diff --git "a/deduped/dedup_0586.jsonl" "b/deduped/dedup_0586.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0586.jsonl"
@@ -0,0 +1,51 @@
+{"text": "Melanoma inhibitory activity (MIA) is a small secreted protein that interacts with extracellular matrix proteins. Its over-expression promotes the metastatic behavior of malignant melanoma, thus making it a potential prognostic marker in this disease. In the present study, the expression and functional role of MIA was analyzed in pancreatic cancer by quantitative real-time PCR (QRT-PCR), immunohistochemistry, immunoblot analysis and ELISA. To determine the effects of MIA on tumor cell growth and invasion, MTT cell growth assays and modified Boyden chamber invasion assays were used.The mRNA expression of MIA was 42-fold increased in pancreatic cancers in comparison to normal pancreatic tissues (p < 0.01). In contrast, MIA serum levels were not significantly different between healthy donors and pancreatic cancer patients. In pancreatic tissues, MIA was predominantly localized in malignant cells and in tubular complexes of cancer specimens, whereas normal ductal cells, acinar cells and islets were devoid of MIA immunoreactivity. MIA significantly promoted the invasiveness of cultured pancreatic cancer cells without influencing cell proliferation.MIA is over-expressed in pancreatic cancer and has the potential of promoting the invasiveness of pancreatic cancer cells. Despite improvements in diagnosis and treatment, pancreatic cancer remains one of the most common causes of cancer-related deaths in the world . One of To quantify the mRNA expression of MIA in pancreatic tissues, QRT-PCR was performed using RNA from pancreatic cancer tissues (n = 23) and normal pancreatic tissue samples (n = 17). The analysis revealed a 42 \u00b1 28-fold increase (p = 0.0013) of MIA mRNA levels in pancreatic cancer tissues compared to the normal pancreas Fig. . To deteTo determine the functional role of MIA in pancreatic cancer, we first investigated MIA expression in pancreatic cell lines. QRT-PCR analysis revealed relatively high MIA mRNA levels in Mia PaCa-2, Panc-1, and SU8686 pancreatic cancer cells compared to the other cell lines Fig. . ImmunobMethods section, MIA significantly increased the invasion of Aspc-1 by 2.4-fold (p < 0.001) and the invasion of T3M4 by 3.1-fold (p < 0.0001) . To analyze whether MIA may promote invasiveness of pancreatic cancer cells, Matrigel-based invasion assays using a modified Boyden chamber were carried out in T3M4 and Aspc-1 pancreatic cancer cell lines that exhibited relatively low MIA expression levels according to QRT-PCR and Western blot data. Added to the top chamber as described in 01) Fig. . To inveOne of the most devastating aspects of malignant growth is the emergence of cancer foci in organs distant from the primary tumor, with most cancer mortality being related to metastases. Thus, understanding the molecular mechanisms underlying the metastatic process is one of the most important issues in cancer research.Pancreatic cancer is characterized by aggressive local tumor growth and early systemic tumor spread -10. ManyAnother important aspect of the metastasis process is neo-angiogenesis. Angiogenesis itself encompasses a cascade of sequential processes emanating from microvascular endothelial cells, which are stimulated to proliferate, degrade the endothelial basement membranes of parental vessels, migrate, penetrate host stroma, and initiate a capillary sprout . NumerouMelanoma inhibitory activity (MIA) increases cell motility by decreasing the attachment of the cells to the extracellular matrix (ECM). Overexpression of MIA leads to increased metastasis of malignant melanoma cells by enhancing invasion and extravasation ,23. In tIn contrast to observations in malignant melanoma, where MIA has been established as a reliable marker for prognosis ,24, we cThe reason why high MIA mRNA levels lead to high serum levels in malignant melanoma, but not in pancreatic cancer, is currently not known. As to the possible role of MIA in pancreatic cancer pathogenesis, MIA had no effect on the proliferation of pancreatic cancer cells, similar to previous experiments employing fibroblasts, keratinocytes, endothelial cells and lymphocytes. The only cellular system in which MIA has been found to influence cell growth is melanoma cells; in these cells, MIA exerts anti-proliferative effects .Although MIA did not affect the growth of pancreatic cancer cells in vitro, its impact on the invasion was striking. Interestingly, promotion of invasiveness of pancreatic cancer contrasts the previously demonstrated decrease in the invasion of MIA-treated malignant melanoma cells . A possiIn conclusion, our study shows a striking overexpression of MIA in cancerous pancreatic tissues without consequent elevation of MIA in the circulation. Involvement of MIA in regulation of invasiveness of pancreatic cancer cells indicates that this protein may serve as a novel therapeutic target in the search for anti-metastatic drugs.Pancreatic cancer tissue samples were collected from 55 patients who underwent pancreatic cancer resection in the Department of General Surgery at the University of Heidelberg, Germany, and in the Department of Visceral and Transplantation Surgery at the University of Bern, Switzerland. Twelve cases were stage I, 13 cases stage II, 23 cases stage III, and 7 cases stage IV pancreatic adenocarcinomas, according to the Union International Contre Le Cancer (UICC) system. According to routine pathological grading, 16 cases were well-differentiated, 22 moderately differentiated, and 17 poorly differentiated. Normal pancreatic tissues were collected from 34 healthy organ donors. Pancreatic tissues were either frozen in liquid nitrogen and stored at -80\u00b0C (for RNA and protein extraction) or immediately fixed in 4% paraformaldehyde solution and subsequently embedded in paraffin. In order to determine MIA serum concentrations, sera from 50 pancreatic cancer patients  and healthy volunteers  were collected at the Department of General Surgery, University of Heidelberg, Germany. Written informed consent was obtained from all patients. The study was approved by the Ethics Committees of the Universities of Bern, Switzerland, and Heidelberg, Germany.2. For TGF-\u03b21 induction experiments, pancreatic cancer cells were seeded in 10 cm dishes in 10% FBS growth medium and allowed to attach for 12 hrs. Growth medium was replaced by serum-reduced medium (0.5% FBS), supplemented with 200 pM TGF-\u03b21 for the indicated time periods. For experimental hypoxia, cells were subjected to a hypoxic microenvironment by one hour-long flushing in a special incubator chamber with an anoxic gas mixture  and sealing of the unit.Mia PaCa-2, T3M4, Aspc-1, Bxpc-3, Capan-1, Colo-357, SU8686 and Panc-1 pancreatic cancer cells and B16 (cloneB78/H1) mouse melanoma cells were grown in RPMI 1640 medium containing 10% FBS , 100 U/ml penicillin and 100 \u03bcg/ml streptomycin . Cells were maintained in a 37\u00b0C humidified atmosphere saturated with 5% COAll reagents and equipment for mRNA/cDNA preparation were purchased from Roche Applied Science . mRNA was prepared by automated isolation using MagNA Pure LC instrument and isolation kits I (for cells) and II (for tissue). cDNA was prepared using a 1st strand cDNA synthesis kit for RT-PCR according to the manufacturer's instructions. Real-time PCR was performed with the Light Cycler Fast Start DNA SYBR Green kit . The numBriefly, consecutive paraffin-embedded tissue sections (5 \u03bcm thick) were deparaffinized and rehydrated. Antigen retrieval was performed by pretreatment of the slides in citrate buffer (pH 6.0) in a microwave oven for 10 min. Thereafter, slides were cooled to room temperature in deionized water for 5 min. After blocking of endogenous peroxidase activity with 0.3% hydrogen peroxide and washing in deionized water 3 times for 10 min, the sections were blocked for 1 h at room temperature with normal rabbit serum , then incubated with primary goat polyclonal anti-MIA antibody  overnight at 4\u00b0C. The slides were rinsed with washing buffer  and incubated with secondary rabbit anti-goat HRPO-labeled IgG , diluted 1:200 for 45 min at room temperature. After color reaction, tissues were counterstained with Mayer's hematoxylin. For negative control, appropriately diluted goat IgG was used instead of the primary antibody.The amount of secreted MIA protein in cell culture supernatants and serum samples was determined using a one-step MIA ELISA  according to the manufacturer's instructions.Cells were washed with ice-cold PBS and collected in lysis buffer  containing the Complete mini-EDTA-free protease inhibitor cocktail tablets from Roche . Lysates were centrifuged at 13,000 rpm at 4\u00b0C for 30 min, the supernatants were collected, and protein concentrations were measured with the BCA protein assay  using BSA as protein standard. 20 \u03bcg of protein were mixed with loading buffer, heated at 95\u00b0C for 5 min, separated on 12% SDS polyacrylamide gels, and transferred onto nitrocellulose membrane at 100 V for 90 min. Membranes were blocked in 5% non-fat milk in TBS-T  for 1 h, incubated overnight at 4\u00b0C with anti-MIA antibody  and exposed to secondary HRPO-labeled donkey anti-goat antibody (Santa Cruz) for 1 h at room temperature. The signal detection was performed using the ECL system .For immunoprecipitation, pancreatic cell lines (Mia PaCa-2 and SU8686) were suspended in lysis buffer  supplemented with the Complete-TM mixture of proteinase inhibitors  and incubated for 30 min on ice. After centrifugation, the supernatant was transferred into a fresh vial, pre-cleared with protein A-Sepharose beads (Santa Cruz) and incubated with 50 \u03bcl anti-MIA antibody  overnight at 4\u00b0C. Following addition of 30 \u03bcl of protein A-Sepharose for 1 h at 4\u00b0C, the mixture was pelleted, washed three times with lysis buffer, and resuspended in Laemmli sample buffer.Cell growth experiments were performed using the 3--2, 5-diphenyltetrazolium bromide (MTT) assay. Pancreatic cancer cells were seeded at a density of 5000 cells/well in 96-well plates, grown overnight, and then exposed to different concentrations of recombinant MIA protein as indicated. After 24 h, MTT was added (50 \u03bcg/well) for 4 hours. Formazan products were solubilized with acidic isopropanol, and the optical density was measured at 570 nm.4 cells were incubated for 24 h and subsequently treated with MIA (100 ng/ml) [Invasion assays were performed in a BD Biocoat Matrigel Invasion Chamber with 8-\u03bcm pore size  according to the manufacturer's instructions. The Matrigel was rehydrated with 500 \u03bcl DMEM (serum-free) and incubated in a 37\u00b0C, 5% CO2 atmosphere for 2 h. 5 \u00d7 100 ng/ml) , which wThe author(s) declare that they have no competing interests.JEF, NG, and AG carried out all the experiments, and participated in data analysis and interpretation. JK, MWB, and HF conceived of the study, and participated in its design and coordination. JK, NG, and AKB analyzed and interpreted the data and drafted the manuscript. All authors read and approved the final version."}
+{"text": "Porcine reproductive and respiratory syndrome virus (PRRSV) is the etiologic agent of PRRS, causing widespread chronic infections which are largely uncontrolled by currently available vaccines or other antiviral measures. Cultured monkey kidney (MARC-145) cells provide an important tool for the study of PRRSV replication. For the present study, flow cytometric and fluorescence antibody (FA) analyses of PRRSV infection of cultured MARC-145 cells were carried out in experiments designed to clarify viral dynamics and the mechanism of viral spread. The roles of viral permissiveness and the cytoskeleton in PRRSV infection and transmission were examined in conjunction with antiviral and cytotoxic drugs.Flow cytometric and FA analyses of PRRSV antigen expression revealed distinct primary and secondary phases of MARC-145 cell infection. PRRSV antigen was randomly expressed in a few percent of cells during the primary phase of infection (up to about 20\u201322 h p.i.), but the logarithmic infection phase (days 2\u20133 p.i.), was characterized by secondary spread to clusters of infected cells. The formation of secondary clusters of PRRSV-infected cells preceded the development of CPE in MARC-145 cells, and both primary and secondary PRRSV infection were inhibited by colchicine and cytochalasin D, demonstrating a critical role of the cytoskeleton in viral permissiveness as well as cell-to-cell transmission from a subpopulation of cells permissive for free virus to secondary targets. Cellular expression of actin also appeared to correlate with PRRSV resistance, suggesting a second role of the actin cytoskeleton as a potential barrier to cell-to-cell transmission. PRRSV infection and cell-to-cell transmission were efficiently suppressed by interferon-\u03b3 (IFN-\u03b3), as well as the more-potent experimental antiviral agent AK-2.The results demonstrate two distinct mechanisms of PRRSV infection: primary infection of a relatively small subpopulation of innately PRRSV-permissive cells, and secondary cell-to-cell transmission to contiguous cells which appear non-permissive to free virus. The results also indicate that an intact cytoskeleton is critical for PRRSV infection, and that viral permissiveness is a highly efficient drug target to control PRRSV infection. The data from this experimental system have important implications for the mechanisms of PRRSV persistence and pathology, as well as for a better understanding of arterivirus regulation. PRRSVin vitro -6. PRRSVin vitro ,8. Previin vitro ,8.The fate of PRRSV-infected MARC-145 cell cultures may include death of some cells by modified apoptosis  or necroin vitro [Previous studies have suggested that initial defenses against PRRSV are comprised of innate lung and alveolar macrophage responses ; subsequin vitro . Howeverin vitro ,16, and in vitro ,16.in vivo, but their potential to regulate PRRSV infection in certain experimental systems provides a rationale for PRRSV discovery research, and anti-PRRSV agents may be important tools for future drug development.The interaction of PRRSV with host cytokines is not well understood, but this area of study is a potential key to understanding host mechanisms during infection. Cytokines have not yet been exploited to control PRRSV infection The viral dynamics of another arterivirus, lactate dehydrogenase-elevating virus (LDV), are dominated by regulation of the LDV-permissive state; only a small fraction of mouse macrophages are susceptible to LDV infection, leading to an avirulent chronic infection in most mice which is maintained through development of newly-permissive cells . Viral pInitially, our goal was to better characterize the dynamics of PRRSV replication in MARC-145 cells. Using flow cytometry and fluorescence microscopy, we demonstrated logarithmic growth of PRRSV in MARC-145 cells, culminating over a period of 3\u20134 days in the death of most cells. Secondary spread of PRRSV infection was observed to be via cell-to-cell transmission, as demonstrated by emergence of clusters of PRRSV-infected cells in confluent monolayers of MARC-145 cells, which preceded PRRSV-induced CPE, were inhibited by colchicine and cytochalasin D, and correlated with reduced actin expression. PRRSV replication was sensitive to IFN-\u03b3 as well as AK-2, which was a relatively more potent PRRSV inhibitor and capable of suppressing both primary and secondary PRRSV infection. The results of this study demonstrate cell-to-cell spread of PRRSV in cultured MARC-145 cells, the dependence of PRRSV infection and transmission on an intact cytoskeleton, and highlight the role of the PRRSV-permissive state as a critical drug target, with important implications for future therapeutic and preventive strategies.When PRRSV replication was assessed in MARC-145 cells at 20\u201322 h p.i., only a small proportion of cells expressed PRRSV antigen, as determined by FA  phase of PRRSV infection was characterized by random targeting of PRRSV-permissive single cells , infection was present mainly in clusters containing multiple PRRSV-positive MARC-145 cells, routinely observed against a PRRSV-negative background of confluent cells  and data representative of numerous experiments are shown in Figure in vitro, actin expression was imaged using Alexa Fluor 594-phalloidin (red). Similar patterns of actin expression were observed in control uninfected  is shown in Figure In other studies, AK-2 pretreatment inhibited PRRSV antigen expression at 20\u201322 h p.i. by about 90% in primary pig macrophages, in each of two experiments. Similarly, pretreatment of primary mouse macrophages with recombinant murine AK-2 inhibited LDV replication by 86% in a single experiment. Thus, the anti-arterivirus effects of AK-2 are expressed over a broad host cell range.Observations were also made for the anti-PRRSV effect of IFN-\u03b3 pretreatment, which was demonstrated in previous studies to inhibit PRRSV replication . PRRSV iThe results of this study show that PRRSV replication in an experimental MARC-145 cell system is composed of two discrete phases: primary infection of a relatively small subpopulation of PRRSV-permissive cells during about the first 22 h p.i, followed by secondary cell-to-cell spread over the next several days to contiguous cells, resulting in formation of infected cell clusters and ultimately cell death/CPE by days 3\u20134 p.i. Flow cytometry of PRRSV infection of pig macrophages has previously been reported , but forin vitro, and soon thereafter in vivo, but there is little or no secondary virus replication after these events [in vivo, it could potentially help PRRSV resist antibody defenses and maintain persistence.These dynamics of PRRSV infection of MARC-145 cells stand in stark contrast to those of the related and relatively benign arterivirus LDV, since primary LDV infection of cultured mouse macrophages peaks at about 8 h p.i. e events . A likelOur studies show that PRRSV transmission to infected cell clusters is dependent upon cytoskeletal function, since the microtubule inhibitor colchine -28 as wein vitro system, potentially analogous to tissue sites in vivo. The viral dynamics from our studies are consistent with previous observations demonstrating infection of a small percentage of cells by day 1 p.i., which increases markedly over the next few days, culminating in peak supernant virus titers at about 72\u201396 h p.i. [50 contains multiple virions since the number of cells acutely infected can exceed the TCID50 dose and optimal infection is achieved at low M.O.I.  as previously reported . Future studies to clarify the relationship of M.O.I and TCID50 might help to determine what special characteristics facilitate primary permissiveness to free virus, which could include ability to bind one or more virions as well as biochemical factors regulating virus replication.Primary infection was dependent on an intact cytoskeleton, and nascent cluster initiation during this time frame was signified by the occasional appearance of infected cell doublets. Formation of secondary PRRSV-infected cell clusters was a function of time p.i. and the cell-to-cell distance, and is thus a physical property of the in vitro.Our data show that the logarithmic increase in the percentage of PRRSV infected cells over about 2\u20134 days p.i. is due to secondary cell-to-cell virus spread, from innately-permissive (reservoir) cells to surrounding uninfected cells. The foci of infection typically observed microscopically, in cultures of PRRSV-infected cells which begin to degenerate by 3\u20134 days p.i., are thus the outcome of secondary cluster infection and direct virus infection. These data reinforce that secondary spread to clusters in MARC-145 cells provides an important direction for future studies of PRRSV mechanisms, since cell-to-cell virus transmission  might heThe present results show that AK-2 is a potent inhibitor of arterivirus (PRRSV and LDV) replication. This is the first published report of the antiviral effects of AK-2, which suppresses viral permissiveness by activating an antiviral gene program , and which we exploited to supplement our studies of the IFN-\u03b3 response. Pretreatment was required for full expression of the drug effects, likely due to a lag phase for activation of the antiviral gene program. Both primary as well as secondary (cluster) PRRSV infection were susceptible to the antiviral actions of AK-2, but required optimal conditions of pretreatment for induction of the PRRSV-resistant state, and secondary PRRSV infection was controlled independently of primary infection by simultaneous or delayed drug exposure. IFN-\u03b3 was relatively less effective under our experimental conditions, but our IFN-\u03b3 data reinforce the conclusion that the viral-permissive state is an important drug target in PRRSV infection. This is also the case for LDV-mediated fetal infection ,50 and nPRRSV infection has been shown to spread by cell-to-cell transmission in a stable MARC-145 cell line. Two stages of viral infection have been identified: primary (innate) permissiveness to free-virus which appears in a relatively small percentage of cells, and secondary permissiveness to cell-to-cell transmission which is highly expressed and culminates in CPE. PRRSV infection of MARC-145 cells requires an intact cytoskeleton, but actin expression may also correlate with cell protection. Drugs such as AK-2 which induce a block in PRRSV permissiveness reveal a potentially important drug target for suppression of primary and secondary PRRSV infection.5 cells/culture) or 8-well glass slide chambers , and for the cell density studies, serial two-fold dilutions of the cells were used. Cells were inoculated with PRRSV at about 1\u20132 days after seeding (time to approximate doubling of the population).A stable and mycoplasma-free MARC-145 cell line was utilized in these experiments. Cells were cultured in DMEM containing10% fetal bovine serum, and for virus infections the medium was switched to MEM containing 2% horse serum. Cells for virus infections were grown to confluency in either T-25 flasks (seeded with about 5 \u00d7 1050).Pig cells were collected from 4\u20138 week old pigs by lung lavage with PBS -23. Cell5 TCID50 per ml) virus stocks from culture supernatants at 48\u201396 h p.i. PRRSV stocks were sequentially filtered through 0.45, 0.22, and 0.10 um filters and confirmed to be mycoplasma-free by testing on PPLO medium. As reported previously , maximum efficiency of PRRSV infection of MARC-145 cells occurs with low M.O.I as determined by TCID50, probably due to the presence of multiple virions per TCID50. For the present studies, M.O.I. of about 0.01 TCID50 (slide cultures) and 0.001 TCID50 (T-flask cultures) were found to result in near-optimal efficiency of infection, and were thus used for our studies unless otherwise noted in Results.PRRSV isolate SD-23983 was passaged on MARC-145 cells, preparing high-titer . MARC-1Peritoneal macrophages were collected from outbred ICR mice, seeded onto glass coverslips, and inoculated with a standard dose of LDV-P as described previously . LDV repin vitro efficacy, the microtubule inhibitor colchicine which binds to tubulin  or the microfilament disruptor cytochalasin D which depolymerizes actin  and actokine-2  were provided by Actokine Therapeutics. AK-2 is a cytokine-based experimental antiviral being developed by Actokine Therapeutics, which consists of recombinant normal human proteins comprising part of the mammalian cell response to virus infection . Soluble stocks of these agents were stored at 4\u00b0C in fetal bovine serum, which also served as the drug-vehicle control for the experiments, and were diluted 1:50 or 1:100 in medium to yield concentrations in cell cultures of about 1\u20132 ug/ml. As noted for individual experiments, cells were exposed to the drug or control treatments prior to PRRSV infection (pretreatment), during the course of PRRSV infection (delayed or post-treatment), or simultaneously with PRRSV infection. Based on previous studies of or 2 \u03bcM; -31) wereThe author(s) declare that they have no competing interests.WAC conceived and designed the study, carried out experiments, performed data collection and analyses, and drafted the manuscript. RGD was responsible for cell culture, carried out some of the fluorescence analyses, and contributed to the FACS analyses. GHW prepared AK-2, IFN-\u03b3, and control reagents and contributed to the experimental design. SS performed the FACS analyses. PWD carried out infection assays and performed some of the manual microscopic analyses. RRRR prepared pig macrophages, MARC-145 cells, and PRRSV for the project. EAN prepared the antibody reagent, MARC-145 cells, and PRRSV for the project. All authors made intellectual contributions to the study, and participated in the review and revision of the manuscript."}
