diff --git "a/deduped/dedup_0933.jsonl" "b/deduped/dedup_0933.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0933.jsonl"
@@ -0,0 +1,65 @@
+{"text": "A number of factors have recently caused mass coral mortality events in all of the world's tropical oceans. However, little is known about the timing, rate or spatial variability of the loss of reef-building corals, especially in the Indo-Pacific, which contains 75% of the world's coral reefs.2 per year). The annual loss based on repeated measures regression analysis of a subset of reefs that were monitored for multiple years from 1997 to 2004 was 0.72 % .We compiled and analyzed a coral cover database of 6001 quantitative surveys of 2667 Indo-Pacific coral reefs performed between 1968 and 2004. Surveys conducted during 2003 indicated that coral cover averaged only 22.1%  and just 7 of 390 reefs surveyed that year had coral cover >60%. Estimated yearly coral cover loss based on annually pooled survey data was approximately 1% over the last twenty years and 2% between 1997 and 2003 (or 3,168 kmThe rate and extent of coral loss in the Indo-Pacific are greater than expected. Coral cover was also surprisingly uniform among subregions and declined decades earlier than previously assumed, even on some of the Pacific's most intensely managed reefs. These results have significant implications for policy makers and resource managers as they search for successful models to reverse coral loss. There is growing scientific and public awareness of the widespread depletion of marine habitat-forming species, such as mangroves, seagrasses, oysters, and corals . This loss inevitably leads to the decline of the plants and animals that live in the biogenic structures created by such foundation species, and contributes to the overall degradation of marine ecosystems Scientists have recognized the ecological and economic value of coral reefs and the threats to reef-building corals for decades in situ or photographic/video-based measurements. Because corals facilitate so many reef inhabitants Here we describe a comprehensive analysis of the timing, rate, and geographic extent of the loss of coral cover across the Indo-Pacific . For theThis study provides the first regional scale and long-term analysis of coral cover in the Indo-Pacific. Our results indicate that the loss of coral cover began earlier than assumed and that coral cover is currently very similar across the Indo-Pacific, suggesting that coral decline is a general global phenomenon.Our analyses were based on quantitative surveys that measured the percentage of the bottom covered by living scleractinian corals on subtidal coral reefs  within ten subregions of the Indo-Pacific . We inclCoral cover data from the Australian Institute of Marine Science's (AIMS) Long Term Monitoring Program (LTMP) in situ by recording the number of points along each transect  that overlay a living hard coral (the point intercept technique) or by taking digital or film images of the bottom at these points within quadrats . In most surveys, multiple transects or quadrats were used to estimate cover at a given reef, producing more than one cover value. We always pooled such replicate cover measurements from one depth/zone into a single mean estimate.Most surveys were based on the line transect technique or some variant to estimate coral cover. A transect  is placed on the reef, oriented either along a depth contour or down the reef slope. Coral cover is then estimated either We also included data from manta tow surveys of coral cover Most of the reefs in the database were surveyed only once, but a subset of 651 reefs were surveyed two or more times . In mostLinear repeated measures regression analysis was used to test the null hypothesis that there was no relationship between coral cover and time from 1968 to 2004. We were unable to perform a formal meta-analysis because several critical components  were not available for all data sets. We used Stata  and performed two sets of analyses: (1) on the annual subregional means based on all 6001 surveys, and (2) on the data from the 651 monitoring sites. In both analyses, time (year) and coral cover were treated as continuous variables. Because locations were repeatedly sampled over time, coral cover estimates of a given subregion or reef in different years were not independent. This longitudinal structure was incorporated into the statistical model by using repeated measures of subregions or reefs. Thus, statistical estimates of the absolute net decline in coral cover were based on the individual trajectories of subregions or reefs and were not derived by pooling all the data for each year. For these and all other analyses, data were transformed when necessary to meet basic statistical assumptions.In the subregion analysis, we used the mean cover in each subregion for each year as the dependent variable, rather than the individual reef means, in part because the sample size varied greatly among years, periods, and subregions. Performing this analysis on yearly subregional averages equalizes the influence of each subregion and prevents the results from being driven primarily by especially well-sampled subregions like the GBR and the Philippines . HoweverFor the analysis of the reef monitoring data, we performed four repeated measures regression analyses to test the null hypothesis and estimate the slope of significant linear functions during the entire 36 year range and for each of the three periods: 1970\u20131983, 1984\u20131996, and 1997\u20132004. The period delineations were based on the timing of major disturbance events and expected and observed trends in coral cover in the Indo-Pacific. For example, the beginning of the third period (1997\u20132004) coincides with a major global mass-bleaching event in 1998 and 1999 Estimates of the rate of coral loss could be influenced by year-to-year and period-to-period changes in the location of reef surveys. For example, if surveys initially focused on high cover reefs or subregions and then shifted focus to low cover reefs, the estimated rate of regional or subregional coral loss could be exaggerated. Alternatively, an initial overrepresentation of low cover reefs or subregions could underestimate the true rate of net coral loss. This problem is diminished in the monitoring sites analysis because individual reefs are monitored through time and reef identity is far less variable. Nevertheless, the identity of monitored reefs did change over time , so this potential source of bias was not entirely eliminated. A second potential bias in the analyses is the overrepresentation of the best-sampled subregions, mainly the Philippines and the GBR. Therefore, the regression results are not necessarily representative of all ten subregions, especially those that were not well monitored.Because the effects of a variety of disturbances on coral cover are depth-dependent Our results indicate that coral cover on Indo-Pacific reefs is currently lower and far more uniform than expected . The regThe general absence of quantitative data on reef health has led to several misconceptions about the causes, patterns, and best remedies for global coral decline. For example, in 2003, coral cover on the Great Barrier Reef (GBR), considered the \u201cbest-managed\u201d Additionally, there are other important measures of reef degradation, in particular the abundance and diversity of reef inhabitants Historically, i.e., 100\u20131000 y.b.p., average coral cover in the Indo-Pacific was probably approximately 50% 2. However, coral cover fluctuated somewhat throughout the 1980s and the regional average was still 36.1% in 1995 , subsequently declining by 14% in just seven years . We used repeated measures regression analysis based on the individual trajectories of subregions or reefs  to quantitatively estimate the absolute net decline of coral cover. Estimates based on subregional means and the reef monitoring data (a subset of the entire database) for similar periods were nearly identical  to 22.1% by 2003 ; an averdentical  and wereThe estimated annual rate of coral cover loss in the Caribbean between 1977 and 2001 was approximately 1.5%, with the greatest decline occurring during the 1980s Acanthaster plancii, a corallivorous sea star that substantially reduced cover on many GBR reefs Acanthaster predation had similar effects in Guam, Fiji, Palau and other locations over the last forty years and is a principle cause of coral loss in several subregions Acanthaster in the 1960s and 1970s partially or wholly recovered by the early 1980s Regional and subregional trends in coral cover during the 1970s are less clear than for more recent periods because fewer surveys were performed, few subregions were adequately sampled, and 77% of surveyed reefs prior to 1973 were on the GBR. Therefore, it is unlikely that the regional cover average of 30% between 1968 and 1972  is representative of all subregions, particularly those that did not experience outbreaks of Acanthaster outbreaks. For example, Endean and Stablum Our analysis suggests that the regional-scale coral decline in the Indo-Pacific began several decades earlier than often assumed. For example, Pandolfi et al. Comparing the timing and rate of coral decline among Indo-Pacific subregions is difficult because many were not adequately sampled until the early 1980s. Furthermore, historic baseline coral cover may have varied among subregions due to differences in disturbance frequency or the morphology of dominant species. For example, reefs dominated by plating acroporiid corals probably had higher baseline cover than reefs dominated by branching corals. Thus, similar current cover among subregions could actually reflect variability in the degree of coral loss. Additionally, the dependence of facilitation and other ecosystem functions on coral cover could vary among subregions .Between 1984 and 1996, coral cover was slightly lower in east Indonesia than on the GBR . HoweverMajor storms, though not novel disturbances, are considered primary causes of recent coral loss in several locations including Hawaii and Moorea Despite the well-documented effects of several causes of mass coral mortality, there is substantial evidence that coral communities remain resilient, often recovering in ten to thirty years after major disturbances Average GBR coral cover has been consistently below 27% since 1986 . But thi\u22122 year\u22121The results of our analysis of 6001 quantitative reef surveys indicate that the degree, geographic extent, and duration of the Indo-Pacific coral decline have been significantly underestimated. Many coral reef scientists know of exceptions to the general pattern of reef degradation: there are currently many, perhaps hundreds or even thousands of high coral cover  reefs in the Indo-Pacific and Caribbean that resemble the presumed historical coral baseline . But our results indicate that such observations are anomalies and currently represent less than 2% of reefs in the Indo-Pacific. This study also highlights the urgent need for conservation policies to restore coral reefs and the ecosystem services they provide, estimated to be worth $23,100\u2013$270,000 kmThe loss of coral cover represents both an absolute loss and a reduction in the quality of reef habitat Text S1Calculation of Indo-Pacific reef area(0.03 MB DOC)Click here for additional data file.Text S2Published data sources(0.04 MB DOC)Click here for additional data file.Text S3Analysis of potential effects of depth on coral cover estimates(0.05 MB DOC)Click here for additional data file.Text S4Potential biases in survey techniques and site selection(0.05 MB DOC)Click here for additional data file.Table S1The number of surveyed reefs in the ten Indo-Pacific subregions.(0.05 MB DOC)Click here for additional data file.Table S2Characteristics of the eight basic sources of coral cover data.(0.05 MB DOC)Click here for additional data file.Table S3Number of monitoring sites in the ten Indo-Pacific subregions during each of three periods (note most monitoring sites were surveyed for more than one period).(0.05 MB DOC)Click here for additional data file.Table S4Results of linear repeated measures regression analyses on the relationship between coral cover and time in the Indo-Pacific. Unlike the results presented in (0.04 MB DOC)Click here for additional data file.Figure S1Patterns of coral cover decline in ten Indo-Pacific subregions. Black bars are mean coral cover \u00b1 1 SE for each year (missing bars are years in which no data are available). Open symbols (right axis) are the number reefs surveyed in each subregion during each year .(0.73 MB EPS)Click here for additional data file.Map S1Locations of the 2667 surveyed reefs (green dots). (This KML file can be viewed with the Google Earth mapping system.)(0.09 MB ZIP)Click here for additional data file."}
+{"text": "A variety of human activities have led to the recent global decline of reef-building corals We compiled a global database of 8534 live coral cover surveys from 1969\u20132006 to compare annual changes in coral cover inside 310 MPAs to unprotected areas. We found that on average, coral cover within MPAs remained constant, while coral cover on unprotected reefs declined. Although the short-term differences between unprotected and protected reefs are modest, they could be significant over the long-term if the effects are temporally consistent. Our results also suggest that older MPAs were generally more effective in preventing coral loss. Initially, coral cover continued to decrease after MPA establishment. Several years later, however, rates of coral cover decline slowed and then stabilized so that further losses stopped.These findings suggest that MPAs can be a useful tool not only for fisheries management, but also for maintaining coral cover. Furthermore, the benefits of MPAs appear to increase with the number of years since MPA establishment. Given the time needed to maximize MPA benefits, there should be increased emphasis on implementing new MPAs and strengthening the enforcement of existing MPAs. A variety of human activities have caused the recent global decline of reef-building corals By limiting or preventing fishing and other extractive activities, Marine Protected Areas (MPAs) have been relatively successful in restoring populations of overharvested fish and invertebrates However, protection within MPAs may not necessarily result in positive effects on coral cover. Coral loss that is driven by regional or global stressors like climate change and coral disease outbreaks seems unlikely to be mitigated by MPAs or other local management actions In spite of the importance of reducing coral losses, no global analyses have explored the potential role of MPAs in reducing coral decline. Coral cover, or the percentage of hard substrate covered by living coral tissue, is a key measure of coral ecosystem health. We compiled a global coral cover database to determine whether changes in benthic coverage by living scleractinian (stony) corals differed within MPAs compared to unprotected reefs. We also examined the potential influence of location (ocean basin) and years since MPA implementation on the mitigation of coral loss by MPAs.We compiled a comprehensive global database to compare long-term changes (1969 to 2006) in coral cover from 5170 independent surveys inside 310 MPAs around the world to 3364 surveys of unprotected reefs . SurveysWe constructed different multi-level models to compare changes in coral cover over time between MPA and non-MPA reefs and to determine how the number of years of protection in MPAs affected temporal changes in coral cover. Multi-level models use parameters that can vary at more than one level. We used this approach to incorporate the spatial and temporal structure  in the coral cover data. We then determined the necessary random effects and additional predictors to incorporate into the model using Akaike Information Criterion. Because change in coral cover is often dependent on initial coral cover For the \u2018MPA versus non-MPA model\u2019, we grouped protected reefs within each MPA with all unprotected reefs within 200 km . This apFor the \u2018years of protection model\u2019, which only included surveys on reefs within MPAs, we built two sub-models: one for the protected Caribbean reefs and the other for all the protected reefs in the Indian and Pacific Oceans (hereafter Indo-Pacific). We used these models to assess whether the number of years of protection affected changes in coral cover within MPAs. When we explored different model forms using generalized additive mixed models for the two ocean basins, we found that a linear model was sufficient for the Caribbean , but a nR2 for both Click here for additional data file.Figure S1The number of reefs by the year of MPA establishment for the (A) Caribbean and (B) Indo-Pacific.(0.58 MB TIF)Click here for additional data file.Figure S2The relationship between the MPA effect on slope  and the distance of non-MPAs surveys from MPAs. The loglikelihood (solid black line) is maximized at 200 km, where approximately 60% of the non-MPA data has been paired in a structural unit with MPA data (dashed green line). MPA effect on slope and confidence intervals (grey dashed line) do not vary significantly with distance.(0.54 MB TIF)Click here for additional data file.Figure S3AIC values for all models examined. The best model is the one with the smallest AIC value. In this case, the best model is one in which MPA modifies the slope and intercept and ocean modifies the intercept only. Models with AICs that exceed 18650 are designated with arrows.(0.39 MB TIF)Click here for additional data file.Figure S4Coefficient estimates for the MPA versus non-MPA model. The 95% credibility intervals (thin light grey line) and the 50% credibility intervals (thick dark grey line) as well as point estimates (median) of the posterior distributions for all parameters in the MPA versus non-MPA model using a Bayesian approach to fit the model. There is a 95% probability that the true value lies within the 95% credibility interval. The MPA x 10-Year Trend term should be contrasted with the 10-Year Trend term, which is the trend for non-MPAs. The MPA x 10-Year Trend term is an effect and gets added to the 10-Year Trend term when MPA\u200a=\u200a1 to obtain the trend for MPAs.(0.41 MB TIF)Click here for additional data file.Figure S5Generalized additive mixed models (non-parametric estimation) for the (A) Caribbean and (B) Indo-Pacific. There is no evidence of a changepoint in the Caribbean, but there is in the Indo-Pacific. The 95% confidence intervals are shown with dashed lines. The models have been smoothed with a 5-year running mean.(0.55 MB TIF)Click here for additional data file.Table S12R for MPA versus non-MPA model. NA denotes the lack of a predictor for the calculation of 2R.(0.02 MB DOC)Click here for additional data file.Table S22R for MPA-only models in the Caribbean and Indo-Pacific. 2R can only be calculated at level 1 for these models.(0.02 MB DOC)Click here for additional data file."}
+{"text": "Mycobacterium avium subsp hominissuis (previously Mycobacterium avium subsp avium) is an environmental organism associated with opportunistic infections in humans. Mycobacterium hominissuis infects and replicates within mononuclear phagocytes. Previous study characterized an attenuated mutant in which the PPE gene (MAV_2928) homologous to Rv1787 was inactivated. This mutant, in contrast to the wild-type bacterium, was shown both to have impaired the ability to replicate within macrophages and to have prevented phagosome/lysosome fusion.M. hominissuis wild-type in the concentration of zinc, manganese, calcium and potassium.MAV_2928 gene is primarily upregulated upon phagocytosis. The transcriptional profile of macrophages infected with the wild-type bacterium and the mutant were examined using DNA microarray, which showed that the two bacteria interact uniquely with mononuclear phagocytes. Based on the results, it was hypothesized that the phagosome environment and vacuole membrane of the wild-type bacterium might differ from the mutant. Wild-type bacterium phagosomes expressed a number of proteins different from those infected with the mutant. Proteins on the phagosomes were confirmed by fluorescence microscopy and Western blot. The environment in the phagosome of macrophages infected with the mutant differed from the environment of vacuoles with The results suggest that the MAV_2928 gene/operon might participate in the establishment of bacterial intracellular environment in macrophages. Mycobacterium avium subsp hominissuis is an environmental organism commonly found in soil and water [Mycobacterium hominissuis causes disseminated disease in immunocompromised people such as in AIDS patients, and disease in patients suffering from chronic pulmonary conditions [Mycobacterium tuberculosis [Salmonella [Leishmania [M. hominissuis interferes with the endosome maturation process which precedes phagosome-lysosome fusion. The mechanisms that M. hominissuis uses to survive within macrophages have been an active area of research. Previous reports have shown that M. hominissuis has the ability to modulate the intracellular environment, remaining accessible to internalized transferrin and limiting the proteolytic activity, maintaining cathepsin D in an immature form [M. tuberculosis) is responsible for the prevention of phagosome-lysosome fusion [M. hominissuis transposon mutant bank for clones with attenuated in human macrophages, identified a 2D6 mutant in which the transposon interrupted MAV_2928 a PPE gene (52% homologous to Rv1787 in M. tuberculosis). MAV_2928 is expressed primarily upon macrophage phagocytosis [nd water ,2. Mycobnditions . The bacnditions , which anditions . Similarrculosis , Salmonelmonella  and Leisishmania , M. homiure form . Other se fusion . Li and e fusion , screeniocytosis . The 2D6M. tuberculosis, Mycobacterium bovis, M. hominissuis and Mycobacterium paratuberculosis. It was previously assumed that M. hominissuis and M. paratuberculosis lack PE-PGRS family of proteins [M. hominissuis . These families of proteins have been associated with virulence of mycobacteria [M. tuberculosis has demonstrated that PPEs are associated with the RD1 operon and participate in the secretion of ESAT-6 and CFP-10, two proteins associated with M. tuberculosis virulence [The PE, PPE, and PE-PGRS families of genes in mycobacteria are dispersed throughout the genomes of proteins , but we bacteria ,13,14, airulence .M. hominissuis, homologue to M. tuberculosis Rv1787, is expressed upon entry in macrophages and, therefore, may participate in the establishment of the M. hominissuis environment within the phagocytic cell. Very little has been published on the proteins that make the bacterial vacuole. A study by Gagnon and colleagues [Early events during the infection are likely to influence the characteristics of the macrophage vacuole. MAV_2928 gene in lleagues  describelleagues ,17. WhetM. avium and macrophages, we decided to examine whether and how the macrophage transcription varies upon 2D6 mutant uptake compared to the gene expression triggered by the uptake of the wild-type bacterium. Tables Because the MAV_2928, homologue to Rv1787, was shown to be upregulated upon initial contact between M. avium or its isogenic 2D6 mutant from the DNA microarray data findings, real-time PCR analysis was used to amplify GRK4 (G-protein coupled receptor kinase 4), DGKD (Diacylglycerol kinase delta), both upregulated in the wild-type but down-regulated in the 2D6 mutant infected macrophages, and LCP2 (Lymphocyte cytosolic protein 2) down-regulated in wild-type but upregulated in the 2D6 mutant. The gene \u03b2-actin was used as a positive control, while the uninfected cells were used as a negative control. As shown in Fig. M. avium infection of macrophages, in contrast to infection by the 2D6 mutant. In addition, the LCP2 gene showed significant increased expression in macrophages upon infection with 2D6 mutant, in contrast to wild-type infected macrophages. None of the three genes showed upregulation in the uninfected negative control cells.To confirm the changes in macrophage gene expression level upon infection with Several of the genes differentially regulated in macrophages upon uptake of the wild-type bacterium or the 2D6 mutants are involved in signal pathways and G-protein receptor, which suggests an early diversification when comparing both bacterial strains. It was then hypothesized that MAV_2928 may be linked to the composition of the vacuole membrane. To examine the hypothesis, we first performed proteomic analysis in purified macrophage vacuoles. As shown in Fig. M. avium phagosomes. To confirm the data obtained by proteomic analysis, we used fluorescence microscopy to establish the presence of some selected proteins. One of the proteins, pulmonary surfactant protein D (SP-D), was observed to be selectively expressed in the MAC 109 phagosomes at 4 h time point but not in the 2D6 phagosomes. The second protein, T-type Ca++ channel 1 alpha, showed selective expression in 2D6 phagosomes at 24 h after infection and not in the MAC 109 phagosomes.Many proteins identified in the mass spectrometry data have not previously been described in M. avium . To verify our initial observation by MS/MS, we carried out parallel infection assays with fluorescein-labeled 2D6 and MAC 109 bacteria for 24 h. As shown in Fig. ++ channel protein staining; whereas, those infected with the wild-type MAC 109 and uninfected control U937 cells failed to express the protein , is attenuated in vivo and fails to inhibit both acidification of the vacuole, as well as phagosome-lysosome fusion. Mycobacterium avium MAV_2928 transposon mutant had comparable ability to enter the mononuclear phagocytes as the wild-type bacterium. The expression of MAV_2928 was noted following uptake of the wild-type bacterium by macrophages but not in culture media, suggesting a possible participation in the early events of the intracellular stage and possibly in phagosome formation [In anulomas ,20. Rich in vivo . In addirophages . In a rerophages  demonstrormation .M. avium chromosomal region with five PPE and PE genes, adjacent to the region homologous to the RD5 region in M. tuberculosis. The organization of this region suggests the existence of three promoters, one upstream of MAV_2928 inactivated in the 2D6 mutant, one between the second, and the third genes and another between the fourth and fifth genes in the downstream region [M. tuberculosis. A PPE gene adjacent to the RD1 region in M. tuberculosis has been suggested to be associated with the transport of proteins [The gene MAV_2928 is part of an m region . This spproteins . Becauseproteins . Intereset al. [M. tuberculosis manipulation of calcium is in part responsible for the phagosome maturation arrest. The pathogenic mycobacterial phagosome has been shown to alter the trafficking of the plasma membrane markers, including MHC molecules [M. tuberculosis-related blocking of phagosome maturation in macrophages appears to take place between the maturation stages controlled by early endocytic marker Rab5 and late endocytic marker Rab7 [Usually, upon bacterial uptake, a macrophage undergoes a series of events specifically designed to eliminate the engulfed microorganism. These include induction of reactive oxygen and nitrogen intermediates, gradual acidification of the phagosome, phagosome-lysosome fusion which loads the resulting compartment with acidic proteolytic enzymes, and antigen processing and presentation. The resulting lethal environment effectively kills the majority of the ingested bacteria. Pathogenic mycobacterial phagosomes, in contrast, show incomplete luminal acidification and absence of mature lysosomal hydrolases . Malik eet al. ,23,24 suolecules , EEA-1 aolecules . M. tubeker Rab7 . The pubM. avium or the 2D6 clone, it is clear that the mutant stimulates membrane-based signals and receptors that are bypassed by the wild-type bacterium.Based on the results obtained in the macrophage transcriptome following infecting with et al. and Via et al. [Mass spectrometry analysis of the phagosomal proteins of 2D6 mutant and the wild-type bacterium yielded several differences in the protein expression in the vacuole membrane. For example, expression of EEA-1 and Rab5 effectors was seen on 2D6 phagosomes but not on the wild-type phagosomes, which is in agreement with the observation reported by Fratti a et al. . The upra et al. .M. tuberculosis by macrophages. It has been shown that CR3 is one of the main receptors involved in phagocytosis of M. avium by macrophages and monocytes [M. avium phagosomes. Studies have suggested an important role of CR1/2, CR3 and CR4 in host defense against Streptococcus pneumoniae infections [A relatively large body of published data suggests the role of complement receptors CR1, CR3 and CR4  and a maonocytes ,29. The fections . Functiofections .M. tuberculosis, resulting in decreased uptake and inhibition of bacterial growth [M. tuberculosis vacuoles has been shown to be involved in enhancing the uptake of bacteria by macrophages [Surfactant-associated proteins A and D (SP-D) are pulmonary collectins that bind to bacterial, fungal and viral pathogens and have multiple classes of receptors on both pneumocytes and macrophages . In addil growth . The prerophages -37.M. avium phagosomes, and its presence in the attenuated 2D6 mutant phagosomes in our data, is in agreement with the above findings that MHC class II molecules are down-regulated upon mycobacterial infection [The lack of MHC class II molecule expression in nfection -40. The nfection . The MHCnfection .Legionella and Brucella have shown that these organisms reside in compartments displaying features of endoplasmic reticulum (ER) [Leishmania and having a major contribution to the phagosomal membrane [Several proteins not previously shown to be associated with the mycobacterial phagosomes were identified in the phagosomal preparations. Because we could not completely rule out the possibility of contamination of the phagosome preparations with other organelles, which indeed is a limiting factor of most subcellular fractionation techniques, we confirmed the findings by identifying proteins by fluorescence microscopy and Western blot. Recent studies on lum (ER) . In addimembrane . This exmembrane .M. avium phagosomes in Balb/c mouse macrophages revealed high concentrations of potassium and chlorine at 24 h time point and correlated it to the microbiocidal killing similar to that observed in neutrophils [A recent report on the elemental analysis of trophils . The inctrophils . Therefo++ and Zn++ suggests that the wild-type bacteria are capable of retaining the elements, but the PPE mutant is not, probably indicating that the mutant cannot suppress the transport mechanisms or cannot continue to induce uptake of the metals.Measurement of the intravacuolar concentration of single elements demonstrates that the 2D6 mutant's vacuole is depleted of several important elements at 24 h after infection. The decrease in the intravacuolar concentrations of CaWe studied protein expression of the mycobacterial phagosome and compared it to a isogenic mutant. We identified several proteins, either previously described or not reported to be present on the phagosomes. The modifications appear to have a significant effect on the intravacuolar environments. Nonetheless, the use of the MAV_2928 mutant established the possibility that one protein may have key function in modulating the formation of the phagosome, perhaps by altering initial events. Alternatively, the PPE-PE operon may be part of a complex system influencing or impacting the expression of other bacterial genes or involved in the transport of bacterial proteins. Change in single element concentrations in the bacterial environment can have significant effect on gene regulation . Future 1. Inactivation of MAV_2928 alters early stages of macrophage transcription in response to MAC infection.2. Absence of MAV_2928 affects the concentration of materials inside the MAC vacuole, indicating changes in the transport mechanisms.3. Investigation of the phagosome membrane components revealed unexpected results for the action of only one protein, suggesting that MAV_2928 may be involved in the transport of other proteins into the host cell.4. Future studies will attempt to identify proteins that are secreted by the PPE MAV_2928-dependent mechanism.Mycobacterium avium strain 109 (MAC 109), a virulent strain in mice initially isolated from blood of a patient with AIDS, was cultured from 20% glycerol stock onto Middlebrook 7H11 agar supplemented with oleic acid, albumin, dextrose and catalase  at 37\u00b0C for 21 days. For the assays, bacteria were suspended in Hank's buffered salt solution (HBSS) and passed through a 26-gauge needle 10 times to disperse clumps. The suspension was then allowed to rest for 5 min and the upper half was used for the assays. The bacterial concentration was adjusted to 1 \u00d7 108 bacteria ml-1 using a McFarland standard. Microscopic observations of the suspensions were carried out to verify dispersion of bacteria. Only well dispersed inocula were used in the described experiments. The 2D6 mutant was cultured from 20% glycerol stock on Middlebrook 7H11 agar containing 400 \u03bcg/ml kanamycin. The 2D6 mutant suspension was made as described above. The complemented 2D6 strain [6 were seeded in 75 cm2 flasks. The cell line was chosen because of convenience, since the strains grow similarly in U937, THP-1 and monocyte-derived macrophages. The U937 was the cell line that allowed the purification of the greater number of vacuoles [-1 phorbol 12-myristate 13-acetate . Human monocyte-derived macrophages and U937 were shown to behave similarly when infected with M. avium wild-type and 2D6 mutant [2. The supernatant was then removed and the cell monolayer was washed three times with HBSS. The tissue culture medium was then replenished.Human monocytic cell line U937 (ATCC CRL-1593.2) was cultured in RPMI-1640 (Gibco Laboratories) supplemented with 10% heat-inactivated fetal bovine serum , 2 mM L-glutamine. The U937 cells were used between passages 15 to 20 and concentrations of 7 \u00d7 10vacuoles . The cel6 mutant . The MAC8 cells were infected with MAC 109 or 2D6 (1 \u00d7 108 concentration) for 4 h. The cells were washed to remove extracellular bacteria and total RNA was isolated using Atlas Pure Total RNA Labeling System  according to the manufacturer's instructions. The resultant RNA was treated with DNase for 30 min at 37\u00b0C followed by phenol-chloroform extraction and precipitation with ethanol. The RNA was run on 1% denaturing agarose gel and quantified by UV spectrometer at 260/280 nm. RNA was then submitted to analysis using the bioanalyzer at the Center for Genome and Biotechnology Research at OSU.For the DNA microarray, the U937 infection assay for MAC 109, 2D6 mutant, and the complemented 2D6 mutant followed by RNA isolation was carried out as described previously . BrieflyTo confirm the expression, as well as to determine the relative transcriptional levels of G-protein coupled receptor kinase 4 (GRK-4), diacylglycerol kinase delta (DGKD) and lymphocyte cytosolic protein 2 (LCP2) by real-time PCR, similar U937 infection assay was performed as described above and modifications in the RNA extraction method were made. After 4 h, the monolayers were washed with HBSS, scraped and collected in a 50 ml falcon tube and placed on ice. The cells were centrifuged at 500 rpm for 5 min to remove any residual extracellular bacteria. Then, 2 ml of Trizol  was added to the falcon tube. The suspension was then passed 20 times through a 21-gauge needle to lyse the mononuclear cells. The lysate was then centrifuged at max  rpm at 4\u00b0C. The supernatant was then transferred to heavy Lock Gel I , and to it chloroform:isoamyl alcohol (24:1) (Sigma) was added and mixed. After centrifugation, the aqueous phase was precipitated in isopropanol followed by 75% ethanol wash to remove isopropanol. The DNase treatment of total RNA was carried out before probe synthesis using the protocol described by the Atlas Pure Total RNA Labeling System . The quality of RNA was verified on a 1% denaturing agarose gel, and the concentration was calculated based on the absorbance at 260 nm.20 and dNTP mix was incubated at 65\u00b0C for 5 min and cooled on ice for 1 min. For each total RNA sample, 10 \u03bcl cDNA synthesis mix was made: 10\u00d7 RT buffer, 25 mM MgCl2, 0.1 M DTT, 40 U/\u03bcl RNaseOUT and 200 U/\u03bcl Superscript III RT. The samples were mixed gently and collected by brief centrifugation. Then, the samples were incubated in a thermal cycler at 42\u00b0C for 50 min and the reaction was terminated at 70\u00b0C for 15 min and cooled on ice. Finally, the reactions were collected by brief centrifugation, and 1 \u03bcl of RNase H was added to each sample and incubated for 20 min at 37\u00b0C. The cDNA prepared was used for real-time PCR.The cDNA was synthesized as per the protocol described by Invitrogen . Total RNA (5 \u03bcg) with oligo(dT)32P-labeled cDNA probes were prepared using the Atlas Pure Total RNA Labeling System (Clontech Laboratories) as previously described [The escribed . This arThe Clontech Human Nylon Filter Arrays (Clontech Laboratories), containing DNA sequences for 1,500 genes, were prehybridized in 5 ml of Express-Hyb solution supplemented with 0.5 mg salmon testes DNA at 68\u00b0C for 30 min. The radiolabeled cDNA probe was heated in a boiling water bath for 2 min, followed by 2 min on ice. Then it was added to the hybridization solution and allowed to hybridize to the filter array overnight. The membranes were washed in SSC plus 0.1% sodium dodecyl sulphate (SDS) at 68\u00b0C for 30 min and further rinsed in SSC for 5 min at room temperature. Next, the filters were wrapped in plastic wrap and exposed to a phosphor imaging screen for 24 h. Analysis of the phosphor imaging screens was done by using a phosphor imager  and AtlasImage 2.0 software. Global normalization method was used, by the background subtraction method followed by SAM analysis. For most of the genes, a Q value  of 5% was used as the cut-off value. The quality of the hybridization signals was assessed using scatter plot analysis of replicate samples, as well as by calculating the coefficient of variance. Only samples with hybridizations with high correlation levels (p > 0.9) among replicates were used for subsequent analysis. The following genes were used as housekeeping genes: glyceraldehyde 3-phosphate dehydrogenase (GAPDH), tubulin alpha 1 (TUBA1), hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1), major histocompatibility class 1 C (HLAC), beta-actin (ACTB) and 23-kDa highly basic protein (PRL13A). Only genes that showed differential expression at least by two-fold were incorporated in the results.Genes were chosen randomly for real-time PCR analysis, and SYBR technology was used. Run protocol for the LightCycler was as follows: denaturation 95\u00b0C for 5 min; amplification and quantification repeated for 35 times: 95\u00b0C for 30 sec, 59\u00b0C for 30 sec and 72\u00b0C for 1 min with one fluorescence measurement followed by 72\u00b0C for 5 min and 4\u00b0C. Table The threshold cycle (Ct) is defined as the fractional cycle number at which the fluorescence reaches 10\u00d7 the standard deviation of the baseline and was quantified as described in User Bulletin #2 for ABI PRIMS 7700 sequence detection system (ABI). The fold change in gene expression was determined using an amplification-based strategy. For each gene amplification, before calculating the fold change, the Ct values were normalized to the Ct of \u03b2-actin using the following formula:(-1/slope). These calculations indicated high real-time efficiency with a high linearity. Because expression of \u03b2-actin is constant, independent of conditions, target genes from both control and experimental groups were normalized to the expression level of the \u03b2-actin gene.Quantitative analysis was performed using iCycler I software . A relative quantification was used in which the expression levels of macrophage target genes were compared to data from a standard curve generated by amplifying several dilutions of a known quantity of amplicons. Real-time PCR efficiency was determined using a dilution series of cDNA template with a fixed concentration of the primers. Slopes calculated by the LightCycler software were used to calculate efficiency using the following formula: E = 10M. avium 109 and 2D6 mutant were isolated according to a protocol described previously [M. avium or 2D6 showed green fluorescein stain when observed under 100\u00d7 oil immersion . Approximately 98% of the phagosomes observed showed bacteria in them.Phagosomes containing eviously , with mieviously . BrieflyThe phagosome samples were run by lc/ms-ms using a Waters  NanoAcquity HPLC connected to a Waters Q-TOF Ultima Global. Phagosome preparation, isolated as described above, was treated using the In-Gel Tryptic Digestion Kit from Pierce , according to instructions provided by the manufacturer. Briefly, the phagosome preparation was treated with activated trypsin for 15 min at room temperature. The suspension was transferred to 37\u00b0C for 4 h. The digestion mixture was then placed in a clean tube. To further extract peptides, 10 \u03bcl of 1% trifluoroacetic acid was added for 5 min. Five microliters of a sample was loaded onto a Waters Symmetry C18 trap at 4 \u03bcl/min, then the peptides were eluted from the trap onto the 10 cm \u00d7 75 \u03bcm Waters Atlantis analytical column at 350 nl/min. The HPLC gradient went from 2% to 25% B in 30 min, then to 50% B in 35 min, then 80% B in 40 min and held there for 5 min. Solvent A was 0.1% formic acid in water, and B was 0.1% formic acid in acetonitrile. Peptide \"parent ions\" were monitored as they eluted from the analytical column with 0.5 sec survey scans from m/z 400-2000. Up to three parent ions per scan with sufficient intensity and 2, 3, or 4 positive charges were chosen for ms/ms. The ms/ms scans were 2.4 sec from m/z 50-2000.The mass spectrometer was calibrated using the ms/ms spectrum from glu-fibrinopeptide. Masses were corrected over the time the calibration was used (one day or less), using the Waters MassLynx DXC system.The raw data were processed with MassLynx 4.0 to produce pkl files, a set of smoothed and centroided parent ion masses with the associated fragment ion masses. The pkl files were searched with Mascot 2.0  database searching software, using mass tolerances of 0.2 for the parent and fragment masses. The Swiss Prot database was used, limiting the searches to human proteins. Peaks Studio  was also used to search the data, using mass tolerances of 0.1, and the IPI human database.The proteomic analysis was compared to the protein profile of bacteria grown on 7H10 plates. Then, if the protein expression was increased or decreased at least 1.5-fold, the data were included. Proteins or peptides to be included in the analysis had to be present in both runs. Proteins present in only one run were not included.++ alpha1I protein, EEA-1, CREB-1, MARCO and \u03b1-tubulin were purchased from Santa Cruz Biotechnology, Santa Cruz, CA. Primary antibodies used were from rabbit, except the goat anti-T-type Ca++ alpha1I. Secondary antibodies were Texas-Red conjugates (TR) and included donkey anti-rabbit IgG-TR  and mouse anti-goat IgG-TR . The two-chamber slides from Nalge Nunc  were employed for macrophage monolayer preparation and fluorescence microscopy. The numbers of U937 cells were determined in a hemocytometer before seeding. A total of 5 \u00d7 105 cells were added in each tissue culture well of the two-chamber slides and were differentiated with 2 \u03bcg/ml of PMA overnight. The monolayers were then infected with MAC 109, 2D6 or the complemented 2D6 mutant labeled with NHS-CF as described above using a MOI of 10. The cells were incubated for 4 h at 37\u00b0C for SP-D protein expression and 24 h for T-type Ca++ alpha1I protein expression. The time points were chosen based on the expression results. The chambers were washed three times with sterile phosphate buffer saline (PBS) and treated with 200 \u03bcg/ml amikacin to kill extracellular bacteria. The cells were subsequently washed and allowed to air dry. Cells were then fixed with 2% paraformaldehyde for 1 h at room temperature, permeabilized in cold 0.1% Triton X-100 (J.T. Baker) and 0.1% sodium citrate for 20 min on ice. Next, the monolayers were washed with PBS and blocked with 2% BSA  in PBS for 20 min at room temperature. The 2% BSA was replaced with 1 ml of specific primary antibody and allowed to incubate for 1 h. All the antibodies were prepared in 2% BSA in PBS to prevent non-specific binding. The cells were then washed three times with sterile PBS and re-incubated with the appropriate Texas-Red conjugated secondary antibody for an additional 1 h. Macrophages were washed three times with sterile PBS and allowed to air dry before adding Aqua-mount mounting media  and cover slips . Cell preparations were visualized with a Leica DMLB microscope. The microscope was operated by Spot 3rd Party Interface Software with a Photoshop CS version 8.0 on a Macintosh OS (version 4.0.9) based system.Because some of the proteins identified in the phagosomes have not been previously described as part of the vacuole membrane, we attempted to confirm their presence by using immunofluorescence. Primary antibodies against pulmonary surfactant protein D (SP-D), T-type CaM. avium wild-type or 2D6 mutant with MOI 1 cell:100 bacteria in 75 mc2 flasks. After 30 min and 24 h following infections, monolayers were lysed and phagosomes were extracted as directed above. Equal amounts of phagosomal proteins were incubated with 10 \u03bcl of primary antibodies and 30 \u03bcl protein A/G Plus-agarose beads at 4\u00b0C overnight with continuous agitation. Next day, beads were washed three times with PBS, and the captured proteins were resolved on a 12% SDS-PAGE gel. Proteins were transferred into a nitrocellulose membrane and blocked overnight with Odyssey blocking buffer (Li-Cor) in TBS . The membranes were probed with EEA1, CREB-1, MARCO and \u03b1-tubulin antibodies (Santa Cruz Biotechnology) for 1 h and after, incubated with appropriate secondary antibodies (Li-Cor) in TBS for 1 h. Proteins were visualized by scanning of the membranes in the Odyssey Imager .The U937 cells were infected with Human monocyte-derived macrophages were purified as previously described ,28, seedt test. A p < 0.05 was considered significant.Elemental maps were extracted from x-ray fluorescence spectra, using the software package MAPS , and quaComparisons between control and experimental groups were submitted to statistical analysis to determine the significance. Statistical analysis of the means \u00b1 SD was determined by ANOVA. A p < 0.05 was considered significant. A DNA microarray was carried out three independent times, while the proteomic analysis of vacuole proteins was performed twice.SJ performed the proteomics, some of the DNA microarray, wrote the initial paper.LD participated in all the steps of the paper.DW, JM, IM, BL performed the x-ray microscopy.YL participated in the microarray.YY participated in the proteomic studies.LEB directed the studies, helped in macrophage experiments, senior author.All authors read and approved the final manuscript."}
+{"text": "Purpose. To examine the influence of positional misalignments on intraocular pressure (IOP) measurement with a rebound tonometer. Methods. Using the iCare rebound tonometer, IOP readings were taken from the right eye of 36 healthy subjects at the central corneal apex (CC) and compared to IOP measures using the Goldmann applanation tonometer (GAT). Using a bespoke rig, iCare IOP readings were also taken 2\u2009mm laterally from CC, both nasally and temporally, along with angular deviations of 5 and 10 degrees, both nasally and temporally to the visual axis. Results. Mean IOP\u2009\u00b1\u2009SD, as measured by GAT, was 14.7 \u00b1 2.5\u2009mmHg versus iCare tonometer readings of 17.4 \u00b1 3.6\u2009mmHg at CC, representing an iCare IOP overestimation of 2.7 \u00b1 2.8\u2009mmHg (P < 0.001), which increased at higher average IOPs. IOP at CC using the iCare tonometer was not significantly different to values at lateral displacements. IOP was marginally underestimated with angular deviation of the probe but only reaching significance at 10 degrees nasally. Conclusions. As shown previously, the iCare tonometer overestimates IOP compared to GAT. However, IOP measurement in normal, healthy subjects using the iCare rebound tonometer appears insensitive to misalignments. An IOP underestimation of <1\u2009mmHg with the probe deviated 10 degrees nasally reached statistical but not clinical significance levels. The iCare TA01i  rebound tonometer is a relatively recent addition to the portfolio of tonometers currently available to the ophthalmic practitioner for measuring intraocular pressure (IOP). Hitherto, studies have shown that the rebound tonometer performs adequately as a screening tool in comparison to the Goldmann applanation tonometer  and other handheld tonometry devices .In brief, the iCare TA01i rebound tonometer comprises a solenoid and housing, a magnetised probe, and other associated electronics. The probe is 40\u2009mm long, 0.3\u2009mm in diameter with a 1.7\u2009mm diameter plastic end-tip . The devAs the iCare probe has a small footprint, it is possible to measure IOP in a number of corneal positions; this is particularly useful in the presence of central corneal abnormalities. What remains equivocal, however, is the impact of probe-cornea misalignments on the resultant IOP reading. Previous studies have attempted to elucidate these putative erroneous errors; however, to date, these studies have generally neglected to examine the central 4\u2009mm corneal zone within which most readings would normally be acquired, clinically. Instead, studies have measured IOP at positions 2\u2009mm from the limbus \u20138. FurthThe aim of the present study, therefore, was to assess the impact of iCare TA01i probe-cornea misalignments on IOP using a bespoke alignment rig with a high level of positional accuracy and precision. Here, measurements were acquired with horizontal angular deviations at 5\u00b0 and 10\u00b0, both nasally and temporally. Further, in contrast to previous research, lateral misalignments were assessed within the central 4\u2009mm corneal zone. Data were collected from the right eyes of 36 healthy subjects (16 men and 20 women) aged from 17 to 49 years (mean \u00b1 SD 24.3 \u00b1 7.6 years). Informed consent was obtained from each subject, and the research followed the tenets of the Declaration of Helsinki. The School of Life and Health Sciences Human Ethics Committee at Aston University, Birmingham, United Kingdom, approved all procedures.IOP measurements were initially taken with the iCare tonometer. For the purpose of this study, the iCare was mounted onto a slit lamp base containing a bespoke alignment rig with six degrees of freedom, thus enabling precise and accurate manipulation of the probe position. The micrometer scales used to modify the tonometer's position in relation to the cornea afforded a 0.01\u2009mm level of precision for linear displacements and 1\u00b0 for angular deviations see . With thTo determine the effect of probe misalignments, IOP was measured with the iCare tonometer in multiple positions. Horizontal angular deviations included 5\u00b0 nasally (5\u00b0N), 10\u00b0 nasally (10\u00b0N), 5\u00b0 temporally (5\u00b0T), and 10\u00b0 temporally (10\u00b0T). In addition, the iCare probe was deviated laterally by \u00b12\u2009mm nasally (2N) and temporally (2T). The sequence of data collection was randomised to control for the potential effect of measurement order. For all positions, three repeats of six consecutive readings were taken with the same iCare probe and averaged.On completion of all iCare IOP readings, GAT measurements were taken. The GAT is currently the clinical gold standard for measuring IOP  and has A second UK-registered optometrist, who was blind to the tonometer scale and to the iCare baseline readings, took GAT measures. All tonometry readings were acquired within a 20-minute interval thus reducing the effect of diurnal changes . Again, t-tests were used to determine any bias between the methods [All statistical analysis was carried out using SigmaPlot  and SPSS for Windows . All data were assessed to confirm normality (using the Kolmogorov-Smirnov test). A probability of <0.05 was taken as statistically significant. Differences in IOP measurements with the two instruments were calculated by subtracting the values obtained with the Goldmann tonometer from those obtained with the iCare tonometer. In addition, variations in iCare IOP values with probe deviation in angle and position were calculated. Paired two-tailed  methods . Limits  methods , 18.versus central iCare tonometer readings of 17.4\u2009\u00b1\u20093.6\u2009mmHg and represents a significant positive correlation  with an overestimate of 2.7 \u00b1 2.8\u2009mmHg  the bias of which increased at higher IOPs  or at 2T . Comparisons were also made between the iCare IOP measurements taken at CC and angular probe deviations; these measures were statistically similar at 5\u00b0T , 10\u00b0T , and 5\u00b0N , but not at 10\u00b0N , which showed an underestimation of IOP compared with central corneal apex measures of 0.8 \u00b1 2.1\u2009mmHg  nor when measured 2\u2009mm temporally  , 10\u00b0T , 5N , and 10\u00b0N   see . For ang549) see .The purpose of the present study was to determine the effect of specified lateral and angular deviations of the iCare tonometer probe on the accuracy of IOP measurement as compared to readings in the optimal position, namely, the central corneal apex; this is the first time that a study of this type has used a bespoke rig to carefully control the desired iCare tonometer probe positions. Further, the relatively small lateral and angular deviations specified in the present study, confined to the central 4\u2009mm zone, were chosen to assimilate the typical misalignments that could occur in everyday clinical practice. IOP measurements taken at the central corneal apex were also compared to the current clinical gold standard, the Goldmann applanation tonometer, in normal, healthy subjects.The present study has confirmed, in broad agreement with earlier work , 19, 20,For lateral deviations, the iCare tonometer readings were marginally lower than those at the central corneal apex see  but not versus horizontal) on IOP readings in healthy and diseased eyes. In this regard, it would also be interesting to examine patients with corneal pathology , which may, in turn, influence the resultant IOP value measured with the iCare.A principal advantage of the iCare rebound tonometer is its ability to measure IOP in patients who are supine at the time of examination. Although our device was able to control accurately the position of the upright iCare tonometer, our study did not examine the influence of patient position on the resultant IOP value. A further study, therefore, is indicated to examine the influence of probe position (upright The present study has shown that the iCare tonometer is clinically robust to small but tangible lateral and angular deviations that can occur during the use of a handheld instrument in general ophthalmic practice."}
+{"text": "Deletion mutational analysis demonstrated that N-terminal region of NS5A was not required for the interaction with the SH2 domain of Fyn. Tyr334 was identified as a tyrosine phosphorylation site in NS5A. Far-western analysis revealed that SH2 domain of Fyn directly bound to NS5A. Fyn and NS5A were colocalized in the lipid raft. These results suggest that NS5A directly binds to the SH2 domain of Fyn in a tyrosine phosphorylation-dependent manner. Lastly, we showed that the expression of NS5A in B cells increased phosphorylation of activation loop tyrosine in the kinase domain of Fyn. NS5A containing ligand for both SH2 and SH3 domains enhances an aberrant autophosphorylation and kinase activity of Fyn in B cells.Hepatitis C virus (HCV) infects B lymphocytes and induces mixed cryoglobulinemia and B cell non-Hodgkin's lymphoma. The molecular mechanism for the pathogenesis of HCV infection-mediated B cell disorders remains obscure. To identify the possible role for HCV nonstructural 5A (NS5A) protein in B cells, we generated the stable B cell lines expressing Myc-His tagged NS5A. Immunoprecipitation study in the presence or absence of pervanadate (PV) implied that NS5A was tyrosine phosphorylated by pervanadate (PV) treatment of the cells. Therefore we examined pull-down assay by using glutathione S-transferase (GST)-fusion proteins of various Src homology 2 (SH2) domains, which associates with phosphotyrosine within a specific amino acid sequence. The results showed that NS5A specifically bound to SH2 domain of Fyn from PV-treated B cells in addition to Src homology 3 (SH3) domain. Substitution of Arg FlaviviridaeHCV is a small enveloped positive-sense RNA virus classified within the family Non-receptor type of protein-tyrosine kinase Fyn is a member of the Src family kinases, and has regulatory roles in immune receptor signaling. Recently, Fyn has been recognized as an important mediator of mitogenic signaling and regulator of cell cycle entry, growth and proliferation. As for pathological aspects, Fyn is overexpressed in various cancers, and overexpression of Fyn in cultured cells resulted in cancer-like phenotypes 420 in Fyn) and dephosphorylation of the C-terminal tail (Tyr531 in Fyn) by protein-tyrosine phosphatases lead to the activation of kinase activity The Src family kinases all share a common structure and pattern of activation. The domains of these proteins include SH2, SH3, and kinase domains followed by a short C-terminal regulatory tail. The SH2 and SH3 domains are highly conserved regions and mediate protein-protein interactions: the SH2 domain binds to phosphotyrosine residue within the specific amino acid sequence, while the SH3 domain recognizes proline rich regions. HCV NS5A was shown to interact with various SH3 domains of intracellular signaling molecules, and the kinase activity of Fyn was upregulated in liver cell lines harboring HCV replicon et al. reported that NS5A binds to the SH2 domain of Src Previously, we reported that Syk, another non-receptor type of protein-tyrosine kinase interacts with transiently expressed NS5A in PV treated BJAB B cells In this study, we investigated the interaction between NS5A and the SH2 domain of Fyn in B cells.420 in Fyn, was from Cell Signaling Technology . The pEF1A-NS5A(Con1)-Myc-His plasmid and its deletion or substitution mutants were described previously 5\u2032-TTGGTACCATGTCCGGCTCGTGGCTAAGAG-3\u2032, 5\u2032-GCTCTAGAGCAGCAGACGACGTCCTCA-3\u2032, 5\u2032-GGTTACGCGGGTGGGGGATCCCGAATTCTTCACAGAAGTG-3\u2032, and 5\u2032-CACTTCTGTGAAGAATTCGGGATCCCCCACCCGCGTAACC-3\u2032, using NS5A cDNA as a template. Substitution of Tyr129 to Phe (Y129F) of NS5A 1\u2013146 was generated by the site-directed mutagenesis using two primers, 5\u2032-GGGGATTTCCACTTCGTGACGGGCA-3\u2032 and 5\u2032-TGCCCGTCACGAAGTGGAAATCCCC-3\u2032, using NS5A 1\u2013146 cDNA as a template. Substitutions of Tyr182 to Phe (Y182F), Tyr321 to Phe (Y321F), and Tyr334 to Phe (Y334F) of NS5A 147\u2013447 were generated by the site-directed mutagenesis using two specific primers designed by QuikChange Primer Design Program (www.genomics.agilent.com), using NS5A 147\u2013447 as a template. The resulted mutations were confirmed by the DNA sequencing.Anti-NS5A and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mAbs were purchased from Millipore . Anti-Myc mAb and anti-Fyn antibody were obtained from Santa Cruz Biotechnology . Anti-phosphotyrosine (pTyr) (PY20) and human anti-IgM mAbs were from Zymed . Anti-GST mAb was from Nacalai . Anti-phospho-Src family (Tyr416) antibody, which detects phosphorylated amount of Tyr6 cells/500 \u00b5l of cells by electroporation . Stably transfected cell lines were selected with 0.4 mg/ml of active G418  B-lymphoid leukemia BJAB cells were kindly provided from Dr. Satoshi Ishido  8) were washed twice with serum free medium and treated with 100 \u00b5M PV or 10 \u00b5g/ml of anti-IgM mAb for 3 min at 37\u00b0C in the same medium. Either unstimulated or stimulated cells were washed twice with ice-cold PBS and then solubilized in the lysis buffer  on ice. In some experiments, 0.5% Nonidet P-40 was used instead of 1% Triton. Precleared cell lysates were incubated with the indicated antibodies prebound to protein A-agarose beads . After rotation for 90 min at 4\u00b0C, the beads were washed 4 times with the lysis buffer, and the immunoprecipitated proteins were eluted by the heat treatment for 5 min at 100\u00b0C with 2\u00d7sampling buffer. Precipitated proteins or cell lysates were separated by SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membrane (Millipore). After blocking in 5% milk in TBST , the blots were incubated with the primary antibodies and then horseradish peroxidase-conjugated goat anti-rabbit IgG, goat anti-mouse IgG antibodies , or horseradish peroxidase-conjugated protein G (Sigma) in TBST. To enhance the signals, Immuno-enhancer Reagent A (Wako) was utilized in the reaction with anti-pTyr (pY20) mAb. Finally, proteins were visualized by the enhanced chemiluminescence (ECL) reagent  BJAB cells (10149-Ala257) and \u2013SH3 (Thr82-Glu148) were amplified by PCR using paired primers 5\u2032-GGAATTCATGGTACTTTGGAAAACTTGGC-3\u2032 and 5\u2032-CCGCTCGAGATCTTTAGCCAATCCAGAAGT-3\u2032 for \u2013SH2, 5\u2032-GGAATTCAACAGGAGTGACACTGTTTGTG-3\u2032 and 5\u2032-CCGCTCGAGCTCTTCTGCCTGGATGGAGTC-3\u2032 for \u2013SH3, using mouse Fyn(T) cDNA  as a template. The cDNA for c-Abl-SH2 (Typ146-His221) and -SH3  were amplified by PCR using paired primers 5\u2032-CGGAATTCCTGGTATCATGGCCCTGTATCT-3\u2032 and 5\u2032-ATAGTTTAGCGGCCGCTAGCTGGGTAGTGGAGTGTGGT-3\u2032 for -SH2, 5\u2032-CGGAATTCCCTTTTTGTGGCACTCTATGAT-3\u2032 and 5\u2032-TAGTTTAGCGGCCGCTGACGGGGGTGATGTAGTTGCT-3\u2032 for -SH3, using mouse c-Abl cDNA  as a template. The cDNA for Cbl-b N-terminal region containing SH2 domain (Ala2-Pro349) was amplified by PCR using 5\u2032-CGGAATTCCGCAAACTCAATGAATGGCAGA-3\u2032 and 5\u2032-CCGCTCGAGCTAAGGTGTAGGTTCACATAATCC-3\u2032, using human Cbl-b cDNA  as a template. Resulted PCR fragments were subcloned into pGEX-4T.3  to make domain in-frame with the downstream of GST and verified by DNA sequencing. The GST-rat Lyn-SH2 and Syk-SH2 (N+C) expression constructs were provided by Dr. Reuben P. Siraganian . Preparation of GST-rat Vav1-SH2, mouse c-Abl SH3 domain-binding protein-2 (3BP2)-SH2, human phospholipase C (PLC)-\u03b32-SH2 (N+C), and rat Lyn-SH3 domain expression constructs were described elsewhere 176 to Lys (R176K) by a point mutation of pGEX-4T.3-Fyn-SH2 was generated by the site-directed mutagenesis using two primers 5\u2032-TCAAAGAGAGCCAAACCACCAAAGG-3\u2032 and 5\u2032-TAAGAAAGGTACCTCTTGGGTTTCC-3\u2032, using Fyn-SH2 cDNA wild type as a template. The resulted point mutation was confirmed by the DNA sequencing. All these SH2 and SH3 domains were fused downstream of GST. The GST fusion proteins were affinity-purified with glutathione Sepharose 4B beads . Extraction of GST-fusion proteins from bacteria was confirmed by the SDS-PAGE and Coomassie brilliant blue staining The cDNA for Fyn-SH2 (Trp8), Huh-7.5 cells stably harboring an HCV replicon (3\u00d7106), COS cells (106) or Ramos B cells expressing SV40 T antigen (Ramos-T cells) (107) were washed twice with serum free medium and stimulated with 100 \u00b5M PV for 3 min at 37\u00b0C. Either unstimulated or stimulated cells were solubilized in the binding buffer . After centrifugation, the resulted supernatants were reacted with 20 \u00b5g of GST-fusion proteins prebound to glutathione Sepharose 4B beads for 90 min at 4\u00b0C. The beads were washed 4 times with the binding buffer. Proteins interacting with GST-fusion proteins were eluted by heat treatment for 5 min at 100\u00b0C with 2\u00d7sampling buffer, separated by SDS-PAGE, and analyzed by immunoblotting.BJAB cells (107) were separated by SDS-PAGE and transferred to PVDF membrane. After blocking, the membranes were incubated with 2.5 \u00b5g/ml of GST or GST-Fyn-SH2 for 1 h at 4\u00b0C. After extensive washing, membranes were reacted with anti-GST mAb, subsequently reacted with horseradish peroxidase conjugated goat anti-mouse IgG antibody, and then subjected to ECL detection Anti-NS5A immunoprecipitates from BJAB cells (3\u00d7108) were solubilized in 2.5 ml of 0.05% Triton in MNEV buffer  and dounced 10 times. Homogenates were cleared of intact cells by centrifugation for 10 minutes at 200 g. The resultant supernatants (2.4 ml) were mixed with equal volumes of 80% sucrose in MNEV buffer , overlayered by 4.8 ml 30% and 2.4 ml 5% sucrose in MNEV buffer, and then centrifuged for 20 hours at 200 000 g . After sucrose density gradient centrifugation, 9 fractions were collected from the top of the gradient and analyzed by the immunoblotting.The low density detergent-insoluble fractions were prepared by sucrose density gradient centrifugation as described P value of <0.05 was considered statistically significant.Quantification of Fyn was analyzed by ImageJ software. The two-tailed Student t-test was applied to evaluate the statistical significance of differences found. A 2, 2 mM MnCl2, 4 \u00b5M ATP, 4 \u00b5Ci [\u03b3-32P] ATP) and 2.5 \u00b5g of acid-treated enolase (Sigma) for 30 min at room temperature. Reaction was terminated and proteins were eluted by the heat treatment for 5 min at 100\u00b0C with 2\u00d7sampling buffer. Proteins were separated by SDS-PAGE and gel was incubated with 1N KOH for 1 h at 56\u00b0C to remove phosphoserine and most of phosphothreonine. After fixation, the gel was dried and radiolabeled proteins were visualized by autoradiography. Immunoprecipitation of Fyn was confirmed by the immunoblotting.Unstimulated BJAB cells were washed twice with ice-cold PBS and then solubilized in the lysis buffer. Precleared cell lysates were incubated with anti-Fyn antibody prebound to protein A-agarose beads. After rotation for 90 min at 4\u00b0C, the beads were washed 4 times with the lysis buffer, 2 times with the kinase buffer without ATP, then incubated with 20 \u00b5l of the kinase buffer  still allowed tyrosine phosphorylation by PV and binding to the SH2 domain of Fyn in COS cells , we examined the conserved tyrosine residues between 147 and 447 of NS5A . Among those, substitution of Tyr334 to Phe (Y334F) reduced tyrosine phosphorylation of NS5A 147\u2013447, however this mutant could interact with the SH2 domain of Fyn , suggesting that some other protein-tyrosine kinases are required for phosphorylating NS5A.In COS cells, full length and a series of deletion mutants of NS5A were tyrosine phosphorylated by PV treatment . BecauseOS cells  and S3. n of Fyn . NS5A Y1Next we examined the mechanism of the interaction of the SH2 domain of Fyn and NS5A. Association of Fyn and NS5A in B cells were tested by the immunoprecipitation study . The resin vitro kinase assay  antibody, which detects phosphorylated amount of a conserved tyrosine in the activation loop of Src family kinase . TherefoThe small interference RNA library screening study demonstrated that Csk is one of the protein-tyrosine kinases involved in the replication of HCV v-Src is the first discovered oncogene, and Fyn is a member of cellular Src family kinases and is also associated with cancer. Overexpression of Fyn in NIH3T3 fibroblast cells exhibited a cancer-like phonotype with increased anchorage-independent growth and prominent morphologic changes. Other studies have revealed that overexpression of Fyn results in promotion of the anti-apoptotic activity of Akt and dysregulation of anchorage-dependent cell growth. In this study, expression of NS5A enhanced autophosphorylation of Fyn in B cells, suggesting that HCV-mediated activation of Fyn can promote aberrant growth and anti-apoptotic status leading to B lymphomagenesis Adaptor proteins have also been recognized candidates to promote oncogenes. For example, v-Crk (CT10 regulator of tyrosine kinase)/Crk-I are adaptor proteins composed of SH2 and SH3 domains but lack negative regulatory region . Those adaptors function as constitutively activated ones, leading to tumorgenesis. Like that, NS5A presumably works constitutive activated adaptor for Fyn kinase In conclusion, present study demonstrated that NS5A binds to the SH2 domain of Fyn in tyrosine phosphorylation-dependent manner and that NS5A containing ligand for both SH2 and SH3 domains produces an aberrant increase in autophosphorylation and kinase activity of Fyn. Further studies are needed to clarify which tyrosine residues in NS5A are phosphorylated and bind to SH2 domain of Fyn. These data, however, may contribute to our understanding of the mechanisms that HCV infection causes B lymphomagenesis.Figure S1GST-human Fyn-SH2 could react with NS5A. The cDNA for human Fyn-SH2 (Trp149-Arg268) were amplified by PCR using paired primers 5\u2032-GGAATTCATGGTACTTTGGAAAACTTGGC-3\u2032 and 5\u2032-GATCAACTGCAGGGATTCTCG -3\u2032, using cDNA from total RNA of BJAB cells as a template. Resulted PCR fragment was subcloned into the pGEX-4T.3  to make domain in-frame with the downstream of GST and verified by DNA sequencing. PV-treated cells expressing Myc-His-NS5A (clone 7) were solubilized in the lysis buffer. Precleared lysates were reacted with GST or GST-human Fyn-SH2 and binding proteins were separated by SDS-PAGE and analyzed with immunoblotting with anti-NS5A mAb. The amount of GST-fusion proteins was confirmed by CBB staining. Molecular sizing markers are indicated at left in kilodalton. The results are representative of two independent experiments.(TIF)Click here for additional data file.Figure S2Tyrosine phosphorylation of NS5A and its mutants in COS cells. Full length and a series of deletion mutants of NS5A were transiently expressed in COS cells. Cells were unstimulated (\u2212) or stimulated (+) with PV and solubilized in the lysis buffer. Cell lysates were immunoprecipitated with anti-Myc mAb and immunoprecipitated proteins were separated by SDS-PAGE and analyzed with immunoblotting with anti-pTyr (PY20) and anti-Myc mAbs. Molecular sizing markers are indicated at left in kilodalton. The results were representative of three independent experiments.(TIF)Click here for additional data file.Figure S3129 is not critical for the binding of NS5A to the SH2 domain of Fyn.Tyr Indicated mutant forms of NS5A were transiently expressed in COS cells. Cells were unstimulated (\u2212) or stimulated (+) with PV. Cells were solubilized in the binding buffer and precleared lysates were reacted with GST-Fyn-SH2. Detergent-soluble lysates and binding proteins were separated by SDS-PAGE and analyzed with immunoblotting with anti-Myc mAb. Molecular sizing markers are indicated at left in kilodalton. The results were representative of three independent experiments.(TIF)Click here for additional data file."}
