the posterior maxilla have good short-term success and survival rates.22,23,24 However, further randomised controlled trials with larger patient samples and an observation period of more than three years are needed, as well as more detailed data regarding success and survival of the associated prosthetic components.Clinicians have anecdotally used the longest implant possible to ascribe to traditional prosthodontic principles of ideal C:Is. Although longer implants allow for a greater surface area of osseointegration, most forces applied to the implant body are concentrated in the crestal 7-9 mm of bone.21 Wide diameter implants are recommended in the maxillary sinus region, with regular diameter implants acceptable . Narrow diameter implants are contraindicated in the maxillary sinus region due to the lower bone: implant contact and reduced strength of narrow implant components.Occlusal forces applied to the implant body concentrate in the crestal 7-9 mm of bone, therefore increasing implant diameter is an effective method of increasing bone: implant contact in the crestal region.It is important to consider provisionalisation in relation to implant success, particularly in relation to augmented maxillary sinuses. The aim is to eliminate movement of the implant and/or bone graft during healing, while providing the patient with acceptable function and aesthetics. For the first two weeks following implant or bone augmentation surgery, patients are advised against wearing a removable prosthesis to prevent pressure on the surgical site. Following the acute post-operative period, it is important to consider how implant loading affects the healing of the implant and augmented sinus before deciding upon a provisional prosthesis.25,26 Therefore, it is advised to allow 6-9 months of graft healing before functionally loading implants in augmented maxillary sinuses to allow for osseointegration and maturation of the grafted bone. It is now recognised that in certain clinical situations, controlled, immediate and early loading protocols do not interfere with implant osseointegration.27,28 For immediate or early implant loading, good primary stability must be achieved with an insertion torque values of >20-45 N/cm and implant stability quotient of >60-65 recommended.29 As posterior maxillary bone is often of the poorest strength, primary stability can be compromised and immediate implant loading is contraindicated. However, there has been increased reporting of the early loading of implants placed with simultaneous maxillary sinus augmentation.30,31,32 The results from two small clinical studies suggest that early loading of implants in the augmented maxilla does not affect implant survival. Caution is advised when extrapolating these results, as a very small number of patients were included and follow-up times were under one year.30,31 A higher-quality preliminary randomised controlled trial assessed implant survival in relation to the timing of sinus augmentation, implant placement and functional loading.32 The results showed that immediately restored implants, regardless of the timing of bone augmentation, had greater failure rates. The group with sinus augmentation at the time of implant placement with immediate loading was discontinued due to low insertion torque values and one implant failure. When traditional healing and loading protocols were followed , implant survival rates were the highest (100% at one year).32 Based on the current evidence, it is recommended that a graft consolidation period of six months, followed by an implant healing period of six months, is permitted before functionally loading implants placed in augmented sinuses for optimum success rates.The literature regarding different loading protocols for implants in augmented maxillary sinuses is limited due to a lack of long-term data, absence of randomised controlled trials and limited studies with large numbers of patients. Histological evaluation of implants placed in autogenous and deproteinised bovine bone grafts following six months healing and subsequent loading show direct bone-implant contact and a similar bone density to native bone.33 Progressively loaded bone reacts by increased formation, maturation and density, which can result in reduced crestal bone loss and early implant failure.33 Progressive bone loading can be considered for implants in augmented maxillary sinuses.Progressive bone loading using modification of provisional prostheses over a period of time has been recommended in sites of poor bone density. Misch showed that bone matures when tension during the prosthetic phase increases gradually without overloading the implant.Provisional restorations should be designed to minimise occlusal loads on the healing implant and consolidating graft. As already discussed, patients should avoid wearing a removable prosthesis for two weeks post-operatively to prevent impingement of the graft and soft tissue. After a recommended minimum implant osseointegration period of four months in native bone or six months in grafted bone, a definitive restoration can be provided. Definitive restorations should be designed to reduce biomechanical load and prevent overload of the native and/or grafted bone. This can be achieved by considering the direction of load, occlusal design, cantilever length and splinting.34 Careful occlusal design will also influence the intensity, direction and transfer of occlusal forces. It is recommended that initial light occlusal contacts occur on the natural dentition just before light contacts on the implant prosthesis in intercuspal position, with the idea that the periodontal ligament will absorb the majority of occlusal forces, thus minimising load on the implant(s). To prevent non-axial loading, no occlusal contacts should be present on implant-retained prostheses during excursive movements. Shallow cuspal inclinations and centrally oriented contacts will reduce lateral loads. A reduced occlusal table using narrower teeth or replacing fewer teeth will reduce occlusal load on the implant and graft.To optimise the dissipation of occlusal forces through the implant and bone, the aim should be to position implants in the ideal prosthodontic position in a straight configuration. A favourable C:I (<1:1) will reduce lever-arm forces and risk of crestal bone overload. The direction of occlusal load through the implants and surrounding bone is influenced by prosthodontic design. Avoidance of cantilevers will reduce the risk of non-axial loading. Cantilever lengths should be shortened or eliminated by planning a restoratively positioned implant, aiming to replace one implant per missing tooth. When multiple implants are placed to restore multiple teeth, splinting the implants via the restoration framework should be considered to control occlusal force distribution. Photoelastic analysis suggests that splinting implants improves stress distribution, improves retention and reduces stress on implant components.in vitro studies have assessed material choice in relation to occlusal loading for implant-retained restorations. Acrylic resin and reinforced composite have been shown to transmit 25% and 15% less occlusal force than porcelain, respectively.35 However, the use of acrylic and composite as veneer materials does not seem to have a protective effect on the implant-bone interface.36 Regarding the framework material, alloys with a lower elastic modulus do not show substantial differences in stress patterns at the implant-bone interface of around the implant screw in finite element analysis.37 However, there are no clinical studies available to substantiate these results.Numerous It is important to note that all restoration designs should prioritise cleansibility and minimal plaque retention for optimum long-term maintenance. The ability to brush and perform interproximal cleaning to the implant is essential to maintain the peri-implant tissues. By making all the mucosa-facing surfaces convex and polished, plaque retention will be minimised. All patients should be educated about how to clean around their implant-retained restoration.When restoring implants in the posterior maxilla, the prosthesis should be designed to reduce or mitigate non-axial forces on the prosthesis, implants, and native and grafted bone. Cases with increasing prosthodontic complexity increase the probability of non-axial loading, thus risking occlusal overload. To assess prosthodontic complexity, the prosthodontic envelope needs to be considered pre-operatively in a horizontal and vertical dimension using a diagnostic tooth set-up with the tooth/teeth in the ideal prosthodontic position. This enables planning of the appropriate prosthesis design, implant position and potential need for bone augmentation.To help establish the prosthodontic complexity of a case, the following factors should be assessed with the diagnostic try-in in situ: crown-ridge position (CRP), IAD and C:I. The CRP assesses the horizontal prosthodontic envelope and refers to the bucco-palatal position of the crown(s) on the diagnostic try-in to the edentulous ridge . The IADThe horizontal prosthodontic envelope can be assessed using the CRP with the crown(s) in the ideal prosthodontic position. With minimal buccal resorption, the crown(s) are centred over the ridge and the implant(s) can be placed in a straight configuration . An opti8 Accepting non-optimal occlusal relationships can overcome the need for bone augmentation by accepting palatally positioned implants placed in a straight configuration and designing a prosthesis that corresponds with the long axis of the implant(s). This approach maintains axial loading; however, cross bites can result in reduced bite force and asymmetrical muscle function during chewing or clenching.39 To achieve the ideal implant position in relation to prosthesis design for horizontal ridge defects, ridge augmentation using guided bone regeneration or block grafting is indicated. If bone augmentation is contraindicated, a removable flanged prosthesis may be necessary.Buccally cantilevered prostheses, angled implants or non-optimal occlusal schemes can overcome the need for adjunctive bone grafting procedures. Buccally cantilevered prostheses position the crowns in the ideal prosthodontic position, with the implant(s) being placed in a straight configuration in a palatal position . With inBox 1 Case 1PMPI: simple horizontal, simple verticalA 53-year-old woman attended for replacement of the 16 following loss of her tooth due to cariesHorizontal and vertical assessment of the prosthetic envelope was performed using a diagnostic wax-up and tooth try-inCRP assessment identified horizontal resorption of less than 2 mm was present allowing the crown to be centred on alveolar ridge in the buccolingual positionIAD assessment identified vertical resorption of 1-2 mm was present enabling the cervical margin of the crown to be situated close to the alveolar ridge thus enabling optimal tooth height The diagnostic wax-up and tooth try-in showed the ideal prosthodontic position was achievable with no ridge augmentation requiredRadiographic examination identified approximately 8 mm from the crest of ridge to the sinus floor. To achieve an optimal C:I of 1:1, sinus augmentation would be requiredA transcrestal sinus augmentation was performed at the time of implant placement to enable 10 mm implant to be placed to achieve an optimal C:I of 1:1A straight implant configuration was achieved with the crown in the ideal posterior occlusal relationshipA crown of normal clinical crown height was placed.Box 2 Case 2PMPI: moderate horizontal, simple verticalA 30-year-old woman attended for replacement of the 26 and 27 following loss of tooth due to cariesCRP assessment identified horizontal resorption of 3 mm (moderate) from the buccal aspect of the ridge was presentIAD assessment identified less than 2 mm of vertical resorption was present Radiographic examination revealed that there was less than 5 mm of alveolar ridge height present in the 26 and 27 region. Sinus augmentation would be required for implant placement and plan a favourable C:I of 1:1A lateral window sinus augmentation was performed, and two 10 mm implants were placed following a graft consolidation period of seven monthsA straight implant configuration was achieved. An ideal posterior occlusal relationship was achieved with buccally cantilevered single crownsCrowns of normal clinical crown height were provided.Box 3 Case 3PMPI: complex horizontal, complex verticalA 72-year-old woman attended requiring the restoration of implants placed in the left posterior maxilla. The implants had been placed by another dentist who was unable to restore themCRP assessment identified horizontal resorption of greater than 6 mm (severe) from the buccal aspect of the ridgeIAD assessment identified greater than 6 mm of vertical resorption was present (severe)Radiographic examination revealed that a 12 mm (24), a 10 mm (25) and an 8 mm (26) implant were presentThe implants had been angled buccally to position the prosthesis in the ideal horizontal position. However, a buccally cantilevered prosthesis was still required to achieve the ideal posterior occlusal relationshipIncreased clinical crown height was required to overcome the increased IAD. Due to the good availability of vertical bone height, longer implants were placed, and C:Is of 0.75:1, 1:1 and 1.2:1 were achieved in the 24, 25 and 26 sites, respectivelyIt must be noted that this treatment option significantly increased the complexity of prosthodontic delivery due to compromised access to the implant platform and the fabrication of custom angled abutments. The definitive restoration was cement-retained and a buccal cantilever of approximately 1-2 mm remained which risks oral hygiene problems and increased non-axial loading.38 C:Is between 1:1 and 2:1 are considered unfavourable but have not been associated with biological complications from the buccal aspect of the ridgeIAD assessment identified 4-5 mm of vertical resorption was present (moderate)Radiographic examination revealed that there was less than 5 mm of alveolar ridge height present in the 26 and 27 region. Sinus augmentation would be required for implant placement and an unfavourable C:I would be accepted due to the increased IADA lateral window sinus augmentation was performed and an 8 mm implant in the 26 and a 10 mm implant in the 27 sites were placed following a graft consolidation period of eight monthsA straight implant configuration was achieved with the crown in the ideal posterior occlusal relationshipCrowns of increased clinical crown height were provided and a C:I of 2:1 was accepted. The crowns were splinted to improve the biomechanical loading on the implants and prosthetic components.42,43,44 The full PMPI is available in Due to the unique challenges associated with planning and providing implant-retained prostheses in the posterior maxilla, the PMPI has been developed to help initiate restoratively driven implant treatment planning. The PMPI is intended to be used at the diagnostic tooth try-in stage to assess the prosthodontic treatment options available to overcome implant-related restorative challenges in the posterior maxilla. Comprehensive alveolar bone assessment at the diagnostic tooth try-in stage helps identify whether unfavourable anatomical factors can be overcome through prosthesis design, or whether further surgical intervention is necessary. The PMPI is to be used alongside other aspects of clinical investigation, which should include clinical and radiographic assessment of the dentition, alveolar bone assessment and sinus floor position. The PMPI has been developed as an adjunctive tool to be used alongside