+{"text": "Melanin pigments are ubiquitous in nature. Melanized microorganisms are often the dominating species in certain extreme environments, such as soils contaminated with radionuclides, suggesting that the presence of melanin is beneficial in their life cycle. We hypothesized that ionizing radiation could change the electronic properties of melanin and might enhance the growth of melanized microorganisms.C. neoformans cells relative to non-melanized cells, and exposure to ionizing radiation enhanced the electron-transfer properties of melanin in melanized cells. Melanized Wangiella dermatitidis and Cryptococcus neoformans cells exposed to ionizing radiation approximately 500 times higher than background grew significantly faster as indicated by higher CFUs, more dry weight biomass and 3-fold greater incorporation of 14C-acetate than non-irradiated melanized cells or irradiated albino mutants. In addition, radiation enhanced the growth of melanized Cladosporium sphaerospermum cells under limited nutrients conditions.Ionizing irradiation changed the electron spin resonance (ESR) signal of melanin, consistent with changes in electronic structure. Irradiated melanin manifested a 4-fold increase in its capacity to reduce NADH relative to non-irradiated melanin. HPLC analysis of melanin from fungi grown on different substrates revealed chemical complexity, dependence of melanin composition on the growth substrate and possible influence of melanin composition on its interaction with ionizing radiation. XTT/MTT assays showed increased metabolic activity of melanized Exposure of melanin to ionizing radiation, and possibly other forms of electromagnetic radiation, changes its electronic properties. Melanized fungal cells manifested increased growth relative to non-melanized cells after exposure to ionizing radiation, raising intriguing questions about a potential role for melanin in energy capture and utilization. Melanin is a high molecular weight pigment, ubiquitous in nature, with a variety of biological functions The term \u201cmelanin\u201d originates from The role of melanin in microorganisms living in high electromagnetic radiation fluxes is even more intriguing when the pigment is considered from a paleobiological perspective. Many fungal fossils appear to be melanized 4 Gy Despite the high prevalence of melanotic microorganisms in radioactive environments, it is unlikely that melanin is synthesized solely for the purposes of protection (shielding) from ionizing radiation. For example, in high elevation regions inhabited by melanotic fungi the background radiation levels are approximately 500\u20131,000 higher than at sea level, which amounts to a dose of 0.50\u20131.0 Gy/year. Since the overwhelming majority of fungi, melanized or not, can withstand doses up to 1.7\u00d710Cryptococcocus neoformansC. neoformans which becomes melanized when grown in presence of a melanin pre-cursor such as L-dopa    and Cladarvation .C. neoformans is amenable to HPLC analysis C. neoformans melanins. The HPLC of oxidized C. neoformans melanin revealed PTCA and TDCA peaks  melanin.In order to investigate the influence of the chemical composition of melanin on its interaction with ionizing radiation, we performed high performance liquid chromatography (HPLC) analysis of melanins from the different fungi used in this study. It must be noted that the structures of both synthetic CA peaks  and the ospermum  and by Watitidis  were cheC. neoformans dry melanin \u201cghosts\u201d after they were subjected to 0.3 kGy irradiation and subsequently suspended in water (Electron spin resonance spectroscopy (ESR) of melanized fungi showed the presence a stable free radical population  in each C. neoformans melanin for 20 and 40 min with 14 Gy/min from a 137Cs source and measured its electron transfer properties in the coupled oxidation of NADH and reduction of ferricyanide. In this system, melanin acts as an electron-transfer agent To quantify the effects of ionizing radiation and other forms of electromagnetic radiation on the electron transfer properties of melanin \u2013 we irradiated dry C. neoformans cells was evaluated with 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide (XTT assay) C. neoformans cells were exposed to ionizing radiation in the dark at 22\u00b0C overnight. The irradiation was performed in a constant field of 0.05 mGy/hr, a non-fungicidal radiation dose that is comparable to the doses inside the Chernobyl reactor We investigated whether the changes in electron transfer properties of melanin post exposure to ionizing radiation  or 30\u00b0C. Melanized cells demonstrated increased XTT reduction activity at both temperatures in comparison with non-melanized controls , and incC. neoformans cells supplied with limited nutrients and placed into the radiation flux. To maintain a steady population of melanized cells, we used the same H99 strain of C. neoformans as in XTT/MTT experiments since it is capable of making melanin when maintained with L-Dopa while its laccase disrupted [Lac(-)] mutant is incapable of melanization de novo in the dividing melanized irradiated cell culture. In this regard, a cell diameter that is one-half to one-third of that for a mature cell results in a 8- and 26-fold decrease in cell mass, respectively. Quantification of whole cell sizes using India ink stained cells showed that proximately 50% of melanized irradiated cells had volumes 2 times smaller than those in the irradiated Lac(-) mutant population (results not shown), accounting for the relatively small increase in the dry weight of the melanized H99 samples in comparison to their larger increase in CFUs.To expand the observations of the influence of irradiated melanin on the growth of melanized cells, we measured the growth of melanized and non-melanized 14C-labeled carbon source (acetate) into melanized and non-melanized C. neoformans cells with and without radiation flux. In the photosynthesis field the incorporation of 14C-acetate in bacteria subjected to visible light is considered to be indicative of their photoheterotrophic capabilities 14C-acetate by wild type H99 compared to Lac(-) cells  H99 cells were incubated with 14C-acetate with and without radiation \u2013 there was almost 3 times more incorporation of 14C-acetate into irradiated melanized cells than into non-irradiated melanized cells, while the ratio of 14C-acetate incorporation into irradiated to non-irradiated Lac(-) cells was only slightly higher than 1  cells . There wr than 1 . OverallC. neoformans which must be supplied with laccase substrate like L-Dopa for melanization - both C. sphaerospermum and W. dermatitidis synthesize melanin without the need for exogenous precursors. Initially we selected C. sphaerospermum because this fungus is a dominant species inhabiting the damaged reactor at Chernobyl C. sphaerospermum was placed in a constant radiation field of 0.05 mGy/hr and colony diameters were measured for 15 days. We supplemented water agar with minimal media containing sources of carbon and mineral salts, and, in one condition, - with a limited amount of sucrose  generation of non-melanized cells required tricyclazole, a compound that could arguably affect other metabolic processes; and 2) this fungus is a mold and its hyphal cells aggregated and this precluded measuring growth by standard CFUs. Although the results showing larger colony radial growth were strongly suggestive of increased fungal mass, larger colonies could conceivably have resulted from differences in cellular packing or swelling. Consequently, we used a third organism to study the effect of irradiation on melanized fungal growth. Wangiella dermatitidis, an intrinsically melanized human pathogenic fungus that exists predominantly as a yeast form in vivo and at 37\u00b0C, was selected for further study since an albino strain of W. dermatitidis  and its complemented strain (wdpks1\u0394-1-501) recently became available C. sphaerospermum, allowed us to quantify the effect of radiation on cell growth by CFUs instead of measuring colony diameters.The W. dermatitidis cells to ionizing radiation resulted in significantly more cells being produced, as measured by CFUs, for the melanized strains (P<0.01) than for the non-irradiated melanized control cells or the irradiated wdpks1\u0394-1 albino mutant strain  increase in dry weight for melanized wild type and complemented strains in comparison with non-irradiated controls. As for C. neoformans - the lower percentage increase in dry weight in comparison with the percentage increase in CFUs  can be explained by the fact that 50% of the cells in the melanized cultures were newly formed with volumes 2 times lower (results not shown) than that of the irradiated more mature albino cells.Exposure of t strain . At 16, t 16 hrs . Wild tyt 16 hrs  in compaTo investigate the influence of ionizing radiation on the electron-transfer properties of melanin and on the growth of melanized fungi, we performed multiple physico-chemical tests and in vivo experiments with 3 genetically diverse fungi. HPLC results which reveal the chemical structure of melanin from different fungi are important for understanding the electronic properties of melanin. The number of electrons per gram is an important contributor to the attenuation properties of a material at the energy levels where the Compton effect predominates The high-energy electrons generated by Compton scattering are ultimately responsible for the radiobiologic effects caused by gamma radiation by either direct interaction with DNA or through radiolysis of water in the cells, a process that results in the formation of reactive short-lived free radicals capable of damaging DNA. Stable free radicals in melanin may interact with these high-energy electrons and prevent them from entering a cell, thus enabling melanin to function as a radioprotector. The Compton electrons may then undergo secondary interactions with melanin molecules with their energy gradually lowered by melanin.14C-acetate into irradiated and non-irradiated melanized C. neoformans cells and its non-melanized Lac(-) mutant, we noted that non-irradiated Lac(-) cells grew better and incorporated more 14C-acetate than non-irradiated melanized cells (14C-acetate incorporation of irradiated Lac(-) cells at 23 and 30 hr is probably due to the well documented phenomenon that very low doses of ionizing radiation can stimulate cell proliferation 14C-acetate in irradiated melanized cells than in non-irradiated melanized controls, while irradiation of Lac changes the electronic structure of melanin post radiation exposure as measured by amplitude changes in the ESR signal; 2) electron transfer properties of melanin in the NADH oxidation/reduction reaction increased 4-fold after melanin irradiation. The ability of radiation to preferentially enhance the growth of melanized fungi is implied by the following observations made in this study: melanized C. cladosporioides manifests radiotropism by growing in the direction of radioactive particles and this organism has become widely distributed in the areas surrounding Chernobyl since the nuclear accident in 1986 The literature already contains some indirect evidence for the notion that radiation can enhance the growth of melanized microorganisms. For example, the melanotic fungus C. neoformans H99 and its laccase lacking mutant Lac(-)  were used in all experiments. C. neoformans was grown in Sabouraud dextrose broth  for 24 hrs at 30\u00b0C with constant shaking at 150 rpm. Melanized C. neoformans cells were generated by growing the fungus in minimal medium with 1 mM 3,4-dihydroxyphenylalanine (L-dopa) for 5\u201310 days. C. sphaerospermum , an intrinsically melanized fungus, was grown on potato dextrose agar  for 15 days. Approximately 1,000 C. sphaerospermum cells were plated on different media: water agar impregnated with minimal media (no glucose) and casein; agar dissolved in minimal media (no glucose) and 40 g/L dextrose; potato dextrose agar ; potato dextrose agar impregnated with 25 ug/mL tricyclazole; and Sabaroud dextrose agar. The laboratory wild-type strain of intrinsically melanized W.\u00a0dermatitidis 8656 {ATCC 34100 [Exophiala dermatitidis CBS 525.76]} a strain with a disrupted polyketide synthase gene wdpks1\u0394-1, and its complemented isolate (wdpks1\u0394-1-501) were a kind gift from Dr. P. Szaniszlo . Routine propagation of these strains was in YPD  at 37\u00b0C with shaking at 150 rpm.American Type Culture Collection  strain Trichoderma harzarium  were added to the suspension at 10 mg/mL and the suspensions were incubated overnight at 30\u00b0C. Protoplasts were collected by centrifugation, and incubated in 4.0 M guanidine thiocyanate overnight at room temperature. The resulting particulate material was collected by centrifugation, and Proteinase K (1.0 mg/mL) in reaction buffer  was added to the particles followed by overnight incubation at 37\u00b0C. The particles were boiled in 6.0 M HCl for 1 hour. Finally, the resulting material (\u201cghosts\u201d) was washed with PBS, dialyzed against deionized water for 2 days and dried in air at 65\u00b0C overnight.Fungal cells were suspended in 1.0 M sorbitol-0.1 M sodium citrate (pH 5.5). Lysing enzymes from C. neoformans, C. sphaerospermum and W. dermatitidis \u201cghosts\u201d or cells were frozen under high pressure using a Leica EMpact High Pressure Freezer . Frozen samples were transferred to a Leica EM AFS Freeze Substitution Unit and freeze substituted in 1% osmium tetroxide in acetone. They were brought from \u221290\u00b0C to room temperature over 2\u20133 days, rinsed in acetone and embedded in Spurrs epoxy resin . Ultrathin sections of 70\u201380 nm were cut on a Reichert Ultracut UCT, stained with uranyl acetate followed by lead citrate and viewed on a JEOL  1200EX transmission electron microscope at 80 kV.Samples were processed at the Analytical Imaging Facility, AECOM. The 18 column , and Shimadzu SPD-6AV UV detector. The mobile phase was 0.1% trifluoroacetic acid in water (solvent A) and 0.1% trifluoroacetic acid in acetonitrile (solvent B). At 1.0 mL/min, the elution gradient was : 0, 0; 1, 0; 12, 25; 14, 25; 16, 0. The UV detector was set at a 255 nm absorbance.The melanin \u201cghosts\u201d were subjected to acidic permanganate oxidation as described in The major peaks generated during chromatography of oxidized melanins were collected and analyzed by MALDI-TOF mass spectrometry in positive pressure mode on PE-Biosystems Mariner mass spectrometer. A peptide mixture with molecular weights of 1059.56, 1296.68 and 1672.95 in 2,5-dihydroxybenzoic acid matrix was used for calibration.C. neoformans \u201cghosts\u201d were also obtained in dry state before irradiation with 0.3 kGy and the \u201cghosts\u201d were subsequently suspended in water and ESR was repeated.The ESR of melanin \u201cghosts\u201d was performed on ER 200D EPR/ENDOR spectrometer with ESP 300 upgrade . ESR spectra were obtained by suspending \u201cghosts\u201d in water. ESR spectra of C. neoformans melanin was used in the reactions; dry melanin was subjected to 20 and 40 min irradiation with the 137-Cs source at a dose rate of 14 Gy/min; put into dry ice following irradiation and taken up in the ferricyanide solution immediately before measurements.The ability of melanin to oxidize or reduce NADH and ferricyanide was determined spectrophotometrically as in C. neoformans cells were washed, suspended in PBS and their concentration was adjusted to 108 per mL. To account for the possibility of melanin itself changing the reaction through electron transfer or solubility/retention of formazan product 7 cells were placed into the wells in 96 well plates, 5 wells per each condition. The plates were covered with foil to exclude any light effects and incubated overnight at room temperature (22\u00b0C), at 30\u00b0C, or at 22\u00b0C in a constant radiation field of 0.05 mGy/hr. For XTT -5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) assay 54 \u00b5L (XTT)/menadinone was added to each well, the plates were covered with foil, shaken for 2 minutes, and incubated at 37\u00b0C for 2 hrs. The absorbance was read at 492 nm . For MTT -3,5-diphenyl-2H-tetrazolium bromide) assay, the MTT solution in PBS was added to the wells with the cells, so that the final MTT concentration became 0.5 mg/mL. After incubation at 37\u00b0C, the contents of the wells was spun down at 2,000 rpm, supernatant was discarded, followed by addition of 200 \u00b5l 0.04 M HCl in absolute isopropanol to each sample. The samples were transferred into the 96-well plate and the absorbance was read at 550 nm.Melanized and non-melanized 3, 1 g/L K2HPO4, 1 g/L MgSO4.7H2O, 0.5 g/L KCl, 0.003 g/L thiamine, 5.3 g/L NH4Cl), pelleted and taken up in 1 mM Na acetate solution in essential salts spiked with 0.1 \u00b5Ci/mL 14C-acetate. The cell concentration was adjusted to 105 cells/ml, 1 mL samples of each strain were placed in 1.5 mL Eppendorf tubes (4 samples per time point) and subjected either to the background level of radiation or to a radiation field of 0.05 mGy/hr created by 188Re/188W isotope generator for up to 30 hr at 30\u00b0C. The cell uptake of 14C-acetate was quantified by counting the tubes in a scintillation counter, spinning cells, separating supernatant and counting the cell pellet again. The cells were also plated for CFUs. For dry weight experiments 5 mL of cells at 4\u00d7107 cells/mL cell density were irradiated for 20 hr at 30\u00b0C, filtered through pre-weighed 0.2 \u00b5 filters, the filters were dried and weighed again.H99 wild type and Lac(-) mutant cells were grown as above. Melanization of H99 was achieved by incubation in 1mM L-Dopa/minimal medium (1/200) in the dark at 30\u00b0C, at 150 rpm. The cells were washed with essential salts solution . The colonies were counted and measured daily.Melanized and non-melanized (tricyclazole-treated) W. dermatitidis were cultured in the following manner using the modified procedure from 6 cells/mL and grown for another 48 hrs. At the end of the 2nd 48 hr period both wild type and complemented strains developed dark coloration while albino mutant cells were light yellow. The cells were again diluted to 106 cells/mL and cultured for 24 hrs, and this procedure was repeated once. Next, the cells were again diluted and grown for 24 hours in minimal chemical media  supplemented with 120 mg/L sucrose as a carbon source. The wild type and complemented strains maintained their dark color and the albino mutant remained light yellow. The cells were collected, washed, and diluted to 5\u00d7105 cells/mL in the minimal medium. One ml aliquots in 1.5 ml microfuge tubes were placed at 37\u00b0C in the dark without shaking, either in the cell incubator with the background level of radiation or in a radiation field of 0.05 mGy/hr created by 188Re/188W isotope generator. For each time point, triplicate samples were used. After 16, 22 and 30 hrs of exposure the cells were plated on YPD agar for 4 days at room temperature for determination of CFUs. The cells entered stationary phase around 30 hrs. For dry weight determinations, 20 mL of each strain in essential salts solution supplemented with 120 mg/mL sucrose at cell density of 107 cell/mL were irradiated for 20 hrs or kept at background radiation level then filtered through pre-weighed 0.2 \u00b5 filters that were dried and weighed again.Before radiation exposure, wild type, albino mutant and complemented strains of 14C-acetate uptake. Differences were considered statistically significant when P values were<0.05.Wilcoxon non-parametric test for unpaired data was performed to analyze the differences in CFUs and"}