+{"text": "A standardized curriculum back school (CBS) has been recommended for further dissemination in medical rehabilitation in Germany. However, implementation of self-management education programs into practice is challenging. In low back pain care, individual factors of professionals could be decisive regarding implementation fidelity. The study aim was to explore attitudes and experiences of professionals who conducted the back school. Qualitative interviews were led with 45 rehabilitation professionals. The data were examined using thematic analysis. Three central themes were identified: (a) \u201cback school as a common thread,\u201d (b) \u201ctheory versus practice,\u201d and (c) \u201cparticipation and patient-centeredness.\u201d The CBS and its manual were frequently described positively because they provide structure. However, specified time was mentioned critically and there were heterogeneous perceptions regarding flexibility in conducting the CBS. Theory and practice in the CBS were discussed concerning amount, distribution, and conjunction. Participation and patient-centeredness were mainly mentioned in terms of amount and heterogeneity of participation as well as the demand for competences of professionals. Factors were detected that may either positively or negatively influence the implementation fidelity of self-management education programs. The results are explorative and provide potential explanatory mechanisms for behavior and acceptance of rehabilitation professionals regarding the implementation of biopsychosocial back schools. Self-management education is a central part of medical rehabilitation and has been proven effective in many clinical populations regarding a variety of outcomes \u20133. ThrouPrograms for persons with low back pain are a prominent example for the above-mentioned changes. In the early 1990s, the so-called back schools rarely incorporated psychosocial factors , whereasA standardized curriculum back school (CBS), built upon the outlined biopsychosocial and patient-centered principles, has proven to be effective within inpatient medical rehabilitation regarding outcomes such as illness knowledge, coping with pain and conducting home exercises . The proHowever, implementation of innovations in healthcare is challenging  with infIn a larger trial in initially 10 inpatient rehabilitation facilities in Germany, the CBS had been implemented into routine care . This waEthical approval for this study was obtained from the respective commission of the medical faculty of the University of W\u00fcrzburg, Germany (decision on the 25 March 2011). The Consolidated Criteria for Reporting Qualitative Research statement (COREQ) was used as guidance for this paper to ensure transparency .Interview Guide with Follow-Up Questions\u201d).Twelve weeks after the implementation of the CBS had been initiated, individual interviews were conducted with 45 rehabilitation professionals (27 women) from 9 rehabilitation facilities (1 clinic had decided not to implement the back school): 9 physicians, 10 psychologists, 17 physiotherapists, 6 exercise therapists, and 3 occupational therapists. Their mean age was 37.4 (SD = 9.3). They were selected by the respective clinics and between 4 and 8 professionals were interviewed from each clinic. 27 of all current study participants had already taken part in interviews prior to the program implementation . It is nInterview Guide with Follow-Up QuestionsWhat is your opinion concerning the curriculum back school (CBS), now that it has been implemented at your clinic?Are there aspects in the CBS that you do not agree with?What was your specific role in the implementation of the CBS?Which experiences did you gather in the organizational implementation of the CBS at the clinic?Which factors complicated the implementation?Which factors facilitated the implementation?When difficulties occurred: What did you do against it? Respectively, what do you plan to do against it?Which experiences did you gather when conducting the back school?Which factors complicated the execution?Which factors facilitated the execution?When difficulties occurred: What did you do against it? Respectively, what do you plan to do against it?What were the consequences of the implementation of the CBS?regarding you personallyregarding colleaguesregarding the interdisciplinary collaborationregarding the clinicregarding patientspositive/negative?(vi)How do you think things will continue with the CBS at your clinic?31 interviews were led by the first author (Stefan Peters), a male exercise scientist, and 14 interviews were led by a female psychologist , both with prior experiences in conducting and analyzing qualitative interviews . They woThe transcripts were analyzed with the software Atlas.ti  using thInterview Guide with Follow-Up Questions\u201d) were translated from German into English by the first author (Stefan Peters).For this paper, all quotations as well as the interview guide  were mentioned less frequently, the interviewees talked more about the CBS (\u201cinnovation\u201d), the \u201cpatients,\u201d and themselves . These three levels displayed a pronounced conjunction  .Across these levels, three central themes were identified: (a) \u201cback school as common thread,\u201d (b) \u201ctheory versus practice,\u201d and (c) \u201cparticipation and patient-centeredness.\u201d For (a) and (c), several subcategories were identified . An in-dMany interviewees described the CBS or its manual, respectively, as \u201ccommon thread.\u201d For them, that was something which creates a \u201csystematization regarding presentation\u201d or an \u201centirely clear structure\u201d or is \u201csystematic\u201d or a \u201cplan.\u201d The connotation of this notion was mostly positive. \u201c(\u2026) it is surely good to be provided with a concept. The curriculum consists of 7 modules, those are the contents! That was surely valuable (\u2026). That certainly helped us a lot, because we did not have to consider, what we need for it, but: ah, it's written here.\u201dPhysician:Thereby, the rehabilitation professionals highlighted the interdisciplinary character of the back school. They stressed that this creates a \u201cconnection\u201d between contents and overcomes \u201cdifferent approaches.\u201d \u201cWell, that I have the feeling that we do, that we as clinic act in concert now (\u2026). That one department does not do one thing, works with other terms and we again do something different with different terms. So I just regard the clarity for patients as higher.\u201dPsychologist:Some interviewees explicitly outlined media and material, which accompany the back school as structure providing. \u201cAll of that was made easier for me by your slides, yes, I mean I have slides of my own as well and that way, that way one had a strict plan, also with those, what I liked, the flipcharts (\u2026). That is clearly arranged.\u201dExercise therapist:However, the specified time for certain contents in the \u201ccommon thread\u201d back school was critically mentioned. Across clinics and professions, a lack of time was described when conducting the back school. \u201cThe situation here is that the physician lecture or the physician seminar are very comprehensive in terms of contents. It partly goes too much into detail (\u2026). In every module 1, we came into conflict with the time. It was never completed with all slides having been presented (\u2026).\u201dPhysician:Obviously, the lack of time did not merely come from the extent of contents but also from participation of patients and the use of interactive methods, respectively. \u201cTime pressure. Well, I regard this as very problematic: not enough time at all. Whenever one suddenly starts to discuss things, time has already passed again; one has to think about the next thing. One cannot simply let things slide if you want to impart the content.\u201dPsychologist:The lack of time led to a variety of implications for the interviewees. Some described that they were able to correct exercises only to a lesser extent; others had left out contents or dealt with contents or methods flexibly.In some cases, the time that is provided by the new back school was characterized positively in comparison with the traditional back school that had been in place at the clinic previously. \u201c(\u2026) it is more fun for me; I have more time at hand than in our conventional back school. Personally, I find this very comfortable.\u201dExercise therapist:The flexibility in dealing with the \u201ccommon thread\u201d back school was another topic across clinics and professions. A supposedly strict \u201cone-to-one\u201d adoption of the curriculum back school seems to have led to difficulties or a rather negative perception of the \u201cguideline.\u201d \u201cThat's a bit like a sword behind your back, where one thinks: Hmm, now you have to see that you pull it through, that you just also stick to a common thread. And that is not always easy to establish if you work together with emotionally reacting human beings.\u201dOccupational therapist:Handling the CBS manual flexibly appears to have made it easier to conduct the program and promoted the satisfaction of rehabilitation professionals. \u201c(\u2026) there I have a common thread, but I can step out of line at both left and right. I regard this as very easy to implement.\u201dPhysiotherapist:The perception of how flexible or not one can handle the back school program seems to be rather stable within individuals and appears to have persisted, even if it was well known that a certain variability is possible. \u201cAnd that everything so exact, precisely accurate, 10 minutes for this issue, 10 minutes for that or 5 minutes for that issue. I think of this as a little bit, that is bound too strictly. However, you have said it already, one is a little bit flexible (\u2026).\u201dPhysiotherapist:It became apparent that the use of the manual requires certain competences. \u201cThere I just realized that different kinds of therapists exist. Some like giving lectures and also teach at physio-schools, for them it is easy to prepare such a lesson. They take that thing [manual of the back school], flip through it and in their head, a structure starts to emerge as to how they conduct the class later. Others just struggled a little bit more to acquaint themselves (\u2026). Well, they just oriented themselves very accurately towards the concept [manual of the back school] and just think \u201cI now conduct the introduction for 7 minutes and then I may speak 5 minutes about this and then comes 12 minutes about that und what shall I do if I need 15 minutes there instead of 12?\u201d Well, simply a little bit too strict.\u201dPhysiotherapist:Interviewees across clinics and professions addressed amount, distribution, and conjunction of theory and practice in the back school program. It was often stated that patients wanted to have more practice and less theoretical content. This relates, for example, to the patients criticizing too much sitting. \u201cOne did also see that all of them then became a little bit more restless, the patients. (\u2026) starting with the 3rd, 4th session [of the back school], not later than with me in the 5th, or so, that they became rather restless and simply said: \u201cHa, today it's theory again, only sitting again\u201d (\u2026) because it is really theory-loaded and listening, receiving so much theory.\u201dPhysiotherapist:From their own point of view, the interviewees also described their wish for more practical content or explained that this comes more naturally to them. In part, they illustrated this by reference to their professional role. \u201c(\u2026) to teach those didactics to the patient. So, you have to make a plan for yourself and this is how a plan may look like [content of action and coping planning in the CBS]. That is more what perhaps exercise therapists do or psychologists. Well, we physiotherapists work more practically.\u201dPhysiotherapist:Theory was also addressed concerning its transfer into practice or everyday life. \u201c(\u2026) it surely is very theoretical (\u2026) that is certainly not realizable at all (\u2026). And this transfer that they should do, (\u2026) this was not yet in my line.\u201dPsychologist:Ambivalences regarding the amount of theory became evident as well. \u201c(\u2026) session 6 and 7, that is when one just sits idle again, but exactly to talk about that, what's it like at home, I regard this as very, very good, to include this.\u201dExercise therapist:Several interviewees connoted the conjunction of theory and practice positively. \u201cWell, in the beginning, this touching on one's own body , that is what (\u2026), what establishes the connection between theory and practice. Well, that is very meaningful. Well, that is something, which we did not do previously for example, and where one simply notices that the participants are really excited and really simply feel this and yes, experience themselves in this.\u201dPhysiotherapist:The participation of patients was mostly described as high, which was partly portrayed as a difference in comparison to the former back school program. \u201cWell, I have fun with that and one recognizes that the patients are interested and that they participate and that they are vigilant and then I think, one can perhaps make a difference (\u2026) that after all something happens at home.\u201dPhysician:It was surprising for many interviewees that participation was so high. \u201cI have thought: Oh dear, if I think about our patients, will they participate? But probably it [previously] had been the case that they sat in the group, let us call it lethargically, because I guess you yourself had chosen only the teacher-centered teaching, in inverted commas.\u201dPhysiotherapist:On the other hand, the rehabilitation professionals often recognized a certain heterogeneity in patients regarding their participation. They mostly saw the reasons for this in varying motivation and acceptance of some patients. \u201cThere were simply those who understood quickly, who innately had little reservations. They participated actively and contributed well. However, there simply were many who, in that case, did not participate actively.\u201dPsychologist:Concerning the competences with regard to the interactive group facilitation, there was an obvious heterogeneity among professionals. \u201c(\u2026) that you worked a lot with questions and let people feel something. However, I know it this way, because I already completed the back school license in the new back school and there it is the usual way to include people more. (\u2026) while our three physiotherapists were a bit critical in the beginning, perhaps a bit insecure. One of them is a bit older. (\u2026) he simply knows that, the original form so to say, and this teacher-centered teaching. And this certainly influences you and there one realized that he is a little bit insecure in the beginning, how to conduct it all [the back school program], struggles a little bit (\u2026).\u201dExercise therapist:It became apparent that an increased patient participation or the empowerment of patients, respectively, could supposedly make it easier for rehabilitation professionals to conduct the back school. \u201c(\u2026) I mean for me it is simply an alleviation actually. Now it is not the case anymore that everybody thinks: Yes, she tells me now how to do it right actually, but they exercise on their own and there is no simple solution, that you click your fingers, but they simply have to give thought to it themselves: What could I do, what could I do better or what could I do more often (\u2026)? As such, the pressure is somewhat, actually, not on me anymore.\u201dPhysiotherapist:The volitional contents of the back school  met the approval of most interviewees. On the one hand, they were characterized as theory-loaded (see theme \u201cTheory versus Practice\u201d), but they were regarded as substantial to support the transfer into everyday life. This approval was even expressed by rehabilitation professionals for whom these contents were new or who had difficulties conducting them. \u201c(\u2026) what was really new for me was the barrier management. That is previously, when I conducted this, I didn't go into that. But now I go into that because this is actually indeed the biggest problem that people have, implementing sporting activity in everyday life, because there certainly emerges one's weaker self and stress and so on.\u201dPhysiotherapist:This study explored potential barriers and facilitators regarding the implementation fidelity of the CBS, which had been implemented in 9 rehabilitation facilities. For this purpose, the rehabilitation professionals who conducted the program were interviewed about their attitudes and experiences with regard to the program.The first finding concerns the importance of individual factors. Central themes mentioned by the interviewees were located on a conjunction of the levels \u201cinnovation,\u201d \u201cindividual professional,\u201d and \u201cpatient\u201d as described in the implementation model of Grol and Wensing : \u201cback sRehabilitation professionals mostly evaluated the alleged characteristic of the CBS as a common thread, guideline, or structure-providing framework as positive. This holds true in particular for the interdisciplinary structure or the common language provided. The role of structure and guidance and its mainly positive perception by rehabilitation professionals had already been pointed out in interviews prior to the implementation of the CBS . In contLack of experience with handling a manual could also be the reason for the difficulties the rehabilitation professionals had with delivering the respective content of the CBS within the dedicated amount of time. In the interviews, however, these difficulties were reported so frequently that multiple reasons seem plausible. Interactive methods and patient participation often appeared to be challenging for the rehabilitation professionals, because this seemingly required a lot of time. Additionally, the back school content was, to some extent, portrayed as quite complex and a certain introduction, for example, for psychological topics, was regarded as necessary. One psychologist mentioned that his usual pain course consists of several sessions with a duration of 90 minutes, which is more time than he has in the psychological session in the CBS. Another session of the CBS covers back posture and the so-called \u201cback-friendly behavior\u201d in everyday life. Rehabilitation professionals might have perceived that less time was available for a content that had been very prominent in their conventional back schools according to findings from interviews and selective visitations prior to the implementation of the CBS , 41.The comparison with the traditional back school program also seems to be the reason why rehabilitation professionals frequently alluded to the ratio between theory and practice in the CBS. Not surprisingly, the CBS was characterized as having more theory than the traditional programs of the clinics. The latter had mostly not been interdisciplinary, had focused more on back posture and physical exercises, and had not contained sessions explicitly aiming at motivation and volition to foster long-term physical activity or other psychosocial contents . A majorPatient participation in the CBS was mostly described as high. In another study in medical rehabilitation in Germany, patients had shown a high appreciation for being encouraged to participate more strongly during educational courses by rehabilitation professionals. They had indicated that it made it easier for them to follow and understand the content of self-management education programs . Still, It is noticeable that issues regarding the implementation intervention  were barely mentioned. However, a differentiation between clinics which implemented the CBS via either guideline or workshop had not been the research question in this interview study. Therefore, the interviews contained no explicit question regarding that issue.There are several limitations of this study, which have to be taken into account. The self-selection of both the rehabilitation clinics in general as well as the interviewees in particular might limit the external validity. The authors do not know whether there were rehabilitation professionals who refused to be interviewed because the clinics were in charge of selecting the interviewees. While nine rehabilitation clinics can be considered a high number of facilities for implementation studies, it might still have been a positive selection since there was no random drawing. However, when including clinics into the study, a variability in terms of sponsor/owner and characteristics of patients  was taken into account. Additionally, when interpreting the results, the characteristics of the study sample should be considered. The sample consisted of trainers, while administration staff and other stakeholders at the clinics were not interviewed because of the research question. This might be one explanation why individual factors were mentioned more commonly as compared to organizational factors. Furthermore, the thematic analysis that was used did not aim at a summary of all the data but at the identification of central themes that came up in the interviews. There was no explicit cut-off for a theme to be \u201ccentral,\u201d and the themes are not without a certain overlap.This study detected factors that may either positively or negatively influence the implementation fidelity of self-management education programs. The central themes of this interview study covered a conjunction of the implementation levels \u201cinnovation,\u201d \u201cpatient,\u201d and \u201cindividual professional.\u201d However, the results are explorative and hypothesis-generating and provide potential explanatory mechanisms for behavior and acceptance of rehabilitation professionals concerning the implementation of the CBS. Regarding this topic, data are scarce for German medical rehabilitation in general or the self-management education in this setting in particular. Educational needs of rehabilitation professionals conducting self-management education programs should be further explored in future research. A crucial future research question may ask what measures may support them bringing the use of manuals in line with their individual practice patterns and a varying degree of patient participation. Particularly the issues of flexibility and time management appear to be important, together with trainer competences for conducting patient-centered, interactive groups. Those are also important topics for educational offers, supporting rehabilitation professionals. Such offers are likely to enhance implementation fidelity of standardized, patient-centered self-management education programs like the CBS."}
+{"text": "Patient's serum sodium (SNa) decreased from 138 to 133 and 125\u2009mEq/L within 24 and 48 hours of cisplatin therapy, respectively. A diagnosis of syndrome of inappropriate antidiuretic hormone secretion (SIADH) was initially made. Despite free water restriction, patient's SNa continued to decrease in association with acute onset of headaches, nausea, and dizziness. Three percent saline (3%S) infusion with rates up to 1400\u2009mL/day was required to correct and maintain SNa at 135\u2009mEq/L. Studies to evaluate Fanconi syndrome revealed hypophosphatemia and glucosuria in the absence of serum hyperglycemia. The natriuresis slowed down by 2.5 weeks, but 3%S support was continued for a total volume of 12 liters over 3.5 weeks. Attempts of questionable benefits to slow down glomerular filtration included the administration of ibuprofen and benazepril. To our knowledge, this is the most severe case of RSW ever reported with cisplatin.Cisplatin is known to induce Fanconi syndrome and renal salt wasting (RSW). RSW typically only requires transient normal saline (NS) support. We report a severe RSW case that required 12 liters of 3% saline. A 57-year-old woman with limited stage small cell cancer was admitted for cisplatin (80\u2009mg/m Cis-diamminedichloroplatinum (CDDP), commonly known as cisplatin, is a chemotherapeutic agent used in the treatment of various cancers including carcinomas, germ cell tumors, lymphomas, and sarcomas. Its antitumor effect is thought to reflect its ability to cross-link with purine bases on DNA, thus interfering with DNA repair mechanisms and leading to DNA damage and tumor cell apoptosis . However2. Renal salt wasting typically only requires transient normal saline (NS) support. With the exception of one patient who required approximately 2.6\u2009L of 3% saline infusion over 2 days, all 17 others only required normal saline support with or without supplemental oral sodium chloride tablets [In a recent literature review, Hamdi et al. analyzed 18 patients who were reported with cisplatin-induced RSW. Patients developed RSW as soon as 12 hours and up to 4 months following cisplatin therapy. Cisplatin dosage used ranged from 80 to 600\u2009mg/m tablets . We here2 on day 1 and etoposide 100\u2009mg/m2 on days 1 to 3 with plan to include radiation at cycle 2. Prior to the administration of cisplatin, patient's serum sodium (SNa) was 134\u2013137\u2009mEq/L. Following the first cisplatin dose, her SNa decreased to 133\u2009mEq/L and 125\u2009mEq/L by 24 and 48 hours, respectively. The acute hyponatremia was initially attributed to the continuous infusion of 5% dextrose half-normal saline in association with presumed lung cancer induced SIADH. However, despite empirical free water restriction, her SNa decreased to 119\u2009mEq/L within 72 hours. Patient developed acute headache, nausea, and fatigue. Renal service was consulted.A 57-year-old woman presented with 4 weeks of shortness of breath, dyspnea on exertion, and nonproductive cough. Imaging studies revealed a lung mass extending into the mediastinum with narrowing of the left pulmonary artery and total left upper lobe collapse. Patient was diagnosed with limited stage small cell carcinoma of the lung (SCCL). Initial therapy included cisplatin 80\u2009mg/mMedications included fluticasone nasal spray twice daily, amoxicillin-clavulanic acid 875\u2009mg twice daily, omeprazole 20\u2009mg daily, and empirical intravenous stress dose of hydrocortisone 100\u2009mg q 8\u2009h. As needed medications included metoclopramide 10\u2009mg q 6\u2009h and albuterol 2.5\u2009mg nebulizer treatment q 4\u2009h.Physical exam revealed blood pressure 123/76\u2009mmHg, heart rate 70 beats per minute, and respiratory rate 18 per minute. Patient was uncomfortable with generalized headaches and nausea but alert and oriented to situation, person, place, and time. Oral mucosa was dry. Heart, lungs, abdomen, and extremities were unremarkable. Neurological exam was nonfocal.Laboratory Findings. Urine studies revealed osmolality (Uosm) 693\u2009mosm/kg, UNa 205\u2009mEq/L, and potassium (UK) 40\u2009mEq/L in association with increasingly high urine output . Cisplatin-induced proximal tubular injury with sodium wasting was suspected. Additional laboratory testing revealed glucosuria in the absence of significant serum hyperglycemia , low-molecular weight proteinuria , and hypophosphatemia (2.4\u2009mg/dL from baseline of 4.2\u2009mg/dL 1 week previously), all consistent with proximal tubular injury. Serum calcium was also noted to trend downwards from a baseline of 8.78 \u00b1 0.46\u2009mg/dL two days before to 8.25 \u00b1 0.39\u2009mg/dL two days following cisplatin therapy. There was no change noted in serum magnesium. Other routine evaluations for hyponatremia including thyroid stimulating hormone and morning serum cortisol levels were within normal limits.Patient was started on 3% saline infusion. Her daily effective electrolyte loss (urine sodium and potassium) averaged at 634 \u00b1 183\u2009mEq/d, with a maximum of 1050\u2009mEq.Patient required approximately 12\u2009L of 3% saline infusion over a 3.5-week period to correct the initial hyponatremia and maintain salt equilibrium prior to gaining sufficient renal recovery for switching to oral sodium supplements. During the worst phase of renal salt wasting, patient required up to 47\u2009g of NaCl or 18.5\u2009g of sodium supplement daily. During the natriuretic phase, attempts to slow her glomerular filtration, thus filtered sodium and potassium load, included ibuprofen 200\u2009mg thrice daily and benazepril 10\u2009mg twice daily . It is uIn the setting of malignancy, hyponatremia commonly arises from excess free water intake in association with SIADH, poor solute intake, or, less commonly, adrenal insufficiency due to metastatic disease. Since current patient was initially euvolemic and had no problem with oral intake or known adrenal insufficiency, the diagnosis of SIADH was entertained. Despite empirical free water restriction of one liter a day, patient developed rapid worsening hyponatremia (SNa dropped from 125\u2009mEq/L to 119\u2009mEq/L within eight hours) and acute onset headaches, nausea without vomiting, and clinical evidence of hypovolemia  in association with polyuria (up to 4\u2009L a day) of high urine sodium plus potassium content . The wor+, Mg2+, Ca2+, PO42\u2212), Fanconi syndrome, and even nephrogenic diabetes insipidus. Given significant natriuresis and hypophosphatemia, mild tubular proteinuria, and glucosuria in the absence of hyperglycemia, patient was felt to have developed Fanconi syndrome and RSW. Of interest, patient's daily urinary sodium loss was up to 8.9-fold the sodium content of her daily hospital-prepared meals (average sodium content of 2.0 \u00b1 0.2\u2009gm daily), assuming she ate all of her meals. To our knowledge, this is the most severe case of cisplatin-induced RSW ever reported. The reason for severe salt wasting in current case is not known. Patient has no underlying kidney disease and was not receiving any diuretic or nephrotoxic agent that could have potentiated the natriuresis. While we successfully supported patient with high volume 3% saline followed by salt tablets, preventive measures are vital.Cisplatin-induced kidney injury is rare but may lead to acute tubulointerstitial nephritis, tubular necrosis, proximal S3 tubular damage with salt wasting (KNormal saline support during cisplatin therapy is likely the key preventive therapy. The protective effects of NS are thought to involve the ability of the chloride ion concentration to stabilize the CDDP molecule, suppress the formation of CDDP metabolites, and reduce the conversion of CDDP to its aquated products. The latter have higher protein binding capacity and thus greater tissue accumulation and damage .Despite the lack of clinical data, concurrent use of commonly used antioxidants including N-acetylcysteine, vitamin C, and vitamin E has been suggested due to their reported efficacy in animal studies and low toxicity profile. Other clinically available agents considered for renoprotection against cisplatin include salicylates for anti-inflammation, allopurinol for the reduction of reactive oxygen species generation, fibrates for the reduction of free fatty acid accumulation and suppression of apoptosis, and resveratrol for antioxidative, anti-inflammatory, and cytoprotective properties .Alternatively, replacement of cisplatin with carboplatin may be considered in cases with either known contraindication with cisplatin or documented severe cisplatin-induced nephrotoxicity. Nonetheless, it must be recognized that cisplatin has unequivocal superiority over carboplatin in terms of antitumor effect on various malignancies . SubsequClinicians must exert great caution when administering cisplatin due to its severe and potentially life-threatening salt wasting complication. Preventive measures, particularly early normal saline infusion with or without concurrent use of antioxidants, anti-inflammatory agents, or both, must be considered to prevent adverse outcomes. In patients with established severe cisplatin-induced RSW, considerations for an alternative agent may be advisable."}
+{"text": "These species are the volatilized products of reactions between hydrogen and carbon contaminants that have backstreamed into the reaction chamber from downstream system components. Consequently, we observe a dramatic suppression of multilayer nucleation when backstreaming is suppressed. These results point to an important and previously undescribed mechanism for multilayer nucleation, wherein higher-order gas-phase carbon species play an integral role. Our work highlights the importance of gas-phase dynamics in understanding the overall mechanism of graphene growth.The processes governing multilayer nucleation in the chemical vapour deposition (CVD) of graphene are important for obtaining high-quality monolayer sheets, but remain poorly understood. Here we show that higher-order carbon species in the gas-phase play a major role in multilayer nucleation, through the use of  It is generally agreed that the growth process begins with an influx of carbon precursors onto the copper surface, which leads to a local supersaturation of active carbon species and triggers the nucleation of graphene domains7. The growth of these nascent nuclei depletes the carbon concentration in their vicinity, which suppresses further nucleation8. The nuclei continue to expand and eventually coalesce to form extended sheets that span the entire surface of the substrate. Due to the limited solubility of carbon in copper, the reaction is surface-limited, thereby providing a high selectivity towards monolayer growth9. The dynamics of the growth process are influenced by four keys parameters: temperature, pressure, methane (CH4) concentration, and hydrogen (H2) concentration. The effects of temperature are well-understood: higher temperatures generally lead to higher quality films by improving the mobility and adsorption-desorption kinetics of surface-bound carbon, thereby improving the grain crystal quality8. The system pressure and flowrates govern the mass transport10 and residence time of the gases in the chamber11, as well as the surface dynamics of the copper substrate on account of copper sublimation at reduced pressures13. The effects of varying the methane and hydrogen partial pressures are closely intertwined with the system pressure, with low CH4/H2 and high CH4/H2 ratios favouring monolayer growths in the atmospheric pressure and low pressure regimes, respectively16. The partial pressures of the gases also determine the chemical potential for carbon deposition, and hence the kinetics of graphene growth on the copper surface. A higher methane partial pressure increases the chemical potential, shifting the graphene grain morphology towards diffusion-limited dendritic growth, whereas hydrogen reduces the potential, favouring kinetically-limited growth of hexagonal domains at high partial pressures23.Large-area, high quality monolayer graphene suitable for applications in flexible electronics can now be reproducibly obtained by chemical vapour deposition (CVD) of graphene on copper, thanks to extensive research into understanding its growth process over the past years26. These observations have so far been explained by hydrogenation of the domain edges, which decouples them from the copper surface and allows diffusion of carbon species underneath the initial monolayer28.However, certain aspects of the role of hydrogen still remain unclear. In particular, while a large hydrogen partial pressure is crucial for obtaining high-quality, hexagonal domains, several studies have reported an increase in multilayer nucleation under such conditionsin-situ gas-phase ultraviolet (UV) absorption spectroscopic technique, we provide evidence for an alternate, possibly complementary explanation, wherein large concentrations of hydrogen activate carbon contaminants in the reaction chamber, volatilizing them and making them available for nucleation. These contaminants, which comprise oils, greases, and condensed products of pyrolysis, accumulate in the chamber as a result of backstreaming from downstream system components, such as the exhaust lines, the vacuum pump, and the foreline trap. The resultant cracking of these species by hydrogen at high temperatures produces the necessary gas-phase precursors for multilayer nucleation. A dramatic reduction in multilayer nucleation is consequently achieved by suppressing backstreaming in a cleaned reaction chamber, which strongly supports this interpretation. The results thus demonstrate that multilayer nucleation can in some cases be wholly ascribed to the volatilized products of reactions between backstreamed contaminants and H2, highlighting the importance of the role of gas-phase carbon species in multilayer nucleation.Here, through the use of a novel In-situ UV absorption spectroscopy measurements were conducted in a cold-wall CVD system according to Fig.\u00a029, whereas laser-based methods run the risk of inducing photochemical reactions and producing spurious results at high temperatures. In contrast, UV absorption spectroscopy is a simple, non-invasive, and sensitive tool that provides direct, real-time measurements of changes in concentrations of photoactive species and is limited largely by instrumental noise30.4 and 1000 sccm H2 flow. High-purity copper foils were fabricated in-house in order to minimize impurities and surface imperfections, which could otherwise adversely influence our results31 (see Methods). The sample was annealed at growth temperature in 700 sccm argon (Ar) flow for 30\u2009minutes, after which Ar was turned off and H2 was introduced. Following a stabilization period of 90\u2009seconds, the growth phase was executed for 30\u2009seconds by introducing CH4.Figure\u00a04 after 150\u2009seconds has a negligible effect on the absorption spectrum. Subsequent scanning electron microscopy (SEM) of the copper surface after growth  is observed while the chamber is still in vacuum. Adding argon results in a mild increase in absorption across the spectrum  grease in vacuum pumps, and one that was also present in our pump. We note that organic fluorine compounds are an unusual contaminant to find in electroplated foils inside in a cleanroom; while PTFE containers have previously34 been suggested as a potential flourocarbon source, we used polypropylene wafer trays in our experiments, which precludes this as a possibility. The results therefore suggest that the contaminants are introduced during the growth process from the chamber itself, and originate from downstream components such as the pump. Moreover, the striking resemblance between the contaminant distribution and graphene nucleation patterns in Fig.\u00a0Figure\u00a040. Whilst oil-based vacuum pumps can be fitted with oil traps to mitigate backstreaming, a finite amount of backstreaming is almost always present, and the traps themselves can easily be exhausted without regular maintenance41. While the results here have been demonstrated for a cold-wall system, similar effects are expected for a hot-wall furnace that is continuously pumped during operation or standby, because pumping at low pressures continuously introduces backstreamed carbon into the chamber  there is very limited literature on UV absorption spectra of species at elevated temperatures with which to benchmark our results, (2) UV absorbance of most species is temperature-dependant, precluding the use of room temperature data for analysis, (3) the measured absorbance is a convolution of absorption by mutiple species, which makes accurate quantification difficult. As such, a more quantitative technique would be needed to identify the species responsible. Nevertheless, It is well-known that backstreaming contaminants are primarily composed of vapours or degraded fragments of pump oils and greases; these comprise a wide range of lubricants used in vacuum systems, such as fluorocarbons, silicones, olefins, esters, and ethers38. As such, the composition can vary from system to system, and even between runs on the same system. This variability can, for instance, be seen when comparing the hydrogen spectra of Figs\u00a0x impurities42 could equally be explained by backstreaming of silicone-based greases. As such, it is unlikely that a single species plays a dominant role in multilayer nucleation in all cases, but rather a plethora of species that can collectively be categorized as higher-order carbon contaminants.While the XPS results in Fig.\u00a044, but in light of the fact that these are carbonaceous contaminants, we believe our results support a novel explanation for the mechanism of the formation of multialyers during the CVD growth of graphene: hydrogen-induced cracking, volatilization and subsequent deposition of higher-order carbon contaminants onto the copper surface presents a large, instantaneous flux of carbon that triggers premature local supersaturation and simultaneous nucleation of multiple layers. The rapid nucleation and growth that such a large initial carbon flux would furnish would also result in the formation and encapsulation of defective multilayers and residual amorphous carbon at the centre of graphene domains, which we observe via Raman spectroscopic maps , such that the initial monolayer grows fast enough to prevent depletion of excess carbon from the nucleation point (and hence suppress adlayer nucleation), but not so fast that it encapsulates and stunts the growth of the secondary layers. Indeed, this \u2018sweet spot\u2019 for CH4/H2 flowrates has been demonstrated by several studies48.Beyond the initial nucleation, the ultimate size of the secondary graphene layers would be governed by the carbon diffusion length and the rate at which the primary monolayer expands. In principle, growth of multilayers could be sustained through the modulation of the carbon chemical potential . As such, the contaminants themselves do not provide sufficient carbon chemical potential to nucleate and sustain the growth of graphene in the absence of methaneane Fig.\u00a0.in-situ spectroscopic tool to probe the effect of gas-phase dynamics on the CVD growth of graphene, and have found that carbonaceous contamination introduced into the chamber through vacuum backstreaming plays a key role in multilayer nucleation. This holds important implications for both research into graphene growth dynamics and the large-scale manufacture of graphene5, where continuous operation is required, and where oil pumps are frequently used. Moreover, the findings here are also applicable to dry pumping CVD systems, where pyrolytic products have accumulated in downstream components through continuous use, and to atmospheric pressure systems, where the chamber is continuously pumped down while in standby. As such, modifications in operating procedures should be considered to ensure that backstreaming and general carbon contamination in the chamber are minimized. For instance, switching from wet pumping systems to dry pumps, regular maintenance and cleaning of downstream and chamber components (and cleaning components in furnaces), reducing pumping times when there is no gas flow, and operating at atmospheric pressures during standby and operation modes are potential steps that can be taken to mitigate the effects of backstreaming.In conclusion, we have used a novel in-situ study of gas-phase dynamics on graphene growth. In light of its relevance towards preventing multilayer nucleation and monitoring backstreaming in real-time, this method may prove to be a scalable and versatile process monitoring tool for large-scale graphene CVD systems, and for vacuum systems in general where backstreaming poses a potential concern.More importantly, the findings presented here address the commonly reported observation that the presence of large hydrogen concentrations during graphene CVD, and in particular during low pressure growths, induce multilayer nucleation. In a broader perspective, the results also point to an unexplored route by which multilayer nucleation may be initiated, where the presence of higher-order carbon species in the gas-phase induce premature local supersaturation and nucleation of multilayered domains. Finally, gas-phase UV absorption spectroscopy proves to be a non-invasive and sensitive tool for the 2 wafers in a cleanroom facility. 30\u2009\u00b5m of copper was subsequently electroplated onto the strike layer in an acidic electroplating bath consisting of 94\u2009g/L CuSO4\u22195H2O  and 100\u2009ml/L H2SO4 . Copper electroplating in a sulfuric acid bath is highly selective towards copper deposition, but nevertheless, low current density DC plating was employed to avoid co-deposition of potential impurities from the solution. The plated films were thoroughly rinsed in deionized water and dried with a combination of acetone and isopropanol rinsing and blow-drying under N2 flow. Finally, the foils were delaminated from the SiO2 wafer immediately before inserting them into the growth chamber, revealing an atomically flat surface  of copper strike layer was sputtered  onto RCA-cleaned SiO2, CH4) are introduced into the chamber via a showerhead assembly, whereby the gases flow past the top heater and heater sample stage, eventually exiting the chamber via the gas outlets at the bottom of the reactor. The reactor uses a rotary vane oil pump (Leybold) and a sorbent foreline trap filled with alumina beads. Two quartz viewports, situated 180\u00b0 from one another, provide optical access to the chamber  and the ith spectrum, respectively, for a given wavelength, k. A series of absorption spectra is thus obtained, with the time interval between spectra defined by the integration time for the experiment.A series of transmission spectra are continuously recorded from 1\u20133\u2009minutes before the end of the annealing phase until the end of the growth phase. All spectra are acquired in single acquisition mode with the same integration time. The integration time was adjusted to be in the range of 800\u20131000 ms prior to each experiment to obtain the maximum transmitted signal at room temperature while the system is at base pressure. A dark spectrum is taken shortly before the continuous recording, which is then subtracted from all subsequent spectra. The initial spectrum in the spectral series is used as the reference spectrum. Absorption spectra are subsequently calculated for each spectrum in the series using the equation below:2 is added. After 2\u2009minutes, once the gas flow has stabilized, 1 sccm CH4  is added for 30\u2009seconds. The sample is subsequently cooled down under 1000 sccm Argon flow.CVD growth of graphene was performed in the Aixtron Black Magic cold-wall CVD system as follows: A small piece of copper foil is placed at the centre of the substrate platform. The chamber is subsequently pumped to base pressure (0.03 mbar for 10\u2009minutes) and flushed with argon  three times before being pumped down to base pressure for 10\u2009minutes again. The chamber is then pressurized to 20 mbar with argon and heated to 1000\u2009\u00b0C (with both the top and bottom graphite heaters on) under 700 sccm argon flow. The copper foil is annealed for 30\u2009minutes at temperature, after which 1000 sccm HThe chamber was cleaned by disassembling and manually cleaning individual components or replacing them with new ones. Quartz components were replaced with new ones, or were cleaned in a copper etchant solution and annealed in a furnace at 1200\u2009\u00b0C to burn off carbon contaminants. Finally, the chamber was heated to 550\u2009\u00b0C and an air plasma generated for 15\u2009minutes to burn off any remaining carbon contaminants. This procedure was found to be effective at removing contamination from the system, as judged by spectroscopic measurements  was conducted with a Zeiss LEO 1550 at 5.00\u2009keV. Raman micro-mapping was performed with a Thermo Fisher DXR microscope . X-ray photoelectron spectroscopy (XPS) measurements were performed with a Thermo Fisher Scientific K-alpha XPS system using a Al K\u03b1 X-ray source (1486.7\u2009eV).The data that support the findings of this study are available from the corresponding author upon request.Supplementary Information"}
+{"text": "Improving ethanol concentration and reducing enzyme dosage are main challenges in bioethanol refinery from lignocellulosic biomass. Ethylenediamine (EDA) pretreatment is a novel method to improve enzymatic digestibility of lignocellulose. In this study, simultaneous saccharification and co-fermentation (SSCF) process using EDA-pretreated corn stover was analyzed and optimized to verify the constraint factors on ethanol production.Highest ethanol concentration was achieved with the following optimized SSCF conditions at 6% glucan loading: 12-h pre-hydrolysis, 34\u00a0\u00b0C, pH 5.4, and inoculum size of 5\u00a0g dry cell/L. As glucan loading increased from 6 to 9%, ethanol concentration increased from 33.8 to 48.0\u00a0g/L, while ethanol yield reduced by 7%. Mass balance of SSCF showed that the reduction of ethanol yield with the increasing solid loading was mainly due to the decrease of glucan enzymatic conversion and xylose metabolism of the strain. Tween 20 and BSA increased ethanol concentration through enhancing enzymatic efficiency. The solid-recycled SSCF process reduced enzyme dosage by 40% (from 20 to 12\u00a0mg protein/g glucan) to achieve the similar ethanol concentration (~\u200940\u00a0g/L) comparing to conventional SSCF.Here, we established an efficient SSCF procedure using EDA-pretreated biomass. Glucose enzymatic yield and yeast viability were regarded as the key factors affecting ethanol production at high solid loading. The extensive analysis of SSCF would be constructive to overcome the bottlenecks and improve ethanol production in cellulosic ethanol refinery. To meet the global demand for energy, lignocellulosic biomass has long been recognized as a potential sustainable resource of mixed sugars for bioethanol fermentation . Corn stThe choice of pretreatment has a significant impact on biorefinery costs and on most other downstream processing decisions . EthylenSaccharomyces cerevisiae, as it enables reducing investment cost, saving energy, and achieving higher ethanol productivity by reducing end-products inhibition compared with separate hydrolysis and co-fermentation (SHCF) [Simultaneous saccharification and co-fermentation (SSCF) is a promising process for bioethanol refinery, in which enzymatic hydrolysis of the pretreated biomass occurs simultaneously with the co-fermentation of hexose and pentose (mainly glucose and xylose) by genetically engineered n (SHCF) \u201310. As tn (SHCF) \u201315. In an (SHCF) , 17. MasIn this study, we comprehensively analyzed the critical factors and optimized ethanol concentration in SSCF with EDA-pretreated CS for the first time. We found that the glucose enzymatic yield and the xylose utilization of the strain were seriously affected by solid loading. Furthermore, in view of high enzyme dosage in traditional SSCF process, we carried out an enzyme-recycled SSCF strategy to reduce enzyme dosage and production period. Recycling solid residues in SSCF is an advisable recycling strategy to recycle unhydrolyzed carbohydrates, adsorbed enzymes, and yeast cells. It was reported that alkaline-pretreated biomass was more suitable for enzyme recycling than acid-pretreated biomass probably due to the lower lignin content in alkaline-pretreated biomass . By the Corn stover (CS), harvested in the suburb of Tianjin, China, was air-dried and milled. Particle size between 0.2\u2009 and \u2009 2\u00a0mm was sieved and collected for pretreatment. The moisture of the prepared CS was 4\u20136%. EDA (\u2265\u200999%) was purchased from Yuanli Co. . Commercial enzymes Cellic Ctec2 and Cellic Htec2 were gifted by Novozymes .EDA pretreatment was carried out in an electric oven as previously reported . In brieS. cerevisiae SyBE005 was constructed and further mutated by evolutionary engineering in our previous research [600 was around 5 . The relationship between cell turbidity and dry cell weight was determined according to previous literature [g for 5\u00a0min.Engineered xylose-fermenting strain research . Seed cuterature . The celSSCF were performed in 100-mL flask with 20\u00a0g total mixture at 150\u00a0rpm. The biomass was first pre-hydrolyzed using the commercial enzymes with designated pH  and time  at 50\u00a0\u00b0C and 250\u00a0rpm. pH was adjusted by concentrated sulfuric acid or potassium hydroxide. Cellic Ctec2 and Cellic Htec2 were added with a loading of both 10\u00a0mg protein/g glucan. Ampicillin with a final concentration of 50\u00a0mg/L was used to prevent bacterial contamination. After the pre-hydrolysis, yeast cells were inoculated at designated inoculum sizes . The temperature was adjusted to designated values . Shaker speed was 150\u00a0rpm. Syringe needles were pierced through the rubber plug to release carbon dioxide during the first 12-h SSCF. 0.5\u00a0mL samples were withdrawn at 0, 12, 24, 48, and 72\u00a0h during SSCF to determine glucose, xylose, and ethanol concentration.For SSCF with 6 and 9% glucan loadings, non-ionic surfactant Tween 20 or bovine serum albumin (BSA) was added at the beginning of pre-hydrolysis with a concentration of 0.1\u00a0g/L.2SO4) flow rate was 0.6\u00a0mL/min. Mannose and galactose, co-eluted with xylose peak, were ignored in this study, as the contents of mannan and galactan in pretreated CS were lower than 2% which were determined by an Aminex HPX-87P column. Gluco- and xylo-oligomer concentrations were also determined according to LAP method. In brief, enzymatic hydrolysates containing oligomers were completely hydrolyzed with 4% H2SO4 at 120\u00a0\u00b0C for 1\u00a0h, and the hydrolysis products (glucose and xylose) were determined by HPLC.The compositions of pretreated and raw CS were determined following the laboratory analytical procedure (LAP) of the National Renewable Energy Laboratory. Compositions of untreated and pretreated CS are summarized in Table\u00a0The protein concentration of enzymes was determined by the BCA protein assay. Cellulase activity was determined using Whatman No.1 filter paper as described by Ghosh . XylanasTo facilitate the mass balance calculation, contents of glucan and xylan in the pretreated CS and solid residue were converted into the content of glucose and xylose. Ethanol yield was calculated based on total sugars in pretreated CS, and ethanol metabolic yield was based on available sugars in hydrolysate. Glucan conversion, xylan conversion, ethanol yield, and ethanol metabolic yield are calculated as follows:g for 20\u00a0min. The supernatant was frozen at \u2212\u200920\u00a0\u00b0C for component analysis. The residual solid was inoculated into the next cycle flask of pre-hydrolysate and thereby the total volume increased from cycle to cycle. 0, 30, 50, 70, and 100% of enzyme loading of cycle 1 was added into the beginning of pre-hydrolysate of cycle 2 to find the proper enzyme dosage to acquire comparable ethanol concentration with cycle 1. This fresh enzyme dosage was used for subsequent cycles (2\u20135). After five cycles, water was added into the residue solids without enzymes and fresh biomass supplementary for the last step.SSCF with the recycling of solid residue was carried out as shown in Fig.\u00a0S. cerevisiae SyBE005. To identify the key factors and maximize the ethanol concentration, several factors in SSCF were investigated   Fig.\u00a0. A pre-hSSCF at 34\u00a0\u00b0C had a slightly higher ethanol concentration (33.7\u00a0g/L) at 96\u00a0h than that of 30\u00a0\u00b0C 31.6\u00a0g/L) and 38\u00a0\u00b0C (31.9\u00a0g/L). Compared to 38\u00a0\u00b0C, 30 and 34\u00a0\u00b0C induced to significant higher xylose consumptions  at 96\u00a0h reached 33.8, 44.2, and 48.0\u00a0g/L, respectively. Higher xylose concentrations (96\u00a0h) remained for 7.5 and 9% glucan loadings (9.5 and 12.1\u00a0g/L) when compared to 6% glucan loading (2.5\u00a0g/L)  in cycle 2 to obtain similar ethanol concentration to cycle 1 (39.8\u00a0g/L at 48\u00a0h) , pre-hydrolysis produced similar glucose and xylose concentrations (0\u00a0h of SSCF)  [In this work, SSCF conditions of EDA-pretreated CS were optimized, which produced the highest ethanol concentration at 34\u00a0\u00b0C, 12-h pre-hydrolysis, pH 5.4, and inoculum size of 5\u00a0g dry cell/L. We found that the optimum conditions of SSCF might be quite different among various cases due to the different compositions of pretreated biomass, amounts of by-products, and microbial robustness. As known,  SyBE005 . The res SyBE005  indicatet yeasts , 29. It (LNH-ST) . A previ(LNH-ST) , which a(LNH-ST) .Improving ethanol concentration is the permanent goal of bioethanol refinery. Ethanol concentration should be as high as possible to reduce distillation cost, although 4%  ethanol is the threshold allowed to be distilled. Therefore, SSCF with high solid loading is necessary and becomes a bottleneck in cellulosic ethanol, as several studies found that ethanol yield decreased with increasing solid loading , 16, 29.As the cost of cellulase accounts for a considerable proportion in the whole cost of bioethanol refinery, reducing enzyme dosage is another bottleneck. Although surfactants or BSA can significantly improve ethanol yield and reduce enzyme dosage, it is still very costly in industry. To reduce enzyme dosage instead, enzyme-recycled process seems to be highly desirable. By adding the solid residue from SSCF into the next SSCF unit without fresh enzyme addition, we got 27.3\u00a0g/L ethanol Fig.\u00a0a, suggesWe established a SSCF process with EDA-pretreated CS and identified the optimum conditions. The optimization of SSCF effectively improved ethanol concentration. Ethanol concentration of 9% glucan loading SSCF demonstrated 42% increase of ethanol concentration and 7% decrease of ethanol yield compared with 6% glucan loading. We analyzed that the decrease of ethanol yield with increasing glucan loading was mainly due to the declined enzymatic efficiency for glucan and the declined xylose consumption. Recycling SSCF process with five cycles reduced enzyme dosage from 20 to 12\u00a0mg protein/g glucan, which saves 40% enzyme cost accordingly. This study demonstrated the high efficiency of EDA pretreatment coupled with SSCF process in biorefinery of cellulosic ethanol."}
+{"text": "R)-matsutakeol and other flavored substances were feasibly synthesized from various alkylaldehydes in high yield  and excellent enantiomeric excess (up to >99%). The protocols may serve as an alternative asymmetric synthetic method for active small-molecule library of natural fatty acid metabolites and analogs. These chiral allyl alcohols are prepared for food analysis and screening insect attractants.An efficient and practical synthetic route toward chiral matsutakeol and analogs was developed by asymmetric addition of terminal alkyne to aldehydes. ( HRMS ESI [M + Na]+ calcd for C10H16NaO3+ 207.0992, found 207.0992. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 14.93 min, minor (S)-enantiomer tr = 16.73 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-13b  as colorless oil. [\u03b1]c 1.05, CH2Cl2), 1H-NMR  \u03b4 (ppm): 4.57\u20134.44 , 3.77 , 2.36 , 1.84\u20131.71 , 1.51\u20131.24 , 0.87 . 13C-NMR  \u03b4 (ppm): 153.51, 88.07, 75.85, 61.76, 52.40, 36.53, 31.25, 28.44, 24.51, 22.16, 13.62. HRMS ESI [M + Na]+ calcd for C11H18NaO3+ 221.1148, found 221.1150. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 31.48 min, minor (S)-enantiomer tr = 37.63 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-13c  as colorless oil. [\u03b1]c 1.05, CH2Cl2), 1H-NMR  \u03b4 (ppm): 4.57\u20134.44 , 3.76 , 2.67 , 1.76\u20131.70 , 1.46\u20131.42 , 1.35\u20131.23 , 0.92\u20130.82 . 13C-NMR  \u03b4 (ppm): 153.58, 88.22, 75.77, 61.70, 52.41, 36.50, 31.36, 28.75, 28.72, 24.56, 22.23, 13.66. HRMS ESI [M + Na]+ calcd for C12H20NaO3+ 235.1305, found 235.1305. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 13.97 min, minor (S)-enantiomer tr = 15.47 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-13d  as colorless oil. [\u03b1]c 1.05, CH2Cl2), 1H-NMR  \u03b4 (ppm): 4.57\u20134.44 , 3.80 , 2.97 , 1.53 . 13C-NMR  \u03b4 (ppm): 153.61, 88.72, 74.99, 57.53, 52.48, 22.85. HRMS ESI [M + Na]+ calcd for C6H8NaO3+ 151.0366, found 151.0365. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 23.06 min, minor (S)-enantiomer tr = 26.75 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-13e  as colorless oil. [\u03b1]c 1.05, CH2Cl2), 1H-NMR  \u03b4 (ppm): 4.57\u20134.44 , 3.79 , 3.09 , 1.87\u20131.75 , 1.04 . 13C-NMR  \u03b4 (ppm): 153.64, 88.07, 75.76, 62.84, 52.45, 29.64, 8.88. HRMS ESI [M + Na]+ calcd for C7H10NaO3+ 165.0522, found 165.0522. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 20.98 min, minor (S)-enantiomer tr = 23.86 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-13f  as colorless oil. [\u03b1]c 1.05, CH2Cl2), 1H-NMR  \u03b4 (ppm): 4.57\u20134.44 , 3.79 , 3.02 , 1.83\u20131.66 , 1.58\u20131.41 , 0.96 . 13C-NMR  \u03b4 (ppm): 153.64, 88.29, 75.69, 61.40, 52.45, 38.47, 17.88, 13.22. HRMS ESI [M + Na]+ calcd for C8H12NaO3+ 179.0679, found 179.0681. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 24.14 min, minor (S)-enantiomer tr = 25.45 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-13g  as colorless oil. [\u03b1]c 1.05, CH2Cl2), 1H-NMR  \u03b4 (ppm): 4.55\u20134.44 , 3.77 , 2.39 , 1.82\u20131.68 , 1.48\u20131.31 , 0.91 . 13C-NMR  \u03b4 (ppm): 153.51, 88.06, 75.85, 61.75, 52.40, 36.23, 26.66, 21.88, 13.48. HRMS ESI [M + Na]+ calcd for C9H14NaO3+ 193.0835, found 193.0835. Enantiomeric excess was determined by HPLC with a Chiralcel OJ-H column , major (R)-enantiomer tr = 7.45 min, minor (S)-enantiomer tr = 8.02 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-13h  as colorless oil. [\u03b1]c 1.05, CH2Cl2), 1H-NMR  \u03b4 (ppm): 4.27 , 3.76 , 3.11 , 1.97\u20131.90 , 1.00 . 13C-NMR  \u03b4 (ppm): 153.64, 87.36, 67.05, 52.44, 33.79, 17.58, 17.09. HRMS ESI [M + Na]+ calcd for C8H12NaO3+ 179.0679, found 179.0680. Enantiomeric excess was determined by HPLC with a Chiralcel OJ-H column , major (R)-enantiomer tr = 8.66 min, minor (S)-enantiomer tr = 10.71 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-13i  as colorless oil. [\u03b1]c 1.05, CH2Cl2), 1H-NMR  \u03b4 (ppm): 5.89\u20135.75 , 5.12\u20134.96 , 4.52 , 3.79 , 2.64 , 2.26 , 1.92\u20131.81 . 13C-NMR  \u03b4 (ppm): 153.53, 136.64, 115.46, 87.75, 76.03, 61.08, 52.48, 35.48, 28.73. HRMS ESI [M + Na]+ calcd for C9H12NaO3+ 191.0679, found 191.0679. Enantiomeric excess was determined by HPLC with a Chiralcel OJ-H column , major (R)-enantiomer tr = 9.01 min, minor (S)-enantiomer tr = 9.75 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (4 (50 mL). The aqueous phase was extracted by ethyl acetate. The combined organic phases were dried over anhydrous Na2SO4, and concentrated under reduced pressure. The residue was dissolved in acetonitrile (12 mL), CuCl  was added in one portion to the mixture. The mixture was allowed to warm to r.t. and stirred for another 13 h. The aqueous phase was extracted by ether. The combined organic phases were dried over anhydrous Na2SO4, and concentrated under reduced pressure. The residue was purified by silica gel chromatography to get the product.A solution of the chiral alkynol (5 mmol) and THF (60 mL) were cooled to 0 \u00b0C, 1 M aq LiOH  was added at a slow rate. The solution was warmed to rt and stirred for an additional 1 h before it was quenched with 1M aq NaHSOR)-12a  as colorless oil. [\u03b1]c 1.0, ethyl ether), lit. + calcd for C8H14NaO+ 149.0937, found 149.0938.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 15:1) to offer (R)-12b  as colorless oil. [\u03b1]c 2.0, CHCl3), lit. + calcd for C9H16NaO+ Exact Mass: 163.1093, found 163.1093.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 15:1) to offer (3), lit.  [\u03b1]D25 =R)-12c  as colorless oil. [\u03b1]c 1.1, CHCl3), lit. + calcd for C10H18NaO+ 177.1250, found 177.1250.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 15:1) to offer (3), lit.  [\u03b1]D25 =To a stirred solution of nickel acetate tetrahydrate  in ethanol (5 mL) under hydrogen, sodium borohydride  in ethanol (2 mL) was added at 0 \u00b0C. After stirring for 1 h at 25 \u00b0C, ethylenediamine  was added. The reaction mixture was stirred for another 10 min before chiral alkynol (2 mmol) in ethanol (2 mL) was added slowly to the reaction mixture at 0 \u00b0C. The reaction was allowed to proceed at 25 \u00b0C under hydrogen for 6 h at 25 \u00b0C. The mixture was filtered through a celite pad, diluted with ether, and concentrated under reduced pressure. The residue was purified by silica gel chromatography to get the product.R)-6a  as colorless oil. [\u03b1]c 1.1, CHCl3), lit. + calcd for C8H16NaO+ 151.1093, found 151.1093.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 10:1) to offer (3), lit.  [\u03b1]D25 =R)-6b  as colorless oil. [\u03b1]c 1.1, ethanol), lit. + calcd for C9H18NaO+ 165.1250, found 165.1250.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 10:1) to offer (l), lit.  [\u03b1]D25 =R)-6c  as colorless oil. [\u03b1]c 1.1, CHCl3), lit. + calcd for C10H20NaO+ 179.1406, found 179.1408.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 10:1) to offer (3), lit.  [\u03b1]D25 =2Cl2 (6 mL) at \u22125 \u00b0C. The mixture was stirred for 5 h at 25 \u00b0C before water (2 mL) was poured into the mixture at 0 \u00b0C. The aqueous phase was extracted with ether, and combined organic phases were washed with saturated brine solution, dried over anhydrous Na2SO4, and concentrated under reduced pressure. The residue was purified by silica gel chromatography to get the product.Triethylamine  and 3,5-dinitrobenzoyl chloride  were added to a stirred solution of the chiral alcohol (1 mmol) in CHR)-21a  as white solid. [\u03b1]c 1.1, CH2Cl2), 1H-NMR  \u03b4 (ppm): 9.22 , 9.16 , 5.92 (m 1H), 5.56 , 5.36 , 1.96\u20131.72 , 1.48\u20131.26 , 0.89 . 13C-NMR  \u03b4 (ppm): 161.45, 148.34, 135.09, 134.00, 129.02, 121.92, 118.05, 77.82, 33.69, 31.09, 24.40, 22.10, 13.57. HRMS ESI [M + Na]+ calcd for C15H18N2NaO6+ 345.1057, found 345.1057. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 17.74 min, minor (S)-enantiomer tr = 14.46 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-21b  as colorless oil. [\u03b1]c 1.1, CH2Cl2), 1H-NMR  \u03b4 (ppm): 9.21 , 9.15 , 6.01\u20135.84 , 5.56 , 5.34 , 1.95\u20131.70 , 1.45\u20131.26 , 0.87 . 13C-NMR  \u03b4 (ppm): 161.45, 148.33, 135.11, 133.99, 129.02, 121.92, 118.01, 77.81, 33.73, 31.27, 28.59, 24.70, 22.17, 13.63. HRMS ESI [M + Na]+ calcd for C16H20N2NaO6+ 359.1214, found 359.1214. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 15.27 min, minor (S)-enantiomer tr = 12.67 min. Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-6c  as white solid. [\u03b1]c 1.05, CH2Cl2), 1H-NMR  \u03b4 (ppm): 9.23 , 9.16 , 5.98\u20135.87 , 5.57 , 5.35 , 1.99\u20131.71 , 1.40\u20131.28 , 0.88 . 13C-NMR  \u03b4 (ppm): 161.45, 148.35, 135.09, 134.02, 129.03, 121.92, 118.08, 77.85, 33.74, 31.37, 28.90, 28.75, 24.76, 22.24, 13.68. HRMS ESI [M + Na]+ calcd for C17H22N2NaO6+ 373.1370, found 373.1370. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 16.89 min, minor (S)-enantiomer tr = 13.50 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (S)-BINOL , HMPA  in methylene chloride (120 mL), diethylzinc  was added slowly at 0 \u00b0C. After stirring for 16 h at 25 \u00b0C, Titanium(IV) isopropoxide  was added and the stirring was continued for another 1 h at 25 \u00b0C. Then an aldehyde (10 mmol) was added and the reaction was allowed to proceed at 25 \u00b0C for another 6 h before being quenched with water (20 mL). The mixture was filtered through a celite pad. The aqueous phase was extracted with ether. The combined organic phases were washed with saturated brine, dried over anhydrous Na2SO4, and concentrated under reduced pressure. The residue was purified by silica gel chromatography to get the product c 1.1, CHCl3), lit. + calcd for C11H22NaOSi+ 221.1332, found 221.1332. Enantiomeric excess was determined by HPLC with a Chiralcel AD-H column , major (R)-enantiomer tr = 14.72 min, minor (S)-enantiomer tr = 13.52 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 20:1) to offer (3), lit.  [\u03b1]D25 =R)-13b\u2019  as colorless oil. [\u03b1]c 1.1, CHCl3), 1H-NMR  \u03b4 (ppm): 4.38 , 1.78\u20131.68 , 1.46 , 1.38\u20131.27 , 0.92 , 0.20 . 13C-NMR  \u03b4 (ppm): 106.68, 88.89, 62.54, 37.36, 31.34, 28.52, 24.70, 22.17, 13.67, \u22120.48. HRMS ESI [M + Na]+ calcd for C12H24NaOSi+ 235.1489, 235.1490. Enantiomeric excess was determined by HPLC with a Chiralcel AD-H column , major (R)-enantiomer tr = 13.68 min, minor (S)-enantiomer tr = 12.42 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 20:1) to offer (R)-13c\u2019  as colorless oil. [\u03b1]c 1.1, CHCl3). 1H-NMR  \u03b4 (ppm): 4.36 , 2.00 , 1.83\u20131.61 , 1.53\u20131.40 , 1.40\u20131.31 , 0.90 , 0.18 . 13C-NMR  \u03b4 (ppm): 106.70, 88.87, 62.54, 37.36, 31.39, 28.81, 28.79, 24.74, 22.26, 13.70, \u22120.48. HRMS ESI [M + Na]+ calcd for C13H26NaOSi+ 249.1645, found 249.1645. Enantiomeric excess was determined by HPLC with a Chiralcel AD-H column , major (R)-enantiomer tr = 18.90 min, minor (S)-enantiomer tr = 16.94 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 20:1) to offer  in methanol (20 mL), potassium carbonate  was added slowly at 0 \u00b0C. After stirring for 20 h at 25 \u00b0C, water (20 mL) was added slowly at 0 \u00b0C. The reaction mixture was concentrated under reduced pressure. The aqueous phase was extracted with ether. The combined organic phases were washed with saturated brine solution, dried over anhydrous NaR)-12a  as colorless oil. [\u03b1]c 1.0, ethyl ether), lit. + calcd for C8H14NaO+ 149.0937, found 149.0937.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 15:1) to offer (r), lit.  [\u03b1]D25 =R)-12b  as colorless oil. [\u03b1]c 2.0, CHCl3), lit. + calcd for C9H16NaO+ Exact mass: 163.1093, found 163.1093.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 15:1) to offer (3), lit.  [\u03b1]D25 =R)-12c  as colorless oil. [\u03b1]c 1.1, CHCl3), lit. + calcd. for C10H18NaO+ 177.1250, found 177.1250.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 15:1) to offer (3), lit.  [\u03b1]D25 =To a stirred solution of nickel acetate tetrahydrate  in ethanol (20 mL) under hydrogen, sodium borohydride  in ethanol (8 mL) was added at 0 \u00b0C. After stirring for 1 h at 25 \u00b0C, ethylenediamine  was added. The reaction mixture was stirred for another 10 min before chiral alkynol (8 mmol) in ethanol (8 mL) was added slowly to the reaction mixture at 0 \u00b0C. The reaction was allowed to proceed at 25 \u00b0C under hydrogen for 6 h at 25 \u00b0C. The mixture was filtered through a celite pad, diluted with ether, and concentrated under reduced pressure. The residue was purified by silica gel chromatography to get the product.R)-6a  as colorless oil. [\u03b1]c 1.1, CHCl3), lit. + calcd. for C8H16NaO+ 151.1093, found 151.1093.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 10:1) to offer (3), lit.  [\u03b1]D25 =R)-6b  as colorless oil. [\u03b1]c 1.1, ethanol), lit. + calcd. for C9H18NaO+ 165.1250, found 165.1250.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 10:1) to offer (l), lit.  [\u03b1]D25 =R)-6c  as colorless oil. [\u03b1]c 1.1, CHCl3), lit. + calcd. for C10H20NaO+ 179.1406, found 179.1406.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 10:1) to offer (3), lit.  [\u03b1]D25 =2Cl2 (40 mL) at \u22125 \u00b0C. The mixture was stirred for 5 h at 25 \u00b0C before water (10 mL) was poured into the mixture at 0 \u00b0C. The aqueous phase was extracted with ether and combined organic phases were washed with saturated brine solution, dried over anhydrous Na2SO4, and concentrated under reduced pressure. The residue was purified by silica gel chromatography to get the product.Triethylamine  and 3,5-dinitrobenzoyl chloride  were added to a stirred solution of the chiral alcohol (6 mmol) in CHR)-21a  as white solid. [\u03b1]c 1.1, CH2Cl2). Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 17.80 min, minor (S)-enantiomer tr = 14.65 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-21b  as colorless oil. [\u03b1]c 1.1, CH2Cl2). Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 15.76 min, minor (S)-enantiomer tr = 12.93 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-21c  as white solid. [\u03b1]c 1.05, CH2Cl2). Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 16.58 min, minor (S)-enantiomer tr = 13.66 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (Dinitrobenzoates (5 mmol) were dissolved in diethyl ether at room temperature, then n-hexane was added slowly to the mixture until a white precipitate occurred. A small portion of diethyl ether was added and the white precipitate was dissolved. The mixture was cooled to \u221230 \u00b0C and stayed for 48 h to get a white crystal of the dinitrobenzoate.R)-21a  as white solid. [\u03b1]c 1.1, CH2Cl2). HRMS ESI [M + Na]+ calcd for C15H18N2NaO6+ 345.1057, found 345.1057. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 18.20 min, minor (S)-enantiomer tr = 14.46 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-21b  as colorless oil. [\u03b1]c 1.1, CH2Cl2). HRMS ESI [M + Na]+ calcd for C16H20N2NaO6+ 359.1214, found 359.1214. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 15.60 min, minor (S)-enantiomer tr = 12.67 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer  as white solid. [\u03b1]2Cl2). HRMS ESI [M + Na]+ calcd for C17H22N2NaO6+ 373.1370, found 373.1370. Enantiomeric excess was determined by HPLC with a Chiralcel OD-H column , major (R)-enantiomer tr = 16.46 min, minor (S)-enantiomer tr = 13.50 min.Following the general procedure, the residue was purified by silica gel chromatography (hexanes/ethyl acetate 8:1) to offer (R)-R)-matsutakeol  and its highly enantioselective analogs, by utilizing the -ProPhenol as chiral catalyst. In addition, the method may allow for gram-scale synthesis of (R)-matsutakeol and its analogs by using (S)-BINOL as chiral catalyst, thus facilitating their potential applications. Besides, this strategy has been proven to be practical for obtaining flavored allyl alcohols with high enantioselectivity in food analysis and screening insect attractants. Biological evaluation of target molecules is in progress and will be reported in due course.In summary, we developed a general synthetic route toward chiral matsutakeol and its analogs via the asymmetric catalytic alkynylation. A practical and efficient access was provided to prepare the ("}