other surgical planning indices for implant and bone augmentation in the posterior maxilla so that prosthodontic and surgical treatment options can be systematically assessed at the outset of treatment.in situ, assessment of the horizontal and vertical prosthodontic envelope is undertaken using CRP, IAD and C:I.A diagnostic tooth try-in with the prosthodontic teeth in the ideal prosthodontic position is required before using the PMPI. This can be achieved using traditional clinical try-in methods or using a virtual mock-up using digital planning software. With the diagnostic tooth try-in 1 Therefore, the increasing PMPI risk categories are associated with an increased risk of non-axial loading and/or overload of the prosthesis, implant or bone. For moderate and complex cases, bone augmentation can be considered to improve the final prosthodontic envelope . However, it is important to remember that implants in grafted bone are at a higher risk of biomechanical overload (see Part 1),1 thus prosthodontic design should always aim to reduce non-axial loading.Using the PMPI, a case can be categorised as 'simple', 'moderate' or 'complex' in both the horizontal and vertical dimensions, which identifies the complexity of prosthodontic rehabilitation. Clinical examples are demonstrated in Alveolar ridge anatomy directly effects prosthodontic delivery, as well as surgical treatment options. It is important that alveolar bone volume, inter-arch relationships and anticipated non-axial loading is assessed at the planning stage, as this will enable restoratively led implant planning. Assessing these parameters will determine the requirements of the definitive prostheses and thus establish the surgical aspects of treatment, such as implant number, angulation, diameter and length. Clinical assessment using CRP, IAD and C:I can help identify the severity of ridge defects, as well as establish the complexity of prosthesis or implant delivery. Assessing these clinical factors can help establish whether resorption/pneumatisation can be overcome with prosthesis design or ridge/sinus augmentation.Appropriate restoratively driven planning helps identify and limit the risk of biological and prosthodontic complications and therefore helps to formulate informed consent, monitoring and maintenance requirements. The PMPI combines the assessment of CRP, IAD and C:I to classify the complexity of prosthodontic and implant treatment in the posterior maxilla. Furthermore, prosthodontic and surgical treatment options are suggested for the different complexities to encourage restoratively driven planning."} +{"text": "Introduction: The all-on-4 concept is widely used in clinical practice. However, the biomechanical changes following the alteration of anterior-posterior (AP) spread in all-on-4 implant-supported prostheses have not been extensively studied.Methods: Three-dimensional finite element analysis was used to compare the biomechanical behavior of all-on-4 and all-on-5 implant-supported prostheses with a change in anterior-posterior (AP) spread. A three-dimensional finite element analysis was performed on a geometrical mandible model containing 4 or 5 implants. Four different implant configurations were modeled by varying the angle of inclination of the distal implants (0\u00b0and 30\u00b0), including all-on-4a, all-on-4b, all-on-5a, and all-on-5b, and a 100 N force was successively applied to the anterior and unilateral posterior teeth to observe and analyze the differences in the biomechanical behavior of each model under the static influence at different position.Results: Adding an anterior implant to the dental arch according to the all-on-4 concept with a distal 30\u00b0 tilt angle implant exhibited the best biomechanical behavior. However, when the distal implant was implanted axially, there was no significant difference between the all-on-4 and all-on-5 groups.Discussion: In the all-on-5 group, increasing the AP spread with tilted terminal implants showed better biomechanical behavior. It can be concluded that placing an additional implant in the midline of the atrophic edentulous mandible and increasing the AP spread might be beneficial in improving the biomechanical behavior of tilted distal implants. The all-on-4 procedure with an implant-supported total prosthesis has been widely used in clinical practice for a mandible with severe alveolar ridge resorption . In suchThe cantilever acts as a force amplifier for implants, abutment screws, prosthesis screws, adhesions, or implant-bone interface while the patient is chewing. This is especially true if the crown is short or if the patient is engaged in para-functional activities. Long cantilevers lead to increased load distribution on the implant, which can lead to biomechanical complications . When caThe ratio of cantilever length to anterior-posterior (AP) spread has been identified as one of the factors associated with the incidence of mechanical complications. The AP spread was first defined by English as the din vivo study data, and 4 or 5 implants were placed in the mandible . Occlusa3. The study protocol was approved by the Ethics Committee of Zhejiang Provincial People\u2019s Hospital (No.QT2022093), and written informed consent was obtained in advance. The images are required to be clear, and the imaging data show no craniomaxillofacial developmental deformities, no periodontal disease or jaw lesions, and no obvious crowding of the dentition. The CBCT data were imported in Digital Imaging and Communications in Medicine (DICOM) format into Mimics software , and a rough 3D contour of the mandible was obtained by thresholding and masking. The resulting file was exported in STL format and further processed in Magics software to segment the dental crown and mandible, resulting in models of the dentition and mandible. The models were imported into Geomagic Studio software for refinement, where a three-dimensional solid model of the mandible was accurately calculated to obtain a complete and smooth surface. The model was simplified to a cortical bone shell with a uniform thickness of 1.5\u00a0mm, and the cancellous bone structure was obtained using the total offset command. The cortical and cancellous bone models were exported in Stereolithography (STL) format. Finally, a prosthesis and titanium frame model was obtained by extraction of the dentition, and the prosthesis was restored to the occlusal surface of the bilateral first molars.In this study, mandible CBCT data were acquired from a 30-year-old healthy female volunteer using a NewTom3G scanner with exposure settings of 110\u00a0kV, 6.0\u00a0mA, 9.0-s exposure time, and a voxel size of 0.027\u00a0mmThe implants in the model refer to the Nobel active system with 3.5\u00a0mm \u00d7 11.5\u00a0mm; 4.3\u00a0mm \u00d7 11.5\u00a0mm; 4.3\u00a0mm \u00d7 13\u00a0mm implants. The implants were categorized into three types based on their length and placement: 0-point implants were 3.5\u00a0mm \u00d7 11.5\u00a0mm, 3-point implants were 4.3\u00a0mm \u00d7 11.5\u00a0mm and 6-point implants were 4.3\u00a0mm \u00d7 13\u00a0mm, representing the central, canine, and first molar sites, respectively. Two abutment designs were employed, including a straight abutment with a height of 3.5\u00a0mm and an angle of 0\u00b0, and a 30\u00b0 angled abutment with a height of 4.5\u00a0mm. Models were designed in SolidWorks based on the implant shape data, abutments, and screws .The models were grouped based on the placement of four or five implants in the edentulous mandible. Four groups were established: all-on-4a, all-on-4b, all-on-5a, and all-on-5b , with APThe Abaqus software was utilized to calculate displacements of the implants and superstructures, strains in the peri-implant bone and von Mises stresses. Strains in the peri-implant bone can be used to predict bone remodeling properties compared to the bone resorption threshold . Maximum2 oval area. The static load magnitude remained constant throughout the simulation. In the anterior region, the central and lateral incisors received vertical loading (A loads), while in the posterior region, the left second premolar and first molar were subjected to vertical loading (P loads) .The displacement values of each component in the four groups are shown in Finite element results showed that the maximum principal strain was all located in the bone tissue near the neck of the implant. Therefore, the top ten maximum principal strain values of the cortical and cancellous bone parts around each group of implants were selected for statistical analysis, representing the modeling and remodeling behavior of the bone tissue around the neck of the implant. The normality of the data distribution was assessed using the Shapiro-Wilk test. Group comparisons were performed using one-way ANOVA followed by Tukey\u2019s test. IBM SPSS version 22.0 was used for statistical analysis, and statistical significance was set at 0.05.p < 0.05), but the difference between the all-on-4b and all-on-5b groups was not significant (p > 0.05) . The dif > 0.05) .p > 0.05), regardless of whether the load was applied to the anterior or unilateral molar region. The strain on the cortical bone surface in the all-on-5a group was significantly lower than that in the all-on-5b group (p < 0.05). In contrast, the p-value results for the strain on the cancellous bone surface were opposite to those observed on the cortical bone and by 54.6% and 72.0% for loads in the posterior region (P loads). However, when the distal implants were vertical, the stress distribution of the implants in the all-on-5b group was not significantly reduced. When the same number of implants, the all-on-4b group had a lower overall von Mises stress level than the all-on-4a group, whereas the all-on-5b group had a higher stress level . The higThe results showed that compared to the all-on-4a group, the maximum von Mises stress in the cortical bone was significantly reduced in the all-on-5a group, especially when loaded in the anterior region. However, the maximum von Mises stress in cortical bone increased in the all-on-5b group when the terminal implants were placed axially. In addition, the maximum von Mises stress in the cancellous bone was lower in the 5-implant groups than in the 4-implant groups under both anterior and posterior loading conditions . The maxUnder load P, the maximum von Mises stress in the superstructure was lower than under load A, and the stresses were mainly concentrated in the titanium frame. Notably, the maximum stress was significantly reduced in the 5-implant groups compared to the 4-implant groups, particularly in the distal implant vertical placement groups .In terms of stress distribution in the abutments, the maximum von Mises stress increased in the all-on-5 groups compared to the all-on-4 groups, regardless of whether the distal implants were vertical or inclined . The peaFinite element analysis has been widely used to detect the biomechanical behavior of functional bite force in prosthetics and surrounding tissues. Due to the complex structure of bone, some assumptions were often made to simulate the actual situation, so that the accuracy of the model was the key to the experiment. In this study, the mandible model was obtained from a patient eligible for CT tomography, and implants and abutments were generated in the software according to actual parameters, which was consistent with clinical practice. Previous studies have suggested that the success rate of 3D finite element mechanical analysis was related to the number of elements and nodes in the digital model . In the Anterior-posterior (AP) spread assessments have been commonly used to determine the length of a distal cantilever that can be extended from an implant-supported fixed full-arch prosthesis. However, recommendations based on AP spread assessments to calculate cantilever lengths have not been validated by prospective scientific evaluations . To dateIn the present study, to analyze the experimental results more conveniently, the variables were controlled, and the placement and position parameters of each implant group were standardized so that the cantilever length of each group was the same. Studies have shown that cantilever length is an important factor in increasing peak bone stress in the fixed implant restoration in edentulous jaws . CurrentIn this study, it was observed that the all-on-5a group resulted in lesser displacement in various aspects such as implants, abutments, prosthetic screws and superstructure compared to the all-on-4a group. Conversely, the total displacement of all-on-5b was greater than that of all-on-4b with axial placement of the distal implants. These results suggest that the all-on-5 technique may improve the initial implant stability in cases where the distal implants were tilted, thereby increasing the implant success rate. Furthermore, there was no evidence of instability due to stress imbalance between the two groups of implants. However, these advantages were not apparent when the distal implants were placed vertically.Furthermore, strain is an important factor in determining the behavior of bone remodeling , and it Within the limited mandibular arch, a significant change in AP distance is not possible and only increased by 4\u00a0mm in this study. The stress distribution on the implants in the all-on-5a group was lower than that in the all-on-4a group, especially at the distal implant, and the stress distribution in the all-on-4b group was even lower than that in the all-on-5b group, except at the D6 position. This suggests that the addition of the AP spread in the all-on-5 approach has better biomechanical behavior when the distal implant is placed in an oblique position. The maximum von Mises stress of the implant was located at the implant-abutment junction, and a small stress was located between the implant neck and cortical bone. It is believed that this junction is the weakest area of the implant and is prone to complications such as stress fatigue and mechanical fracture. Furthermore, the stress distribution on the prosthetic abutment, screws and superstructure was evaluated, with the maximum stress found at the neck thread , suggestIn conclusion, according to the results of displacement, strain, stress on bone tissue and implant, AP spread was increased by adding an implant to the anteromedial aspect of the mandible, when the distal implant was tilted, that is, the all-on-5a group showed a more dominant biomechanical behavior. We speculated that this might be because, under the same load, when the distal implant was tilted, unlike when the single implant was implanted, part of the stress transmitted from the superstructure to the implant was dispersed by the bone tissue, resulting in less stress on the implant than when the vertical implant was implanted. In addition, the all-on-5a group added implants anteriorly, increasing the AP spread, and all implants formed a triangular structure, which was more stable compared to all-on-4a and, therefore better shared the stresses.One limitation of this study is that, due to the nature of the model chosen, the prostheses were designed to mimic their original positions, resulting in relatively short cantilever lengths in all groups, and due to the shape of the dental arch, limiting the increase in AP spread. Therefore, the degree of influence between AP spread and cantilever was not very obvious. Although the AP spread of all-on-5 was only increased by 4 mm, the results showed that the same length of the cantilever and a shorter increase in AP spread could help improve the biomechanical behavior of the superstructure and improve the success rate of implantation surgery. The study was also limited by the use of static rather than dynamic forces. To address these limitations, we recommend future research investigate different dental arch shapes, cantilever lengths, and AP spread to further our understanding in this area.However, due to a large number of theoretical assumptions in the simulation process, and a series of factors such as structural simplification and material property uncertainty, there are inevitable errors between the simulation and the actual structure. The minimum mesh size of this experimental model was 0.1 mm, and the discrete error was controlled within 3%. According to the Guide for Verification and Validation in Computational Solid Mechanics outlined by the American Society of Mechanical Engineering (ASME), it is deemed imperative to undertake subsequent experimental investigations aimed at validation. These experimental endeavors are crucial in ascertaining the accuracy and reliability of the computational model. In addition, given the limitations of existing finite element models and the complexity of masticatory biomechanics, future studies such as clinical trials may help quantify and understand the long-term effects of all-on-5 and demonstrate the potential value of all-on-5.Within the limitations of this study, it can be concluded that increasing AP spread by adding an extra implant in the mandibular midline appears to be beneficial in improving the biomechanical behavior of all-on-4 groups with tilted distal implants, while no improvement was observed in distal axial groups. AP spread is not the only aspect to consider when designing an all-on-4 fixed full-arch implant-supported prosthesis."