+{"text": "Escherichia coli exceeded 98.5%.Many studies involving interacting microorganisms would benefit from simple devices able to deposit cells in precisely defined patterns. We describe an inexpensive bacterial piezoelectric inkjet printer (adapted from the design of the POSaM oligonucleotide microarrayer) that can be used to \u201cprint out\u201d different strains of bacteria or chemicals in small droplets onto a flat surface at high resolution. The capabilities of this device are demonstrated by printing ordered arrays comprising two bacterial strains labeled with different fluorescent proteins. We also characterized several properties of this piezoelectric printer, such as the droplet volume (of the order of tens of pl), the distribution of number of cells in each droplet, and the dependence of droplet volume on printing frequency. We established the limits of the printing resolution, and determined that the printed viability of  Other examples include printing of bacterial coloniesBesides commercial printing of ink on paper, there are many other useful applications of inkjet technology. In the electronics industry, inkjet printing finds use in printing electronic circuits using conductive polymer \u201cinks\u201dThere are two main classes of inkjet printers, thermal and piezoelectric. In thermal inkjets, a resistive heating element causes air bubbles to expand, expelling a liquid drop. In piezoelectric inkjets, voltage-induced deformation of a rectangular piezoelectric crystal squeezes ink droplets through the nozzle. POSaM employs piezoelectric inkjets because they are able to print a wider variety of solvents and because they are easier to clean.We have adapted POSaM to create a simple piezoelectric printer for patterning bacteria onto a substrate such as a glass slide, agar plate, or nitrocellulose membrane. Our motivation for developing a bacterial inkjet printer is to enable precise control of the spatial arrangement of interacting microbial strains. For example, different strains could be patterned in lattices, grids, rows, or other geometries. Inkjet printing not only allows us to vary the spacing of such arrangements, but also allows higher inter-drop resolution than nl dispensers because of the small drop volumes . Automated control of printing would result in reproducible initial conditions important for the quantitative analysis of patterned growth on agar surfaces or membranes.Previously, colony arrays of a single bacterial strain have been printed using thermal inkjetsOur printing system, based on the POSaM designwww.bioinformatics.org/pogo/.The electronics consists of a multifunction data acquisition (DAQ) board and a circuit board. Digital waveforms generated by a DAQ board, AT-DIO 32HS , were converted to trapezoidal pulses by the circuit board electronics with a maximum height 30V. These waveforms drive the piezoelectric crystals inside the printhead to produce drops. The circuit board is a simplified version of the electronics of the POSaM project which implements waveform generation, droplet detection, and solenoid array controls. The DAQ board also sends digital pulses to the motorized stage controller prompting it to move to the next coordinate in preprogrammed raster patterns. The cable connecting the printhead to the electronics was obtained by scavenging an Epson Stylus 700 printer. Software which controls the electronics was written in Visual Basic 6.0 and contains custom routines for printing patterns by directing stage motion, enabling droplet formation from arbitrary nozzles, and generating arbitrary voltage waveforms. The POSaM software was used as a starting point. It is freely available at The solution to be printed  is loaded into a 5 ml septa-capped vial (Fisher Scientific). A rack secured close to the printhead can hold six of these vials. A 0.032\u201d outer diameter, 2\u201d long stub needle  pierces the septum down to the bottom of the vial and is connected to 0.030\u201d inner diameter silicone tubing , ending with a tubing adapter  to the printhead inlets. A syringe and two 25 gauge needles that pierce the septa are used to prime the nozzles. One needle attached to the syringe applies pressure while the second needle is temporary sealed. During priming, air pressure generated within the syringe causes large droplets or jets to be expelled through the printhead nozzles. Removing the temporary seal releases the pressure to equalize with atmospheric and then nozzle surfaces are wiped clean with a lintless towel. A cleaning procedure is used between printing sessions which consists of flushing nozzles and the tubing with acetone and then air drying.After repeated use, it is difficult to ensure that all the nozzles will fire after priming the printhead so they must be individually tested. Nozzles usually fail permanently if they are clogged, or temporarily if either an air bubble enters the nozzle or if liquid pools underneath the nozzle. Such hanging droplets may be due to pressure differences between the vial and the nozzle. After priming, it is important to inspect the inkjet head to ensure that hanging drops are not forming, since these prevent drops from falling onto the substrate. Individually functioning nozzles were identified using one of two droplet detection schemes. The first method used was to print a thousand droplets from individual nozzles onto parafilm or a piece of paper. A visible droplet or a colored spot can then identify functional nozzles. The second method we used to identify functional nozzles was to print a pattern of columns with colored solutions onto a piece of paper. Missing columns are associated with malfunctioning nozzles.E. coli strain MG1655. Fluorescent cells were constructed by transforming plasmids pZS*2R-CFP, pZS*2R-GFP, or pZS*2R-Venus. These plasmids are based on the low-copy pZS* vector seriesfimA gene which encodes the main structural protein of fimbriae allowing bacteria to stick to surfaces and of the flu gene which encodes the Ag43 auto-aggregation protein.The strains printed are derived from wild type To determine how well the printer could be calibrated, we measured drop volumes by three different methods. The first method consisted of direct counting under the microscope of the number of beads or cells inside droplets printed from a solution of known concentration. The second method consisted of weighing 500,000 drops and then dividing the mean weight of one droplet by the density of water. The third method was to print a fluorescent solution, e.g. of fluorescein droplets, fluorescent cells, or fluorescent beads, and compare the fluorescence of 100,000 printed droplets (\u223c3 \u00b5l) to a standard calibration curve of fluorescence versus volume. Fluorescence measurements were performed in multiwell plates using a Wallac Victor2 fluorimeter (PerkinElmer).A matrix encoding the locations where each strain is to be printed was created by our printing software. The motorized stage was programmed to move in a raster pattern, and at each point, a nozzle from the first bank was activated if strain 1 was to be printed at the current location. The stage was then homed and shifted by an offset (accounting for the distance between different banks) and the stage was moved again, this time firing the nozzle from the second bank to print strain 2 when appropriate.Slight variations in nozzle shapes may lead to small angular deviations of the droplet trajectory. For example, at a substrate distance of 5 mm, a 1\u00b0 angular deviation would result in a (5 mm)(tan1\u00b0)\u200a=\u200a43.6 \u00b5m horizontal displacement. Therefore, the offset was fine-tuned when the distance from the nozzle to the substrate caused significant droplet deflection. For immediate visual feedback of printing accuracy, we typically added a colored dye to the bacterial solutions. Ink for normal desktop printing on paper, Generations Micro-Bright Ink , was originally used because the dye did not spread after printing, but this ink was found to have negative effects on cell viability. We determined that these three inks have a negligible effect on cell viability at the following concentrations: 2.5 mg/ml Allura Red, 2.0 mg/ml Bromophenol Blue, and 0.5 mg/ml Xylene Cyanol.Phase contrast and fluorescence images of cells in individual droplets were acquired with a Retiga EXi CCD camera (QImaging) attached to a Zeiss Axiovert 200M microscope. Images were analyzed for cell counts and cell positions using ImagePro (Media Cybernetics). Images of fluorescent colonies patterned on agar plates were acquired using a Typhoon 9400 fluorescent scanner (GE Amersham Biosciences). The resolution of an array pattern was determined by extracting colony locations using ImagePro. The position data were the analyzed in Matlab  as follows. For each row, end colonies were assumed to be in position. The absolute horizontal deviations of all the colonies between the end colonies from an even spacing were determined and averaged over several rows. The y deviation was assumed to be the same as the x deviation.The piezoelectric printer is outlined in block diagram form in E. coli, single droplets of a fresh overnight culture of MG1655 + pZS*2R-GFP were printed onto an agar plate. Using phase contrast and fluorescence microscopy, 273 cells were tracked for three hours during growth at 30\u00b0C. The fluorescence allowed us to distinguish between live cells and lysed cells or dust, but phase contrast was sufficient to identify all the growing cells. et. al determined that over 92% of mammalian cells were viable after being printed through a thermal inkjet printheadLarge shear forces are present when droplets exit the printer which may harm the bacteria. In order to test the viability of piezoelectrically printed fluorescent c, the average number of cells per droplet n\u0305, and the droplet volume dV are related byThe droplet volume generated by a piezoelectric inkjet depends on factors such as the nozzle geometry, the shape of the voltage waveform applied to the piezo, actuation waveform frequency, solvent viscosity, and solvent surface tension. The average concentration of cells in printed droplets n cells per drop with an average of n\u0305 isThe first method we used to estimate drop volume is based on a simple assumption that the number of cells counted per droplet is expected to produce a Poisson distribution, where the probability of finding To test this assumption, samples containing fluorescent GFP-expressing cells at four different optical densities, were printed onto glass slides. The stage moved after each drop, so the printing rate was 1 drop every 0.1 seconds. For each sample, the number of cells per droplet was measured by microscopy for 100 different droplets . The expdV by dividing the measured mean cells per droplet by the known cell concentration. The correspondence between cell density and optical density was calibrated by counting bacteria via flow cytometry. At an optical density of 0.71 the cell density measured on a flow cytometer was 1.07\u00b10.11\u00d7109 cells/ml. Below this cell density, OD600 was found to be linear with cell density by successive two-fold dilutions dr \u221d rdr. This form predicts a linear increase in the frequency of cells at a radius r from the origin up to the average radius of a droplet. The observed distribution may indicate a slight preference of cells to be pushed towards the perimeter. Smaller satellite droplets  were printed with 10 drops per location at an approximate density of 10 cells per droplet. A series of lined patterns were printed to determine the smallest spatial resolution possible. We also demonstrated the possibility of printing more complex patterns, such as a checkerboard shown in The two strain patterns in E. coli or fluorescein drops at 10 kHz. We obtained the mean drop volume by printing 500,000 drops and either weighing the printed volume or measuring the fluorescence of the printed volume and using the calibration curve. For such high speed printing we found the drop volume was 30.6\u00b18.7 pl by direct weighting (116 weighing measurements), and 30.2\u00b12.7 pl in an experiment of fluorescein droplet fluorimetry.To investigate drop properties when printed at high frequency, we printed fluorescent For low speed printing, on the other hand , the meaThe current design can be improved in several ways. The motorized stage was the limiting factor to printing speed due to specifics of the controller. Alternative stages could be used or built at even lower cost. A motorized z-axis would also be useful for precisely raising and lowering the inkjet printhead assembly so that the height of the nozzles relative to the substrate could be more reproducibly controlled. This could be of some concern because at large enough distances (>5mm), droplet deflection may become significant, thereby degrading printing resolution. In addition, the relatively expensive DAQ card could be replaced with a simple, high-speed microcontroller such as the Atmel AVR or Microchip PIC which would considerably reduce the cost of the electronics.Our bacterial piezoelectric inkjet printer should find many applications such as synthetic biology and model \u201cecological\u201d studies involving microbes. For example, multicellular systems of engineered bacterial strains can display interesting spatial patterns of gene expression"}
+{"text": "Nasopharyngeal carcinomas (NPC) are consistently associated with the Epstein-Barr virus (EBV). Their malignant epithelial cells contain the viral genome and express several antigenic viral proteins. However, the mechanisms of immune escape in NPCs are still poorly understood. EBV-transformed B-cells have been reported to release exosomes carrying the EBV-encoded latent membrane protein 1 (LMP1) which has T-cell inhibitory activity. Although this report suggested that NPC cells could also produce exosomes carrying immunosuppressive proteins, this hypothesis has remained so far untested.Malignant epithelial cells derived from NPC xenografts \u2013 LMP1-positive (C15) or negative (C17) \u2013 were used to prepare conditioned culture medium. Various microparticles and vesicles released in the culture medium were collected and fractionated by differential centrifugation. Exosomes collected in the last centrifugation step were further purified by immunomagnetic capture on beads carrying antibody directed to HLA class II molecules. Purified exosomes were visualized by electron microscopy and analysed by western blotting. The T-cell inhibitory activities of recombinant LMP1 and galectin 9 were assessed on peripheral blood mononuclear cells activated by CD3/CD28 cross-linking.HLA-class II-positive exosomes purified from C15 and C17 cell supernatants were containing either LMP1 and galectin 9 (C15) or galectin 9 only (C17). Recombinant LMP1 induced a strong inhibition of T-cell proliferation (IC50 = 0.17 nM). In contrast recombinant galectin 9 had a weaker inhibitory effect (IC50 = 46 nM) with no synergy with LMP1.This study provides the proof of concept that NPC cells can release HLA class-II positive exosomes containing galectin 9 and/or LMP1. It confirms that the LMP1 molecule has intrinsic T-cell inhibitory activity. These findings will encourage investigations of tumor exosomes in the blood of NPC patients and assessment of their effects on various types of target cells. Nasopharyngeal carcinoma (NPC) is a human epithelial malignancy which represents a major threat for public health in several areas of the world . Very hiEBV-infection in NPC cells is predominantly latent. Several copies of the EBV genome (about 170 kb) are contained in the nuclei of malignant cell. Most of the about 80 EBV genes are silenced but several immunogenic viral proteins are consistently expressed in NPCs, including EBNA1 (Epstein-Barr nuclear antigen 1), LMP1 (latent membrane protein 1), LMP2 and the BARF1 protein . Most ofSo far the mechanisms of local immune escape in NPCs have remained poorly understood. One clue has been provided by studies on EBV-transformed B-cells which release exosomes containing the EBV-encoded LMP1 in the extra-cellular medium ,15. BothThis study was designed to address the hypothesis of a possible production of exosomes containing LMP1 and/or galectin 9 by malignant NPC cells. We report that LMP1-positive NPC cells release HLA-class II-positive exosomes containing both LMP1 and galectin 9 whereas LMP1-negative NPC cells release exosomes containing only galectin 9. Since both LMP1 and galectin 9 are known to have effects on immune response mechanisms, these observations are likely to improve our understanding of host-tumor relationships in NPC and possibly in Hodgkin's disease.6 cells/well in 1.5 ml RPMI culture medium supplemented with 1.5% fetal calf serum and 5 mM Hepes. Collected supernatants were clarified by centrifugation at 300 g for 10 min and frozen at -80\u00b0C prior to differential centrifugation. Collected 300 g cell pellets were also stored at -80\u00b0C.C15 and C17 are EBV-positive NPC tumor lines permanently propagated by subcutaneous passage into nude mice . SuspensCS1-4  is a pool of 4 MoAbs directed to the C-terminal part of LMP1; it was used under the form of hybridoma culture supernatant, as provided by the manufacturer . GalectiCell pellets were dissolved in pre-chilled RIPA buffer  supplemented with Complete protease inhibition mixture  and sonicated. Extracts were then clarified by centrifugation for 15 min at 10,000 g at 4\u00b0C. Protein concentration was assayed by the Lowry method using a detergent-compatible micro-assay system . Western blotting was performed on PVDF membranes  according to standard protocols, using HRP-conjugated secondary antibodies and the ECL system .NPC cell conditioned media were subjected to sequential centrifugations. Following each centrifugation step, the pellet was collected for further analysis, and the supernatant was used for subsequent centrifugation. In addition to the initial 300 g step made prior to freezing and storage, culture supernatants were centrifuged twice at 1200 g (10 min) and then once at 10,000 g (30 min), 40,000 g (60 min) and 100,000 g (60 min) using a Beckman XL-80 ultracentrifuge with a SW41 or SW27 rotor. Pellets were named according to their order in the separation process from P1 (300 g) to P6 . When required, several procedures of differential centrifugation were performed in parallel. All pellets collected at the same step were resuspended in 500 \u03bcl serum free culture medium, pooled and pelleted again by ultracentrifugation using a TL-100 Beckman rotor . Using this approach, as much as 120 ml of culture supernatant were routinely processed in one experiment yielding approximately 100, 80 and 180 \u03bcg proteins for P4, P5 and P6 respectively. For Western blot analysis, representative pellets of each separation step were dissolved in RIPA buffer (30 to 100 \u03bcl), sonicated and clarified as indicated for cell protein extraction. An aliquot of each protein extract was used to assay protein concentration prior to gel separation. For electron microscopy analysis, pellets P4, P5 and P6 were submerged and aggregated in the glutaraldehyde solution. For immunomagnetic isolation of exosomes, pellet P6 was resuspended in 400 \u03bcl culture medium.7 magnetic beads carrying an anti-HLA class II monoclonal antibody in 500 \u03bcl serum-free culture medium, under mild agitation . The same type of magnetic beads carrying an irrelevant monoclonal IgG were used as control beads . Following the capture step, magnetic beads were washed 4 times in 1 ml PBS. For electron microscopy analysis, loaded beads were resuspended in the fixative solution. For Western blot analysis of captured material, loaded beads were boiled 5 min in Laemmli buffer in order to release proteins for gel separation.A resuspended P6 pellet derived from 60 ml conditioned medium was incubated for 5 h at 4\u00b0C, with 3.5 \u00d7 10Cell or microparticle pellets were fixed 1 h with 1.6% glutaraldehyde at 4\u00b0C, washed and fixed again in aqueous 2% osmium tetroxide, then dehydrated and embedded in epon resin. Ultrathin sections were cut on an LKB-III ultra-microtome, stained for contrast with uranyl acetate and lead citrate and examined with a Zeiss EM 902 transmission electron microscope.For visualisation of exosomes following immunomagnetic purification, loaded beads were fixed for 1 hour at 4\u00b0C in 1.6% glutaraldehyde in phosphate S\u00f6rensen buffer 0.1 M, pH 7.3, and washed 3 \u00d7 20 min in Phosphate buffer. They were subsequently resuspended in 4% agar, fixed 1 hour at room temperature with 2% osmic acid  and washed in water. Samples were then dehydrated using increasing percentages of ethanol : 70% (30 min), 80% (20 min), 95% (30 min), 100% (1 hour). Finally they were included in Epon by progressively mixing Epon with ethanol. Polymerisation was made at 60\u00b0C for 48 hours. Ultrathin sections were cut with a Reichert Ultramicrotome III and counterstained with uranyl acetate and lead citrate.Full length LMP1 (LMP1) was produced in recombinant baculovirus-infected Sf9 cells and purified by immuno-affinity chromatography as previously described ,30. His-5 cells were mixed with 17 000 beads in 200 \u03bcl RPMI medium with 10% FCS. During the last 8 h, 3.7 \u00d7 104 Bq [3H] thymidine was added per well. The cells were harvested onto fibreglass filters and [3H] thymidine incorporation was determined by liquid scintillation counting.The ability of several recombinant proteins to antagonize peripheral blood T-cell activation and proliferation was assessed on PBMCs  stimulated with anti-CD3/anti-CD28 beads. These beads are potent activators of peripheral blood resting T-cells . PBMCs were mixed with stimulating beads and candidate inhibitory proteins and then seeded in 96-well round-bottom culture plates. In each well, 1 \u00d7 10in vitro growth of NPC cells derived from clinical specimens. However, two xenografted NPC tumor lines were obtained in our laboratory and have been extensively characterized [in vitro and preparation of conditioned culture supernatants. These supernatants were subjected to differential centrifugation in order to collect extra-cellular particles or vesicles in distinct pellets on the basis of their sedimentation characteristics. Cell debris were cleared by 2 centrifugations at 1200 g (pellets P2 and P3) prior to sedimentation of microparticles and vesicles at 10,000 g, 40,000 g and 100,000 g, yielding pellets P4, P5 and P6 respectively. All pellets were analysed by western blotting. As shown in Figure So far there has been no experimental system allowing cterized ,31. BothTo confirm that at least a fraction of the small vesicles recovered in P6 were typical exosomes we intended to purify these elements by immunomagnetic capture. One major characteristic of exosomes released by immune effector cells is their exhibition of HLA class II molecules whose extra-cellular domain is accessible on their external face . BecauseBoth B-cell derived exosomes and purified recombinant LMP1 were shown to inhibit the proliferation of peripheral blood T-cells induced by antigen, mitogen or CD3-CD28 stimulation whereas galectin 9 is known to modulate T-cell maturation and functions in various ways ,15,18-20Malignant as well as non-malignant cells can release several types of vesicles and microparticles ,34. Mostin vitro. The same inhibition is obtained using short peptides containing a critical inhibitory motif derived from LMP1 first transmembrane segment (LALLFWL \u2013 amino-acids 34\u201340). This motif has a strong homology with a retroviral motif also known to antagonize T-cell activation [Both LMP1 and galectin 9 have proven immunomodulatory properties. Soluble recombinant LMP1 has strong inhibitory effects on the activation of human resting T-cells tivation . In figutivation . On the tivation . Finallytivation . In our in situ. Moreover, alterations of systemic immunity has been reported in NPC patients [Because of the immunomodulatory properties of LMP1 and galectin 9, our observations are expected to have a major impact in the elucidation of host-tumor relationships in NPC patients. Indeed the emergence of a malignant process producing several immunogenic viral proteins in a context of local inflammation and heavy leucocytic infiltration remain one major paradox of this disease. It is even more surprising since previous reports indicate that NPC cells retain a functional antigen presenting machinery ,35. Thispatients ,40. It wpatients ,41.This study demonstrates that NPC cells can release HLA class-II positive exosomes containing galectin 9 and/or LMP1. Along with galectins 1 and 3, galectin 9 should now be included in the list of galectins which can be carried by exosomes. This report confirms that recombinant LMP1 has intrinsic T-cell inhibitory activity although no synergy between recombinant galectin 9 and LMP1 were found in T-cell inhibition experiments. One important aim in the future will be to assess on various target cells the biological activity of extra-cellular galectin 9 and LMP1 when they are inserted in exosomes. Another important aim will be to investigate the presence of galectin 9/LMP1-positive exosomes in the blood and biological fluids of NPC patients.The author(s) declare that they have no competing interests.CKB carried out exosome purification and production. CPD made T-cell inhibition experiments. CV contributed to monitoring of exosome purification by western blotting. SS made electron microscopy experiments and observations. NN provided recombinant galectin 9 and participated in the design of the study. MH provided galectin 9 antibodies and participated in the design of the study. JM provided recombinant LMP1 and helped to draft the manuscript. PB conceived the study and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "Specification of primordial germ cells (PGCs) results in the conversion of pluripotent epiblast cells into monopotent germ cell lineage. Blimp1/Prmt5 complex plays a critical role in the specification and maintenance of the early germ cell lineage. However, PGCs can be induced to dedifferentiate back to a pluripotent state as embryonic germ (EG) cells when exposed to exogenous signaling molecules, FGF-2, LIF and SCF.Here we show that Trichostatin A (TSA), an inhibitor of histone deacetylases, is a highly potent agent that can replace FGF-2 to induce dedifferentiation of PGCs into EG cells. A key early event during dedifferentiation of