+{"text": "Branch retinal artery occlusion (BRAO) is typically associated with irreversible vision and peripheral visual field loss. We report a case of a 62-year-old woman with a BRAO related to several cardiovascular risk factors. Our patient encountered gradual but significant vision recovery months following carotid artery endarterectomy for carotid stenosis. Branch retinal artery occlusion (BRAO) accounts for 38% of acute retinal artery obstruction cases . In BRAOEmbolism is the most common cause of retinal artery occlusions with calcific plaques originating from the carotid artery as the primary source and less commonly the aortic arch or heart . PatientVarious treatment modalities for BRAO have been proposed and reported including YAG laser embolysis and embolectomy, surgical embolus removal, and local fibrinolysis. Unfortunately, none of these have achieved an outcome better than natural history and each can be associated with serious complications .Vision recovery after embolic BRAO is rare. Previously, we reported a case of surgical retinal embolectomy where retinal embolectomy successfully prevented vision loss . CurrentA 62-year-old woman presented with a one-month history of sudden painless visual loss in the right eye. On examination, best corrected visual acuity (BCVA) was 20/20 in both eyes. Intraocular pressure was 21 mmHg in both eyes. Dilated funduscopic examination in the right eye revealed retinal emboli inferior to the optic disc obstructing a small arteriole associated with retinal ischemia Figures . The lefFluorescein angiography revealed delayed retinal perfusion along the inferior arcade in the right eye Figures . OpticalUnexpectedly, the patient presented with a three-day history of sudden painless visual loss OD a year and a half after her initial presentation. BCVA was counting fingers (CF) in the right eye. Fundus exam revealed new superotemporal retinal ischemia associated with two new emboli. OCT demonstrated thickening and hyperreflectivity of the inner retinal layers consistent with an acute BRAO OD . The patAfter endarterectomy, vision in the right eye improved from counting fingers to 20/200 and 20/250 at 2 months and 6 months, respectively. Postoperatively, retinal whitening resolved and reduced intraretinal edema was noticed . One yeaOur patient presented with a clinical picture consistent an embolic BRAO. However, there was significant and gradual improvement in her vision following carotid endarterectomy. Currently, there exists no evidence-based efficacious treatment for BRAO . Our patCarotid endarterectomy has been studied for carotid stenosis; according to the most current Cochrane Review , particiDr. Hayreh and Dr. Zimmerman  have desExperimental studies have shown that the retina suffers no damage with RAOs lasting less than 97 minutes; however, occlusions lasting longer than about 240 minutes cause irreversible retinal damage .Our case is unique in that our patient with cardiovascular risk factors had a BRAO with significant acute vision loss. Her endarterectomy was several months after her presentation with acute visual loss, and her vision improvement was gradually seen months after this extraocular intervention. Our case highlights the utility of urgent cardiovascular workup and referral to a subspecialist pending further workup. Long-term vascular remodeling, especially prominent in former smokers, may lead to cardiovascular recovery as a protective recovery mechanism. The exact timing and threshold for endarterectomy in the setting of acute BRAO warrants further investigation."}
+{"text": "Improved glycemic control is the desired outcome after the discharge of patients with diabetes. We aimed to determine the efficacy of a basal-bolus insulin protocol in hospitalized patients with diabetes treated with glucocorticoids.n\u2009=\u200961) or without glucocorticoids (n\u2009=\u200989). All patients were treated with a basal-bolus regimen.A retrospective cohort study compared the glycemic control of 150 hospitalized patients with diabetes and elevated inflammatory markers who were either treated with (p\u2009<\u2009.0001), and significantly higher at 5:00\u00a0PM , and 8:00 P.M.  . No difference was detected between the two groups in prandial and basal insulin doses during hospitalization. Overall, 64% of patients in the glucocorticoid-treated group versus 39% in the untreated group had inadequate glycemic control during hospitalization (p\u2009=\u20090.003).Glycosylated hemoglobin A1C (HbA1C) levels, mode of diabetes treatment before admission, length of hospitalization and inflammatory markers were similar in both groups of patients (treated and untreated with glucocorticoid). There was a trend toward female predominance in the glucocorticoid-treated group. Mean daily glucose levels were higher in patients taking glucocorticoids when compared with untreated patients (12.5\u2009\u00b1\u20092.7\u00a0mmol/l vs. 10.9\u2009\u00b1\u20092.4\u00a0mmol/l, . New basal-bolus protocols with appropriate adjustments of short acting insulin are needed to treat patients with diabetes on glucocorticoid therapy.A significantly higher percentage of patients with diabetes who were treated with glucocorticoids during hospitalization did not achieve glycemic control with a basal-bolus insulin protocol. These patients had significantly higher mean blood glucose levels due to elevated levels in the afternoon and evening The deleterious effects of hyperglycemia on the length of hospitalization, rate of infection, in-hospital mortality, and disability after hospitalization are well known from previous studies \u20133, so enGlucocorticoids are widely used for treating inflammatory, autoimmune and malignant diseases . New-onsAlthough a growing body of studies have examined various glycemic control protocols for glucocorticoid-treated patients with diabetes \u201315, therThis retrospective study was approved by HaEmek Medical Center Research Ethics Committee . We reviewed the electronic charts of patients diagnosed with type 2 diabetes mellitus (T2DM) admitted to the internal medicine department of the Medical Center from 2013 to 2015 and treated with a basal-bolus insulin protocol during their stay. Patients were included in the analysis if they were hospitalized for a minimum of 4\u00a0days, were 18\u00a0years of age or older, and had elevated inflammatory markers (C-reactive protein [CRP] \u226520) on admission. Exclusion criteria were pregnancy, type 1 diabetes and the presence of diabetic ketoacidosis. A total of 150 patients met the inclusion criteria: 61 who received glucocorticoid treatment during hospitalization  and 89 who did not  for each patient (in the preceding 3\u00a0months) was retrieved.Both patient groups were treated according to the hospital\u2019s standard protocol for treating of patients with hyperglycemia. The protocol was written by an endocrinologist, a clinical pharmacologist and a nurse responsible for diabetes treatment in our hospital. The treatment protocol was first implemented in July 2011 and has been used since then as the standard recommended care for diabetes in the hospital\u2019s internal medicine departments . If more than two subsequent glucose measurements were\u2009>\u2009180\u00a0mg/dl (10\u00a0mmol/l), correction doses of insulin were added at meal times. After the first 24\u00a0h of treatment, the insulin doses  were calculated. Basal insulin doses were adjusted if the 08.00\u00a0AM blood glucose level was outside the target range  for hyperglycemia as well as hypoglycemia  were started on a basal\u2013bolus insulin regimen. All oral hypoglycemic and non-insulin injectable diabetes medications were discontinued in patients eligible for insulin treatment. A total daily dose (TDD) of insulin was estimated as 0.5\u00a0units /kg/day for glucose levels of 180\u2013400\u00a0mg/dl (10\u201322.2\u00a0mmol/l) on admission. Patients treated with glucocorticoids or having a glucose level\u2009>\u2009400\u00a0mg/dl (22.2\u00a0mmol/l) were treated with 0.7\u00a0units/kg/day of insulin. The TDD was distributed as follows: 50% long-acting, defined as basal insulin, and 50% prandial fast, defined as bolus insulin. The long-acting insulins used in the study were insulin glargine (Lantus) and insulin detemir (Levemir) given in the evening. The short-acting insulins were glulisine (Apidra) and aspart (NovoRapid). We analyzed blood glucose levels by type of long-acting insulin in both patient groups (steroid-treated and control). If pre-meal glucose levels were\u2009>\u2009180\u00a0mg/dl(10\u00a0mmol/l), a correction factor insulin was given  during hospitalization: patients with three or more such readings were considered not controlled and the percentage of such patients in each group was recorded.We compared blood glucose levels of patients treated with glucocorticoids before their hospitalization to those of patients who were not treated with glucocorticoids and performed additional analysis of these two groups of patients. In the group of patients treated with glucocorticoids, we also compared blood glucose levels of patients treated with prednisone with those of patients treated with other steroids.p value <\u20090.05 was considered significant.We hypothesized that the difference in mean blood glucose between patients treated with steroids and those in the control group (patient with diabetes who were not treated with glucocorticoids) would be at least 20\u00a0mg/dl (1.1\u00a0mmol/l) (SD 40). A sample size of 64 patients in each study group was required for a power of 80% and alpha 5% (two sided test). The final sample included 61 patients treated with steroids and 89 patients in the control group. As a result the study power increased to 85%. Categorical variables were presented with frequencies and percent, and continuous variables were presented with a mean\u2009\u00b1\u2009standard deviation (SD) and median. The association between the glucocorticoid-treated and the control groups and categorical variables was examined by the Chi-square test or Fisher\u2019s exact test. Continuous variables were analyzed by T-test or Wilcoxon two sample tests. The difference in insulin dosage between the first and last day of hospitalization was calculated in each group and analyzed by the Wilcoxon signed-rank test. The statistical analyses were performed with the SAS 9.4 software. A p\u2009=\u20090.5), were the same in both groups. Treated patients received either prednisone (81%), methylprednisolone (5.9%), hydrocortisone (11%) or dexamethasone (2.2%).The demographic characteristics of the treated and untreated groups were similar, but a trend towards female sex predominance was found in the glucocorticoid group Table\u00a0. The meaThe mean daily glucocorticoid dose was 42.0\u2009\u00b1\u200929.4\u00a0mg of prednisone or its equivalent. The main reason for glucocorticoid treatment was pulmonary diseases. (Table\u00a0p\u2009<\u20090.001. The mean blood glucose level at 5\u00a0PM in the glucocorticoid-treated group was significantly higher than in the untreated group: 235.8\u2009\u00b1\u200961.9\u00a0mg/dl (13.1\u2009\u00b1\u20093.4\u00a0mmol/l) vs. 183.5\u2009\u00b1\u200954.2\u00a0mg/dl (10.2\u2009\u00b1\u20093.0\u00a0mmol/l), respectively, p\u2009<\u20090.001. Similarly, the mean blood glucose level at 8\u00a0PM was also significantly higher in the glucocorticoid-treated group compared with the untreated group: 251.2\u2009\u00b1\u200974.6\u00a0mg/dl (13.9\u2009\u00b1\u20094.1\u00a0mmol/l) vs. 198.3\u2009\u00b1\u200955 (11\u2009\u00b1\u20093.1), respectively, p\u2009<\u20090.001 (Table\u00a0p\u2009>\u20090.1). Comparing the daily insulin dose between the first and last day of hospitalization, a significantly higher daily insulin dose was recorded at the end of hospitalization only in the steroid treated group  vs. 196.5\u2009\u00b1\u200943.1\u00a0mg/dl (10.9\u00a0mmol/l\u2009\u00b1\u20092.4\u00a0mmol/l), respectively, p\u2009=\u20090.003).A significantly lower proportion of patients in the steroid treatment group were controlled with the basal-bolus treatment protocol, i.e. had less than three consecutive measurements of blood glucose >\u2009200\u00a0mg/dl (11.1\u00a0mmol/l) -CRP levels are higher in patients with T2DM with macrovascular complications . A recenApproximately two-thirds of steroid-treated patients had inadequate glycemic control compared with only one-third of the control group patients, according to the criteria arbitrarily defined for the present study. Specifically, the glucocorticoid-treated patients had higher blood glucose measurements in the afternoon and evening compared with the untreated patients. Insulin prandial doses were similar in the two groups. These findings are in agreement with those of Donihi et al.  who repoComparing the results obtained using the basal-bolus regimen with those of other reported treatment modalities suggest that the basal-bolus regimen is more effective for glycemic control. The regimen demonstrated better glycemic control and lower frequency of hospital complications compared to the sliding scale insulin regimen (SSI) for treatment of inpatients with diabetes, without increasing the number of severe hypoglycemic events , 19. GosIn a recent randomized parallel-arm study comparing two different protocols for glucocorticoid-treated patients, only 54% of patients in the basal-bolus group had blood glucose levels within the target range compared to 62% of patients in the NPH group . In our Considering that prednisone induced hyperglycemia takes place in the afternoon and evening, it seems reasonable to switch basal insulin glargine to insulin NPH and perform appropriate adjustments to short acting insulins. Nonetheless, several previous studies , 15, 20 Although a significant proportion of patients hospitalized in internal medicine department are treated with steroids other than from prednisone, with different glycemic profiles, our results showed that glycemic control was not influenced by the type of steroid administered. Therefore, we think it wiser to treat all of these patients with a uniform protocol. In addition, we need to take into account that a significant proportion of patients with diabetes are treated with basal insulin on a permanent basis. In Israel insulin NPH is not used as basal insulin, so it seemed unwise to change their home insulin to insulin NPH without achieving a clear benefit in diabetes control. Patients treated with glucocorticoids have a distinct pattern of blood glucose distribution during the day (with elevation of blood glucose in the latter part of the day). This is in accordance with Burt\u2019s study  which foWe conducted a retrospective real data study in order to evaluate the existing basal-bolus protocol in our institution and to assess its implementation. In addition to the inherent limitations due to its retrospective design, the main limitation of our study is in the failure of our patients with diabetes on glucocorticoid treatment to achieve adequate glycemic control on the basal-bolus insulin protocol. A high proportion of patients in both groups were undertreated, according to the existing protocol. We attribute this to the inadequate insulin dosing adjustments done by junior doctors and nurses responsible for the treatment of each specific patient; thus, a substantial proportion of patients did not receive an appropriate insulin dose, essentially due to excessive caution taken to avoid hypoglycemia and inability to make appropriate fine tuning, especially of prandial dosing of insulin. On the other hand, the strength of our study lies in the collecting of data about real-world patient experience thus assisting in filling the knowledge gap between clinical trials and actual clinical practice, by adding to the understanding of how best to incorporate new therapies into everyday clinical practice. We hope that our study will help to guide changes in protocols to achieve better glycemic control for inpatients receiving glucocorticoid treatment. Moreover, that this has the potential to improve the quality and delivery of medical care, reduce overall costs and improve outcomes.Treatment of hyperglycemia in inpatients with T2DM receiving glucocorticoids remains challenging. Raising the awareness of medical staff about the appropriate use of insulin protocols during hospitalization and increasing the doses of short acting insulin in the afternoon and evening in glucocorticoid-treated patients with diabetes could optimize the inherent benefits of the basal-bolus protocol."}
+{"text": "The use of noninsulin antihyperglycaemic drugs in the hospital setting has not yet been fully described. This observational study compared the efficacy and safety of the standard basal-bolus insulin regimen versus a dipeptidyl peptidase-4 inhibitor (linagliptin) plus basal insulin in medicine department inpatients in real-world clinical practice. We retrospectively enrolled non-critically ill patients with type 2 diabetes with mild to moderate hyperglycaemia and no injectable treatments at home who were treated with a hospital antihyperglycaemic regimen  between January 2016 and December 2017. Propensity score was used to match patients in both treatment groups and a comparative analysis was conducted to test the significance of differences between groups. After matched-pair analysis, 227 patients were included per group. No differences were shown between basal-bolus versus linagliptin-basal regimens for the mean daily blood glucose concentration after admission (standardized difference = 0.011), number of blood glucose readings between 100\u2013140 mg/dL (standardized difference = 0.017) and >200 mg/dL (standardized difference = 0.021), or treatment failures (standardized difference = 0.011). Patients on basal-bolus insulin received higher total insulin doses and a higher daily number of injections . Basal and supplemental rapid-acting insulin doses were similar . There were no differences in hospital stay length (standardized difference = 0.003), hypoglycaemic events (standardized difference = 0.018), or hospital complications (standardized difference = 0.010) between groups. This study shows that in real-world clinical practice, the linagliptin-basal insulin regimen was as effective and safe as the standard basal-bolus regimen in non-critical patients with type 2 diabetes with mild to moderate hyperglycaemia treated at home without injectable therapies. Patients with type 2 diabetes (T2D) are frequently admitted to the hospital in both medicine and surgery departments ,2,3, witClinical guidelines recommend treatment with multidose insulin regimens for non-critically ill hospitalized patients with T2D . The useThe use of noninsulin antihyperglycaemic drugs in the hospital setting has been limited due to the potential side effects or contraindications of most of them in hospitalized patients . The incOn the other hand, since 2013, various randomized trials in non-critically ill medical and surgical patients with T2D managed with dipeptidyl peptidase-4 inhibitors (DPP4i) alone or in combination with basal insulin have reported similar levels of hospital efficacy and safety as the basal-bolus regimen. Despite the limited number of patients in these pioneering randomized trials, the results obtained have provided evidence for the use of sitagliptin and saxagliptin as a therapeutic alternative for patients with T2D in non-intensive-care unit settings ,18,19. IWe carried out an observational, multicentre, real-world study of patients with T2D hospitalized in medicine departments in two university hospitals  and two General Medical Clinics  and Hospital Cenyt (Estepona)) in M\u00e1laga, Spain, between January 2016 and December 2017. Hospital data on patients were collected from each medical centre via medical records from the electronic medical record system and review of medical records; these data required manual review by investigators. We included non-critically ill hospitalized patients with history of T2D who were aged \u226518 years old who were treated with a hospital antihyperglycaemic regimen. In our current clinical practice, we have implemented 2 recommended local protocols for non-critically ill hospitalized patients with T2D: The basal-bolus insulin regimen (standard of care) and the DPP4i (linagliptin)-basal insulin regimen . 2. A total daily dose of 0.4 units per kg is used for patients who meet the criterion of admission BG concentrations between 150 and 200 mg/dL and 0.5 units per kg is used for patients who meet the criterion of admission BG concentrations of >200 mg/dL. Fifty percent of total daily dose is ordered as basal insulin at the same time each day (04:00 p.m.) and fifty percent is ordered as rapid-acting insulin divided into doses of 30%, 40% and 30% before breakfast, lunch and dinner, respectively.The basal-bolus regimen includes the administration of once-daily basal insulin and rapid-acting insulin analogues before meals. Patients start on a total daily dose of 0.3 units of insulin per kg when the following criteria are met: admission BG concentrations of <150 mg/dL, patients \u226570 years old, serum creatinine \u22652 mg/dL and/or body mass index \u226420 kg/m2. 0.2 units per kg is used for patients who meet the criterion of admission BG concentrations between 150 and 200 mg/dL and 0.25 units per kg is used for patients who meet the criterion of admission BG concentrations of >200 mg/dL. Basal insulin is ordered at the same time each day (04:00 p.m.). In addition, the linagliptin-basal insulin regimen is switched to basal-bolus regimen when there is treatment failure\u2014defined as two consecutive or a mean daily BG concentration of >240 mg/d. These patients start with a total daily insulin dose of 0.5 units per kg.The DPP4i-basal insulin regimen includes linagliptin in combination with a once-daily basal insulin injection. Only patients with mild to moderate hyperglycaemia\u2014defined as an admission glycated haemoglobin (HbA1c) level of <8%; admission BG concentration <240 mg/dL; and who are treated at home with diet, oral monotherapy or any combination of oral antidiabetic drugs\u2014can be managed with this regimen. Patients who meet the following criteria are excluded from DPP4i-basal insulin treatment and are instead treated with the basal-bolus regimen: patients who have an admission HbA1c of \u22658%; who have an admission BG concentration of \u2265240 mg/dL; who are treated at home with a glucagon-like peptide-1 receptor agonist or any insulin therapy; who have a history of acute diabetic complications; who have type 1 diabetes; who have hyperglycaemia without a known history of diabetes; who have concomitant hospital treatment with a systemic glucocorticoid; who are expected to require admission to an intensive care unit or have heart surgery; who have clinically-relevant liver disease or cirrhosis; who have renal function impairment, blood dyscrasias, or any disorders causing haemolysis or unstable red blood cells; who have gastrointestinal obstruction; who are pregnant; who are expected to be without oral intake; who have a history of pancreatitis episodes or active gallbladder disease; or who have had previous bariatric and other gastrointestinal surgeries that induce chronic malabsorption. Patients managed with the DPP4i-basal insulin regimen receive a single dose of 5 mg at the same time in the morning (09:00 a.m.) and 0.15 units of basal insulin per kg if they meet the following criteria: admission BG concentrations of <150 mg/dL, patients \u226570 years old, serum creatinine \u22652 mg/dL, and/or body mass index \u226420 kg/mOur optional protocol uses linagliptin  because it is the only DPP4i available in hospitals in our area. Basal insulin glargine  and rapid-acting insulin lispro  or aspart  are the insulin used in both protocols. During the hospitalization, the dose of insulin is modified when required according to our protocols. Basal insulin is increased by 20% if there is basal or fasting hyperglycaemia (>140 mg/dL) without overnight hypoglycaemia. Rapid-acting insulin is increased by 10\u201320% before breakfast if there is hyperglycaemia before lunch, increased before lunch if there is hyperglycaemia before dinner, and/or increased before dinner if there is hyperglycaemia before bedtime or after dinner. If there is hypoglycaemia (<70 mg/dL), the dose of insulin is reduced in the same proportion. The goal of therapy is to maintain fasting and pre-prandial glucose concentrations between 100 and 140 mg/dL. Supplemental rapid-acting insulin before meals and bedtime is used when required. The dose is calculated according to BG concentrations, total daily insulin units and patient bodyweight  . Fasting, pre-prandial and bedtime capillary BG concentrations are measured using a point-of-care glucose meter. Additionally, BG concentration is measured any time a patient experiences symptoms of hypoglycaemia or when is requested by the medical provider. Only patients who had previously given consent for their medical records to be used for medical research were included in this study. It was carried out in accordance with the Declaration of Helsinki. This study was approved by the Institutional Research Ethics Committee of M\u00e1laga.The primary outcome of the study was to compare glycaemic control, measured by mean daily BG concentrations, between both treatment regimens  during the hospitalization. Secondary outcomes were to analyse any differences in the proportion of hypoglycaemia , BG concentrations between 100 and 140 mg/dL, hyperglycaemic events (BG >200 mg/dL), treatment failures, total daily dose of insulin , insulin injections per day, length of hospital stay, complications and mortality. Propensity scores were used to match each patient who initiated basal-bolus regimen with a patient who initiated the DPP4i-basal regimen in a 1:1 manner, using a calliper of 0.2. A greedy matching algorithm was used to match patients in the basal-bolus regimen and DPP4i-basal regimen groups. The probability of starting a DPP4i-basal regimen  was estimated using a logistic regression model that took into account variables that could have affected treatment assignment or outcomes as independent variables . The adequacy of propensity matching was assessed through the standardized difference (SD) of post-matching hospitalized patients with type 2 diabetes characteristics. A significant imbalance was considered to be present if a more than a 10% standardized difference was present between the 2 groups after matching.t-test or the Mann-Whitney-Wilcoxon rank-sum test for continuous variables and Pearson\u2019s chi-squared test for categorical data. Values were considered to be statistically significant when p < 0.05. Multiple comparisons across different days on therapy were adjusted conservatively using Tukey\u2019s adjustment. Statistical analyses were performed using SPSS Statistics for Windows, version 15.0 and SAS for Windows, version 9.3. Baseline characteristics of patients in the both groups were analysed using descriptive statistics. Continuous variables were expressed as means \u00b1 standard deviation and categorical data as absolute value and percentage. In order to test the significance of differences between groups, a comparative analysis was conducted by carrying out the two-sample Student\u2019s n = 953) had mild to moderate glycaemic control and met our protocol\u2019s eligibility criteria for treatment with DPP4i-basal regimen. Among these patients, a total of 325 (34.1%) were treated with the DPP4i-basal regimen and 628 (65.9%) with the basal-bolus regimen. Finally, after a matched-pair analysis, 227 patients were included in each treatment group. A flow chart for patient inclusion for both regimens is shown in Of the 2632 hospitalized patients with T2D identified between January 2016 and December 2017, 36.2% , number of patients with mean BG reading of 100\u2013140 mg/dL  and >200 mg/dL  and number and day of treatment failure . Patients treated with the basal-bolus regimen received higher total , related to the use of prandial rapid-acting insulin, as well as a higher number of injections per day during the hospitalization . Basal and supplemental rapid-acting insulin doses were similar . Regarding hypoglycaemic events  and presence of complications (including those requiring admission to an intensive care unit and deaths), no significant differences were noted between groups . However, before matching, patients treated with linagliptin-basal regimen had higher mean daily BG concentration after admission, a mean BG reading of 100\u2013140 mg/dL and >200 mg/dL and a higher number of treatment failures. In addition, they needed higher total and rapid-acting insulin doses and a higher number of injections. On the other hand, the number of hypoglycaemic events and hospital complications were higher in patients treated with basal-bolus regimen. All these data are summarized in About a third of all patients on linagliptin-basal group had a treatment failure or a mean BG reading >200 mg/dL. The pre- and post-propensity matching clinical characteristics and glycaemic control of these patients are listed in This observational, multicentre, real-world study found that the linagliptin-basal insulin regimen was as effective and safe as the basal-bolus insulin regimen in non-critically ill medicine department inpatients with T2D who have mild to moderate hyperglycaemia and who are treated at home without injectable therapies. In addition, treatment with the linagliptin-basal insulin regimen was simpler than the standard basal-bolus regimen, with less daily total and prandial insulin doses and injections during the hospitalization compared to the basal-bolus insulin regimen. These findings are important because they represent real-world clinical practice data that support the efficacy and safety of linagliptin with a once-daily basal insulin injection in order to manage non-critically ill medicine department patients with T2D in the hospital. The glycaemic control and hospital complications in patients with T2D treated with linagliptin-basal insulin were similar to what was observed with basal-bolus insulin regimen. The results of this study support the increasing body of evidence on the use of DPP4i, alone or in combination with basal insulin, for the hospital management of non-critically ill patients with T2D ,18,19. FTreatment with multidose insulin regimens for non-intensive-care unit patients with T2D has been recommended as preferential in different clinical guidelines ,8. Use oThe use of oral antihyperglycaemic drugs for the management of hyperglycaemia in the hospital setting has traditionally been limited due to the lack of efficacy and safety data ,13,18. HIn addition, apart from the role of incretin-based therapies on stimulation of insulin secretion and reduction of glucagon secretion, the increase of postprandial incretins as glucagon-like peptide-1 could potentially affect glucose regulation through multiple effects, such as a delay in gastric emptying and a decrease in caloric intake likely secondary to centrally mediated signalling ,14,30. TTo our knowledge, Lina-Real-World Study is the first real-world clinical practice report addressing the efficacy and safety of the use of the linagliptin-basal insulin regimen in hospitalized patients with T2D with regards to glycaemic control, hyperglycaemic events, total dose of insulin and number of injections per day, treatment failures, length of hospital stay, presence of hypoglycaemia, complications and mortality. Our findings should be examined within the context of several potential limitations. Firstly, given the retrospective nature of our data, the possibility of residual, unmeasured confounding factors cannot be excluded, despite a robust propensity-matching analysis. Secondly, we used a local protocol based on our current clinical practice for managing hyperglycaemia in non-critically ill hospitalized patients with T2D. This protocol is not fully implemented in our area; only some hospitals and clinics have implemented it. Therefore, our data cannot be completely generalized, despite the fact that the cohort of patients analysed in this study would be a representable community-based sample with similar clinical characteristics to other studies\u2019 cohorts ,18,19. MIn conclusion, this real-world study shows similar improvements in glycaemic control and presence of complications in non-critically ill medicine department inpatients with T2D treated with the linagliptin-basal insulin regimen when compared to the standard basal-bolus insulin regimen. In addition, treatment with the linagliptin-basal insulin regimen is simpler than the standard basal-bolus regimen, with fewer insulin doses and injections during the hospitalization. The proposed therapeutic regimen is an effective, safe and adequate alternative to the standard basal-bolus regimen for hospitalized patients with T2D with mild to moderate glycaemic control treated without injectable therapies at home. Mounting evidence from randomized controlled trials and this real-world study indicate the efficacy and safety of different DPP4i in the management of hospitalized patients with T2D."}
+{"text": "Escherichia coli standard and field strains isolated from bovine teat skin.This study aimed to estimate the enumeration of total bacteria and coliform on teat skin from dairy cows and evaluate the efficacy of the natural rice gel containing 5% v/v lactic acid (NGL) against E. coli on teat skin was measured by 3M Petrifilm method. The minimum inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC) of lactic acid were evaluated for reference strain of E. coli ATCC 25922 and two field strains of E. coli. The natural teat sanitizer was formulated using 5% NGL with modified rice gel. In vitro antiseptic efficacy of 5% NGL was determined by time-kill kinetic assay. E. coli morphology after exposure with 5% NGL was examined under a scanning electron microscope (SEM).A total of 100 bacterial teat skin samples (25 cows) were collected from dairy cows in smallholder farm. The cows were housed in freestall barns. The colonization of total bacteria and 4 and 1.54\u00d7101 colony-forming units/ml, respectively. The MIC and MBC of lactic acid on the tested bacteria were 0.5% v/v. The natural teat dip was successfully prepared with minimum change in consistency after 1 year of storage at 4\u00b0C. The reduction rate of 5% NGL on E. coli ATCC 25922 and field strain showed 32.77% and 27.58%, respectively. An appearance under SEM of non-viable E. coli after being incubated with 5% NGL clearly showed atypical form and rough surface cell membrane.The total bacteria and coliform counts from bovine teat skin were 2.11\u00d710E. coli causing bovine mastitis in dairy cows.The rice gel containing 5% v/v lactic acid is a promising preparation as a natural teat antiseptic for reducing bacteria on teat skin. It was shown to be effective against  Escherichia coli are the etiological agents often isolated from clinical cases in India and China [E. coli resulting in a high risk of intramammary infection and greater usage of antibiotics with the possibility of developing antibiotic resistance [In the dairy industry, bovine mastitis is a critical problem of economic loss, milk loss and affects milk components. The prevalence of clinical and subclinical mastitis is 16-48% and 29-79%, respectively . Althougsistance .Streptococcus spp. [It is known that teat disinfection pre- and post-milking is an important tool to reduce the possibility of mastitis. Pre-milking teat disinfection will probably reduce the number of environmental pathogens, while post-milking teat disinfection is effective against contagious mastitis pathogens . Pre-milcus spp. ,15.2-hydroxypropanoic acid or lactic acid products have been shown to have antibacterial activities against Gram-positive and Gram-negative bacteria . These iE. coli were investigated by time-kill kinetic assay. The preparation of NGL affected bacterial cell structure was also observed using scanning electron microscopy (SEM).The objectives of this research were to explore the number of total bacteria and coliforms on teat skin from smallholder dairy farm in Chiang Mai Province, Thailand. The antibacterial activities of 5% natural gel lactic acid (NGL) against The study was approved by the Animal Ethics Committee of the Faculty of Veterinary Medicine, Chiang Mai University, Chiang Mai, Thailand .The study was conducted in a smallholder farm in Chiang Mai Province, Thailand, subregion of San Kamphaeng. The global positioning system of this subregion coordinates of 18\u00b044\u203243\u2033 N 99\u00b07\u203213\u2033 E. 25 Holstein Friesian cows were housed in freestall barn dairy farms and milked twice a day. Cows with good udder health were required for this study.A total of 100 teat skin samples (1 swab/teat of 25 cows) were collected from healthy dairy cows on July 2017-August 2017. Teat skin samples were collected after washing udder with clean water and dried before the milking process using a sterile cotton swab with phosphate-buffered saline (PBS) . All sam2) and multiply it by 20 to get the number of total bacteria per plate [For the 3M Petrifilm method, the samples were diluted by 10-fold dilution and 1 ml inoculated on 3M Petrifilm rapid aerobic count plate and 3M Petrifilm coliform count plate for counting total bacteria and coliform, respectively. The Petrifilms were incubated at 37\u00b0C for 24 h. After incubation, the number of bacterial colonies was counted with the guideline of 3M Petrifilm interpretation. Pink colonies were enumerated as total bacteria, while red and blue colonies with gas were counted as coliform. The limitation of 3M Petrifilm rapid aerobic count plate and coliform count plate is 300 and 150 colonies, respectively. If the bacteria are too many to count, the average number of bacteria can be made by counting in one square  plates containing 5% sheep blood, following the National Committee for Clinical Laboratory Standards recommendation. The bacterial colonies from the agar were inoculated into test tube containing Mueller-Hinton broth , and the turbidity was adjusted to 0.5 McFarland standard before use. Lactic acid was diluted into various concentrations of 10, 5, 1, 0.5, and 0.1% v/v in sterile distilled water in test tubes. A sterile 96-well plate containing equal volumes of bacterial suspension and various concentrations of lactic acid was incubated at 37\u00b0C for 24 h. Plates were observed for the absence or presence of turbidity. The minimum concentration of the lactic acid showing no turbidity was recorded as MIC value. The MBC value was determined by the drop plate technique on Mueller-Hinton agar  from the clear wells. The plates were incubated at 37\u00b0C overnight. The lowest lactic acid concentration that could completely inhibit bacterial growth is the MBC value. The MIC and MBC assays of each strain were run in duplicate.The bacterial strain of standard et al. [et al. [The nano preparation containing 5% v/v lactic acid was obtained from the Research Center of Pharmaceutical Nanotechnology, Chiang Mai University, Thailand. The chemical modification method of milled rice grains was performed based on the method previously described by Okonogi et al.  and Chot [et al. . Brieflyin vitro modified time-kill analysis was performed to find out the killing time of standard and two field isolates of E. coli. The bacterial suspension was adjusted to 0.5 McFarland standards. An exact amount of 0.8 ml of 5% NGL and 0.1 ml of bovine fetal serum was added into 0.1 ml of each bacterial suspension. The samples were 10-fold serial diluted in PBS. The mixture samples were taken at time intervals of 30 s and 1, 5, 15, 30, and 60 min and inoculated aseptically into approximately 20 ml of plate count agar  by pour plate technique at 37\u00b0C for 24 h. Then, viable bacteria were counted. The procedure was performed in duplicate (two independent experiments) and a graph of the log colony-forming units (CFU)/ml and time were plotted.An E. coli ATCC 25922 in normal saline solution (NSS) was incubated with 5% lactic acid at 37\u00b0C for 8 h, while the viable bacteria in NSS without lactic acid were used as a culture control. The treated cell was fixed using 2.5% glutaraldehyde in phosphate buffer (pH 7.4) at 4\u00b0C for 24 h. The specimen was dehydrated with graded ethanol and sputter coated with gold particles before examining the cell morphological appearance under SEM .All tested bacteria were normalized to CFU and then log 10 transformed before analysis. The data were analyzed using one-way analysis of variance; significant differences were assumed if probabilities <0.05. Statistical analysis was performed with R statistical software .4 and 1.54\u00d7101 CFU/ml, respectively. A higher number of total bacteria and coliform count were >2.50\u00d7104 and >5.10\u00d7103 CFU/ml, respectively, were reported from a previous study [This study was performed during 2 months in a smallholder farm in Chiang Mai Province, Thailand. The results indicated that the number of total bacteria and coliform count on teat skin showed 2.11\u00d710us study . The difus study . The bacus study . Good saus study ,27.E. coli ATCC 25922 and E. coli field strains toward lactic acid were 0.5%. The MIC and MBC against all E. coli was 0.5% v/v. Lactic acid MBC to MIC ratios of E.coli was 1. This value <4 was indicated as bactericidal activity [Shigella sp., Salmonella Enteritidis, and Listeria monocytogenes at 0.5% [Broth microdilution methods have been used in the determination of MIC and MBC values. The MIC and MBC values of activity . The pre at 0.5% ,30. The  at 0.5% . The dif at 0.5% .The rice gel containing 5% lactic acid was successfully prepared. The formulation composed of lactic acid, rice gel, sodium chloride, and water. The property of this preparation was homogeneous, slightly air bubble, easy flow, and clear of color . After 1E. coli ATCC 25922 and E. coli field strain. The killing effect of 5% NGL was shown in E. coli ATCC 25922 and E. coli field strain of 3 and 2 log CFU/ml (32.77% and 27.58%) after 60 min exposure time to 5% NGL, respectively. E. coli ATCC 25922 which had the most negative slope (k=\u22120.0378). The results indicated that the 5% NGL has antimicrobial ability against Gram-negative bacteria causing bovine mastitis. However, a low number of coliform were observed on teat skin (1.54\u00d7101 CFU/ml). The efficiency of 5% NGL is able to against E. coli on teat skin bacteria. From a previous study, lactic acid has been reported to reduce the population of E. coli [Time-kill analysis was performed to evaluate the killing time of  E. coli ,35. The E. coli in NSS without lactic acid as culture control is shown in E. coli incubated with 1% v/v of lactic acid is shown in E. coli underwent significant morphological changes from rod shape to atypical form and rough surface cell membrane. Most of the studies about the mechanism of antibacterial lactic acid on Gram-negative bacteria focused on their effects on cellular membranes [E. coli are driven by the proton-motive force. From the previous study, the effect of weak acid on rotational speed of E. coli motors with intracellular pH was investigated [E. coli is also found to be related to acidic pH. At acidic pH, the expression level of the flagellin-encoding gene was decreased as compared to neutral pH [An appearance under SEM of viable embranes ,36. The stigated . When thutral pH .E. coli. Our results demonstrate that the MIC and MBC of lactic acid for E. coli were 0.5%. The natural gel preparation did not change during storage at 4\u00b0C over a period of 1 year. The product formulation reduced the rate of E. coli, which means that it can play an important role in preventing new intramammary infection. It can be an alternative choice due to safe, biodegradable, and restrictions on the use of antibiotics.The results of the present study show that the rice gel containing 5% v/v of lactic acid possesses antibacterial activity against SO prepared the natural rice gel. RM designed the model and the computational framework. RC and RM performed the laboratory investigation. RC and KNL analyzed the data. SP and PS supported material equipment and teat skin collection. RC and RM drafted the manuscript. All authors read and approved the final manuscript."}
+{"text": "Malaria remains a significant public health challenge in regions of the world where it is endemic. An unprecedented decline in malaria incidences was recorded during the last decade due to the availability of effective control interventions, such as the deployment of artemisinin-based combination therapy and insecticide-treated nets. However, according to the World Health Organization, malaria is staging a comeback, in part due to the development of drug resistance. Therefore, there is an urgent need to discover new anti-malarial drugs. This article reviews the literature on natural products with antiplasmodial activity that was reported between 2010 and 2017.Relevant literature was sourced by searching the major scientific databases, including Web of Science, ScienceDirect, Scopus, SciFinder, Pubmed, and Google Scholar, using appropriate keyword combinations.Plasmodium, were reported in the period under review. Out of these, 39% were described as new natural products, and 29% of the compounds had IC50\u2009\u2264\u20093.0\u00a0\u00b5M against at least one strain of Plasmodium. Several of these compounds have the potential to be developed into viable anti-malarial drugs. Also, some of these compounds could play a role in malaria eradication by targeting gametocytes. However, the research into natural products with potential for blocking the transmission of malaria is still in its infancy stage and needs to be vigorously pursued.A total of 1524 compounds from 397 relevant references, assayed against at least one strain of  Plasmodium falciparum malaria, from a prevalence of 40% in 1910\u20131929 to about 24% in 2010\u20132015 . P. PDrimys69) Fig.\u00a0, which wL6 cells .Fig.\u00a025S171), produced by the soil fungus Penicillium copticola PSURSPG138, inhibited K1 parasites but was also cytotoxic against human oral epidermoid carcinoma (KB) and Vero cells . Th. ThBuxus250\u2013254) . The couinactive . BetulonL6 cells .Fig.\u00a033SEntandrophragma congoense (Meliaceae) bark, a plant used in Cameroonian traditional medicine against malaria. They isolated the apotirucallane triterpenoids prototiamins A\u2013G (256\u2013262) and the known 263 as the major constituents, and gladoral A (264) was obtained as a minor metabolite . Triterpenoid 256, with a sub-micromolar IC50 value, was the most selective against the parasite . T. TEntandparasite , 161. Co=\u200940\u00a0\u00b5M) . The eth4\u00a0\u00b5g/mL) . A syner quinine .Fig.\u00a034SMomordica balsamina (Cucurbitaceae) afforded the new curcurbitacin balsaminol F (267), the glycoside balsaminoside B (268), and the known kuguaglycoside A (269)  more active than the parent compound without cytotoxicity against MCF-7 cells. However, the activity was lost with the corresponding tribenzoyl ester derivative of balsaminol F stigmasterol (292) with antiplasmodial activity against the D6 and W2 strains. Crucially, the aglycone, which was isolated from the chloroform fraction, was inactive, suggesting that the two sugars potentiate antiplasmodial activity . T. TArtoca01\u00a0\u00b5g/mL . The premponents . The ant strains , 197. A 19) Fig.\u00a0. It was .4\u00a0\u00b5g/mL . The preactivity . Furtherectivity . Anotherat 40\u00a0\u00b5M .Fig.\u00a041SHumulus lupulus, Cannabaceae) interfere with haem degradation in P. falciparum, suggesting a possible mechanism of action -4\u03b2-dihydro-2(3H)-pyranone (332) exhibited selective antiplasmodial activity. Compound 331 inhibited 3D7 and K1 P. falciparum, while 332 was active only against the 3D7 strain. Both compounds also inhibited \u03b2-haematin formation similar to chloroquine and H2O2-mediated heme degradation, suggesting a possible mechanism of action . T. TO-rhamextracts . Howevernds Fig.\u00a0 of whichf action . The knoL6 cells . (\u2212)-EpifHsp70-z . A previemisinin . Howeverherapies .Fig.\u00a042SAngelica purpuraefolia (Apiaceae) led to the isolation of the pyranocoumarins 3\u2032-decanoyl-cis-khellactone (335) and 4\u2032-decanoyl-cis-khellactone (336) as the main antiplasmodial compounds , with an additional oxygen atom in the lactone ring, was also isolated as the main antiplasmodial constituent from a Carpesium divaricatum (Asteraceae) extract anthraquinones, urdamycinone E (393) and G (394), and the known urdamycin E (395). Sub-micromolar antiplasmodial activity was obtained for these compounds against the K1 strain. However, the compounds also showed antiproliferative activity against cancerous KB, MCF-7, and NCI-H187 cells, but were less cytotoxic against non-cancerous Vero cells [396\u2013399) from an active root extract of Rennellia elliptica (Rubiaceae) was demonstrated [An antiplasmodial screening of 6900 extracts identified 6\u00a0\u00b5g/mL) . Bioassales Fig.\u00a0. The com80 cells . InhibitKB cells . Aloe-emytotoxic . The cru6 strain . The leaarasites . Antiplaro cells . The antnstrated .Fig.\u00a053SPentas longiflora (Rubiaceae), which is used in Kenyan folk medicine to treat malaria, was active against P. falciparum [50\u2009=\u20090.93 and 0.99\u00a0\u00b5g/mL, respectively). Phytochemical investigation yielded the pyranonaphthoquinones pentalongin (400) and psychorubrin (401)  stem bark showed activity against the W2 and K1 strains . Two furanonaphthoquinones (402 and 403) were isolated from the extract and inhibited the W2 and K1 parasites. However, 402 and 403 were also cytotoxic against L6 cells [404) is the major phytochemical in the extracts of several Plumbago species (Plumbaginaceae), including Plumbago indica and Plumbago zeylanica, with anti-malarial activity [404) inhibited 3D7 and K1 P. falciparum strains and suppressed parasitaemia in P. berghei-infected mice by 41% after treatment (25\u00a0mg/kg body weight). Acute and subacute toxicity was observed in mice after oral administration of 404 above 100 and 25\u00a0mg/kg body weight, respectively. The relatively poor in vivo anti-malarial activity of 404 might be due to low bioavailability in living cells [The leaf extract of lciparum . Antipla01) Fig.\u00a0 with antL6 cells . Plumbagactivity , 249. Plng cells .Fig.\u00a054S405), 14-O-acetylcercosporin (406), and di-O-acetylcercosporin (407)  Fig.\u00a0 were isoactivity , 252.Xestospongia testudinaria produced a halenaquinone-type polyketide 3-ketoadociaquinone A (408) . Two benzoquinone polyketides, geldanamycin (409) and 17-demethoxyreblastatin (410), were isolated from the extract and showed antiplasmodial activity against the K1 strain. The quinone moiety in 409 appears to contribute to the cytotoxicity since the structural analogue 410 with a phenol group instead of the quinone was more selective against the parasite [411) and C (412), were isolated from the ethyl acetate extract of the Thailand soil fungus Chaetomium longirostre. Both compounds inhibited K1 P. falciparum but were also cytotoxic against cancerous KB cells. Compound 411 was also cytotoxic against NCIH-187 and MCF-7 cancer cells, whereas 412 was inactive, indicating selective cytotoxicity [411 in the configuration of the isochromeno-lactone ring junction and a double bond in the butyrolactone ring, was inactive. Likewise, longirostrerone B, which lacks the lactone moiety, was less active. These observations suggest that the nature of the six-membered ring attached to isochromene, the lactone ring, and the configuration of the compounds play a role in the activity, and further modifications might produce analogues that are more selective.The Solomon Island-sourced marine sponge 08) Fig.\u00a0, which scompound . The cruparasite . Two newtoxicity . Longiro413\u2013415) were isolated from the ethyl acetate leaf extract of Poupartia borbonica (Anacardiaceae) by bioassay-guided fractionation [P. falciparum with IC50\u2009=\u20093.28\u00a0\u00b5g/mL. The compounds were active against W2 and 3D7 parasites but were also cytotoxic against HeLa and WI38 cells. No haemolytic activity was observed with the compounds, indicating that the antiplasmodial activity was due to direct action on the parasites. Treatment of P. berghei-infected mice with 413 (15\u00a0mg/kg/day for 4 days) led to 69.5% parasite suppression, but it was also toxic to the mice. A toxicity assay of 413 using the zebrafish embryo model indicated that the compound might be cardiotoxic [Three other new cyclohexenones, poupartones A\u2013C   constituted 60% of the mixture. The compounds were identified as homologs of \u03b2-galactopyranosylceramide, containing a 2-amino-1,3,4-trihydroxy-octadecene sphingoid base. Moreover, the fatty acid methyl ester of the major compound (416) was identified as 2-hydroxytetracosanoic acid. The mixture exhibited antiplasmodial activity against the FcB1 strain (IC50\u2009=\u20090.53\u00a0\u00b5M) and was not cytotoxic against a panel of cancerous cells. The activity also appeared to be parasite selective because Leishmania donovani and Trypanosoma brucei were not susceptible to the mixture [Diaporthe miriciae produced epoxycytochalasin H (419) with potent antiplasmodial activity against D6 and W2 parasite strains. The compound was not cytotoxic against Vero cells, indicating that the toxicity to the parasite is selective [The Senegalese marine sponge 18) Fig.\u00a0. The mix mixture . The endelective .Callophycus serratus and had antiplasmodial activity [Callophycus serratus afforded bromophycolides R (420), S (421), and U (422) , which lacked the bromine atoms and a cyclohexane ring, showed that these features are not essential but improve the potency [423), a 40-membered ring polyhydroxy macrolide with 10 stereocentres and a rare tert-butyl terminus, was isolated from marine cyanobacterium, Okeania hirsuta (PAB-19MAY11-4) [tert-butyl group near the lactone ester in the bastimolide structure protects the lactone ring against hydrolysis. The compound inhibited multidrug-resistant strains TM90-C2A, TM90-C2A, TM91-C235, and W2 with nanomolar IC50 values. Surprisingly, the chloroquine-sensitive HB3 strain was less susceptible to 423 (IC50 in \u00b5M). Additionally, the semi-synthetic (2E)-isomer was more active against the HB3 strain than the (2Z) natural product. Further investigation of Okeania hirsuta yielded bastimolide B, in which lactonization produced a 24-membered ring and a highly oxidized side chain that terminated in a tert-butyl group. Bastimolide B was not as active as 423, suggesting that the lactone ring size affects the potency [Pachastrissa nux exhibited antiplasmodial activity against K1 P. falciparum (IC50\u2009=\u20090.7\u00a0\u00b5g/mL). The 25-membered ring trisoxazole macrolides kabiramides B (424), D (425), and J\u2013L (426\u2013428) , azalomycin B (430), and 11,11\u2032-O-dimethylelaiophylin (431) as active metabolite against the K1 strain, but these compounds were also cytotoxic against cancerous and Vero cells [Streptomyces sp. BCC72023, isolated from rice stems, produced the macrolide efomycin G (432) and 29-O-methylabierixin (433), with activity against K1 P. falciparum [The bromophycolides are diterpene-benzoate macrolides that were isolated from the Fijian marine red alga\u00a0activity . A reinv22) Fig.\u00a0 with ant potency , 261. So potency . BastimoMAY11-4) . The pla potency , 264. Th28) Fig.\u00a0 were subro cells . Streptolciparum .Fig.\u00a056SPaecilomyces sp. SC0924 produced the new 14-membered ring \u03b2-resorcylic acid lactones , E (435), F (436), together with aigilomycin B (437) and aigialomycin F (438), all with potent antiplasmodial activity. Paecilomycin E (435) and aigialomycin F (438) showed sub-micromolar inhibition of 3D7 parasites, with all the compounds more potent against the 3D7 than the Dd2 strain, suggesting resistance by the Dd2 strain. The compounds were not cytotoxic against Vero cells at 50\u00a0\u00b5M [Cochliobolus lunatus in trace quantities [439 inhibited P. falciparum (SI\u2009=\u2009184) selectively, whereas the hydroxylated parent was inactive. Also, cochliomycin C, the chlorinated derivative of paecilomycin F (436), was inactive. SAR deductions from the RAL structures indicate that the presence of acetyl and acetonide groups on the lactone ring hydroxy groups improve activity, with the acetonide derivative having a superior activity. A chlorine atom on the aromatic C-5 decreases activity, while the C-2 phenolic group is important for selective activity. The presence of an enone moiety in the lactone macrocycle contributes to cytotoxicity, whereas the configuration of the 1,2,3-triol or 1,2-diol stereocentres had a negligible effect on the activity [The mycelial culture of the filamentous fungus, at 50\u00a0\u00b5M . Cochlioantities , 270. Twactivity .Fig.\u00a057S440\u2013442) , a glyco-hexadepsipeptide with a polyketide residue, was isolated from an Australian Streptomyces sp. CMBM0244 and had a potent nanomolar antiplasmodial activity. It was equally active against the 3D7 and Dd2 strains and only slightly cytotoxic against human fibroblast cells (SI\u2009>\u200920), suggesting selectivity against the parasites [444) and B (445), were isolated from Indonesian soil Streptomyces sp. RK85-270. The octaminomycin amino acid sequence was established as cyclo-. Furthermore, the only structural difference is the presence of propionyl and acetyl chains on the threonine nitrogen in 444 and 445, respectively. Both compounds were active against 3D7, Dd2, and K1 strains, and were not cytotoxic at 30\u00a0\u00b5M [446), was obtained from Mentha longifolia (Lamiaceae) root endophytic fungus, Fusarium sp. from Saudi Arabia. The amino acid sequence was established as cyclo-(Ala-Ala-Thr-Ile-Tyr-Glu). Compound 446 exhibited antiplasmodial activity against D6 P. falciparum and was moderately cytotoxic against cancerous L5178Y and PC12 cells [The cyclodepsipeptides\u00a0lagunamides A\u2013C (42) Fig.\u00a0 were obtus cells , 273. Tharasites . Two othat 30\u00a0\u00b5M . A new c12 cells .Fig.\u00a058S447) . The peptides act in synergy with artemisinin and kill the parasite by targeting the \u03b25 subunit of Plasmodium proteasome [Streptomyces bangulaensis, produced the antiplasmodial tetrapeptide, actinoramide A (449). The compound displayed sub-micromolar antiplasmodial activity against P. falciparum Dd2, HB3, 7G8, GB4, and cp250 strains, and no cytotoxicity. The 25-epimer of 449, 25-epi-actinoramide A was about 20-fold less active, suggesting an influence of the configuration on activity. Actinoramide F, which is structurally similar to 449 but has a 5-amino-5,6-dihydrouracil terminus instead of the cyclic 2-amino-4-ureidobutanoic acid of 449, was inactive. This suggests that the terminal substructure of the actinoramides is crucial for antiplasmodial activity [450), was isolated from the rice fungus pathogen, Fusarium fujikuroi, and the amino acid composition was established to be l-tryptophan, d-pipecolic acid, l-phenylalanine, and l-2-aminooctanedioic acid [Carmaphycin B (47) Fig.\u00a0, with anoteasome . A marinactivity . A new aoic acid .Fig.\u00a059S451) , inhibited the K1 strain of P. falciparum without cytotoxicity to MRC-5 cells at 64\u00a0\u00b5M [Cyclopeptide alkaloids are 13, 14, or 15-membered ring polyamides with a styrylamine unit, a \u03b2-hydroxy amino acid and other common amino acid forming the macrocycle. The macrocyclic polyamide has an attached side chain, which could be basic or neutral. Spinanine B (51) Fig.\u00a0, a cycloat 64\u00a0\u00b5M . Evaluatat 64\u00a0\u00b5M , 282.Salinospora sp., produced a new class of antiplasmodial scaffold based on a bicyclic phosphotriester core, substituted with alkyl chains. Among the new compounds, salinipostins A-D, F-G, and I (452\u2013458)  and vinyl carbon (R1) led to increased activity while branching of the R1 alkyl causes a slight reduction in activity. The most active 452 had sub-micromolar IC50 values and stage-specific activity on early stage parasite ring forms, but parasite trophozoites were less susceptible. The compound did not affect parasite schizonts, indicating that it acts by disrupting the processes required for the establishment or growth of intracellular parasites. Salinispostin A (452) did not inhibit haemozoin formation but appears to cause cellular disorganization and disintegration of internal structures. Moreover, experiments for resistance selection under three different conditions failed to identify mutant resistant strains, suggesting that the compound may be less susceptible to resistance development. These compounds represent a new class of antiplasmodial agents, and further biological studies on them are warranted [A marine actinobacterium, 58) Fig.\u00a0 potentlyarranted .Fig.\u00a060SPlasmodium parasite biology following the sequencing of its genome has led to the identification of novel potential drug targets that are thought to be essential for parasite survival [Understanding the mechanism of action of bioactive molecules facilitates the development of leads into improved therapeutic compounds and aids in the understanding of resistance evolution. Natural products have proven to be a prolific source of drug leads, but limited knowledge about the mechanism of action often impedes further development . In ordesurvival .2+ metabolism, glyoxalase detoxification system, and protein folding pathways have been inhibited by natural products. Reports on natural products as inhibitors of potential and proven antiplasmodial targets together with the mechanism of action are summarized in Table\u00a0Crucial enzymes and macromolecules in the parasite fatty acid, haemoglobin, protein, CaZanthoxylum heitzii, Vernonia amygdalina, Artemisia afra, Trichilia emetica, Turraea floribunda, and Leonotis leonurus have shown gametocidal activity [\u00ae, an azadirachtin-enriched neem extract, has also demonstrated potent transmission-blocking activity ex vivo and in vivo [Malaria chemotherapy has focused mainly on controlling the disease. Thus, most anti-malarial drugs act on asexual blood stage parasites that are responsible for the clinical manifestations of the disease. However, there has been a shift in focus towards malaria elimination strategies. In this regard, compounds with activity against asymptomatic gametocytes and liver stage parasites, including hypnozoites (prophylaxis), are crucial to the eradication agenda. As yet, artesunate, artemether, methylene blue, and primaquine are the known gametocidal agents, with primaquine being the only approved prophylactic and gametocytocidal drug . Some naactivity , 311. Th in vivo , 313. ThThe present review covered the antiplasmodial natural products reported between 2010 and 2017. A breakdown of the statistics of compounds and the biological source reported per year is given in Fig.\u00a050\u2009\u2264\u20093.0\u00a0\u00b5M against at least one strain of asexual blood-stage P. falciparum. Some of these compounds showed potent selective activity against parasites. However, others were equally cytotoxic against cancerous and/or noncancerous cells. Notwithstanding the cytotoxicity, we have considered these compounds to be promising anti-malarial hits of which the cytotoxicity could be mitigated by medicinal chemistry approaches, as was demonstrated, for example, with ferruginol (230) and carmaphycin B (447) [A total of 447 compounds derived from plant, microrganisms, and marine organisms were found to have IC B (447) , 277. Al B (447) , 13. ThiMany of the plants were investigated based on the ethnobotanical history of use against malaria, while the non-plant materials were mostly investigated because of their chemical profiles. This underscores the need to employ the dual approach of ethnobotanical reputation and chemical profiling in the search for anti-malarial natural products. Although fewer marine and microorganisms have been screened for antiplasmodial compounds compared to plants, the diverse nature of metabolites produced by these alternative sources presents a compelling case for intensive exploration. Only a small number of in vivo studies to validate the in vitro efficacy of these compounds have been conducted. This is not surprising considering that natural products are usually isolated in small amounts, which is barely sufficient for in vitro testing. Nevertheless, the need for in vivo confirmation of observed in vitro potency could not be overemphasized. Therefore, efficient total synthesis of the most promising compounds identified in this review should be prioritized.Plasmodium parasite transmission from an infected host to uninfected mosquitoes should be blocked to curtail the spread of malaria. Compounds with activity against sexual and liver stage parasites are therefore crucial to the malaria eradication agenda. Sadly, only a few chemical compounds have a proven ability to kill liver and sexual stage parasites. In spite of the fruitful relationship between malaria chemotherapy and natural products, only a few natural products have been evaluated for activity against the parasite gametocytes and liver forms. As this review has shown, the few investigated natural products have shown promise. Therefore, the exploration of natural products in this regard cannot be overemphasized. The compounds covered in this review will be a good starting point, since natural products, unlike the synthetic counterparts, might have multi-stage activity. Priority should be given to compounds of which the mode of action does not involve the inhibition of haemozoin formation since stage V gametes, which are the transmissible form of the parasite, do not digest haemoglobin. Standardized assay methods for evaluating late stage gametocidal and liver stage activities have been developed that will aid in the high-throughput screening of natural products [It is now accepted that the products , 320.Additional file 1. Antiplasmodial activity reported (2010\u20132017) for all natural products, irrespective of level of activity ."}