} +{"text": "Sinus augmentation in conjunction with implant placement is widely considered to be a predictable and successful treatment option for the edentulous posterior maxilla. However, the anatomical changes of the posterior maxilla following tooth extraction creates unique challenges for implant and prosthodontic rehabilitation. A large volume of literature has been published regarding the surgical indications and treatment planning for implants in the posterior maxilla. In comparison, there is a relative paucity of literature regarding the prosthodontic challenges associated with implants placed in augmented maxillary sinuses. This article describes the scientific background of native and grafted alveolar bone healing in relation to implant rehabilitation. Furthermore, clinical classifications available to assist implant treatment planning are described.Zusatzmaterial online: Zu diesem Beitrag sind unter 10.1038/s41415-023-6391-7 f\u00fcr autorisierte Leser zus\u00e4tzliche Dateien abrufbar. Alveolar bone changes following tooth extraction complicate implant planning, placement and restoration in the posterior maxilla.A large volume of literature has been published regarding the surgical planning for implants in the posterior maxilla despite the importance of restoratively driven planning.Numerous classifications can be applied to help plan implant treatment in the posterior maxilla but none have the details required for restoratively driven planning.Zusatzmaterial online: Zu diesem Beitrag sind unter 10.1038/s41415-023-6391-7 f\u00fcr autorisierte Leser zus\u00e4tzliche Dateien abrufbar. Implant placement is either performed simultaneously (at the time of bone grafting) or after a period of graft consolidation , depending on the residual native maxillary bone height.With the increasing prevalence of dental implants for the restoration of missing teeth, bone grafting procedures have also increased in prevalence to enable implants to be placed in more challenging sites. The anatomy of the posterior maxilla changes significantly following tooth extraction due to alveolar ridge resorption and maxillary sinus pneumatisation, resulting in reduced alveolar bone width and height. Of the numerous bone grafting techniques used to increase vertical bone height, sinus augmentation provides the most predictable implant survival rates with the reduced need for a donor site, and thus is the most common bone grafting procedure used in the posterior maxilla.To achieve the best functional and aesthetic implant treatment outcomes, prosthodontic planning should drive surgical planning. However, as implant planning in the posterior maxilla often requires a considerable degree of surgical planning, the prosthodontic aspects of treatment planning can easily be overlooked. This inclination is reflected in the dental literature, with the majority of articles and classifications focusing on the surgical aspects of planning. In comparison, there is a relative paucity of literature describing the prosthodontic challenges associated with implants placed in the posterior maxilla and/or augmented maxillary sinuses.2,3 Furthermore, implants placed in augmented maxillary sinuses have shown to have a lower survival rates than those placed in native posterior maxillary bone.4,5 The bone of the posterior maxilla has fine trabeculae and thin buccal cortical plates which provides poor bone quality for the placement of dental implants.6 When posterior maxillary teeth are extracted, the alveolar ridge undergoes vertical and horizontal resorption . Such classifications encourage objective clinical assessment, facilitate the identification of case complexity and can provide a guide for clinical decision-making. Furthermore, classifications assist clinical record-keeping, inter-professional communication and help standardise reporting in the scientific literature. Having a thorough knowledge of the different classifications related to dental implant planning and potential adjunctive bone grafting is advantageous for clinicians involved in the prosthodontic and surgical treatment of such cases.The aim of this paper is to describe the alveolar bone changes that affect implant planning and prosthodontic delivery and describe the classifications available to assist the planning for implants in the posterior maxilla.Alveolar bone volume directly influences prosthesis design and implant position. As alveolar bone volume decreases, the complexity of prosthesis and implant delivery increases, with significant bone resorption rendering implant placement and restoration unviable without adjunctive bone augmentation techniques. It is therefore important to understand the alveolar bone changes in the posterior maxilla following tooth extraction.10 The average posterior maxillary alveolar bone height in relation to the maxillary sinus is approximately 7.8-8.1 mm in dentate individuals. Following tooth extraction, alveolar bone resorption occurs with approximately 3.87 mm loss in the horizontal dimension and 1.67-2.03 mm loss in the vertical dimension.11 Most alveolar resorption occurs within six months of extraction, with 30% occurring within the first 12 weeks.12 Additionally, after tooth loss, the maxillary sinus pneumatises inferiorly, which results in a further reduction in alveolar bone height. Post-extraction expansion of the maxillary sinus in an inferior direction is approximately 1.83-2.83 mm, with larger sinus pneumatisation of approximately 2.91-3.56 mm observed in the second molar region.13 Post-extraction sinus pneumatisation occurs within 4-6 months following extraction.13 Certain local factors increase the likelihood of maxillary sinus pneumatisation and these include: teeth surrounded by a superiorly curving sinus floor, tooth roots shown to protrude into the sinus cavity by computerised tomography (CT) imaging, extraction of second molars, extraction of several adjacent posterior teeth, and extraction of a tooth with missing adjacent teeth.13 Identifying these factors pre extraction can help identify patients who may be at risk of sinus pneumatisation in the short- and long-term.The horizontal and vertical shape of the posterior alveolar ridge is determined by tooth position. The average width of the dentate posterior maxilla is approximately 9.57 mm in the second premolar region and 12.38 mm in the first molar region.For dentists involved with the placement or restoration of implants, it is important to be able to assess and predict these alveolar bone changes clinically and radiographically as a result of tooth loss. By doing so, the prosthodontic and surgical complexity of a case can be determined pre-operatively. Classification tools can be effective in helping achieve this.14 However, in the posterior maxilla, the bone volume and strength is often compromised and the potential to exceed the 'adapted window' is high. Prosthodontic and implant planning should take into account the bone volume and strength in this region to reduce the risk of occlusal overload.Thorough assessment of alveolar bone is the foundation of comprehensive prosthodontic, surgical and implant planning, and enables planning of the different treatment stages listed in Bone volume can be examined clinically through visual assessment and palpation of the edentulous ridge, or radiographically using measurements from conventional radiographs and cone beam computed tomography (CBCT) scan data. If reduced bone volume is identified, it is important to plan at the outset whether this will be overcome using prosthodontic techniques or surgical techniques .Table 2 Numerous bone volume classifications have been published to aid objective assessment of alveolar bone levels. Essentially, bone volume is clinically assessed by examining bone width, bone height and inter-arch relationships. Bone volume assessment begins the process of prosthodontic planning, as it identifies whether there is enough bone to place both the teeth and implants in their ideal position, or whether surgical intervention is necessary to improve the prosthodontic envelope.15 Therefore, a minimum of 6 mm bucco-lingual/palatal width is required if using a conventional diameter implant. Narrow implants (less than 3.75 mm in diameter) are contraindicated in the posterior maxilla.16Bone width is defined as the distance between the buccal and the palatal/lingual plates, measured at the crest. With regards to surgical planning, a dental implant should be surrounded by a minimum of 1 mm of buccal and palatal/lingual bone. The ideal bone width depends on the diameter of implant being selected, with a conventional implant diameter ranging from 3.75-4 mm.Bone height for implant placement is measured from the alveolar crest to proposed depth of implant placement, or to the level of an associated anatomical structure if present. It is recommended that a minimum margin of 2 mm from vital structures is respected; however, implants in the posterior maxilla can be planned to engage the bone of the sinus floor or penetrate the sinus floor if sinus augmentation is performed. Conventional implants have a length of \u226510 mm, so traditionally, 10 mm+ of alveolar bone is recommended for predictable implant placement. Most indices and sinus augmentation techniques developed for implant placement in the posterior maxilla are based on the ability to achieve an implant placement of 10 mm length.Vertical and horizontal inter-arch relationships can be affected by alveolar resorption. Vertical resorption can lead to increased inter-arch distance and horizontal resorption can result in an unfavourable horizontal relationship of the maxillary and mandibular ridges/teeth .17 In the long-term, reduced bone strength is related to a higher risk of implant failure following prosthetic loading, and occlusal overload has been suggested as a possible risk factor for marginal bone loss and implant loss.2,3,18Understanding bone strength in the posterior maxilla is crucial to plan predictable short- and long-term dental implant treatment. Due to the fine trabecular bone structure, bone strength in the posterior maxilla is low compared to the bone in other areas of the maxilla and mandible. In the short-term, reduced bone strength can result in reduced implant primary stability. As achievement and maintenance of implant stability are prerequisites for successful osseointegration, implants with poor primary stability have a higher risk of failure.19 Bone quality is independent of BMD and is determined by bone architecture, turnover, damage accumulation and mineralisation.20 Furthermore, bone architecture is defined by the number and viability of bone cells, orientation and degree of crosslinking of collagen fibres and the texture and orientation of biological apatite crystals in bone.19 The only true method of assessment of bone strength is histological examination. As attainment of bone histology is not clinically feasible, secondary methods to assess the quality of bone can be utilised; namely radiographic assessment using CBCT imaging or intra-operative assessment using tactile feedback.Bone strength is determined by the bone mineral density (BMD) and the bone quality .19 Bone 21 However, HUs were originally used to measure radiodensity on medical-grade CT scans and the use of HUs in CBCT is complicated because of crucial differences in the radiophysics between the two scans. Therefore, although HUs can offer some information about radiographic bone quality, there is a risk of unreliability when HU scales are used to measure alveolar bone quality on CBCT scans.22Accurately assessing bone quality pre-operatively is challenging, if not impossible. Hounsfield units (HUs) from CBCT scans have been suggested to identify alveolar bone quality. HUs, which are used to measure the density of a pixel in a CT image, provide a quantitative assessment of bone quality. Strong correlations have been found between medical-grade CT mean bone density using HUS, implant insertion torque and resonance frequency analysis.23,24 ITVs and ISQs have been shown to be reduced in the posterior maxilla, with significantly reduced ITVs and ISQs detected for implants placed via sinus augmentation procedures.25 Using these methods to estimate bone strength enables the restoring dentist to design a prosthesis with features to minimise occlusal overloading if necessary.The most commonly used intra-operative methods to objectively measure primary stability are insertion torque values (ITV), which measures rotational stability and implant stability quotient (ISQ), which measures axial stability. A minimum of 32 Ncm ITV has been shown to be necessary for implants to achieve osseointegration, and an ISQ between 55 and 85 is considered acceptable stability at the time of implant placement.Implants in grafted maxillary sinuses are at a higher risk of biomechanical overload due to the physiology of the native and grafted bone surrounding them. The coronal portion of the implant is positioned in native crestal bone and the apical portion is positioned in grafted bone . It is i26 At three months, the graft is considered immature as new bone is not in apposition to xenograft granules which are enveloped by loose connective tissue. By six months, most xenograft particles are surrounded by newly formed immature bone; this is considered an appropriate time for delayed implant placement in larger augmentation cases. The typical histological structure of bone begins to appear at around nine months, and continued bony maturation is detected up to four years and more.26 Photoelastic models have demonstrated that implants in immature grafted bone transmit significant stress to the native cortical bone, with a high level of stress transmitting to the grafted bone, with the native bone acting as a 'fulcrum' for stress transfer.27,28 Conversely, when the graft is mature and reaches the same stiffness as native bone, more equitable stress along the implant body is shown. Therefore, implants in augmented maxillary sinuses should be considered at a higher risk of overload, particularly those in more extensive bone grafts and grafts of less than one year. Masticatory forces should be carefully controlled during healing and loading through judicious prosthesis design.Bone in grafted sinuses matures over a period of months.Numerous classifications are available to aid clinical assessment for the treatment planning of dental implants and adjunctive procedures, such as alveolar bone augmentation. Such classifications can be applied to planning implants in the posterior maxilla, with some being specifically designed for this clinical situation. 