PGCs in response to FGF-2 or TSA is the down-regulation of Blimp1, which reverses and apparently relieves the cell fate restriction imposed by it. Notably, the targets of Blimp1, which include c-Myc and Klf-4, which represent two of the key factors known to promote reprogramming of somatic cells to pluripotent state, are up-regulated. We also found early activation of the LIF/Stat-3 signaling pathway with the translocation of Stat-3 into the nucleus. By contrast, while Prmt5 is retained in EG cells, it translocates from the nucleus to the cytoplasm where it probably has an independent role in regulating pluripotency.We propose that dedifferentiation of PGCs into EG cells may provide significant mechanistic insights on early events associated with reprogramming of committed cells to a pluripotent state. Primordial germ cells (PGCs) are the embryonic precursors of the germ cell lineage, which are restricted to form only sperm and eggs following their specification from pluripotent epiblast cells. Evidence suggests that Blimp1 is the key determinant of germ cell specification as it initiates the germ cell-specification program in pluripotent epiblast cells at embryonic day (E) E6.5\u20137.5 Dnd, Pten, Pgct1 and Akt signaling Cell culture induced reprogramming has been successfully achieved with PGCs isolated from E8.0\u201312.5 old embryos, but the efficiency of reprogramming declines particularly after E11.5 of development (unpublished observation), presumably because PGCs undergo major epigenetic and phenotypic changes upon entry into the developing gonads and they are no longer able to respond to the environmental cues We set out to examine the critical steps that lead up to the conversion of PGCs to EG cells. Our work has identified important sequential steps during reprogramming of PGCs to pluripotency. We suggest that Blimp1 has an important role in preventing PGCs from dedifferentiation into pluripotent stem cells, and its down-regulation is an early key event, which leads to the up-regulation of some of its key targets, amongst which are c-Myc and Klf-4, while the activation of LIF/Stat-3 pathway is important for the self renewal of EG cells.First we set out to identify some key differences between PGCs and EG cells, to discover important markers and potential regulators of dedifferentiation of PGCs into EG cells. We performed both representative differential analysis (RDA) screen and expression analyses of selected genes associated with pluripotency and/or self-renewal. RDA screen was performed between cDNA libraries made from E11.5 PGCs and EG cells and an expression analysis was performed using single cells complementary DNAs (sc cDNAs) made from PGCs isolated from E8.5 embryos, and EG cells.Dnmt3L was identified in the RDA screen as one of the genes that is expressed in EG cells but not in the PGCs. By contrast, Blimp1 is the key gene that is associated with PGCs and not detected in EG cells The expression of 27 genes we examined in PGCs and EG cells is summarised in First, we asked if there was any change in the expression of Blimp1 during the culture of PGCs under the conditions when they undergo reprogramming into EG cells. This is because expression of Blimp1 has been identified as the key event during the specification of PGCs from pluripotent epiblast cells Indeed, we found that Blimp1 (but not Prmt5- see below), which is expressed in PGCs but not in EG cells , is rapiIn contrast to Blimp1, we detected Prmt5 in nuclei of PGCs cultured for the first seven days but thereafter Prmt5 underwent nuclear-to-cytoplasmic translocation in large colonies of cells resembling EG cells . HoweverDhx38, which is not detected in migrating PGCs until E11.5, but it is detected at E12.5 when the Blimp1/Prmt5 complex translocates from the nucleus to cytoplasm Dhx38 is an example.If Blimp1/Prmt5 complex is involved in maintaining the germ cell phenotype, we would expect that some targets of the complex would be up-regulated, which are repressed during specification of PGCs, and during their subsequent migration into the developing gonads. One known target of the Blimp1/Prmt5 complex is c-Myc is another known target of Blimp1 c-Myc is expressed in EG cells but not in the PGC, as judged by PCR analysis, and by immunostaining using specific antibodies on PGCs isolated from E8.5 or 11.5 embryos, but it is detected in the nuclei of EG cells . We did not detect Stat-3 protein in PGCs from E8.5 embryos but we detected Stat-3 protein in late PGCs obtained from E12.5\u201314.5 gonads . We alsoStat-3 is expressed in both ES and EG cells and the signalling pathway is activated by LIF We decided to investigate if attempts at direct alteration of the epigenetic status of PGCs could substitute for the requirement of FGF-2. We investigated the impact of Trichostatin A (TSA), an inhibitor of histone deacetylases (HDACs), to see if it can trigger PGC dedifferentiation into EG cells in the absence of FGF-2. PGCs were cultured in the presence of TSA and LIF, but without FGF-2 for 3-days, followed by culture in medium with LIF only. While TSA at a concentration of 15 ng/ml was toxic, we found a striking effect following the addition of only 5 ng/ml of TSA, which resulted in the formation of more EG-like colonies when compared to the controls (LIF plus FGF-2), which iin vitro derivatives, can do so Here we have demonstrated the key sequence of events associated with reprogramming of PGCs to EG cells . Whereasin vivo developmental programme towards the formation of EG cells in vitroc-Myc, which would be abrogated by TSA In our previous study we found that the presence of FGF-2 is critical during the first day but it is dispensable thereafter, when presumably the PGCs begin to switch from their Recent studies have shown that fetal and adult fibroblast cells can be reprogrammed into iPS cells by the introduction of four transcription factors, Oct-4, Sox-2, Klf-4 and c-Myc We propose that reprogramming of PGCs to EG cells provides a tractable model system to discover other key events and factors, including epigenetic regulators, involved in this dedifferentiation event. This analysis may be particularly important for the discovery of the earliest events associated with the reprogramming events, which could deepen our understanding of the mechanism of reprogramming of PGCs as well as of somatic cells into pluripotent stem cells.Animals were treated according to guidelines approved by the Cambridge University Ethical Review Committee. MF1 females mated with homozygous 129 males were used to provide fetuses. The day of the vaginal plug was designated as embryonic day E 0.5. E11.5 PGCs were sorted by using magnetic beads preformed as described Single-cell cDNA libraries were generated as previously described Dissection of PGC-containing tissues from E8.5 embryos, the culture conditions for derivation of EG cell lines and TNAP staining were as described Immunofluorescence of PGCs, EG cells or cultured PGCs in Lab-tek chambers (Nunc) was carried out as described Figure S1Expression of Oct-4 and Sox-2 in cultured PGCs. 8.5 dpc PGCs were cultured in LIF and FGF-2 containing media on feeder cells expressing SCF. Immunostaining of Oct-4 (green) and Sox-2 (red) were performed on 1-, 3- or 7-days cultured PGCs. Cultured PGCs co-expressed Oct-4 and Sox-2 at high levels. Merged images are shown with DNA stained with Toto-3 (blue). Scale bar, 30 \u00b5m.(2.08 MB EPS)Click here for additional data file.Figure S2Expression of Blimp1/Prmt5 and Dxh38. 8.5 dpc PGCs and EG cells were stained with Blimp1 or Prmt5 specific antibody. (A) Blimp1 (green) is detected in nuclei of PGCs (dashed line) and not detected in EG cells. (B) Prmt5 (green) is detected in nuclei of 8.5 dpc PGCs but in EG cells is predominantly detected in their cytoplasm. (C) Cultured PGCs for different period of time were stained with Dxh38 antibody. Dhx38 (green) was not detected in 4-d cultured PGCs but strong signal was detected in somatic cells. After 7\u20138 d of culture PGCs Dhx38 was detected at low levels in small colonies and at high levels in large colonies. PGCs and EG cells were identified by using Oct-4 antibody (red). Merged images are shown with DNA stained with Toto-3 (blue). Scale bar 50 \u00b5m.(2.69 MB EPS)Click here for additional data file.Figure S3c-Myc expression. (A) RT-PCR analysis was performed on 11.5 dpc PGCs (purity 85%) and EG cells. PGCs did not express c-Myc. In contrast EG cells expressed c-Myc at high level. (B\u2013D) Immunofluorescence staining of c-Myc (green) in PGCs and EG cells. PGCs and EG cells were identified by using Oct-4 antibody (red). (B\u2013C) 8.5 and 11.5 dpc PGCs, respectively, did not express c-Myc. Few somatic cell surrounding 8.5 dpc PGC expressed c-Myc (arrowhead) (D) EG cells expressed c-Myc at high levels. Merged images are shown with DNA stained with Toto-3 (blue). Scale bar 50 \u00b5m.(3.11 MB EPS)Click here for additional data file.Figure S4Expression of Klf-4. Immunofluorescence staining of Klf-4 (green) was performed on (A\u2013B) 8.5 dpc PGCs and EG cells and \u00a9 cultured PGCs for different period of time. PGCs and EG cells were co-stained with antibodies against Oct-4 (red). (A) 8.5 dpc PGCs did not express Klf-4 (B) EG cells expressed Klf-4 at high levels. (C) 1-day cultured PGCs did not express Klf-4, but after 3-days of culture we detected a week signal, which was stronger in PGCs forming large colonies after 8-days of culture. Merged images are shown with DNA stained with Toto-3 (blue). Scale bar, 30 \u00b5m.(2.45 MB EPS)Click here for additional data file.Figure S5AGAAGAAAGGG.Klf-4 is Blimp1 target. Association of BLIMP1 with the KLF4 promoter region in vivo. (A) Position of putative BLIMP1 binding site \u2212384 to \u2212374 upstream of the KLF4 transcription start (TS) site. (B) Chromatin prepared from BLIMP1 expressing H929 or U266 myeloma cells or non-expressing Daudi B-cells was immunoprecipitated with control rabbit IgG or anti-BLIMP1 and the amount of KLF4 sequence present in each quantified by real-time PCR. Data is displayed as enrichment relative to control IgG and plotted using the position of the forward primer. Note: the position of the binding site refers to the sequence (0.74 MB EPS)Click here for additional data file.Figure S6Expression of Stat-3 in 12. 5 to 14.5 dpc germ cells, and EG cells. Cryosections of genital ridges isolated from 12.5, 13.5 and 14.5 old female and male embryos were stained with Stat-3 antibody. Stat-3 (green) was detected in cytoplasm of germ cells in both males and females. Germ cells were identified with Oct-4 antibody (red). At 14.5 dpc male and female germ cells we did not detect Oct-4. In EG cells Stat-3 was detected in nuclei and cytoplasm. Merged images are shown with DNA stained with Toto-3 (blue). Scale bar 50 \u00b5m.(3.21 MB EPS)Click here for additional data file.Figure S7TSA can replace FGF-2 to generate EG cells. EG cell lines generated in the presence of TSA resembled those obtained in the presence of FGF-2. (A) Undifferentiated EG cells were stained with several antibodies used for the characterisation of pluripotent stem cells. EG cells expressed SSEA-1 (red), EMA-1 (red), Oct-4 (red) and Sox-2 (green). (B) Differentiation potential of EG cells was studied via embryoid body formation. Cells differentiated into several lineages as judged by the expression of collagen IV (green), GDNF (red) and fibronectin (green). Merged images are shown with DNA stained with Toto-3 (blue). Scale bar 50 \u00b5m.(1.36 MB EPS)Click here for additional data file."}
+{"text": "Cocaine is a worldwide used drug and its abuse is associated with physical, psychiatric and social problems. The mechanism by which cocaine causes neurological damage is very complex and involves several neurotransmitter systems. For example, cocaine increases extracellular levels of dopamine and free radicals, and modulates several transcription factors. NF-\u03baB is a transcription factor that regulates gene expression involved in cellular death. Our aim was to investigate the toxicity and modulation of NF-\u03baB activity by cocaine in PC 12 cells. Treatment with cocaine (1 mM) for 24 hours induced DNA fragmentation, cellular membrane rupture and reduction of mitochondrial activity. A decrease in Bcl-2 protein and mRNA levels, and an increase in caspase 3 activity and cleavage were also observed. In addition, cocaine (after 6 hours treatment) activated the p50/p65 subunit of NF-\u03baB complex and the pretreatment of the cells with SCH 23390, a D1 receptor antagonist, attenuated the NF-\u03baB activation. Inhibition of NF-\u03baB activity by using PDTC and Sodium Salicilate increased cell death caused by cocaine. These results suggest that cocaine induces cell death (apoptosis and necrosis) and activates NF-\u03baB in PC12 cells. This activation occurs, at least partially, due to activation of D1 receptors and seems to have an anti-apoptotic effect on these cells. Cocaine is the second highest drug of abuse in USA, according to the United Nations Office on Drug and Crime (UNODC)  in plasma membrane causing an increase in extracellular dopamine levels. This results in the stimulation of the brain reward pathway that can lead to the development of addiction ,2. AddicAlong with addiction, cocaine can also induce neurological impairment , behavioral disinhibition, emotional instability, impulsiveness, and movement disorders ,6. CliniNecrotic cell death involves loss of membrane integrity and selective permeability, whereas apoptotic cell death is characterized by membrane blebbing, cell shrinkage and chromatin condensation and fragmentation. The apoptotic changes are often accompanied by caspase activation and cytochrome c release into cytosol . MembersCocaine neurotoxicity has been associated with induction of apoptosis such as activation of caspase -19, lossNuclear factor-\u03baB (NF-\u03baB) is a transcription factor found in a variety of cell types including neurons and microglia . NF-\u03baB c32P-ATP and poly dI-dC from Amersham Biosciences , the gel shift assay system kit for NF-\u03baB from Promega , and the BioRad protein assay kit from BioRad . Routine reagents were from Sigma-Aldrich .Dulbecco's modified Eagle's medium (DMEM), bovine serum, horse serum, trypsin, penicillin and streptomycin were provided by Cultilab . Reagents for SDS-PAGE and immunoblotting were purchased from Bio-Rad Laboratories . SCH23390 was from ToCris, Missouri, USA; PDTC and Sodium salicilate were obtained from Sigma-Aldrich, St Loui, MO, USA. \u03b3-4 cell/well) to poly L-lysine coated 6-well plates. After 48 hours, the medium was replaced by a DMEM without serum and cultured under different combinations of time exposure periods and drug treatments.PC12 cells, a dopaminergic neuronal model, were maintained in DMEM supplemented with 5% heat inactivated bovine serum, 10% horse serum, penicillin (100 units/mL), streptomycin (25 units/mL). Confluent cultures were washed with phosphate-buffered saline (PBS), detached with 2.0 mM EDTA, centrifuged and subcultured , PDTC  and Sodium Salicilate (1 and 2 \u03bcM), inhibitors of NF-\u03baB. SCH23390, PDTC and Sodium Salicilate were dissolved in PBS.2, 10 mM KCl, 0.1 mM EDTA, 0.5 mM PMSF, 2 \u03bcg/mL leupeptin, 2 \u03bcg/mL antipain, 3 mM sodium ortovanadate, 30 mM sodium fluoride, 20 mM sodium pyrophosphate) and incubated on ice for 10 min. After the addition of NP-40 , samples were vigorously mixed and centrifuged for 30 s at 13,000 g. Supernatants were kept at -80\u00b0C for immunoblot analysis. Nuclei were resuspended in extraction buffer , incubated for 20 min on ice and centrifuged for 20 min at 13,000 g at 4\u00b0C. The remaining supernatants containing nuclear proteins were stored at -80\u00b0C. Protein concentration was determined using the BioRad protein reagent. EMSA for NF-\u03baB was performed using a gel shift assay kit from Promega. NF-\u03baB double-stranded consensus oligonucleotide (5'-AGTTGAGGGGACTTTCCCAGGC-3') was end-labeled with \u03b3-32P-ATP using T4 polynucleotide kinase. Unincorporated nucleotides were removed by passing the reaction mixture through a Sephadex G-25 spin column . Purified 32P-labeled probe  was incubated in 20 \u03bcL with 5 \u03bcg nuclear extracts in a binding reaction mixture containing 50 mM NaCl, 0.2 mM EDTA, 0.5 mM DTT, 4% glycerol, 10 mM Tris-HCl (pH 7.5) and 0.05 \u03bcg poly (dI-dC) for 30 min at room temperature. DNA-protein complexes were separated by electrophoresis through a 6% non-denaturing acrylamide:bis-acrylamide (37.5:1) gel in 0.5\u00d7 Tris-borate/EDTA (TBE) for 2 h at 150 V. Gels were vacuum-dried, and analyzed by autoradiography. For competition experiments, NF-\u03baB and TFIID (5'-GCAGAGCATATAAGGTGAGGTAGGA-3') unlabeled double-stranded consensus oligonucleotide was included in 2-fold molar excess over the amount of 32P-NF-\u03baB probe in order to detect specific and non-specific DNA-protein interactions, respectively. Unlabeled oligonucleotides were added to the reaction mixture 20 min before the radioactive probe. The composition of the complexes was determined by supershift assays; antibodies (1:10 dilution) against different NF-\u03baB subunits  were added before the incubation of nuclear extracts with the labeled oligonucleotide. Autoradiographs were quantified by ChemImager detection system .Nuclear extracts were prepared as previously described  with minElectrophoresis was performed using a Bio-Rad mini-Protean II apparatus. In brief, the proteins present in the cytosolic (30 \u03bcg) fractions were size-separated in SDS-PAGE (10% or 15% acrylamide). The proteins were blotted onto a nitrocellulose membrane (Bio-Rad) and incubated with the specific antibodies (cytocrome-c sc-7159 (1:500) ; \u03b1-spectrin MAB1522 (1:1000); I\u03baB-\u03b1 ab325 (1:250) Bax ab32503 (1:250), Bcl-2 ab7973 (1:250) ; or caspase-3 AB1899 (1:500) . The Ponceau staining method was used to determine the loading amount . Immunoblots were quantified as described above. Proteins recognized by antibodies were revealed by ECL technique, following the instructions of the manufacturer . To standardize and quantify the immunoblots, a ChemImager detection system  was used. \u03b2-actin antibody  was used as an internal control. Results were expressed in relation to the intensity of \u03b2-actin and as percentage of control value.Total RNA was isolated using Trizol reagent and semi quantitative reverse transcription-PCR (RT-PCR) amplification was performed according to the instructions of the manufacturer . The primer sequences were: BDNF (304 bp), 5'-ATGCTCAGCAGTCAAGTGCC-3'(sense) and 5'-AGC CTTCCTTCGTGTAACCC-3'(antisense); Bax (271 bp), 5'-TGAACTGGACAACAACATGGAGC-3'(sense) and 5'-GGTCTTGGATCCAGACAAACAGC-3'(antisense); Bcl-2 (259 pb), 5'-GGAGGATTGTGGCCTTCTTTGAG-3' (sense) and 5'-TATGCACCCAGAGTGATGCAGGC-3' (antisense); GAPDH (258 pb), 5'-GCCAAGTATGATGACATCAAGAAG-3' (sense) and 5'-TCCAGGGGTTTCTTACTCCTTGGA-3' (antisense). The GAPDH was used for PCR control. The PCR conditions consisted of 45 s at 94\u00b0C, different number of cycles and temperature depending on the gene studied for 30 s  and a final extension at 72\u00b0C for 10 min. Gel electrophoresis of the PCR product was performed using an ethidium bromide-containing agarose gel (1.5%), and resulting bands were visualized under UV light. The photographs were captured by VilberLourmat , and the optical density of the bands was determined using the ImageJ software. Results were expressed in relation to the intensity of GAPDH and as percentage of control value.DNA fragmentation was analyzed by flow cytometry after DNA staining with PI according to the method previously described ). After Cell viability was estimated by the 3--2,5-diphenyl tetrazolium bromide (MTT) reduction assay . After iTo measure the effects of cocaine on caspase 3 activity colorimetric assay kit  was used. After 6 hours of treatment with 1 mM cocaine cells were scraped in cold PBS, centrifuged at 1500 g for 10 minutes, resuspended in lyses buffer  and incubated for 10 minutes in ice. After centrifugation  the supernatant was separated and incubated with 50 \u03bcL AC-DEVD-AMC (capase-3 substrate) at 37\u00b0C for 2 hours. 7-methylcoumarin (AMC), formed from the cleavage of the substrate by caspase 3, was spectrophotomteric assay at 460 nm. Increase in caspase activity was expressed as percentage of control values.Results were expressed as mean \u00b1 S.E.M. of the indicated number of experiments. Statistical comparisons were performed by non-paired Student's t test and one-way ANOVA followed by the Newman-Keuls test P < 0.05 was considered as statistically significant. All statistics analyses were performed using a Prism4 software package .Nuclear extracts from cells treated with 1 mM cocaine for 6 hours presented three DNA/protein complexes indicated by EMSA assay Figure . The com32P-NF-\u03baB/protein complex 1. Complexes 2 and 3 were not displaced by the antibodies confirming that they are not related to NF-\u03baB family. Because complex 1, mainly composed by p50/p65 heterodimers, was the major DNA/protein complex altered by the treatments, the term NF-\u03baB was used to identify this complex.Supershift analysis indicated that the p65 subunit antibody shifted DNA/protein interactions found in complex 1. The p50 subunit antibody induced a partial decrease in complex 1. In contrast, the antibodies against the p52 and c-Rel subunits did not affect DNA-protein complex Figure . This suPC12 cells were incubated for 6 hours with different concentrations of cocaine (0.05 \u2013 2.0 mM) and nuclear proteins were submitted to EMSA assay. Activation of NF-\u03baB by cocaine was concentration-dependent; starting at 0.25 mM and with maximum response at 1 mM Figure . We alsoTo confirm the activation of NF-\u03baB by cocaine in PC12 cells the content of I\u03baB-\u03b1 in the cytoplasm of cells treated with 1 mM cocaine for 6 hours was measured. A reduction in I\u03baB-\u03b1 expression Figures  and 1H wAs cocaine indirectly induces activation of D1 receptors, the cells were pre-treated with a D1 antagonist, SCH 23390, twenty minutes before the exposure to cocaine (1 mM). SCH 23390, at all concentrations tested, partially inhibited the activation of NF-\u03baB by cocaine  were used to evaluate PC12 cell death. All assays were performed after 6 and 24 hours of incubation with 1 mM cocaine.Flow cytometric analysis was used to evaluate the effects of cocaine on DNA fragmentation in PC12 cells. The proportion of apoptotic cells in cocaine-treated PC12 cells  was approximately 25-fold greater than in control cells (PBS-treated) Figure . No chanThe MTT assay indicates changes in metabolic activity associated to cell survival (cell viability). A decrease in metabolic activity of PC12 cells treated with cocaine for 24 hours Figure  was obseLDH is released from cells as a result of loss of plasma membrane integrity. Incubation with cocaine raised LDH activity in the medium after 6 Figure  and 24 hThe effects of SCH 23390 on cocaine-induced PC12 cell death were evaluated by measuring MTT reduction and LDH release to the incubation medium. The pre-treatment of the cells with 10 \u03bcM SCH 23390 did not change cell viability Figure .We next determined whether PDTC or Sodium Salicilate modulates cocaine-induced cell toxicity as assessed by LDH and MTT assays. Sodium salicilate inhibits the I\u03baB-\u03b1 degradation, preventing the translocation of NF-\u03baB to the nucleus , whereas PDTC directly inhibits NF-\u03baB. Both drugs partially decreased NF-\u03baB activation by cocaine (data not shown). The decrease in PC12 cell viability induced by cocaine was more pronounced in the presence of the NF-\u03baB inhibitors Figure . No diffSpectrin plays a key role to