+{"text": "Patients positive for anti-glutamic acid decarboxylase 65 (GAD65) antibodies have attracted increasing attention. Their clinical manifestations are highly heterogeneous and can be comorbid with tumors. Currently, there is no consensus on the therapeutic regimen for anti-GAD65-associated neurological diseases due to the clinical complexity, rarity and sporadic distribution. We reported six anti-GAD65 autoimmune encephalitis (AE) patients who received intravenous methylprednisolone (IVMP) or immunoglobulin (IVIG) or both. Then, we evaluated the therapeutic effect of both by summarizing results in previous anti-GAD65 AE patients from 70 published references.Our six patients all achieved clinical improvements in the short term. Unfortunately, there was no significant difference between IVMP and IVIG in terms of therapeutic response according to the previous references, and the effectiveness of IVMP and IVIG was 45.56% and 36.71%, respectively. We further divided the patients into different subgroups according to their prominent clinical manifestations. The response rates of IVMP and IVIG were 42.65% and 32.69%, respectively, in epilepsy patients; 60.00% and 77.78%, respectively, in patients with stiff-person syndrome; and 28.57% and 55.56%, respectively, in cerebellar ataxia patients. Among 29 anti-GAD65 AE patients with tumors, the response rates of IVMP and IVIG were 29.41% and 42.11%, respectively. There was no significant difference in effectiveness between the two regimens among the different subgroups.Except for stiff-person syndrome, we found that this kind of AE generally has a poor response to IVMP or IVIG. Larger prospective studies enrolling large numbers of patients are required to identify the optimal therapeutic strategy in the future. Glutamic acid decarboxylase 65 (GAD65), an intracellular antigen that is highly expressed in pancreatic \u03b2-cells and the presynaptic terminal of inhibitory neurons, is becoming increasingly important both clinically and experimentally \u20134. PatieIn this study, we retrospectively analyzed the clinical characteristics of six anti-GAD65 AE patients in our tertiary epilepsy center who presented with different clinical injury sites and severity. To date, no study has indicated which treatment is better for anti-GAD65 AE patients when comparing intravenous methylprednisolone (IVMP) and intravenous immunoglobulin (IVIG). Thus, we analyzed the chosen treatments for all anti-GAD65 AE patients by searching PubMed, and we compared the efficacy of IVMP with that of IVIG. The purpose of the study is to raise the awareness of this disease and guide clinical therapies.Six subjects from Beijing Tiantan Hospital gave written informed consent for participation and written consent to permit the publication of clinical details. The study was approved by the Medical Ethics Committee of Beijing Tiantan Hospital, Capital Medical University, and was carried out in accordance with the Declaration of Helsinki.We conducted a search on PubMed for articles up to April 2019 and used the title/abstract search terms \u201cencephalitis\u201d and \u201cGAD\u201d or \u201cglutamic acid decarboxylase\u201d. A total of 133 references were retrieved. The criteria for enrollment were as follows: patients with anti-GAD65 Abs received a therapy of IVMP or IVIG or a combination of both, and we were able to obtain the response to the treatment. We were not particularly concerned about whether patients used antiepileptic drugs (AEDs) because the effect of AEDs was very limited , 13. IVMWe eliminated many references for the following reasons. First, we excluded studies for which it was difficult to assess the efficacy of methylprednisolone, immunoglobulin or a combination of methylprednisolone and immunoglobulin because patients received immunosuppressive therapy in addition to IVMP or IVIG meanwhile, such as plasma exchange \u201316, immuThe 70 references included in the statistics are listed in Additional file We counted the number of patients who responded to IVMP or IVIG or a combination of both in the literature. At the same time, we also counted the number of patients who did not respond to IVMP, IVIG or a combination of both. The clinical treatment for anti-GAD65 AE patients was diverse and complex, and most patients underwent a variety of treatment options. In many cases, patients changed into the second treatment plan since the first was ineffective or because of illness relapse; therefore, the same patient was likely to be assigned two statistical data points. For example, if one patient made no response to IVMP while responding to IVIG, we counted once that IVIG was effective and counted once that IVMP was ineffective. If one patient responded to combination therapy , we counted that combination therapy was effective once instead of calculating once separately that both IVMP and IVIG were effective. If one patient was unresponsive to combination therapy, we counted once separately that both IVMP and IVIG were ineffective. We completely followed the information obtained in the literature and objectively collected data according to the original authors\u2019 standpoints.P\u2009<\u20090.05 was considered to be statistically significant.Statistical analyses were performed with SPSS 22.0 software . Differences were evaluated by the Chi squared test or Fisher\u2019s exact test. Six illustrative anti-GAD65 AE cases from our center are comparatively described in Table\u00a0A 35-year-old female reported sudden onset of nocturnal generalized tonic\u2013clonic seizures (GTCSs) 3\u00a0months ago; these GTCSs lasted approximately 1\u00a0min, with 5 episodes in total. In addition, she also had an inexplicable sense of fear, several times per day. She received adequate doses of levetiracetam, and the effect was not obvious. During the past 2\u00a0months, she experienced 3\u20134 conscious nauseous sensations per week. Initial neurological examination revealed only a decrease in calculation capacity. The Montreal Cognitive Assessment (MoCA) score was 22 (primary school degree) on a scale ranging from 0 to 30. Routine examinations of blood and CSF were normal. Comprehensive onconeural and neuronal surface Abs screening in the serum and CSF, detected by the cell-based transfection immunofluorescence assay method, showed only positive anti-GAD65 Abs. Brain magnetic resonance imaging (MRI) showed abnormal signals of the right medial temporal lobe . Routine blood examinations suggested that he had multiple kinds of autoimmune Abs simultaneously , levetiracetam (250\u00a0mg/q12h), clonazepam (1\u00a0mg/q12h) and carbamazepine (200\u00a0mg/q12h) for long-term maintenance therapy. The above symptoms improved significantly. One month later, he received another 5-day course of IVIG for consolidation therapy. Three months later, the SPS had almost disappeared, the ataxia improved, he could walk by himself, and the number of seizures was reduced by more than 50%.Seventy references were identified, and the included patients were all diagnosed with anti-GAD65 AE. In Table\u00a0We further divided patients according to their typical clinical manifestations. In Table\u00a0As shown in Table\u00a0It should be mentioned that we cannot compare the efficiency of combination therapy with monotherapy because of their statistical overlaps.Screening for anti-GAD65 Abs has been widely reported among type 1 diabetic patients. However, increased awareness of neurologists in considering patients with anti-GAD65 Abs remains challenging. Among adult epilepsy patients with unknown etiology, three recent studies found that 1.7% 7/416) , 16.1%  and 72.73% (8/11), respectively ; however, when calculated together, the improvement rates of IVMP and IVIG slumped to 29.41% (5/17) and 42.11% (8/19), respectively. Interestingly, a good outcome may be predicted for patients who had coexisting thymoma; only one out of 8 did not respond to immunotherapy, but the symptoms could be relieved by benzodiazepines or baclofen . In contThere was no denying that some anti-GAD65 patients completely recovered without immunotherapy; however, they were reported just in scattered case reports , 48, 49.Our study also had some limitations. First, the retrospective analysis of the literature had the following inherent limitations: the diverse vocabularies could have led to a certain degree of misinterpretation; the description of clinical features, investigations, and outcomes also differed from one article to another. Second, we abandoned some related literature because we could not obtain the prognosis after immunotherapy, leading to statistical bias. Third, different hospitals had their own experience in choosing IVMP, IVIG or others, and the absence of IVMP or IVIG therapy did not mean that the patient was insensitive to it. Fourth, we excluded many patients who received combination therapy (IVMP/IVIG and others) because we could not judge which drug had an effect. Fifth, there was a certain ineluctable subjectivity in our judgment of reactivity to therapy. Sixth, there were significant differences in the follow-up time of patients, and we focused only on whether the clinical symptoms were improved after immunotherapy, leading to the inability to judge the effective time of IVIG and IVMP treatment. Although many patients were initially sensitive to immunotherapy, they will relapse inevitably after a period of time , 50\u201354, Here, we reported six anti-GAD65 AE patients and found that they all achieved clinical improvements in a short period of time after immunotherapy. However, by summarizing the therapeutic effects of previous patients, we have confirmed that this AE usually has a poor response to IVMP or IVIG, except anti-GAD65-associated SPS. Larger prospective studies enrolling large numbers of patients are required to identify the optimal therapeutic strategy.Additional file 1. References included in the statistics. We conducted a search on PubMed for articles up to April 2019 and finally included 70 references. The article type, clinical characteristics of each patient, and whether the patient received combined therapy are noted.Additional file 2: Tabe S1. Clinical data of 29 patients who had coexisting tumors in previous references. The clinical information, concomitant tumor, tumor therapy and response to immunotherapy of each patient are listed."}
+{"text": "The purpose of this paper is to offer a new framework for understanding action, optimization, and choice when applied to economic theory more generally. By drawing upon the concept known as the variational free energy principle, the paper will explore how this principle can be used to temper rational choice theory by re-formulating how agents optimize. The approach will result in agent behavior that encompasses a wide range of so-called cognitive biases, as seen in the scientific literature of behavioral economics, but instead of using these biases as further indications of market inefficiencies or market failures, the paper will likewise attempt to show the limits to which these biases can inform or critique standard economic theory. The paper therefore offers up a \u201cmiddle of the road\u201d approach, in which the neoclassical agent is not quite as \u201crational\u201d as rational choice theory assumes, but at the same time, not quite as irrational as behavioral economics would often have us believe. A number within n\u211d can then be thought of as a point within a space defined by set theory and expressed as a particular state or outcome belonging to a set of states or outcomes that is a superset of various sets of acts.When utility is operationalized, then utility can be expressed in accordance with measure-theory, given that any real number exists within the space In economics, the underlying axioms  are typix1,x2) > and < and\u223c, with respect to a class of outcomes or a basket of goods.A preference ordering is complete if and only if, for any two outcomes X and Y, an individual prefers X to Y, prefers Y to X, or is indifferent between the two. Formally this can be represented as  > and > then > .For any three outcomes, X, Y, and Z, if X is preferred to Y, and Y is preferred to Z, then X must be preferred to Z as well. x1,x2)\u2265, meaning that any outcome is at least as good as an identical outcome, or any good is at least as good itself.Z is weakly preferred to pY + (1\u2212p)Z. This means that preferences over outcomes cannot be influenced by factors that are not relevant to the initial preference order. Suppose one is faced with the choice of two lotteries, (p)[q(V) + (1\u2212q)(U)] + (1\u2212p)(Z) and (p)(Y) + (1\u2212p)(Z). Independence says that, if the first lottery is preferred over the second, then what determines this preference cannot have anything to do with the commonalities (p) and (1\u2212p)(Z). The choice is thus solely a choice between q(V) + (1\u2212q)(U) and Y. Embedding a direct lottery in a compound lottery, without changing the initial conditions, should therefore have no relevance in the valuation of the respective lotteries.Let p \u2208  such that one is indifferent between the lottery pX + (1\u2212p)Z and the certainty of Y. Continuity thus states that a unique probability distribution can always be found, such that one is indifferent between the probability of receiving the most preferable outcome, plus the probability of receiving the least preferable outcome, and the certainty of receiving the middle outcome  or action .The variational free energy principle is herein used, in order to provide a first principle account of how systems must behave given a very high degree of complexity. It does this by suggesting a variational approach to optimal behavior that absorbs both Bayesian decision theory  and optiboundedly rationality . Here, the first task will be to resolve uncertainty about the consequences of subsequent actions, which means that action cannot be a function of the states in the world but must be a function of beliefs about states in the world. This generates an intensity measure, or more precisely an energy functional, here the free energy function F of a function Q which describes an approximate posterior distribution indicating beliefs given a policy \u03c0. We are not just trying to optimize the next best action but the best sequences of actions in line with a path integral, or a time average \u2211\u03c4, of an energy functional of beliefs about future world states s\u03c4. This is basically the same as invoking Hamilton\u2019s principle of least action  when framing policies in terms of good or bad behavior as conceptualized by the economist, read, rational, or irrational .The above equation says that the best way to move from one point another, with beliefs about world states given a particular policy, is to minimize variational free energy at each step. Hamilton\u2019s principle of least action says that the best path between two points in space\u2013time given a set of configurations (Lagrangian) is the path where action is stationary (least). Therefore, if we are in the business of minimizing free energy, \u201coptimal behavior\u201d can be construed as following the principle of least action, which, again, is a principle for minimizing the cost associated with performing an action. Placed in a policy framework, optimal behavior therefore implies ordered actions and not ordered preferences Applying Hamilton\u2019s principle of least action, in the context of an information theoretic treatment of self-organization, can be read as a tendency to resist an increase in disorder or entropy by minimizing surprise . This cathere is no one-to-one mapping between choice behavior and prior preferences or subjective utility. A key drive of this epistemic behavior is the value of information  depend upon current beliefs . This isormation , reflectormation . This diThe principle states that all organic systems are characterized by a common feature, the ability to combat the dispersal forces of entropy on the cellular level, and counterbalance entropy by exploiting energy from the surrounding environment. How organic systems do this is by minimizing the property known as variational free energy. An interesting aspect of this principle is its logical extension from a biological/thermodynamical principle, to a technical description of neurological processes. It is, however, necessary to point out that variational free energy is not to be confused with thermodynamic free energy. Under the free energy principle, variational free energy is the upper bound on entropic surprise, the surprise element being unforeseeable or atypical states and events confronting the agent. This is also known as the negative logarithm of model evidence in information theory, where the average surprise over time is entropy. More commonly, entropy is often interpreted as the law that all things move to a less and less ordered state, and while this interpretation is applicable herein, this paper will exclusively refer to Claude Shannon\u2019s average surprise over time formulation whenever entropy is mentioned. More intuitively, we can view entropy as the average amount of information expected to be gained when sampling any random variable. In order to minimize variational free energy, the brain must generate a probabilistic model of the environment and all the events typically encountered within it .This model comprises a recognition density that corresponds to the posterior probability of the hidden causes of sensory input and a generative density that comprises a likelihood and prior. The likelihood is simply the probability that the sensory data were generated by the hidden states or causes, while priors correspond to prior beliefs about those causes before seeing the data. The Kullback\u2013Leibler (KL) divergence between the recognition density  and the true posterior under the generative density is referred to as an evidence bound or variational free energy. By minimizing variational free energy, the KL divergence approaches zero and the free energy becomes the negative logarithm of model evidence. Instead of having a model of the environment generated from the ground up by sensory input alone, the free energy principle suggests that the sensory inputs from the environment are inferred initially from prior beliefs and subsequently matched with sensory input by active sampling, often referred to as active inference. This active inference generates prediction errors by matching predicted with actual signals, and through iterative sampling, i.e., iterative acts, the prediction errors diminish, minimizing the KL divergence along with variational free energy . Behavioln\u2061P(\u03c0) is the probability distribution of a policy \u03c0, and G is the expected free energy. What we are saying here is simply that the selection of a policy has a cost and that this policy cost is equal to expected free energy. As such, this equation places a cost on cognition  is an energy term that describes that hidden states in the world S\u03c4 cause observable outcomes O\u03c4 given a particular policy \u03c0, and P is the probability distribution of outcomes that are generated by hidden states. The ln\u2061Q(S\u03c4|\u03c0) term describes the belief in the consequences of a policy, where Q is an approximate posterior distribution of this belief, here playing the role as the recognition density mentioned earlier.  This can be rearranged in terms of risk sensitivity and subjective utility .where ln\u2061Q, then what is left will be the KL divergence, here indicating risk sensitivity or KL control EQ[ln\u2061P(O\u03c4|m)\u2212ln\u2061Q(S\u03c4|\u03c0)]. Without ambiguity, this term says that states are no longer hidden, which means that states and observations are the same. Here the KL divergence scores the difference between what we believe will happen given a particular policy ln\u2061Q(S\u03c4|\u03c0) and what we want to have happen ln\u2061P(O\u03c4|m) given a generative model of the world m, which can also be described as our prior preferences about long-term outcomes. This difference is therefore the same as a score for the objective risk we are willing to accept, assuming a subjectively well-defined log-likelihood. In other words, what is the perceived probability of ending up in a specific world state, and how badly do we want to do so.If we remove any uncertainty or ambiguity with regard to observations ln\u2061Q(S\u03c4|\u03c0), what we are left with is a term describing subjective utility under risk/negative Bayesian risk EQ(O\u03c4|\u03c0)[ln\u2061P(O\u03c4|m)], where we expect our actions to maximize the probability of ending up in a preferred world state based exclusively on our prior beliefs (notice that the equation contains no hidden states).This also means that if we remove relative risk The expected free energy can also be rearranged to be expressed in terms of subjective utility under uncertainty  and information gain. Here subjective utility is associated with prior preferences about long-term outcomes under the consideration of hidden states, where there is an attraction to states of high expected probability or minimum expected surprise. Because surprise is also negative log evidence, expected/subjective utility can be seen as the same as expected log evidence through the minimization of expected surprise/minimum expected deviation from prior preferences. The second term of Eq. 4 scores the information gain in terms of the divergence between beliefs about future states with and without observing outcomes. This is an important quantity in optimal Bayesian design  and manyEQ(O\u03c4|\u03c0)[DKL[QQ(S\u03c4|\u03c0)]] describes information gain that resolves uncertainty by scoring the degree to which uncertainty is reduced by pursuing a given policy , we can then start to model an agent based on variational first principles.Much of economics rests upon temporal discounting and the change in the subjective value of various goods depending upon when they will be secured. As with the broader literature , under tBecause belief updating is dependent on surprise/entropy, and the fact that entropy is not uniformly distributed, it is suggested that time perception is connected to the amount of belief updating/work that must be performed within an externally allotted time frame. This can be interpreted as an agent\u2019s sense of urgency. So even though uncertainty about state transitions increases over time , time peWe therefore have a mechanism by which time perception (information gain) is matched with, and mediated by, expected free energy, communicating the degree to which an expected action sequence is frustrated given the need for adaptation. This is important, because it means that prior preferences, and the precision with which these prior preference are held , directlvarying degrees of probability. The free energy formulation is an account from first principles on how systems must behave. By analyzing its different components, we therefore see the different conditions that must be present given a specific behavior. If agents\u2019 discounting behaviors were conforming to an exponential function, then there would have to be very strict controls on the amount of information an agent could sample, or the time frame that the agent would have to \u201csimulate,\u201d eliminating the influence from the information gain term. In a real world situation, this would not be impossible, but highly improbable. If agents\u2019 discounting behaviors were conforming to a hyperbolic function, then there would have to be a sufficiently large temporal dimension that would increase uncertainty (accumulated cost), to the point where further temporal increases become too costly to simulate, which is a lot more probable. In regard to the smaller sooner/larger later effect for instance, we should therefore be able to design a simple experiment that would make this effect disappear.The dynamics of the variational free energy principle means that active inference on future states  will only partly conform to \u201cexternal time\u201d as both process limitations and adaptation becomes influencing factors. The aspect of the free energy formulation that may constitute a problem, however, is the inability of the principle to properly disentangle choice behavior from temporal choice behavior, as all choices will have an associated temporal dimension. Coupled with the complete class theorem, this means that we can make any perceivable discounting function conform to the principle, only with varying degrees of probability. Exponential , hyperboThe hyperbolic discounter would prefer $5 now over $7 tomorrow, but not $5 in a year over $7 in a year and a day. In the free energy formulation, this preference reversal is due to the uncertainty/cost in dealing with small consequences over large time scales. What the agent is actually answering is therefore more like answering if he would prefer $5 now or $7 tomorrow, and $5 in a year or $7 in a year, simply evaluating the present value of the future $5 compared to the $7. To remove this effect, we would have to ask if the agent preferred $5 now or $7 tomorrow and then ask the agent to first imagine jumping 1 year forward in time and then proceed to repeat the question. This should keep preferences stable with a higher probability . As suchHopefully the connection between time perception and information gain has now become clearer. The crucial part is to disconnect \u201cexternal time\u201d from \u201cinternal time,\u201d where the latter refers to the amount of work, or the strain of the system, responding to surprise/entropy. Changing external time frames will therefore not result in more or less \u201cheuristic\u201d behavior but will result in more or less urgent behavior. Here this urgency feeds back into expected free energy, possibly influencing preference ordering and discount functions. This \u201cstrain\u201d is exactly the information gain, which follows from the fact that the information gain is mathematically the expected degree of belief updating as measured by the KL divergence in Eq. 4. The higher the cognitive strain, the lower the present value of more and more remote rewards, all else equal, and conversely, the faster the discount rate on the future .Any action is initiated by a call for alleviation or a rectification of a psychological or biological state. The action schema (G) then posits a set of causally related action sequences or policies expected to work. The most often used successful strategies in the past convey the highest probability for success, resulting in a strongly weighted expectation following the principle of least resistance or Hamilton\u2019s principle of least action, which under certain restrictive assumptions  can also be expressed as KL control or risk sensitivity . The firThis of course questions one of the fundamental laws of expected utility theory, namely, the law of transitivity, since subjective value, and therefore preference, no longer can be said to be a stable property of any individual, for any duration of time. Moreover, it is also the case that the vast majority of preferred future states are themselves hidden states to be discovered through action, resulting in satisficing behavior , in manyIn spite of the fact that a wide range of different goods has the ability to satisfy the same want, it cannot be said, however, that these goods therefore are of equal subjective value. Different action sequences (policies) imply different evaluations based on the different time strains they incur. This means that even two identical goods can be valued differently at different points in time depending on the amount of adaptation that is necessary in order to obtain or use the goods. Thus, even the truism of the reflexivity axiom cannot be said to hold when factoring in any length of time. Having to adapt policies during action sequences must hereby influence subjective valuations in numerous obvious and subtle ways, meaning that one of the staples of microeconomic consumer analysis, the indifference curve, is likewise not commensurate with any notion of choice in reference to human action and behavior.This of course also questions the continuity and the revealed preference axiom. We can see this more clearly when considering that the suppression of variational free energy can be interpreted as a proxy for subjective value, where the factors that influence the former inform the latter. Thus, any attempt to measure or express the latter, will likewise encounter the problem of measuring or expressing the former, bearing in mind that variational free energy is an energy term and not a quantity. Thus, by optimizing beliefs, we remove the extensive property of utility and place it within a softmax function that is constantly being modified by the input from information gain. We can therefore say that monotonicity or positive affine transformations with respect to utility cannot apply to situations where there is uncertainty, since uncertainty resolution is the ultimate \u201cpurpose\u201d of information gain, culminating in a variable time perception that alters whatever utility function that might be deemed representative of a stated set of preferences.To illustrate this dynamic, imagine setting out to buy a long desired bicycle that now has come on sale. Arriving at the store you notice an unexpected queue forming outside. \u201cApparently you were not the only one interested in buying that particular bicycle.\u201d Nevertheless, you must now decide whether to stand in line with the other customers or return home empty handed. Quite possible you will decide to wait in line, but the mere fact that you contemplated your options signifies a decrease in the present value of the bicycle, as it receded further into the future compared to your initial expected action sequence. Having now integrated your expectations with the act of standing in line, further frustrations or surprises might indeed prompt you to leave the store without completing your purchase, as the present value of the bicycle consequently would fall even further. However, you now spot an opportunity that allows you to skip waiting in line without being discovered by the other customers. Immediately you feel the intensity of your want increase and experience a heightened sense of urgency as your pace quickens and anticipation rises. Given your previous expectation (that included standing in line), the present value of the bicycle increases dramatically and adds an unexpected premium to the bicycle compared to earlier.This dynamic places utility and choice behavior within a context that connects and mediates the expression of subjective utility through action and adaptation. As such, present value formulations become dependent on expected surprisal (risk), as well as unexpected surprisal (uncertainty), where utility changes dynamically in response to both. If an agent runs for the bus as it is about to leave station and is ascribing some probability for catching it, then he or she should be willing to pay a premium for the bus fare in proportion to the probability ascribed if actually catching it. In other words, an agent should be willing to pay a premium for successfully completing an action sequence when the action sequence affords the agent unexpected costs and should therefore also be willing to bear a relatively high unexpected cost in order to complete an action sequence. That this behavior occurs under an optimizing scheme puts irrational behavior such as the sunk cost fallacy in a new light, by highlighting some fundamental issues pertaining to a system that tries to make predictions in a fundamentally uncertain setting.The indifference curve describes a situation where an agent chooses between various configurations or bundles of two different goods, illustrated by a downward sloping convex curve. The convexity of the indifference curve is due to a diminishing marginal rate of substitution between the two goods, indicating that agents would prefer a mix of goods instead of a higher quantity of just one good. Any point on the curve is thus equally as preferential as any other point, allowing for the aforementioned indifference to occur. However, because the present value of all goods depends on the perceived time flow incurred from specific action sequences, urgency, and therefore preference, along with derived utility, shifts in response to any and all changes along the action sequence. This includes having to choose between bundles X and Y. Concordantly, there can be no indifference between one choice and another. This is partly because this would imply having to perform two mutually exclusive actions at the same time, but more importantly, because adaptation during any action sequence is unavoidable and that it would be correct to view this adaptation as either a gain or a loss function on the end goal in response to any and all dynamic updates to any action sequence (accumulated cost). A gain is when an unexpected opportunity presents itself, shortening time perception, heightening urgency, and increasing present value of the good toward which the opportunity was afforded, and a loss when externalities frustrate expectations, lengthening time perception, lowering urgency, and decreasing present value of the good toward which opportunity was frustrated.The crucial part is that the initial act must be based on an established belief system (action schema) including a policy for resolving uncertainty. This expectation term selects an action sequence born from experience and, in so doing, posits a more or less articulated goal conveying a direction and a measure of time denoting urgency. Unless this expectation term is perfectly satisfied during the proposed action sequence, meaning that no new information can present itself, there is no reason to assume that setting out to buy milk will in fact result in the purchase of milk, to say nothing of a specific brand of milk. That is not the interesting part, however. The interesting part is that all new information is weighted against the expectation term, generating a modified action sequence based on the available responses/actions \u201cstored\u201d in the wider action schema. A necessary condition for indifference can therefore only be inaction, since every choice an agent could possibly make lowers the present value of every other alternative choice. If an agent proclaimed to be indifferent between a red shirt and a blue shirt, the only way to demonstrate this indifference would be for the agent to choose neither and walk away. If an agent chooses the blue shirt, but still proclaimed to be indifferent between the blue and the red shirt, then the agent should have no quarrels with swapping the one for the other. Also, once this swap was completed, the agent should not have any objections to swapping back. In fact, if the agent chooses the blue shirt, but simultaneously proclaims to be indifferent, then the agent should have no quarrels with swapping between the two shirts indefinitely. What breaks this endless loop can be cast in terms of variational free energy. When an action sequence is resolved, free energy is minimized. Expending further energy toward the resolution of the same want beyond this point introduces a new action sequence that cannot but increase free energy if the connected reward does not justify the computational complexity incurred save for belief updating . We see here that a choice once committed to must carry a premium over alternatives and will result in a different valuation behavior pre commitment compared to post commitment/choice. The literature on behavioral economics bears this out in numerous examples, the most prevalent of which is the endowment effect and the status quo bias .p \u2208  that renders an agent indifferent between the lottery pX + (1\u2212p)Z and the certainty of Y only serves to specify the point at which there can be no information gained through further action, and therefore, the point at which further action becomes meaningless. Action is inherently uncertainty resolving (Eq. 4). If an agent is indifferent between two outcomes, then the agent is not resolving uncertainty and is therefore not acting.Solving for preference is thus an \u201ceither/or,\u201d not an \u201cand/or\u201d problem, meaning that there is only one solution and one solution alone to how the individual selects a given action sequence. Ignoring opportunity costs for the time being , giving up some of good X in order to get some of good Y is framing the problem incorrectly, since good X and Y are linked to two different policies that in many cases just happens to utilize a lot of the same actions up to a point. In instances where an individual does in fact substitute one good for another, this has to represent a decrease in the present value of the initial formulation, due to either an unexpected opportunity or an unexpected frustration. Invoking a probability This paper has used the variational free energy principle in order to describe how complex organic systems optimize while simultaneously being free to violate the axioms of expected utility theory. The approach is centered on the optimization of beliefs rather than the maximization of utility and, by this process, depicts rational behavior as following Hamilton\u2019s principle of least action. This highlights the costs associated with deviations from least action and establishes choice behavior as a function of uncertainty resolution and adaptation . Once this is done, many behavioral \u201canomalies\u201d become \u201crational\u201d when framed in terms of a system that tries to make predictions and perform actions in a fundamentally uncertain setting.Additionally, this has consequences for temporal discounting behavior, where discount functions become more or less erratic reflecting, and depending on, real time adaptations. This erratic discounting behavior can, however, be mitigated and mediated by the perceived uncertainty and expected complexity connected to state transitions over time.However, the implication that agents do in fact optimize, and therefore do not exclusively employ psychological heuristics in the decision process, serves to restrain more extraordinary behavioral criticisms of standard economic theory. This also places the behavioral economist at a disadvantage when prescribing means and measures that purports to rectify apparent failings of human cognition and decision making.All datasets generated for this study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.The author confirms being the sole contributor of this work and has approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Analysis of the relationship between UIC \u2265 150 \u03bcg/L and the women\u2019s dietary habits showed that the percentage with UIC \u2265 150 \u03bcg/L increased with greater consumption of milk in the first trimester, and the same was true for iodized salt use in all three trimesters and iodine supplementation in all three. (4) Conclusion: During pregnancy, increased intake of milk, iodized salt, and iodine supplements were associated with an increase in the UIC.(1) Background: The nutritional status of women during pregnancy can have a considerable effect on maternal and fetal health, and on the perinatal outcome. Aim: to assess the changes occurring in dietary iodine intake, potassium iodide supplementation, and smoking habit, and the impact of these changes on the urinary iodine concentration (UIC) during pregnancy in a population of women in Catalonia (Spain). (2) Methods: Between 2009\u20132011, an observational study included a cohort of women whose pregnancies were monitored in the public health system in the Central and North Metropolitan areas of Catalonia. Women received individual educational counseling, a dietary questionnaire was completed, and a urine sample was collected for iodine determination at each trimester visit. (3) Results: 633 (67.9%) women answered the questionnaire at all 3 visits. The percentage of women with a desirable UIC (\u2265150 \u03bcg/L) increased from the first to the second trimester and remained stable in the third (57.3%, 68.9%, 68%;  Iodine is an essential nutrient required for synthesizing thyroid hormones which regulate the body\u2019s metabolism, growth, and development. Iodine requirements increase significantly during pregnancy and lactation, and if the intake is insufficient during these periods, thyroid hormone production can decrease, with consequent repercussions on the mother, the developing fetus, and the breastfed infant . Severe Appropriate nutritional habits together with iodine supplementation can help meet iodine requirements during pregnancy and postpartum, and prevent or correct iodine deficiency and its consequences . Most foHealth education regarding nutrition during pregnancy aims to improve the quality of the diet, instructing women on which foods and what amounts of food should be consumed to achieve an optimal dietary intake. It should also include advice on the use of various micronutrient supplements containing iron, folic acid, and iodine . RegardiIn Catalonia, the nutritional recommendations provided during pregnancy are aimed at maintaining a healthy weight, suppressing the use of tobacco and alcoholic beverages, and establishing a balanced, healthy diet. A healthy diet should be sufficient, complete, varied, and balanced, but also adapted to the characteristics of the individual, while being satisfying, safe, sustainable, and affordable. To cover iodine needs during pregnancy, the diet should contain 3 servings of milk and dairy products and 2 g of iodized salt per day ,10. If tFew studies in our setting have focused on the changes in iodine nutrition that occur during pregnancy and the possible relationship between iodine status and dietary habits. Hence, this study aimed to investigate the effects of dietary iodine intake, KI supplementation, and smoking habit on iodine status in a population of pregnant women in Catalonia.An observational study carried out in a cohort of pregnant women monitored in the public health care system of the Central and North Metropolitan areas of Catalonia (Spain). Initially, the study was contemplated as part of a clinical trial project to evaluate the efficacy of an educational intervention imparted in groups to promote iodine intake and optimal urinary iodine concentrations (\u2265150 \u03bcg/L) in pregnant women. The women were enrolled, but the intervention by groups was found to be impracticable in our setting because of difficulties with ensuring the proper development of the educational program. Hence, the design was converted to an observational study with a single-arm  cohort in which women received the educational counseling on an individual basis. As a part of the routine clinical practice in our primary care centers, midwives impart information about diet and other relevant recommendations at a prenatal visit during the first trimester of pregnancy.Institut Catal\u00e0 de la Salut  in the province of Barcelona.The study was conducted within the framework of the primary care center Program for Sexual and Reproductive Health Care (PASSIR) of the Catalonian Central and North Metropolitan regional offices of the Consecutive recruitment was carried out during 2008 and 2009. All women older than 17 years attending the participating centers in their first trimester of pregnancy (<13 weeks) and willing to participate were included in the study. Pregnant women with thyroid disease, no telephone contact, or difficulty communicating with the health personnel , and those refusing to participate, were excluded.Each trimester, a visit was scheduled in the participating primary care centers where women answered a questionnaire and a urine sample was collected for iodine determination. The questionnaire compiled sociodemographic data, including patient age, place of origin, place of residence , and educational level. Information on dietary habits and other factors was collected at a personal interview by primary care midwives, using a standardized questionnaire  that shoUrinary iodine concentration (UIC) was determined as follows: A first-morning urine sample was collected from each woman, quickly frozen at \u221240 \u00b0C, and transported within 24 to 48 h to a central laboratory , where UIC determination (\u03bcg/L) was performed using the Benotti and Benotti method ,13. Urint-test for independent data and the Mann-Whitney U test, as appropriate, were used to compare the quantitative variables, and the Pearson chi-square test was used for categorical variables.Quantitative variables are described as the mean and standard deviation or the median and first-third quartiles (Q1\u2013Q3) for those with a non-normal distribution. Categorical variables are expressed as the absolute frequency and percentage. The Student The intake information was grouped into 3 categories . Multilevel mixed-effects logistic regression models adjusted for paired measures in the 3 trimesters were performed to assess the effect of iodine-rich food intake or supplementation on UIC values \u2265150 \u03bcg/L.p < 0.10. The final model included variables that were statistically significant at p \u2264 0.05; the Akaike information criterion and biological plausibility were also taken into consideration.The initial regression model included all variables that were individually associated with the outcome at a significance level of Missing values for food intake at follow-up were imputed using all available variables. The estimation model was based on 10 replicates and included the same variables as in the final hierarchical model.p \u2264 0.05 (two-tailed). Data were analyzed with SPSS . Multiple imputation and mixed-effects logistic regression analyses were performed with the Stata/SE Statistical Package 14.0  for Windows.Statistical significance was set at ClinicalTrials.gov: NCT01301768.Ethics approval and consent to participate: All women were informed and signed their informed consent to participate in the project.The study was approved by the Clinical Research Ethics Committee at the Primary Care Research Institute (IDIAP) Jordi Gol (Code: P07/02).In total, 970 women who attended a first-trimester prenatal visit were included. Among them, 945 (97.4%) answered the dietary questionnaire at this visit, 752 (77.5%) attended the second-trimester visit, and 705 (72.7%) the third-trimester visit . The 633In the first trimester evaluation, the mean age was 30.6 (4.6) years, 83% of participants were Spanish natives, and 73.7% lived in an urban setting. As to educational level, 3.5% were illiterate or had not completed primary school, 24.6% had a primary school diploma, 41.6% a high school diploma, and 30.4% a university degree.The results of the dietary questionnaire are summarized in p < 0.05) (p = 0.070). Consumption of cheese, cold cooked meats, and dried fruit showed no changes. Iodized salt use increased considerably in the second trimester and held steady in the third . The same trends were seen for iodine supplementation . Tobacco use decreased somewhat in the second trimester and was maintained in the third, with only marginal significance . The median UIC increased from the first to the second trimester and held steady in the third .In general, the consumption of milk, cooked and fresh vegetables, fish, meat, eggs, and fruit increased along the three trimesters ( < 0.05) . Yoghourp < 0.001)  increased from the first to the second trimester and held steady in the third  Analysis of the relationship between UIC \u2265 150 \u03bcg/L and the women\u2019s dietary habits  showed tp < 0.001), iodized salt intake , and milk consumption .We carried out a multilevel mixed-effects logistic regression analysis of repeated measures to determine which intake-related factors were associated with UIC < 150 \u03bcg/L. Variables that were candidates for inclusion in the analysis were examined . The resAfter carrying out multiple imputation of missing values in the three trimesters  and repeThe results of this study showed favorable changes in iodine nutrition in a sample of pregnant women from central Catalonia following individual educational counseling on dietary habits imparted by the midwife in the first trimester of pregnancy. The median UIC increased from the first to the second trimester and held steady thereafter . These changes were related to greater consumption of milk, iodized salt, and iodine supplements. The data indicate that iodine nutrition is adequate in pregnant women in our setting, in accordance with the recommendations of the WHO, the ICCIDD, and the UNICEF, which recommend a population median of > 150 \u03bcg/L .The daily iodine intake recommended by the WHO during pregnancy and lactation is at least 250 \u03bcg/day. However, it is difficult to estimate iodine intake through analysis of the diet, as the amount of this micronutrient in both food and water can vary considerably from one area to another. Under normal conditions, there is a balance between iodine intake and urinary iodine elimination, which makes the determination of the UIC in casual urine specimens a reliable indicator of the iodine nutritional status of populations . EvidentThe probability of developing iodine deficiency-related disorders is undoubtedly higher when the median UIC does not reach 150 \u03bcg/L. However, a large part of the studies conducted in Europe over the last few years have reported median UIC values considerably lower than this limit, and even below 100 \u03bcg/L ,30,31,32The UIC changes observed over pregnancy have been a subject of debate, particularly in iodine-deficient areas. Some studies, such as one conducted in the United Kingdom , have shIn the present study, the dietary habits that had an impact on the UIC were consumption of milk and iodized salt, as well as KI supplementation. These findings concur with the results obtained in the study by Bath  in the UDairy products are an important source of iodine in numerous European countries, as evidenced in the study by Bath in the United Kingdom , Dahl inIn the present study, vegetable consumption did not present in the final model as having a significant impact on the IUC, in accordance with the 2007\u20132012 study by NHANES showing no correlation between vegetable intake and the UIC . The forNutritional education and counseling during pregnancy are focused on improving the quality of the diet. Women are provided information on what foods and what amounts of food are needed to achieve proper nutrition, and they are instructed on the use of micronutrient supplements such as iodine when adequate amounts are not guaranteed by the diet . We founSeveral studies, carried out in Spain, show that supplementation with KI during pregnancy makes it possible to achieve UIC \u2265 150 \u00b5g/L ,41,42. HThis research faced the impossibility of carrying out the group of nutrition education interventions as planned in order to promote iodine consumption during pregnancy. As it has been mentioned, an individual nutrition education intervention was carried out in the midwife\u2019s prenatal control surgery. However, the longitudinal design of the study allows us to attribute to it the changes observed in the iodine intake in the 2nd and 3rd trimester and its effects on the iodine status.As for future research, the results of this study could be extended with a further study that would have the objective of establishing the impact of eating habits and iodine supplements on UIC amongst breastfeeding mothers postpartum.In conclusion, the individual educational counseling on proper diet and nutrition carried out by the midwife during the routine first-trimester prenatal visit had a positive impact on the consumption of iodine-rich foods in pregnant women. Greater intake of milk and iodized salt, as well as KI supplementation, was associated with an increase in the UIC. As a result, the median UIC in the pregnant population in central Catalonia rose from the first to the second trimester of pregnancy and was sustained in the third. These data indicate adequate iodine nutrition in the pregnant population of this area, in accordance with the WHO, ICCIDD, and UNICEF recommendations.Thus, a dietary educational intervention should be considered an essential component of pregnancy management to promote optimal iodine nutrition. The benefits obtained will contribute to decreasing fetal and maternal morbidity, as well as morbidity in the breast-fed infant. In addition, the knowledge gained can lead to better dietary habits in women beyond pregnancy."}
+{"text": "Iodine deficiency (ID) is a global public health problem and its impact is more pronounced in low-income countries. During pregnancy, iodine requirement is known to elevate sharply, making pregnant women, especially those living in low-income countries highly vulnerable to iodine deficiency. This study aims to assess the prevalence of iodine deficiency and its associated factors among pregnant women in Ethiopia.2 test. A random-effects model was used to estimate the pooled prevalence and pooled odds ratio. The presence of publication bias was checked using Funnel plot and Egger\u2019s test.A systematic literature search was performed by using PubMed, CINAHL, Web of science, global health, and Google scholar electronic databases. Two authors independently extracted all the necessary data using a structured data extraction format. Data analysis was done using STATA Version 14. The heterogeneity of the studies was assessed by using IOne thousand one hundred and sixteen studies were reviewed and seven studies fulfilling the inclusion criteria were included in the meta-analysis. The meta-analysis of seven studies that included 2190 pregnant women showed a pooled prevalence of iodine deficiency during pregnancy to be 68.76% (95% CI: 55.21\u201382.31). In a subgroup analysis, the prevalence in Oromia region is 71.93% (95% CI: 54.87\u201388.99) and in Amhara region is 60.93% (95% CI: 57.39\u201364.48). Iodized salt use  and 1st trimester pregnancy  were found to have a significant association with iodine deficiency.The prevalence of iodine deficiency during pregnancy using urine iodine is considerably high in Ethiopia. Using iodized salt is found to reduce the burden. Hence, there is a need to strengthen iodization programs to tackle the problem.The online version contains supplementary material available at 10.1186/s12884-021-03584-0. Iodine is an indispensable micronutrient and essential component of the thyroid hormones thyroxine (T4) and triiodothyronine (T3), which are vital for normal growth and metabolism during pregnancy, infancy, and throughout life . Iodine In 2011, globally an estimated 1.8 billion people had inadequate amounts of iodine in their diet and are at risk of iodine deficiency disease (IDD) . Iodine The amount of iodine needed by our body varies by different factors like physiological changes, including pregnancy. The iodine requirement during pregnancy is known to increase sharply because i) there is a 50% increase in maternal thyroxine (T4) production needed to maintain maternal euthyroidism and meet the thyroid hormone requirements of the fetus; ii) iodine needs to be transferred to the fetus for fetal production of thyroid hormone, specifically in later gestation stages; and iii) probable increment in renal iodine clearance. Adequate iodine intake is essential during pregnancy for fetal and maternal production of thyroid hormones which is critical for optimal fetal neurodevelopment .Inadequate iodine in our diet leads to a range of poor health outcomes. The consequences of severe iodine deficiency (ID) during pregnancy include spontaneous abortion, stillbirth, congenital abnormalities, and endemic cretinism . MountinRecently WHO/UNICEF increased the recommended nutrient intake (RNI) for iodine during pregnancy from 200 to 250\u2009\u03bcg/d. Inadequate iodine intake below the recommended level in children and women can be assessed using urine iodine concentration (UIC) and thyroid volume (goiter rate) (GR) . The recAs one of the bold strategies to combat the highly prevalent iodine deficiency, in 2011, Ethiopia\u2019s government passed comprehensive legislation that mandates the use of iodized salt for human consumption . WHO recDespite the government\u2019s implementation of a long-term plan to eradicate ID through salt iodization, the problem reportedly persists. Moreover, evidence concerning vulnerable groups like pregnant women is incomplete. Therefore, we conducted this systematic review and Meta-analysis to assess the prevalence of iodine deficiency and its associated factors among pregnant women in Ethiopia.A systematic literature search was performed by using PubMed, Cochrane library, CINAHL, and Google scholar. We applied Boolean operator like \u201cAND\u201d, \u201cNOT\u201d and \u201cOR\u201d. Through consideration of the Boolean operator we searched as follows: ((\u201cIodine OR Iodine\u201d[Mesh]) AND (level OR Status OR deficiency [Subheading]) AND (Pregnant Women [Mesh]) AND \u201cEthiopia\u201d[Mesh])) .Language: only studies published/written in the English language.Population: studies conducted among pregnant women.Publication issue: both published and unpublished articles were searched.Study period: 2010\u20132020.Context: Researches that have been conducted in Ethiopia using urine iodine concentration (UIC) to assess iodine deficiency were only included.Systematic searching of the studies was undertaken from the 10th of March, 2020 to the 15th of May, 2020. All results were limited to articles published in English Language from 2010 till May 2020\u2009G.C. Additionally all observational studies  were included. Case reports and case series were excluded from this study.Initially, availability of full text titles and abstracts of the articles were assessed. Then the full papers of relevant articles were reviewed. Articles with inaccessible full papers and those published before 2010 were excluded from the analysis.Two authors (RH and MF) independently extracted all the necessary data using a standardized data extraction format prepared in Microsoft Excel. Disagreements between the authors during data extractions were discussed and reached on consensus. The data extraction format includes the name of the first author, publication year, name of the region, number of samples, response rate, median UIC, the method used to measure UIC, and prevalence with 95% CI. For the second outcome (associated factors), data were extracted in a two by two table format and then the odds ratio for each factor was calculated based on the findings of the original studies.There are two main outcomes in this study. The prevalence of iodine deficiency was estimated by dividing the total number of iodine-deficient cases by the total number of pregnant women participating in the studies then multiplying by 100. The second outcome was associated factors of iodine deficiency in pregnant women. For major determinants, the odds ratio was calculated based on binary outcomes from the primary studies. The factors included in this review were: use of iodized salt (Yes versus No), educational status of women (unable to read and write versus able to read and write), and trimester/stage of pregnancy .For assessing the quality of the studies, Newcastle-Ottawa Scale (NOS) quality assessment tool was used . The too2 test static and its p-value . Similarly, there is no significant association between iodine deficiency and the stages of pregnancy. But statistically significant marginal association was observed between the first trimester and iodine deficiency as compared to those in second trimester. The association of the stage of pregnancy with iodine deficiency was also insignificant in almost all of the included studies \u201318 and sOne of the limitations of this study was only articles written in English were considered in this review, which may result in the exclusion of other articles. This Meta-analysis represented studies reported from only two regions of the country, which may reflect as under-representation since few articles were found and included. All the studies included in this review were cross sectional studies, thus results generated in this study should be interpreted with caution since the quality of evidence produced from cross sectional studies is relatively low.All included studies reported a single UIC measurement, which might not clearly show iodine deficiency at an individual level, rather at a population level. There are also variations from one study to another study in different aspects of urine iodine measurement like urine storage, transportation, time of measurement by each study. Such variations might explain the high heterogeneity of estimates observed in the current study.Iodine deficiency among pregnant women remains to be a major public health problem in many parts of Ethiopia. Iodized salt utilization at the household level was significantly associated with iodine deficiency among pregnant women. Although the iodized salt coverage in Ethiopia is reportedly high (89.2%), the prevalence of IDD among pregnant women remained significantly high. This finding implies that the prevalence of iodine deficiency among pregnant women in Ethiopia still needs due consideration and efforts has to be made by the government to increase accessibility and utilization of iodized salt.Hence, intervention aiming at preventing iodine deficiency in the country including the use of iodized salt as the only primary option for iodine source at the household level might need re-consideration. Particularly, other options like processed foods that are being practiced in some countries that might boost the effect of iodized salt particularly among pregnant women needs consideration.Additional file 1: Supplemental file 1. Summary of search results for the PubMed, Google Scholar and other databases.Additional file 2: Supplemental file 2. Quality score of each study.Additional file 3: Supplemental file 3. PRISMA  checklist."}
+{"text": "Iodine is an essential micronutrient important for foetal nerve and brain development, especially in the early stages of pregnancy. The re-emergence of mild to moderate iodine deficiency has recently been reported in the United Kingdom (UK). The level of knowledge amongst pregnant women regarding iodine nutrition is poorly understood. The aim of this study was to determine the level of knowledge about iodine nutrition during pregnancy among pregnant women living in Northern Ireland (NI).A cross-sectional study in pregnant women was carried out in Royal Jubilee Maternity Hospital Belfast, from March to June 2015. Two hundred pregnant women were provided with a short questionnaire on iodine knowledge during routine clinic visits and comparisons were made across trimester and parity.Only 20% of women were aware of the potentially increased iodine requirements during pregnancy and breast feeding; 45% were unable to identify any foods they thought would be iodine rich. The three main sources of dietary iodine in the UK are fish, dairy and eggs and 30, 9 and 15% correctly identified these as good sources respectively. When asked about whether they felt they had been given sufficient advice about folic acid and iodine in pregnancy, 90% felt this was so for folic acid, but only 5% for iodine.This study suggests that iodine knowledge among pregnant women living in NI is poor. In the absence of any iodine fortification programme, women in the UK may be vulnerable to iodine deficiency in pregnancy. At present they are poorly equipped to make positive dietary changes to meet their increasing iodine requirements during pregnancy and breastfeeding. Public health strategies should be considered to target this population group.The online version of this article (10.1186/s40795-019-0285-8) contains supplementary material, which is available to authorized users. Iodine is an essential trace element required for production of thyroid hormones, and an increased supply of dietary iodine is of particular importance during pregnancy to compensate for foetal requirements . Within Iodine is found in a range of foods, with the richest sources being fish and dairy products. Within Ireland and the UK, milk and dairy products tend to be the main sources of dietary iodine, , 7. The There are no UK specific recommendations on iodine supplementation or fortification during pregnancy, despite international guidelines (WHO 2007) . The SciLittle is known if women themselves are aware of the importance of iodine in the perinatal period and if they are able to identify foods that are rich in iodine. In Northern Ireland (NI) \u2018The Pregnancy Book\u2019 is offered to all pregnant women . InformaRecruitment and data collection were carried out in the Royal Jubilee Maternity Hospital, Belfast Health and Social Care Trust between March and June 2015. Ethical approval was obtained from the Office of Research Ethics Committees Northern Ireland (Ref 14/NI/0047) and Governance approval from the Belfast Health and Social Care Trust (ref 13171KM-AS).Two hundred questionnaires were distributed during routine antenatal clinics or education sessions by a member of the research team who explained the purpose of the questionnaire and offered a paper copy to those who provided consent.These clinics and visits occurred across trimesters. The numbers recruited were based on previous comparable questionnaire studies \u201314. Consp\u2009<\u20090.05. Non parametric testing was used in view of nominal and ordinal results from the questionnaire, with Mann-Whitney and Kruskall-Wallis tests used to compare results for 2 or\u2009\u2265\u20092 groups respectively. Data were presented using descriptive statistics and comparisons in responses among women at different stages and number of pregnancies were made.Statistical analyses were conducted using the Statistical Package for the Social Sciences software  and significance set at A total of 183/200 (91.5%) completed and returned the questionnaire. Of these 59% were nulliparous. Most were in later stages of pregnancy with a breakdown of 4, 33 and 63% in 1st to 3rd trimester respectively. When asked to identify which gland iodine is needed for, 28% correctly identified the thyroid gland with 59% not sure. There was no significant difference in responses either between nulliparous and multiparous women or between trimesters. When asked to identify foods be rich in iodine nearly half of participants were not sure (Table\u00a0p\u2009=\u20090.006) but otherwise there were no differences between these two groups. There were no significant differences by trimester in the identification of the iodine rich foods.The three main sources of dietary iodine in the UK are fish, dairy and eggs and 30, 9 and 15% correctly identified these as good sources respectively. Nulliparous women were less likely than multiparous women to identify seafood as a good source of iodine (22% vs 49%) (p\u2009=\u20090.007) although there was no difference between trimesters (data not shown).Participants were asked \u201cWhat happens to your iodine requirements during pregnancy and [breastfeeding]?\u201d The majority were unsure for both pregnancy and breastfeeding while only ~\u200920% answered correctly that iodine requirements increase during both periods  and lowest for iodine (5%). No differences were observed in response to this question when analysed by parity or trimester stage. Table\u00a0Our study findings are consistent with the two other studies available in the UK which show that knowledge around iodine in pregnant women is low. Table\u00a0Women report poor understanding of the importance of iodine in pregnancy, are inaccurate at identifying foods rich in iodine and are not confident about how to best optimise iodine intake in pregnancy. A similar study, but in non-pregnant women in the UK, was also consistent with these findings with 41% of participants unable to identify any health problem related to iodine deficiency .Although knowledge regarding the importance of iodine is limited, motivation among women to make appropriate dietary changes in pregnancy is high as demonstrated in a qualitative paper on iodine in pregnancy conducted in 48 perinatal women in the UK . The stuAlthough countries outside of the UK have shown similar low levels of knowledge, the UK population may be more vulnerable to possible iodine deficiency in pregnancy , 15. TheIt is interesting that broadly speaking, neither advanced trimester nor parity affected knowledge levels in our study and this would fit with a pattern of lack of accessible information for our pregnant women. The comments centre around a lack of information provided by health care providers and pregnancy literature provided. This contrasts markedly with adequacy of information regarding folic acid. The \u201cPregnancy Book\u201d given to all pregnant women in NI discusses folic acid and advises supplementation of folic acid and vitamin D but fails to mention iodine. Bouga et al. points to community midwives as the main source of dietary advice in pregnancy in the UK but the advice received focussed on multivitamin supplements rather than food choices .A recent Australian survey of 329 midwives reported that the majority rated both the importance of nutrition and the significance of their role in nutrition education as high . Indeed Dietary knowledge about iodine has not always been shown to lead to significantly improved iodine status. O\u2019Kane et al. reported that greater iodine knowledge scores were positively associated with a higher dietary intake of iodine in a non-pregnant population, as measured by a food frequency questionnaire (FFQ) . HoweverPublic health strategies should be considered to increase awareness of the importance of iodine in pregnancy in this population group. Promotion of the BDA food fact sheet about iodine may be a good first step in this process although this may be an insufficient measure without a food fortification programme. Further work re iodine optimisation in this group is warranted.This study has a number of limitations. Data on age, socio-economic status, education level and provision of any previous pregnancy nutritional education were not collected. No information was collected on those that did not complete the questionnaire or who did not want to take part. Those with poor nutritional knowledge may have declined completing this questionnaire potentially affecting results. All data were self-reported with the possibility of reporter bias but this pertains to all similar studies. Data on iodine knowledge among local midwives were not examined in parallel with this cohort and may be an interesting avenue as we endeavour to develop strategies to improve iodine nutrition in pregnancy.This study suggests that dietary iodine knowledge among pregnant women living in NI is poor. In the absence of any iodine fortification programme, women in the UK may be vulnerable to iodine deficiency in pregnancy. At present they are poorly equipped to make positive dietary changes to meet their increasing iodine requirements during pregnancy and breastfeeding.Additional file 1:Questionnaire. Iodine Knowledge Questionnaire. Copy of questionnaire provided in study. (PDF 125 kb)"}