29,30,31,32 whereas more detailed classifications quantify the severity of alveolar resorption to provide objective assessment of the alveolar ridge size.33,34,35 Cawood and Howel and Leckholm and Zarb define case severity by classifying the shape of the alveolar ridge. Although not specific to implant planning, they can be used for the preliminary planning stages for implants or bone augmentation. The Siebert, modified Siebert and horizontal, vertical and combination classification (HVC) define case severity by quantifying the degree of alveolar ridge resorption.31,32,33,35 These classifications were specifically designed to assess alveolar bone before ridge augmentation procedures and are useful to approximate whether sufficient alveolar bone is present for implant placement, or whether adjunctive ridge augmentation is required. The HVC classification also provides recommended treatment options for different clinical ridge shapes. However, all treatment options recommended are surgically, not prosthodontically, focused. Misch and Judy classify case severity using implant angulation and crown height, as well as alveolar ridge shape.34 Including implant angulation and crown height is an important step towards restoratively led planning; however, the recommended treatment options provided within this classification only describe surgical options.Due to their broad scope, classifications for general implant planning can be applied to implant sites anywhere in the maxilla or mandible. All are based on the clinical assessment of alveolar ridge shape and are therefore simple to use to approximate bone volume before implant treatment. The simplest classifications categorise alveolar bone via the description of ridge shape only,36,37 Among the large range of factors assessed in each classification, both include alveolar bone assessment to define case complexity and can therefore be used to plan implants in the posterior maxilla. The ITI SAC is an online tool developed by the ITI which differentiates between case complexity using numerous surgical and prosthodontic criteria.36 By completing a survey-style checklist which guides the user through relevant clinical information, cases are categorised as 'simple', 'advanced' or 'complex'. As part of the ITI SAC tool, the severity of horizontal and vertical alveolar bone defects are categorised by appraising whether bone augmentation is required. Proposed augmentation options are provided for each ridge category, including sinus augmentation for posterior maxillary sites in the 'complex' category. The ABC Risk Score for Implant Treatment is a tool design to aid treatment planning of dental implants using medical history, local factors, surgical factors and restorative factors.37 Using this information, cases are categorised as low risk , medium risk ('between') and increased risk ('complex'). Similarly, the ABC risk score assesses the alveolar ridge in the horizontal and vertical dimensions to establish the overall complexity of a case. Treatment recommendations for bone augmentation, including sinus augmentation, are provided for each ridge category. In both classifications, minimal clinical description is provided to differentiate between the ridge categories but measurements are not provided to quantify ridge defects. Both recommend sinus augmentation for posterior maxillary vertical ridge deficiencies; however, neither provide detail regarding relevant diagnostic criteria of prosthodontic treatment options for such cases. Therefore, these classifications are useful to initiate the planning process for implants in the posterior maxilla but lack the detail required for more comprehensive treatment planning.The International Team for Implantology's (ITI) Simple, Advanced, Complex (SAC) tool and Always, Between, Complex (ABC) risk-assessment tool are more comprehensive assessment tools designed for general implant planning.To summarise, categorisation of the alveolar ridge using general implant planning classifications helps to guide treatment planning decisions, such as implant diameter, number, position and angulation. Furthermore, they help establish whether adjunctive ridge augmentation is required to optimise implant position and long-term prosthodontic outcomes. However, as these classifications are based on clinical examination alone, posterior maxillary anatomical changes, such as sinus pneumatisation, cannot be evaluated. Therefore, they are not ideal to use for planning of implants in the posterior maxilla. Nonetheless, they are useful for initial clinical assessment and begin the process of determining the surgical and prosthodontic complexity in posterior maxillary edentulous sites.38,39,40 Each requires radiographic as well as clinical assessment of alveolar bone, thus enabling planning of implants in the maxillary sinus region. Each categorises radiographic vertical bone height using measurements in millimetres. The ideal bone height for implant placement is based on the provision of a \u226510 mm implant, either with or without the need of a sinus augmentation procedure. Each classification describes treatment recommendations for each ridge severity category, including the timing of implant placement (immediate or delayed) and method of sinus augmentation technique . The Misch (1999) classification recommends healing periods for graft consolidation and implant osseointegration depending on the augmentation technique or implant timing protocol used.39 The Juodzbalys and Kubilius classification includes assessment of the edentulous ridge length and width and alveolar ridge vertical position , which helps determine the surgical and prosthodontic complexity of the case.40 However, no further details regarding prosthodontic assessment and treatment planning are provided.The Jensen, Misch (1999) and Juodzbalys and Kubilius classifications listed in To summarise, the classifications for implant planning in the posterior maxilla enable objective assessment of ridge severity and pre-operative case complexity. Furthermore, they facilitate detailed planning of implant treatment and sinus augmentation techniques. However, each tends to focus on surgically led planning, with minimal details regarding prosthodontic planning provided.41the bone of the posterior maxilla tends to be of a poorer quality than elsewhere in the jaws. Furthermore, augmented bone in the maxillary sinus is of poorer quality than native bone, particularly in the first six months of graft consolidation.42 Bone of lower quality has lower implant-bone contact and lower strength; therefore, there is a higher risk of poor primary stability in the short-term and a higher risk of bone over-loading in the long-term.Although most implant planning classifications focus on alveolar bone volume to establish case complexity, to comprehensively plan the surgical and prosthodontic needs of implant treatment in the posterior maxilla, bone quality should also be considered. As described in the first article of this series,30,42 These classifications are described in detail in 42 It also proposes the likely HUs for each bone quality category, therefore allowing clinical application of this classification. Furthermore, the Misch (2021) classification includes a category for grafted bone and describes this as being the lowest bone quality. These classifications help the clinician consider bone quality as part of planning for implant treatment in the posterior maxilla. They identify the posterior maxilla as being a higher risk zone for implants due to the reduced bone quality, with grafted bone being the poorest bone quality. When considering implants in the posterior maxilla, this highlights the increased complexity of achieving good primary stability and long-term physiologic bone loading in this region. Surgical protocols, implant timing, implant loading protocols and prosthesis design should accommodate for the poorer bone quality, particularly in augmented sinuses.The two most commonly referred to classifications relating to bone quality for implant placement are Leckholm and Zarb, and Misch (2021).34,36,37,40A small number of the already described classifications include elements of prosthodontic assessment to aid pre-operative treatment planning; namely, the ITI SAC, ABC risk score, Misch and Judy, and Juodzbalys and Kubilius classifications.36 The prosthodontic factors assessed in the ABC risk score classification include: biomechanics ; aesthetics ; fixed restoration for full arch ; and complexity exceeding patient's capability (handling and cleanability).37 Both the ITI SAC and ABC risk score classifications are helpful to assess the general prosthodontic complexity for implant planning. However, there is limited focus on the unique factors affecting implant-retained prostheses in the posterior maxilla.The ITI SAC and ABC risk score classifications cover a broad scope of factors to aid prosthodontic assessment. The ITI SAC includes: patient expectations; oral hygiene and compliance; craniofacial/skeletal growth; access; number of implants to be placed; prosthesis design (fixed or removable); lip line; biotype; shape of crown; restorative status of neighbouring teeth; tissue contour and volume; inter-arch distance; mesio-distal space; loading protocol; bruxism; use of a provisional restoration; and the retention of the prosthesis (cement- or screw-retained) for the prosthodontic complexity assessment.34,40 These include implant angulation, crown height and alveolar ridge vertical position . It is encouraging that aspects of prosthodontic complexity are considered in relation to the surgical aspect of treatment; however, the treatment guidance is surgically driven, with no further focus on prosthodontic planning or delivery.A limited number of prosthodontic factors are included in the Misch and Judy and Juodzbalys and Kubilius classifications.41Currently, no classifications consider the aspects of clinical assessment required for restoratively driven planning of implant-retained prostheses in the posterior maxilla. Furthermore, the clinical guidance in each has a surgical rather than a prosthodontic focus for overcoming the unique clinical challenges associated in the posterior maxilla. The second article in this series describes the clinical factors that should be assessed as part of prosthodontic planning, as well as a prosthodontic complexity classification - the Posterior Maxilla Prosthodontic Index (PMPI) - to aid restoratively-driven implant planning.Comprehensive understanding of the posterior maxillary anatomy, native bone architecture, and augmented bone architecture is central to providing appropriate prosthodontic and surgical implant treatment. The posterior maxilla presents unique challenges for implant placement due to the anatomical changes in alveolar bone following tooth extraction. The aim of dental implant treatment in the posterior maxilla is to provide a prosthesis that is predictably retained and maintained over time. In order to achieve this, prostheses and implants should be designed to withstand the occlusal forces and prevent bone overload. Numerous classifications are available to help plan the details of dental implant treatment in the posterior maxilla, ranging from simple clinical classifications which assess alveolar ridge shape and volume, to more complex classifications assessing the radiographic extent of the posterior ridge. Furthermore, some classifications include treatment suggestions to help identify the correct treatment in certain clinical situations. However, all current implant planning classifications which can be applied to the posterior maxilla focus on the surgical aspect assessment, planning and treatment, and do not focus on restoratively driven planning.41 The index focuses on the pre-operative assessment of the horizontal and vertical prosthetic envelope to encourage restoratively led planning for implants placed in the posterior maxilla.To aid assessment of the prosthodontic complexity of restoring implants in the posterior maxilla, the second article in this series proposes a prosthodontic complexity classification: the PMPI.Supplementary Table (PDF 331KB)"} +{"text": "The study aims to use cone beam computed tomography (CBCT) to (1) define the virtual valid length of pterygoid implants in maxillary atrophic patients from the prosthetic prioritized driven position and (2) measure the implant length engaged in the pterygoid process according to the HU difference of the pterygoid maxillary junction.Virtual pterygoid implants were planned with CBCT of maxillary atrophic patients in the software. The entry and angulation of the implant were planned according to the prosthetic prioritized driven position in the 3D reconstruction image. The planned implant length and the valid length defined as the implant between the pterygoid maxillary junction and pterygoid fossa were recorded. The relationship between the implant and sinus cavity was also evaluated.A total of 120 CBCT samples were enrolled and virtually planned. The mean age of the patients was 56.2\u2009\u00b1\u200913.2\u00a0years. One hundred and sixteen samples could successfully place virtual implants according to the criterion. The mean implant length and mean implant length beyond the pterygoid maxillary junction were 16.3\u2009\u00b1\u20094.2\u00a0mm and 7.1\u2009\u00b1\u20093.3\u00a0mm , respectively. Ninety percent of virtually planned implants had a close relationship with the sinus cavity, and implants exhibited longer lengths when they had no relation with the sinus.From a prosthetic prioritized driven position with fixed entry and angulation, pterygoid implants achieve adequate bone anchorage length beyond the pterygoid maxillary junction. Due to the individual anatomy and the volume of the maxillary sinus, the implants presented a different positional relationship with the maxillary sinus. The pterygoid implant was proposed by Tuslane and Tessier in 1989 as a graftless solution to treat atrophic posterior maxilla . One recCompared to sinus grafting, this approach is associated with several advantages, including reducing treatment duration and decreasing surgical morbidity and cost , 6. FromAlthough the concept and technique have been proposed for 30\u00a0years, due to the complex anatomical structure the implant passes through and its technique sensitivity (it is a semiblind procedure through 15 of 20\u00a0mm of bone), limited studies, mainly retrospective studies, and a limited number of implants inserted are available in the literature.The implant passes through the maxillary tuberosity, pyramidal process of the palatine bone and pterygoid process of the sphenoid to pterygoid fossa. Some authors have described this anatomical complex as a \u201ccorridor\u201d. In previous studies, to determine the ideal position of pterygoid implants, several measurements have been performed to determine the bone available for the \u2018corridor\u2019 and the safe and ideal position and angulation of pterygoid implants. Unlike the posterior maxillary alveolar ridge, the \u2018corridor\u2019, especially the pterygoid process, is not a tooth-dependent structure and is not related to tooth pathology or sinus pneumatization. Anatomical