maintain cellular membrane proprieties. Cocaine (1 mM) augmented \u03b1-spectrin fragmentation (150 e 120 kDa) after 6 hours incubation Figures  and 5C. Cocaine-induced \u03b1-spectrin fragmentation and other reports suggesting that caspase-3 is the major protease in apoptosis led us to verify whether caspase-3 activation was involved in the induction of PC12 cells apoptosis by cocaine. Caspase-3 activity was measured at 6 h, a critical time point at which cocaine induced the highest NF-\u03baB activation. Cocaine increased caspase-3 activity as well as protein cleavage (another index of caspase-3 activation) in PC12 cells when compared to control (PBS-treated) cells Figures  and 5F.Cocaine exposure significantly reduced Bcl-2 mRNA and protein levels after 6 hour exposure and the mRNA levels were still lower after 24 hours. No changes in Bax mRNA and protein levels were observed  is a neurotrofin that participates in the neuronal protection and its expression can be regulated by transcription factors (such as NF-\u03baB) the expression of this protein was investigated in PC12 cells after incubation with cocaine. We observed an increase in BDNF mRNA levels after 6 hours of treatment, which was not seen after a longer period (24 hours) of incubation Figure .Cocaine treatment induced PC 12 cell death by apoptosis and necrosis. These effects were verified by mitochondrial dysfunction, increase in LDH release, activation of caspase 3, decrease in Bcl-2 expression and increase in \u03b1-spectrin cleavage. Cocaine treatment also activated the p50/p65 subunit of NF-\u03baB in PC 12 cells after 6 hour partially due to the activation of D1 dopamine receptor.Cocaine concentrations used in this study were similar to those previously employed by others in different cell types ,33-36. ACocaine treatment activated NF-\u03baB in PC12 cells in the interval of 3\u20138 hours while cell death was more pronounced after 24 hours only. Supershift assay analysis indicated that cocaine increased the p50/p65 NF-\u03baB complex content. In agreement with our results, others showed activation of NF-\u03baB by cocaine in different models. Chronic administration of cocaine induced NF-\u03baB activation in nucleus accumbens of mice . CocaineSo, none of these studies investigated the mechanism of cocaine-induced NF-\u03baB activation. This is the first report that investigates the mechanism linking activation of NF-\u03baB and cell death induced by cocaine.The involvement of dopaminergic receptors in the activation of this transcription factor by cocaine was also investigated in PC 12 cells. Pre-incubation with a D1 antagonist, SCH 23390, caused a partial reduction in cocaine-induced NF-\u03baB activation, suggesting the participation of these receptors in this process. Others have also investigated the participation of dopamine receptors in the activation of NF-\u03baB. Dopamine D1 receptor raised the expression of immediate early genes  that acHan and col. (2007) suggested that the increase in NF-\u03baB activity caused by dopamine occurs by its interaction with D1 receptors leading to the activation of G protein, increased levels of intracellular cyclic AMP and stimulation of the phospholypase C/PKC pathway . These e2O2) formation by protein kinase C (PKC), subsequently leading to activation of p38 MAPK and JNK, that stimulate NF-\u03baB activation as showed by Lee et al. (2006) in mouse embryonic cells [Dopamine readily oxidizes to form reactive oxygen species (ROS), free radicals, and quinones, a process that can occur either spontaneously in the presence of transition metal ions  or via aic cells . In the ic cells . TherefoNF-kB is a transcription factor activated in response to cellular stress that is involved in the regulation of apoptosis. Depending on the cell type and the apoptotic agent, NF-\u03baB has been reported to mediate or prevent apoptosis . The celTo further investigate the role of NF-\u03baB in cocaine induced-cytotoxicity NF-\u03baB cell permeable inhibitors were used. The inhibition of NF-\u03baB significantly increased the cell death promoted by cocaine treatment, suggesting that this transcription factor plays a protective role in cocaine treated PC12 cells. Lee and colleagues showed an anti-apoptotic effect of NF-\u03baB in PC12 cells death induced by auto-oxidized dopamine . High coCocaine caused a reduction in anti-apoptotic Bcl-2 protein level but no change in pro-apoptotic Bax altering, therefore, the Bax/Bcl-2 ratio, which triggers cellular apoptosis. The reduction of Bcl-2 levels after exposure to cocaine has also been reported in fetal rat myocardial cells . Howevervitro [in vivo [In addition, study of caspases, which are also important regulators of apoptosis, revealed that exposure of PC12 cells to cocaine increased caspase-3 activity of and the cleavage of caspase-3 precursors. Several studies have reported the induction of caspase-3 by cocaine both in vitro ,18,36,60[in vivo ,61. Coca[in vivo . This daAn increase of BDNF mRNA levels was found after 6 hours of treatment with cocaine only, indicating a transitory augment of this neurotrophin. Le Foll and colleagues also observed a transitory increase of BDNF mRNA levels in frontal cortex of rats after a single injection of cocaine . BDNF reThe exposure of PC12 cells to cocaine decreased the ratio Bax/Bcl-2, reducing the levels of Bcl-2, and leading to activation of caspase-3 that can act as a modulator of the apoptosis process observed after 24 hours of exposure to the drug Figure . MoreoveThe author(s) declare that, except for income received from my primary employer, no financial support or compensation has been received from any individual or corporate entity over the past three years for research or professional service and there are no personal financial holdings that could be perceived as constituting a potential conflict of interest.LBL: participated in all of the experiments, have made substantial contributions to conception and design, acquisition of data, analysis and interpretation of data; have been involved in drafting the manuscript or revising it critically for important intellectual content; and have written the manuscrip to be published.CDM: have made substantial contributions to conception and design, acquisition of data, analysis and interpretation of data; have been involved in drafting the manuscript or revising it critically for important intellectual content, have given final approval of the version to be published.EMK: have made substantial contributions to conception and design, acquisition of data, analysis and interpretation of data; have given final approval of the version to be published.LMY: participated in the design of the study and performed the statistical analysis; have given final approval of the version to be published.LSL: particpated in the performance of the experimental MFB: carried out the FACS assay and have given final approval of the version to be published.TML: carried out the FACS assay and have given final approval of the version to be published.RC: participated in the design of the study and performed the statistical analysis; have given final approval of the version to be published.CSP: have made substantial contributions to conception and design, acquisition of data, analysis and interpretation of data; have been involved in drafting the manuscript or revising it critically for important intellectual content, have given final approval of the version to be published.CS: have made substantial contributions to conception and design, acquisition of data, analysis and interpretation of data; have been involved in drafting the manuscript or revising it critically for important intellectual content, conceived of the study, and participated in its design and coordination.This work is part of studies regarding the PhD thesis of LBL."}
+{"text": "A 30 min exposure of Chinese hamster (Line V79-753B) cells to submicromolar concentrations of m-AMSA killed 50% of the cells. The survivors had an enhanced sensitivity to radiation-induced cell killing. Depending upon the conditions, m-AMSA enhanced the radiation effect by either a decrease in the survival-curve shoulder or by an increase in slope. m-AMSA may act partly by suppressing the accumulation of sublethal damage but, if so, recovery from damage as measured in split-dose experiments with cells pretreated with the drug is not affected to its radiation effect from selective toxicity to cells in a radioresistant phase of the cell cycle cannot be excluded. Radiation and the drug interacted to give increased cell killing, even when the exposures to each agent were separated in time. It is concluded that m-ASMA may behave like actinomycin D and adriamycin, and enhance clinical radiation responses. In vivo testing to determine the effect of m-AMSA on the therapeutic index is recommended."}
+{"text": "Epstein-Barr virus (EBV)-encoded LMP1 protein is commonly expressed in nasopharyngeal carcinoma (NPC). LMP1 is a prime candidate for driving tumourigenesis given its ability to activate multiple signalling pathways and to alter the expression and activity of variety of downstream targets. Resistance to TGF\u03b2-mediated cytostasis is one of the growth transforming effects of LMP1. Of the downstream targets manipulated by LMP1, the induction of Id1 and inactivation of Foxo3a appear particularly relevant to LMP1-mediated effects. Id1, a HLH protein is implicated in cell transformation and plays a role in cell proliferation, whilst Foxo3a, a transcription factor controls cell integrity and homeostasis by regulating apoptosis. The mechanism(s) by which LMP1 induces these effects have not been fully characterised.In this study, we demonstrate that the ability of LMP1 to induce the phosphorylation and inactivation of Foxo3a is linked to the upregulation of Id1. Furthermore, we show that the induction of Id1 is essential for the transforming function of LMP1 as over-expression of Id1 increases cell proliferation, attenuates TGF\u03b2-SMAD-mediated transcription and renders cells refractory to TGF\u03b2-mediated cytostasis. Id1 silencing in LMP1-expressing epithelial cells abolishes the inhibitory effect of LMP1 on TGF\u03b2-mediated cell growth arrest and reduces the ability of LMP1 to attenuate SMAD transcriptional activity. In response to TGF\u03b2 stimulation, LMP1 does not abolish SMAD phosphorylation but inhibits p21 protein expression. In addition, we found the induction of Id1 in LMP1-expressing cells upon stimulation by TGF\u03b2. We provide evidence that LMP1 suppresses the transcriptional repressor ATF3, possibly leading to the TGF\u03b2-induced Id1 upregulation.The current data provide novel information regarding the mechanisms by which LMP1 suppresses TGF\u03b2-induced cytostasis, highlighting the importance of Id1 in LMP1 mediated cell transformation In vitro studies show that LMP1 is essential for EBV immortalisation of primary B cells, and can induce a state of cell activation in B lymphoma-derived cell lines. In epithelial cells, LMP1 increases cell proliferation, promotes anchorage independent growth, protects cells from apoptosis, induces an epithelial-mesenchymal transformation, promotes cell invasion and perturbs epithelial cell differentiation [The Epstein-Barr virus (EBV)-encoded latent membrane protein LMP1) is commonly expressed in nasopharyngeal carcinoma (NPC) and is believed to play important role in NPC pathogenesis [ is commontiation ,3. LMP1 ntiation ,3.kip and cyclin D1, which regulate apoptosis or cell-cycle progression respectively. Foxo proteins are subject to regulation through phosphorylation, resulting in nuclear to cytosolic export and subsequent degradation. Foxo protein deregulation is associated with cell proliferation, altered differentiation and an accumulation of DNA damage findings suggestive of a role in driving carcinogenesis [Of the signalling pathways activated by LMP1, PI3K/Akt, ERK-MAPK and NF\u03baB signalling pathways have been shown to induce phosphorylation and inhibit the activity of the Forkhead box class O (Foxo) transcription factors . Foxo faogenesis ,5. Althoogenesis . The Id1ogenesis .Cell proliferation and differentiation are tightly regulated by growth promoting factors and growth inhibitory factors. TGF\u03b2 functions as a prototypical tumour suppressor, inhibiting the growth of untransformed epithelial, endothelial and lymphoid cells. In keeping with its role as a tumour suppressor, resistance to TGF\u03b2 is regarded as one of the crucial steps in malignant progression ,9. TGF\u03b2-In this study, we report that LMP1 inactivates the function of Foxo3a leading to upregulation of Id1. The induction of Id1 by LMP1 confers cellular resistance to TGF\u03b2 through a mechanism involving inhibition of TGF\u03b2-SMAD-mediated transcription. In addition, we show that LMP1 inhibits the expression of ATF3, a transcription repressor that co-operates with SMAD to mediate Id1 suppression. By inhibiting ATF3 expression, LMP1 relieves the suppressive effect of TGF\u03b2 on Id1 expression.kip, a transcriptional target of Foxo3a by LMP1 was also observed [kip protein  or p3Tplux into HEK-293 cells. Twenty-four hours post-transfection, cells were subjected to TGF\u03b2 treatment for 16 hours prior to harvesting for luciferase reporter analysis. As shown in Figure LMP1 has previously been reported to inhibit SMAD transcription ,13. HereWe have found that LMP1 suppresses TGF\u03b2-mediated SMAD transcription without affecting SMAD phosphorylation. Over a time-course of 48 hours, TGF\u03b2 treatment stimulated phosphorylation of the SMAD2 and SMAD3 proteins in both NP69-pLNSX and NP69-LMP1 cells as early as 2 hours after the addition of TGF\u03b2 and high levels of phosphorylated SMAD proteins persisted thereafter although gradually declining by 48 hours post-stimulation Figure . ExpressWe found that expression of the Id1 protein increased in both NP69-pLNSX and NP69-LMP1 cells 2 hrs after TGF\u03b2 addition. Thereafter, high levels of Id1 persisted in NP69-LMP1 cells, while in NP69-pLNSX cells, the levels of Id1 protein gradually decreased reaching basal levels 48 hours post-stimulation. During the time course following TGF\u03b2 treatment, the levels of Foxo3a did not change significantly in either NP69-pLNSX or NP69-LMP1 cells although the overall levels of Foxo3a protein were lower in NP69-LMP1 compared to NP69-pLNSX cells. These data show that Id1 is induced in LMP1-expressing cells in response to TGF\u03b2 stimulation and that this induction is not likely associated with the expression and/or activity of Foxo3a.Massagu\u00e9 and colleagues have demonstrated that Id1 is transiently induced by TGF\u03b2-activated SMAD3 but long-term TGF\u03b2 stimulation results in Id1 transcriptional repression, which is dependent on induction of the ATF3 transcriptional repressor . Here, wIn an examination of primary NPC tumours , which displayed strong, moderate, and weak expression of LMP1 respectively, we observed a positive correlation between expression of LMP1 and that of Id1, whereas expression of Foxo3a was inversely correlated with LMP1 expression. For example, tumour T1 shows strong staining for both LMP1 and Id1, but weak Foxo3a nuclear staining. In contrast, tumour T3 showed strong nuclear staining of Foxo3a but weak detection of LMP1 and Id1 proteins. While in the normal nasopharyngeal epithelium (NP) which is LMP1 negative, we found weak Id1 expression but strong nuclear Foxo3a staining Figure . These din vitro studies. Also, we have found that the LMP1 induction of Id1 contributes to resistance to TGF\u03b2-mediated cytostasis and modulate TGF\u03b2-SMAD-mediated transcription  according to manufacturers' instructions.HEK-293 and HepG2 cells were grown in DMEM medium (Sigma) supplemented with 10%v/v FBS, and antibiotics. NP69 nasopharyngeal epithelial cells were maintained in Keratinocyte-Serum free (KSF) medium (Invitrogen). Recombinant human TGF-\u03b21 (PeproTech) and MG132 (Sigma) were used for treatment of cells when specified. Plasmid transfections were performed using either Fugene HD (Roche) or TurboFect\u2122 The Id1 (-1695) and (-353) promoter luciferase reporters were generated by PCR and cloned into the pGL3 basic vector (Promega). The Id1 shRNA B & C expression vectors were generated by inserting a fragment of synthesised Oligo (Sigma) with the sequence of Id1 coding region into pSUPER.retro.puro vector (oligoengine). The sequence of Id1 shRNA B is GATCCCCGCGCGCTGAAGGCCGGCAATTCAAGAGATTGCCGGCCTTCAGCGCGCTTTTTA and Id1 shRNA C is GATCCCCGGTGCGCTGTCTGTCTGAGTTCAAGAGACTCAGACAGACAGCGCACCTTTTTA. pECE-HA-Foxo3a was kindly provided by M. Deckert , pGL2-BiThe detailed procedures of Western blotting have been described previously . BrieflyThe expression of LMP1 and Foxo3a in paraffin-embedded NPC specimens was examined by immunohistochemistry as described previously . Primary5 cells grown in 24-well plates were co-transfected with 40 ng of luciferase reporter constructs together with different amounts of expression vectors as indicated in the text. RSV-\u03b2-Gal vector (50 ng) was transfected as an internal control to normalise for transfection efficiency. Two days post-transfection, cells were lysed in reporter lysis buffer (Promega) and then assayed for luciferase and \u03b2-gal activities. For detection of Id promoter activity, transfected cells were cultured in serum free medium for 6 hrs before harvesting. For detection of TGF\u03b2 responsive promoter activity of pGL3(CAGA) and p3TLux constructs, cells were cultured in medium containing 0.2% FBS and 5 ng/ml TGF\u03b2 for 16 hrs prior to harvesting.1\u00d7105) were fixed in ice cold 70% ethanol for 1 hr. Prior to analysis, fixed cells were washed with PBS, treated with RNase (1 \u03bcg/ml) and stained with propidium iodide (50 \u03bcg/ml) for 30 min at 37\u00b0C. Cell cycle analysis was carried out on a XL-MCL flow cytometer (Beckman-Coulter) and data analyzed using the MultiCycle AV DNA Analysis software (Phoenix Flow Systems).Cells (5 \u00d7 103 per well) were seeded into 96-well plates. One day after cell seeding. TGF\u03b21 (10ng/ml) was added. MTT assay was analyzed each 24 hrs by adding MTT solution  and cells were incubated at 37\u00b0C for 5 hrs. The culture media were aspirated and DMSO (200 \u03bcl/well) was added to dissolve the formazan crystals. The absorbance was measured at a wavelength of 570 nm. Each time point was performed in triplicate. Results are presented as relative growth rate by dividing the absorbance value of the cells at indicated time points by the absorbance value of the cells one day after cell plating. Each data point is represented by the mean and SD.For MTT assay, cells , pSuper.retro-Id1 shRNA C (shId1C) or two shRNA-Id1 constructs (shId1B+C). The sequences of Id shRNA B and C are described in Material and Methods. After Puromycin drug selection, Id1 shRNA expressing cells were validated for Id1 expression by western blotting.Click here for fileId1 suppresses TGF\u03b2-mediated SMAD transcriptional activity. NP69 or HepG2 cells were transfected with SMAD-responsive luciferase reporter construct pGL3(CAGA) together with various doses of an Id1 expression vector. Twenty-four hours post-transfection, cells were treated with 10 ng TGF\u03b2 in medium supplemented with 0.2% FBS for 16 hrs prior to harvesting for luciferase analysis.Click here for fileLMP1 induction of Id1 suppresses TGF\u03b2-mediated SMAD transcriptional activity. NP69 or HepG2 cells were transfected with pGL3(CAGA) or p3TPlux and various doses of LMP1 expression vector together with Id1 shRNA (shId1B+C). Twenty-four hours post-transfection, cells were treated with 10 ng TGF\u03b2 in medium with 0.2% FBS for 16 hrs prior to harvesting for luciferase analysis.Click here for fileLMP1 induction of Id1 suppresses TGF\u03b2-mediated SMAD transcriptional activity. NP69 or HepG2 cells were transfected with pGL3(CAGA) and various doses of LMP1 expression vector together with a Foxo3a expression vector. Twenty-four hours post-transfection, cells were treated with 10 ng TGF\u03b2 in medium supplemented with 0.2% FBS for 16 hrs prior to harvesting for luciferase analysis.Click here for file"}
+{"text": "The DNA-binding bisbenzimide fluorochrome Hoechst 33342 is being used routinely in radiobiological studies to assess cell kinetic parameters and tumour blood flow. However, there are reports in the literature which indicate that exposure to this compound can affect the radiation sensitivity of tumour cell populations. In this investigation, it was found that staining murine tumour cells in vitro with H33342 at concentrations greater than 0.1 microM before irradiation resulted in radioprotection. The protection factor calculated for fibrosarcoma cells stained with 10 microM H33342 was 1.7. Varying the time between radiation treatment and exposure to the fluorochrome demonstrated that the effect rapidly changed to radiosensitization when staining was performed subsequent to irradiation. Cells in transplanted KHT tumours were stained in vivo by intravenous administration of H33342 to determine whether the radiation sensitivity of these populations might also be modified. Flow cytometric analysis of suspensions prepared from tumours stained in this manner revealed that recovered cells exhibited a greater than 100-fold range in fluorescence intensities. These suspensions were irradiated in vitro and the cells were then fractionated according to fluorochrome content using cell sorting. Little evidence for a radioprotective effect was observed when these subpopulations were assessed for survival, even when tumour-bearing mice were given doses of H33342 which approached the LD50. Further analysis demonstrated that insufficient amounts of the fluorochrome were taken up by cells during in vivo staining to attain levels required for radioprotection. However, our results indicate that the amount of H33342 accumulated by cells may affect the radiation sensitivity of populations exposed to high concentrations of this fluorochrome, such as those required to achieve stoichiometric binding to DNA."}