+{"text": "The guest molecules were most likely encapsulated inside inner shell voids of the host. The number of guest molecules depended on the number of biotin residues of the host, which was 15 for non-biotin-containing glucoheptoamidated G3 down to 6 for glucoheptoamidated G3 with 8 biotin residues on the host surface. The encapsulates were not cytotoxic against Caco-2 cells up to 200-\u00b5M concentration in the dark. All encapsulates were able to deliver 5-aminolevulinic acid to cells but aqueous encapsulates were more active in this regard. Simultaneously, the reactive oxygen species were detected by staining with H2DCFDA in Caco-2 cells incubated with encapsulates. The amount of PpIX was sufficient for induction of reactive oxygen species upon 30-s illumination with a 655-nm laser beam.Polyamidoamine PAMAM dendrimer generation 3 (G3) was modified by attachment of biotin via amide bond and glucoheptoamidated by addition of \u03b1-D-glucoheptono-1,4-lacton to obtain a series of conjugates with a variable number of biotin residues. The composition of conjugates was determined by detailed 1-D and 2-D NMR spectroscopy to reveal the number of biotin residues, which were 1, 2, 4, 6, or 8, while the number of glucoheptoamide residues substituted most of the remaining primary amine groups of PAMAM G3. The conjugates were then used as host molecules to encapsulate the 5-aminolevulinic acid. The solubility of 5-aminolevulinic acid increased twice in the presence of the 5-mM guest in water. The interaction between host and guest was accompanied by deprotonation of the carboxylic group of 5-aminolevulinic acid and proton transfer into internal ternary nitrogen atoms of the guest as evidenced by a characteristic chemical shift of resonances in the  Photodynamic therapy (PDT) is a non-invasive and an effective procedure that has been clinically approved for treating a number of diseases, including cancer. PDT is widely used in dermatology in the treatment of actinic keratoses , Bowen\u2019sPDT offers the advantages of minimal invasiveness, better cosmetic outcomes, and minimal functional disturbances. PDT is usually well tolerated and can be applied repeatedly at the same site . The effIn order to avoid protein-assisted ALA influx barrier, we used dendrimeric drug carriers which showed an appreciable efficacy for ALA delivery ,26,27. TD-glucoheptono-1,4-lactone (GHL) and biotin  \u2013CH resonances which were multiplets within the 3.4\u20134.2 ppm region, and versus biotin resonances, some of which were well behind the G3 and gh resonances envelope. The multiplets of 3b, 4b, and 5b  were in the region 1.0\u20131.7 ppm and 8b and 9b quartets at 4.34 and 4.25 ppm, respectively (2(b) signals (triplets) were overlapped and located at 2.3 ppm, this resonance of intensity [120H] was used as an internal intensity reference. Other PAMAM G3 resonances were assigned as before . Thus, in the series of G31B31gh, G32B27gh, G34B24gh, G36B21gh, and G38B17gh, the intensities gh \u2013CH resonances were: 220, 190, 168, 147, and 120, which after dividing the intensity by 7 (number of \u2013CH protons in every gh substituent) gave 31, 27, 24, 21, and 17 gh substituents per conjugate molecule, respectively (The average stoichiometry of G3ectively .a(COOH) = 3.90 and pKa(NH3) = 8.05 [32gh, all the 1H and 13C resonances in NMR spectra of ALA shifted remarkably and remained unchanged until 68 mM concentration. The 1H NMR spectra of the solutions are presented in H2(5), and CH2(3) and CH2(2) resonances  = 8.05 . When th in 32gh B\u2013G. The  2.4 ppm .1H and 13C NMR spectra accompanying the interaction of ALA with G332gh indicated clearly that the carboxylic group underwent deprotonation.The largest chemical shifts for carbon and proton nuclei next to carboxylic group in the 1H NMR spectra of the G3 core changed regioselectively upon interaction with ALA with G332gh. Namely, the \u2013CH2- proton resonances neighboring ternary nitrogen atoms shifted downfield gradually upon addition of ALA. The common resonance of d0, d1, and d2 as well as a0, a1, a2, and a3  shifted from 2.49 and 2.65  did not shift upon addition of ALA . However, the stock solutions in DMSO were finally replaced by aqueous stock solutions  for phototoxicity studies in order to avoid interference from water\u2013DMSO mixtures on metabolic behavior of the colorectal adenocarcinoma model line, i.e., Caco-2 cells. For simplicity the encapsulates would be further abbreviated as A@Dn .Similar NMR spectral patterns of solutions containing G3n of ALA . This is32gh in water was 1.8 (\u00b10.2) nm, while the molecule expanded into 4.0 (\u00b10.2) nm at pH 5 [32gh, G32B27gh, and G36B21gh expanded from 2.0 (\u00b10.2) nm in water into 5.0, 5.3, and 5.4 (\u00b10.3) nm upon addition of 5 equivalents of ALAxHCl and further for solution containing 16 equivalents of ALA. This was attributed to both protonation of tertiary amine groups and encapsulation of ALA.The encapsulation of ALA by conjugates was accompanied by an increase of molecular size of conjugates, comparable to those observed for protonation. Thus, the number-average size determined by dynamic light scattering (DLS) of G3 at pH 5 . The molgh encapsulates, the MTS cell viability assay was performed. The concentration of dendrimers was normalized to the concentration of ALA in acid-containing conjugates which was equal 180, 540 \u00b5M, and 1.08 mM, respectively, in solutions in H2O/DMSO  and water (A@D2 and A@D6). The viability of Caco-2 cells treated with dendrimer conjugates at concentrations of 30, 90, and 180 \u00b5M in H2O/DMSO is shown in To assess the dark cytotoxicity of aqueous and DMSO solutions of PAMAM-biotin conjugates and its ALA@G32O/DMSO . After 24-h incubation, fluorescence at 605 nm was assayed using cytofluorimeter. This wavelength corresponded to the peak of PpIX fluorescence [1, A@D2, A@D4, and A@D8). The greatest shift of the mean fluorescence channel in relation to host dendrimers was observed for A@D1 and A@D2 encapsulates  in comparison with the number-average diameter (5.0 nm both). Considerably, a larger volume-average in relation to the number-average molecular size evidenced the association of dendrimers and was previously found for cytisine-G3gh conjugates [Interestingly, we found that an increased number of biotin residues in the host conjugate did not improve the intracellular level of PpIX in comparable conditions. In fact, in the case of host G3njugates . Another2, H = 4.1 J/cm2) and (B) 60s . With the applied illumination parameters and ALA concentration, we did not observe the phototoxic effect of conjugates dissolved in DMSO and water upon 1-min illumination. The phototoxic effect, manifested by the ROS production in cells illuminated for 30 s, was observed for A@D2 and A@D6 conjugates in aqueous solution, not in the presence of traces of DMSO  induced upon the illumination of treated cells. Caco-2 cells were incubated with conjugates for 24 h and then illuminated with a 655-nm laser beam, corresponding to the PDT window of Protoporphyrin IX. Illumination was performed for (A) 30s .1H and 13C NMR spectra as well as 2-D 1H-1H correlation spectroscopy (COSY), 1H-13C heteronuclear single quantum correlation (HSQC), and the heteronuclear multiple bond correlation spectra (HMBC), were recorded in deuterated water using Bruker 300 MHz  and worked up with TopSpin 3,5 software at the College of Natural Sciences, University of Rzesz\u00f3w.The 1-D N-hydroxysuccinimide ester of biotin (NHS-B) into 0.414 g of G3 (60.3 \u00b5M) dissolved in 3 mL dimethylsulfoxide (DMSO) with vigorous stirring. The mixture was left at an ambient temperature for 12 h, transferred into dialytic tube , and dialyzed against water for 3 days (5 times 3 dm3). Water was evaporated under reduced pressure and products were identified by 1H NMR spectroscopy as G3 substituted with average 1, 2, 4, 6, and 8 equivalents of biotin per one PAMAM G3 molecule: G31B, G32B, G34B, G36B, and G38B, respectively. The isolated yield was above 80% in every case.PAMAM G3 dendrimer was obtained at the 5 millimolar scale according to the procedure published by Tomalia et al. , and stoca 20 \u00b5M of G31B, G32B, G34B, G36B, and G38B with 20% excess of \u03b1-D-glucoheptono-1,4-lactone (GHL) in relation to terminal amine group of G3. In a typical procedure to the 120 mg of G32B (16.3 \u00b5M), 2 mL DMSO solid GHL was added stepwise  with magnetic stirring until it dissolved. The mixture was kept at 50 \u00b0C for 6 h and then dialyzed against water for 2 days. Afterwards, water was removed under reduced pressure and solid products were isolated at >80% yield.The biotin-substituted G3 PAMAM dendrimers were further converted by blocking amine groups in reaction of 1H NMR spectroscopy  were 4.0 (\u00b10.2), 4.2 (\u00b10.3), and 4.4 (\u00b10.3) nm, while the volume-average diameters were 4.6 (\u00b10.2), 5.0 (\u00b10.3), and 5.0 (\u00b10.3) nm, respectively. The size of all conjugates in water were within 1.8\u20132.0 (\u00b10.3) nm (number-average).The molecular size of conjugates was determined by the DLS method as before . The num32gh conjugate and ALA in aqueous solution was monitored by the 1H NMR spectroscopy. Thus, solid ALA was added into an NMR tube containing 5.1 mM G332gh, and NMR spectra were recorded after ALA was dissolved. Addition of ALA was continued until final portion of ALA remained undissolved. The spectrum of the final solution in equilibrium with the precipitate was taken after one day equilibration. The precipitate was separated from the mixture and identified as pure ALA. The final concentration of ALA in the presence of 5.1 G332gh was 76 mM, which was ca twice higher in comparison to the concentration of ALA in a saturated aqueous solution (D2O). The 1H NMR spectra of starting compounds and mixtures of G332gh and ALA are presented in Interaction between the G31B31gh, G32B27gh, G34B24gh, and G38B17gh conjugates and ALA. The results are illustrated by series of 1H NMR spectra of G34B24gh and ALA in D2O in 4B24gh conjugate was 6.2 mM, while the final concentration of ALA was ca 50 mM in equilibrium with the solid. The solid was isolated and identified as a G34B24gh: ALA 1:8 complex. Similar results were also obtained for other conjugates containing a variable amount of biotin.Similar experiments were performed in the case of all G3Bgh conjugates and 36 mM ALA in DMSO were prepared and used as stock solution for biological tests. The 1H NMR spectra of all solutions were examined after one month storage at room temperature and showed no traces of converted ALA.Finally, the 6-mM solutions of G34B24gh and other encapsulates, the 5-mM aqueous solution of 8ALA@G34B24gh encapsulate (10 mL) was dialyzed in a cellulose bag (MWcutoff = 3.5 kDa) against 0.1 M phosphate buffer pH 7.2 (3 dm3) four times for 4 h and at every step. The 1H NMR spectrum of remaining encapsulate was recorded. The final composition of dialyzed encapsulate was determined as 6ALA@G34B24gh.In order to determine the stability of ALA@G332gh, G32B27gh, and G36B21gh, and 6 equivalents of ALA were 5.0, 5.3, and 5.4 (\u00b10.3) nm, which increased slightly upon addition of further 10 equivalents of ALA into: 5.2, 5.4, and 5.5 (\u00b10.3) nm, respectively. The hydrodynamic diameters determined by DLS in aqueous solutions containing G32.Colorectal adenocarcinoma cells (Caco-2) were cultured in eagle medium  supplemented with 10% fetal bovine serum  and 2 mM L-glutamine . Cells were cultured on Petri dishes , flasks, and 24- or 96-well plates  at 37 \u00b0C in a humidified atmosphere of 5% CO2O/DMSO and with aqueous solutions of dendrimers at concentrations of 45, 135, and 270 \u00b5M . Cells incubated with H2O/DMSO  at the same dilutions as the dendrimer served as a solvent control.Caco-2 cells were seeded on a 96-well plate . Cells were treated with ALA encapsulates at concentrations of 30, 90, and 180 \u00b5M in Hd 270 \u00b5M . After 2n conjugates at a concentration of 180 \u00b5M (solutions in H2O/DMSO) and at a concentration of 270 \u00b5M (aqueous solutions). After 24-h incubation at 37 \u00b0C in a humidified, 5% CO2 atmosphere, cells were harvested and washed with PBS . Cells were analyzed using LSRFortessa flow cytometer . Excitation and emission wavelengths were chosen to detect the presence of Protoporphyrin IX in cells: a 405-nm laser was used as a fluorescence excitation source, and the fluorescence was measured at 605 and 710 nm. For data analysis, Flowing Software 2.5.1 was used .Caco-2 cells were seeded on a 24-well plate . Cells were treated with A@Dn encapsulates at concentration of 180 \u00b5M (solutions in H2O/DMSO) and at a concentration of 270 \u00b5M (aqueous solutions). After 24-h incubation at 37 \u00b0C in a humidified, 5% CO2 atmosphere, culture medium was harvested. Cells were stained with 10 \u00b5M of H2DCFDA for 30 min in PBS with 10% FBS and washed twice with warm PBS with 2.5% FBS. Next, cells were illuminated ((A) \u03bb = 655 nm, E = 137 mW/cm2, H = 4.1 J/cm2 and (B) \u03bb = 655 nm, E = 137 mW/cm2, H = 8.2 J/cm2). Then cells were harvested, washed in PBS, and analyzed using LSRFortessa flow cytometer . For data analysis, Flowing Software 2.5.1 was used .Reactive oxygen species (ROS) induction was assessed by measuring the 488-/530-nm fluorescence of H2DCFDA , Molecular Probes, Thermo Fisher Scientific, Inc., Waltham, MA, USA. In this regard, Caco-2 cells were seeded on a 24-well plate . Cells were treated with A@DBgh carriers enter the cells of normal fibroblasts (BJ), squamous cell carcinoma (SCC-15), and glioblastoma (U-118 MG) within 24 h in a time- and concentration-dependent manner and are 3\u20134 times less cytotoxic than the non-biotinylated carrier. All cell lines survived a 50-\u00b5M concentration of G3Bgh as well as keratinocytes (HaCat) [Nanosized dendrimers are currently tested as drug delivery systems in many laboratories. The current state of nanotechnology applications in colorectal cancer has been recently reviewed, including clinical trials and status . The chi (HaCat) ,42. Bgh), is a highly effective host to encapsulate 12-6 molecules of 5-aminolevulinic acid (ALA) in water. Aminolevulinic acid was deprotonated and hydrogen cation was transferred from its carboxylic group into internal ternary nitrogen atoms of the host. The encapsulated guest molecules were bound by ionic interaction and were released slowly in neutral pH. The payload of encapsulates depended on the number of biotin residues in the conjugate and equaled 12 for one biotin-containing conjugate. In this paper, we found that the third generation polyamidoamine dendrimer, with amide-linked biotin and glucoheptoamide substituents  at a 1-mM concentration of ALA for 24 h, the rapid increase of Protoporphyrin IX was observed. The Protoporphyrin IX-induced cells produced single oxygen upon 30-s irradiation with a 655-nm laser pulse. Both phenomena accompanied the regular response and photocytotoxicity pattern for photodynamic anticancer therapy, including colorectal cancer ,12.Bgh offered the possibility to use this PSDS in local treatment if the concentration of deposited encapsulates was higher. In order to estimate the effectiveness of the designed PSDS, the PK profiles were needed from in vivo studies on model animals. In local PS delivery, the concentration of G3Bgh could be higher than 0.3 mM; thus, the ALA concentration could be at least 3 mM. Another issue to optimize in vivo is the number of biotins in G3Bgh; here we did not find the difference in Protoporphyrin IX level between the 2 and 6 biotin-containing host. The elaborated PSDS is currently being tested for treatment of the skin impairments encountered in the introduction [The encapsulates of ALA in G3oduction ."}
+{"text": "The visualization of colorimetric changes in the different PCV-2 concentrations was possible without the use of equipment. The biosensor production methodology presented reproducibility and specificity, as well as easy synthesis and low cost. An enhanced version of it may be used in the future to replace traditional tests such as PCR.The aim of the current study is to introduce a methodology aimed at producing a biosensor that uses gold nanoparticles (AuNPs) to detect porcine circovirus 2 (PCV-2). This biosensor was based on AuNPs, which were modified with self-assembled monolayers (SAMs) and antibodies. The AuNPs\u2019 surface and virus modification process applied to enable antibody binding was accompanied by localized surface plasmon resonance (LSPR), surface plasmon resonance (SPR), transmission electron microscopy (TEM), and energy-dispersive X-ray spectroscopy (EDX). Virus quantification was possible by the light absorption difference in the spectrum at concentrations of 10 Circoviridae, genus Circovirus, which comprises three endemic types, PCV-1, PCV-2, and PCV-3 [Porcine circovirus diseases (PCVD) is one of the most important diseases affecting domestic swine production; it is caused by porcine circovirus 2 (PCV-2) belonging to the family The PCV-2 has a single-stranded DNA genome, with 1760 bases, wrapped by an icosaedric capsid . This vi9 to 1012 DNA copies/mL; animals with moderate lesions have a rate of 107 DNA copies/mL; mild lesions represent a rate of 105 to 106 DNA copies/mL, and animals with rates below 104 DNA copies/mL do not present clinical signs [PCV-2 can infect wild and domestic pigs presenting different health standards. Viral transmissions result from direct contact with infected animals and through oral, nasal, oropharyngeal, fecal, and urine fluids. There are also reports about transmission through semen and colostrums . PCV-2 ial signs . PCV-2 ial signs .PCV-2 diagnosis is initially carried out by veterinarians who analyze animals\u2019 clinical signs and request laboratory tests such as hybridization in situ, quantitative PCR (qPCR), PCR, immunoperoxidase, and immunofluorescence in order to investigate the presence of the antigen or nucleic acid of PCV-2. However, both techniques have some limitations that can influence the outcome, such as expansive sample analysis and the need for specialized professionals and specific equipment to perform them ,3,14.PCV-2 prevention and control must be implemented in farms based on hygiene measures, correct feeding, stress reduction, sick animals\u2019 removal, and herd vaccination, which often takes place within the first four weeks of piglets\u2019 lives. However, the vaccine is not yet 100% effective, because factors such as changing manufacturers, conditioning temperature, and non-vaccination of the whole herd enable PCV-2 to keep on affecting animals . PCV-2 iThe use of nanomaterials to develop a diagnostic platform has been gaining more and more space in recent years. The use of nanopolymers, nanotubes, and nanoparticles represent a growing biosensors production market. More specifically, gold nanoparticles (AuNPs) provide unique features such as biocompatibility and easy protein functionalization, which make them ideal to produce remote analysis kits ,16. AuNPThe aim of the current study was to introduce a methodology aimed at enabling an easy and simple PCV-2 quantification based on the use of gold nanoparticles. In this biosensor development, storage at room temperature (25\u00b0) maintained stability without losing the properties of the reagents and was economical, at a cost of $3 per sample.4); sodium citrate dehydrate 99%; 11-mercaptoundecanoid acid, 95% (MUA); absolute ethanol 99%; N-(3-imethylaminopropyl) -N\u2032ethylcarbodiimide hydrochloride (EDC); N-hydroxysuccinimide (NHS) 98%; phosphate-buffered saline (PBS); glycine\u2013HCl (pH 3.0), and bovine serum albumin solution (BSA) 98%  were purchased at Merck . The deionized water used in the current study came from a Millipore unit . All working solutions were prepared with analytical grade chemicals.Gold (III) chloride trihydrate 99.99% (HAuClv/v), based on the protocol described by Johnstone and Thorpe 1996. Rabbit IgG antibody anti-PCV-2 was purified with a 5 mL column HiTrap\u00ae Protein G , according to the manufacturer\u2019s instructions. The purified IgG protein concentration was 8 mg/mL, which was based on the BCA methods, using BSA as protein standards, as described by Smith et al., 1985.  and 10 negative samples also confirmed by the qPCR technique were used in the current study. All samples were collected from animals bred in farms served by the Molecular Diagnostic Laboratory at S\u00e3o Paulo State University, Botucatu, Brazil.Thirty positive serum samples with PCV-2 virus presence confirmed by the qPCR technique , according to the manufacturer\u2019s instructions. The DNA was eluted with 100 mL of elution buffer. Extraction control (nuclease-free water) was included in each extraction procedure.\u22121, and a wavelength accuracy of 0.5 nm. The binding process observed during the experiment was analyzed in surface plasmon resonance equipment (SPR) . The planar gold sensor SPR discs (17 mm diameter) were purchased from Autolab. All experiments were carried out at 22 \u00b0C. The absorbance and wavelength graph was generated in a Biochrom LiraS11 spectrophotometer  in a 1 cm glass cell, a 1 nm step; a speed of 500 nm min6 200 KV coupled to an EDX operating system . The copper grids used in the experiment were covered with carbon film and placed in 10 \u00b5L of sample; next, they were left to dry at room temperature for two days prior to analysis.The size and dispersion of gold nanoparticles at different scales were characterized through transmission electron microscopy (TEM), and energy-dispersive X-ray spectroscopy (EDX) in a JEOL-JEM2100 LaBViral quantification of samples was performed based on the qPCR technique. It was done by using a 7500 Fast Real Time PCR System, Thermo Fisher Scientific, Foster City, CA, USA.4 solution (1 mM) added, which was stirred at 100 \u00b0C to the boiling point. Next, 2 mL of sodium citrate (10 mM) was added to the Erlenmeyer glass. The solution, which was yellow, turned red because the sodium citrate reduced the Au3+ complex to Au0, which led to the formation of nanoparticles. The excess of citrate anions in the solution enabled the gold metal surface to give a negative charge to each nanoparticle. The AuNPs solution was cooled to room temperature and stored in amber glass in a refrigerator (\u22122 \u00b0C). The synthesis of gold nanoparticles was based on Basso et al. . An Erle\u22121) was added to 2 mL of AuNPs solution for 40 min at 25 \u00b0C, which resulted in irreversible thiol adsorption on the AuNPs surface. Next, 100 \u00b5L of the 1:1 solution containing EDC (0.4 mol L\u22121) and NHS (0.1 mol L\u22121) was added and remained there for 40 min to activate terminal carboxylic groups that were capable of creating covalent bonds with antibodies\u2019 amines.Self-assembled monolayers (SAMs) were formed and worked as anchor molecules to enable antibodies to bind to the AuNPs surface. SAMs provided optimum conformational conditions, as well as stability and an excellent microenvironment for biocatalytic activities, which enables biomolecules to guide nanoparticles without denaturation . Alkanet\u00ae qPCR Master Mix kit , according to the manufacturer\u2019s instructions. Reaction conditions were 95 \u00b0C/2 min, 40 cycles at 95 \u00b0C/15 s and 60 \u00b0C/1 min, followed by a melting curve from 95 \u00b0C to 60 \u00b0C. Extraction and reaction controls (nuclease-free water) were processed with the test samples. The viral load was determined based on absolute quantification. A standardized plasmid was diluted from 108 to 105 copies of DNA/mL in duplicate to produce a standard curve. The standard curve was included in each processed plate. Viral load was expressed as the number of DNA copies/mL.The forward (5\u2032-GAT GAT CTA CTG AGA CTG TGT GA) and reverse (5\u2032-AGA GCT TCT ACA GCT GGG ACA) primers described by Ladekjaer-Mikkelsen et al.  were useAll of the AuNPs surface modification stage was monitored through the localized surface plasmon resonance (LSPR) spectroscopy technique; they presented absorbance peak reduction and wavelength shift . Changes7 DNA copies/mL PCV-2; after their addition, there was an absorbance peak decrease to 0.86 and wavelength shift to 550 nm (yellow line). The second sample plotted on the graph had a PCV-2 concentration of 7.8 \u00d7 109 DNA copies/mL, which resulted in a significant absorbance peak decrease to 0.30 and wavelength shift to 610 nm (pink line). The addition of both samples indicated antigen\u2013antibody binding and complex formation. All samples were quantified based on the qPCR technique.AuNPs without surface modification showed an absorbance peak of 1.44 at 526 nm (black line); this value is typical of AuNPs, as described in the literature . Thiol b\u22122 of material attached to the gold sensor corresponds to 120 millidegrees in the plasmon resonance angle [All modification steps were also followed by surface plasmon resonance (SPR), which enabled adsorption and desorption kinetics in each modification at real time . Accordice angle .9 DNA copies/mL) was added and remained there for 30 min; after the washing procedure was over, there was small drop in the graph in comparison to the virus injection point. This outcome indicated that the virus bond to the antibody immobilized on the sensor surface. Glycine-HCL solution (100 \u00b5L) was added and remained there for 15 min, so it was possible going on with the experiment by using a different sample. Glycine\u2013HCL broke the antigen\u2013antibody binding, but it preserved the SAMs/antibody/BSA complex on the sensor surface, which was ready to analyze the second sample. The aliquot of 100 \u00b5L of PCV-2 virus negative serum sample subjected to qPCR was added in order to allow analyzing the binding specificity of the immobilized antibody on sensor surface. This sample was used a negative control in the experiment, and it remained on the sensor surface for 30 min. After the washing procedure was over, there was total drop in the graph line in comparison to the negative sample injection point, which indicated antigen\u2013antibody binding specificity. The antibody did not recognize any protein normally present in swine serum that could react with it, such as albumin. After the injection of each solution and their respective incubation time, the sensor surface was washed with PBS buffer to remove the weakly bonded molecules and excess of molecules. All these steps are shown in the graph by the blue arrows pointing downwards.The gold sensor surface was cleaned with ultrasound detergent for 30 min. Next, it was washed 10 times with deionized water and dried with lens paper. The sensor was inserted into the equipment, and 100 \u00b5L of the MUA solution was added to its surface to enable SAMs formation. The solution remained there for 24 h. Then, the sensor surface was washed with pH 7.4 phosphate buffer (PBS) to remove the excess of MUA from it. EDC\u2013NHS solution was added to activate the carboxylic groups and remained there for 30 min before it was washed with PBS. The aliquot of 100 \u00b5L of antibody was injected at 2.5 \u00b5g/mL and remained there for 30 min. After the washing procedure was over, there was slight drop in the SPR chart line, which indicated a RU of 1235 equivalent to 10.3 of antibodies attached to the sensor. Then, BSA solution (1 mg/mL) was added and used to fill the blanks on the sensor surface in order to avoid false positive connections. Washing with PBS has removed the unbound material. The 50-\u00b5L aliquot of PCV-2 sample  (5 DNA copies/mL showed an absorbance peak of 0.85 at a wavelength of 547 nm (black line). The red line on the graph showed the concentration of 8.8 \u00d7 106 DNA copies/mL with an absorbance peak of 0.75 at 564 nm. The concentration of 1.8 \u00d7 107 DNA copies/mL showed an absorbance peak of 0.73 at 574 nm (green line). The blue line showed an absorbance peak of 0.71 at 577 nm for the concentration 1.8 \u00d7 108 DNA copies/mL, and the last concentration (7.8 \u00d7 109 DNA copies/mL) showed an absorbance peak of 0.68 at wavelength of 580 nm (pink line). Based on this graph analysis, it was possible observing an absorbance peak intensity decrease and wavelength shift in samples with higher PCV-2 concentrations. Similar results were observed by Basso et al. [5, 106, 107, 108, and 109 DNA copies/mL virus) showed an R2 value of 0.99  A. One sao et al.  and Wango et al. , and theo et al. . The cal of 0.99 B. Variat of 0.99 C. NegatiThis AuNPs/SAMs/antibody/sample PCV-2 complex was measured over the following three months and showed good biosensor stability.TEM and EDX images were generated to confirm the UV-Vis graph and view AuNP surface modifications . The firThe software in the equipment analyzed AuNPs\u2019 size and dispersion in the grids and provided the herein indicated size (in nm). All the experiments in the current study were performed in triplicate.Tests using pig serum that tested negative for PCV-2 were performed based on the qPCR to evaluate the experimental specificity and selectivity . Five saCircoviridae. Non-enveloped DNA viruses belonging to the Parvoviridae and Adenoviridae families were tested to verify the binding specificity of the antibody used [In addition, we evaluated the detection of viruses in the presence of potential interferences to validate the proposed methodology. PCV-2 is a non-enveloped DNA virus belonging to the family ody used ,36. AnotThe current study introduced a methodology for PCV-2 diagnosing in pig serological samples. The conjugation between AuNPs and antibodies by SAMs has formed a stable and specific complex for the PCV-2, which kept the reproducibility of the results. The methodology also proved to be simple and easy to be implemented in comparison to traditionally techniques such as qPCR. The final cost of the analysis was also significantly lower: $3 per sample. Since the disease is caused by an immun-suppressive agent, animals become more prone to develop other diseases, as well as to present emaciation, which has further negative impact on farmers\u2019 incomes. Early PCV-2 detection allows applying the proper treatment to pigs."}
+{"text": "Robustness, compactness, and portability of tensegrity robots make them suitable candidates for locomotion on unknown terrains. Despite these advantages, challenges remain relating to ease of fabrication, shape morphing (packing-unpacking), and locomotion capabilities. The paper introduces a design methodology for fabricating tensegrity robots of varying morphologies with modular components. The design methodology utilizes perforated links, coplanar (2D) alignment of components and individual cable tensioning to achieve a 3D tensegrity structure. These techniques are utilized to fabricate prism (three-link) tensegrity structures, followed by tensegrity robots in icosahedron (six-link), and shpericon (curved two-link) formation. The methodology is used to explore different robot morphologies that attempt to minimize structural complexity (number of elements) while facilitating smooth locomotion (impact between robot and surface). Locomotion strategies for such robots involve altering the position of center-of-mass  to induce \u201ctip-over.\u201d As an example, a sphericon formation comprising of two orthogonally placed circular arcs with conincident center illustrates smooth locomotion along a line (one degree of freedom). The design of curved links of tensegrity mechanisms facilitates continuous change of the point of contact  that results from the tip-over. This contrasts to the sudden and piece-wise continuous change for the case of robots with traditional straight links which generate impulse reaction forces during locomotion. The two resulting robots\u2014the Icosahedron and the Sphericon Tensegrity Robots\u2014display shape morphing (packing-unpacking) capabilities and achieve locomotion through internal mass-shifting. The presented static equilibrium analysis of sphericon with mass is the first step in the direction of dynamic locomotion control of these curved link robots. Tensegrity structures are comprised of disconnected rigid compressive elements (links) suspended by a network of pre-stressed tensile elements (cables). The redundant links impart robust and fault tolerance, the strategic prestressed cable-link combination provides them with compliance and shape morphing ability (packing-unpacking)  but do not move during assembly. Cables are intentionally cut past their tuned free length so that routing to distant holes does not require stretching cables or forcing links into position. With sufficiently oversized cable lengths, all connections may even be made on a flat surface, eliminating the need for jigs . FinallyThe proposed methodology provides the benefits of rapid prototyping and hassle-free assembly, and cable manipulation capability. The components are quickly produced, applicable to a range of designs, and simple to assemble. Cutting a link by laser takes around 2 min, while printing the same link through an FDM process takes 45 min (machine preparation times are approximately the same). Only five tools are used: fabric shears to cut cables, a BOSS LS-1416 laser cutter for the links, a wrench and hex key to modify the clamping force of the nut-bolts and forceps to grab difficult-to-grasp cables when tuning. Additionally, individual cables may be passively and independently clamped and removed without pretensioning. Icosahedron, as illustrated in The three-link prism  and the Tensegrity mechanisms adapted to mobile robots conventionally achieve locomotion through rolling about their body. Intuitively, morphologies resembling spheres facilitate smooth rolling which can be defined as continuous change in the point of contact along the body as the robot moves. Traditional straight link robots are limited in their ability to approximate a spheres curvature and achieve smooth rolling motion. Closer approximations to a sphere require increases in structural complexity, i.e., more links, cables and connections. For example, as shown in Another approach to achieving smooth rolling locomotion is by directly introducing curvature to the compressive rigid links. Here, the curvature introduces additional bending moment to links (straining the definition of tensegrity). Smooth uniaxial rolling locomotion has been achieved using tensegrity mechanism comprising of two curved links\u2014a morphology that resembles a condensed spehricon, rather than a sphere   and Sphericon (curved two-link) Tensergrity Robots.The three orthogonal links were modified to incorporate mass-shifting systems and the electronics payload was distributed over two additional links as highlighted in This morphology overcomes challenges faced by the previous case and incorporates mass-shifting systems into both curved links while the control payload was bundled and suspended in the center of the robot as illustrated in This tensegrity robot can be modeled as a sphericon mechanism . They arI coordinate system be fixed in the inertial reference frame with origin at a point on a planar surface and orthonormal basis vectors B coordinate system be fixed on the body reference frame, origin at the center of the sphericon and orthonormal basis vectors {\u00eax, \u00eay, \u00eaz}. The rotation matrix defining the relationship between the two coordinate systems can be written as . Thereafter, it is rotated by \u2212\u03b3 about the z-axis of the intermediate coordinate system (\u00ea3) as illustrated in B and inertial I coordinate systems arewhere the mechanism is rotated 45\u00b0 about the y-axis of the inertial coordinate system Consequently, the velocity of these points can be calculated asThe potential energy of the system is equivalent toThe static equilibrium positions of the mechanism can be obtained through the Lagrange's equations where the kinetic energy is zero and the generalized coordinate is \u03b3The paper presents a design methodology for fabricating tensegrity robots of varying morphologies with modular components that facilitates rapid prototyping and hassle-free assembly, and capabilities to manipulate cable positions and tensions during assembly. Exploration of desirable morphologies for locomotion is critical to the design of tensegrity robots and includes investigation of their shapes (straight versus curved links), their placement (location of center of link arcs), number of links and even non-structural elements. The resulting two autonomous shape morphing tensegrity robots\u2014the straight link Icosahedron and curved link Sphericon morphology\u2014achieve locomotion through internal mass-shifting utilizing the presented mass-shifting mechanism. The curve link tensegrity robot demonstrates smooth locomotion and packing behavior with folding-deployment orientations.All datasets generated for this study are included in the article/TR fabricated all the tensegrity morphologies, designed the mechatronics, programming logic of the robots and contributed to the writing the draft. CG assisted TR with fabrication, writing and performed the mathematical analysis. VV supervised the research and oversaw all the activities.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Taxomyces andreanae, azadirachtin A and B from Eupenicillium parvum, vincristine from Fusarium oxysporum, and quinine from Phomopsis sp. The discovery of the billion-dollar anticancer drug taxol was a landmark in endophyte biology/research and established new paradigms for the metabolic potential of plant-associated endophytes. In addition, endophytic fungi have emerged as potential prolific producers of antimicrobials, antiseptics, and antibiotics of plant origin. Although extensively studied as a \u201cproduction platform\u201d of novel pharmacological metabolites, the molecular mechanisms of plant\u2013endophyte dynamics remain less understood/explored for their efficient utilization in drug discovery. The emerging trends in endophytic fungi-mediated biosynthesis of novel bioactive metabolites, success stories of key pharmacological metabolites, strategies to overcome the existing challenges in endophyte biology, and future direction in endophytic fungi-based drug discovery forms the underlying theme of this article.Plant-associated endophytes define an important symbiotic association in nature and are established bio-reservoirs of plant-derived natural products. Endophytes colonize the internal tissues of a plant without causing any disease symptoms or apparent changes. Recently, there has been a growing interest in endophytes because of their beneficial effects on the production of novel metabolites of pharmacological significance. Studies have highlighted the socio-economic implications of endophytic fungi in agriculture, medicine, and the environment, with considerable success. Endophytic fungi-mediated biosynthesis of well-known metabolites includes taxol from  Endophytes represent biological reservoirs of novel natural products, opening new avenues in the frontiers of drug discovery. Plant-associated microorganisms that colonize the internal tissues of all plant species are gaining momentum as key targets for bio-prospection in the search for novel chemical entities ,2. The dWith the emerging threat of drug-resistant microbes and antimicrobial resistance (AMR), it has become essential to discover novel antimicrobials to counter AMR. However, the low pace of discovery and indiscriminate use of the existing antibiotics have further necessitated the exploration of novel antimicrobial entities to compensate for the drying drug pipeline ,6,7,8. TTaxomyces andreanae in 1993 [With increasing research on the discovery of natural products from biological species, endophytes are increasingly being explored as production platforms for bioactive metabolites with diverse chemical structures. The discovery of taxol from the endophytic fungus  in 1993 , and sub in 1993 ,17. EndoAlthough plant-associated endophytes serve as \u201cbiosynthetic platforms\u201d of pharmaceutically important secondary metabolites, challenges exist in terms of the limited knowledge of endophyte biology and decreased production of secondary metabolites due to repeated sub-culturing of endophytic strains, projecting a need to adopt a more integrated and systematic approach towards the exploitation of endophytes in drug discovery and research. In this direction, a comprehensive insight into plant\u2013endophyte associations and their dynamics is necessary to understand how and why endophytes biosynthesize secondary metabolites . AnotherMoreover, approaches in metagenomics, whole-genome sequencing, and omics biology have further enabled access to the less explored natural product reservoirs of plant-associated endophytes. The existing and emerging trends in endophytic fungi-mediated biosynthesis of novel bioactive metabolites, success stories of key pharmacological metabolites, strategies to overcome the existing/forthcoming challenges in endophytic biology, and future directions/outcomes in endophytic fungi-based drug discovery form the underlying theme of this article.Plants possessing pharmacological properties and bioactive metabolites are used to treat ailments in modern healthcare . The smaPlant-associated endophytes comprise bacterial and fungal species that colonize internal plant tissues and complete their partial or entire life cycle inside the host plant. Showing universal occurrence and inhabiting almost all vascular plant species, endophytes demonstrate multifaceted advantages to the host plant by promoting growth, conferring tolerance to biotic/abiotic stresses , and bioEndophytic fungi produce diverse kinds of bioactive metabolites and are categorized as terpenoids, indole alkaloids, polyketides, and non-ribosomal peptides  biosynthFusarium, Aspergillus, Penicillium, and Alternaria [Pestalotiopsis microspora. The novel solid-state NMR approach led to structural elucidation and a dimeric structure was suggested for ambuic acid, consisting of a hydrogen-bonded adjacent carboxyl group, including the lattice structure details, an excellent study performed for the first time on a natural product. The bio-prospection of endophytic fungi suggests that very few fungal strains have been studied in-depth, with others highlighting the potential for the existence of enormous novel candidates. The dominant taxonomic categories for the synthesis of chemical entities are from the orders Ascomycota (~97%), Basidiomycota (~2%), and Mucoromycota (~1%), and the key metabolite-rich strains include ternaria ,138. Theternaria , metabolternaria ,141. Sevternaria . Among tternaria , loline ternaria , chitosaternaria , taxol aternaria , fatty aternaria , and ascternaria , among oternaria  predicteMuscodor spp. has gained momentum in multi-faceted applications. Diverse types of volatile organic compounds (VOCs) are produced by Muscodor spp. and comprise aldehydes, aromatics, esters, alcohols, terpenoids, and nitrosamides, among others [Muscodor spp., includes agricultural applications , food preservation, the perfume industry, and bioactive compounds in healthcare [Penicillium chrysogenum MTCC 5108 [Furthermore, the quorum-sensing activity of ambuic acid in Gram-positive bacteria suggested its development as a potent antipathogenic drug for targeting the virulence expression of Gram-positive bacteria. The compound, ambuic acid, inhibited quorum sensing in bacteria via the inhibition of gelatinase biosynthesis-activating pheromone (GBAP) biosynthesis . Anotherg others . The endalthcare . In addiTCC 5108 . SimilarTCC 5108 . Plant-associated endophytes have gained significant momentum in bio-prospection and isolation of bioactive metabolites with multi-faceted attributes. In this direction, literature reviews have provided key insights into the existing and emerging significance of endophytes in drug discovery and research\u2014a few articles worth mentioning include Discussion on biodiversity of endophytes and its exploitation in drug discovery , BioactiParaconiothyrium SSM001 to tackle host pathogens [Evolutionary studies have suggested an important role of fungal partners in plant adaptation/colonization in terrestrial systems . Severalathogens . Furtherathogens , such asathogens . In termathogens . An inteathogens .Fusarium solani utilizing the host enzyme strictosidine synthase for CPT biosynthesis, suggesting the horizontal transfer of gene clusters between endophytic fungi and host plants in an evolutionary course [Recent advances in scientific interventions and whole-genome sequencing have contributed substantially to the bio-prospection of endophytic fungi to produce pharmacological metabolites. Endophytic fungi and their metabolic pathways are key targets for research. Although the metabolic pathway has defined a genetic framework to produce a specific metabolite, gene clusters mostly remain silent under laboratory conditions . Moreovey course . Both eny course . HoweverKey strides have been made in the discovery and characterization of valuable bioactive metabolites from natural sources. Substantial efforts to identify novel bioactive metabolites have opened new avenues in natural product-based drug discovery from endophytic fungi. The increasing importance of natural products in pharmacological applications has greatly impacted the large-scale production of high-value metabolites. Plant\u2013microbe associations, particularly endophytic fungi, continue to intrigue researchers worldwide with a considerable potential to impact the pharmaceutical industry ,165. WitRecently, there has been an increased exploration of plant\u2013endophytic associations for the discovery of high-value metabolites with potential pharmacological applications. Deep learning methods have defined an interesting platform for the bio-prospection of endophytes, regulatory networks, and the prediction of novel chemical entities . As discAspergillus terreus when co-cultivated with Podocarpus gracilior leaves [Another interesting strategy is the co-cultivation of different endophytic fungal strains to elicit gene expression in silent gene clusters . For exar leaves . Furtherr leaves , host rir leaves , and mutr leaves . In addir leaves , and mosOne of the key approaches for analyzing large data comprises artificial intelligence, further classified as deep learning and machine learning. These methods predict the distribution pattern of the plant microbiome  and may accurately predict the biosynthesis of bioactive metabolites from endophytes , highligAdvances in computational biology and whole-genome sequencing have been instrumental in defining new avenues for endophyte-mediated natural product discovery. Comparative genomics aims to understand the diversity of chemical entities from microbes because of the conserved BGCs across species, associated with regulatory genes, uptake, and product transport . MoreoveTaxomyces andreanae, similar to its plant host (Taxus brevifolia) in 1993, endophytes have been increasingly explored for the production of high-value metabolites. Plant-associated endophytes, particularly endophytic fungi, have emerged as production platforms for pharmacological metabolites with diverse therapeutic applications [Medicinal plants form the backbone of the traditional system of medicine and are a rich source of pharmacological metabolites for the treatment of diseases and prospects as modern medicines . Since tications . There hTaxus brevifolia, but its concentration was too low (0.001\u20130.05%) in most species. Therefore, 1 g of taxol production requires 15 kg of tree bark, while the anticancer dose amounts to 2.5 g [Taxomyces andreanae [The anticancer drug taxol is one of the most successful drugs marketed globally for its anticancer activity. Taxol was isolated from the medicinal plant to 2.5 g . To incrndreanae , and subndreanae .T. andreanae was discovered in Taxus brevifolia, detected via electrospray mass spectroscopy [Taxus baccata L.), characterized, and validated using HPLC-MS [Fusarium redolens, Gibberella avenacea, Fusarium tricinctum, Paraconiothyrium brasiliense, and Microdiplodia sp. G16A, with the highest taxol yield of 66.25 \u03bcg/L by Fusarium redolens [Taxol and its derivatives represent a popular class of anticancer drugs produced by different endophytes. The mechanism of action includes inhibition of mitosis and promotion of tubulin depolymerization during cell division . After stroscopy  and comp HPLC-MS . The fivredolens . The ditredolens ,216. Howredolens .Paraconiothyrium sp. with Alternaria sp., and Phomopsis sp. enhanced taxol production eightfold [Agrobacterium-mediated transformation [Presently, considering the global market for anticancer drugs, research efforts have been made for large-scale production of taxol from endophytic fungi ,219,220.ightfold . Geneticightfold , Agrobacormation , electroormation , and genormation  are someCamptotheca acuminata, a native Chinese tree. CPT has a pentacyclic structure and is a topoisomerase inhibitor that binds to topoisomerase I and DNA complex and stabilizes it, leading to DNA damage and apoptosis . In clinical trials, CPT showed anticancer activity against colon, lung, breast, and stomach cancers. The commercial success of CPT is attributed to its applications in cancer chemotherapies, and its derivatives are marketed with the name belotecan, topotecan, irinotecan, and trastuzumab deruxtecan [Nothapodytes nimmoniana and C. acuminata and has a high global demand for cancer treatment [CPT is a monoterpene indole alkaloid that is commercially marketed as an anticancer drug. Initially, it was isolated from the stem and bark of ruxtecan ,230. CPTreatment . Althougreatment ,233. Thereatment . To prodreatment , leadingTrichoderma atroviride LY357 [Fusarium solani strain ATLOY-8 [Neurospora sp. [Alternaria sp. from N. nimmoniana. The endophyte produced up to ~200 \u03bcg/g of CPT in axenic cultures and demonstrated cytotoxic activity against cancer cell lines [The emerging popularity of endophytes as production platforms for high-value metabolites necessitates the potential bio-prospection of endophytes for natural product drug discovery. CPT-producing endophytes have been discovered, including de LY357 , Fusariu ATLOY-8 , and Neupora sp. . Howeverpora sp.  reportedll lines . Regardill lines  identifill lines , limitinll lines .Catharanthus roseus) and are listed on the World Health Organization\u2019s List of Essential Medicines [https://en.wikipedia.org/wiki/ accessed on 23 July 2021). Vinblastine is an analog of vincristine, and its anticancer mechanism is defined by binding to tubulin, thereby inhibiting microtubule assembly and formation, and is regarded as an effective chemotherapeutic agent. Two of the most successful commercial drugs\u2014vinblastine and vincristine\u2014are present at very low concentrations in plants. Moreover, the estimated global demand for bioactive metabolites  and global market of USD 200 million projects additional requirements from alternative natural resources [C. roseus leaves is required to produce 1 g of pure vincristine. Although vinca alkaloids differ slightly in their chemical structure and mechanisms, their clinical activity and toxicity vary. The commercial success and importance of vinca alkaloids have led to studies on endophytes from C. roseus. Several endophytic fungi were isolated and screened to produce vincristine/vinblastine, and a few key examples are Aspergillus, Alternaria, and Cladosporium sp. Moreover, the endophytic fungus Talaromyces radicus (from C. roseus) produced vincristine in substantial amounts (670 \u03bcg/L) in modified M2 medium and vinblastine in PDB medium (70 \u03bcg/L). Furthermore, vincristine was purified, and it demonstrated cytotoxic activity against cancer cell lines [Vinca alkaloids are pharmacological metabolites isolated from Madagascar periwinkle  (antitumor metabolite), and genome shuffling of eight parental protoplasts resulted in a high-yielding strain (produced >200-fold DAM) in the transgenic endophytic strain [Pestalotiopsis microspores (endophytic fungi) aimed to decode the taxol biosynthetic pathway via protoplast transformation [Ozonium sp. strain BT2 (taxol-producing fungi) [Agrobacterium-mediated genetic transformation in Ozonium sp. EFY21, with enhanced efficiency of transformation [Ozonium sp. EFY-21 [Escherichia coli and transformed into Alternaria alternata TPF6 for taxadiene production. This study was able to address the challenges associated with the first step of taxadiene production, and a consistent supply of taxadiene in A. alternata TPF6 (61.9 \u00b1 6.3 \u03bcg/L) was obtained [Studies on the engineering of endophytes are preliminary and investigate endophyte chassis to improve the yields of targeted metabolites through genetic strategies. Genetic manipulation of endophytes defines potential future outcomes by introducing key pathway genes via genetic transformation for yield enhancement of high-value metabolites in axenic cultures. Studies on the genetic transformation of taxol-biosynthesizing endophytes include the overexpression of genes and genome rearrangement with mutagenesis for enhanced metabolite production ,258. Ranc strain . Similarormation . These ug fungi) ; Agrobacormation  and PEG-. EFY-21 . In thisobtained . The inaNodulisporium sylviforme. The taxol production in the mutant strain increased to 468.62 \u03bcg/L compared to the parent endophyte strains, suggesting mutagenesis as a powerful approach for yield enhancement, with some considerations. To exploit endophytes on a commercial scale, it is imperative to understand and tap into the biosynthetic potential of endophytes to enhance the yield of high-value metabolites. To address the concern toward low-yielding endophyte strains, strain improvement strategies may be employed to enhance yield and other characteristics, including utilization of nitrogen/carbon sources, changes in morphology, and reduction in undesired metabolites . In addiCorynespora cassiicola SUK2 and Colletotrichum fructicola SUK1 (endophytic fungi), isolated from Nothapodytes nimmoniana (Grah.) Mabb. (Ghanera), demonstrated host-independent biosynthesis of CPT under fermentation conditions, with a significantly higher yield (>1.4-fold) than that of monocultures [E. coli with Gliocadium roseum (endophytic fungi) and increased hydrocarbon production by 100-fold, compared to pure cultures of G. roseum. Other key examples, namely co-cultivation of Phomopsis and Alternaria, led to an eightfold increase in taxol production [Alternaria and Paraconiothyrium SSM001 co-cultures led to a threefold increase in taxol production, and other examples suggest that co-culturing of compatible endophyte strains highlights an attractive alternative for yield enhancement of high-value metabolites. With the discovery of many endophytes and bio-prospection of their respective strains, the compatibility of endophytes to produce a target metabolite has been explored . The indcultures . Ahamed cultures  co-cultioduction , and AltNeurospora intermedia DP8-1 (diuron-degrading endophyte) from sugarcane and reported effective biodegradation of up to 99% of the diuron present. In the endophytic fungi F. solani from Ferocactus latispinus, the pH value and nitrogen/carbon ratio were found to affect polyketide production and were optimized, resulting in a higher yield (476 \u03bcmol/L) [Paraconiothyrium SSM001 and decreased the level of gene expression [Although the production of diverse chemical entities by endophytic fungi is prospective in addressing natural product-mediated drug discovery, the multiple factors that govern production remain poorly understood. The cultural factors that play a key role in metabolite production include temperature, pH, cultivation time, nutrients, and aeration in the medium . The ter \u03bcmol/L) . In addi \u03bcmol/L) . The colpression .The BCGs in fungi are present in the heterochromatin state and are controlled by epigenetic processes, including DNA methylation and histone deacetylation . Gene exThe discovery and commercial production of taxol was a landmark in endophyte biology and research and marked the bio-prospection of endophytes in natural product-mediated drug discovery. The key pharmacological metabolites, including CPT, podophyllotoxin, huperzine A, and vinca alkaloids (vincristine/vinblastine), define a novel paradigm in pharmacology, with a new hope to discover and employ high-value metabolites in therapeutic endeavors. Although endophytes continue to gain popularity as an attractive production platform for pharmaceutical therapeutics at an affordable scale, the existing and emerging bottlenecks regarding the purity of endophyte strains, sub-culturing concerns, low yields, and adverse effects need to be further addressed for maximal utilization. Recent advances in scientific interventions and high-throughput methods have made substantial contributions to endophyte research, aiming to address the projected challenges. Genetic engineering of endophytes comprising gene overexpression and gene constructs, strain mutagenesis, and co-cultivation of compatible strains is targeted toward the improvement of different endophyte strains and high yield of targeted metabolites. With the depletion of natural resources and limited availability of natural products, the bio-prospection of endophytes and their genetic improvement is an important area of research in drug discovery programs."}
+{"text": "Pharmaceuticals and their packaging have a significant negative impact on the environment providing a very strong argument for action on the part of pharmacists and pharmacy technicians to engage with pro-environmental behaviours (PEBs) in their workplaces. The aims of this research were therefore to investigate in hospital pharmacists and pharmacy technicians, 1) factors affecting engagement with workplace PEBs, and 2) determine if legislated carbon reduction targets in the UK influenced workplace PEBs in the UK compared with Australia which does not have legislated carbon reduction targets. The environmentally responsible disposal of pharmaceutical waste was the PEB of interest in this study. A mixed methods research design was utilised and a conceptual model  was developed to identify factors influencing workplace PEBs. Participants were from five hospitals in Queensland, Australia and five NHS hospitals in England, UK. There was no statistically significant difference in environmental attitude or concern between the two groups\u2014most had a mid-environmental attitude score and low levels of environmental concern. Participants lacked knowledge of the issue and the link between the environment and public health. Both Australian and UK participants reported recycling packaging waste was not a priority in the hospital pharmacy workplace  as hospitals focused on compliance with clinical (contaminated) and confidential waste streams. Environmental attitude, knowledge, and concern therefore appeared to be weak influences on intention to perform workplace PEBs with workplace social norms (compliance due to audits) appearing to be a significant mediator of action. The key difference between the cohorts was that UK pharmacists felt waste was not in the scope of their role, and therefore not their responsibility. This study identified that legislated carbon reduction targets did not influence hospital pharmacy workplace PEBs\u2013neither cohort reported engaging significantly in workplace PEBs. UK Government and NHS sustainability policy did not appear to have disseminated to pharmacy department level of UK public hospitals to any great extent. The manual coding trees for the Australian and UK participants\u2019 responses to this question are provided in the supplementary materials  Australian participants and 38.46% (40/104) UK participants of whom 49.1% (52/104) expressed concern for pharmaceuticals entering the natural environment. A higher percentage of Australian participants  compared with UK participants  reported feeling concerned about the impact of pharmaceuticals entering the environment . Fisher\u2019Next, binary logistic regression was performed to determine if environmental attitude (NEP score) was a predictor of environmental concern in each cohort . EnvironThe principal finding of this research was that regardless of the presence or absence of carbon reduction legislation there was very little difference in pharmaceutical waste disposal practices between Australian and UK hospital pharmacy staff. The UK has carbon emissions reduction legislation in place, a government committed to reducing the country\u2019s carbon emissions, and a public health system with a specialised unit dedicated to developing and implementing a carbon reduction strategy. Unfortunately, this was not evident from the responses of the UK pharmacists and pharmacy technicians in this research. UK Government and NHS sustainability policy did not appear to have disseminated to the pharmacy department level of UK public hospitals to any great extent.Many researchers have found the link between environmental attitudes and behaviours to be weak \u201350, inclThis study supports Blake\u2019s findings\u2013in each cohort approximately 20% of participants were pro-environmental; however, a pro-environmental attitude did not lead to increased workplace PEBs. Despite a pro-environmental attitude, these participants had low levels of environmental knowledge regarding the impact of pharmaceuticals on the environment and most reported low levels of environmental concern. Both Australian and UK pharmacy staff reported pharmaceutical waste disposal as not being a priority in the hospital pharmacy workplace; competing workplace pressures contributed to a gap between environmental values and actual workplace PEBs. This highlights an organisational barrier and provides insight into why pro-environmental staff might lack motivation to overcome another identified organisational barrier (lack of recycling bins) to workplace PEBs.Through the use of mixed methods, qualitative and quantitative data could be compared for each participant and the circular relationship between environmental attitude, knowledge, and concern explored. Regardless of environmental attitude (NEP score), all participants demonstrated a lack of knowledge of the impacts of pharmaceutical waste on the environment  and this carried through into low levels of environmental concern. Only in the Australian cohort was environmental attitude a predictor of environmental concern. Those who expressed concern had not sought further to increase their environmental knowledge. This lack of concern in the majority of participants could be due to a lack of understanding of the interconnectedness between the environment and human health and the environmental determinants of human health. In both cohorts, most participants reported they had never given much thought previously to the impact of pharmaceuticals on the environment and the subsequent negative impacts on human health. In the UK cohort, issue denial or a belief that nature can adapt to pharmaceuticals entering the environment was also linked to a lack of environmental concern. For the majority of participants who had a mid-environmental attitude, low environmental concern, and low environmental knowledge, there was minimal engagement with PEBs as predicted by the conceptual model . The finet al. [do have a responsibility for the environmental impact of medicines [Barriers to workplace PEBs as listed in the model , such aset al.  in theiredicines . In 2015edicines . That phedicines  and reduedicines . The Intedicines  \u201cwhich rThe authors acknowledge that a limitation with this research is the small number of hospitals recruited in each country. A larger number of hospitals across multiple Australian cities and across the UK including NHS Trusts in Scotland, Wales, and Northern Ireland would have strengthened the findings; however, this was outside the scope of the research both financially and in time available.S1 Fig(PDF)Click here for additional data file.S2 Fig(JPG)Click here for additional data file.S3 Fig(JPG)Click here for additional data file.S4 Fig(JPEG)Click here for additional data file.S5 Fig(PNG)Click here for additional data file.S6 Fig(PDF)Click here for additional data file.S7 Fig(JPG)Click here for additional data file.S8 Fig(JPG)Click here for additional data file.S1 File(PDF)Click here for additional data file.S2 File(PDF)Click here for additional data file.S3 File(PDF)Click here for additional data file.S4 File(PDF)Click here for additional data file.S5 File(XLSX)Click here for additional data file.S6 File(DOCX)Click here for additional data file."}