structure analysis from cadaver and radiography studies showed that dense bone at the juncture of the palatine and pterygoid processes is approximately 3\u20136\u00a0mm. With the implant tilted and placed with an angulation, it is easy to obtain 8\u20139\u00a0mm cortical bone anchorage for good primary stability and implant-to-bone direct contact \u201310.From a clinical point of view, the ideal emergence of the fixture would be limited between the first and second molar regions but not distal to the second molar area and extended with angulation through the pterygoid process into the fossa. Excessive distal entrance will lead to difficulty in restoring, and oral hygiene maintenance after prosthesis delivery will be difficult. However, this point was not often a concern of many in vitro anatomical measurements and clinical studies. The anterior\u2013posterior and implant sizes were always determined in the sinus cavity and posterior wall of the sinus. Nevertheless, very limited information available on this region especially focuses on prosthesis-driven implant placement. Regarding the issue of implant length, a variety of implant lengths between 13 and 20\u00a0mm were proposed by radiographic and anatomical studies. However, few studies have focused on valid implant lengths in the maxillary region and pterygoid process, and studies on the relationship between inserted implants and the sinus cavity are also lacking.Regarding angulation, a range between 45\u00b0 and 75\u00b0 has been suggested after some investigations , 10. CliThe study based on cone beam computed tomography (CBCT) data aims to (1) define the virtual valid length of pterygoid implants in maxillary atrophic patients based on prosthetic data and (2) measure the implant length engaged in the pterygoid process according to the HU difference of the pterygoid maxillary junction.The study was approved by the ethical committee of Shanghai Ninth People\u2019s Hospital, Shanghai Jiao Tong University, School of Medicine and was conducted according to the Helsinki Declaration.Patients who had missing posterior maxillary teeth and presented atrophic posterior upper jaws were included. Patients had been edentulous for more than one year in the posterior maxillary region. CBCT scans using the i\u2010CAT 3D Imaging System were performed using the following scanning parameters: 5\u00a0mA, 120\u00a0kV, voxel size of 0.4\u00a0mm, FOV of 25\u00a0cm (D)\u2009\u00d7\u200918\u00a0cm (H), and scan time of 16\u201320\u00a0s.Patients who had residual bone height less than 4\u00a0mm due to sinus pneumatization or alveolar ridge resorption were enrolled. If the patient had bilateral posterior maxillary atrophy, the right side was chosen for evaluation to avoid individual error. Then, the CBCT data were exported as DICOM files and imported to planning software for anatomical structure measurement and pterygoid implant planning.Due to different alveolar ridge resorption patterns and the position of the head during CBCT scanning, the occlusal plane was not as stable as the Frankfort plane. Thus, the Frankfort plane was used as a relatively horizontal line. Two independent investigators (YS and NW) performed the measurement, and interrater reliability was calculated.An implant that was 4.3\u00a0mm in diameter was virtually placed according to one unified plan. In the head position, the red line in the middle passes through the bilateral infraorbital points and the upper edge of the external auditory canal to determine the Frankfort plane Fig.\u00a0. The lowThen, a virtual implant entrance point was set 10\u00a0mm away from the point parallel to the midline , 12. LatThe virtually placed implant length was recorded. In the 3D reconstructed module, the implant length in the sinus cavity was also recorded. The implant beyond the pterygoid maxillary junction was considered an implant in the pterygoid process, and the length of this implant was also measured Fig.\u00a0. In addiThe relationship between the body of the implant and the sinus cavity was divided into 4 categories. A: No implant body in the sinus cavity; B: One side of implant anchored in the posterior sinus wall and the other side of implant in the sinus cavity; C: Less than 1/2 of the whole implant body in the sinus cavity; D: Greater than 1/2 of the whole implant body in the sinus cavity Fig.\u00a0.Fig. 9FoStatistical analysis was performed using SPSS software . Cronbach\u2019s \u03b1 coefficient (\u03b1) was obtained to verify interrater reliability. Descriptive statistics of the virtually planned implant values were calculated. The normality of the data was corroborated with the Kolmogorov\u2013Smirnov test.A total of 120 CBCT samples were enrolled and virtually planned. The mean age of the patients was 56.2\u2009\u00b1\u200913.2\u00a0years . The mean lost teeth in this group of patients was 7.8 in the maxillary arch, and the etiology of tooth loss was periodontitis.The coefficient (\u03b1) was 0.86, showing good inter-rater reliability. According to the above-mentioned placement principle, 4 of 120 implants could not penetrate from the pterygoid fossa. The remaining 116 CBCT samples were enrolled and virtually planned.The number and percentage of virtually planned implants with different lengths are listed in Table Eleven of 116 implants (9.4%) showed no relationship to the sinus cavity. The implant passed the large maxillary tuberosity directly through the pterygoid process. In this category, the mean virtually planned implant length was 17.2\u2009\u00b1\u20092.4\u00a0mm range, 13\u201318\u00a0mm), which was slightly longer than the mean values throughout the study. In categories B and C, the numbers of virtually planned implants were 12 (10.3%) and 65 (56.0%), respectively. The other 28 implants (24.1%), which belonged to category D, exhibited a closer relationship to the sinus cavity. Greater than half the length of the implant went into the maxillary sinus. The implant proportion distribution of different lengths in the maxillary sinus cavity is shown in Table \u201318\u00a0mm, wThe mean buccal-palatal angulation of the implant in coronal sections was 83.2\u2009\u00b1\u20093.02\u00b0 (81.3\u201385.6\u00b0).Posterior maxillary teeth loss due to periodontitis is a common clinical scenario. Compared to bone grafting, pterygoid maxillary implants provide an alternative solution in making the best use of residual bone of the maxillary-pterygoid complex. In contrast to the bone quality of the posterior maxilla, the implant engaged in the cortical layer of the pterygoid process makes it easy to obtain optimum primary stability \u201315. AlthTo analyze the anatomical characteristics of this complex from a clinically feasible perspective, the present virtual study sought to provide information related to this complex from prosthetic-driven implant placement.In previous anatomical measurements, the distance between the most concave point on the lateral surface of the pterygomaxillary junction and the greater palatine foramen was approximately 7\u00a0mm. With the horizontal and vertical absorption of alveolar bone, the distance between the aforementioned structures is reduced. The study set the entrance point of the virtual implant 10\u00a0mm away from the junction in the horizontal plane to mimic the entrance location of the second molar area and to proceed from the perspective of being more clinically feasible and maneuverable.The inclination of pterygoid implants has been studied in previous radiographic and cadaver studies . The ranIn the assessment of buccal-palatal angulation, due to the fixed entrance and exit position of the virtually placed implant, it is easy to calculate the angulation in the software. A minor difference was detected between the present study and previous reports. In Rodriguez et al.\u2019s study, an implant angulation of 81.09\u2009\u00b1\u20092.65\u00b0 were found in the buccal-palatal axis . To avoiIn the present study, the length of the implant beyond the pterygoid maxillary junction was the parameter of greatest concern. In some CBCT samples, the alveolar process of maxillary bone and pterygoid process of sphenoid bone are not completely fused; in this situation, the pterygoid maxillary junction is very easy to identify. Other samples showed a fused line of higher density compared to the surrounding structures. In contrast to large volume changes in the alveolar process and maxillary sinus cavity, the bone volume and density of the sphenoid pterygoid and palatine vertebrae are basically constant. These structures are precisely the most important structures that provide good stability of the implant during surgery.Previous studies showed a mean bone column length (bone corridor) following the long axis of the implant of approximately 22\u00a0mm , 10, 18.We found that the limited anchorage of some implants in the pterygoid process is too short, usually when the sinus cavity is large. In addition, the maxillary tubercle is too small, and the posterior wall of the maxillary sinus is located behind the entrance of the pterygoid implant. When the implants had bone anchorage in the maxillary tuberosity, in category A, the mean virtually planned implant length was longer than the average length.To establish a standardized entry point, the size of the maxillary tuberosity still affects the choice of implant length. Four patients could not complete the design because the vertical bone resorption of the alveolar ridge was too severe. After implantation at an oblique angle of 45\u00b0, the implant tip was at the root of the pterygoid process or close to the direction of the pterygopalatine fossa. This finding suggests that in clinical practice, when the alveolar bone is absorbed vertically instead of the lack of bone height caused by maxillary sinus pneumatization, oblique angle implantation is very risky. The slope should be increased. When the vertical defect of the alveolar ridge is not too serious, the inclination angle of the implant can be appropriately reduced, for example, between 45\u00b0 and 70\u00b0.With the limitations of this study, from the prosthetic prioritized driven position, the virtual valid length of pterygoid implants in maxillary atrophic patients was determined. An implant with a mean length of 16\u00a0mm could be used in this region.This area could be implanted with an average length of 16\u00a0mm implants. Approximately half of this length could cross the pterygoid maxillary junction using the pterygoid process for retention, whereas the other half of the length is located in the maxillary tuberosity area. Due to the individual anatomy and the volume of the maxillary sinus, the implants presented a different positional relationship with the maxillary sinus."} +{"text": "Immediate implant placement is well-known science and treatment in implant dentistry. It is a multitasking treatment consisting of surgical, prosthodontic, and periodontal aspects, implemented to obtain long-term clinically esthetic and functioning prosthesis. Immediate placement enables clinicians to reduce the number of surgical steps and shorter treatment duration. It has become a standard surgical protocol in modern implant practice. According to existing literature, dual implant placement can be done to avoid any cantilever effect in a single implant and to distribute masticatory forces.This clinical report describes the extraction of an infected mandibular right first molar, followed by immediate dual placement of dental implants in the rinsed and cleansed sockets. The tooth was atraumatically extracted from the socket, and the latter was prepared to the required depth, and endosseous implants were placed in both the mesial and distal sockets. This atraumatic graft-free operating technique and immediate placement resulted in the preservation of hard and soft tissues. It also increased the patient's comfort, acceptance, and satisfaction due to immediate loading with a provisional removable prosthesis. This was later replaced with a dual screw-retained hybrid implant crown. Immediate implants describe the placement of the implant into the extraction alveolus after the tooth extraction. Adequate patient selection and aseptic surgical methods should be followed . ScientiThe implant-supported prosthesis is considered a success when they clinically imitate adjacent natural teeth and surrounding harmonious soft tissue frame. Tooth loss leads to soft tissue collapse and bone resorption, resulting in a flat anatomical contour ,4. ThereImmediately placed implants provide essential benefits such as less surgical intervention, shorter treatment time, and improved aesthetics. However, this approach requires a careful assessment of bone quality, amount of soft tissue, and biotype ,7. The eA 40-year-old male patient came to the Department of Prosthodontics and Implantology to enquire about treatment modalities for replacing missing natural teeth. There was no significant medical history. On intraoral examination, the patient reported a history of grossly decayed mandibular lower right molar. The patient was evaluated both clinically and radiographically. Radiographic evaluation revealed non-defined radiolucency involving enamel, dentin, and pulp, as evident in Figure No clinical or radiographic bone loss was noticed, so it was decided to place an implant immediately following extraction and curettage to avail the benefits of preservation of the bone. The patient desired to have a crown at the earliest. The treatment execution protocol was explained to the patient and was well accepted.Surgical phaseThe key to an immediate implant's success is atraumatic tooth extraction followed by curettage. This eventually leads to the preservation of alveolar bone. Local anesthesia was administered using lignocaine . Atraumatic tooth extraction was done using a periosteal elevator and periotomes Figure .The fragment was slowly luxated and extracted carefully without enlarging the socket excessively. Both the sockets were debrided with povidone-iodine , and two-part implants \u00a0of dimensions 3.3mm x 11.5mm were placed individually following the immediate Implant placement protocol into the existing anatomy of the mesial and distal root sockets , amoxycillin and potassium clavulanate tablets , paracetamol tablets . The sutures were removed after a week. The patient was recalled after four months for final prosthodontic procedures.Prosthodontic phaseThe primary stability of the mesial and distal implants followed good placement. Since the patient insisted on having an early tooth replacement, it was decided to passively load the sutured soft tissue area with a single tooth flexible, removable partial denture in implant protective occlusion with clasps Figures , 6, 7.On recall, after four months, the patient was evaluated intraorally and through an\u00a0intraoral periapical radiograph (IOPA) for adequate osseointegration. The cover screws were exposed with a small incision, and circumferentially trimmed healing abutments were placed in both implants to have stable and screwable abutments\u00a0. Two weeks later, an adequate amount of gingival cuff was formed around the implants. The healing abutments were removed, and the open tray impression using carefully modified open tray implant impression copings was made using putty and light body . Initially, the impression copings contacted each other due to a lack of parallelism in the dual implants. Therefore to enable a good impression, all the sides of dual copings were trimmed and altered to facilitate ease in impression making Figure .Healing abutments were again screwed back in position over two implants. A jig trial was performed to check for impression perfection. A bisque trial consisting of a porcelain fused to metal screw-retained implant crown made from cobalt chromium , and 30 degrees angulated titanium stock abutment \u00a0was carried out Figure . Later, The masticatory surface of the crown had two openings and was adequately sealed with composite resin without creating any high spots. Buccal and occlusal views of the implant crown immediately after final torque of 25 Ncm in both screws are shown in Figure Many factors determine immediate implant placement in a fresh extraction socket. The initial stability of the implant is a primary factor in determining the success of implant placement . To gainImmediate implant placement has high survival rate than implants inserted in non-extraction sites. One study states that the survival rate of implant insertion in the mandibular posterior region is comparatively less than that of the mandibular anterior region .The titanium bases provide an alternative to avoid fracture in the connection of the implant abutment interface. The characteristic feature of titanium bases includes optimum resistance, adequate stability, and biocompatibility with adjacent soft tissues ,15. An iPrevious studies stated that all implants inserted clinically were present at 10 to 18 months. Dual implant insertion has been successfully shown to be a more functional and esthetic method of molar replacement. Replacement of lost molar with dual narrow diameter dental implants is a promising surgery providing clinically feasible and predictable long-term positive clinical solutions ,17. AnotOne study stated that regular\u2011diameter implants might not withstand occlusal chewing forces . The surThis clinical report described a minimally invasive graft-less surgical technique utilizing dual nonstandard diameter implants for replacing a\u00a0molar by following the root anatomy while placing two implants instead of parallel placements, enhancing primary stability for immediate passive loading. Difficulties encountered during the prosthetic phase were clinically corrected to enable final prosthesis placement. Lesser chairside time and surrounding soft tissue area preservation added advantages to this technique. Proper patient selection, strategizing, and applying correct treatment, coupled with good post-surgical care, are vital for the clinical success of immediate implants placed without grafts."