+{"text": "The histamine receptor-1 (H1)-antagonist, loratadine has been shown to inhibit growth of human colon cancer xenografts in part due to cell cycle arrest in G2/M. Since this is a radiation sensitive phase of the cell cycle, we sought to determine if loratadine modifies radiosensitivity in several human tumor cell lines with emphasis on human colon carcinoma (HT29).ser345, and Cyclin B was analyzed by western blot.Cells were treated with several doses of loratadine at several time points before and after exposure to radiation. Radiation dose modifying factors (DMF) were determined using full radiation dose response survival curves. Cell cycle phase was determined by flow cytometry and the expression of the cell cycle-associated proteins Chk1, pChk1ser345, however a subsequent decrease in expression of total Chk1 and Cyclin B correlated with abrogation of the G2/M checkpoint. Analysis of DNA repair enzyme expression and DNA fragmentation revealed a distinct pattern of DNA damage in loratadine-treated cells in addition to enhanced radiation-induced damage. Taken together, these data suggest that the observed effects of loratadine are multifactorial in that loratadine 1) directly damages DNA, 2) activates Chk1 thereby promoting G2/M arrest making cells more susceptible to radiation-induced DNA damage and, 3) downregulates total Chk1 and Cyclin B abrogating the radiation-induced G2/M checkpoint and allowing cells to re-enter the cell cycle despite the persistence of damaged DNA.Loratadine pre-treatment of exponentially growing cells  increased radiation-induced cytotoxicity yielding a radiation DMF of 1.95. However, treatment of plateau phase cells also yielded a DMF of 1.3 suggesting that mechanisms other than cell cycle arrest also contribute to loratadine-mediated radiation modification. Like irradiation, loratadine initially induced G2/M arrest and activation of the cell-cycle associated protein Chk1 to pChk1Given this unique possible mechanism of action, loratadine has potential as a chemotherapeutic agent and as a modifier of radiation responsiveness in the treatment of cancer and, as such, may warrant further clinical evaluation. It is well established that the effects of radiation varies as a function of cell cycle position . SpecifiProgression through the cell cycle is regulated by a complex network of proteins that monitor the health of the cell. This mechanism serves to protect cells from potentially lethal stressors by temporarily halting cell cycle progression to allow time for repair of damaged cell components, especially damage involving DNA. For example, it is well known that DNA damage induced by radiation results in cell cycle block in G2/M during which time the DNA repair machinery attempts to correct the damage. If the damage is repaired, cells are released from the cell cycle block and are allowed to divide. Persistent DNA damage may result in cell death initiated by other surveillance mechanisms. In eukaryotic cells, the G2/M checkpoint is controlled by several proteins including cell division cycle 2 (Cdc2) and Cyclin B . Cdc2 isSince G2/M is a particularly radiosensitive phase of the cell cycle, it is logical to suggest that the induction of a cell cycle block in G2/M by loratadine would enhance radiation-induced cytotoxicity, however this has not yet been studied. This study was initiated to determine whether loratadine modifies the effect of radiation on cell survival and, if so, to elucidate the mechanism underlying that effect.5 cells/100 mm plastic petri dish) and incubated for 16 hours at 37\u00b0C. Loratadine was dissolved in 0.1% DMSO then added at various concentrations to the exponentially growing cells in complete medium and the cells were incubated at 37\u00b0C for 24 hour. DMSO (0.1%) was also added to control cells. Most studies used a loratadine concentration of 75 \u03bcM [HT29 (human colon carcinoma) and DU145 (human prostate carcinoma) were purchased from American Type Culture Collection . SF295 (human glioblastoma) were a gift from Dr. Kevin Camphausen. SF295 cells were grown in DMEM, and all other cell lines were grown in RPMI 1640. All media contained 10% heat-inactivated fetal bovine serum and antibiotics. For cell survival studies, cells were plated . Histones from the nuclear pellet were extracted in 0.2 mol/L sulfuric acid by incubating samples on ice for 4-6 hours. After centrifugation, acid-soluble histones were transferred to fresh tubes and 9 volumes of ice cold acetone were added. Histones were precipitated at -20\u00b0C overnight and were pelleted by centrifugation at 14,000 rpm for 10 min at 4\u00b0C. Supernatant was discarded and pellets were air-dried. Histones were solubilized in 4 mol/L urea and protein concentration was determined by BioRad DC protein assay. Histones were separated on 18% Tris-Glycine gels  by loading 20 \u03bcg samples and transferred to nitrocellulose membrane using iBlot Dry Blotting System from Invitrogen . Membranes were incubated overnight at 4\u00b0C with mouse monoclonal anti-phospho Histone H2AX (Ser139), clone JBW301  from Millipore , washed 3 times with PBS-T and incubated with HRP-conjugated anti-mouse antibody from Santa Cruz Biotechnology, Inc. . \u03b3H2AX was visualized by ECL detection kit  using Fluor Chem SP imager . Membranes were stripped using Re-Blot Plus mild antibody stripping solution  and reprobed with 1:1000 rabbit antiserum to histone H2A (acidic patch) from Millipore  to ascertain uniform loading. Signal intensities were normalized to their loading control H2A and expressed as fold change compared to controls.7 per ml. An equal volume of 1% low gelling temperature agarose was added, and the cell suspension was drawn into 3/32 inch (i.d.) silicone tubing with a syringe. Both ends of the tubing were clamped, and the tubing was immersed in an ice bath to rapidly solidify the agarose. The agarose was then extruded from the tubing, cut into 5 mm lengths, and these \"plugs\" were placed into 1.5 ml centrifuge tubes. This procedure results in approximately 105 cells per 5 mm plug. DNA was purified by incubating at 55\u00b0C in ESP buffer  for 24 hr. The plugs were then rinsed in TE buffer  for 24 hr with three buffer changes. RNA was digested by incubation with 0.1 \u03bcg/ml boiled RNAse A in TE buffer for 2 hr at 37\u00b0C.DNA was prepared for electrophoresis by the methods of Schwartz and Cantor  and Gard0.8% agarose gels were cast in 0.5\u00d7 TBE . Agarose plugs were loaded into 2 \u00d7 6 \u00d7 5 mm wells, and the wells were sealed with melted agarose. Electrophoresis was carried out for 24 hr at 56 volts (4 volts/cm), with a 3:1 ratio of forward to reverse pulse time. The initial forward pulse time was 7.5 seconds (reverse pulse 2.5 seconds), increasing to a final forward pulse time of 90 seconds . The running buffer (0.5\u00d7 TBE) was re-circulated and cooled to maintain a temperature of 12-15\u00b0C. These electrophoresis conditions were chosen based on methods of Stamato and Denko , and theQuantification was done by densitometry using a FluorChem gel documentation system  and AlphaEaseFC software . Each band in the gel was outlined manually and the density determined. The results are expressed as \"%DNA released,\" determined by dividing the density of the released DNA band by the density of the total DNA in the lane (the released DNA band plus the unreleased DNA remaining in the well).The effect of loratadine on cell cycle distribution was analyzed by flow cytometry by propidium iodide staining after treating cells with the drug for 24 hour. Briefly, cells were trypsinized, washed with PBS and fixed in 70% ethanol overnight. Cells were pelleted and nuclei were isolated by pepsin/HCl digestion followed by treatment with 10 mmol/L borate (pH 8.6) to neutralize the acid. Cells were then incubated with FITC-labeled anti-human IgG and PI staining. Cell cycle data were collected on BD FACSCalibur Flow Cytometer  and analyzed using CellQuest/MOD-Fit software .The cells were lysed in RIPA buffer  containing protease inhibitor cocktail and phosphatase inhibitors . The samples were incubated in the lysis buffer on ice for 30 minutes, centrifuged at 14000 rpm in a refrigerated centrifuge for 30 minutes and the supernatant collected. The samples were kept at 40\u00b0C if used on the same day or frozen at -70\u00b0C for storage. Protein concentration was determined with Dc Protein Asssay kit . 40 \u03bcg of protein was separated on 4-20% Tris-Glycine gels  and transferred to nitrocellulose membrane using iBlot Dry Blotting System from Invitrogen . Non specific protein binding was blocked by incubating the membranes for 1 hour in 3% blocking grade non fat dry milk  in TBST. The membranes were then left overnight at 40\u00b0C in the primary antibody at a dilution of 1:1000 for rabbit monoclonal anti pChk1 (Ser 345) , 1:200 for mouse monoclonal anti Chk1 , 1:1000 for mouse monoclonal anti Cyclin B ; and 1:5000 for mouse monoclonal anti Actin . The membranes were washed thrice in TBST and incubated for 1 hour in horseradish peroxidase conjugated secondary antibody  at a dilution of 1:2000. The proteins were then visualized by chemiluminescence  using Fluor Chem SP imager . Fold change in protein expression was expressed as a ratio calculated by dividing the specific protein band density with the actin band density (loading control), and then normalized to the control.All experiments were performed a minimum of three times. In some cases, the plots represent the average of these experiments. For some experiments, representative results are represented. Whether the plot represents the average of several experiments or a representative experiment has been indicated for each figure. When present, error bars represent the standard error of the mean. Dose modifying factors (DMF) were calculated for clonogenic survival assays.HT29 cells treated with loratadine (75 \u03bcM) 4, 8, 12, 18, and 24 hours prior to irradiation (6 Gy) demonstrated that the radiation modifying effect of loratadine increased with increasing exposure time prior to irradiation Figure . The toxHT29 cells in log phase growth were treated with loratadine (75 \u03bcM) for 24 hours prior to irradiation . A radiation dose response was clearly demonstrated with enhancement of the radiation-induced cytotoxicity by loratadine at all radiation doses Figure  resultinHT29, SF295, and DU145 cells in log phase growth were treated with loratadine (75 \u03bcM) for 24 hours prior to irradiation (6 Gy) and cell survival was assessed using a clonogenic assay. Loratadine alone was more toxic to SF295 cells  than HT29 cells  but enhanced the radiation response in both cell lines (data not shown). Despite significant toxicity to DU145 cells of loratadine alone , no increase in susceptibility to radiation-induced cytotoxicity was seen in loratadine-treated cells.HT29 cells treated with loratadine (75 \u03bcM) for 24 hours prior to treatment with Cisplatin . A Cisplatin dose response was clearly demonstrated with enhancement of the cisplatin-induced cytotoxicity by loratadine at all radiation doses Figure  resultinTo establish whether the observed effects of loratadine were being mediated by antagonism of the H1-receptor, HT29 cells were treated with loratadine with and without exogenous histamine. Exposure to histamine (100 or 1000 \u03bcM) alone for 15 minutes did not alter survival (data not shown). At both doses a cell survival of 99% was observed by clonogenic assay. Likewise, histamine did not modify the response to radiation as there was no significant difference between cells exposed to 9 Gy alone compared to those that were pretreated with histamine.\u03b3H2AX recruitment was measured by western blot in HT29 cells treated with loratadine (75 \u03bcM) for 24 hours prior to irradiation (6 Gy) then collected at 1, 6 and 24 hours after irradiation. One hour post-irradiation, \u03b3H2AX was increased in radiation-treated samples compared to unirradiated control Figure . CommensHT29 cells treated with loratadine (75 \u03bcM) for 24 hours. Loratadine was then washed off and cells were irradiated (8 Gy). Cell cycle progression was analyzed by flow cytometry after loratadine treatment, then again 6, 12, and 18 hours after irradiation. After 24 hour treatment with loratadine alone, cells exhibited a G2 block (from 14 to 37%) Figure . This G2ser345) and Cyclin B in HT29 cells treated with loratadine (75 \u03bcM) for 24 hours prior to irradiation (8 Gy). pChk1ser345 increases in response to loratadine (LR) within 6 hours after exposure, peaks at 12 hours and returns to baseline by 36 hours  but in contrast to cells exposed to radiation only, pChk1ser345 expression returns to control levels by 12 hours post-irradiation. Furthermore, Chk1 levels in cells exposed to radiation and loratadine are markedly decreased compared to cells exposed to radiation alone and even compared to controls. Cyclin B increases in irradiated cells at 8 and 16 hours post-irradiation but this response is abrogated in cells treated with loratadine.Western blots were performed to detect total Chk1, phosphorylated Chk1 (pChk1In this study, treatment with loratadine enhanced the cytotoxic effect of radiation. This effect was both time and dose dependent and occurred optimally when cells were treated with 75 \u03bcM loratadine for 24 hours prior to irradiation. Loratadine exhibited significant cytotoxicity alone and a narrow therapeutic window with little to no effect below 75 \u03bcM and profound toxicity above that dose. This radiation-enhancing effect was observable in several cell lines including colon cancer, glioblastoma, and prostate cancer lines.The mechanism by which radiation-enhancement occurred, however, appeared to be somewhat more complex than predicted based on previous studies. As might be expected, the action of loratadine on its putative target, the H1-receptor, did not appear to be play a mechanistic role as incubation with histamine did not prevent the loratadine-mediated radiosensitization. As has been previously shown , loratadThis finding is further supported by the enhancement and persistence of both the DNA fragments detected by pulsed-field gel electrophoresis and the \u03b3H2AX expression. The persistence of DNA damage may also account for the appearance of the second band of fragmented DNA that was observed on pulsed-field gel electrophoresis in loratadine treated cells Figure . It is pFinally, loratadine also generates DNA damage on its own which induces DNA repair mechanisms in the cell such as \u03b3H2AX. The pulsed field gels demonstrate the presence of double strand breaks, however since additional lower molecular weight DNA is also present, other types of DNA damage must be occurring. This DNA damage occurs at doses of 75 \u03bcM and above and it appears that this damage is required for radiosensitization as lower concentrations did not result in an increase in DNA damage or radiation-induced cytotoxicty. Since the flow DNA histograms Figure  did not Loratadine enhancement of the cytotoxic effect of radiation is both dose and time-dependent. The mechanism underlying this effect is multifactorial and involves an early promotion of G2/M cell cycle blockade which enhances radiation sensitivity, followed by abrogation of the radiation-induced G2/M arrest and premature release of DNA-damaged cells back into the cell cycle. Loratadine-induced DNA damage is also observed and is likely additive to the radiation-induced damage. Given this unique potential mechanism of action, loratadine is a potentially promising radiation modifying drug.DMF: Dose Modifying Factor; Gy: Gray; H2AX: histone 2AX; \u03b3H2AX: phosphorylated histone 2AX; HT29: human colon cancer cell line; DU145: human prostate cancer cell line; SF295: human glioblastoma cell line.The authors declare that they have no competing interests.BPS - design and performance of lab experiments, writing and editing of manuscript.NLS - design and performance of lab experiments, writing and editing of manuscript.WGD - design and performance of lab experiments, editing of manuscript.RC - performance of lab experiments.JAC - design and performance of lab experiments, editing of manuscript.JBM - design and performance of lab experiments, writing and editing of manuscript.All authors have read and approved the final manuscript."}
+{"text": "Streptococcus pyogenes produces an endoglycosidase, EndoS that hydrolyzes the chitobiose core of the asparagine-linked glycan on the heavy chain of human IgG. IgG-binding to Fc gamma receptors (Fc\u03b3R) on leukocytes triggers effector functions including phagocytosis, oxidative burst and the release of inflammatory mediators. The interactions between Fc\u03b3R and the Fc domain of IgG depend on the IgG glycosylation state.The human pathogen Here we show for the first time that EndoS hydrolyzes the heavy chain glycan of all four human IgG subclasses (IgG1-4), in purified form and in a plasma environment. An inactive form of EndoS, obtained by site-directed mutagenesis, binds IgG with high affinity, in contrast to wild type EndoS that only transiently interacts with IgG, as shown by Slot-blotting and surface plasmon resonance technology. Furthermore, EndoS hydrolysis of the IgG glycan influences the binding of IgG to immobilized soluble Fc\u03b3R and to an erythroleukemic cell line, K562, expressing Fc\u03b3RIIa. Incubation of whole blood with EndoS results in a dramatic decrease of IgG binding to activated monocytes as analyzed by flow cytometry. Moreover, the IgG bound to K562 cells dissociates when cells are treated with EndoS. Likewise, IgG bound to immobilized Fc\u03b3RIIa and subsequently treated with EndoS, dissociates from the receptor as analyzed by surface plasmon resonance and Western blot.N-glycan hydrolysis and IgG purification/detection, or as a potential immunosuppressing agent for treatment of antibody-mediated pathological processes.We provide novel information about bacterial enzymatic modulation of the IgG/Fc\u03b3R interaction that emphasizes the importance of glycosylation for antibody effector functions. Moreover, EndoS could be used as a biochemical tool for specific IgG  N-acetylglucosamine and mannose with added terminal and branching carbohydrate residues such as N-acetylglucosamine, fucose, sialic acid, and galactose  class of antibodies plays an important role in the adaptive immune defense of the human host against pathogens. IgG consists of two identical heavy chains and two identical light chains, which in turn are composed of variable and constant domains. Papain treatment of the IgG molecule generates two separate monovalent Fab fragments recognizing antigens and an intact Fc fragment, a recognition site for host receptors and a site of interaction with a number of effector molecules, including the classical complement pathway starting with factor C1q alactose  [3]. TheFc\u03b3Rs provide a linkage between the humoral and cellular immune responses. Phagocytic cells express members of three classes of IgG-Fc receptors, Fc\u03b3RI, Fc\u03b3RII and Fc\u03b3RIII, characterized by structural and functional homology and by the specific recognition site on the CH2 region of IgG Streptococcus pyogenes is one of the most common human pathogens causing pharyngitis, scarlatina and more severe infections like necrotizing fasciitis and sepsis Streptococcus pyogenes and has a specific endoglycosidase activity on native IgG by hydrolyzing the conserved asparagine-linked glycans on the heavy chains of IgG , which show enhanced hydrolytic activities on the denaturated forms of basically any glycoproteins with the appropriate N-linked glycan, or EndoE from Enterococcus faecalis that in addition to activity on the glycan of native IgG also hydrolyzes high-mannose glycans on other denatureted glycoproteins in vitros of IgG  [24], [2In the present study we elucidated the effect(s) of EndoS on IgG subclasses and IgG-Fc\u03b3R interactions. The results revealed that EndoS hydrolyses the heavy chain of all four human IgG subclasses (IgG1\u20134), both soluble and in a plasma environment. Additionally, we found that EndoS hydrolysis of the IgG glycan dramatically influences the binding of IgG to soluble, immobilized Fc\u03b3RIIa and Fc\u03b3RIIb as well as to Fc\u03b3R-expressing cells. Moreover, IgG pre-bound to these cells dissociates due to treatment of cells with EndoS. Furthermore, an inactive form of EndoS generated by site-directed mutagenesis binds with high affinity to IgG1\u20134, while the active form only transiently interacts with its substrates. These results provide novel information about the mechanisms behind enzymatic modulation of the host immune defense by bacteria, provide novel information about the molecular interactions between an IgG glycan-hydrolyzing enzyme and IgG, and emphasize the importance of IgG glycosylation for correct antibody effector functions.Lens culinaris agglutinin (LCA) lectin recognizing \u03b1-linked mannose residues  of 0.42 \u00b5M. No binding of either EndoS or EndoS(E235Q) to IgG1\u20134 subclasses, which were hydrolysed by EndoS before immobilization, was detected. These findings indicate that the intact IgG glycan is necessary for the interaction between EndoS and IgG. Furthermore, the experiments comparing the interactions between EndoS, EndoS(E235Q) and IgG indicates that EndoS binds IgG with a high affinity, but the active enzyme is instantly released after glycan hydrolysis in a \u201ctouch and go\u201d manner.We have previously partly elucidated the molecular requirements for EndoS hydrolysis of IgG. Site directed mutagenesis of glutamic acid 235 to glutamine (EndoS(E235Q)) at the proposed orifice of the catalytic tunnel abolishes enzymatic activity. In addition, chemical blocking of tryptophanes revealed that these amino acid residues are important for activity Since the nature of the interactions between Fc\u03b3Rs and the Fc domain of IgG is highly dependent on the IgG glycosylation state 125I and incubated with the K562 cells. The radioactivity of the cell pellets was measured. This revealed significantly decreased binding of radioactive IgG, originally purified from plasma treated with EndoS, to K562 cells  of EndoS glycosidase activity on the interaction between Fc\u03b3Rs and IgG. For this purpose we used an erythroleukemic cell line (K562) exclusively expressing Fc\u03b3RIIa 62 cells . In a co62 cells . Likewisth EndoS . To furtth EndoS . These rOur experiments this far have revealed that EndoS hydrolysis of IgG inhibits binding to Fc\u03b3Rs on cells and surfaces, but it remained unclear if EndoS has activity on IgG already bound to Fc\u03b3Rs and if such activity could release the IgG bound to Fc\u03b3Rs. Therefore, we investigated the effects of EndoS on IgG bound to K562 cells that had been exposed to human plasma and subsequently treated with EndoS. The cell lysates were analyzed by SDS-PAGE and Western blot using an antibody against human IgG. There was a significant binding of IgG to K562 cells as judged by the results presented in N-glycan hydrolyzing activity for IgG-Fc\u03b3R interactions. We present for the first time that EndoS specifically acts as an endoglycosidase on all human IgG subclasses, both in purified form and in a plasma environment. As expected, there is a physical interaction between the enzyme and all IgG subclasses, that we successfully demonstrated using an enzymatically inactive, mutated form of EndoS. In this study we could not separately investigate the EndoS effects on the isolated binding of IgG to Fc\u03b3RI. However, we observed that EndoS-hydrolyzed IgG did not bind to monocytes, and that there was a nearly complete dissociation of IgG from monocytes upon hydrolysis by EndoS. Since monocytes express Fc\u03b3RI and this receptor has the highest affinity for IgG, we conclude that EndoS influences IgG binding even to Fc\u03b3RI because the effects of EndoS observed must be predominantly due to involvement of Fc\u03b3RI. EndoS seems to have an effect on both isotypes of Fc\u03b3RII receptors, thus influencing both activating and inhibiting IgG mediated effector stimulation. Interestingly, IgG2 treated with EndoS, in opposite to what was observed for the other subclasses of IgG, showed increased binding to Fc\u03b3RIIb, and slightly also to Fc\u03b3RIIa, immobilized to microtiter plate. One possible explanation for this could be aggregation of IgG2 upon hydrolysis by EndoS leading to increased binding to Fc\u03b3Rs. However, no binding of IgG2 to Fc\u03b3Rs was detected using surface plasmon resonance which is in agreement with earlier publications In the present study we attempted to elucidate the physical interaction between EndoS and IgG and the physiological relevance of EndoS IgG S. pyogenes expressing this enzyme with potential modulation and/or evasion of an IgG-mediated response against the bacteria. We have previously demonstrated that EndoS treatment of human opsonizing IgG antibodies directed towards the cell-wall anchored M protein significantly enhances the bacterial survival in blood S. pyogenes, EndoS is a potentially harmful molecule to the human host that contributes to the bacterial virulence. In contrast to this, the purified form of EndoS has substantial potential as a biotechnological tool and/or a therapeutical agent that could be beneficial for future experimental science and possibly also health