+{"text": "Recent studies, which aim to optimize maxillary sinus augmentation, have paid significant attention exploring osteogenic potential of maxillary Schneiderian sinus membrane-derived cells (MSSM-derived cells). However, it remains unclear that how MSSM-derived cells could respond to niche's biomechanical properties. Herein, this study investigated the possible effects of substrate stiffness on rMSSM-derived stem cell fate. Initially, rMSSM-derived stem cells with multiple differentiation potential were successfully obtained. We then fabricated polyacrylamide substrates with varied stiffness ranging from 13 to 68\u2009kPa to modulate the mechanical environment of rMSSM-derived stem cells. A larger cell spreading area and increased proliferation of rMSSM-derived stem cells were found on the stiffer substrates. Similarly, cells became more adhesive as their stiffness increased. Furthermore, the higher stiffness facilitated osteogenic differentiation of rMSSM-derived stem cells. Overall, our results indicated that increase in stiffness could mediate behaviors of rMSSM-derived stem cells, which may serve as a guide in future research to design novel biomaterials for maxillary sinus augmentation. Millions of lost teeth need dental implant treatments each year . HoweverRecently, findings have demonstrated that cells derived from the maxillary Schneiderian sinus membrane (MSSM) possess osteogenic potential \u201310. A prStiffness, among many biophysical signals, could potentially alter cell spreading, proliferation, and stem cell fate \u201316, via With regard to maxillary sinus elevation results, the bone formation quality plays a decisive role. Given the lack of the study on stiffness-mediated rMSSM-derived stem cells behavioral differences, we conducted this research to investigate the potential behavioral response of rMSSM-derived stem cells to substrate stiffness. It has been found that partly due to size and ease of handling , rabbit n = 6) as previously described with slight modifications [\u03bcm cell strainer . The isolated cells were seeded into 25\u2009cm2 tissue culture flasks  with alpha minimum essential medium  containing 10% fetal bovine serum  and 1% P/S. The cultures were maintained at 37\u00b0C in a humidified atmosphere with 5% CO2, and the medium was changed twice a week in order to remove the nonadherent cells. When the cell population reached 80-90%, the primary cells were passaged using 0.25% trypsin enzyme , followed by centrifugation, resuspension, and reseeding up to 2-4 passages. For sphere formation, the cells were plated at clonal density  in ultra-low attachment surface plates . The cells were observed under inverted phase contrast microscope .rMSSM-derived stem cells were isolated from 6-month-old Japanese white rabbits  and then washed with PBS for three times. The incubation with secondary antibodies of CD44 and CD45 antibodies  was carried out according to the same procedure as used for the primary antibodies. The cell suspension incubated with PBS was used as a negative control. After incubation and washing with PBS, approximately 1 \u00d7 106 of cells was resuspended in 300\u2009\u03bcL PBS and examined by FACSCalibur flow cytometer . The cells were gated according to their forward (FSC) and side scattered (SSC) properties during the analysis.The detection of various surface markers was performed by flow cytometric analysis. The cells were digested with 0.25% trypsin, centrifuged at 600\u2009\u00d7\u2009g, 4\u00b0C for 5\u2009min, and washed with PBS for three times. The cell suspension, at a density of 1 \u00d7 10\u03b1-MEM medium containing 10% FBS, 10\u2009mM \u03b2-glycerophosphate, 50\u2009\u03bcg/mL ascorbic acid, 1% P/S, and 10\u2009nM dexamethasone) and adipogenic medium  to induce osteogenic and adipogenic differentiations. For chondrogenic differentiations, cells (5 \u00d7 105) were resuspended and precipitated in 0.5\u2009mL of commercially differentiation media kits  to form high-density cartilage pellets. The pellets were incubated in an incubtator with 5% CO2 at 37\u00b0C. Medium were replaced at a 3-day cycle. Alizarin Red and Oil Red O staining were carried out after 4 weeks and 2 weeks of osteogenic and adipogenic culture, respectively, to verify the stemness of these cells. Cells for staining were seeded in 6-well plates at a density of 1 \u00d7 105 cells/well and were fixed with 4% paraformaldehyde for 10-15\u2009min. 1% Alizarin Red S solution  and Oil Red O  were applied for 15\u2009min at room temperature. For chondrocyte differentiation, the pellets were fixed with 4% paraformaldehyde for 3 days after 3 weeks of culture, embedded in paraffin after being dehydrated, cut into 5\u2009\u03bc\u2009m-thick sections, and stained with Alcian blue after being dewaxed with xylene and dehydrated with alcohol . Cells were observed under inverted phase contrast microscope .rMSSM-derived stem cells were cultured in osteogenic medium  and tetramethylethylenediamine . The mixture was thereafter transferred to 24-well and 6-well plates by using coverslips previously treated with 3-aminopropyltrimethoxysilane  and 0.5% glutaraldehyde . After that, the mixture was coated with 0.2\u2009mg/mL N-sulfosuccinyimidyl-6-(4\u2032-acidosis-2\u2032nitrophenylamino) hexanoate  dissolved in 10\u2009mM HEPES (pH\u20098.5) and was exposed in 365\u2009nm ultraviolet light for 70\u2009min to facilitate photoactivation. The polyacrylamide was washed with PBS to remove excess reagent and then incubated in 2\u2009\u03bcg/cm2 fibronectin solution  overnight at 4\u00b0C. Young's modulus of each sample was thereafter measured with a biomechanical testing machine under contact load at a strain rate of 0.5\u2009mm/s [Polyacrylamide substrates with varying stiffness were fabricated as described previously . Briefly0.5\u2009mm/s .The cell proliferation on different stiffness of polyacrylamide substrates was analyzed via Cell Counting Kit-8 assay . Briefly, the cells were resuspended, counted, and seeded at a density of 8000 per well onto 24-well plates, in which gel slide with different stiffness had been placed. After culturing the cells for 1, 3, 5, and 7 days, the CCK-8 assay was carried out following the manufacturer's instructions. CCK-8 was added, and the samples were kept for 2\u2009h in the incubator. The degree of absorbance of CCK-8 solution at 450\u2009nm was analyzed by a Synergy HT spectrophotometer .\u03bcg/mL FITC-phalloidin and 1\u2009\u03bcg/mL DAPI were applied in sequence, each for 10\u2009min at room temperature and in darkness. The staining agents were removed altogether, and the samples were washed before observed under confocal microscopy . To measure the cell area, ImageJ software was used to analyze FITC staining. The aspect ratio of cell is the ratio of major to minor axis which was also computed from the threshold binary image of the cell using ImageJ. The cells were subjected to immunofluorescence using the primary antibodies of vinculin and osteopontin after 3 days of incubation. The samples on the different substrates were rinsed and then fixed with 4% paraformaldehyde. To permeabilize the cells, 0.1% Triton X-100 was applied for 15\u2009min. Thereafter, the cells were blocked with 1% bovine serum albumin (BSA) for 1\u2009h at room temperature and then incubated with the primary antibody  overnight at 4\u00b0C. The cells were then incubated with the secondary antibody  for 1\u2009h. Thereafter, the counterstaining with DAPI  for 10\u2009min was performed. The samples were observed under fluorescent microscope . ImageJ was used for quantification of relative fluorescence intensity of vinculin and OPN in the different groups. The quantification was performed by measuring three images in the different wells and not just one image/well.After a 12-hour culture in different stiffness, the culture medium was removed, and the cells were washed with PBS for three times. The cells were then fixed by 4% paraformaldehyde for 30\u2009min at 4\u00b0C and washed, ready for Fluorescein isothiocyanate-  conjugated phalloidin and 4\u2032,6-diamidino-2-phenylindole  staining. 10\u20093 cell/cm2 and cultured in the normal \u03b1-MEM medium. The cells were induced to differentiate into osteoblasts-like cells by converting to osteogenic medium. The medium was changed every 3 days. Total RNA of rMSSM-derived stem cells was extracted with TRIZOL , and reverse transcription was performed using TAKARA Reverse Transcriptase kit  following the manufacturer's instructions. The concentration and quality of RNA were determined by Thermo NANODROP 2000c . Thereafter, the polymerase chain reaction (PCR) was performed using PrimeScript\u2122 RT-PCR kit  and Applied Biosystems 7300  according to the instructions. The cycling conditions used for PCR reaction consisted of 95\u00b0C for 30 seconds, followed by 40 cycles of 95\u00b0C for 5 seconds, and 60\u00b0C for 31 seconds. All the primer sequences of the various markers analyzed have been listed in -\u2206\u2206Ct method and normalized to that of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. Each experiment was carried out in triplicate.rMSSM-derived stem cells were resuspended, counted, and seeded onto the FN-coated substrates at a density of 8 \u00d7 10P < 0.05.All the values have been presented as mean \u00b1 standard\u2009deviation (SD) from at least three independent experiments. The differences were analyzed with SPSS 26.0 (IBM) using one-way ANOVA and posthoc Tukey's test. The differences were considered as statistically significant when n = 3), CD90 (93.33 \u00b1 3.1%), and CD44 (77.50 \u00b1 2.6%) expressions were observed to be positive, while hematopoietic markers such as CD34 (3.31 \u00b1 2.0%) and CD45 (3.40 \u00b1 3.1%) were negative  . The immThe cell proliferation on substrates with increased stiffness was investigated via the CCK-8 assay on the first, third, fifth, and seventh days of culture. All data were normalized to that of 62-68\u2009kPa ECM to better compare the possible effect of stiffness. The cell proliferation was significantly enhanced on the substrate with the highest stiffness of 62-68\u2009kPa . It alsoTo investigate the role of substrate stiffness in the osteogenic differentiation of rMSSM-derived stem cells, the cells were cultured on the substrates with varying stiffness in the presence of osteogenic medium. We then carried out quantitative real-time PCR (qRT-PCR) assays and immunofluorescence analysis. qRT-PCR results indicated a marked increase in the mRNA expression level of ALP , OPN (osteopontin), RUNX-2 (runt-related transcription factor-2), BMP-2 (bone morphogenetic protein-2),and COL1A1  at both day 3 and day 7 on 62-68\u2009kPa ECM Figures . AdditioOur results illustrated that substrate stiffness could alter several important cellular behaviors of rMSSC-derived stem cells. It was found that the stiffer substrates facilitated proliferation, adhesion, and osteoblastic differentiation of cells in the current study. This mechanical-mediated regulation of behavior of rMSSC-derived stem cells has significant implications in bone biology and bone tissue engineering. Here, we fabricated elastic polyacrylamide hydrogels by mixing 8% acrylamide with 0.1%, 0.5%, and 0.7% bisacrylamide, which mimicked cellular biomechanical signal. To facilitate adhesion of rMSSC-derived stem cells , the subSubstrate stiffness, acting as a vital biomechanical factor, has been reported to modulate cellular functions in previous studies , 19, 38.However, little is known about the potential interaction between MSSC-derived stem cells and physical microenvironment. The MSSM is a bilaminar membrane that can attach to the inner wall of maxillary sinus . By elevIn our study, we demonstrated that cytoskeleton of rMSSC-derived stem cells changed significantly in response to the varied stiffness. Fibroblast-like and stretched out cells were detected on the 62-68\u2009kPa stiff group, whereas rMSSC-derived stem cells adopted to adipocyte-like shapes and were found to spread poorly on the softer substrates. A similar phenomenon was observed in a previous work by Zhang et al. who reported that osteoblasts were widely stretched out on the stiff group but shrank into small size on the soft substrates . It can Cell proliferation and differentiation are two key factors involved in regulating the process of tissue regeneration . In our The medium was converted to osteogenic medium when cells were induced to undergo differentiation into osteoblasts-like cells. The osteogenic differentiation ability was measured by analyzing the expression levels of various osteogenic markers, including ALP, OPN, RUNX-2, and BMP-2 as well as COL1A1, and our results clearly demonstrated that rMSSC-derived stem cells took advantage of the stiff substrates to differentiate. However, there was no significant difference in the expression of RUNX-2, BMP-2, and COL1A1 between intermediate and soft groups as shown in 4 of 10\u2009bar graphs , which iWe then investigated the expression of vinculin, a key adhesion protein that could link ECM and cytoskeleton by reinforcing integrin binding . Our resThere are also several limitations associated with our study. First, given that other osteogenic-related cells also reside in maxillary sinus, such as osteoblasts and osteoclasts, the possible crosstalk of rMSSC-derived stem cells with these cells during the process of osteogenesis needs to be illustrated. Second, rMSSC-derived stem cells in this study were isolated only from rabbits, the antibody of rabbits is rare on the market, and so we only stained OPN for immunofluorescence images. Also, rabbit stem cells may have some differences with the human stem cells and hence further work in human cells is required. Third, Alizarin Red staining was used to detect the deposition of late osteogenic calcium salt. We did the alizarin red staining test, but there was no significant difference between the groups. Perhaps may be that the time of osteogenesis is short, only changes of early osteogenesis markers could be detected in our study. Fourth, although the stiffness could mimic extracellular physical signals, it might not represent a real extracellular microenvironment, which is complex due to existence of various factors like microtopography and chemical components. The fifth limitation is that structures of 2D substrates in our study were markedly distinct from the complicated structures in vivo. Better cell-culture platforms, including 3D systems with tunable stiffness, may overcome this disadvantage. Sixth, the signaling pathway associated with mechanotransduction in the regulation of stiffness-mediated differentiation of MSSC-derived stem cells should also be evaluated in future studies. In summary, substrate stiffness could significantly alter the behaviors of rMSSC-derived stem cells, and thus this factor should be carefully considered in the material design applied in maxillary sinus augmentation."}
+{"text": "In this study, diurnal changes of net photosynthetic rate (Anet), stomatal conductance (gs), and photochemical efficiency of PSII (Fv\u2032/Fm\u2032) were measured in two rice cultivars grown in the open-top-chambers at ambient (\u223c450 \u03bcmol mol\u20131) and elevated (\u223c650 \u03bcmol mol\u20131) CO2 concentration [(CO2)] throughout the growing season for 2 years. The results showed that elevated (CO2) greatly increased Anet, especially at jointing stage. This stimulation was acclimated with the advance of growing season and was not affected by either stomatal limitations or Rubisco activity. Model parameters in photosynthesis model  and two stomatal conductance models (m and g1) varied across growing stages and m and g1 also varied across (CO2) treatments and cultivars, which led to more accurate photosynthesis and stomatal conductance simulations when using these cultivar-, CO2-, and stage- specific parameters. The results in the study suggested that further research is still needed to investigate the dominant factors contributing to the acclimation of photosynthetic capacity under future elevated CO2 conditions. The study also highlighted the need of investigating the impact of other environmental, such as nitrogen and O3, and non-environmental factors, such as additional rice cultivars, on the variations of these parameters in photosynthesis and stomatal conductance models and their further impacts on simulations in large scale carbon and water cycles.Investigating the diurnal and seasonal variations of plant photosynthetic performance under future atmospheric CO Rice has the third largest planting area in the world and has been the main source of daily food for nearly half of the world\u2019s population. With Global (CO2) rising and the increase of global population, it is critical to investigate and predict the responsive changes of the physiology and growth of rice to the increasing (CO2).Under the influence of human activities, atmospheric COscenario . Rice (O2) will stimulate photosynthesis and increase the biomass production and yield (2) from 350 to 700 \u03bcmol mol\u20131 increased rice growth, grain yield and canopy photosynthesis and increased the final aboveground biomass by 29% with sufficient irrigation (2) made the CO2 effect on photosynthesis more complicated. Leaf photosynthetic rate (A) of two species, rice and soybean, were both increased under (CO2) enrichment, but this enhancement was reduced when the air temperature increased by 3\u00b0C (2) from 370 to 700 \u03bcmol mol\u20131 could offset the negative effect on photosynthesis due to 3.0\u20133.9\u00b0C warming, but had larger negative effect on photosynthetic carboxylation capacity in warming condition compared with ambient air temperature (2) and temperature increased the photosynthesis but decreased yield for rice (\u20131 above ambient (CO2) and 1\u00b0C warming was reported in another research and the decrease of spikelet density might be the dominant factor  and transpiration rate (TR), therefore higher water use efficiency (WUE) due to elevated (CO2) were reported in varieties of species (s when (CO2) increased from 360 to 627 \u03bcmol mol\u20131 (2) by 200 \u03bcmol mol\u20131 significantly decreased gs by 23% on average and doubling (CO2) made transpiration of rice reduced by 45 and 41% at full heading stage and mid-ripening stage, respectively (s of wheat grown under ambient (CO2) was observed compared with that under elevated (CO2) when ammonium fertilization was supplied as the sole N source, and this phenomenon disappeared when plants were set under nitrate nutrition (s for one dominant C3 grass and two sympatric C3 forbs due to increasing (CO2) by 150 \u03bcmol mol\u20131  O. Kuntze] (Elaeagnus umbellata showed that Anet and gs both reached the maximum rates early in the day (around 10 a.m.) and the daily average levels decreased significantly during times of drought stress  in the early growing stage, but the difference could be observed in the late growing stage  and elevated (CO2) could either significantly enhance the assimilation ability or weaken the midday depression (3 plants were exposed to elevated (CO2) for an extended period of time, the accelerated rate of photosynthesis often cannot be maintained, a phenomenon called photosynthetic acclimation to elevated (CO2) (2) concentrations compared with what was expected with the influence of short-term elevated (CO2) (2 conditions (2), especially under nitrogen limitation  . Ignorined (CO2) . Photosynditions . For plamitation . Few stucmax, Jmax, and Rd from the FvCB model, m and g0 from BWB model, g1 and g0 from MED model) are valuable for large-scale simulations and represent important physiological traits that determine plant photosynthetic potential and water-use efficiency. How do photosynthetic parameters of Vcmax, Jmax, and Rd and stomatal slope parameters vary among different rice cultivars and under different CO2 conditions require further study and analysis. Whether using cultivar-specific or environment-specific, instead of generic, model parameters can increase the accuracy of both photosynthesis and stomatal conductance simulations needs further investigation too.Understanding and predicting large-scale carbon, water, and energy cycles requires accurate simulations in leaf photosynthesis and stomatal activities . The Farnet), stomatal conductance (gs), intercellular CO2 concentration (Ci) and chlorophyll a fluorescence characteristics  were measured in two rice cultivars grown in the open-top-chambers at ambient (\u223c450 \u03bcmol mol\u20131) and elevated (\u223c650 \u03bcmol mol\u20131) CO2 concentrations throughout the growing season for 2 years. Seasonal variations of Vcmax, Jmax, and Rd and stomatal slope parameters were determined by Anet-Ci measurements at different growing stages. The objectives of this study were: (1) to investigate the diurnal and seasonal variations of rice photosynthetic performance under future atmospheric CO2 conditions; (2) to compare the diurnal and seasonal variations across two rice cultivars; (3) to test whether the photosynthetic and stomatal conductance models are effective under elevated CO2 conditions and whether using cultivar-, CO2- and stage- specific parameters can improve the accuracy of the photosynthesis and stomatal conductance simulations. Specifically, we hypothesized that (1) the positive effects of elevated (CO2) observed in the earlier growing season will decrease in the later growing season; (2) the extent of photosynthetic acclimation will be smaller for the more CO2-responsive cultivar; (3) the cultivar-, CO2-, and stage- specific parameters will increase the accuracy of the photosynthetic and stomatal conductance models.In this study, diurnal changes of net photosynthetic rate (A\u20133 and the pH (H2O) value were 6.3. The organic carbon and total nitrogen content were 11.95 and 1.19 g\u22c5kg\u20131, respectively.The study site was located in the agrometeorological experimental station of Nanjing University of Information Science and Technology, in Nanjing, Jiangsu province of China . The climate in this region characterizes subtropical monsoon season, with the annual average precipitation of 1,100 mm, the average temperature in recent years of 15.6\u00b0C and the average annual frost-free period of 237 days. The soil texture in the tillage layer was loamy clay and the clayey content was 26.1%. The bulk density of 0\u201320 cm soil was 1.57 g\u22c5cm2) treatments and description was provided in 2. There were two (CO2) treatments, ambient [a(CO2)] and elevated [e(CO2)], each with four replicative chambers. The treatment of elevated (CO2) started from the turning green stage and lasted to the end of growing season. The (CO2) concentration in the OTCs was controlled with an automatic control platform, composed of CO2 sensors, gas-supplying devices and automatic control system. Three wind-blowing fans were placed in each chamber to make the CO2 gas in the chamber evenly distributed and the top of the OTC is designed with an opening inclined 45\u00b0 inward to avoid the rapid loss of CO2 gas. The CO2 sensor fed back the surrounding CO2 concentration information in the chambers to the automatic control system every 2 s. Our experiment was performed from 2019 to 2020 to make sure that the trend we observed was not a random impact. The daytime (CO2) averaged over the growing season was 641 \u00b1 43 and 631 \u00b1 39 \u03bcmol mol\u20131 in elevated (CO2) chambers and 478 \u00b1 34 and 485 \u00b1 33 \u03bcmol mol\u20131 in ambient (CO2) chambers in 2019 and 2020, respectively. The nighttime (CO2) was 667 \u00b1 27 and 673 \u00b1 24 \u03bcmol mol\u20131 in elevated (CO2) chambers and 537 \u00b1 49 and 550 \u00b1 36 \u03bcmol mol\u20131 in ambient (CO2) chambers.Open top chambers (OTC) were used in the experiment to simulate elevated . During the whole growing season, sufficient supplies of water and fertilizer were maintained.Two rice cultivars, Yangdao6, a more CO studies , were se2) of the leaf chambers were set according to the OTC conditions and the temperature and light levels were set as the environmental conditions. Photochemical efficiency of PSII in light-adapted leaves (Fv\u2032/Fm\u2032) and photochemical quenching (qP) were measured using a Licor 6400-40 Leaf Chamber Fluorometer. The photosynthesis-CO2 response (Anet\u2013Ci) curves were measured on the next day after the diurnal measurements were taken. During measurements, leaves were acclimated for 30\u201360 min before adjusting the CO2 concentrations. Thereafter, CO2 concentration was decreased in six steps  and then increased in four steps . Leaf temperature was controlled at 35, 35, 35, 30, and 25\u00b0C when Anet\u2013Ci curve measurement was conducted at jointing, booting, heading, grain-filling, and maturity stage, respectively, and photosynthetic photon flux density (PPFD) was maintained at 2,000 \u03bcmol m\u20132 s\u20131 all the time because the light level is close to the midday light level in the region.Gas exchange characteristics  were measured with a portable infrared gas analyzer  on one randomly selected and fully expanded healthy leaf of each cultivar from each chamber. The measurement was taken at jointing, booting, heading, grain-filling and maturity stage on July 24, August 18, September 8, September 28 and October 13 in 2019, and July 25, August 24, September 7, September 24 and October 20 in 2020, respectively, which were confirmed by observation and previous research . During net-Ci curves were fit to the FvCB models  to solve the photosynthetic parameters including maximum ribulose 1\u22c55-bisphosphate carboxylase/oxygenase (Rubisco) carboxylation rate , potential light saturated electron transport rate , and leaf dark respiration , respectively. Anet-Ci curves were then fit to the BWB (Equation 3) and Medlyn (Equation 4) models to solve the parameters of m and g1 (Am and g1 .i is the intercellular (CO2), O is the oxygen concentration, \u0393\u2217 is the photosynthetic CO2 compensation point without dark respiration, KC and KO are the Michaelis\u2013Menten constants for CO2 and O2 and can be found in net is limited by Rubisco activity [low (CO2)] and if Anet is limited by the regeneration of ribulose-1,5-bisphosphate (RuBP) at high (CO2), it can be determined as follows:where Cmax with the non-rectangular hyperbolic model  can be used to describe variation in minimum gs. Only simulations that provided a regression between modeled and observed stomatal conductance with an R2 > 0.8 were included in further analyses , A is the net rate of photosynthetic CO2 uptake (\u03bcmol m\u20132 s\u20131), h is atmospheric relative humidity (unitless), Ca is the atmospheric CO2 concentration at the leaf surface (\u03bcmol mol\u20131), g0 is the y-axis intercept and m is the slope of the line.where 1 is the model parameter related to the slope of the line. Previous study showed that whether the value of g0 is 0 does not significantly affect the linear and non-linear relationship in Equations 3, 4  and gons 3, 4 , so we snet and gs were used to validate the coupled FvCB photosynthetic model and BWB and MED stomatal conductance models (2- and stage- specific) photosynthetic and stomatal parameters and generic parameters  were used to test whether the specific parameters will increase the accuracy of the models.The diurnal measurements of Ae models . Specifi2 treatments and their interactions on Anet, gs, Fv\u2032/Fm\u2032, Vcmax, Jmax, Rd and stomatal slope parameters. Post hoc Tukey\u2019s HSD tests were conducted on specific contrasts to examine significant treatment effects among groups. General linear models (GLM) were used to assess the relationship between observed and modeled parameters. For all the analysis, the normality of the residuals was tested using the Shapiro\u2013Wilk test. All statistical testes were considered significant at P \u2264 0.05. Mean values of each variable were expressed with their standard error (SE). All analyses were conducted in R with package \u201cplantecophys\u201d and all figures were drawn with the \u201cggplot\u201d function in package \u201ctidyverse\u201d (R 3.6.31).Four-way analysis of variance (ANOVA) was used to test the fixed effects of years, cultivars, growing stages, CO\u20132 s\u20131 at jointing, booting, heading, grain-filling and maturity stages in 2019 and 2,019.40, 1,919.95, 1,850.80, 1,940.95, and 1,701.12 \u03bcmol m\u20132 s\u20131 in 2020, respectively. Diurnal variations of air temperature (Tair) and vapor pressure deficit (VPD) followed the similar trend as PAR. The maximal Tair were 38.03, 32.91, 32.97, 31.06, and 25.28\u00b0C in 2019 and 34.50, 37.71, 34.62, 28.92, and 22.57\u00b0C in 2020, while those of VPD were 2.09, 1.96, 2.02, 1.72, and 1.41 kPa in 2019 and 2.29, 2.42, 2.18, 1.98, and 1.42 kPa in 2020 on the measuring date at five growing stages. Tair, VPD and PAR varied significantly across the growing season.The photosynthetic active radiation (PAR) usually reached its maximum from 10 a.m. to 13 p.m. . The maxnet increased to the maximum around noon and decreased in the afternoon and the maximum value appeared no later than 14 p.m. (net was observed on some of the measuring dates for both the cultivars and (CO2) treatments. On average, elevated (CO2) significantly stimulated Anet of both cultivars by 34.19% in 2019 and 47.65% in 2020 in the whole growing season, which was consistent with the impact of elevated (CO2) on intercellular (CO2) (2) on Anet could be observed around midday at jointing stage , and the enhancement of Anet of each cultivar due to elevated (CO2) at the following four growing stages were much lower than that at this stage in 2 years (net decreased significantly with the advance of growing season and there were significant (CO2) \u00d7 growing stage effect on Anet (2-responsive cultivar Yangdao6 had higher Anet than Wuyunjin30 and the two cultivars responded similarly to elevated (CO2)  . The gre 2 years . Anet de on Anet . The mored (CO2) .s remained relatively high before 15 p.m. and started to decrease after that  \u00d7 cultivars tended to decrease significantly with the advance of growing season, while a slight recovery of gs beginning at heading stage was observed for Wuyunjing30 under both (CO2) treatments (s of Yangdao6 under both (CO2) treatments slightly increased from jointing to booting stage, while that of Wuyunjing30 decreased or remained stable during this period, and gs always decreased from heading to maturity stage. Seasonal variations in gs synchronized well with those in Anet, especially in 2020. Elevated (CO2) had no significant effect on gs  significantly increased Fv\u2032/Fm\u2032 of both cultivars by 6.92% in 2019 and 6.41% in 2020 across the growth season, while qP was decreased by 4.30% in 2019 and 3.97% in 2020, respectively (v\u2032/Fm\u2032 due to elevated (CO2) at midday were 21.39% at heading stage in 2019 and 26.80% at the same stage in 2020 for Wuyunjing30, and 16.18% at maturity stage in 2019 and 29.27% at grain-filling stage in 2020 for Yangdao6  and Yangdao6 grown at elevated (CO2) in 2019. The values of Rd increased to the maximum at grain-filling or maturity stage. There is no significant influence of (CO2) or cultivar or the interaction on Vcmax, Jmax, and Rd (net-Ci curves showed no differences of three parameters among four (CO2) \u00d7 cultivar treatments, either (1 were highest at maturity stage across (CO2) \u00d7 cultivar treatments. On average, elevated (CO2) significantly decreased m and g1 of both cultivars by 7.62 and 9.82% respectively. The values of m and g1 of more CO2-responsive cultivar Yangdao6 was 10.75 and 10.87% lower than those of less CO2-responsive cultivar Wuyunjing30, respectively.For most treatments, Vty stage , which ci curves . Values , and Rd , and Ane, either . The valnet and gs correlated well with the measured ones across all treatments no matter whether BWB or MED was used or specific or generic model parameters were selected (2) between predicted and measured values was used to describe the simulation accuracy in our study. We found that the accuracy of photosynthetic simulations was higher when using the specific parameters (r2 = 0.83) than using the generic ones (r2 = 0.66). The moderate improvement of gs simulations was achieved using specific parameters (r2 = 0.45 for BWB and 0.47 for MED model), compared with using generic parameters (r2 = 0.41 for BWB and 0.37 for MED models).The predicted values of Aselected , 6. The 2 effects on plant physiology and production  the diurnal variation of net photosynthetic rate was mainly affected by the dynamic of photosynthetic active radiation and air temperature and the midday depression of net photosynthetic rate observed in most cases was caused by both stomatal and non-stomatal factors; (2) CO2 had a positive effect on net photosynthetic rate and the effects decreased after the booting stage and the degree of the acclimation did not vary between the two tested cultivars; (3) the photosynthetic and stomatal conductance models proved to be effective under elevated CO2 conditions and using specific parameters greatly improved the accuracy of the photosynthetic simulations and moderately improved that of stomatal conductance simulations.Individual studies and meta-analysis have investigated the general tendency of elevated COoduction . Howevernet were lower in the early morning and the late afternoon and the maximum occurred around noon. These unimodal or bimodal patterns were consistent with the dynamics of PAR and Tair across growing stages. In contrary, although the decrease of gs was synchronous with that of Anet in the afternoon, the variation of gs in the morning could not reflect the dynamic of Anet in this period. Therefore, light intensity as well as air temperature, rather than stomatal functions, were the dominant factors affecting the diurnal variation of Anet on daily scale  at heading stage in 2019. But Ci changed little or remained unchanged, for Wuyunjing30 and Yangdao6 under ambient (CO2) at jointing stage in 2020. Meanwhile, we noticed the decrease of Fv\u2032/Fm\u2032 and qP around noon for each cultivar at both the (CO2) treatments and they recovered to normal or even higher values at late afternoon, proving the existence of reversible photoinhibition in rice throughout the growth season  on plant photosynthesis has been widely reported in recent decades, but the magnitude of the stimulation varied greatly depending on species, plant functional types (PFTs) and other environmental factors (2) enhanced Anet of rice by 34.19 and 47.65% on average throughout the growing season in 2019 and 2020, respectively, which was comparable to what was reported 33% increase in the meta-analysis studies (2 concentration (Ci) and photochemical efficiency of PSII (Fv\u2032/Fm\u2032) were the main factors for the stimulation on Anet of rice at elevated (CO2). Photosynthetic acclimation to elevated (CO2) was found in crop varieties with limited sink size (net due to elevated (CO2) was greatest at jointing stage in 2 years, but was weakened afterward and even disappeared at maturity stage in 2020, which suggested the occurrence of photosynthetic acclimation at elevated (CO2) and it could happen at the early growing season. We did not observe the less enhancement by elevated (CO2) on Fv\u2032/Fm\u2032 and qP at the following growing stages compared with jointing stage or any significant influence of elevated (CO2) on gs, Vcmax and Jmax which could explain the early season photosynthetic acclimation. Therefore, the down-regulation of stomatal and Rubisco enzyme functions might not be the only reasons for the photosynthetic acclimation of rice at elevated (CO2)  . A more  studies .cmax, Jmax, and Rd) and stomatal slope parameters in BWB model (m) and MED model (g1) varied across growing stages. The decrease of Vcmax and Jmax could be the reason for the decline of photosynthetic capacity with the advance of growth period. Vcmax, Jmax, and Rd varied not only among different species (2) did not lead to significant changes of Vcmax and Jmax in our research. The response of Vcmax, Jmax, and Rd in C3 plants grown at elevated (CO2) were reported to be quite different and both stimulation and inhibition of elevated (CO2) effects had been reported in recent years (2) treatment as short as 7 days increased Vcmax and Jmax for cucumber by 12.0 and 14.7% without drought stresses, but the enhancement was no longer significant under mild and severe drought stresses  (2) grown wheat (1) varied across both (CO2) treatments and cultivars, demonstrating that variability of m and g1 was caused not only by the diversity of plant function groups but also by the diversity of physiological characteristics among cultivars within a single species.Model parameters in FvCB model  . Howeverwn wheat . In our cmax, Jmax, and Rd) and stomatal conductance model (m and g1) compared with using generic parameters was achieved in this study, suggesting that future simulations in large scale carbon and water cycles should take account of the variations of model parameters across environmental and non-environmental factors. Though we did not observe a significant impact of elevated (CO2) on Vcmax and Jmax, it should be noted that not considering the impact of mesophyll conductance (gm) might lead to the potential increased systematic errors of determining Vcmax and Jmax (2), cultivar and growing stage variation of photosynthesis and stomatal conductance model parameters of rice and other plant species.Higher accuracy of simulation using specific model parameters in both photosynthesis model (Vand Jmax . And the2) greatly increased net photosynthetic rate at jointing stage. This stimulation was acclimated with the advance of growing season and was not affected by either stomatal limitation or Rubisco activity. Model parameters in photosynthesis model  and two stomatal conductance models (m and g1) varied across growing stages and m and g1 also varied across (CO2) treatments and cultivars, which led to more accurate photosynthesis and stomatal conductance simulations when using these specific parameters. The results in the study suggested that further researches are still needed to investigate the dominant factors contributing to the acclimation of photosynthetic capacity under future elevated CO2 conditions. The study also highlighted the need of investigating the impact of other environmental, such as nitrogen and O3, and non-environmental factors, such as additional rice cultivars, on the variations of the model parameters in photosynthesis and stomatal conductance models and the further impacts on simulations in large scale carbon and water cycles.In conclusion, diurnal variations of net photosynthetic rate of rice showed unimodal or bimodal patterns, which was mainly influenced by light intensity and air temperature. Meanwhile, the closure of stomata and the photoinhibition around noon were dominant factors for the short-term midday depression of net photosynthetic rate. Elevated (COThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.DW conceived the idea and led the study. YM and YC designed the experiment. YM, YC, and HW measured all the data used for this study. YM analyzed the data and wrote the manuscript with the critical suggestions by DW. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Saccharomyces cerevisiae, but in principle, it could be applied to any other eukaryotic organism. HT-5Pseq is easy, scalable, and uses affordable duplex-specific nuclease-based rRNA depletion.mRNA degradation is connected to the translation process up to the degree that 5\u2032-3\u2032 mRNA degradation follows the last translating ribosome. To study 5\u2032-3\u2032co-translational mRNA decay and the associated ribosome dynamics, here we present an improved high-throughput 5\u2032P degradome RNA sequencing protocol (HT-5Pseq). We exemplify its application in For complete details on the use and execution of this protocol, please refer to   \u2022HT-5Pseq facilitates the investigation of 5\u2032P mRNA degradome\u2022HT-5Pseq is an easy, scalable, and affordable protocol\u2022HT-5Pseq can be potentially applied in any eukaryotic organism Saccharomyces cerevisiae, but in principle, it could be applied to any other eukaryotic organism. HT-5Pseq is easy, scalable, and uses affordable duplex-specific nuclease-based rRNA depletion.mRNA degradation is connected to the translation process up to the degree that 5\u2032-3\u2032 mRNA degradation follows the last translating ribosome. To study 5\u2032-3\u2032co-translational mRNA decay and the associated ribosome dynamics, here we present an improved high-throughput 5\u2032P degradome RNA sequencing protocol (HT-5Pseq). We exemplify its application in  HT-5Pseq captures in\u00a0vivo 5\u2032P mRNA degradation intermediates by ligating an RNA oligo to the exposed 5\u2032P. After ligation, the RNA molecules are reverse-transcribed to cDNA using oligo-dT and random hexamer as primers. After cDNA library generation, cDNA generated from abundant rRNA molecules is removed using duplex-specific nuclease (DSN) and custom designed DNA probes. The remaining cDNA molecules are used as template for Illumina compatible sequencing library preparation .Figure\u00a01Timing: 1 h1.a.Mix equal volumes of the equimolar probes.b.Dilute probes mix from 200\u00a0\u03bcM to final 2\u00a0\u03bcM before use.Prepare the rRNA depletion probes mix:Note: Here we use rRNA depletion probes  using a standard bench microcentrifuge at 30 s, 8000\u00a0rpm at room temperature.b.i.Tube 1: 500\u00a0\u03bcL phenol:chloroform:IAA (125:24:1)Tube 2: 500\u00a0\u03bcL chloroform:IAA (24:1)2O)Tube 3: 40\u00a0\u03bcL 3M NaOAc (made with nuclease-free HSet up the following tubes:ii.Add (approx. 200\u00a0\u03bcL) of glass beads and 150\u00a0\u03bcL LET in yeast cell pellet.iii.Add 150\u00a0\u03bcL phenol. Vortex at 20\u00b0C\u201325\u00b0C in vortex mixer for 2\u00a0min at top speed.iv.2O and 250\u00a0\u03bcL phenol:chloroform:IAA.Add 250\u00a0\u03bcL nuclease-free Hv.g.Vortex in vortex mixer for additional 2\u00a0min followed by centrifugation at 4\u00b0C for 2\u00a0min at 14,000\u00a0\u00d7 vi.g.Remove aqueous phase (approx. 450\u00a0\u03bcL) and add to Tube #1. Vortex 30 sec and spin 1\u00a0min at 14,000\u00a0\u00d7 vii.Remove aqueous phase and add to Tube #2. Vortex 30 sec and spin 1\u00a0min at 14,000\u00a0rpm.viii.Remove aqueous phase (approx. 400\u00a0\u03bcL) and add to Tube #3 mix well. Add 1\u00a0mL 95% (vol/vol) ethanol, mix and place at \u221220\u00b0C/\u221280\u00b0C, 30\u00a0min.ix.g.Collect RNA by centrifugation at 4\u00b0C for 20\u00a0min at 14,000\u00a0\u00d7 x.Wash pellet with 500\u00a0\u03bcL 70% (vol/vol) cold ethanol and re-centrifuged for 10\u00a0min.xi.Drain supernatant and air-dry pellet for ~ 3\u00a0min.xii.Resuspend pellet in 10\u00a0\u03bcL nuclease-free water.Extract total RNA using phenol-chloroform extraction method.Obtain total RNA from sample of interestCRITICAL: Phenol and Chloroform are acute toxic. Be careful when handling phenol and chloroform, always wear gloves, lab coat and perform manipulations following local safety regulations in fume hood.CRITICAL: To avoid RNA degradation, perform RNA extraction with phenol:chloroform as fast as possible.2.Check RNA quality by running a Bioanalyzer RNA gel or an agarose gel.Note: Any alternative approach producing high-quality RNA may be used instead.Timing: 45\u00a0min3.Starting with 6\u00a0\u03bcg of total RNA, prepare the following mix and incubate the samples for 20\u00a0min at 37\u00b0C.Note: It is possible to lower starting material to 500\u00a0ng in total. However, low input material usually decreases library complexity and increase the PCR duplicates.4.Add 2\u00a0\u03bcL of TURBO DNAse inactivation reagent and incubate 5\u00a0min at 20\u00b0C\u201325\u00b0C (tapping once in a while).5.g for 2\u00a0min at 20\u00b0C\u201325\u00b0C and transfer the supernatant to a clean precooled tube.Centrifugate at 14,000\u00a0\u00d7 Note: This pellet is normally quite loose, repeat the centrifugation if it is resuspended and avoid the carryover of any DNase inactivation reagent.6.Ethanol precipitate the DNA-free RNA by adding 2.5 volumes (with respect to the sample volume) of 95% (vol/vol) ethanol, a 1/10 volume of 3\u00a0M sodium acetate, 1\u00a0\u03bcL of glycoblue. Mix sample by gently inverting and incubate it for minimum 30\u00a0min at \u221220\u00b0C/\u221280\u00b0C.Pause point: The ethanol precipitation can be left 16\u201318\u00a0h at \u221220\u00b0C/\u221280\u00b0C.7.g for 30\u00a0min at 4\u00b0C to precipitate the RNA.Centrifugate at 14,000\u00a0\u00d7 8.Wash the pellet with 500\u00a0\u03bcL of cold 70% (vol/vol).9.g for 10\u00a0min at 4\u00b0C.Centrifugate 14,000\u00a0\u00d7 10.Remove the remaining ethanol, air-dry pellet for 3\u00a0min and resuspend it in 1.8\u00a0\u03bcL of RNAse-free water.Note: If the next step is the single-strand RNA ligation, RNA can be directly resuspended in ligation mix (step 11) and top up RNAse-free water to 10\u00a0\u03bcL .CRITICAL: When handling with RNA samples, always keep them in RNase-free environment and place samples on ice.Any contaminant DNA is removed from the sample.Timing: 2 h11.Prepare a 10\u00a0\u03bcL reaction mix with the components listed below:CRITICAL: Add PEG provided by T4 RNA ligase 1 in the end of the reaction mix, as it is sticky at high concentration.12.Incubate sample at 25\u00b0C for 2 h.13.Increase the sample volume with RNase-free water to 40\u00a0\u03bcL.14.\u00d7 volumes of RNAClean XP beads, as described by the manufacturer\u2019s instruction.a.Add 72\u00a0\u03bcL of RNAClean XP beads and mix sample by several times pipetting up and down.b.Incubate at 20\u00b0C\u201325\u00b0C for 5\u00a0mins until RNA bind to beads.Purify the sample using 1.815.a.Remove the supernatant.b.Wash beads twice with 200\u00a0\u03bcL of freshly made 70% (vol/vol) ethanol.Place the PCR tubes at the magnets stand and wait till the solution is clear (~2\u00a0mins)16.a.Elute samples in 12\u00a0\u03bcL RNase-free water.Remove the ethanol and let the beads slightly dry for 1\u00a0min.Note: avoid over drying the beads as that might result in sample loss.5\u2032 phosphate molecules are ligated with RNA oligos including unique molecular identifiers (UMI).Timing: 1.5 h17.Prepare a reaction mix as the components listed below:CRITICAL: This optimized ratio of oligo-dT and random hexamer increase coverage in the 3\u2032 region of the gene. Altering the ratio of oligo-dT and random hexamer will lead to differences in the relative 5\u2032/3\u2032 coverage.18.Denature the sample at 65\u00b0C for 5\u00a0min. Then place on ice directly.19.To each tube, add 6.2\u00a0\u03bcL of mixture containing the following components:20.Add 1\u00a0\u03bcL of SuperScript II reverse transcriptase to each tube.21.Incubate the sample at 25\u00b0C for 10\u00a0min, 42\u00b0C for 50\u00a0min and inactivate reaction at 70\u00b0C for 15\u00a0min.Note: Any commonly reverse transcriptase could be used instead of SuperScript II.Pause point: Samples can be stored at \u221220\u00b0C.cDNA library is transcribed by the defined ratio of oligo-dT and random hexamer.Timing: 0.5 h22.Remove the template RNA by adding 100\u00a0mM NaOH (8\u00a0\u03bcL) to the sample (from step 21), and incubate at 65\u00b0C for 20\u00a0min.23.Neutralized sample by adding 100\u00a0mM Tris-HCl, pH\u00a0= 7.0 (8\u00a0\u03bcL).Note: It is also possible to remove excess RNA in cDNA-RNA duplex by using RNaseH.24.\u00d7 volumes of Ampure XP beads, as described by the manufacturer\u2019s instruction.a.Add 64.8\u00a0\u03bcL of Ampure XP beads and mix sample by several times pipetting up and down.b.Incubate at 20\u00b0C\u201325\u00b0C for 5\u00a0mins until samples bind to beads.Purify the sample using 1.825.a.Remove the supernatant.b.Wash beads twice with 200\u00a0\u03bcL of freshly made 70% (vol/vol) ethanol.Place the PCR tubes at the magnets stand and wait till the solution is clear (~2\u00a0mins).26.Remove the residual ethanol and allow the beads to slightly dry for 1\u00a0min. Elute in 8\u00a0\u03bcL of RNase-free water.Note: avoid over drying the beads as that might result in sample loss. If Ampure XP beads is not available, alternative beads such as MagSi magnetic beads (cat: MDKT00010075) can also be used.Removing any excess of RNA, avoids that cDNA-RNA duplexes are degraded during duplex-specific nuclease (DSN) treatment.Timing: 0.5 h27.Set up the following 16\u00a0\u03bcL reaction:CRITICAL: The concentration of rRNA depletion probe mix is optimized for using 6\u00a0\u03bcg of total RNA as starting material. If the input RNA increases, the rRNA depletion probes should increase accordingly. The ratio between depletion probe mix and targeted molecules (cDNA) is around 2:1.28.Denature sample for 2\u00a0min at 98\u00b0C using thermocycler.29.Incubate the sample for 5\u00a0min at 68\u00b0C.30.Add pre-warmed (2\u00a0min at 68\u00b0C) mix containing the following components:CRITICAL: To avoid unspecific binding of probes to cDNAs during the treatment and thus unspecific degradation, it is critical to keep the reaction temperature at 68\u00b0C when mixing samples (from step 27 ) with DSN enzyme mix (from step 30). Pre-warm the reaction mix, using a separate PCR block and keep samples in the thermocycler when adding the pre-warmed mix.31.Mix sample by pipetting several times and incubate for 20\u00a0min at 68\u00b0C in a thermocycler.32.\u00d7), mix contents and spin the tube briefly in a micro-centrifuge.To inactivate DSN enzyme, add 20\u00a0\u03bcL of DSN stop solution  ethanol.Place the PCR tubes at the magnets stand and wait till the solution is clear (~2\u00a0min).36.Remove the residual ethanol and allow the beads to slightly dry for 1\u00a0min. Elute in 9.6\u00a0\u03bcL of RNase-free water.Note: avoid over drying the beads as that might result in sample loss.rRNA depletion is based on the designed DNA probes targeting ribosomal RNA .Timing: 1.5 h37.To amplify the library by PCR, prepare the following mix:CRITICAL: To increase the sequencing complexity per sample and enable multiplexing, we use different oligos for each sample  of Ampure XP beads (20\u00a0\u03bcL respect to 100\u00a0\u03bcL) to the recovered supernatant from step 41. Mix the sample by pipetting up and down and incubate at 20\u00b0C\u201325\u00b0C for 5\u00a0mins.Add with 0.243.a.Remove the supernatantb.Wash beads twice with 200\u00a0\u03bcL of freshly made 70% (vol/vol) ethanol.Place the PCR tubes at the magnets stand and wait till the solution is clear (~2\u00a0mins).44.Remove the residual ethanol and allow the beads to slightly dry for 1\u00a0min. Elute in 10\u00a0\u03bcL in water or EB buffer .45.Measure the final library concentration by Qubit using the dsDNA HS assay kit and check the size distribution by Bioanalyzer.46.Sequence the libraries using pair-end 75 cycles Illumina NextSeq 500.Note: For pair-end 75 cycles sequencing in this case, using 60\u00a0bp for read1 and 15\u00a0bp for read2. Read2 will identify the molecule primed by either oligo-dT or random hexamer. In general, we recommend at least 6 million raw reads per yeast sample. Any alternative Illumina platform could be used instead of a NextSeq 500. Read sequencing length can be altered depending on the complexity of the genome of interest and the ability to uniquely map reads to the genome.This protocol will generate sequencing libraries of 5\u2032P mRNA degradation intermediates, detailed workflow is shown in \u2022De-multiplex raw data using the indexing information: Using bcl2fastq (v2.20.0) for base-calling. We recommend allowing 1 mismatch in index 1 and 1 mismatch in index2.\u2022Trim sequencing adaptor: Use cutadapt V1.16 to trim sequencing adapter (-a AGATCGGAAGAGCACACGTCTGAACTCCAGTC).\u2022Extract UMI: Use UMI-tools (v0.5.4) to extract 8-nt random barcodes on the 5\u2032 ends of reads. These UMI information will be used to remove PCR duplicates.\u2022S.\u00a0cerevisiae genome). For mapping the 5\u2032-ends reads to the genome, we recommend using the parameter --alignEndsType Extend5pOfRead1 to exclude soft-clipped bases on the 5\u2032end.Align sequencing reads: Use star/2.7.0  to align\u2022Remove PCR duplicates: Use UMI-tools (v0.5.4) to remove duplicated 5\u2032 ends of read introduced by PCR during library preparation.\u2022Quantify transcripts: Use Subread package (featureCounts)  to count\u2022Fivepseq package to map 5\u2032 ends with respect to start, stop codon and codons at metagene level  complemented by other endonucleolitica cleavages events. In addition, HT-5Pseq libraries may vary in library complexity as a result of the variation of fractions on mRNA degradation intermediates present in a sample in respect to the total RNA. For example, HT-5PSeq libraries from xrn1\u0394 cells are in general more complex, as 5\u2032P mRNA degradation intermediates are not efficiently removed and thus represent a higher proportion of the total RNA population. To control for this, we add UMI during the RNA ligation step. If a lower fraction of mRNA degradation intermediates is expected, we recommend increasing the amount of total RNA starting material.Thirdly, as the abundance of 5\u2032P end molecule depends on both translation and mRNA stability, any factor involved in those process can affect the observed 5\u2032P seq profile. For example, when investigating mRNA degradation profiles in ecreased . In xrn1RNA degradation1)When handling with RNA samples, always keep RNA on the ice.2)Check the RNA integrity of RNA extraction.3)Use RNase inhibitor during the protocol (steps 11 and 19) and aliquot RNase-free reagents.4)Perform RNA extraction with phenol-chloroform (step 1) as fast as possible.Low yield DNA library (step 45)1)If starting RNA is less, increase the starting RNA amount.2)Inefficient removal of RNA template (step 22), this will loss the cDNA library after DSN treatment. Optimize RNA removal steps (step 22).3)Increase few PCR cycles in PCR amplification steps (step 38). Final PCR cycles should be less than 20 cycles.4)For bead cleanup, do not over dry the beads. That might lead to sample loss.Large number of rRNA reads1)DNA leftover in RNA sample can potential saturate DSN enzymatic activity (step 27). This may decrease the rRNA depletion efficiency. Perform DNase treatment to RNA samples (step 3).2)Optimize DSN for rRNA depletion if using custom depletion probes (step 27\u201336). Optimize mix annealing temperature (steps 29\u201330) based on the melting temperature of newly designed probes. Mix samples with probes by pipetting and keep them on the thermocycle at the selected temperature.Large number of PCR duplicates3)Increase the input RNA material to increase the complexity.4)Decrease the final PCR cycles (from step 38) that will increase the useful reads.Biased 5\u2032P reads to 3\u2032 end5)If the 5\u2032P reads biased towards to 3\u2032, decrease the usage of oligo-dT in reverse-transcription (step 17) to get more homogenous distribution profile.vicente.pelechano.garcia@ki.se) .Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Vicent Pelechano (This study did not generate new unique materials nor reagents.GSE152375.The raw and processed sequencing data are deposited at GEO with accession number"}
+{"text": "Caenorhabditis elegans to measure transcription from embryos and adult worms. Here, we provide a detailed overview of the protocol highlighting the critical steps for generating successful libraries.Global Run-On sequencing (GRO-seq) is one of the most sensitive techniques to detect nascent transcription from RNA polymerase (Pol) at a genome-wide level. The protocol incorporates labeled ribonucleotides into nascent RNAs from Pol I, II, and III. We have adapted the GRO-seq protocol to the nematode For complete details on the use and execution of this protocol, please refer to   \u2022C.\u00a0elegans adults or embryosIsolation of nuclei from \u2022Labeling of nascent transcripts with a biotinylated nucleotide\u2022Three immunoprecipitation steps allow the efficient removal of the background\u2022The library preparation strategy allows further removal of the background Caenorhabditis elegans to measure transcription from embryos and adult worms. Here, we provide a detailed overview of the protocol highlighting the critical steps for generating successful libraries.Global Run-On sequencing (GRO-seq) is one of the most sensitive techniques to detect nascent transcription from RNA polymerase (Pol) at a genome-wide level. The protocol incorporates labeled ribonucleotides into nascent RNAs from Pol I, II, and III. We have adapted the GRO-seq protocol to the nematode  Drosophila melanogaster, and plant cells . For information about NGM plates and M9 buffer composition, please refer to the WormBook (http://www.wormbook.org/).CRITICAL: the first embryonic divisions happen in a relatively short time. Therefore, handling time should be minimized to avoid the collection of embryos at more advanced developmental stages. Always use cold reagents after bleaching to slow down embryonic cell divisions.Optional: If needed, embryos can be stained with DAPI and visualized using a fluorescent microscope to assess the developmental stage of the population. For more information about this step, please refer to . Low temperatures would cause Sarkosyl to precipitate. Allow all reagents to equilibrate at room temperature before mixing. Prepare immediately before use and visually inspect the buffer before adding to the sample.Note: The table shows the volumes to perform one Nuclear Run-On (NRO) reaction. Scale-up accordingly if you are performing an NRO reaction on multiple samples. NRO reaction is performed in 200\u00a0\u03bcL final volume: 100\u00a0\u03bcL nuclei suspension\u00a0+ 80\u00a0\u03bcL NRO 2\u00d7 mix\u00a0+ 20\u00a0\u03bcL Bio-11-UTP.Optional: 0.04% Tween 20 can be added to the Binding & Washing Buffer 2\u00d7 to reduce non-specific binding.CRITICAL: NaOH can cause chemical burns. Handle with care and avoid any contact with skin and eyes.Optional: 0.02% Tween 20 can be added to Solution A to prevent beads to adhere to tube walls during washes.Optional: 0.02% Tween 20 can be added to Solution B to prevent beads to adhere to tube walls during washes.CRITICAL: all steps of the protocol are performed at 4\u00b0C unless stated differently. Pre-chill all reagents and equipment before use. Nuclease-free reagents need to be used in all steps of the protocol.Timing: 1 h1.Resuspend worms or embryos in 1.5\u00a0mL of cold Nuclei extraction buffer (NEB) and transfer to a pre-chilled stainless steel tissue grinder on ice.2.Lyse worms to release nuclei by applying 40 dounce strokes.CRITICAL: take a small aliquot of the lysate (10\u201320\u00a0\u03bcL) and check that the worms are lysed using a stereomicroscope. Intact bodies and embryos should be absent. If intact corpses are still present, increase the number of dounce strokes.3.Transfer the lysate to a pre-chilled 1.5\u00a0mL microcentrifuge tube.Note: Multiple samples can be processed simultaneously. If so, keep lysate from step 3 on ice while lysing the other samples. In this case, wash the metal dounce well between each sample with milliQ water. After processing all the samples, proceed immediately to step 4.4.g for 4\u00a0min at 4\u00b0C.Remove debris by centrifuging at 100\u00d75.Transfer the supernatant to a new 1.5\u00a0mL low binding microcentrifuge tube.CRITICAL: carefully collect the supernatant without disturbing the debris pellet. If necessary, repeat steps 4 and 5 until lysate is clear from debris. A residual 50\u2013100\u00a0\u03bcL can be left in the tube to avoid debris carryover.6.\u00d7g for 4\u00a0min at 4\u00b0C.Pellet nuclei by centrifuging at 1,0007.Remove supernatant and wash nuclei with 1\u00a0mL NEB.CRITICAL: wash nuclei by pipetting up and down several times using a wide-bore tip. Gently pipette nuclei to preserve their integrity.8.\u00d7g for 4\u00a0min at 4\u00b0C.Pellet nuclei by centrifuging at 1,0009.Repeat steps 7 and 8 three more times for a total of 4 washes with NEB.10.Wash nuclei in 1\u00a0mL Freezing buffer NO-Glycerol.CRITICAL: wash nuclei by pipetting up and down several times using a wide-bore tip. Gently pipette nuclei to preserve their integrity.11.\u00d7g for 4\u00a0min at 4\u00b0C and discard the supernatant.Pellet nuclei by centrifuging at 1,00012.Resuspend nuclei in 100\u00a0\u03bcL Freezing buffer.Pause point: nuclei in the Freezing buffer can be stored at \u221280\u00b0C for up to 1 year.The following steps describe the procedure to isolate intact nuclei from worms or embryos. The protocol has been tested with 1,000 to 40,000 worms and 40,000 to 300,000 early embryos.Timing: 15\u00a0minde novo assembly of the pre-initiation complex and avoid new transcriptional initiation. A negative NRO control reaction can be added at this step. In the negative NRO reaction, UTP is used instead of Biotinylated-UTP. If you are performing the experiment for the first time, the addition of negative control is strongly recommended.13.Prepare the NRO 2x mix  and gently mix.Add 20\u00a0\u03bcL of Bio-11-UTP 10\u00a0mM to the NRO 2CRITICAL: if running a negative NRO reaction, replace Bio-11-UTP with 0.5\u00a0\u03bcL of UTP 100\u00a0mM and 19.5\u00a0\u03bcL of nuclease-free water.16.Add 100\u00a0\u03bcL of lysed nuclei from the previous step 12. Gently mix the reaction well using a wide bore tip.17.Incubate the reaction for 3\u00a0min at 30\u00b0C.18.Transfer the tubes on ice and add 50\u00a0\u03bcL ice-cold nuclease-free water and 750\u00a0\u03bcL TRIzol LS reagent and mix well to stop the reaction.19.Incubate nuclei in TRIzol for 5\u00a0min at room temperature (20\u00b0C\u201325\u02daC) to permit complete dissociation of the nucleoprotein complexes.CRITICAL: TRIzol has an acute oral and dermal toxicity. Always handle in a chemical hood. Contact with eyes and skin should be avoided.Pause point: Nuclei in TRIzol can be stored at \u221280\u00b0C for up to a week (we have not tested longer storage).NRO is performed on isolated nuclei in the presence of Bio-11-UTP. Sarkosyl is added to prevent Timing: 1\u00a0h 15\u00a0min20.Add 100\u00a0\u03bcL of 1-Bromo-3-chloropropane (BCP) and mix it well by vortexing.CRITICAL: BCP is toxic upon inhalation. Always handle in a chemical hood.21.Incubate at RT for 15\u00a0min.22.\u00d7g for 15\u00a0min at 4\u00b0C, then transfer the aqueous phase (upper phase) containing the RNA to a new low binding microcentrifuge tube.Centrifuge at 12,000Note: Avoid transferring any of the interphase or organic layer into the pipette when removing the aqueous phase. The tube can be angled at 45\u00b0 to facilitate the process. Approximately 450\u00a0\u03bcL of aqueous phase can be collected at this step.23.Add 2\u00a0\u03bcL of GlycoBlue and mix it well by vortexing for 5\u201310 s.24.Add 500\u00a0\u03bcL of isopropanol and mix it vigorously by vortexing for 10\u201315 s.25.Incubate at RT for 15\u00a0min to precipitate the RNA.26.\u00d7g for 15\u00a0min at 4\u00b0C to pellet the RNA.Centrifuge at 12,00027.Remove the supernatant and add 1\u00a0mL of 75 % Ethanol to the RNA pellet.28.\u00d7g for 5\u00a0min at 4\u00b0C.Centrifuge at 7,500Note: After centrifugation, a blue pellet should be visible at the bottom of the tube.CRITICAL: Carefully remove the supernatant without disturbing the RNA pellet.29.Note: to completely remove the supernatant without disturbing the pellet you can use the following procedure:a.Remove the supernatant using a p1000 micropipette.b.Briefly centrifuge to collect all residual supernatant at the bottom of the tube. At this point, the pellet should be on the side of the tube.c.Using a p200 micropipette, gently push at the bottom-center of the tube and remove all residual ethanol. Always check that the pellet is not entering the tip.d.CRITICAL: do not over-dry the RNA pellet as this would make it difficult to resuspend it.Briefly air dry the pellet.Remove the supernatant and air dry the pellet for 1\u20132\u00a0min.Total RNA, including biotinylated nascent RNA, is isolated using TRIzol.Timing: 8\u00a0min30.Resuspend the RNA pellet from the previous step 29 in 8\u00a0\u03bcL water.Pause point: RNA can be stored at \u221280\u00b0C for up to a week.Note: The analysis of RNA quality/integrity is not required at this step. This is because degradation fragments cannot be cloned with the library preparation strategy described in this protocol. Only RNA molecules with 3\u2032-hydroxyl biotinylated ends will be suitable for cloning. In addition, the RNA quality control methods will primarily detect mature mRNAs and not Polymerase-bound nascent RNAs, which are much less abundant.31.\u00d7 reverse transcriptase buffer (provided with SuperScript\u2122 IV Reverse Transcriptase) and mix it well by pipetting or vortexing. Spin down the samples using a benchtop centrifuge.Add 2\u00a0\u03bcL of 5Note: RNA fragmentation can be performed using different buffers, including commercially available RNA fragmentation reagents, based on MgCl2 or ZnCl2. If using a different buffer, check that the final library size is correct and adjust the fragmentation time accordingly.32.Incubate the samples at 95\u00b0C for 7\u00a0min.Note: incubation can be performed in a ThermoMixer equipped with Thermo Top. Alternatively, the sample can be transferred to a PCR tube and incubated in a thermocycler with the lid temperature set at 105\u00b0C. During the fragmentation time, it is possible to start preparing the Dynabeads magnetic beads to isolate biotinylated molecules.33.Immediately block fragmentation by shifting the samples on ice.34.Add 50\u00a0\u03bcL of ice-cold nuclease-free water and keep on ice for at least 1\u00a0min before proceeding to the next step.Timing: 10\u00a0minmanufacturer\u2019s instructions before binding to biotinylated RNA.CRITICAL: This step is crucial since the beads are not supplied in RNase-free solutions.Note: all the washing steps are performed at room temperature (20\u00b0C\u201325\u02daC) unless stated differently.35.Resuspend the Dynabeads\u2122 magne/tic beads in the vial .36.Transfer 30\u00a0\u03bcL of Dynabeads\u2122 magnetic beads per sample to a low binding microcentrifuge tube.Note: 30\u00a0\u03bcL of beads are sufficient for a sample of 1,000 to 40,000 adult worms or 40,000 to 300,000 embryos. If performing the experiment with a different number of worms/embryos, the volume of beads should be scaled accordingly.37.\u00d7 and resuspend by pipetting or gentle vortexing for 5\u201310 s. Then, briefly centrifuge the tube using a benchtop centrifuge.Add 1\u00a0mL of Binding & Washing Buffer 138.Place the tube on a magnet for 1 mi/n or until the solution appears clear and discard the supernatant.39.\u00d7 equal to the initial volume of beads taken from the vial at step 36. Resuspend beads by pipetting or gentle vortexing for 5\u201310 s. Then, briefly centrifuge the tube using a benchtop centrifuge.Remove the tube from the magnet and resuspend the magnetic beads in a Binding & Washing Buffer volume 140.Place the tube on a magnetic stand for 1\u00a0min or until the solution appears clear and discard the supernatant.41.Repeat steps 39\u201340 twice for a total of 3 washes.42.Wash the beads twice in Solution A for 2\u00a0min. Use a volume of Solution A equal to or larger than the initial volume of Dynabeads\u2122 magnetic beads initially taken from the vial.43.Wash the beads once in Solution B. Use a volume of Solution B equal to the volume used for Solution A.44.\u00d7 Binding & Washing Buffer.Resuspend the beads in 60\u00a0\u03bcL per sample of 2Note: The washed beads can be prepared in advance and stored at 4\u00b0C for 1\u00a0day.Dynabeads are washed following the Timing: 50\u00a0min45.Add 60\u00a0\u03bcL of washed beads from previous step 44 to 60\u00a0\u03bcL of fragmented RNA from previous step 34.46.Incubate for 30\u00a0min at 25\u00b0C with 1200\u00a0rpm agitation (15\u2019\u2019 ON 45\u201d OFF) in a ThermoMixer.47.Briefly spin the tubes using a benchtop centrifuge and place on a magnetic rack for 1\u00a0min or until the solution appears clear.48.Remove the supernatant and add 1\u00a0mL of High salt buffer. Incubate on rotation for 5\u00a0min at 4\u00b0C.49.Briefly spin the tubes using a benchtop centrifuge and place on a magnet for 1\u00a0min or until the solution appears clear.50.Remove the supernatant and add 1\u00a0mL of Medium salt buffer. Incubate on rotation for 5\u00a0min at 4\u00b0C.51.Briefly spin the tubes using a benchtop centrifuge and place on a magnet for 1\u00a0min or until the solution appears clear.52.Remove the supernatant and add 1\u00a0mL of Low salt buffer. Incubate on rotation for 5\u00a0min at 4\u00b0C.53.Briefly spin the tubes using a benchtop centrifuge and place on a magnet for 1\u00a0min or until the solution appears clear.54.Remove the supernatant, add 1mL TRI Reagent solution, and proceed to RNA isolation as previously described .Pause point: Beads in TRIzol can be stored at \u221280\u00b0C for up to a week.Biotinylated nascent RNAs are enriched by binding to Dynabeads\u2122 magnetic beads. After binding, the beads coated with the biotinylated molecules are washed using high salt buffers to efficiently remove non-biotinylated molecules.Timing: 35\u00a0minNote: Since incorporating Bio-11-UTP stall RNA polymerases, all nascent RNAs should terminate with a 3\u2032-hydroxyl biotinylated end. Therefore, RNA molecules terminating with a 3\u2032-phosphate end, result from the fragmentation steps and represent the background for this protocol. For this reason, 3\u2032-phosphate ends do not need to be repaired to allow ligation of the adapter.55.Resuspend RNA after TRIzol purification in 20\u00a0\u03bcL water.Pause point: RNA can be stored at \u221280\u00b0C for up to a week.56.a.\u00d7 Polynucleotide Kinase Buffer to pellet the gel.Spin \u201c5PRIME Phase Lock Gel\u2122 \u2013 Heavy\u201d tubes for 2\u00a0min at 12,00060.Add the solution from the previous step 58 to a pre-spun Phase Lock tube.61.Add 1 volume (300\u00a0\u03bcL) of Phenol/Chloroform/Isoamyl Alcohol and mix thoroughly by inverting 10\u201315 times.CRITICAL: do not vortex the tube to avoid disturbing the Phase Lock gel.CRITICAL: Phenol:Chloroform is toxic upon inhalation. Always handle in a chemical hood. Contact with eyes and skin should be avoided.62.\u00d7g for 5\u00a0min at room temperature (20\u00b0C\u201325\u02daC) and transfer the aqueous phase containing the RNA (upper phase) to a fresh low binding microcentrifuge tube.Centrifuge at 12,00063.Add 30\u00a0\u03bcL of 3\u00a0M sodium acetate and 2\u00a0\u03bcL of GlycoBlue and vortex for 5\u201310 s.64.Add 900\u00a0\u03bcL ethanol and vortex vigorously for 10\u201315 s.65.Precipitate the RNA by incubating for 1h at \u221220\u00b0C.Pause point: RNA can be precipitated overnight or over-weekend.66.\u00d7g for 30\u00a0min at 4\u00b0C.Centrifuge to pellet the RNA at 12,00067.Remove the supernatant and add 1\u00a0mL of 75 % Ethanol to the RNA pellet.Note: After centrifugation, a blue pellet should be visible at the bottom of the tube.CRITICAL: Carefully remove the supernatant without disturbing the RNA pellet.68.\u00d7g for 5\u00a0min at 4\u00b0C.Centrifuge at 12,00069.Remove the supernatant and air dry the pellet for 1\u20132\u00a0min.CRITICAL: do not over-dry the RNA pellet as this would make it difficult to resuspend it.70.Resuspend the RNA in 5\u00a0\u03bcL water.Timing: 16 h71.a.1\u00a0\u03bcL 10\u00a0\u03bcM 3SR adapterb.\u00d7 Ligation Buffer2\u00a0\u03bcL 10c.2\u00a0\u03bcL \u201cT4 RNA Ligase 2, truncated KQ\u201dd.10\u00a0\u03bcL 50% PEG8000Perform adapter ligation in 20\u00a0\u03bcL final volume by adding to the RNA from the previous step:CRITICAL: PEG8000 is very viscous. Carefully pipette the right amount of PEG in the solution and mix well by carefully pipetting up and down at least 20 times or vortexing. Visually inspect that the solution is well mixed.72.Incubate the reaction for 16\u00a0h at 16\u00b0C in a ThermoMixer equipped with a Thermo top.Biotinylated RNA molecules are ligated to the 5\u2032 pre-adenylated DNA adapter using an optimized version of the T4 RNA ligase. This strategy reduces the formation of ligation artifacts such as concatemers or circles.Timing: 40\u00a0minAlternatives: equivalent SPRI beads can be used at this step instead of Agencourt RNAClean XP beads.73.Add 3 volumes (60\u00a0\u03bcL) of isopropanol to the ligation reaction from the previous step.74.Add 1.8 volumes (36\u00a0\u03bcL) of Agencourt RNAClean XP beads.CRITICAL: beads are very viscous. Mix well before use and carefully pipette the right volume of beads.75.Mix well by pipetting up and down at least 15 times or by gentle vortexing and incubate for 20\u00a0min on ice.Note: during this time, it is possible to start washing Dynabeads (steps 35\u201344) for the 2nd enrichment of biotinylated RNA molecules.76.Briefly spin and place the tube onto a magnetic tube rack for 5\u00a0min to separate the beads from the solution.77.Slowly pipette the cleared solution from the tube and discard.78.While on the magnetic rack, dispense 200\u00a0\u03bcL of 75% ethanol into the tube, incubate for 30\u00a0s and discard the ethanol.79.Repeat the previous step for a total of 2 washes.80.Remove the tube from the magnetic rack and briefly spin down residual ethanol using a benchtop centrifuge.81.Place the tube onto a magnetic tube rack and remove residual ethanol.82.Let the beads air dry for 5\u00a0min.CRITICAL: Over-drying the sample may result in a lower recovery.83.Remove tubes from the rack and elute purified RNA from the beads by adding 61\u00a0\u03bcL water.CRITICAL: manually resuspend the beads by pipetting up and down several times. Expel the elution buffer down the side of the tube to ensure the entire bead mass comes into contact with the buffer. Incubate for 30\u00a0s before proceeding to the next step.84.Place the tubes onto a magnetic tube rack for 1\u00a0min to separate the beads from the solution. Then, slowly collect 60\u00a0\u03bcL RNA solution and transfer to a fresh tube.CRITICAL: slowly collect the solution while keeping the tubes onto the magnetic rack to avoid beads' carryover. 1\u00a0\u03bcL of excess water is added at step 83 is added to avoid beads' carryover.Pause point: RNA can be stored at \u221280\u00b0C for up to a week.SPRI (Solid Phase Reversible Immobilization) beads are used to purify the RNA from the ligation reaction. No size selection is performed at this step.Timing: 1 h85.Heat purified RNA at 65\u00b0C for 5\u00a0min to denature secondary structures and place on ice for 1\u00a0min.86.nd enrichment of biotinylated RNA molecules by repeating steps 45\u201354.Perform a 2Timing: 2 h87.Resuspend RNA after trizol purification in 15\u00a0\u03bcL water.88.a.1\u00a0\u03bcL 5SR adapter 10\u00a0\u03bcMb.\u00d72\u00a0\u03bcL Ligation buffer 10c.2\u00a0\u03bcL T4 RNA LigasePerform 5\u2032 end ligation in a total volume of 20\u00a0\u03bcL by adding to RNA from the previous step:89.Mix well and incubate the reaction at 25\u00b0C for 2 h.90.Proceed to RNA purification using Agencourt RNAClean XP beads as described in steps 73\u201384.Timing: 1 h91.Heat purified RNA (60\u00a0\u03bcL) at 65\u00b0C for 5\u00a0min to denature secondary structures and place on ice for 1\u00a0min.92.rd enrichment of biotinylated molecules by repeating steps 45\u201354.Proceed to the 3Timing: 1\u00a0h 20\u00a0min93.Resuspend RNA after TRIzol purification in 11\u00a0\u03bcL of water.94.a.1\u00a0\u03bcL SR_RT primer 50\u00a0mMb.1\u00a0\u03bcL dNTP mix 10\u00a0mMc.\u00d74\u00a0\u03bcL SSIV Buffer 5d.1\u00a0\u03bcL DTT 100\u00a0mMe.1\u00a0\u03bcL RNase inhibitorf.1\u00a0\u03bcL SuperScript IV reverse transcriptasePerform reverse transcription reaction in a final volume of 20\u00a0\u03bcL by adding to RNA from the previous step:95.Mix well and incubate the reaction at 50\u00b0C for 1\u00a0h in a thermal cycler with the lid temperature set at 85\u00b0C.96.Inactivate the reaction by heating the sample at 80\u00b0C for 10\u00a0min.97.Keep the sample at 4\u00b0C until ready to proceed to the next step.Pause point: reverse-transcribed cDNA can be stored at \u221220\u00b0C for up to a month.Ligated RNA molecules are reverse transcribed to produce complementary DNA molecules suitable for library amplification.Timing: 45\u00a0minAfter reverse transcription, libraries are amplified by PCR using a universal primer and a barcoded primer to allow sample multiplexing. Primer sequences are listed in CRITICAL: The number of PCR cycles should be minimized to avoid overamplification, which increases PCR artifacts. Please refer to Note: if multiple samples need to be sequenced together, use a different SR barcode primer per sample. The sequence of the SR barcode primers is available in The number of amplification cycles required to amplify the libraries is influenced by many factors and needs to be determined experimentally for each sample . Therefore, we suggest performing a test PCR amplification of the libraries using \u00bc of the reverse transcription reaction.98.a.17\u00a0\u03bcL waterb.5\u00a0\u03bcL reverse-transcribed cDNA libraryc.1.5\u00a0\u03bcL 10\u00a0\u03bcM SR universal primerd.1.5\u00a0\u03bcL 10\u00a0\u03bcM SR barcode primer 10e.\u00d725\u00a0\u03bcL NEBNext\u00ae Ultra\u2122 II Q5\u00ae Master Mix 2Setup PCR reaction in a final volume of 50\u00a0\u03bcL by combining:99.Place the tube on a thermocycler with the heated lid set to 105\u00b0C and perform PCR amplification using the following PCR cycling conditions:Note: We generally perform 20 PCR cycles for the test PCR for both adults and embryos.Timing: 30\u00a0minAlternatives: equivalent SPRI beads can be used at this step instead of Agencourt AMPure XP beads. If different beads are used, the beads/sample ratio might vary. Refer to manufacturer guidelines to select the proper beads/sample ratio to purify fragments > 100\u00a0bp.100.Add 90\u00a0\u03bcL AMPure XP beads to 50\u00a0\u03bcL PCR reaction.CRITICAL: beads are very viscous. Mix well before use and carefully pipette the right volume of beads.101.Mix well by pipetting up and down at least 15 times or by gentle vortexing and incubate for 5\u00a0min at RT.102.Briefly spin using a benchtop centrifuge and place the tube onto a magnetic tube rack for 5\u00a0min to separate the beads from the solution.103.Slowly pipette the cleared solution from the tube and discard.104.While on the magnetic rack, dispense 200\u00a0\u03bcL of 75% ethanol into the tube, incubate for 30\u00a0s and remove the Ethanol.105.Repeat the previous step for a total of 2 washes.106.Remove the tube from the magnetic rack and briefly spin down residual ethanol using a benchtop centrifuge.107.Place the tube onto a magnetic tube rack and remove residual ethanol.108.Let the beads air fry for 5\u00a0min.CRITICAL: Over-drying the sample may result in a lower recovery.109.Remove the tube from the rack and elute purified DNA from the beads by adding 18\u00a0\u03bcL water.CRITICAL: manually resuspend the beads by pipetting up and down several times. Expel the elution buffer down the side of the tube to ensure the entire bead mass comes into contact with the buffer. Incubate for 30\u00a0s before proceeding to the next step.110.Place the tubes onto a magnetic tube rack for 1\u00a0min to separate the beads from the solution. Then, slowly collect 17\u00a0\u03bcL of cleaned DNA libraries and transfer them to a fresh tube.CRITICAL: slowly pipette the solution while keeping the tubes onto the magnetic rack to avoid beads' carryover 1\u00a0\u03bcL of excess water is added at step 110 to prevent beads carryover.AMPure SPRI beads are used to remove salts, dNTP, primers, and primer dimers from the PCR reaction. 1.8 volumes of AMPure beads are used to recover fragments > 100\u00a0bp (expected size of amplicons 140\u2013350\u00a0bp).Timing: 10\u00a0min111.manufacturer conditions.Run 2\u00a0\u03bcL purified DNA libraries on an Agilent Tapestation instrument using the High Sensitivity D1000 reagents following 112.Examine the result of the Tapestation run and determine the right PCR cycles for the full-scale PCR amplification. An example of Tapestation results for both worms and embryos can be found in the CRITICAL: Adjust the PCR cycles of the final PCR amplification, calculating that each library should be in the same amount range of the upper and lower markers. Check for the presence of over-amplification products (high molecular size products) and reduce the number of PCR cycles to eliminate them (See them See .113.a.7\u00a0\u03bcL waterb.15\u00a0\u03bcL reverse-transcribed cDNA library (from step 97)c.1.5\u00a0\u03bcL SR universal primer 10\u00a0\u03bcMd.1.5\u00a0\u03bcL SR barcode primer 10\u00a0\u03bcMe.\u00d725\u00a0\u03bcL NEBNext\u00ae Ultra\u2122 II Q5\u00ae Master Mix 2Setup a full-scale PCR reaction in a final volume of 50\u00a0\u03bcL by combining:114.Place the tube on a thermocycler with the heated lid set to 105\u00b0C and perform PCR amplification using the following PCR cycling conditions:115.Purify the PCR reaction by repeating steps 100\u2013110.116.manufacturer conditions.Run 2\u00a0\u03bcL of purified DNA libraries on an Agilent Tapestation instrument using the High Sensitivity D1000 reagents following CRITICAL: This step is crucial to assess the amount of each DNA library, the amplification status, and the absence of residual PCR primers before quantifying and sequencing. An example of TapeStation results for both worms and embryos can be found in the section Purified DNA libraries are run on an Agilent Tapestation instrument using the High Sensitivity D1000 reagents to check for library size, purity, and amount.Timing: 20\u00a0min117.a.Prepare 200\u00a0\u03bcL of working solution for each sample by diluting the Qubit\u00ae dsDNA HS Reagent 1:200 in Qubit\u00ae dsDNA HS Buffer.b.To quantify the standard solutions transfer 190\u00a0\u03bcL working solution and 10\u00a0\u03bcL standard solution into a new Qubit 0.5\u00a0mL tube (for both standards #1 and #2).c.To quantify the libraries, transfer 198\u00a0\u03bcL of working solution and 2\u00a0\u03bcL of sample into a new Qubit 0.5\u00a0mL tube.d.Mix well, briefly spin using a benchtop centrifuge, and incubate for 2\u00a0min at RT.e.Read sample concentration by selecting the dsDNA High Sensitivity as the assay type on the Qubit instrument.Quantify libraries using the Qubit\u2122 dsDNA HS Assay Kit Always measure Qubit standard solutions before quantifying the DNA libraries.118.Combine the average peak size (step 116) and the concentration value to calculate the molarity of each library. Pool all libraries that have to be sequenced together in an equimolar ratio.Note: Library pooling can be performed by using the \u201cIllumina Pooling Calculator\u201d at https://support.illumina.com/help/pooling-calculator/pooling-calculator.htmIn the following steps, libraries are precisely quantified and combined in an equimolar ratio based on the size distribution and the concentration.Timing: 12\u201324 h119.Sequence pooled GRO-seq libraries using an Illumina Sequencing platform compatible with the TruSeq approach.Note: we use a NextSeq-500 instrument and the NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Single-read sequencing). Generally, 20\u201330 million reads per sample provide enough coverage for both worms and embryos.After amplification, cDNA libraries are run on a Tapestation to check their quality and quantity. Expected library size range between 140\u2013350\u00a0bp A and 1B.1.Use bcl2fastq to demultiplex the samples and convert base call files (bcl) to fastq.gz files.Note: NextSeq 500 flowcell has 4 different lanes. Therefore, the result of the previous step will be 4 fastq.gz per sample. We usually concatenate all files corresponding to the same sample and work with a single file per sample. Files from different lanes can also be processed separately to assess differences between sequencing lanes.2.Remove adapter sequence from raw reads using cutadapt or any equivalent software. Adapter sequence: TGGAATTCTCGGGTGCCAAGG3.Remove random tetramers at both 5\u2032 and 3\u2032 ends using cutadapt or any equivalent software.Optional: random tetramers at both ends can also be used for removing PCR duplicates.Note: To improve the mapping step, we remove reads that are too short for mapping. Therefore, we apply a size selection criteria during raw reads processing, keeping only reads of 24\u00a0bp or longer after adapter trimmings. Thus, after random tetramers removal, reads will be 16 nucleotides or longer.4.C.\u00a0elegans genome using bowtie2.Map the trimmed reads on 5.Count features using featureCounts or any equivalent software. This step will produce a count table for the selected feature .6.Compute TPM or use deseq2 software to perform differential gene expression analysis.Optional: to visualize genomic data, we suggest generating normalized bigwig files .C.\u00a0elegans, which required 100,000 worms  or 40,000 early embryos . The input required for this protocol is much lower than the first reported GRO-seq in 00 worms . NonetheAnother limitation is the high cost of the method. Indeed, reagents such as biotinylated nucleotides, streptavidin-conjugated beads, and ligases drastically influence the cost per sample. Home-production of the required enzymes and order of large batches of biotinylated nucleotides helps reduce the cost per sample of this protocol.Ultimately, to understand the advantages and the limitations of the general GRO-seq procedure, we suggest referring to .No library product or > 25 PCR amplification cycles are required to obtain the libraries (step 112).Possible causes:Poor nuclei preparation quality.Problems in the NRO reaction.RNA degradation.Low recovery in the SPRI purification steps.Potential solutions are listed below:Stain nuclei with DAPI and check for their integrity by fluorescence microscopy. If nuclei are not intact, reduce the number of dounce strokes at step 2.\u00d7 mix. If present, prepare the solution again.Check for precipitates in the NRO 2Always work on ice and use RNase-free reagents at all steps.Be careful not to over-dry the beads after purification. Dry beads are difficult to resuspend and may result in low recovery of RNA or DNA.Libraries show the presence of unused primers or primer-dimers (< 100\u00a0bp) after Tapestation analysis (step 116).Note: We do not recommend performing gel purification to remove primer-dimers as this would result in sample loss. In our experience, an additional round of SPRI beads purification is sufficient to remove unused primers or primer-dimers and to obtain libraries of high quality.If primers are present (< 100\u00a0bp), perform a new round of library size selection using AMPure SPRI beads and perform a new Tapestation analysis.Libraries are overamplified and show peaks corresponding to high molecular weight products (> 600\u00a0bp) (step 112).Reduce PCR amplification by 2\u20134 cycles and perform a new Tapestation analysis. Streptavidin magnetic beads adhere to the tube wall after washing with solution A (step 42).The addition of 0.02% tween to Solution A can help to prevent this issue. Also, the use of low binding microcentrifuge tubes is suggested.Furthermore, we have noticed that solution A might form precipitates few days after preparation. Therefore, we suggest preparing a new batch of solution A for each experiment.Small or no pellet recovered after TRIzol or Phenol:Chloroform purification (steps 26 or 66).The absence of pellet after RNA precipitation might be due to incomplete mixing of the aqueous phase containing the RNA with GlycoBlue and Isopropanol/Ethanol (steps 23\u201324 for TRIzol purification and 64\u201365 for Phenol:Chloroform purification).Mix the sample again by vortexing at maximum speed for 15\u00a0s and repeat the precipitation and centrifugation steps.\u00d7g.If the pellet is still not visible, add 2\u00a0\u03bcL of GlycoBlue, mix thoroughly, and repeat the precipitation and centrifugation steps by increasing the centrifugation speed to 16,000germano.cecere@pasteur.fr).Further information and requests for resources and reagents should be directed to and fulfilled by the lead contact, Germano Cecere (All materials are available commercially. A list of manufacturers for all reagents is provided in the"}