} +{"text": "Antimicrobial stewardship during end-of-life care is unique because its principles are employed in the context of palliative care. Understanding how antimicrobials facilitate palliative care \u2013 with its focus on management of symptoms, psychosocial support, and assistance with decision-making \u2013 offers new opportunities to optimize the reach and effectiveness of antimicrobial stewardship. Nevertheless, many aspects of this area warrant increased scrutiny by stakeholders.Improving the use of antimicrobials across healthcare settings is a national priority. While considerable literature has accumulated regarding antimicrobial stewardship across the continuum of care, new frontiers for implementation remain. In general, end-of-life refers to the final days to weeks of a life-limiting illness. However, alternative definitions encompass the entire time interval of a life-limiting illness, such as advanced cancer or advanced dementia, when death would not be unexpected. Palliative care can complement curative therapies during the end-of-life period and may be delivered by diverse clinicians and healthcare settings . Such heterogeneity in the provision of end-of-life care can complicate the implementation of effective antimicrobial stewardship.There is no standardized definition of end-of-life. Consequently, exposure to antimicrobials is common during palliative care. Among hospitalized patients experiencing cancer-related death, 87% received antimicrobials during hospitalization, and over one-third of these patients received antimicrobial therapy following transition to comfort care. Among nursing home residents with advanced dementia, more than 40% received antimicrobials in the 2 weeks prior to death. Nationally, 27% of hospice patients received \u2265 1 antimicrobial during the last week of life, and over 1 in 5 patients discharged to hospice were continued on antimicrobials. In one recent meta-analysis, based on data from 72 studies in which the definition of end-of-life ranged from the day of death to 6 months prior to death, over 50% of patients near the end-of-life receive antimicrobials across healthcare settings. Importantly, evidence to support the presence of bacterial infection was insufficient in most studies, suggesting that many antimicrobial prescriptions are potentially inappropriate. These data indicate that exposure to antimicrobial therapy is substantial during end-of-life care and establish ripe targets for future research and quality improvement.Patients near the end-of-life are prone to infection due to the prevalence of immunosuppression, multimorbidity, cognitive impairment, and device utilization. It remains unknown what specific symptoms associated with infection are most likely to benefit from antimicrobial therapy during this period. Limited evidence suggests that genitourinary symptoms related to urinary tract infection may improve with antimicrobial therapy, whereas those associated with oral cavity, skin and soft tissue, and bloodstream infections may be less responsive. With respect to respiratory symptoms, there are conflicting data. In one American study of patients with advanced dementia and suspected pneumonia, antimicrobial therapy was associated with decreased comfort but improved survival. In contrast, in two Dutch studies, antimicrobial therapy was associated with lower symptomatic burden among patients with dementia who developed pneumonia. These data suggest that the use of antimicrobial therapy for the symptomatic management of infection may lack benefit in long-term care and hospice settings. In acute care settings, withholding antimicrobials should be considered when survival is not a primary goal given the high potential for harm and limited data on efficacy related to relief of symptoms. Ultimately, antimicrobial therapy should be deemed aggressive care during the end-of-life period and be administered orally whenever possible based on good practice recommendations.Goals of care often vary from survival to comfort near the end-of-life. Yet, to date, no study has rigorously evaluated the impact of antimicrobial therapy on mortality or relief of symptoms in an end-of-life population. Two systematic reviews provided limited data to support the use of antimicrobial therapy to achieve relief of symptoms among patients receiving palliative care.Clostridioides difficile infection, and antimicrobial resistance, the pressures to prescribe are powerful and often multifactorial. For example, among 283 surveyed physicians affiliated with an academic medical center, 86% and 75% continued antimicrobial therapy during end-of-life care to honor the request of patients and family members, respectively. These providers often cited a desire to avoid the perception that they were giving up on the patient. Among patients discharged to hospice, nearly 20% of prescriptions were linked to the specific desire of patients and/or their family members to receive antimicrobial treatment. Additionally, the decision to withhold or withdraw antimicrobial therapy may be sensitive to social dynamics within interdisciplinary care teams, including hierarchy, professional power, and shared accountability. These factors, along with many others lie in the backdrop of prognostic uncertainty. Given that predicting death is inevitably imprecise, physicians may favor continuing antimicrobials among patients receiving end-of-life care.It is likely that behavioral and decision-making aspects are key barriers to the implementation of antimicrobial stewardship during end-of-life care. Despite the substantial harms associated with antimicrobial therapy, such as adverse drug events, These recommendations, combined with recent survey data, underscore a role for educational programs to increase the integration of antimicrobial use into advance care planning at the time of enrollment in long-term care or hospice programs. At the facility level, multifaceted interventions supported by information technology including antimicrobial restrictions, clinical decision support tools, and/or comfort care order sets may be designed and evaluated specifically for patients receiving end-of-life care in acute care settings. The benefits and harms of antimicrobial use during end-of-life care using valid and reliable metrics involving patient and caregiver relevant outcomes also require investigation across racially and ethnically diverse populations. Additionally, there is a need to integrate best practices related to antimicrobial stewardship, such as the \u201cFour Moments of Antibiotic Decision Making,\u201d into palliative care settings; this may be achieved using methods of implementation science. Finally, there are no national or international guidelines to facilitate decision-making related to antimicrobial use during end-of-life care. Future studies may consider addressing this gap in knowledge using methods that combine expert opinion and evidence in a systematic manner.There are many potential pathways to promote antimicrobial stewardship during end-of-life care. Good practice recommendations emphasize shared decision-making about future care and agreement regarding goals of treatment as part of advance care planning.In conclusion, antimicrobial use is prevalent during end-of-life care. As antimicrobial stewardship programs strive to optimize antimicrobial prescribing across the continuum of care, end-of-life care represents a challenging new frontier for antimicrobial stewards to improve clinical outcomes and reduce antimicrobial-associated harms."} +{"text": "Cx43 and Scn5a expression may lead to electrical uncoupling in RVOT. The purpose of this review is to update the current understanding of the cellular and molecular mechanisms of RVOT arrhythmogenesis.The right ventricular outflow tract (RVOT) is the major origin of ventricular arrhythmias, including premature ventricular contractions, idiopathic ventricular arrhythmias, Brugada syndrome, torsade de pointes, long QT syndrome, and arrhythmogenic right ventricular cardiomyopathy. The RVOT has distinct developmental origins and cellular characteristics and a complex myocardial architecture with high shear wall stress, which may lead to its high vulnerability to arrhythmogenesis. RVOT myocytes are vulnerable to intracellular sodium and calcium overload due to calcium handling protein modulation, enhanced CaMKII activity, ryanodine receptor phosphorylation, and a higher cAMP level activated by predisposing factors or pathological conditions. A reduction in The right ventricular outflow tract (RVOT) tachycardia is a form of monomorphic or polymorphic ventricular tachycardia originating from the RVOT and accounts for the majority 80%) of outflow tract ventricular arrhythmias. The RVOT is a dominant site of origin of premature ventricular contractions and ventricular tachyarrhythmias that are often observed in patients without structural heart diseases, including idiopathic ventricular arrhythmias, Brugada syndrome, torsade de pointes, and long QT syndrome. The RVOT is also one of the origins of malignant ventricular tachycardia caused by structural heart disease, such as arrhythmogenic RV cardiomyopathy (ARVC) ,2,3,4. I0% of outThe RVOT refers to the region of the right ventricle (RV) between the supraventricular crest and the pulmonary valve and antero-cephalad to the left ventricle, resulting in a characteristic \u201ccrossover\u201d relationship between the right and left ventricular outflows. The RVOT is a thin, smooth-walled, tubular structure, and comprises a complex three-dimensional network of myocardial fibers arranged circumferentially in the sub-epicardium and longitudinally in the sub-endocardium . MusculaSema3C and the subpulmonary myocardium is specifically affected and possibly largely absent in Tbx1 mutant mice [Hey2 is expressed in the ventricular working myocardium in a transmural gradient and represses the expression of Scn5a and is absent from the outflow tract. Hey2 is expressed in the RVOT of adult mouse heart. The gene variants may influence the expression of HEY2, leading to reduced SCN5A expression and a reduced sodium (Na+) current, thereby mimicking a loss of function mutation in SCN5A as found in a minority of patients with Brugada syndrome [Cx43 and Scn5a, are less expressed in the adult mouse RVOT [Scn5a mutation is maintained in the adult heart, resulting in a lower conduction reserve in the RVOT [The RVOT and left ventricular outflow tract have a common origin. The subpulmonary myocardium, which corresponds to the adult RVOT, is formed during the fetal period when a large inferior portion of the muscular embryonic outflow tract is incorporated into the RV free wall, and shows different gene expression from the superior part of the embryonic outflow tract . The infant mice ,20. Durisyndrome . Embryoluse RVOT . The slothe RVOT . Additiothe RVOT . These f+ channel function was found in mouse RVOT myocytes, resulting in an increased vulnerability to conduction abnormalities [The RVOT tissue structure is interspersed with the heterogeneous distribution of fibrous and fat tissue ,25, and malities . Given tmalities , the RVOmalities . Moreovemalities .2+) current (ICa-L), and a spontaneous oscillatory release of Ca2+ from the sarcoplasmic reticulum that activates a transient inward current, giving rise to a DAD [+ channel was found at the basal endocardium of RVOT in non-diseased human hearts [+ current (INa-Late) flows during the late-phase of AP to prolong APD and plays an important role in the genesis of cardiac arrhythmias as a result of enhanced triggered activity. A single Scn5a insertion mutation produces an early Na+ channel closure but augments the INa-Late, which may present in patients with features of both Brugada syndrome and long QT-3 syndrome [+) current (Ito) plays a pivotal role in the genesis of Brugada syndrome, the larger Ito in RVOT myocytes may mediate a more prominent phase 1 notch in AP morphology [Ca-L was obviously larger in the long-APD-RVOT myocytes, which is correlated with the occurrence of early afterdepolarization (EAD) [Ca-L that relates to Ca2+ overload. Moreover, the smaller rapid component of the delayed rectifier K+ current (IKr) may produce a delay in phase 3 repolarization of the AP and the INa-Late flows during the late phase of the AP in RVOT myocytes, resulting in their longer APD. Both reduced IKr and increased INa-Late are known to cause long QT syndrome, a clinical condition associated with an increased risk for torsades de pointes-type of ventricular tachycardia.Triggered activity is considered to be the mechanism underlying adenosine-sensitive RVOT tachycardia due to catecholamine-induced delayed afterdepolarization (DAD). Catecholamine stimulation causes increases in intracellular cyclic adenosine monophosphate (cAMP), L-type calcium . In our 2+ homeostasis in a cardiomyocyte can lead to electrical disturbance. Normally, depolarization opens voltage-gated Na+ channels that lead to large Ca2+ influxes after opening the L-type Ca2+ channels and some Ca2+ through the T-type Ca2+ channels and the reverse mode Na+-Ca2+ exchanger (NCX), leading to an increase in the intracellular Ca2+ concentration. The increased Ca2+ concentration triggers Ca2+ to release from the sarcoplasmic reticulum into the cytoplasm via the ryanodine receptor, a process known as Ca2+-induced Ca2+ release [2+ level then decreases