care.The activity of EndoS on IgG has obvious benefits for Our results reveal that EndoS possesses a capacity to inhibit the IgG binding to Fc\u03b3Rs and detach IgG bound to Fc\u03b3Rs on cell surfaces. We have recently been able to show that pre-treatment of arthritogenic antibodies abrogates development of arthritis in a mouse model of collagen-induced arthritis in vitro treatment of whole blood or purified blood cells in order to remove IgG already bound to various Fc\u03b3Rs on these cells. This could facilitate the analysis of effects of specific IgG preparations added to the cells, regarding receptor binding and cellular activation, without the interference of pre-bound IgG. The inactive form of EndoS (EndoS(E235Q)) has a great potential as a specific IgG purification and detection tool. In this study we have demonstrated that EndoS(E235Q) interacts equally well with all subclasses of IgG. This is comparable to what can be seen for protein G, one of the major molecules currently used for IgG preparation and detection We suggest two principally different biotechnological uses of EndoS, one based on the IgG-glycan hydrolyzing activity of the wild-type enzyme, and the other based on the high affinity IgG-binding of EndoS(E235Q). The active enzyme could be used for N-glycan hydrolysis and IgG purification/detection, or perhaps as a potential immunosuppressing agent that could be used to interfere with antibody-mediated pathological processes.In conclusion, EndoS is a bacterial immunomodulatory protein with a great potential. Our results provide novel information about bacterial pathogenesis, i.e. how the pathogens evade the immune system of the host organism by affecting the functions of IgG/Fc\u03b3Rs. Moreover, EndoS could be used as an important biochemical tool for specific IgG Escherichia coli harboring the plasmid pGEXndoS. When appropriate, the GST-tag was removed using Factor Xa as previously described Blood was drawn from healthy individuals and collected in heparin-containing tubes. Full-length EndoS with glutathione-S-transferase (GST) as a fusion was recombinantly expressed and purified from Lens culinaris agglutinin (LCA)-lectin  blot analysis (se below).Purified human IgG1\u20134 was hydrolyzed with GST-EndoS purified as previously described g, the supernatant was discarded and the pellet washed three times with PBS. IgG was eluated with 0.1 M glycine pH 2.0 and neutralized with 1 M Tris-HCl pH 8.0. The IgG concentration was determined to 8 mg/ml using the Advanced Protein Assay .A volume of 2 ml human plasma was incubated with 20 \u00b5g EndoS or a PBS equivalent for 1.5 hours at 37\u00b0C. The IgG fraction was purified using Protein G Sepharose . Briefly, 200 \u00b5l Protein G Sepharose suspended 1\u22361 in PBS  was added to plasma samples and incubated at 4\u00b0C for 2 hours or over night. After centrifugation for five minutes at 8000\u00d72 and 95% humidity. Nunclon flasks for cell culture were used . Cells were cultured in a serum free medium for 20 hours before being used in experiments. Monocytes were isolated from human whole blood using the Polymorphprep kit  or Ficoll-Paque Plus  according to instructions provided by the manufacturers. After isolation, the cells were counted and resuspended in PBS or RPMI-medium.The K562 cell line was cultured in RPMI 1640 medium supplemented with Glutamax-I, 100 \u00b5g/ml antibiotics (penicillin and streptomycin) and 10% fetal calf serum at 37\u00b0C in an atmosphere containing 5% CO2CO3 and 35 mM NaHCO3, pH 9.6 and kept at 4\u00b0C overnight. The plates were washed three times with lectin buffer containing 10 mM HEPES, pH 7.5, 0.15 M NaCl, 0.01 mM MnCl2, 0.1 mM CaCl2 and 0.1% v/v Tween 20 and blocked in the same buffer for one hour at room temperature. In the next step purified IgG fraction (dilution 1\u2236100) was added and the incubation proceeded for another 2 hours at 37\u00b0C. After three washes with lectin buffer, 1 \u00b5g/ml biotinylated LCA-lectin was added and incubation continued for 1 hour at 37\u00b0C. Following three more washes, 0.1 \u00b5g/ml peroxidase-labeled streptavidin (Vector Laboratories) was added and the plate was incubated for 1 hour at 37\u00b0C. The color reaction was developed with 0.1 M citric acid monohydrate, 0.1 M Na2HPO4\u00d72H2O buffer pH 4.5 containing 0.012% v/v H2O2 and 1.7 mM 2,2\u2032-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS). The absorbance was read on a model 550 micro plate reader  at 415 nm. For detection of binding of human IgG subclasses to Fc\u03b3Rs, the plate was coated with soluble Fc\u03b3RIIa or Fc\u03b3RIIb or Fc\u03b3RIIIa at a concentration 5 \u00b5g/ml for 20 hours at 4\u00b0C. Next day, the plate was blocked with PBS supplemented with 0.05% v/v Tween 20 (PBST) and 2% w/v bovine serum albumin for 2 hours at room temperature. After this step, the purified IgG subclasses, 0.1 \u00b5g of each, were added. The plate was washed three times with PBST after the coating step and between each of the following incubation steps. A peroxidase-conjugated protein G (dilution 1\u22365000)  was used for detection. The color reaction was performed as above. All experiments were made in triplicates.For glycan detection, microtiter plates  were coated with 100 \u00b5L monoclonal mouse anti-human IgG1, IgG2, IgG3 or IgG4  diluted to final concentrations of 1.5\u20130.5 \u00b5g/ml in a coating buffer containing 16 mM Na125I  using the IODE-BEADS Iodination reagent kit  according to the manufacturer's instructions. The unbound radioactivity was removed by desalting the proteins on PD-10 Sepharose . The activity of the labeled proteins was estimated to 4 \u00b5Ci/\u00b5g protein.Proteins were labelled with 0.2 mCi Na 125iodine (125I). For detection of 125I-IgG binding to K562 cells, 2\u00d7106 cells were incubated with 0.5\u00d7106 cpm of 125I-IgG or 125I-deglycosylated IgG for 30 minutes at room temperature. After five washes with PBS and centrifugations at 1000\u00d7g for three minutes, the radioactivity of the cell pellets was detected using Wallac Wizard\u2122 1470 Automatic Gamma Counter . To evaluate the specificity of the binding of radioactive IgG to K562 cells a control experiment was performed. The cells were incubated with 20 \u00b5g human IgG in addition to radioactive IgG during the similar incubation conditions as mentioned above. In another experiment, 1\u00d7106 monocytes were incubated with 0.5\u00d7106 cpm of 125I-IgG or 125I-EndoS treated IgG for 30 minutes at room temperature. After five repeated washes of cells with PBS and final pelleting of cells by centrifugation at 1000\u00d7g for five minutes, the cells were resuspended in lysis buffer containing 20 mM Tris-HCl pH 7.4, 0.150 M NaCl, 1% v/v Triton-100 and 0.25% v/v NP40 for ten minutes at 4\u00b0C. Next, the samples were centrifuged for ten minutes at 14000\u00d7g and supernatants applied on a polyacrylamide gel. After separation, the gel was dried and samples analyzed by phosphoimaging in a Fujix BAS 2000 Bioimaging analyzer . In an experiment where the binding of IgG to cells was analyzed by Western blot, 0.5\u20131\u00d7106 cells were incubated with plasma treated with either EndoS or buffer (as described above), at 37\u00b0C for 1 hour. Afterwards, the cells were washed three times with PBS or RPMI medium, resuspended in 100 \u00b5L lysis buffer and the bound IgG in cell lysates analyzed by Western blot.IgG was purified from human plasma treated with EndoS or PBS as described above and thereafter labeled with 6 and 8\u00d7106 respectively, were incubated with two ml of human plasma for 30 minutes at 37\u00b0C. The cells were washed five times with PBS and centrifuged at 1000\u00d7g for ten minutes after every wash. EndoS, 40 \u00b5g in PBS or PBS alone was added to cells and incubation followed for one hour at 37\u00b0C. Cells were washed three times with PBS and resuspended in 100 \u00b5L lysis buffer. Samples were centrifuged for five minutes at 14000\u00d7g, pellets discarded and supernatants analyzed for IgG and glycan contents using SDS-PAGE and Western blot.K562 cells or monocytes, 2\u00d710IgG1\u20134, 0.3, 015 and 0.075 \u00b5g of each in PBS were applied to PVDF membranes using a slot-blot apparatus from Schleicher and Schuell, Inc., Kene, NH 03431, USA. The membranes were incubated with PBST and 5% skim milk for 1 hour, washed with PBST and incubated with EndoS or EndoS (E235Q), 0.05 mg/ml in PBST and 5% skim milk for 1 hour. After washing, the membranes were incubated with rabbit EndoS-antiserum and subsequently with peroxidase conjugated goat anti-rabbit antibodies. The color development was made using ABTS as peroxidase substrate. All incubation steps were performed at room temperature.ak) and dissociation (dk) rate constants were determined simultaneously using the equation for 1\u22361 Langmuir binding in the BIA Evaluation 4.1 software (BIAcore). The binding curves were fitted locally and the equilibrium dissociation constants (DK) were calculated from mean values of the obtained rate constants.Receptors, IgGs and deglycosylated IgGs were diluted with 10 mM sodium acetate pH 4 and immobilized via amine coupling to different flow cells of CM5 sensorchips . Immobilization levels were optimized to around 8000\u201310000 response units. After determining EndoS(E235Q) as a non-binder to all deglycosylated IgG variants, these flow cells were considered as controls for bulk refraction index changes for EndoS(E235Q) binding to IgG1 throughout IgG4, respectively. In experiments determining IgG1-IgG4 affinity for the receptors Fc\u03b3RIIa, Fc\u03b3RIIb and Fc\u03b3RIIIa, a flow cell subjected to the immobilization protocol but without addition of protein was used as control. For affinity measurements, the binding and dissociation phases were monitored in a BIAcore 2000 instrument. In control experiments for possible mass transfer limitations, the IgGs were injected over the receptors and the EndoS variants over the IgG sub-classes at different flow rates. No differences in initial binding were observed at 5 \u00b5l/min or above indicating no limitations to any combinations. Interactants were injected in different concentrations  at 35 \u00b5l/min and 25\u00b0C over the different coated surfaces (flow cells) . Between experiments, the surfaces were strictly regenerated with pulses of running buffer containing 2 M NaCl followed by an extensive wash procedure after reaching baseline. For EndoS digestion of IgG bound to pre-immobilized Fc\u03b3RIIa, an IgG1 concentration (10 \u00b5g/ml) was chosen to give a suitable steady-state dissociation phase at a time point were the IgG1 injection was aborted and replaced by running buffer. This experiment was considered as a control and as such compared to an EndoS injection at the same time point after IgG1 binding to Fc\u03b3RIIa. After X and Y normalization of data, the blank curves from control flow cells of each injected concentration were subtracted. Where applicable, the association , IgG2 (22 mg/ml), IgG3 (16 mg/ml) and IgG4 (24 mg/ml). Five \u00b5l of this mixture was added and samples incubated for ten minutes at room temperature. In the next step 5 \u00b5l of FITC-conjugated goat anti-mouse IgG  was added before erythrocytes were lysed using the DakoCytomation Uti-Lyse erythrocyte kit . Signals were analyzed on a FACSCalibur flow cytometer . Monocytes were identified by forward scatter and side scatter characteristics (FSC/SSC).A volume of 15 ml blood was incubated with 0.4 mg EndoS or PBS for 35 minutes at 37\u00b0C. An activator of leukocytes, formyl-methionyl-leucyl-phenylalanine (fMLP), (dilution 1\u223610000)  was then added and the incubation continued for 10 minutes at 37\u00b0C. Next, blood samples were centrifuged 1000\u00d72, 0.1 mM CaCl2 and 0.1% v/v Tween 20) at room temperature and incubated with biotinylated LCA lectin (diluted 1\u22365000). After repeated washes in lectin buffer the membranes were incubated with peroxidase-labeled streptavidin (Vector Laboratories) (diluted 1\u223610000). All membranes were developed using SuperSignal West Pico  according to the manufacturer's instructions before analyzing by the Chemidoc XRS imaging system and Quantity One image analysis software (BIO-RAD).Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed using Mini Protean II cell equipment from BIO-RAD  or equipment from LKB  using the buffer system described by Laemmli"}
+{"text": "Streptococcus pyogenes are functionally related in that they both hydrolyze IgG leading to impairment of opsonizing antibodies and thus enhance bacterial survival in human blood. In this study, we further investigated the relationship between EndoS and SpeB by examining their in vitro temporal production and stability and activity of EndoS. Furthermore, theoretical structure modeling of EndoS combined with site-directed mutagenesis and chemical blocking of amino acids was used to identify amino acids required for the IgG glycan-hydrolyzing activity of EndoS.The endoglycosidase EndoS and the cysteine proteinase SpeB from the human pathogen in vitro S. pyogenes secretes the IgG glycan-hydrolyzing endoglycosidase EndoS prior to the cysteine proteinase SpeB. Upon maturation SpeB hydrolyzes EndoS that then loses its IgG glycan-hydrolyzing activity. Sequence analysis and structural homology modeling of EndoS provided a basis for further analysis of the prerequisites for IgG glycan-hydrolysis. Site-directed mutagenesis and chemical modification of amino acids revealed that glutamic acid 235 is an essential catalytic residue, and that tryptophan residues, but not the abundant lysine or the single cysteine residues, are important for EndoS activity.We could show that during growth We present novel information about the amino acid requirements for IgG glycan-hydrolyzing activity of the immunomodulating enzyme EndoS. Furthermore, we show that the cysteine proteinase SpeB processes/degrades EndoS and thus emphasize the importance of the SpeB as a degrading/processing enzyme of proteins from the bacterium itself. Streptococcus pyogenes have been extensively studied and shown to be of importance for the pathogenesis of this human pathogen (for a review see [S. pyogenes enzyme EndoS (AAK00850) has a specific endoglycosidase activity on native human IgG by hydrolyzing the conserved asparagine-linked glycans found on each heavy chain of IgG [ndoS gene encoding EndoS is present in all tested isolates, and is highly conserved. Both healthy and infected humans have circulating antibodies against EndoS, suggesting in vivo expression [S. pyogenes expressing this enzyme with modulation and/or evasion of an IgG-mediated response against the bacteria. In contrast to this, the purified form of EndoS has substantial potential as a therapeutical agent against antibody-mediated autoimmune diseases and other conditions where IgG is involved in pathological processes. It has recently been shown that pre-treatment of arthritogenic IgG antibodies with EndoS abrogates development of arthritis in a mouse model of collagen-induced arthritis [Extracellular enzymes from view see ). The sen of IgG . EndoS-an of IgG . The ndopression . In addioS AAK0080 has a srthritis .in vitro and in vivo studies, as well as clinical studies have suggested a role for SpeB as an important virulence factor [One of the most studied streptococcal enzymes is the cysteine proteinase, SpeB. Several e factor -9. SpeB e factor -17. In ae factor -20.S. pyogenes are functionally related in that they both hydrolyze IgG leading to impairment of opsonizing antibodies and thus enhance bacterial survival in human blood [EndoS and SpeB from an blood .in vitro temporal production and reveal a novel activity of SpeB; processing and eventually complete degradation of EndoS with loss of its IgG hydrolyzing activity. Furthermore, theoretical structure modeling of EndoS combined with site-directed mutagenesis and chemical blocking of amino acids identified amino acids required for the IgG glycan-hydrolyzing activity of EndoS.In this study, we further investigated the relationship between EndoS and SpeB by examining their S. pyogenes strain AP1 was cultured in a medium for optimal expression of EndoS and SpeB [and SpeB ,21, and ndoS gene was analyzed under the same conditions. This revealed that MC14 does not produce any EndoS  and anaTo further investigate the hydrolysis of EndoS, recombinantly expressed EndoS (rEndoS) was incubated with serial dilutions of SpeB. This revealed that SpeB processes rEndoS into two major fragments of approximately 62 and 46 kDa Fig. , lane E.Porphyromonas gingivalis [Clostridium tetani [Listeria monocytogenes  [Listeria spp. are essential for cellular attachment and internalization through binding of E-cadherin [EndoS contains a 37 amino acids N-terminal signal sequence that has been verified by amino-terminal sequencing , an aminngivalis , the tetm tetani , and froE, InlE)  Porphyrom3 from Elizabethkingia meningoseptica (formerly Flavobacterium meningosepticum) [3 (PDB 1EOK) as the template. The generated model of amino acids 37\u2013446 covers the active site and displays a typical (\u03b1/\u03b2)8-barrel with eight repeated \u03b2-strand/loop/\u03b1-helix units with the parallel \u03b2-strands forming an eight-stranded \u03b2-barrel   and subjrel Fig. . The puthydrates ,33. The hydrates . HypotheListeria spp. Using the same approach as for the amino-terminal part we were able to construct a model of amino acids 446\u2013577 of EndoS using the LRR region of Internalin B  from Listeria monocytogenes as a template [S. pyogenes protein has structural similarity with LRR's of internalins that are crucial for cellular invasion and virulence. Furthermore, since the concave face of other LRR's including InlB has been suggested to be a major site for protein interactions, the model of the LRR region in EndoS could be used as a starting point for finding potential cellular and protein targets in the human host.Since EndoS contains LRR's with similarities to other bacterial LRR proteins we attempted to generate a model of this region to investigate if EndoS has the potential of adopting a similar structure known to be important for protein-protein interaction and virulence in template . This mondoS gene and recombinantly expressed EndoS(E235Q). This protein was tested for activity against purified human IgG by SDS-PAGE and lectin blot analysis. This revealed that EndoS, but not EndoS(E235Q) could shift the apparent mass of the IgG heavy chain approx. 3 kDa   inhibits chitinase activity [Streptomyces griseus [3 . Furthermore, we have not been able to separate the SpeB generated fragments of EndoS using gel filtration, ion-exchange chromatography, or affinity chromatography with immobilized EndoS antibodies (data not shown).Attempts to recombinantly express the amino- and carboxy-terminal parts of EndoS separately for functional studies have this far proven unsuccessful. The amino-terminal part could be expressed in S. pyogenes LRR protein; Slr  is involved in virulence and phagocytosis resistance [Homology modeling, site-directed mutagenesis, and chemical modification experiments of EndoS suggest that the amino-terminal part contains several key elements necessary for enzymatic activity on human IgG. The function of the carboxy-terminal part remains unknown, but the observation that only full-length EndoS has activity on IgG indicates that also this part of the protein is important for the interaction with IgG, either as necessary structural element or by direct interactions with IgG. The primary and possible structural similarities between EndoS and LRR's from other pathogenic bacteria suggest that it might have similar adhesive or invasive functions either as a liberated domain or in the intact enzyme. Interestingly, another recently identified extracellular sistance . Our finsistance . A proteS. pyogenes infections, even though the attenuation seen in SpeB mutants might include loss of activity agianst IgG. There are fundamental differences between the two enzymes despite their shared substrate; SpeB is a broad spectrum protease with activities against a whole array of host proteins while EndoS is very specific for IgG. This might give a hint about their respeictive contribution to IgG hydrolysis. SpeB most likely contributes to IgG hydrolysis during infections but there will be many competing substrates that will lower the effeciency against IgG. It should also be mentioned, that S. pyogenes possesses another cysteine proteinase, IdeS, that in contrast to SpeB only hydrolyzes IgG [S. pyogenes and only comes into play when there are circulating antibodies towards the bacteria. We are currently setting up animal models to test this hypothesis. Animals will be immunized with surface structures from S. pyogenes prior to challenge with wild type bacteria and an isogenic mutant in the ndoS gene. This might help us to further elucidate the role for EndoS during infections.It is currently not known how the IgG-hydrolyzing activities of SpeB and EndoS contributes to the pathogenesis of yzes IgG . EndoS oin vitro and possibly during some conditions in vivo), researchers setting out to study EndoS are bound to experience degradation/inactivation of EndoS if not the temporal production and activity of both enzymes are taken into account.The cysteine proteinase SpeB processes, inactivates, and ultimately degrades the IgG glycan-hydrolyzing enzyme EndoS. Glutamic acid 235 in EndoS is required for glycan-hydrolyzing activity and tryptophans in EndoS are involved in the enzymatic activity on human IgG. This is important information for future studies of the function and presence of EndoS in various systems. Since SpeB and EndoS are expressed during the same conditions  [The escribed ,24; MC14 pH 7.5) . When ap.Culture supernatants were precipitated using trichloroacetic acid at a final concentration of 5% and separated by 10% SDS-PAGE  followedEscherichia coli harboring the plasmid pGEXndoS as previously described [S. pyogenes strain AP1 using ion-exchange chromatography as previously described [trans-epoxysuccinylleucylamido(4-guanidino)butane), a specific cysteine proteinase inhibitor [Lens culinaris agglutinin lectin (LCA) and 1 \u03bcg/ml of Streptavidin-Horseradish peroxidase  and SuperSignal West Pico peroxidase substrate . Membranes were analyzed using a Chemidoc XRS imaging system and Quantity One image analysis software .Full-length EndoS with (GST-EndoS) or without (rEndoS) glutathione-S-transferase (GST) as a fusion partner was recombinantly expressed and purified from escribed . The natescribed . The immescribed  for 1 honhibitor  followed3 from Elizabethkingia meningoseptica (formerly Flavobacterium meningosepticum) [3 (PDB 1EOK) as the template. The generated model was visualized using the VMD 1.8.5 software [Amino acids 37\u2013446 of EndoS was aligned with EndoFepticum)  using thepticum)  and submepticum) ,50 usingsoftware  and highsoftware  running 2HPO4, pH 4.5 for 30 minutes at room temperature. Chemical modification of cysteine residues as performed by incubating 20 \u03bcg of rEndoS with 10 mM N-ethylmaleimide (NEM) (Sigma) in 20 \u03bcl of 0.1 M citric acid-Na2HPO4, pH 6 for 30 minutes at room temperature or with 20 mM iodoacetamide (IAA) (Sigma) in 20 mM Tris-HCl, pH 8.5 for 30 minutes at room temperature. For determination of enzymatic activity, 0.5 \u03bcg rEndoS from the above reaction mixtures was incubated with 10 \u03bcg human IgG in 20 mM Tris-HCl, pH 7.4 for 2 hours at 37\u00b0C. Samples were separated by 10% SDS-PAGE and stained with Coomassie or electroblotted onto PVDF for analysis with LCA lectin blot as above.Chemical modification of tryptophan residues was performed according to . BrieflyndoS generating plasmid pGEXndoS(E235Q). Mutation was verified by sequencing. Recombinant EndoS(E235Q) was expressed and purified as described above for EndoS.Mutation of glutamic acid 235 (Glu-235) into glutamine (E235Q) was performed using QuickChange II Site-Directed Mutagenesis Kit according to manufacturer's instructions . The mutagenic oligonucleotide primers (mutation underlined) used was 5'-CCT TGA TGG CTT AGA TGT GGA TGT TCA ACA TGA TAG TAT TCC-3' for E235Q in combination with the anti-sense of the above sequences and the plasmid pGEXMA participated in the design of the study and performed the experiments. MC and AO conceived of the study and participated in its design. MC performed sequence alignments and homology modeling, and drafted the manuscript. All authors read and approved the final manuscript."}