+{"text": "Non-invasive longitudinal imaging of osseointegration of bone implants is essential to ensure a comprehensive, physical and biochemical understanding of the processes related to a successful implant integration and its long-term clinical outcome. This study critically reviews the present imaging techniques that may play a role to assess the initial stability, bone quality and quantity, associated tissue remodelling dependent on implanted material, implantation site (surrounding tissues and placement depth), and biomarkers that may be targeted. An updated list of biodegradable implant materials that have been reported in the literature, from metal, polymer and ceramic categories, is provided with reference to the use of specific imaging modalities  suitable for longitudinal and non-invasive imaging in humans. The advantages and disadvantages of the single imaging modality are discussed with a special focus on preclinical imaging for biodegradable implant research. Indeed, the investigation of a new implant commonly requires histological examination, which is invasive and does not allow longitudinal studies, thus requiring a large number of animals for preclinical testing. For this reason, an update of the multimodal and multi-parametric imaging capabilities will be here presented with a specific focus on modern biomaterial research.  Because of the invasive nature of implantation practice and associated organism reactions to the presence of foreign materials, imaging has been used as a tool to monitor the patient\u2019s condition ever since the discovery of X-rays in 1895. With the development of technologies and the increase in variety, the possible aspects and options for imaging have increased, allowing the visualization not only of structural condition, but also biological reactions and interactions. Currently, implants used in orthopaedics, dentistry, reconstructive and cosmetic surgery use a large variety of materials, including permanent implants made of polymers  , ceramicBecause of the ongoing diversification and narrow specialization in the field of science, the available information has become increasingly diverse and complicatedly interlinked. Concerns have been raised about the insufficient mutual understanding of the needs and capabilities among the specialists in the related fields such as medicine, biotechnology and imaging. As a result, the inadequate combinations of imaging modalities and targets have resulted in studies not being performed to their full potential. This review provides a detailed overview of the non-invasive imaging techniques commonly used in preclinical studies: computed tomography (CT), positron emission tomography (PET), ultrasound (US), PAI (photoacoustic imaging) and MRI (magnetic resonance imaging). The advantages and limitations of these modalities are evaluated for imaging the available biodegradable metallic, ceramic and polymer implants and the related tissue healing processes through targeting biomarkers of bone regeneration, angiogenesis and inflammation.With the scientific progress and development of new materials, by the 20th century, a variety of new substances and multi-phase materials were found and developed, such as alloys based on titanium, zirconium oxide, cobalt-chromium, nickel-chromium, stainless steels, polymers etc. ), ceramics , metals  and their composites are known to be biodegradable  and alreBased on the above, the potential targets for clinical and research imaging of biodegradable implants are: (i) immediate and long-term tissue and cell responses; (ii) tissue regeneration; (iii) implant integration (implant\u2013tissue interface); and (iv) changes in implant structure. The biological processes have specific characteristics that are known as biomarkers  which caThe damage to the living tissue and subsequent healing are closely associated with the inflammation process that is controlled by the immune system. While the actual details of cellular and biochemical reactions can differ depending on the severity and the site of the trauma, in general the inflammatory response can be separated into: (1) recognition of the harm by cell receptors (danger-associated molecular patterns of pattern recognition receptors); (2) activation of inflammatory pathways ; (3) release of inflammation markers ; and (4) recruitment of inflammatory cells  . In the Blood vessel formation, or angiogenesis, is a crucial part of trauma healing, ensuring the necessary transport of the metabolic molecules and the formation of the regenerated tissues. This directly influences the biochemical processes associated with damage and subsequent healing. When dealing with the biodegradable implants, blood vessels are also involved in the disposal of the degradation products, such as in the case of metal ions . Bone regeneration in the context of implants refers to the absorption of damaged tissue and the growth of new tissue around the bone implant. The involved pathways of chondrocyte, osteoclast and osteoblast activity regulation are highly complex, involving specific and non-specific tissue healing cell signals which are directly linked to hematoma from damaged blood vessels and inflammatory reactions . PhysicaBecause they are essentially designed to become a part of the human body, both chemical and mechanical properties of the biodegradable implants have to fulfil strict requirements. They need to be biochemically neutral, non-toxic and must not trigger adverse reactions. At the same time, they must have a controlled, gradual rate of degradation while maintaining structural integrity, which is needed to allow the tissues to regenerate and compensate for the lost implant volume without the danger of damage from fragmentation. Chemical properties of implants are mostly influenced by the material they are made of. A major factor is the chemical reaction of the implanted material with the surrounding tissues, and corresponding changes in local biochemistry. The resulting changes in cell activity that affect the whole process of wound healing and tissue remodelling can be material-specific. By making use of alloys or otherwise mixed materials, the possible variables affecting degradation and interaction with the tissues can be manipulated with high flexibility and precision. Notable examples for this approach is the use of calcium, zinc, aluminium and various rare metals to adjust the degradation properties of magnesium implants ,11 and hMechanically, implants differ according to production methods, geometry and surface treatment. Production methods decide the microstructure\u2014arrangements of the atoms, density, purity, distribution of additives etc. Depending on the material, these variables can have significant effects on the physical properties of the final product, such as absorption, scattering and attenuation of photons. Geometry, or the shape, of the implants is diverse\u2014both due to specialized uses and also patent analogues from competing manufacturers. In the case of biodegradable implants, geometry also changes during the degradation process. For imaging applications, it is necessary to consider the possible effects of the presence of irregular and thin shapes that can be difficult to recognize. Surface treatment, as the border between the bulk of the implant and the body, has the principal role of interaction with the tissues. Since this decides the success of implant integration, it is the primary focus of imaging, be it in the clinical or research approach. The use of coatings to promote the integration, reduce the adverse reactions and regulate the degradation is increasing, with notable examples being magnesium implants coated with hydroxyapatite, polymers, oxide layers etc ,17. A vaComputed tomography, being the three-dimensional version of the conventional planar X-ray scan, relies on the same principles of using electromagnetic radiation (photons) and the difference in its attenuation rate by different matter. As photons interact with the surrounding matter, they can be absorbed by a photoelectric effect, or undergo scattering through incoherent (Compton) or coherent (Rayleigh) scattering.3/E3 . Except for the absorption edge points in the absorption spectrum of the substance, where there is a sharp rise in absorption coefficient as the energy increases, and the energy of the photon becomes equal to the energy of the electron shell. The combination of the scattering and absorption coefficients is represented as mass absorption coefficient (in cm2/g). In radiology, the mass absorption coefficient has little practical use, instead these values are multiplied by density to obtain linear absorption coefficient (in cm\u22121). In the photoelectric effect, the incident photon is absorbed by the atom while displacing the electron from its shell, which creates the contrast in the rays absorbed by the matter, creating the image. This effect is dependent on electron binding energies, as the lower binding energy allows lower energy photons to interact, and the probability is generally proportional according to formula ZTherefore, to achieve a clear image of an implant, there needs to be sufficient contrast between it and the surrounding tissues while staying within the acceptable photon energy range and ensuring that the attenuated photons do not go below the detector minimum detection range. The polymers, bioengineered implants and grafts are often indistinguishable from the surrounding tissues because of the similar absorption properties. To image these, using CT requires special approach to enhance the contrast, such as alloying the implant material to create composites with desirable properties or using surface coating. The widely spread titanium, stainless steel and zirconium oxide implants have absorbance coefficients significantly higher than those of the body tissues, so they are easily distinguishable. However, the presence of metals produces significant artefacts that reduces the quality of the obtained images ,36,37. ADespite the limitations, CT is a reliable and trusted method for imaging bone pathologies, structural changes and with the use of contrast agents, vascularisation. According to data in +) decay of radionuclides that are the signalling components of the radiotracers. The emitted positron interacts with a surrounding electron and the mutual annihilation reaction produces two photons of gamma energy spectrum (511 keV) that move in opposite directions at a 180\u00b0 angle from each other. The photons are detected, and the annihilation event location is reconstructed using corresponding algorithms. Positron emission tomography uses positrons that are emitted during beta plus . There DAGA-RGD , and MMPDAGA-RGD . In FiguDAGA-RGD , an 18F-x-axis of the scan and to have a uniform shape without sharp angles. However, even if the radiotracer does not interact with the implant, the gamma photons that are the basis of the detection are influenced by the presence of foreign matter, resulting in additional absorption, attenuation, deflection and scatter. To illustrate this, As one of the most safe, comfortable and simple imaging modalities, ultrasound is widely used to study structures and physical processes happening under the cover of the soft tissues. Ultrasound imaging uses the principle of sound waves echoing from the borders of mechanically different tissues , due to Acoustic impedance is defined as material density  and sounAlthough US is limited to soft tissues and the topography of hard surfaces , it stilPhotoacoustic imaging (PAI) relies on the optical absorbance qualities of the tissues and included optical contrast agents down to molecular level. The target chromophores absorb the specific wavelength laser pulses, and the optical energy is converted into detectable sound pressure waves. These chromophores can be endogenous  and exogenous  .The use of PAI for implant monitoring has been previously explored in studies such as by Lee et al.  Figure , who achPhotoacoustic imaging also has potential to be used with biodegradable implants. The possibility to observe in vivo the molecular activity during implant degradation is one of the desired tools in the relevant research. Notably, photoacoustic measurements of oxyhaemoglobin and deoxyhaemoglobin levels reflect the state of blood supply and angiogenesis in the wound area. B0), which is disturbed with a pulse of radiofrequency (RF) field at Larmor frequency (fo), which in turn is calculated based on the strength of magnetic field and gyromagnetic ratio (\u03b3) of the targeted nucleus or particle (with formula being fo = \u03b3 \u00d7 B0) [MRI is one of the most advanced, non-invasive and low-discomfort imaging modalities, which is only limited by high costs, personnel qualification level and incompatibility with ferromagnetic materials. MRI is based on nuclear magnetic polarization created through static magnetic field ( \u03b3 \u00d7 B0) . The res+ protons [MRI is best at imaging soft tissues and liquids, because of the high content of H protons . This ma protons  or by de protons . + protons, like bones and implants, are not optimal imaging targets. However, with bone still being living tissue, it remains possible to image osteolysis at the damage sites [Due to the operating principle of MRI, hard objects without free Hge sites , giving ge sites ,69 and tge sites . While mge sites ,71. IronDue to the ever-expanding list of imaging targets and the constant refinement of imaging technologies, it is becoming increasingly complex to choose a single appropriate modality. Depending on variables such as implant material, surrounding tissue and placement depth, the same target may require different imaging techniques or a combination of them. Thanks to the advances in composite material development, it is possible to produce implants that have drastically different properties. On one hand, it improves the biocompatibility of composites, on the other hand, these composites are often patented. This results in competing manufacturers producing their own alternatives and patenting these in turn. Hence, there are many new materials, often with severely lacking information about their composition and even some basic physical properties. This further complicates imaging studies, since without knowing these properties, it is more difficult and time-consuming to design and perform the studies. For the same reasons, the information about some modalities may be underrepresented compared to others. For example, because X-ray and CT have been established as the gold standard in multiple areas of material and biomedical studies, it was possible to provide material attenuation data relevant for the modality. At the same time, information about magnetic susceptibility, sound velocity and absorption spectrum  for biodegradable materials was insufficient for an adequate compilation. It is necessary for implant material studies to put more focus on reporting these characteristics.To improve the quality of the data obtained using imaging, one of the approaches is to design implants that consider the specifics of the imaging modality. With the developing technologies of custom production such as 3D printing, this is a possible future for preclinical studies that are aiming to understand the details of the body and implant interactions. As an example, it is possible to include chromophores to the bulk material, producing an implant whose degradation kinetics can be followed with PAI at the molecular level. However, such an approach is unsuitable for clinical use and for studying the already existing materials. This is where the multimodal imaging can be of advantage. By achieving an optimal combination of imaging techniques that help to cancel out or mitigate the individual shortcomings, the diagnosis, evaluation and treatment can be done with the highest accuracy and reliability.V\u03b23 isoform is the most used). The \u03b1V\u03b23 expression is quantified using a tracer such as 68Ga-NODAGA-RGD [V\u03b23 expression, and PET to follow bone mineralization with the help of 18F-NaF. When making use of multimodal imaging, the imaging techniques need to be chosen based on how suitable they are for the intended combination of the target(s) and the aim(s). As an example, angiogenesis is a common and reliable imaging biomarker for evaluating tissue healing, because new blood vessels are required to support the growth and functioning of the new tissues. It can be imaged using all imaging modalities mentioned in this paper . By way of example, using PET, the angiogenetic process (i.e. new blood vessel formation associated to vascular endothelium proliferation) can be studied non-invasively by assessing the regulation of the integrin expression . The process of imaging is directly followed by image processing and analysis, the procedures that translate the visual information into quantitative and qualitative parameters. The use of mathematical comparison and evaluation through statistical methods confirms the validity of the results and allows the translation of the data between the similar cases. In implant and tissue imaging, the texture analysis is essential, and can be interpreted as classifying different images or image regions into distinct groups [As mentioned before, different imaging modalities show different variable properties of the imaging target\u2014CT differentiates the attenuation coefficient of the matter, which is linked to density values, PET targets specific metabolic activities, US is for separating tissues based on their difference in acoustic impedance, USPA makes use of optical absorbance differences of molecules and MRI makes use of the magnetic properties of the Ht groups . Most imt groups . For tist groups . The uset groups ,91, has It can be concluded that the multimodal and multi-parametric imaging can provide all the complimentary information and longitudinal views that are necessary in modern biomaterial research. To allow unhindered progress of research and further development, it is necessary to have a flow of information and continuous cooperation between the fields of imaging, engineering and biomedicine. Considering the wide range of involved specializations, this information needs to be easy to access and understand. Be it for translating the results \u201cfrom bench to bedside\u201d or to ensure high selectivity and sensitivity of the target data, having clear guidelines is helpful for all involved parties. This work provided an overview of the techniques that can be considered to be most suitable for imaging the processes that involve biodegradable implants. By further developing the optimal approaches for different implants and imaging targets, the resulting standardization and accumulated knowledge will promote the scientific and technological development in the field of biomaterial research."}
+{"text": "A state of the art, custom-built direct-metal deposition (DMD)-based additive manufacturing (AM) system at the University of Michigan was used to manufacture 50Cu\u201350Fe alloy with tailored properties for use in high strain/deformation environments. Subsequently, we performed preliminary high-pressure compression experiments to investigate the structural stability and deformation of this material. Our work shows that the alpha (BCC) phase of Fe is stable up to ~16 GPa before reversibly transforming to HCP, which is at least a few GPa higher than pure bulk Fe material. Furthermore, we observed evidence of a transition of Cu nano-precipitates in Fe from the well-known FCC structure to a metastable BCC phase, which has only been predicted via density functional calculations. Finally, the metastable FCC Fe nano-precipitates within the Cu grains show a modulated nano-twinned structure induced by high-pressure deformation. The results from this work demonstrate the opportunity in AM application for tailored functional materials and extreme stress/deformation applications. Laser-based additive manufacturing techniques such as powder-bed or directed powder deposition have attracted interest in recent years as effective tools to build 3D-printed metallic alloys ,2,3,4. T\u03b1-Fe (BCC) \u2192 \u03b5-Fe (HCP) is previously reported as martensitic in nature and occurs at approximately 13 GPa pressure [\u03b5-Fe (HCP) is a first-order phase transformation and athermal in character [\u03b1-Fe to \u03b5-Fe under static [\u03b1-Fe to \u03b5-Fe followed Burgers path, which was originally proposed by Burgers referring to a \u03b1-Zr\u2194 \u03b2-Zr transformation [\u03b1-Fe to \u03b5-Fe, for a certain range of pressure and temperature, \u03b1-Fe is found to be transformed into reversible \u03b3-Fe with a face-centered cubic (FCC) structure [\u03b3-Fe with an FCC structure is stable at higher temperatures, in certain instances, this can be found to be present at ambient condition as well, especially during solidification process in Cu\u2013Fe alloys [\u03b1-Fe, \u03b3-Fe has also been found to undergo martensitic phase transformation without being aided by higher temperatures owing to the application of deformation [\u03b3-Fe particles owing to the interaction with glide dislocations and/or formation of twins [In the current study, an equiatomic AM Cu\u2013Fe alloy (50Cu\u201350Fe) with a hierarchical microstructure, i.e., phase-separated grains of Cu and Fe as well as the presence of Cu precipitates in Fe grains and Fe precipitates in Cu grains, is subjected to very high hydrostatic pressure. At ambient conditions, pure Fe metal exists in a body-centered-cubic (BCC) crystal structure (\u03b1 phase). At high pressures, Fe is known to transition into the \u03b5 phase with a hexagonal-closed-packed (HCP) lattice. This pressure-induced phase transition of pressure . Earlierharacter ,12,13,14r static ,16,17 asr static ,20,21,22r static ,19,20,21ormation . Howevertructure ,25,26. Ae alloys ,28,29. Sormation ,31. Earlof twins ,31,32,33In recent years, the martensitic phase transformation of Cu has attracted great attention. This phenomenon is important to the current context as the material in this study contains FCC Cu in the form of microscale grains as well as nanoscale precipitates. The FCC lattice structure of Cu is the stable state, with some indication from first-principles energy calculations that the BCC and HCP Cu could be expected ,35. EarlIn the current investigation, an equiatomic Cu\u2013Fe alloy  made by direct-metal deposition (DMD)-based additive manufacturing technique was used. Gas-atomized Cu (particle size distribution: d5\u2013d75 \u00b5m) and Fe powders (particle size distribution: d25\u2013d150 \u00b5m) with nominal composition of 99.999% Cu  and 99+% Fe, 0.05% Oxygen, 0.006% Sulfur and 0.001% Phosphorus , respectively, were used for the fabrication of this alloy. The substrate used for deposition of composites was an uncoated mild steel 1/4 inch thick. A custom-built DMD system at the University of Michigan was operated using a 4 kW Nd:YAG laser unit with a laser beam diameter of 1 mm to manufacture the 50Cu\u201350Fe alloy. Argon was used as a shielding gas to avoid oxidation and as powder carrier. More details of processing-related information can be found in our previous publication on the same material [3 were cut from the bulk of the 50Cu\u201350Fe sample using the laser cutting system available at the High Pressure Collaborative Access Team (HPCAT) [2. Series of 2D translation Laue diffraction scans, with step size of 2 \u03bcm, were collected in situ along with increase in pressure between 5.3 and 18.3 GPa, as well upon decompression . For the Laue diffraction measurements, special care was taken to avoid \u201cbridging\u201d of the sample between diamond anvils and keep compression hydrostatic across the sample. After completing the Laue measurements, the sample was further studied at 16IDB at highest pressure and using a monochromatic beam, which allowed further identification of the crystalline phases present in the matrix areas and the obtaining of information on relevant sample texture. Series of angular scans with step size of 1\u00b0 were collected across the samples with monochromatic beam during sample compression up to highest pressures and after full decompression.Samples on the order of 50 \u00d7 50 \u00d7 30 \u03bcm (HPCAT)    and 16ID (HPCAT) . X-ray p2. The area detector was tilted vertically by 30\u00b0 with respect to the incident beam and positioned at ~600 mm from the sample.As the laser cutting procedure may affect the microstructure of the samples, Laue diffraction data from the bulk samples of Cu50Fe50 were also collected for comparison. The bulk sample blocks were parallelepiped-like shaped with sizes of approximately 1 \u00d7 1 \u00d7 0.5 mm. DAC-sized samples were cut from the areas near the edges of bulk samples as presented in During the in situ Laue diffraction experiment, pressure was increased remotely using a membrane system. Pressures before and after collection of Laue data were measured using an off-line Ruby system  availablFollowing the high-pressure compression study, the pressure was released, and the recovered sample was still contained inside the gasket assembly used in the DAC experiments a,b. FurtThe representative micrographs show the presence of two phase-separated regions of Cu and Fe grains; The formation of a hierarchical microstructure in typically immiscible Cu\u2013Fe alloy can be attributed to the high cooling rate associated with the laser direct metal deposition (DMD) additive manufacturing technique. The solid solubility of Cu in BCC Fe above 600 \u00b0C is very low (the highest being 1.9 wt.% at 850 \u00b0C) and almost negligible below this temperature even under equilibrium condition . The verOnce a nucleus is formed, its growth is influenced by kinetics of atom attachment to the interface, capillarity, and diffusion of heat and mass at the interface and away from the interface. The rejected Cu at the solid\u2013liquid interface is likely to influence these factors and restrict the growth of existing Fe nuclei. The excess Cu rejected from the solid will accumulate in an enriched boundary layer ahead of the interface . PossiblThe nano-precipitates observed within both the constituent phases in DMD alloy have not been reported in Cu\u2013Fe alloys processed by other techniques. The solidification rates associated with laser additive manufacturing are quite high, typically >1000 K/s . During With the in situ X-ray diffraction study, only reflections from Fe and Cu matrices are considered here because the reflections from nanoscale coherent precipitates cannot be reliably detected. Diffraction signal from matrix areas is at least one order of magnitude higher as compared to precipitates owing to the smaller volume fraction of Cu precipitates within the Fe matrix ; moreover, the fraction of Fe precipitates within the Cu matrix is even smaller, i.e., 1.7% [2, and, therefore, microstructural features in a scale of micrometers, e.g., both Cu and Fe grains, can be revealed by X-ray diffraction.Both Cu and Fe matrices produce arc-like diffraction lines with monochromatic beam indicating that these areas are nano-crystalline aggregates with essentially arbitrary orientations of nano-crystallites, although they exhibit preferred orientations; 5/s.Phase transition from the BCC to HCP type of crystal lattice was clearly observed in Fe matrix during compression. During multiple X-ray diffraction experiments with monochromatic beam, the highest pressure when no Fe (HCP) phase was observed was 15.9 GPa e, and thUsing Laue diffraction technique, it was observed that the 50Cu\u201350Fe alloy contains micron-sized single-crystals embedded into the nano-crystalline aggregates. Apart from the nano-crystalline areas, these crystals produced sharp diffraction spots; however, when monochromatic beam is used, these spots overlap with the arc-like diffraction lines from the nano-crystalline aggregates and make identification of these microcrystals extremely challenging. On the Laue diffraction images, the nano-crystalline areas produced only diffuse, extremely broad \u201cstreaky\u201d reflections or just introduced rise to the background, while the microcrystals produced sharp and clearly distinguishable Laue diffraction spots.Optical images of the sample before and after Laue diffraction measurements are presented in The same Cu (FCC) microcrystals were identified also in bulk samples. As examples, indexed Laue diffraction patterns from microcrystals referenced below as crystals 5\u20139 are presented in The Cu (FCC) microcrystals exhibit deformation across compression indicated by gradual broadening of their Laue reflections. As an example, in 2 X-ray beam, is also homogeneous. As was mentioned previously, different areas of crystals 1\u20134 may exhibit this deformation at slightly different pressures, but this is also explainable by the intrinsic inhomogeneity of crystals 1\u20134 in terms of density of dislocations and other defects of their lattices, which may affect the onset pressure of the transition of Fe (FCC) precipitates. It is interesting that onset pressures of the BCC to HCP transition of Fe dendrites and the suggested transition of Fe (FCC) precipitates coincide.The observed type of deformation of crystals 1\u20134 is explainable by a transition of the Fe precipitates with FCC-type lattice causing deformation of the Cu matrix as well. As the precipitates are distributed homogeneously within the matrix area, it is reasonable to suppose that this transition of the precipitates takes place at similar pressures across the entire Cu matrix area, and, therefore, the deformation caused by the transition, as detected by the 2 \u03bcmAs presented in The high-angle annular dark field technique in scanning transmission electron microscopy (HAADF-STEM) mode was used for the ex situ characterization of the structural changes that occurred in nano-precipitates  during high-pressure experiments in 50Cu\u201350Fe alloy. A low-magnification HAADF micrograph shows the presence of Cu precipitates (indicated by yellow arrows) and Fe precipitates (indicated by red arrows) within Fe and Cu grains, respectively; A (~2.5 nm \u00d7 2.5 nm), within the center of the Cu precipitate exhibits a lattice structure similar to the BCC lattice (having a zone axis of <001>), as can be seen in the FFT diffractogram of the region (box A), which also consists of superlattice spots. Moreover, a region close to the interface with Fe grain (box B) shows FCC lattice structure (with zone axis of <011>), although the Fe grains were initially of BCC structure, whilst another region (box C) close to the Cu precipitate\u2013Fe grain interface showed BCC lattice configuration (with zone axis of <001>), as confirmed from the corresponding FFT diffractogram; One feature observed within Cu precipitates on numerous occasions is the change in local lattice configuration; The Fe precipitates present in the Cu matrix have also undergone structural changes due to high pressure from their initial metastable FCC structure that was coherent with the adjacent Cu matrix. However, unlike Cu precipitates in Fe grains, Fe precipitates in Cu matrix showed only one kind of changed feature post high-pressured deformation. These Fe precipitates (diameter ~5 nm) showed regular-spaced modulated structure. However, FFTs acquired from these Fe-precipitated regions exhibit twin reflections in their corresponding diffraction patterns, which suggests these modulated structures within Fe precipitates primarily resulted from parallel-oriented multiple-twinned regions having  at multiscale, i.e., at microscale grains and at nanoscale precipitate domains, from their initial configurations. The onset of reversible phase transformation (BCC to HCP) in Fe at grain scale has been found to occur at approximately 16 GPa pressure. However, metastable FCC Fe nano-precipitates within the Cu grains show a modulated structure in the form of multiple nano-twinned (with {011} type twin planes) domains within the precipitates. TEM studies exhibit different modes of structural changes in FCC Cu precipitates due to high-pressure deformation, such as local alterations in lattice structures  from its initial FCC lattice and the formation of large stacking faults across the precipitates."}
+{"text": "Producing and sustaining a competent nursing workforce is imperative to protect the public. Identifying current issues and trends in nursing competence can strengthen insights and provide direction for the future nursing workforce. A summative content analysis was performed; PubMed, CINAHL, and Scopus were searched for content from the last ten years. A total of 3225 titles and abstracts regarding nursing competence were identified and analysed using the big-data analysis software Leximancer. Five themes were discovered from the analysis: (1) standardisation of nursing competencies with emerging competencies, (2) assessment competency levels, (3) graduates\u2019 expectations and achievement, (4) safe and quality practice with teamwork, and (5) competency curriculum development. This found standardised nursing competencies, which suggests prioritising which core competencies should be focused on during education to produce competent generalist professional nurses, and employers could help nursing graduates improve their competence in specialised areas. This review also suggests that further education strategies should be developed to better prepare graduates for culturally safe practice to meet the needs of diverse minority populations and for informatics competency during the COVID-19 pandemic. Competence assessment methods must be extensively investigated to measure nursing competencies both longitudinally and cross-sectionally. Producing a competent nursing workforce is essential to meet population needs and protect the public . AlthougDeveloping competence is an essential component of nursing education to ensure nursing graduates are prepared with the essential knowledge, skills, and attitudes to enter the workforce and functioning safely in entry-level positions . EvaluatAdditionally, education providers still need to investigate emerging competencies required for new graduate nurses in order to meet the demand of the contemporary healthcare system. For example, nursing professionals are now expected to play a central and extended role in supporting ageing populations with changing illness patterns in increasingly diverse care delivery environments ,9. FurthOf note, while competence has been a broadly used concept in nursing, criteria to ex-plain competency have changed over time, reflecting how nurses\u2019 roles are constantly evolving in response to healthcare needs. While discussion about nursing competence has increased exponentially in recent years, debate remains about the definitions of competence and competency, particularly related to new graduate nurses. Both are used inter-changeably and inconsistently in the literature . HoweverThis paper aims to explore how nursing competence and competency in relation to newly graduated nurses have been used in the current global literature; we focused our attention on the current issues relevant to newly graduated nurses\u2019 competence in the published articles. It is hoped that findings will provide important insight into current global status of new graduates\u2019 competence, which can be used by nursing educators and employers to prepare and support new graduate nurses for their practice.Summative content analysis was used to identify trends and relationships in the contextual use of nursing competence within the literature . In a suSemantic analysis (whereby meaning is drawn from text) software Leximancer was used for the content analysis. This software efficiently analyses large volumes of textual data and examines it without pre-existing assumptions about the meanings of words, identifying key concepts and how they relate to each other . CompeteA search in the computerised databases produced 5103 international studies related to the nursing competence of new graduates. The search terms were \u2018graduates\u2019, \u2018compe-tence\u2019, and \u2018competency\u2019, as well as related terms such as \u2018preparedness\u2019, \u2018readiness\u2019, and \u2018efficacy\u2019. To select probable samples, duplicated articles and references unrelated to nursing competence were manually deleted. A total of 3225 international studies were selected as the probable sample see . The titAfter importing the data into Leximancer for analysis, there is some consideration of the program setting. Firstly, the stop-word list was set. Frequently occurring words that hold weak semantic information are called stopwords. These words do not contribute towards the context or information of the documents and should be removed during indexing and before querying by an information retrieval system . Thus, tThe data was analysed in two steps. The first step of Lexiamncer was an initial exploratory analysis which provided an overall view of the imported data. This initial analysis showed \u2018Nursing\u2019, \u2018Health\u2019, and \u2018Patients\u2019 as the most frequently mentioned words, but these were deemed too broad to find the important meanings related to nursing competence. Considering the purpose of this analysis, the review used a profiling analysis as a second step to focus on the concept \u2018competence/competency\u2019. This method allows the discovery of new concepts that are relevant to it. This was an effective way to zoom in on topics in the data and could be useful in analysing a specific research question or issue in a large text corpus covering a range of themes .A key feature of Leximancer is that the information is displaying a visual map that provides a bird\u2019s eye view representing the main concepts (frequently occurring words) within the text as well as the information about how they are related . As see Five themes emerged concerning nursing competence and competency related to newly graduated nurses from current global references: (1) standardisation of nursing competencies with emerging competencies areas, (2) assessment to measure competency levels, (3) nursing graduates\u2019 expectations and achievement, (4) safe and quality practice with teamwork, and (5) competence curriculum development see .Standardisation of nursing competencies was discovered as the most significant theme in the selected literature. Unsurprisingly, the dominant concept in this theme and most frequently mentioned was \u2019competency\u2019 with 5135 counts. This is because this concept comprised the main topic and the key search terms in the selected references. As seen in the concept map in Students are expected to graduate with competencies in accordance with professional standards that promote their safe and comprehensive nursing care provision. (#2001)One approach for nursing success is standardizing the entry-level education for nurses and developing a uniform professional development and career advancement trajectory with appropriate incentives to encourage participation. (#2244)This analysis also discovered two emerging new competency areas: informatics and cultural competency. Firstly, \u2018competency\u2019 was often mentioned with \u2018informatics\u2019, at 131 counts with 40% likelihood, and the concepts were closely situated. This can be explained by information technology having become more utilised in the current healthcare system, so informatics skills and abilities were frequently discussed in this context. Additionally, \u2018competency\u2019 and \u2018cultural\u2019 were mentioned together 214 times with 38% likelihood in the text. This indicates that culturally safe care was also a prominent concept in the data, suggesting that cultural competency had been often considered an essential competency issue in the global context.Many health-care organizations and associations recommend that registered nurses be culturally competent and technologically savvy to compete in today\u2019s global society. (#715)The expectation that nurses provide effective care across varied population groups highlights the need for attainment of cultural competency by baccalaureate nursing graduates. Nursing programs must develop strategies to address this educational need. (#855)\u2018Assessment\u2019 was one of the predominant concepts discovered in this review. This word was mentioned 2253 times in the text. This concept was highly associated with \u2018measurement\u2019 at 22% likelihood. These concepts reflected the importance of assessment to measure nursing competencies in the current context of nursing competence. In addition, \u2018self-assessment/self-perceived\u2019 was closely situated and occurred in the international references 476 times. Self-assessment methods could have been widely used to measure nursing competencies with traditional assessment methods. The examples of reviews mentioning assessment methods is as follows.The three most common methods used to evaluate competence  lack reliability and validity; the processes are subjective, and assessors may be making judgements on imperfect evidence. (#515)Forty seven nurses commencing a 12-month graduate nurse programme were invited to undertake a self-assessment of their level of competence at four-time points; commencement, 3 months, 6 months and 12 months (#859)\u2018Graduates\u2019 was one of the frequently occurring words in the selected international literature . \u2018Competency\u2019 was mentioned with \u2018graduates\u2019 with 28% likelihood (215 counts), and \u2018graduates\u2019 was also often linked with \u2018baccalaureate\u2019 (bachelor nursing degree). This can be explained that Nursing Baccalaureate degree graduates may be internationally considered one of the main target groups in nursing education and practice. As seen in Nursing education should emphasize to a greater extent ethical competency and training for the challenging situations students will encounter in clinical practice. (#1971)The proportion of older adults in the population is rapidly increasing, and this trend is expected to continue. Because more than half of all new graduates eligible to enter the nursing workforce are prepared, it is critical these new nurses are well prepared to care for older adults. (#1319)Safe and quality nursing practice was a significant issue related to nursing competency. This theme consisted of \u2018safe/safety\u2019 and \u2018quality\u2019. The word \u2018safe/safety\u2019 was mentioned 854 times in the selected global titles and abstracts. These terms were mainly used for describing patient safety as an outcome of the competent practice of newly graduated nurses. \u2018Competency\u2019 was mentioned with \u2018teamwork\u2019 with 26% likelihood (59 counts). The concept \u2018teamwork\u2019 mainly described the importance of interprofessional collaboration for effective practice.Although teamwork and interprofessional collaboration are critical to patient safety, nursing, medical, and allied health graduates often feel ill-prepared to confidently communicate and collaborate with other team members. (#490)This theme contained \u2018curricular\u2019 and \u2018framework\u2019. \u2018Curricular\u2019 occurred in the selected references 559 times and was mentioned together with \u2018competency\u2019 with 23% likelihood. This analysis found a continuous effort to design and redesign nursing curricula with required competencies. Examples mentioning curriculum development were as follows.This study has identified the need to develop a standardised competency-based educational and training program for all European countries that will ensure the practice and policies that meet both the standards of care and the broader expectations for professionalisation of the disaster and crisis workforce. (#967)Embedding pain management core competencies into prelicensure nursing education is crucial to ensure that nurses have the essential knowledge and skills to effectively manage pain and to serve as a foundation on which clinical practice skills can be later honed. (#308)This paper explored how nursing competence and competency related to new graduates have been used in the current literature. Three main usages were identified. The first was standardisation of nursing competencies for new graduates; education providers preparing nursing students and graduates achieving core nursing competencies as professional registered nurses. This is in line with the finding of Smith and McCarthy  that nurThe second finding was that emerging competencies are required in the current healthcare environment. This review discovered culturally safe practice and healthcare informatics as predominant concepts related to nursing competencies in the global context. The importance of the trend in cultural competency is because healthcare professionals are expected to provide quality and safe care for patients from culturally and linguistically diverse backgrounds. Therefore, providing multicultural educational support and training for the nursing workforce to be prepared for culturally competent practice is often cited in the literature . InteresAnother growing trend in nursing competency is related to healthcare information technology. This finding may reflect that information technology in a healthcare system has become a key element due to nurses\u2019 roles becoming increasingly reliant on and inter-twined with digital health tools, such as electronic records, mobile computing devices, telehealth, and robotics . A systeLast, assessment to measure levels of nursing competency is another noticeable concept in the global literature. This review found that a common method to evaluate nursing competencies was self-assessment (self-report). This is supported by Cowan\u2019s study , who jusThis study has a limitation. Although the computational text analysis software allows efficient analysis of large volumes of text data, it still requires analytical sensitivity and judgement in its interpretation. Leximancer provides the benefits of presenting all connections that exist in the data, many of which might not be explored manually, and the risk remains of missing important insights in the findings that may be initially less apparent to the researcher . TherefoThis content analysis was conducted to explore how nursing competence has been used in the published literature. The relevant titles and abstracts were collected and analysed using Leximancer. The findings were interpreted with relevant concepts. The findings provided important insights into new graduates\u2019 perceived competencies and highlighted that regularly revising standardised nursing education for entry-level practice and nursing graduates is essential. This, in turn, reflects the demand for cultural and healthcare informatics technology competency in the current healthcare environment. This analysis has also raised important questions about competency assessment. Although self-assessment is common for evaluating new graduate nurses\u2019 competency levels, further research should investigate and develop assessment methods to measure multiple aspects of nursing competence throughout education and practice."}
+{"text": "Fixed-wing vertical take-off and landing (VTOL) UAVs have received more and more attention in recent years, because they have the advantages of both fixed-wing UAVs and rotary-wing UAVs. To meet its large flight envelope, the VTOL UAV needs accurate measurement of airflow parameters, including angle of attack, sideslip angle and speed of incoming flow, in a larger range of angle of attack. However, the traditional devices for the measurement of airflow parameters are unsuitable for large-angle measurement. In addition, their performance is unsatisfactory when the UAV is at low speed. Therefore, for tail-sitter VTOL UAVs, we used a 5-hole pressure probe to measure the pressure of these holes and transformed the pressure data into the airflow parameters required in the flight process using an artificial neural network (ANN) method. Through a series of comparative experiments, we achieved a high-performance neural network. Through the processing and analysis of wind-tunnel-experiment data, we verified the feasibility of the method proposed in this paper, which can make more accurate estimates of airflow parameters within a certain range. The tail-sitter aircraft can cruise at a relatively high speed like a fixed wing aircraft, and it can also take off and land vertically like a rotary wing aircraft, so it has attracted much attention in recent years. However, it is precisely this advantage that makes it have to go through the phase of attitude change in the flight process, which makes the tail-sitter aircraft more vulnerable to the wind and more difficult to control. Therefore, a good ability to measure wind disturbance is needed for tail-sitter aircraft. In fact, the measurement of wind disturbance is essentially the measurement of wind speed, which can be converted into the measurement of air speed and ground speed, and then into the measurement of air flow parameters , because the ground speed can be simply obtained through GPS . For theSimilarly, we chose a 5-hole probe to estimate the airflow parameters. Using the pressure data of the five holes at the probe\u2019s head measured by pressure sensors, the airflow parameters can be estimated by many different methods, including the look-up table method, interpolation method, etc, which are briefly introduced below.The table lookup (figure) method and interpolation method are similar ,7,8,9,10The algebraic solution is usually simple. The least square method and three-point method ,14,15,16The method of polynomial fitting  is generArtificial neural networks have been very popular in recent years. Considering the obvious relationship between the parameters we need to estimate and the pressure data, the neural network method can be regarded as a good method. It is also true that we can get well-performing neural networks only through structural design, data collection and network training. In addition, of all methods, neural network methods have the smaller error, fastest calculation speed and lowest memory needs. However, previous studies focused more on the performances of neural networks at small angles  ,23,24,25Our aircraft of interest, tail-sitter aircraft, need to change their mode during flight to achieve the purpose of combining the advantages of fixed-wing aircraft and rotary-wing aircraft, which leads to the need for accurate prediction of airflow parameters when the angle of attack is large. Therefore, in this paper, we explore the performance of the five-hole probe based on the neural network method at large angles.In this article, our contributions are as follows: we propose a combined airflow-parameters-estimation method using a 5-hole probe and an ANN estimation algorithm to offer a solution to face the challenge of large AOAs (angles of attack) and AOSs (angles of sideslip) or estimation for the tail-sitter UAV. As is known, there is almost no prior work on large AOA and AOS estimation for tail-sitter UAV. Analysis results show that the proposed method has good performance: the error of the angle of attack can be found within \u00b11\u00b0 in the range of \u221260\u00b0 to 60\u00b0; the sideslip-angle-estimation error is larger but can be less than \u00b11\u00b0 when the absolute value of sideslip angle is less than 50\u00b0; and the estimation error of incoming flow velocity can be kept relatively small in the whole measurement range. This article is an extension of the work presented at the AIAA Aviation Forum , but artIn this paper, the research purpose, background and results are presented first. Here is the research background for our article. This tail-sitter fixed-wing VTOL UAV, \u201cETS-20,\u201d was developed at the Southern University of Science and Technology (SUSTech), China, by the research group of Professor Xiaowen Shan, as shown in Compared with the traditional fixed-wing aircraft, the combination of a propeller and control surface makes it possible to control the flight attitude at full airspeed, thereby ensuring its maneuverability and vertical takeoff and landing capability. However, at the same time, this structure also makes it very sensitive to the propeller speed, wind speed and its own angle of attack, so it is very important to estimate the airflow parameters.We used a 5-hole pressure probe method based on an ANN to estimate the airflow parameters the tail-sitter VTOL vehicles require. The probe was the source of measurement data, and the pressure of the incoming flow was sensed by the pressure sensor through the holes on the head of probe for subsequent calculations.In consideration of cost, we designed the probe we used  in the eBy comparing the pressure difference between each pressure orifice and the static pressure orifice, we can obtain a set of pressure data characterizing the air flow speed and direction. By matching the multiple groups of pressure data obtained in the measurement process with the actual angles recorded in the experiment, we can obtain the relationship model between the pressure difference and the velocity and direction of the airflow, so that we can predict the airflow parameters according to the pressure data later.Our main task was to establish the relationship model between the pressure values and the air flow parameters. As mentioned in the introduction, there are many methods to build the model we need, such as the look-up table, interpolation, polynomial fitting and neural network methods. After comparison, considering the accuracy and scope of application, we finally chose the neural network method to establish the estimation model.Among various neural networks, we chose the BP neural network as the basis. BP is backpropagation. The backpropagation algorithm is a parameter-training method suitable for multi-layer neural networks, and its basis is gradient descent. In the actual training process, we cannot directly obtain the errors of the nodes of the hidden layer, but only the errors of the prediction results and labels are directly known. Therefore, the known output errors need to be transformed into the errors of the hidden layer through layer propagation, and various weight parameters of the network should be adjusted in this process, so as to realize the network training.However, generally speaking, the first forward-propagation results always have a big deviation, so the above-mentioned, namely, the most important backpropagation process in a BP neural network, is needed. Through backpropagation, the parameters and weights in each layer are corrected, making the errors gradually decrease via gradient descent. The training process of BP neural network is the process of error-based repeated propagation and weighted repeated adjustment, which finally makes the output meet the requirement or the training time meet the requirement.However, the specific structure of the neural network still needs to be considered in detail. An excellent neural network architecture can help us get more accurate estimation results. Additionally, for a neural network, the main factors affecting its structure include: the choice of input and output, the number of hidden layers and the number of neurons in each layer. Therefore, the exploration of the neural network structure we want is based on these three parts.The artificial neural network method needs abundant data for training. We conducted the wind-tunnel experiment to obtain the required experimental data.The multi-hole pressure probe used in the experiment was made by 3D metal printing technology and fixed to the turntable using tooling .In order to realize the change in a large angle range, we used a two degree of freedom turntable, whose motors in both directions can be controlled by a computer .We used the VectoDAQ Air Date Computer  to obtaiIn the experiment, the turbulence of the wind tunnel we used was less than 0.1%, which can provide a stable wind-field environment.As for the speed setting in the experiment, first of all, we mainly focused on the performance of the research object being at low speed (below 25 m/s). Second, we need to consider how it behaves over the whole low-speed range. Finally, we found in the pre-experiment that when the speed was too small , the data availability was poor (the pressure fluctuation of a single measuring point was similar to the pressure change between adjacent measuring points), so 10, 15 and 20 m/s were finally selected as the velocities in the experiment.As for the selection of the experimental angle range, the tail-sitter VTOL must undergo attitude change during flight, which may cause it to encounter an angle of attack close to 90\u00b0. Thus, we want to get the same performance for the neural network approach at angles of attack ranging from 50\u00b0 to 80\u00b0 and even up to 90\u00b0. Therefore, the initial experimental plan was to set the variation range for both the angle of attack and the sideslip angle to \u221290\u00b0 to 90\u00b0. However, due to the limitation of the wind-tunnel test section , we coulObviously, different neural networks will show different performances in the process of building models due to their differences in structure. The contents to be considered include the selection of input and output, the number of hidden layers and the number of hidden layer neurons.The first is the selection of input and output. In one of Quindlen J.\u2019s papers , they veThen, the number of hidden layers and the number of neurons in each layer were selected. At present, there is no mature theory to help determine these parameters, so we could only choose them according to experience, mainly based on two empirical theories. The first is that the higher the number of hidden layers, the better the training effect and the longer the training time; the second is that the distribution of the number of hidden layer neurons has a better training effect if the number of neurons in the hidden layer changes from less to more, and then from more to less.In order to reduce the time required for training while ensuring the training effect, and also considering that the corresponding relationship between the input and output of our model is relatively complex, we finally chose to set the number of hidden layers to four. For the exploration of the specific number of neurons in each of the four hidden layers, we set several possible values for each layer, then combined them, trained them separately and finally took the combination with the best training performance. The number of optional neurons in the first hidden layer was . The second layer had , the third layer had  and the fourth layer had . There were 180 combinations in total.The metrics that can be used in machine learning algorithms include The smaller the values of In addition to the above factors, we note that the quality of input data will also have a certain impact on the training results of neural networks, so we also tested and got the results before and after filtering the input data. The training results show that filtering the input data can improve the training performance obviously. To sum up, we finally determined that the neural network for the ANN-based estimation method should be a BP neural network with the structure of (5-15-30-15-5-1). Its input is five pressure values, and its output is angle of attack or sideslip angle or speed of incoming flow. There are four hidden layers inside, and the number of neurons in each layer is (15-30-15-5).We used Neural Net Fitting App in MATLAB R2020b software to build and train the neural network. In order to ensure the training performance and efficiency, we selected the Levenberg\u2013Marquardt algorithm as the training algorithm. After training, the required neural network can be obtained, and it can be imported into Simulink for subsequent verification and simulation. Partial images of this process are shown below .In fact, we obtained a lot of data from the wind-tunnel experiments. Here, we look at the experimental data we got when the sideslip angle and the angle of attack were not zero at the same time. The specific measurement contents are described as follows: the angle of attack changed from \u221250\u00b0 to 80\u00b0 at uneven intervals. . At each angle of attack, the sideslip angle changed from \u221230\u00b0 to 30\u00b0 at uniform intervals (2\u00b0). For each fixed angle of attack and sideslip angle combination, the pressure measuring valve collected data at a frequency of 20 Hz for 5 s. In addition, we selected three different incoming flow velocities, 10, 15 and 20 m/s.The purpose of selecting this part of experimental data was to verify that the airflow parameter estimation method based on neural network can be applied to the case of large angles of attack, so as to better meet the needs of tail-sitter VTOL UAV. On the other hand, it is to test whether this method would work well when the angle of attack and the sideslip angle are not zero at the same time (this means that the drone is exposed to non-positive airflow).Although the turbulence degree of the wind tunnel is not high, the pressure data obtained from the probe have relatively large fluctuations because of the relatively low incoming flow velocity. In addition, the fluctuation of pressure data gradually intensifies as the angle of attack increases and with the separation of air flow. Theoretically, the pressure data of a certain combination of speed and angle should be fixed, so we can try to use the filtering method to process the data.The so-called filtering is to simply use the one-dimensional Kalman filter method to process the original data, so as to reduce the fluctuations in the data. We should note that in the training and subsequent application process, the input value should also be the filtered value. In fact, this simple filtering method will make the experimental data at low angles of attack produce fluctuations that did not exist before, thereby slightly increasing the estimation error. However, in order to improve the overall training performance, we finally chose filtered data for training and testing.After training the neural network with the training set, we can input the test set, compare the obtained output with the expected output and get the following figures.In addition, we also obtained the relationship between these errors and the change in sideslip angle .It should be noted that the abscissa of the following three images is the change in samples, which represents the uniform change in sideslip angle from \u221230\u00b0 to 30\u00b0 from left to right. We can see that the error displayed in these images always changes from small to large in a certain period. This phenomenon is because in our experimental data, each sideslip angle corresponds to a group of angles of attack varying from \u221250\u00b0 to 80\u00b0. These images also verify the conclusion that the estimation error of the airflow parameters will increase gradually as the absolute value of the angle of attack increases.(1)When the angle of attack and sideslip angle are not zero at the same time, the neural network method can still well predict the angle of attack, sideslip angle and velocity of incoming flow. It can be seen in (2)The errors of predicting angle of attack, sideslip angle and incoming flow velocity by the neural network method will gradually increase as the angle increases (angle of attack or sideslip angle). Good prediction results can be obtained within 50\u00b0, and relatively good results can be obtained within 70\u00b0. The deviation in prediction results will increase rapidly at large angles. By referring to , it can (3)Due to the simple and clear relationship between the pressure and the incoming flow velocity, the error of the neural network in the estimation of the incoming flow velocity is very small , which i(4)The performance of the neural network trained with filtered data is better than that of the neural network trained with raw pressure data. From the comparison between (5)In a small angle range, the filtered data will slightly increase the prediction errors of the angle of attack, sideslip angle and incoming flow velocity, but the errors are still within good ranges. This conclusion can be seen in (6)We also found that the performance of angle-of-attack estimation and that of sideslip-angle estimation are not similar like . This isFrom above figures and analysis, we can draw the following conclusions:In this paper, the estimation of the airflow parameters of the tail-sitter VTOL aircraft needed was studied. The feasibility and scope of application for the 5-hole-probe and ANN method for estimating air flow parameters were explored. A compound airflow-parameters-estimation method using a 5-hole probe and ANN estimation algorithm was proposed to offer a solution to face the challenges of large AOA and AOS measurement or estimation for the tail-sitter UAV. As is known, there was almost no prior work on large AOA and AOS estimation for tail-sitter UAVs. Analysis results show that the proposed method has good performance.This paper first discussed the calculation methods used in the estimation of airflow parameters of multi-hole probes in recent years; and briefly described the principles, advantages and disadvantages, and application scopes of those various methods. After comprehensive consideration, the applicable ANN method was selected to use the pressure data, and the final neural network structure was determined through a series of experiments and comparisons. Finally, for the research object of this paper, we specially selected 5-hole pressure probes and completed the required wind-tunnel experiments.In addition, differently from article , we firsAlthough it is a pity that we have not completed the onboard experiment, it can be seen from the experimental results that the neural network method can provide estimation of the angle of attack with estimated error of less than 1\u00b0 within the range of \u00b170\u00b0 of the angle of attack (which can meet the requirements of most of the flight time of the tail-sitter VTOL aircraft). It can provide sideslip-angle estimation with an estimation error of less than 1.5\u00b0 within the range of \u00b150\u00b0  and can provide very accurate velocity estimation when the speed is low (less than 25 m/s). All these indicate that the 5-hole probe based on the neural network can provide much better estimation accuracy than other traditional methods for the estimation of the angle of attack, sideslip angle and incoming flow velocity of the tail-sitter VTOL aircraft, which is of great significance for the subsequent development of the tail-sitter VTOL aircraft."}