through Ca2+ reuptake into the sarcoplasmic reticulum by the sarco/endoplasmic reticulum Ca2+-ATPase and Ca2+ extrusion by the sarcolemmal NCX and plasma membrane Ca2+-ATPase [2+ represents the balance between Ca influx and extrusion. In some pathological conditions, Ca2+ overload is found when intracellular Ca2+ removal becomes impaired with increased sarcoplasmic reticulum and intracellular Ca2+ concentrations, leading to the increased Ca2+ leak by ryanodine receptors [2+ release from the sarcoplasmic reticulum are observed under the conditions of Ca2+ overload, induce triggered activity, resulting in ventricular tachycardia and ventricular fibrillation [2+ overload and the lengthening of the Ca2+ transient duration and is associated with a shortening in APDs [2+-handling genes was found at the basal epicardium of human RVOT [2+ overload is known to play a major role in RVOT arrhythmogenesis. The potential Ca2+ dysregulation in RVOT myocytes suggests that the RVOT may have a propensity for ventricular arrhythmias. RVOT myocytes had a faster decline in the intracellular Ca2+ transient, suggesting that sarcoplasmic reticulum Ca2+ uptake is faster in RVOT myocytes. A higher sarcoplasmic reticulum Ca2+ load may lead to a spontaneous Ca2+ wave and produce the triggered activity of DAD [2+ and decreasing sarcoplasmic reticulum Ca2+ content. The larger INa-Late in RVOT myocytes may alter the rate of Na+ extrusion/Ca2+ entry and lead to intracellular Ca2+ overload in different species [+-K+ pump and increases INa-Late by Ca2+ calmodulin-dependent protein kinase II (CaMKII) that causes Ca2+ overload in ventricular myocytes [Na-Late inhibitor (ranolazine) can terminate ouabain-induced ventricular arrhythmias in rabbit RVOT but not in rabbit RV apex. Accordingly, CaMKII and INa-Late inhibition on RVOT tissues ameliorates ouabain-induced ventricular tachycardia with Na+ and Ca2+ overload expression, leading to Ca2+ handling abnormalities. The increase in NCX function possibly originated through CaMKII-dependent phospholamban phosphorylation.The larger I loading , which mnhibitor . The CKD2+ dysregulation. The protein expression of SERCA2a and SERCA2a activity may have been inhibited by the generation of oxidative stress. The hypersympathetic innervation in the CKD RVOT suggests that the RVOT may play a role in the induction of ventricular arrhythmia in CKD through enhanced sympathetic activity. The CKD RVOT with higher oxidative stress and autonomic hyperactivity exhibited distinctive electrophysiological characteristics and Ca2+-handling abnormalities, which contributed to the induction of ventricular tachycardia.The CKD RVOT myocytes also show an increased level of oxidative stress, which may have promoted kinase activity and CaMKII expression to cause Ca2+-handling properties that are known to cause arrhythmias. Multiple intrinsic and extrinsic factors are linked to RVOT arrhythmogenesis, which is easily induced in pathological states (The RVOT becomes highly arrhythmogenic because RVOT myocytes have unique electrical and Cal states . As a re"} +{"text": "Cdh13 gene to be associated with hypertension. However, the role of T-cadherin in regulating blood pressure has not been experimentally elucidated. Herein, we generated Cdh13\u2206Exon3 mice lacking exon 3 in the Cdh13 gene and described their phenotype. Cdh13\u2206Exon3 mice exhibited normal gross morphology, life expectancy, and breeding capacity. Meanwhile, their body weight was considerably lower than of WT mice. When running on a treadmill, the time spent running and the distance covered by Cdh13\u2206Exon3 mice was similar to that of WT. The resting blood pressure in Cdh13\u2206Exon3 mice was slightly higher than in WT, however, upon intensive physical training their systolic blood pressure was significantly elevated. While adiponectin content in the myocardium of Cdh13\u2206Exon3 and WT mice was within the same range, adiponectin plasma level was 4.37-fold higher in Cdh13\u2206Exon3 mice. Moreover, intensive physical training augmented the AMPK phosphorylation in the skeletal muscles and myocardium of Cdh13\u2206Exon3 mice as compared to WT. Our data highlight a critically important role of T-cadherin in regulation of blood pressure and stamina in mice, and may shed light on the pathogenesis of hypertension.T-cadherin is a regulator of blood vessel remodeling and angiogenesis, involved in adiponectin-mediated protective effects in the cardiovascular system and in skeletal muscles. GWAS study has previously demonstrated a SNP in the However, T-cadherin is a non-canonical representative of cadherins. While T-cadherin\u2019s extracellular part consists of five Caol (GPI) . Besidesol (GPI) . An elevol (GPI) ,5. Unlikol (GPI) . The comol (GPI) , suggestol (GPI) .Several papers have recently demonstrated that T-cadherin is essential for the adiponectin-mediated protective effects. T-cadherin and adiponectin co-localize in the cardiovascular system, specifically in aorta and heart tissue, as well as in skeletal muscles ,8,9. UsiRecently, it was demonstrated that the adiponectin/T-cadherin system enhances exosome biogenesis and secretion in T-cadherin\u2013expressing endothelial cells in vitro and in the aorta in vivo, as well as exosomes in conditioned media and in the blood . UpregulCdh13 gene has been associated with hypertension in two independent GWAS studies conducted on populations from Germany and Estonia [\u2206Exon3 mice model with truncated T-cadherin lacking exon 3 to study the phenotype of these mice, and thereby determined the role of T-cadherin in regulating blood pressure and physical stamina.Obata et al. showed that the increased exosome production in endothelial cells was T-cadherin dependent and accompanied by the reduction of cellular ceramides through exosome-mediated ceramide efflux . The ele Estonia . While nloxP/loxP mice, possessing 2 loxP sites flanking exon 3 of the Cdh13 gene, to mice constitutively expressing Cre-recombinase (\u2206Exon3 mice) (To create T-cadherin-deficient mice we crossed Cdh13ombinase A. We isoombinase A. We conombinase . Accordin3 mice) B. These n3 mice) A, in conn3 mice) B. Given n3 mice) B.\u2206Exon3 mice, the sequencing of Cdh13 mRNA was performed ; these mice were subsequently used for breeding. The Plaur gene (reference gene) was amplified in all mice tested, confirming the specificity of the results. The amplification cycles of the products corresponding to the 2nd and 3rd exons in the Cdh13 gene are presented in Further, to confirm the absence of exon 3 in the Cdh13 gene modification using murine samples from the aorta, brain, heart, muscle, and kidneys, where T-cadherin is highly expressed [\u2206Exon3 mice, the heart samples were obtained from three WT and two Cdh13\u2206Exon3 mice, while one kidney sample was obtained from one Cdh13\u2206Exon3 mouse. In all samples from Cdh13\u2206Exon3 mice T-cadherin expression was not detected (Cq > 40), except in one aorta sample from a Cdh13\u2206Exon3 mouse, where the expression level was 0.00102 \u00b1 0.00004 (mean \u00b1 SEM) of the WT level. Therefore, the obtained results clearly indicated the presence of mRNA, containing the 3rd exon, only in WT mice.We also applied qPCR to verify the xpressed ,16. The \u2206Exon3 and WT mice. For that, we used the commercially available antibodies raised against the N-terminus peptide of T-cadherin corresponding to the exon 3 region . Both 130-kDa pro-protein and proteolytically cleaved 105-kDa, a mature form of T-cadherin, were readily detected in the tissues of WT mice, but not in those of Cdh13\u2206Exon3 mice , N = 12 vs. 22.4 g , N = 10, p = 0.042) (\u2206Exon3 mice preliminarily familiarized with the procedure. Median (interquartile range) systolic blood pressure was 70 mm Hg in wild-type mice (N = 10) and 99 in knockout mice (N = 10) p = 0.1714. Median (interquartile range) diastolic blood pressure was 40 mm Hg in wild-type mice and 56 in knockout mice (p = 0.2571). Median (interquartile range) heart rate was 616 mm Hg in wild-type mice and 456 in knockout mice (p = 0.1714). Therefore, resting blood pressure in Cdh13\u2206Exon3 mice was moderately higher, however the difference was not significant.The obtained Cdh13= 0.042) . We have\u2206Exon3 mice responds differently to stress. To test this hypothesis, we compared the ability of wild type and Cdh13\u2206Exon3 mice to run on a treadmill for a sustained period of time. We found that the time spent running and the distance covered by both Cdh13\u2206Exon3 and WT mice did not differ. However, systolic blood pressure was higher in Cdh13\u2206Exon3 mice compared to WT mice , N = 8 vs. 74 mmHg, interquartile range , N = 11) . These d\u2206Exon3 mice using an ELISA kit . Indeed, the adiponectin plasma concentration was 4.37-fold higher in Cdh13\u2206Exon3 mice compared to WT . However, despite the observed decline tendency in adiponectin concentration in myocardium, no significant difference was detected .Since T-cadherin expression is closely tied to the expression of its ligand-adiponectin, we assumed that T-cadherin deficiency can affect the adiponectin plasma level. We compared the plasma adiponectin levels of WT and Cdh13\u2206Exon3 and WT mice. However, after running on the treadmill, the AMPK phosphorylation level was higher in the skeletal muscles and myocardium of Cdh13\u2206Exon3 mice compared to WT mice demonstrated a strong association and a 4.5-fold decrease in plasma adiponectin levels [\u2206Exon3 mice. In line with the previously published results [\u2206Exon3 mice: a 4.37-fold rise in Cdh13\u2206Exon3 mice was detected compared to WT mice. Therefore, our data suggest that it is the efficiency of adiponectin interaction with the full-length T-cadherin that is particularly important for blood pressure control, rather than the level of this circulating hormone per se.Emerging evidence indicates that the h13 gene . A rare n levels . A prime results ,28, we f\u2206Exon3 mice, despite the decreased tissue adiponectin content and the lack of full-length T-cadherin expression were recorded.Genomic DNA from ear biopsies after proteinase K digestion was used for mouse genotyping. We designed three primers: two forward (5\u2032-ACTGAGGCATTCAAGTTCGGT-3\u2032 and 5\u2032-TTTCCCCATCAACTGGCACA-3\u2032) and one reverse primer (5\u2032-GCAGGGTTGTGCATCACTAGA-3\u2032). This system allowed us to identify WT and knockout alleles in any combination . We usedFor the partial sequencing of T-cadherin mRNA in knockout mice, total RNA was isolated from brain samples of knockout mice with the RNeasy Mini Kit . Reverse transcription was performed with a MMLV RT kit to amplify T-cadherin cDNA fragments with the following primers: forward ATGCAGCCGAGAACTCCGCT, reverse GTCATCGATCACGATGGTGGCTGT. The resulted PCR product was cloned into the pAL-T2 rapid ligation vector using T4 ligase . The insert was sequenced using T7dir and M13rev oligonucleotide primers .\u2206Exon3 mice, qPCR was performed. Tissue samples were flash-frozen in liquid nitrogen immediately after isolation. RNA was isolated using the RNeasy Mini Kit . We carried out reverse transcription using a MMLV RT kit . To amplify the Cdh13 gene, the following primers placed in exons 3 and 4 were used: forward 5\u2032-CATGGCAGAACTCGTGATTG-3\u2032, reverse 5\u2032-GGTTCTCTGGGATCAAGATGG-3\u2032. Rplp0 was used as a reference gene with the following primers: forward 5\u2032-GAGGAATCAGATGAGGATATGGGA-3\u2032, reverse 5\u2032-AAGCAGGCTGACTTGGTTGC-3\u2032. PCR was performed using qPCRmix-HS , and a CFX96 PCR machine .To evaluate T-cadherin expression in WT and Cdh13Plaur gene (the urokinase receptor) was used as a reference gene for the isolated murine genomic DNA. Amplification was carried out in a volume of 35 \u03bcL using the following program: 50 cycles of 94 \u00b0C\u201410 s, 68 \u00b0C\u201420 s, 72 \u00b0C\u201410 s. The fluorescence level was measured in each cycle using two channels (FAM and HEX) at a temperature of 68 \u00b0C.For mice genotyping and subsequent selective breeding, blood sampling was conducted in 1 mL disposable tubes. Next, the blood was subjected to erythrocyte washing. Genomic murine DNA was then isolated from the precipitated leukocytes. DNA isolation was performed using the \u201cProba-NK\u201d kit according to the manufacturer\u2019s instructions. The isolated DNA, in a volume of 100 \u03bcL, was used for RT-PCR with Taq-Man fluorescent probes. The primer pairs and corresponding probes are presented in Proteins were extracted from hearts and hind limb muscles by homogenization in liquid nitrogen, followed by solving in Laemmli buffer containing protease and phosphatase inhibitors, as well as beta-mercaptoethanol . Samples were subjected to SDS-PAGE next to the protein ladder , followed by the transfer to PVDF membrane. Membranes were blocked in 5% skim milk for 12 h at +4 \u00b0C and probed with rabbit primary antibodies anti-AMPK alpha, , anti-phospho-AMPK alpha , anti-T-cad , and anti-beta-actin , followed by incubation with horseradish peroxidase-conjugated secondary antibodies . Protein bands were visualized using enhanced chemiluminescence with Clarity Max Western ECL Blotting Substrate (Bio-Rad) registered on a ChemiDoc instrument according to the manufacturer\u2019s protocols. Image analysis was performed in Image Lab (Bio-Rad).\u2206Exon3 knockout mice were isolated, minced and thoroughly homogenized in 10\u00d7 (V/m) volume of Cytosolic extraction buffer containing protease inhibitors, followed by a 10 min incubation on ice and filtration through the mesh supplied by the manufacturer. Filtrates were centrifuged at 500\u00d7 g for 5 min, resulting in supernatant (cytosolic fraction) and pellet (fraction enriched in membrane proteins) further used for sample preparation and electrophoresis.To separate the cytoplasmic fraction and the fraction enriched with membrane proteins, we used the Pierce Subcellular Fractionation kit for tissues , performing all manipulations at +4 \u00b0C. The hearts of 8-week-old WT and Cdh13Samples were subjected to SDS-PAGE, followed by the transfer onto Nitrocellulose membrane (Thermo Scientific 88018) next to the protein ladder . Membranes were blocked in 5% skim milk for 12 h at +4 \u00b0C and were probed with the primary antibodies anti-T-cadherin and anti-alpha tubulin , followed by incubation with horseradish peroxidase-conjugated secondary antibodies , donkey anti-mouse HRP (#715-035-151), donkey anti-rabbit (#111-035-003). Protein bands were visualized using enhanced chemiluminescence with the Affinity ECL kit and registered on a ChemiDoc instrument according to the manufacturer\u2019s protocols. Image analysis was performed using the Fiji program .g) and snap frozen in liquid N2. 100 mL from homogenate or plasma samples diluted by 1:2000 was applied in each well and processed further according to the manufacturer\u2019s protocol.Adiponectin concentration was measured in heparin plasma and heart homogenates using an ELISA kit . Hearts were placed on ice, then washed by ice-cold PBS; 100 mg of each heart was homogenized in 3 mL of lysis buffer using gentle MACS Dissociator in M-tubes (running mouse heart 2.2. protocol). Homogenates were centrifuged ."} +{"text": "Bipolar disorder (BD) is a mood disorder that affects millions worldwide. Up to half of the diagnosed patients are reported to not receive adequate treatment. This study aims to assess the relationship between the gut\u2013brain axis and BD and to discuss and compare the efficacy of varying methods of balancing gut microbiotas in BD.Using PubMed, Embase, and Google Scholar from November 2021 to February 2022, we found 5310 studies on gut microbiota and its relation to BD. Using our inclusion criteria, 5283 studies were excluded. A total of 27 full\u2010text articles were assessed for eligibility. Also, 12 articles that met our criteria and eligibility criteria reported on 613 BD patients.Lactobacillus, Faecalibacterium, and Ruminococcus abundance in BD compared to controls were found to be the most consistent across a few of the studies, but their effects on the gut\u2013brain axis conflicted. Probiotic supplementation was found to lower patient rehospitalizations and significantly improve depressive symptoms and cognitive impairments among patients with BD.Most studies analyzed found an overall difference in gut microbiota composition in bipolar patients compared to healthy controls, though the alterations found were not consistent. Differences in Multiple studies included in this review point toward a possible link between BD and the gut microbiota. Probiotic supplements and other gut\u2010balancing therapies could serve as effective adjunctive methods for the treatment of BD. Notable limitations of the studies included for analysis were small sample sizes and majority observational study designs. Furthermore, the microbiota aberrations found in patients with BD were not consistent across multiple studies. Despite these limitations, our findings demonstrate the need for further research regarding the relationship between aberrant gut microbiota profiles and BD, as well as the effectiveness of gut balancing methods as adjunctive treatments. In this systematic review, the link between the gut microbe and the development and progression of bipolar disorder is investigated. Furthermore, the potential use of gut balancing methods such as probiotics as adjunctive therapy for bipolar symptoms is analyzed. Our investigation found a link between gut microbiota composition and bipolar disorder, as well as evidence that supports the use of probiotics as an adjunctive treatment. In this systematic review, we aim to assess how components of the gut\u2013brain axis contribute to BD, to determine how balancing gut microbiotas affect the severity of symptoms, and to discuss and compare the efficacy of varying methods of balancing gut microbiotas in BD.22.1For this systematic review, we searched PubMed, Google Scholar, and Embase for articles published between April 2017 and January 2021. Search terms on PubMed were (gut microbiotas mood disorders) AND (probiotic treatment BD) AND (microbiotas BD) AND (treatment target gut microbiome mood) AND (gut biomarkers mania) AND (gut biomarkers mania) AND (treatment target gut microbiome mood disorders). Search terms on Google Scholar were ((probiotic treatment BD) AND (gut microbiota changes in bipolar). Search terms on Embase were \u201cgut microbiotas mood disorders\u201d OR ((\u201cgut\u201d/exp OR gut) AND (\u201cmicrobiotas\u201d/exp OR microbiotas) AND (\u201cmood\u201d/exp OR mood) AND (\u201cdisorders\u201d/exp OR disorders)) AND (probiotics) AND (mania) AND (gut) AND (biomarkers) AND (bipolar) AND (gut microbiota changes in bipolar) AND (gut biomarkers mania)).All authors initially selected articles via manual screening of abstracts and searched the reference lists of the chosen articles for additional information that could be applied to our investigation. Articles that investigated the gut microbiome and its link to mood disorders were included.2.2Population: Patients with diagnosed BD.Outcome(s) of interest or condition: The first outcome was determining an association between the gut\u2013brain axis and BD. The second outcome was to document any noted changes in symptom severity of patients after correcting the gut microbiota in affected patients. And last, to evaluate existing methods of gut microbiota balancing in bipolar patients.Study design and context: Eligible studies were randomized controlled trials, double\u2010blind controlled trials, cohort studies, cross\u2010sectional studies, and case\u2010control studies.Studies were selected according to the following criteria: population, outcome(s) of interest or condition, study design, and context:2.2.1Human studies that examined and reported (a) a link between gut microbiotas and the physiologic causes of BD , (b) current documented changes to gut microbiota using probiotics, supplements, fecal implantation, or diet, (c) any functional, depressive, and/or manic symptom changes observed with gut microbiota balancing.2.2.2Systematic review studies, editorials, case studies, commentaries, and articles irrelevant to either the development or treatment of BD or the behavioral changes associated with gut microbiota.2.3All authors independently reviewed the abstracts of all the articles identified. We divided the articles into two groups of \u201cAdopted\u201d and \u201cNot Adopted\u201d based on the inclusion criteria. Then, we screened the \u201cAdopted\u201d articles and created a spreadsheet to include them to be used for our research work. After the final selection process, a Preferred Reporting Items For Systematic Reviews and Meta\u2010Analysis (PRISMA) flow chart was generated following the PRISMA guidelines. Resources for this review were obtained via qualitative and quantitative analysis.2.4Quantitative and qualitative studies based on original research that examined the gut microbiota and brain relationship in BD and nonpharmacologic methods for treating bipolar symptoms were included. The data synthesis was conducted in a detailed summary of the included studies by table construction. The quantitative data were extracted using Microsoft Word. The data were grouped according to the objective of this study.3Our study included 613 BD patients , 39 first\u2010degree relatives, and 321 healthy controls . Other characteristics such as BMI, medication status, lifestyle modifications, and BD I vs. BD II diagnosis were collected during this analysis and are listed in Table\u00a03.1The following were observed in this analysis: (1) the composition of the gut microbiome; (2) the neurotransmitter pathway differences of gut microbiota; and (3) the gut microbiota composition and its relation to inflammation and serum lipids.3.1.1Flavonifractor, Actinobacteria, and Coriobacteriaceae were found to be increased in patients with BD compared to healthy individuals . The prevalence of Flavonifractor in the first\u2010degree unaffected relatives (44%) differed from patients with BD (Q\u202f\u00a0=\u00a0\u202f0.02) but not from healthy individuals (Q\u202f\u00a0=\u00a0\u202f0.7).Coello et\u00a0al. conductep\u202f\u00a0=\u00a0\u202f5.8\u202f\u00d7\u202f10\u22124, Q\u202f\u00a0=\u00a0\u202f0.04) more likely to have Flavonifractor detected compared to HCs. Despite adjusting for the presence of Flavonifractor in BD for age, sex, smoking, waist circumference, physical activity, and medication, BD was still associated with Flavonifractor prevalence. However, among patients with BD, smoking and female sex were associated with the presence of Flavonifractor.An interesting finding of this study was that newly diagnosed patients with BD were 2.9 times ratio of the BD group was significantly lower than the HCs (p\u00a0=\u00a0.001).Lu et\u00a0al.\u2019s results also found significant differences in the gut microbiota composition of patients with BD. They found that the counts of p\u00a0=\u00a0.044) were more abundant, while Clostridiaceae and Roseburia were more abundant in patients with BD with depressive symptom improvement. When comparing patients with BD and HCs, Actinobacteria and Coriobacteria were significantly more abundant in BD when compared with HCs, and Ruminococcaceae and Faecalibacterium were more abundant in HC when compared with BD or fecal Lactobacillus counts . Male and female subjects were examined separately, and there were still no significant differences found for fecal bacterial counts. Separately comparing Bipolar I , aromatic aminotransferase, which is reported to cause less synthesis of tryptophan. Also, the KO1667 (FDR.p\u00a0<\u00a0.001), Tryptophanase enzyme, was found in higher abundance in BD patients.Lai et\u00a0al. examinedLactobacillus , the family of Lactobacillaceae , the family of Coriobacteriaceae and Clostridiaceae from individuals with low Trp and Streptococcus compared with BD individuals with lower IL\u20106 compared to patients with BD with low cholesterol levels.Painold et\u00a0al. investig3.1.4r\u00a0=\u00a0\u22120.389, p\u2009\u00a0=\u00a0\u2009.0238) and evenness in individuals with BD. The alpha\u2010diversity, a count of the different bacterial taxa that exist in the gut and is measured by the Simpson index, differed significantly between patients with BD with current depressive symptoms (n\u2009\u00a0=\u00a0\u200913) and those who were euthymic \u2009\u00a0=\u00a0\u20094.695, p\u2009\u00a0=\u00a0\u2009 .039, Partial Eta2\u2009\u00a0=\u00a0\u20090.144).Bengesser et\u00a0al.\u2019s study wa3.2We analyzed studies that investigated how balancing gut microbiotas affected the severity of bipolar symptoms, such as mania and depressive symptoms, and found conflicting results.Bifidobacterium bifidum, Bifidobacterium lactis, and Bifidobacterium langum, and Lactobacillus acidophilus. The YMRS mania scale and Hamilton's depression scale questionnaires were completed by a psychiatry resident at the start of the study, before the intervention (probiotic capsule), at the 4\u2010week mark, and at the 8\u2010week mark. While both the probiotic and placebo groups displayed a decrease in mania and depression questionnaire scores throughout the duration of the study, it was found that patients in the probiotic group displayed significantly higher decreases in symptom severity via the Young Mania and Hamilton questionnaire scores throughout the three measured points of the study. However, even though the probiotic group had a more significant improvement in questionnaire scores throughout the 8\u2010week study as compared to the placebo group, there were no significant differences in overall mania and depression scores between placebo and probiotics patients with type 1 BD.Eslami Shahrbabaki et\u00a0al. evaluateF \u00a0=\u00a03.621, p\u00a0=\u00a0.048; YMRS: F \u00a0=\u00a04.751, p\u00a0=\u00a0.023). There was no significant improvement in symptoms between the different time points of the studyIn their study, Reininghaus et\u00a0al. examined3.3We analyzed studies that investigated how balancing gut microbiotas affected the severity of bipolar symptoms, such as mania and depressive symptoms, and found conflicting results. Other parameters, such as cognition, mood, and hospitalization, were investigated.Bifidobacterium bifidum, Bifidobacterium lactis, and Bifidobacterium langum, and Lactobacillus acidophilus. The YMRS mania scale and Hamilton's depression scale questionnaires were completed by a psychiatry resident at the start of the study, before the intervention (probiotic capsule), at the 4\u2010week mark, and at the 8\u2010week mark. While both the probiotic group and placebo group displayed a decrease in mania and depression questionnaire scores throughout the duration of the study, it was found that patients in the probiotic group displayed significantly higher decreases symptom severity via the Young Mania and Hamilton questionnaire scores throughout the three measured points of the study. However, even though the probiotic group had a more significant improvement in questionnaire scores throughout the 8\u2010week study as compared to the placebo group, there were no significant differences in overall mania and depression scores between placebo and probiotics patients with type 1 BD.Eslami Shahrbabaki et\u00a0al. evaluateLactobacillus rhamnosus strain GG and Bifidobacterium animalis subsp. Lactis strain Bb12 over a a period of 24\u00a0weeks. During the study period, there were eight (24.2%) rehospitalizations and YMRS scales by week, F\u00a0=\u00a010.84, p\u00a0\u2190\u00a0.0001).Dickerson et\u00a0al. gave recF\u00a0=\u00a08.60; \u03b72\u00a0=\u00a00.49, p\u00a0<\u00a0.01). Furthermore, executive function measured with the TMT\u2010B, increased significantly over 3 months . In the second study \u00a0=\u00a03.621, p\u00a0=\u00a0.048; YMRS: F \u00a0=\u00a04.751, p\u00a0=\u00a0.023). There was no significant improvement in symptoms between the different time points of the study. However, it was found that, those who received probiotic supplementation with Lactobacillus and Bifidobacterium were found to have a significantly decreased Leiden Index of Depression Sensitivity\u2010Revised rumination score over time with three interval points: \u00a0=\u00a04.024, p\u00a0=\u00a0.037; t2 (mean 14.0 SD\u00a0=\u00a06.0) to t3; F\u00a0=\u00a010.563, p\u00a0=\u00a0.004)).Reininghaus et\u00a0al. conducte4Lactobacillus was found to have a direct correlation with higher tryptophan levels, essentially affecting neurotransmitter levels known to play a role in BD pathogenesis. This gut\u2013brain axis connection between the gut microbiome and brain neurotransmitters illustrates how some bacteria can be used as \u201cpsychobiotics\u201d patients and 312 HCs. This is an ideal cumulative size, however, outside of one study (Evans et\u00a0al., 6Identify common microbiome alterations that can be linked to BD. The studies included in this review reported microbiome alterations among patients with BD, however, those alterations varied. There have yet to be additional studies that have replicated the findings of the articles mentioned.Additional investigations into gut\u2010balancing methods aside from probiotics.Further investigation of how gut microbiome alterations serve as epigenetic factors of the pathogenesis of BD. One of the included studies found a link between gut microbiota alterations and the epigenetic impact on the gene ARNTL, which is thought to play a role in BD pathogenesis (Bengesser et\u00a0al., In this systematic review, we aimed to assess how components of the gut\u2013brain axis contribute to BD, to determine how balancing gut microbiotas affect the severity of symptoms, and to discuss and compare the efficacy of varying methods of balancing gut microbiotas in BD. There are significant associations between BD pathogenesis and alterations of gut microbiome diversity via immunomodulation, the HPA axis, and neurotransmitter alterations. Specific microbiome species could serve as therapeutic targets as adjunctive therapies for patients with BD to manage depressive and manic symptoms. Additionally, other gut\u2010balancing methods, such as ketamine, charcoal, and vitamin D supplementation, have also shown promise as adjunctive agents. Despite these promising findings, current studies investigating the gut\u2013brain axis relationship among patients with BD are limited by small sample sizes and a lack of adequate replication of results. However, the conclusions drawn from this review highlight that there may be specific bacteria common to patients with BD that could serve as screening tools and therapeutic targets, of which future studies could investigate. We recommend that future studies place emphasis on the following:The products used for this research are commonly and predominantly used products in our area of research and country. There is absolutely no conflict of interest between the authors and producers of the products because we do not intend to use these products as an avenue for any litigation but for the advancement of knowledge. Also, the research was not funded by the producing company rather it was funded by the personal efforts of the authors.As per international standards or university standards, Participants\u2019 written consent has been collected and preserved by the authors.The authors have declared that no competing interests exist.https://publons.com/publon/10.1002/brb3.3037The peer review history for this article is available at" \ No newline at end of file