+{"text": "The authors regret that The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The author regrets that 2-NS and 61.12% by Ag-NS.\u201dThe correct version of The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "RSC Adv., 2020, 10, 5371\u20135384, https://doi.org/10.1039/C9RA05895H.Correction for LC-MS analysis and hypotensive effect  The authors regret that an incorrect version of The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that a footnote to indicate that Chu Chen and Guanhua Xu are co-first authors was omitted in the original manuscript.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "Sci., 2022, 13, 12808\u201312817, https://doi.org/10.1039/D2SC04558C.Correction for \u2018Tyrosine bioconjugation with hypervalent iodine\u2019 by Nina Declas  The authors regret that due to a technical issue with the ChemDraw file, part of the reaction conditions in The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that incorrect versions of An independent expert has viewed the corrected images/data and has concluded that they are consistent with the discussions and conclusions presented.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "T. Sudheesh Kumar  The authors regret that there were errors in The images in the lower panel of The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "Photonics Res., 2018, 6, 929\u2013942, DOI: 10.1364/prj.6.000929.The authors regret that there was an error in ref. 8 in the original article. The correct reference should read: E. Jimenez-Villar, M. C. S. Xavier, N. U. Wetter, V. Mestre, W. S. Martins, G. F. Basso, V. A. Ermakov, F. C. Marques and G. F. de S\u00e1, The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "In the published article there was an error in the primer DNA (22 nt) sequence in The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "F is incorrect, and the correct definition is RF = \u2013CF(CF3)(OCF2CF(CF3))nOCF2CF2CF3. The correct versions of The authors regret that a consistent structure error appears in The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The University was omitted in the affiliation in the published article; the revised affiliation is shown here.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that affiliation e was missing in the original article. In addition, the institute name in affiliation b was incorrect. The correct affiliations are as presented here.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret an error in The authors have repeated the experiment and provided new data for The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "Prod. Rep., 2022, https://doi.org/10.1039/d2np00042c.Correction for \u2018Dearomative logic in natural product total synthesis\u2019 by Christopher J. Huck  The authors regret that the stereochemistry of intermediates 270 and 271  is incorThe Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "DOI: 10.1039/D1RA04031F.Correction for \u2018Helium-induced damage in U The authors regret that an incorrect version of The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "Affiliation a was incorrect in the published article; the correct version is shown here.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that the email address was not included for one of the three corresponding authors, Guang-ji Wang. Contact email addresses for all three corresponding authors are presented here.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "Mazenauer  An incorrect email address was provided for affiliation a, the correct version, along with capitalisation of Z\u00fcrich in affiliation b, is shown below.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that incorrect images were mistakenly included in The corrected graphical abstract is presented below.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "Lactobacillus reuteri 121 inulosucrase and production of inulin-type fructooligosaccharides\u2019 by Thanapon Charoenwongpaiboon et al., RSC Adv., 2018, 8, 17008\u201317016.Correction for \u2018Highly porous core\u2013shell chitosan beads with superb immobilization efficiency for  The authors regret that The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that incorrect details were given for ref. 52 in the original article. The correct version of ref. 52 is given below as The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that some of the affiliation and contact details were incorrect in the original manuscript. The correct affiliation and contact details are shown above.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "Ref. 28 in the published article was incorrect, with an incorrect page range provided. The correct version is shown as The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The Royal Society of Chemistry regrets that incorrect details were given for Ref. 10b, 11b and 11c in the original article. The correct versions of Ref. 10b, 11b and 11c are given below as The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that in the original manuscript there were some errors in the structures displayed in The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The correct web link to the datasets and trained models is The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "In the original manuscript, the authors regret an error in the vertical axis label for The conclusions remain unaffected by this change.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that in the Acknowledgements section of the original manuscript, the funding information was given incorrectly.The authors extend their sincere appreciation to the Researchers Supporting Project number (RSPD2023R682), King Saud University, Riyadh, Saudi Arabia for the support.The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "The authors regret that an incorrect version of product 74a in The authors also regret that incorrect details were given for ref. 91 in the original article. The correct version of ref. 91 is given below as ref. The Royal Society of Chemistry apologises for these errors and any consequent inconvenience to authors and readers."}
+{"text": "Ocular brucellosis is a potential cause of endogenous endophthalmitis in endemic areas, which can be associated with sight\u2010threatening complications.Brucella melitensis. A 25\u2010year\u2010old woman with a history of fever and right shoulder pain from 4\u2009months ago and a positive Wright test presented with acute panuveitis in her right eye. All laboratory tests were unremarkable except for the positive polymerase chain reaction (PCR) test of the vitreous sample for B. melitensis. Despite the therapeutic efforts, including multiple vitreoretinal surgeries, and intravitreal and systemic antibiotics, the patient's final follow\u2010up examination after 6\u2009months revealed hand motion vision, hypotonia, and pre\u2010phthisis bulbi status. The fellow eye was entirely normal. Brucella endogenous endophthalmitis can be fulminant and result in poor visual outcomes. It is suggested to consider ocular brucellosis as a potential cause of endogenous endophthalmitis in endemic areas.To report a patient with unusual fulminant endogenous endophthalmitis due to  Summary of the patient\u2019s clinical course. There are six types of brucella, four of which include B. melitensis, B. abortus, B. canis, and B. suis, which were recognized as pathogens involving humans. B. melitensis was described as the most common and virulent pathogen worldwide. Lemaire described the first case of ocular brucellosis in a human being in 1924,Brucellosis is a zoonotic infectious disease with a wide range of manifestations, including malaise, anorexia, fever, and profound muscular weakness, as described by Marston in 1860,B. melitensis, which is rare and unusual.Ocular manifestations of acute and chronic infection include anterior and posterior uveitis, panuveitis, keratitis, conjunctivitis, papillitis, cataracts, maculopathies, glaucoma, and ocular muscle paresis. Modern treatments of ocular brucellosis, intraocular and systemic antibiotics, have improved the prognosis of the disease.2A 25\u2010year\u2010old woman came to the emergency department of Khatam\u2010Al\u2010Anbia Eye Hospital  with complaints of acute decreased vision, photophobia, and redness in the right eye from 1\u2009week ago. She had no history of trauma, eye surgery, or systemic conditions such as diabetes or hypertension. The patient had a history of mild fever with right shoulder pain 4\u2009months ago. She did not mention any history of night sweats or coughing in herself or her family members. She lived in a rural area and had a history of consumption of unpasteurized animal products and contact with animals. Because of the endemic area where she lived, the physician suspected brucellosis. Wright and 2\u2010mercaptoethanol tests were 1/80 and 1/40, respectively, which were positive for the patient. Lab results included an ESR (erythrocyte sedimentation test) of 38, and a 1+ CRP (C\u2010reactive protein). Accordingly, the patient had been treated with oral doxycycline 100\u2009mg every 12\u2009h, trimethoprim\u2010sulfamethoxazole, 400/80\u2009mg tablets (sulfamethoxazole 400\u2009mg\u2009+\u2009trimethoprim 80\u2009mg), four tablets daily, as the common medications to treat brucellosis in this area. The patient had poor compliance with medicine consumption and follow\u2010up for periodic examinations. During these 4\u2009months, the patient experienced shoulder pain and a mild fever with an on\u2013off pattern.The best\u2010corrected visual acuity with a tumbling E\u2010chart in the right eye at the time of presentation was hand motion with projection and 10/10 in the left eye. Intraocular pressure (IOP) was within the normal limit in both eyes. The right eye examination showed clear cornea, hypopyon and flare, and 4+ vitreous cells (based on SUN Working Group) in the anterior segment.With the possible diagnosis of vision\u2010threatening endogenous endophthalmitis or infectious retinitis, the patient was admitted for further diagnostic evaluations and therapies. Regarding the positive history of Wright test and brucellosis symptoms, consultation with an infectious diseases specialist for more systemic assessment was performed. Systemic workups and laboratory tests, including blood, urine, throat culture, chest x\u2010ray, complete blood count, platelet count, blood urea nitrogen, creatinine, urine analysis, and cardiologic consult for the possibility of infectious endocarditis, were unremarkable. However, Wright test was still positive. A neurology consultation was performed to investigate the case of brain involvement, in which no significant finding was reported. Vitreous sampling was served with a 25\u2010gauge needle through pars plana and evaluated for polymerase chain reaction (PCR) to detect the Herpes Simplex virus, Varicella Zoster virus, Cytomegalovirus, Brucella, and smear and culture. Intravitreal vancomycin (1\u2009mg/0.1\u2009mL) and ceftazidime (2.25\u2009mg/0.1\u2009mL) were injected. Regarding the suspicion of herpetic retinitis, we started valacyclovir, 1000\u2009mg tablets every 8\u2009h for the patient.The results of the smear and culture of the vitreous sampling were negative. However, in infectious endophthalmitis, more than half of the cases may report negative culture results of vitreous samples.Two months after the first surgery, because of significant cataracts and near\u2010total rhegmatogenous retinal detachment (RRD) and subretinal fibrotic bands under silicon oil, we performed cataract surgery with intraocular lens implantation, silicone oil removal, 23G\u2010re\u2010vitrectomy, and subretinal band removal and re\u2010injection of silicone oil (5700 centistoke viscosity). Systemic antibiotics, including oral doxycycline 100\u2009mg every 12\u2009h, and trimethoprim\u2010sulfamethoxazole, 400/80\u2009mg tablets (sulfamethoxazole 400\u2009mg\u2009+\u2009trimethoprim 80\u2009mg), four tablets daily, were prescribed for 6\u2009weeks, and the systemic corticosteroid was tapered off for the patient during 4\u2009weeks.At the final follow\u2010up, the visual acuity of the right eye was hand motion with projection. IOP was 4\u2009mmHg. A retinal fold could be observed, and the right eye had developed pre\u2010phthisis bulbi Figures\u00a0 and 2.The left eye was completely normal at the last visit.3Brucellosis is a common zoonotic medical condition. Although eradicated and under control in most developed countries, it still represents a significant health problem in many parts of the world, including the Middle East, the Mediterranean, Mexico, and Central and South America.Brucellosis is known to manifest with diverse patterns, and bacteriological and serological tests are indispensable in reaching the correct diagnosis. Ocular involvement caused by brucella remains poorly recognized. Some ocular manifestations include dacryoadenitis, episcleritis, chronic sclerouveitis, nummular keratitis, cataract, glaucoma, multifocal choroiditis, exudative retinal detachment, maculopathy, and optic neuritis.Cavallaro et\u00a0al. reported a patient with papilledema due to brucellosis treated with sole anti\u2010brucellosis without steroid administration.endophthalmitis is one of the rare manifestations of brucellosis spread from ocular blood circulation. We summarized some of the previous case reports of endogenous endophthalmitis caused by B. melitensis in Table\u00a0brucella endophthalmitis is sometimes tricky and only achieved through high clinical suspicion, especially when the characteristic systemic features are absent.Endogenous endophthalmitis is an ophthalmic emergency that can have severe sight\u2010threatening complications and still presents a diagnostic and therapeutic challenge even with improvements in therapeutic modalities. The main prognostic factor is the virulence of the causative organism: once the organism enters the eye, it rapidly destroys ocular tissues. However, our patient's poor outcome could also be related to sequelae of endophthalmitis, such as RRD and proliferative vitreoretinopathy (PVR), rather than the high virulence of the organism. Endogenous systemic corticosteroids and azathioprine with an initial misdiagnosis elsewhere. They concluded that the diagnosis of brucellosis should be considered in any case of panuveitis of unknown origin in endemic areas.Regarding a 1.3% false positive rate for serology assessment for diagnosing brucellosis, we considered other differentials such as fungal, bacterial, and tuberculosis\u2010related endogenous endophthalmitis.B. melitensis, which supports an infectious etiology.Posterior segment inflammation in a patient with systemic brucellosis is not always considered septic. Rabinowitz et\u00a0al.,While previous studies have shown an appropriate response to treatment in patients with brucella endophthalmitis,4The prevalence of brucellosis has decreased in many developed countries, and ophthalmic complications are rare in these regions. However, it is suggested that in endemic areas, ophthalmologists consider workup for brucellosis in any case of panuveitis of unknown origin in a patient with a history of consumption of unpasteurized animal products and contact with animals, as it seems that early diagnosis and prompt treatment of the disease could decrease vision\u2010threatening complications.Seyedeh Maryam Hosseini: Data curation; investigation; supervision. Mohammad Baghi: Data curation; investigation. Mohamadreza Ansari Astaneh: Supervision; writing \u2013 review and editing. Mehrdad Motamed Shariati: Conceptualization; writing \u2013 original draft.The authors received no funding from the government or academic institutes.The authors declare that they have no competing interests.We obtained written consent from the patient before publishing this case report and the related images. The written consent template is available for review by the Editor\u2010in\u2010Chief of this journal."}
+{"text": "Energy-based focal therapy (FT) uses targeted, minimally invasive procedures to destroy tumors while preserving normal tissue and function. There is strong emerging interest in understanding how systemic immunity against the tumor can occur with cancer immunotherapy, most notably immune checkpoint inhibitors (ICI). The motivation for combining FT and ICI in cancer management relies on the synergy between the two different therapies: FT complements ICI by reducing tumor burden, increasing objective response rate, and reducing side effects of ICI; ICI supplements FT by reducing local recurrence, controlling distal metastases, and providing long-term protection. This combinatorial strategy has shown promising results in preclinical study (since 2004) and the clinical trials (since 2011). Understanding the synergy calls for understanding the physics and biology behind the two different therapies with distinctive mechanisms of action. In this review, we introduce different types of energy-based FT by covering the biophysics of tissue-energy interaction and present the immunomodulatory properties of FT. We discuss the basis of cancer immunotherapy with the emphasis on ICI. We examine the approaches researchers have been using and the results from both preclinical models and clinical trials from our exhaustive literature research. Finally, the challenges of the combinatory strategy and opportunities of future research is discussed extensively. Over thSurgical resection, chemotherapy, and radiotherapy are the most common SOC choices currently. Surgical resection has remained the first choice for most solid tumor cases. With advanced-stage cancer, chemotherapy, radiation, or both are usually suggested to control symptoms or to reduce the chance of local tumor recurrence and metastasis . HoweverEnergy-based focal therapy (FT), sometimes referred to as energy-based tumor ablation, is a rapidly growing field in loco-regional therapy (LRT) and interventional oncology (IO) for cancer management. FT uses targeted, minimally invasive procedures, usually performed with the help of image guidance, to treat and/or relieve the symptoms of cancer. It has been used for decades to treat solid tumors by effectively destroying tumors while preserving normal tissue and function so as to reduce side effects and cause minimal pain , 11. In 1.2The utility of leveraging the immune system to fight tumors has now been robustly validated. Cancer immunotherapy, most notably immune checkpoint inhibitors (ICIs), have definitively established that cancer can be treated very effectively by the immune system without directly eliminating cancer cells . ICIs arin situ and therefore creates antigens to enhance a locoregional and systemic antitumor immune response  and clinical trials (Section 7) from our exhaustive literature research. Finally, the challenges of the combinatory strategy (Section 8) and opportunities of future research (Section 9) are discussed extensively.In this review, we start by introducing different types of energy-based focal therapy. In Section 2, we cover the biophysics of FT based on heating and hyperthermia, freezing and electric membrane disruption, and how each utilization of energy leads to focal tissue destruction. In addition, practical and immunomodulatory advantage of energy-based FT compared to conventional cancer therapy is discussed. In Section 3, we present important aspects of immune responses following FT due to its strong association with immunogenic cell death (ICD), as understanding the immunomodulatory effects of FT serves as the foundation of designing and optimizing combinatory approaches with cancer immunotherapy. We continue by introducing cancer immunotherapy (Section 4) with an emphasis on ICI (Section 5) to provide the basis for the synergy between FT and ICI. Later, we examine the approaches and outcomes researchers have been using and the results from both 2Energy-based FT, or focal tissue ablation, is a form of locoregional therapy that relies on energy to destroy tissues without affecting the rest of the body. Cancer focal therapies can be categorized into thermal and nonthermal techniques, depending on the form of energy leading to tissue destruction. Thermal techniques can be high-temperature-based, such as radiofrequency ablation (RFA), microwave ablation (MWA), high-intensity focused ultrasound (HIFU), laser ablation and nanoparticle (NP)-mediated hyperthermia, or low-temperature-based such as cryoablation. Nonthermal techniques include irreversible electroporation (IRE) and histotripsy. Ablation techniques, the source of energy, and their clinical targets are summarized in It should be noted this review focuses on physical energy as the direct and immediate cause of cell death, and we do not cover every form of locoregional therapy. While widely used in clinical settings, some locoregional therapies rely on cell death mechanisms other than energy-cell interaction. Techniques not discussed in this review include but are not limited to (1) ionizing radiation therapy , such as2.1Heat has long been studied as a crucial mechanism for cellular damage; different temperature ranges can lead to distinct biological mechanisms. As such, many different energy-based focal ablative techniques exist, as shown in Radiofrequency ablation (RFA) occurs by applying an oscillating electric current  to the target tissue through direct placement of one or more interstitial electrodes into the tumor. Tissues further away from the electrode are heated primarily by thermal conduction , 44. TheMicrowave ablation (MWA) relies on the electromagnetic field generated by an intratumorally placed antenna to generate dielectric heating. The most common frequencies used for microwave ablation are 915 MHz, 2.45 GHz, and broadband frequencies between 1 GHz and 10 GHz. Polar molecules (primarily water) within the tissue continuously realign with the oscillating electromagnetic field, effectively increasing kinetic energy. The ability to cause hyperthermic injury is determined by device design , MW characteristic (power and frequency), tissue electrical properties , and tissue thermal properties , 47.High intensity focused ultrasound (HIFU) uses multiple high-intensity non-ionizing ultrasound beams and focuses them on a selected focal area to destroy the target tissue. HIFU systems typically operate in the frequency range of approximately 500 kHz and 7.5 MHz. HIFU causes tissue injury through two primary mechanisms: thermal damage due to absorption of the applied acoustic energy and mechanical damage due to acoustic cavitation. The amount of acoustic energy transferred from the acoustic wave to the tissue is directly proportional to the intensity of the wave and the innate absorption coefficient of the targeted tissue . (Micro)Laser ablation, which refers to laser-induced interstitial thermotherapy (LITT) in our context, also known as stereotactic laser ablation (SLA), is performed by implanting a laser catheter into the tumor. It uses high-intensity lasers to generate heat. Heat is generated by optical absorption and is then conducted to the rest of the tissue to shrink or destroy tumors . TemperaNP-mediated hyperthermia generates heat based on the unique and highly tunable optical or magnetic properties of nanomaterials. Based on the energy source, NP-mediated hyperthermia can be categorized as photothermal therapy (PTT) or magnetic hyperthermia therapy (MHT), also known as magnetic fluid hyperthermia (MFH). PTT involves the application of normally benign light wavelengths (most often NIR light) in combination with efficient photothermal agents  that convert the absorbed light to heat . MHT rel2.2Cryoablation relies on cryogenic temperature to cause cold injury and destroy target tissue, as also featured in Cryoablation is performed using needle-like probes, where rapid cooling is achieved by circulating cryogen  or by the Joule-Thomson effect . Heat tr2.3IRE, as also featured in Unlike thermal ablation techniques, IRE is not susceptible to heat sink effect, which occurs when heat or cold is absorbed by flowing blood or air and carried away from the area of ablation, thereby limiting the effectiveness of ablation when the target lesion is in close proximity to a large blood vessel . In addi2.42) focused ultrasound techniques [sometimes refer to ultrasound irradiation (2) techniques that increases cell permeability and extremely high-intensity (>10 kw/cm2) focused techniques [for example histotripsy  duration pulses of high-intensity ultrasound with low duty cycles . The tisadiation ], high itotripsy , boilingtotripsy ] leadingtotripsy .2.52 and heating by RFA. Some are still in developmental stages, for example cryoelectrolysis, which combines electrolysis and freezing. However, due to limited knowledge available, their immunological effect and/or their combinatory approach with immunotherapy are not covered in this review.There are numerous energy-based cancer therapies being developed and tested. Some techniques have gained FDA approval, such as tumor treating fields, which rely on mild electrical fields for tumors including glioblastoma multiforme (GBM)  to inter2.6Focal therapy (FT) has been proposed as a minimally invasive option for treating localized disease with the aim of minimizing the side effects associated with radical treatment while maintaining the oncological benefit of local treatments . FT is uFT offers a range of practical advantages over conventional surgical resection, radiation therapy and chemotherapy. Being a cost-effective alternative to surgery, minimally invasive FTs are indicated for a large range of malignancies at an early stage or for those not eligible for surgery. They have a better complication/risk profile than radical surgery and can be used in patients who are not fit enough for or decline radical options . When thAlthough focal therapy can offer several advantages compared to traditional treatment, clinical use of FT as a first-line treatment is quite limited. In the clinic, cryosurgery is a first-line treatment in dermatological disorders for early-stage skin cancer, retinoblastoma, and precancerous growths on the skin and cervix . Thermal3in vivo models and in clinical studies  exposure of tumor antigens, (2) ICD and release of DAMPs, (3) antigen presentation and activation of immunity, (4) recruitment of immune effectors, (5) modulation of immunosuppressive cell types and (6) maintenance of memory cells. Here we describe the basis of each pathway and the modulations that focal therapies have in common. The DAMPs, cytokines, and chemokines that have been observed following FT together with their primary roles in the immune response against cancer are summarized in 3.1Tumor antigens are proteins or carbohydrates that are recognizable by T cells or B cells as antigens and against which an antitumor immune response can be generated , 103. BaDuring tumor focal destruction, when cancer cells are going through mostly necrosis, cellular contents containing tumor antigens are exposed to the extracellular space due to the loss of plasma membrane integrity, the disruption of cell organelles, and the degradation of nucleic acids and proteins , 106. AnEven though antigens are released and/or exposed by all forms of focal therapy, the quantity and quality of released antigens are very different among focal therapy approaches, leading to variable immunogenicity. For example, cryoablation is considered to induce higher post-ablative immunogenicity compared to high-temperature-based methods  based on the assessment of the serum antigen level and the percentage of antigen-loaded DCs in the draining lymph node, and the general evaluation of inflammatory responses \u2013113. A p3.2DAMPs also known as danger-associated molecular patterns and danger signals, are host biomolecules released from or exposed on dying, stressed, or injured cells that act on pattern-recognition receptors to activate the innate and, subsequently, the acquired immune systems , 87. TheDuring focal ablation, DAMPs are released from or exposed on the ablated tissue, including tumor cells, stromal cells, endothelial cells, and immune cells, as well as released due to the disruption of local extracellular matrix . These Din vivo and clinically. Heat shock proteins, ATP, HMGB1, calreticulin, and end-stage degradation products  have been largely limited to in vitro study.Cytokines are widely studied in the immunological response to focal ablation through evaluation of serum levels of cytokines Following thermal ablation, increase of pro-inflammatory cytokines  are common for several hours to days \u2013120, whi3.3After the maturation and activation of APCs (particularly DCs) stimulated by DAMPs, dying tumor cells or released antigens are absorbed and processed by APCs, then the activated APCs travel to the draining lymph nodes, where antigens are presented to naive T cells . Cross-pin vitro study, IRE has shown superior induction of CTL response compared to cryoablation and heat-based treatment  within the draining lymph nodes have been demonstrated , 130. Inreatment . NeverthThere is a growing interest in the role of CD4+ T cells in anti-tumor immunity \u2013135. Th1In addition to cellular adaptive immunity, which is mediated by T lymphocytes, humoral immunity, which is an antibody-mediated response, is also involved in FT-induced anti-cancer immunity. The predominance of macrophages for the uptake of ablated tumors is more likely to induce a humoral response involving helper T cells and B cells rather than a cellular response .3.4After FT, a variety of cell types are recruited to the ablation site owing to injury response, inflammation reaction, and wound healing. These recruited cells can be immune-promoting or immune-suppressive, depending on their functional phenotype, as summarized in TILs including cytotoxic (CD8+) and helper (CD4+) T cells, B cells, and NK cells are emerging as prominent biomarkers in predicting the efficacy and outcome of treatments . Tumor-iIn addition to TILs, DCs and M1 macrophages are also considered to be critical immune effectors contributing to the activation of TILs. Much evidence suggests that FT can promote DC activation and maturation and macrophage polarization toward M1 , 146\u20131483.5Many cell types contribute to the generation of an immunosuppressive tumor microenvironment, including cancer-associated fibroblasts, myeloid-derived suppressor cells (MDSCs), Tregs, and tumor-associated macrophages (TAMs) . These cConflicting results have been published on how FT modulates these immunosuppressive cell types, especially for thermal ablation techniques such as RFA. For example, a number of studies have reported the reduced frequency of Treg cells in the tumor and peripheral blood after RFA, thereby promoting antitumor immunity , 153. Onin vivo and clinically , a subset of memory CD8+ T cells, are non-recirculating tissue-localized cells crucial for protective immunity against tumor recurrence  distal to the tumor after IRE treatment, specifically within the salivary gland, contralateral skin, and liver . It rema3.7In addition to these above-mentioned 6 aspects of immune response to FT, FT can also modulate the immune system through other pathways, including but not limited to (1) cell infiltration and permeability, such as changes in vascular structure and blood flow and stroma remodeling; (2) modulation of gene expression of cancer cells and immune cells; (3) changes in metabolism, such as tumor hypoxia; and (4) tissue damage and remodeling.It has been shown that changes in temperature can cause a wide range of changes to the tumor microenvironment. For example, hyperthermia is usually accompanied by increased blood flow, resulting in increased oxygenation and intense infiltration of inflammatory cells and tumor-infiltrating lymphocytes (TILs) , 16. Hyp4Combining FT with immunotherapy may improve the potential of focal therapy to eliminate established tumors and prevent tumor recurrence. By taking advantage of focal ablation\u2019s ability to induce the activation of an anti-cancer immune response, the efficacy of immunotherapy can be improved. Here, we examine different types of cancer immunotherapies and the status of preclinical and clinical research combining the two forms of cancer treatment.4.1Cancer immunotherapies basically work through stimulating effector mechanisms and/or counteracting inhibitory and suppressive mechanisms. The NIH categorizes immunotherapy into 5 types: monoclonal antibodies, treatment vaccines, immune system modulators, T cell transfer therapy, and immune checkpoint inhibitors , as summ4.2The immune responses after focal ablation monotherapy are usually weak and rarely induce clinically relevant antitumor effects. Different modalities of immunotherapy have been combined with focal therapy to stimulate a more robust anti-tumor reaction with the hope of a systemic immune response, as summarized in 5Immune checkpoints are crucial to the immune system for maintaining self-tolerance and modulating the duration and amplitude of physiological immune responses in order to prevent auto-immune disease . When chAmong identified immune checkpoints, cytotoxic T-lymphocyte-associated protein (CTLA-4) and Programmed cell death protein 1/Programmed death-ligand 1 (PD-1/PD-L1) are the most common targets in checkpoint blockade therapy. In general, it is perceived that CTLA-4 predominantly regulates early-stage T cell activation, whereas PD1/PD-L1 primarily regulates effector T cell activity within tissue and tumors , 216.5.1During antigen recognition, T cells are activated when T cell receptors (TCRs) bind to antigen displayed in the MHC on APCs in concert with CD28:B7-mediated costimulation . CTLA-4 5.2PD-1 is a member of the B7/CD28 family of costimulatory receptors . It regu5.3With ample evidence suggesting that T cell response modulated by checkpoint blockade can promote durable cancer remission, the US Food and Drug Administration (FDA) has approved nine ICIs for targeted diseases , as summ5.4In addition to the well-known CTLA-4 and PD-1 pathways, other immune checkpoints such as LAG-3, TIM-3, TIGIT, and VISTA are considered as promising immune therapy targets, and numerous antibodies have been developed to regulate these pathways , 224. ReICIs can be used in combination for better efficacy and response by targeting different checkpoints simultaneously. The combination of CTLA-4 and PD-1/PD-L1 blockers has been the most extensively researched regimen . For exaOur knowledge of the fundamental biological roles of these molecules remains limited and, in many cases, is being outpaced by clinical investigation. Deeper understanding of the basic biology is in urgent need for the rational development of new immune checkpoint blockade therapies and combinatory approaches. Meanwhile, ongoing efforts in preclinical and clinical studies are expected to reveal mechanisms of using these novel ICIs to enhance anticancer immunity.5.5Although ICIs have been used widely and show great promise for improving the outcome of cancer treatment, this therapy is limited by low response rate. Many patients exhibit innate resistance and disease progression. For example, among all cancer types, anti-CTLA-4 drugs have the highest objective radiographic response of 15% in advanced metastatic melanoma . Anti-PDImmune-related adverse events (irAEs) associated with ICIs is another concern for clinical use, due to overactivation of the immune system in almost any organ of the body. IrAEs can occur at any point along a patient\u2019s treatment course. The most common toxicities during the treatment using CTLA-4-blocking antibodies include enterocolitis, inflammatory hepatitis, and dermatitis. The most common adverse events of anti-PD-1 ICIs are fatigue, diarrhea, rash, and pruritus , 235. SeTherefore, the evaluation of biomarkers that can predict tumor response to ICI treatment is necessary to avoid overtreatment of ICIs and minimize side effects. Emerging research has focused on identifying predictive markers and combinatory approaches to improve the relatively low response rate of ICIs \u2013238.5.6There are a wide range of biomarkers being used to predict the ICI therapy response. Tumor mutational burden  is one of the biomarkers . For colCertain cell surface markers have also been identified as biomarkers for ICI responsiveness. For example, PD-L1 expression has been vital to predicting tumor response to anti-PD-1 or anti-PD-L1 antibodies in melanoma and NSCLC , 242. PDImmune cell infiltration is another important predictive biomarker considering the mechanism of ICI therapy. Generally, a higher number of tumor-infiltrating lymphocytes (TILs) has been a favorable prognostic factor in many types of cancers, including melanoma and colorectal cancer , 247.Taken together, \u201chot tumors,\u201d characterized by high tumor mutational burden, increased expression of PD-L1 and IFN-\u03b3 signaling, and high T-cell infiltration are associated with better ICI efficacy , 249. In5.7To improve the benefit of ICI immunotherapy, especially to increase the objective response rate and reduce irAEs, substantial efforts are focused on combination strategies aimed at turning \u201ccold\u201d tumors into \u201chot\u201d tumors  by changImmunomodulation by energy-based focal therapy, as we discussed previously, is well aligned with the strategy of combination therapy with ICI to improve tumor immunogenicity  with anti-CTLA-4 was also shown to enhance the anti-tumor response . Other sCryoablation has been described to exert both immunostimulatory and immunosuppressive effects due to the specific physiological mechanisms of cold injury , 130. SoRM) in non-lymphoid tissues including skin. Mice that had previously achieved complete remission following dual IRE + anti-CTLA-4 therapy were also 100% protected from secondary tumor challenge  are less well characterized. This non-thermal ablation process can increase the expression of both CTLA-4 and PD-1 pathway receptors , which s6.3in vivo research on animals. In preclinical studies, NP-mediated hyperthermia, both photothermal therapy (PTT) and magnetic hyperthermia (MHT), combined with ICI has been demonstrated to enhance therapeutic outcomes, reverse tumor-mediated immunosuppression, result in therapeutic effect for both primary tumors and metastatic lesions, prevent cancer recurrence, and prolong the survival period  of light for PTT and the poor magnetothermal conversion efficiency for MHT all severely dampen the treatment effect. Second, effective delivery of nanomedicine remains a major challenge. Only a fraction of intravenously administered nanomaterials can be delivered to the tumor regions, while the majority are absorbed by the reticuloendothelial system during blood circulation, followed by clearance from the body . At the 77.17.1.1The keywords, database, and inclusion and exclusion criteria of the literature research of clinical trials are summarized in The keyword search identified a total of 55 studies by Sept 15, 2022, as summarized in The majority of trials were in phase I or II or a combination of phase I and II, enrolling small cohorts, typically fewer than 50 patients. One phase III and one phase IV trial (both outside U.S.) were identified  or anti-CTLA-4 drugs (Ipilimumab) in combination with FT, which are the first three ICI drugs approved by the FDA. The number of ICIs that are used in combination treatment has been increasing during the past 10 years. Although ipilimumab was the only ICI involved in a clinical trial in 2011, 11 distinct ICIs have been included in clinical trials by 2022 along with the thriving development of ICI drugs worldwide Table\u00a07,Dual immunotherapy using an anti-PD-1/L1 antibody and an anti-CTLA-4 antibody with FT was identified in 10/50 trials. Ipilimumab + Pembrolizumab/Nivolumab (7/50) were the most common double-agent immunotherapies along with FT. The application of dual combinations is encouraged by the evidence that combination anti-CTLA-4 plus anti-PD-1 checkpoint blockade has shown enhanced efficacy compared to monotherapy in a wide range of cancer types \u2013289. In 7.1.3Cryoablation, which has been used in 21 trials (19 single FT + 2 more than one FT), has been the most commonly studied FT modality Table\u00a02.The choice of FT in combination for specific disease is largely based on the established clinical benefit of locoregional therapy (LRT) monotherapy, which depends on the properties of the targeted tissue and the FT mechanism, as we reviewed in section 2. For example, RFA, MWA and cryoablations were used on primary liver tumors, while cryoablation was the most frequently studied FT modality to be combined with ICIs for primary breast cancer.7.1.4The combination of FT and ICI is likely to benefit a broader range of patients than monotherapy, reflected by the widening scope of indications for which this treatment has been tested. In Combination therapies greatly expand the application of ICI, offering opportunities to treat a wider variety of cancer where ICI monotherapy is ineffective. When used alone, ICI therapy has been mostly limited due to low response rates; the FDA-approved indications focus on \u201chot\u201d tumors with high TMB. Cancer types with higher response rates to ICI largely associated with their TMB, including melanoma, lung cancer, and colorectal cancer, have been treated with combination therapy. In addition, certain cancers with lower ICI response rates due to their relatively low mutation loads, such as prostate cancer, pancreatic cancer, and MSS CRC, are being treated in clinical trials with combination therapy. Still other cancer types, including HCC, BTC, and glioma are benefiting from combination therapy with ICI, mainly owing to the crucial role that LRTs have played in managing these diseases.LRT monotherapies are usually considered in patients with unresectable local disease, as either a conservative approach  or a palliative or even \u201clast-ditch measure\u201d , according to NCCN guideline. In comparison, the combination therapies are being evaluated as a first- or second-line treatment: not limited to primary tumors but also used for recurrent and/or metastatic disease.Taken together, combination therapy shows promise for mitigating the limitations of both ICI and FT monotherapy to expand their application. This strategy not only makes existing monotherapy more effective, but more importantly, opens up possibilities for a broader range of cancers.7.2It is anticipated that the combination of ICIs and FTs can produce synergistic effects, leading to improved outcomes without added toxicities. The primary reported outcomes of clinical studies examined, most commonly, safety and tolerability, survival, response rate, and immune-related biomarkers. The potential benefits of combination therapy include: 1) improved therapeutic effect, 2) enhanced immune response, and 3) reduced adverse events Table\u00a0117.2.1The therapeutic effect is improved by an increase of response rate and/or better survival compared to either FT or ICI monotherapy. For example, a phase II study that evaluated subtotal thermal ablation (RFA or MWA) with anti-PD-1 therapy (nivolumab or pembrolizumab) in patients with advanced HCC has shown that additional ablation increases the objective response rate with tolerated toxicity and achieves a relatively better median survival . In this7.2.2An enhanced immune response is typically demonstrated by an elevation in the biomarkers associated with stronger anti-tumor immunity in most of the trials or lessening of immune anergy. Most noticeable is the sustained elevation in intratumoral and/or peripheral CD8 T cells in combination therapy. In one study, cryoablation and tremelimumab treatment led to a significant increase in immune cell infiltration and tertiary lymphoid structures in patients with metastatic clear cell RCC . Another7.2.3Safety and tolerability are the primary outcome for most studies demonstrating the reduction of adverse effects. Among all the reported trials, the combination therapy was well-tolerated, and the toxicity is not increased by the association of ICIs and LRTs. Adverse events were less than or equal to Grade II for most of the studies. Moreover, the ICI dose in combination treatment can be reduced owing to the increase in therapeutic effect and improved response rate, therefore reducing the immune-related adverse effects.7.2.4More clinical evidence is needed to demonstrate whether the combination of ICIs and FTs is feasible and effective in treating solid tumors and shows advantages over monotherapy and even SOCs. As of the writing of this review, the numbers of completed clinical trials and retrospective clinical studies are still small, especially compared to those in radiation oncology or chemotherapy. Among these studies with combination FT and ICI, the patient selection may be biased; some patients with low TMB (and presumably low response rate to ICI) may have been excluded. In addition, more detailed analysis of immune response is warranted for better understanding of immune modulation by this combined treatment.There has not been a reported randomized phase III study that compares combination therapy with other treatments including monotherapy . The immune and therapeutic effects of the combination therapy remain to be better understood. Fundamental questions in designing optimal combinatorial treatment regimen need to be answered, as we discuss in our next sections.88.1Unlike thermal dosing, the \u201cimmunological dosing\u201d of FT, which describes the interaction between the immune system and the FT, is not well defined nor established. Even though there have been comprehensive reviews on the immunomodulation of types of FT such as cryoablation , hyperthex vivo and in vivo physical performance of the probes with regards to the biological sequelae of tumor destruction.The best choice of FT is usually not straightforward. Currently, clinicians are not selecting FT approaches based on the immunological effects of specific FT modalities, in part because such immunologic effects are not yet clear, but by other factors, including the tumor location, tumor size, and disease stage. To date, clinical studies offering direct comparison of the immune response among the different modes of FT have not been conducted. Preclinical comparison among different modes of FT is also still lacking. Another factor that further complicates the issue is that the device and setup of FTs vary among different laboratories: some use a clinical-size probe which is less than ideal for sub-centimeter tumors, while some groups opt to build probes specially for small animal research . When FTin vivo measurements including monitoring and validating the energy fields need to be taken and compared to the models to ensure the consistency of FT protocols.Proper dosing in clinical study is key for optimal combination therapy. For example, even though RFA and anti-PD-1 generally works well in most of the cases, the inflammation induced by incomplete RFA can accelerate tumor progression and hinder anti-PD-1 immunotherapy . However8.2Despite research advancement toward understanding synergistic combination therapy, the optimal timing of ICI treatment has not been well studied. Little is known about how to design the combinatory regimens to favor therapeutic efficacy, whether before, during or after the FT. Most clinical studies incorporated FTs during ICI treatment. This fact might lead to weakened responses, as some preclinical evidence suggests that checkpoint inhibition before antigen priming can lead to poor anti-tumor effects . A populIn addition to timing, there is a need for preclinical and clinical investigation to optimize the synergistic efficacy of the dosage, frequency, and delivery approach of ICI when combined with FT. Most of the studies adopted dosage regimens based on the previous experience of preclinical studies or previous clinical trials on ICIs alone and adjusted them according to regular evaluation , rather 8.3Most research in this field is currently still in the proof-of-principle phase. Preclinical research largely precedes clinical studies in terms of optimizing treatment approaches and understanding immune system modulation. However, we should recognize the gaps between preclinical models and clinical trials, especially considering differences in (1) the cancer models (2), the size difference, and (3) the drug delivery approaches.The immune effect is highly dependent on not only the cell death by FT, but also the type of tumor in the experimental mouse model. The extent to which preclinical research can be generalized to humans is largely limited by the heterogeneity of tumor types, animal models, and ablation methodologies. The mouse subcutaneous tumor model has prominent advantages, allowing treatment of a large number of animals with easy handling and housing and lower costs than other mammalian species, and also offering access to an array of assays, reagents and genetically engineered mice that facilitate mechanistic understanding . HoweverThe size of mice becomes another disadvantage for investigation of local therapies and drug delivery, due to the disparities in scale. On small animal cancer models, the tumors being treated by FT are usually small (a few millimeters) and spherical. Clinical devices, designed to treat tumors at centimeter scale, are usually too big for the tumors on mice, so customized devices have to be used for preclinical research. Monoclonal antibodies are each unique, so ICI drugs for mice are inherently different than for humans, making it difficult to translate the treatment effect from mouse to human. Scaling up the setup and dose of FTs and ICIs remains a big challenge. The size difference may also have an impact on the ICI timing and dosing.The difference in drug delivery methods between animals and humans also becomes a challenge in translational research. ICI drugs are typically infused intravenously in clinical studies while different drug delivery methods, such as intraperitoneal and intratumoral injection, are typically used in animal studies. Nonetheless, studies of syngeneic cell lines or genetically engineered mouse models have supported progress to date on cancer immunotherapy and that situation is not likely to change in the near future.9T cell responses that recognize and eradicate cancer cells are an important part of the cancer-immunity cycle , as showTo design an effective approach involving FT and ICI, the following 3 steps are needed. First, the cancer immune microenvironment must be assessed to identity the \u201cbottlenecks\u201d of the cycle. Second, with the knowledge of the limiting steps, the prescription of FT and/or ICI needs to target the stimulatory and inhibitory factors within each step, without introducing additional bottlenecks to the system. Finally, auxiliary immunotherapy and adjuvant therapy can be prescribed to better address the bottlenecks and stimulate antitumor immunity.9.1For a tumor to exist or even to progress, the crucial steps of the cancer-immunity cycles leading to cancer elimination must be arrested. To determine the bottlenecks, the tumor immune microenvironment must be fully assessed before the combination therapy, as the microenvironment of cancer varies among tumors and patients. Predictive biomarkers that are present at baseline prior to treatment initiation and predict ICI response can be evidence of stimulatory signal or inhibitory/suppressive factors. Such factors include the genetics of the cancer cells that dictate the mutation burden and the attributes  of immune cells.Equally important are the preemptive biomarkers, which are generated upon treatment initiation. Biomarkers associated with good prognoses can be evidence of effective treatment that alleviates the bottlenecks in the cancer-immunity cycle. Biomarkers contrary to prediction can be signs of failed strategy and will require changes of strategy. One challenge, however, is that some biomarkers cannot be detected in peripheral blood and will require tumor biopsy. Other challenges involve elusive data from systematic comparisons of the immunogenic effects of different modalities of focal therapy. The immune cell populations (both the immune effectors and regulators) and immunological features following FT, as monotherapy or with ICI, in addition to their comparisons to conventional treatment, remain largely unknown.9.2The summary of potential solutions to the bottlenecks is presented in MJ, SF, and QS contribute to the conception, MJ and QS were involved in acquisition, analysis, or interpretation of data; MJ, SF, and QS drafted the work and/or substantively revised it. All authors contributed to the article and approved the submitted version."}
+{"text": "Vessels encapsulating tumor clusters (VETC) have been considered an important cause of hepatocellular carcinoma (HCC) metastasis.To compare the potential of various diffusion parameters derived from the monoexponential model and four non-Gaussian models  in preoperatively predicting the VETC of HCC.86 HCC patients (40 VETC-positive and 46 VETC-negative) were prospectively enrolled. Diffusion-weighted images were acquired using six b-values (range from 0 to 3000 s/mm2). Various diffusion parameters derived from diffusion kurtosis (DK), stretched-exponential (SE), fractional-order calculus (FROC), and continuous-time random walk (CTRW) models, together with the conventional apparent diffusion coefficient (ADC) derived from the monoexponential model were calculated. All parameters were compared between VETC-positive and VETC-negative groups using an independent sample t-test or Mann-Whitney U test, and then the parameters with significant differences between the two groups were combined to establish a predictive model by binary logistic regression. Receiver operating characteristic (ROC) analyses were used to assess diagnostic performance.Among all studied diffusion parameters, only DKI_K and CTRW_\u03b1 significantly differed between groups . For predicting the presence of VETC in HCC patients, the combination of DKI_K and CTRW_\u03b1 had the larger area under the ROC curve (AUC) than the two parameters individually .DKI_K and CTRW_\u03b1 outperformed traditional ADC for predicting the VETC of HCC. AlthougRecent studies have shown that preoperative morphological features of HCC based on magnetic resonance imaging (MRI) or computed tomography (CT) could be used to characterize VETC , 7. HowePrevious studies have shown that these advanced non-Gaussian models are superior to the monoexponential model in detecting the microstructural heterogeneity of various solid tumors, such as glioma, endometrial carcinoma, and hepatocellular carcinoma \u201321. HoweThis prospective trial was approved by the ethics committee of The First Affiliated Hospital of Guangxi Medical University (NO. KY-E-245), and informed consent was obtained from all participating individuals. From December 2021 to August 2022, 159 individuals whose CT and/or ultrasonography results indicated primary liver cancer were recruited. All patients received preoperative conventional MRI and 6 b-value DWI in our institute.Exclusion criteria: (1) the patient received treatment previously , 20 cases; (2) the patient was not eligible for surgery or did not receive surgery in our hospital, 25 cases; (3) the interval between the MRI and surgery exceeded 1 month, 5 cases; (4) the HCC lesion was too small (<1\u00a0cm), 6 cases; (5) the final pathological results indicated other malignancies instead of HCC, 14 cases; (6) the quality of the MRI image was inadequate for analysis, 3 cases. Ultimately, 86 patients were included in the study.2 , repetition time (TR) = 4,900 ms, echo time (TE) = 57 ms, field of view (FOV) = 380 \u00d7 261 mm2, matrix size (MS) = 128 \u00d7 88, slice thickness (ST) = 5\u00a0mm, slice gap = 1\u00a0mm, parallel imaging acceleration factor = 2, diffusion scheme = monopolar, bandwidth = 2442 Hz/pixel, and scan duration = 4\u00a0min and 40s.A MAGNETOM Prisma 3T MRI scanner  with a body coil (18 channels) and a spine coil (12 channels) was used to examine the patients. A free-breath single-shot echo-planar-imaging (ss-EPI) combined with integrated slice-specific dynamic shimming (iShim) was used to acquire the DWI data for non-Gaussian and monoexponential models simultaneously in three orthogonal directions. The imaging acquisition parameters are as follows: 6 b-values = 0, 200, 600, 1000, 2000, and 3000 s/mm2, MS = 320 \u00d7 320; ST = 3\u00a0mm, and the flip angle (FA) = 120\u00b0); the coronal T2-weighted images were acquired with half-Fourier single-short turbo spin-echo (HASTE) sequence ; in-phase and out-phase T1-weighted imaging was performed with fast spoiled gradient-recalled dual-echo sequence ; the fat-suppressed axial T1-weighted 3D volume interpolated breath-hold examination (VIBE) sequence  was used to capture images at the following phases: pre-contrast, late arterial phase (25 \u2013 35 s), portal venous phase (55 \u2013 65 s), and delayed phase (3\u00a0min).For conventional MRI sequences, the information and parameters are listed as follows: The transverse fat-suppressed T2-weighted images were acquired with respiratory-triggered turbo spin-echo sequence . The corresponding calculation formulas of models are as follows:(1) Monoexponential modelwhere S(b) and S0 are the image signal intensities measured with and without diffusion weighting of b value, respectively. ADC is the apparent diffusion coefficient.(2) Diffusion kurtosis imaging modelwhere D represents diffusivity, and K represents kurtosis.(3) Stretched-exponential modelwhere DDC represents distributed diffusion coefficient, and \u03b1 is intravoxel heterogeneity index.(4) Fractional order calculus modeld is the diffusion gradient amplitude, \u0394 is the gradient lobe separation, \u03b4 is the diffusion gradient pulse width.where D represents diffusion coefficient, \u03b2 represents fractional order derivative in space, and \u03bc is spatial constant. G(5) Continuous-time random walk modelwhere D represents anomalous diffusion coefficient, \u03b1 and \u03b2 represent temporal diffusion heterogeneity and spatial diffusion heterogeneity respectively.2) using 3D slicer (version 5.0.2). Obvious cystic or necrotic areas were excluded according to the signals from T2- and contrast-enhanced T1-weighted images. Subsequently, the VOIs were applied to all other parametric maps to determine the parametric values, and the mean value was used.The fittings for the four non-Gaussian models were performed using the DWI data across all b-values. For the monoexponential model, fittings were conducted using DWI data with b-values of 0, 600, and 1,000. The parameters included the diffusivity (DKI_D) and kurtosis (DKI_K) from the DKI model, the distributed diffusion coefficient (SEM_DDC) and intravoxel heterogeneity index (SEM_\u03b1) from the SE model, the diffusion coefficient (FROC_D), fractional order derivative in space (FROC_\u03b2) and spatial constant (FROC_\u03bc) from the FROC model, the anomalous diffusion coefficient (CTRW_D), temporal diffusion heterogeneity (CTRW_\u03b1) and spatial diffusion heterogeneity (CTRW_\u03b2) from the CTRW model, and the apparent diffusion coefficient (ADC) from the monoexponential model. Two experienced radiologists blinded to the study independently and manually delineated the tumors\u2019 volume of interest (VOI) along the boundary of the whole tumor on each slice of DW images . Surgically removed hepatic tissues were independently evaluated by 2 experienced pathologists blinded to this study to determine their pathological classification. Any disagreements were discussed in detail, and the data were reviewed again until a consensus was reached. Notably, it is well-documented that the VETC pattern is construed as CD34-positive sinusoid-like vessels forming web-like networks and trapping individual tumor clusters in the whole/part of the tumor .All statistical analyses were generated using SPSS software . Categorical and quantitative variables were presented as numbers/percentages and mean values \u00b1 standard deviation (SD). The Pearson\u2019s Chi-Square test (including continuity correction when appropriate) was used for categorical data comparisons. On the other hand, the unpaired student\u2019s t-test  and Mann-Whitney U test  were used for continuous variable comparison between the VETC-positive and VETC-negative groups. A value of P less than 0.05 was considered statistically significant. The intraclass correlation coefficient (ICC) was used to reflect the inter-observer agreement toward the diffusion parameters . The diffusion parametric values measured by two radiologists were averaged for further analysis. Binary logistic regression was used to integrate the parameters with significant differences between the two groups for establishing a predictive model. Finally, receiver operating characteristic (ROC) curves were plotted to evaluate the predictive power of every single parameter with a significant difference and their combined model. The maximum Youden index value was used to define the optimal cutoff value, and the related sensitivity and specificity were evaluated. DeLong test was used to assess the predictive power by comparing the area under the ROC curve (AUC).In this study, 86 patients were enrolled, including 72 male and 14 female patients . There were 40 VETC-positive HCC cases  and 46 VETC-negative HCCs . The detailed clinical information of the patients is demonstrated in Detailed parameters derived from each non-Gaussian model and ADC values measured by two observers were demonstrated in We also evaluated the performance of the diffusion parameters with significant intergroup differences in determining VETC in HCC cases by comparing their ROC curves Figure\u00a04In this study, we compared the prediction capacity of parameters derived from monoexponential model and four non-Gaussian diffusion models in VETC presence. The results showed that among all parameters, only DKI_K and CTRW_\u03b1 were potential predictors of VETC positivity. Besides, the combination of these two parameters had moderate diagnostic ability for VETC (AUC=0.747).One previous study reported by Fan et\u00a0al.  showed tIn our results, expect DKI_K and CTRW_\u03b1, the other non-Gaussian model parameters did not correlate with the VETC of HCC. On the one hand, the failure to achieve statistical significance in other parameters may be partially caused by the limited sample size. On the other hand, each model\u2019s parameters focus on different aspects of non-Gaussian properties and are not necessarily different between VETC subgroups defined by the tumor vascular morphology. So far, the non-Gaussian diffusion models have rarely been substantially studied in HCC, and the biological interpretation of their various parameters remains intriguing. Therefore, the potential underlying mechanisms and the association between the parameters above and VETC requires further investigation.2), moderate (600\u20131000 s/mm2), and high (2000\u20133000 s/mm2) b-value clusters. Our study used a prototype ss-EPI sequence with ishim (There is an increasing need for radiologists to be able to provide additional information to oncologists which could be used to evaluate tumor grading, classifications, and prognoses. Unfortunately, conventional MRI based on morphological features alone cannot satisfy this challenge due to the limitation of achievable voxel size. In contrast, high b-value DWI demonstrated promising capability in distinguishing tumor heterogeneity and predicting tumor aggressiveness . Howeverth ishim , 38 and th ishim .Our study has several limitations. First, the sample size was limited. And to determine VETC more accurately, only patients who underwent tumor resections in our hospital were enrolled, and cases with needle biopsies were excluded, which may introduce some sampling bias. In the future, we will expand the sample size to improve the reliability of the results. Second, diffusion-weighted imaging data were obtained under free-breathing, which could cause some interference in the model\u2019s curve fitting. Although a consensus was not reached, some investigators recommended the free-breathing scheme due to its reproducibility and shorter acquisition duration , 41. LasIn conclusion, this pilot study showed that DKI_K and CTRW_\u03b1 values derived from non-Gaussian diffusion models are superior to the traditional ADC value in predicting the VETC of HCC.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by First Affiliated Hospital of Guangxi Medical University Ethics Review Committee. The patients/participants provided their written informed consent to participate in this study.CL and YW contributed equally to this work. Study concept and design, CL, YW, and LL. Drafting of the manuscript, CL. Critical revision of the manuscript, all authors. Image obtaining and postprocessing, CL, YW, JX, and QC. Statistical analysis, HZ. Administrative, technical, or material support, LL, HZ, HG, and YD. All authors contributed to the article and approved the submitted version."
\ No newline at end of file