+{"text": "This work demonstrates that cardiac energetcics is further impaired during exercise in hypertrophic cardiomyopathy. This may be a possible reason for exercise related death in HCM.In hypertrophic cardiomyopathy (HCM), sarcomere mutations increase the energy cost of contraction. Impaired resting cardiac energetics as measured by phosphocreatine/adenosine triphosphate (PCr/ATP) using 31Phosphorus MR Spectroscopy(31P MRS) has been documented in animal models and patients.We hypothesize that: 1.Cardiac energetics are further impaired acutely during exercise in HCM, which does not occur in normals or athletes ; 2. This impairment is not related to the degree of hypertrophy or late gadolinium enhancement (LGE) burden.Cardiac 31P MRS (3T) was performed in 35 HCM patients, 12 athletes and 20 normal controls  at rest and during 8 minutes of prone leg exercise with 2.5 kg weights attached to both legs. Cine and LGE images were also acquired.Increases in rate pressure product with exercise were similar: normal 72\u00b144%; HCM 73\u00b138%; Athlete 75\u00b147%.There was no difference in resting PCr/ATP between normals 2.14\u00b10.36) and athletes . Resting PCr/ATP was significantly reduced in HCM, , but no significant change in normals , and athletes  and athletes (92\u00b119g/m2) compared to normal (65\u00b110g/m2) P >0.05.There was no correlation between cardiac mass index and rest PCr/ATP ratios  or change in PCr/ATP with exercise.In HCM, average wall thickness at voxel placement for PCr/ATP was 18\u00b16mm (range 7.8-28.8 mm). This did not correlate with resting PCr/ ATP or change in energetics with exercise. Wall thicknesses were normal in the athlete group, 9\u00b12mm.Normals and athletes had no LGE. In HCM, the average LGE >2SD in the mid ventricular septum was 24\u00b115%. LGE correlated weakly with resting PCr/ATP ratio, , and did not correlate with absolute exercise or change in PCr/ATP with exercise.During exercise, the pre-existing energetic deficit in HCM is further exacerbated and is not influenced by the degree of hypertrophy or scar burden. Acute derangement of energy-dependent ion homeostasis, triggering Ca++ overload and ventricular arrhythmias, may be a possible explanation for the high incidence of exercise-related death in HCM. Treatments that optimize energetics may be protective.This research was funded by the British heart foundation."}
+{"text": "Persistent production of type I interferon (IFN) by activated plasmacytoid dendritic cells (pDC) is a leading model to explain chronic immune activation in human immunodeficiency virus (HIV) infection but direct evidence for this is lacking. We used a dual antagonist of Toll-like receptor (TLR) 7 and TLR9 to selectively inhibit responses of pDC but not other mononuclear phagocytes to viral RNA prior to and for 8 weeks following pathogenic simian immunodeficiency virus (SIV) infection of rhesus macaques. We show that pDC are major but not exclusive producers of IFN-\u03b1 that rapidly become unresponsive to virus stimulation following SIV infection, whereas myeloid DC gain the capacity to produce IFN-\u03b1, albeit at low levels. pDC mediate a marked but transient IFN-\u03b1 response in lymph nodes during the acute phase that is blocked by administration of TLR7 and TLR9 antagonist without impacting pDC recruitment. TLR7 and TLR9 blockade did not impact virus load or the acute IFN-\u03b1 response in plasma and had minimal effect on expression of IFN-stimulated genes in both blood and lymph node. TLR7 and TLR9 blockade did not prevent activation of memory CD4+ and CD8+ T cells in blood or lymph node but led to significant increases in proliferation of both subsets in blood following SIV infection. Our findings reveal that virus-mediated activation of pDC through TLR7 and TLR9 contributes to substantial but transient IFN-\u03b1 production following pathogenic SIV infection. However, the data indicate that pDC activation and IFN-\u03b1 production are unlikely to be major factors in driving immune activation in early infection. Based on these findings therapeutic strategies aimed at blocking pDC function and IFN-\u03b1 production may not reduce HIV-associated immunopathology. A persistent type I interferon (IFN) response is thought to be important in driving immune activation and progression to AIDS in human immunodeficiency virus (HIV)-infected individuals. Plasmacytoid dendritic cells (pDC) produce copious amounts of type I IFN upon virus exposure through engagement of Toll-like receptor (TLR) 7 and TLR9 and thus may be central players in the etiology of immune activation. We used a dual antagonist of TLR7 and TLR9 to selectively block the response of pDC but not other mononuclear phagocytes prior to and for 8 weeks following simian immunodeficiency virus (SIV) infection of rhesus macaques. We show that pDC are major, but not exclusive, producers of IFN-\u03b1 that mediate a marked but transient IFN-\u03b1 response in lymph nodes in the acute phase of infection. TLR7 and TLR9 antagonist prevented this IFN-\u03b1 production without suppressing pDC recruitment. Nevertheless, TLR7 and TLR9 blockade did not impact expression of IFN-stimulated genes or decrease the activation of T cells, the hallmarks of immune activation. The findings indicate that TLR7 and TLR9-driven activation of pDC is unlikely to be a major contributor to immune activation in the early stages of immunodeficiency virus infections and suggest that therapeutic strategies aimed at targeting pDC and IFN-\u03b1 production may not reduce HIV-associated immunopathology. Chronic immune activation is a driving factor in CD4+ T cell loss and disease progression in HIV-infected individuals, yet the mechanisms responsible for this process are not completely understood Plasmacytoid dendritic cells (pDC) produce copious amounts of type I IFN in response to virus exposure but their role in HIV infection appears to be complex pDC are activated by HIV and SIV nucleic acids to produce IFN-\u03b1 and TNF-\u03b1 through engagement of endosomal receptors TLR7 and TLR9 To determine if TLR7 and TLR9 blockade was effective at selectively inhibiting pDC responses to SIV in rhesus macaques, we first tested the specificity and efficacy of a TLR7 and TLR9 antagonist in vitro. Peripheral blood mononuclear cells (PBMC) and peripheral lymph node cell suspensions from healthy SIV-na\u00efve macaques were incubated with aldrithiol-2-inactivated SIVmac239 particles (iSIV) or influenza virus in the presence or absence of DV056, a 25-based single-stranded phosphorothioate oligodeoxynucleotide antagonist of TLR7 and TLR9 that contains the necessary inhibitory motifs with optimization for activity in nonhuman primates and humans We next determined the capacity of DV056 to block the response to viral RNA in rhesus macaques in vivo. We treated 4 SIV-naive macaques with DV056 at a dose of 2 mg/kg by weekly subcutaneous injections and collected PBMC 3 days after each injection for functional analyses. This drug regimen was based on preliminary studies showing that a similar dose and course of a related TLR7 and TLR9 antagonist in macaques blocked the ex vivo induction of ISG in PBMC in response to influenza virus stimulation . After a single treatment the proportion of blood pDC producing cytokines in response to virus stimulation dropped by 80 to 90%. In addition, the amount of each cytokine produced by pDC as judged by mean fluorescence intensity was substantially reduced in DV056-treated macaques . To asseAfter a total of 4 weekly doses of DV056 we infected the 4 rhesus macaques with SIVmac251 intravenously and continued weekly drug dosing up to day 53 post infection, encompassing the critical acute-to-chronic phase when immune activation is established. In parallel we infected 5 untreated macaques with the same dose of virus as controls. The kinetics of viremia were highly similar in both groups of animals, with nearly identical peak virus loads at day 11 and virus set-points at around day 70 post infection . InfectiWe next harvested PBMC from DV056-treated and control macaques and measured proinflammatory cytokine production after virus exposure ex vivo. Blood pDC from macaques that did not receive DV056 treatment had robust IFN-\u03b1 and TNF-\u03b1 production when stimulated with iSIV and influenza virus at the time of SIV infection. However, pDC from these animals rapidly lost responsiveness to virus stimulation ex vivo, and pDC hyporesponsiveness persisted into chronic infection, consistent with previous studies  [43]. pDWe next determined if DV056 treatment impacted pDC recruitment and cytokine production in lymph nodes following SIV infection. The frequency of CD123+ pDC within the Lineage\u2013 HLA-DR+ fraction of cells did not change at day 14 or 56 post infection in either DV056-treated or control animals when compared to preinfection samples . HoweverWe next evaluated the impact that DV056 treatment had on the systemic type I IFN response following infection. In macaques that were SIV-infected without concurrent TLR7 and TLR9 blockade we detected a robust and transient increase in plasma levels of IFN-\u03b1 which peaked at day 11 post infection. DV056-treated macaques had nearly identical plasma IFN-\u03b1 responses . To deteTo determine if T cell activation and proliferation were impacted by TLR7 and TLR9 blockade, we analyzed CD4+ and CD8+ T cell subsets in blood and lymph node cell suspensions in DV056-treated and untreated macaques by flow cytometry . We focuThis study is the first to directly dissect the role of innate immunity in driving immune activation in pathogenic SIV infection of rhesus macaques, a model that produces AIDS-like disease very similar to HIV infection in humans but with an accelerated time frame While pDC were found to be major producers of IFN-\u03b1 in response to SIV infection, they were not exclusive producers of this cytokine. Macrophages from na\u00efve macaques produced IFN-\u03b1 when stimulated in vitro with iSIV and were found to contribute to IFN-\u03b1 production in lymph nodes during the acute phase of infection, although as shown here for pDC, macrophages and monocytes also become refractory to stimulation following SIV infection Notably, IFN-\u03b1 production in lymph nodes was transient despite sustained high levels of virus and was temporally unrelated to chronic immune activation. In other studies, deliberately increasing levels of IFN-\u03b1 in chronically infected sooty mangabeys through exogenous injection of an IFN-\u03b1 agonist does not induce lymphocyte activation but reduces virus load We were unable to sample gut mucosal tissues for pDC activity and TLR7 and TLR9 blockade and therefore cannot rule out the possibility that pDC recruited to these tissues maintained continuous production of IFN-\u03b1 that drove ISG expression and immune activation TLR7 and TLR9 antagonist did not suppress the upregulation of CCR7 by pDC or their recruitment to lymph nodes in acutely infected macaques, despite the fact that HIV-mediated activation of TLR7 drives CCR7 upregulation in these cells An unexpected finding of our study was the significant increase in DV056-treated macaques of proliferating memory CD4+ and CD8+ T cells in blood. These increases were not associated with increased in virus load (data not shown) which is known to impact T cell proliferation Our findings support the conclusion that TLR7- and TLR9-mediated activation of pDC leads to significant and transient IFN-\u03b1 production in lymph nodes but may not by itself drive the pathologic process of immune activation. The data reinforce the findings of others This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All animal procedures were performed according to a protocol approved by the Institutional Animal Care and Use Committee of the University of Pittsburgh (protocol number: 1002392). Appropriate sedatives, anesthetics and analgesics were used during handling and surgical manipulations to ensure minimal pain, suffering and distress to animals.Macaca mulatta) were used in the study. Four macaques were treated with the dual TLR7 and TLR9 antagonist DV056 (Dynavax Technologies), by weekly subcutaneous injections at 2 mg/kg, with 4 doses prior to and 8 doses after SIV infection. All macaques were infected by intravenous inoculation with 300 TCID50 SIVmac251 . Bromodeoxyuridine  was administered by intravenous injection at 30 mg/kg at 24-h intervals for 3 days prior to collection of peripheral lymph nodes at day \u22127, 14 and 56 post infection, which were processed as previously described Nine Indian-origin rhesus macaques , CD20 , CD14 (M\u00f8P9), CD123 (7G3), CD11c (S-HCL-3), HLA-DR (L243 or G46-6), CD163 (GHI/61), CCR7 , CD4 (L200), CD8 (RPA-T8), CD28 (CD28.2), CD38 , CD95 (DX2), IRF-7  and Ki67 (B56). Flow cytometric analysis and determination of blood pDC and CD4+ T cell counts were done as described 6 cells/well for 7 h with iSIV at a capsid concentration of 200 ng/ml, virus-free microvesicles at 200 ng/ml, live SIVmac239 at a capsid concentration of 400 ng/ml , live H7N3 influenza virus  at a multiplicity of infection of 5, or CpG-C oligodeoxyribonucleotide C274 (Integrated DNA Technologies) at a concentration of 5 ug/ml with and without prior incubation of cells with 1 \u00b5M DV056 for 1 h. Data generated using microvesicles as controls showed background cytokine production similar to unstimulated cells stained with isotype control antibody. In some experiments pDC were depleted from PBMC by labeling cells with PE-conjugated antibody to CD123 followed by anti-PE microbeads (Miltenyi) and then passing cells through a magnetic column (Miltenyi). For flow cytometric analysis, cytokine secretion was blocked by addition of 5 \u00b5g/ml brefeldin-A (BD Biosciences) after 2 h.PBMC and lymph node cell suspensions were stimulated at 2.5\u00d710IFN-\u03b1 in plasma and culture supernatants was measured using a commercial ELISA  according to the manufacturer's instructions.Lymph nodes were prepared as described CTGTTTCCGCGTGCCCT (forward), GCCACAGCCCAGGCCTT (reverse); Mx-b, GAGACATCGGACTGCAGAT (forward), GTGGTGGCAATGTCCACGTTA (reverse); 2.5 OAS, AGGGAGCATGAAAACACATTTCA (forward), TTGCTGGTAGTTTATGACTAATTCCAAG (reverse); GBP-1, TGGAACGTGTGAAAGCTGAGTCT (forward), CATCTGCTCATTCTTTCTTTGCA (reverse); and ISG-54, CTGGACTGGCAATAGCAAGCT (forward), AGAGGGTCAATGGCGTTCTG (reverse). Primers and probes for ISG20 (Hs00158122_m1) were provided by Applied Biosystems.Gene expression analysis was done as previously described Comparisons between treatment groups at a single time were performed by two- or three-way ANOVA. Profiles of measurements on animals assessed at multiple times were compared using mixed effects ANOVA, with a random effect for animal and fixed effects for time and other control variables. Where appropriate, tests were performed against baseline (Day 0 or \u22127) within treatment. For analysis of T cell subsets trend was tested by treating time as a discrete variable Figure S1Quantification of cytokine-producing cells in lymph node sections. Shown are representative images of IFN-\u03b1 and TNF-\u03b1 staining of untreated animals at day 14 and day 56 post infection, respectively. Portions of actual images are shown to highlight detail. To count nuclei, the fluorescence image of Hoescht-labeling in the original confocal image (left) are converted to 16 bit, gray scale images using the MetaMorph image analysis program (Molecular Devices). Parameters for nuclear width minimum and maximum and intensity of staining relative to background are then set using this program. An image is generated producing a gray scale dot over each nucleus (middle) and the corresponding nuclear count is determined. To count cytokine+ cells, the red/green/blue images of interest are opened in the ImageJ program , and all images are adjusted for brightness and contrast. The cell counting application is launched and the image to be counted is initialized. Cytoplasmic staining that is associated with and surrounds at least 50% of a nucleus is identified and marked manually with a cursor creating a dot over the respective cell (right) and adding to a cumulative total of counted cells. The frequency of cytokine+ cells per 10,000 cells is then calculated using the formula: /total number of nuclei.(TIF)Click here for additional data file."}
+{"text": "No IFN\u03b1+ cells other than pDC were detected by intracellular staining. Blood-pDC and peripheral lymph node-pDC both lost IFN\u03b1\u2212 production ability in parallel. In blood, this phenomenon correlated with an increase in the counts of Ki67+-pDC precursors with no IFN\u03b1 production ability. In tissues, it was associated with increase of both activated pDC and KI67+-pDC precursors, none of these being IFN\u03b1+in vivo. Our findings also indicate that activation/death-driven pDC renewal rapidly blunts acute IFN\u03b1 production in vivo: pDC sub-populations with no IFN\u03b1-production ability rapidly increase and shrinkage of IFN\u03b1 production thus involves both early pDC exhaustion, and increase of pDC precursors.IFN-I production is a characteristic of HIV/SIV primary infections. However, acute IFN-I plasma concentrations rapidly decline thereafter. Plasmacytoid dendritic cells (pDC) are key players in this production but primary infection is associated with decreased responsiveness of pDC to TLR 7 and 9 triggering. IFN\u03b1 production during primary SIV infection contrasts with increased pDC death, renewal and dysfunction. We investigated the contribution of pDC dynamics to both acute IFN\u03b1 production and the rapid return of IFN\u03b1 concentrations to pre-infection levels during acute-to-chronic transition. Nine cynomolgus macaques were infected with SIVmac251 and IFN\u03b1-producing cells were quantified and characterized. The plasma IFN-I peak was temporally associated with the presence of IFN\u03b1 in vivo that plasmacytoid dendritic cells (pDC) are major contributors to IFN\u03b1 production in lymphoid tissues and, most importantly, that this production rapidly shrinks after primary infection. IFN\u03b1 production rapidly decreased as a consequence of both activation-induced exhaustion of pDC, and their replacement by pDC precursors with no IFN\u03b1 production ability. Our data indicate that pDC renewal contributes to the rapid contraction of pDC-derived IFN\u03b1 production during primary infection, which may favor the transition from acute-to-chronic infection by limiting the efficacy of innate immunity.Chronic immune activation is a characteristic of HIV infection and a key contributor to CD4 T-cell depletion and progression to AIDS. Persistent up-regulation of interferon-induced genes (ISG) is associated with chronic immune activation and is a molecular signature of the progression of SIV infection in non-human-primate models. Nevertheless, the type and tissue compartmentalization of IFN-I-producing cells at different stages of infection, and the details of the involvement of IFN-I in sustaining chronic immune activation remain elusive. Using the cynomolgus macaque model of progressive SIV infection, we demonstrate  HIV-1 infection is characterized by chronic immune activation, a major cause of CD4 T-cell depletion and HIV/SIV-specific immunity dysfunction, and facilitating viral replication and progression to AIDS Acute interferon-alpha (IFN\u03b1) production is observed in both lymphoid and non-lymphoid tissues during primary Simian Immunodeficiency Virus (SIV) infection (PSI) Plasmacytoid dendritic cells (pDC) are bone marrow (BM)-derived antigen-presenting cells that are central to innate and adaptive immunity In vitro, pDC are activated by HIV/SIV particles in vivo by pDC: in the vaginal mucosa early after exposure de novo re-stimulation with SIV and HSV in vivoin vitro data showing that stimulation of human pDC by HIV leads to persistent IFN\u03b1 production and the acquisition of a partial activation phenotype, but not a refractory stage, as a result of HIV trafficking through a specific intra-cellular pathway in these cells In contrast, pDC are quantitatively and functionally affected by HIV/SIV infection. During HIV infection pDC counts correlate negatively with viremia + BM-derived pDC precursors during acute infection Plasmacytoid DC turnover is increased during acute infection In this study, we investigated the involvement of pDC in IFN\u03b1 production in blood and tissues during the early stages of SIV infection in cynomolgus macaques (CyM) and studied the role of pDC sub-population dynamics in IFN\u03b1 production. We report that pDC are major cell type responsible for the massive IFN\u03b1 production during acute infection in both lymphoid tissues and gut in this species, and show that pDC dynamics, including both activation-driven exhaustion and increased renewal by bone marrow derived pDC precursors with no IFN\u03b1 production capacity, accounts for the rapid decline of pDC responsiveness and consequent shut-down of acute IFN\u03b1 production.+ T-cell counts on day 28 were significantly below baseline levels (mean: 72.23%\u00b112.57% of baseline) . Significant CD4+ T-cell count decline was observed in all animals, except #30742   with CD4t #30742 , and chrt #30742  was alsoThere was a transient increase in the plasma IFN-I activity , coincidThese data show that despite dynamic changes in pDC numbers in primary infection these cells do not show any activation in the blood.PLN were studied in the nine SIV-infected macaques of the longitudinal study. All were sampled at baseline, three on days 7, 8 and 9 p.i., and six on days 8, 9, 35 and month 3 (M3).+ pDC could hardly be detected in PLN at baseline by direct ex vivo intracellular staining, but were significantly increased in PLN on days 7, 8  and 9  p.i.    p.i. . On and =\u200a0.031)  A. IFN\u03b1 =\u200a0.003)  B. TheseRNA load  and IFN\u03b1RNA load   euthanized on day 10 p.i., and one non-infected control . Intracellular staining was used to track IFN\u03b1-producing cells. IFN\u03b1-producing pDC were detected in spleen, mesenteric LN, and some colon and ileum biopsies from these animals . The perAdditional colon samples from 4 na\u00efve macaques, 4 SIV-infected macaques at day 9 p.i., and 4 SIV-infected macaques in chronic infection, revealed increased pDC numbers in the colon on day 9 p.i., which persisted in chronic infection (data not shown). Remarkably, although the numbers of pDC were significantly increased in colon, numbers of pDC remained about ten fold lower than in lymph nodes. Intracellular IFN\u03b1 was evidenced in colon pDC in day 9 samples, within the same range (1.5 to 4%), but were not detectable in chronic infection (data not shown).in vitroInterestingly, in BM, which mostly contains pDC precursors that do not produce IFN\u03b1 upon stimulation These findings show that pDC are also major producers of systemic IFN\u03b1 in various lymphoid and mucosal tissues during acute infection in CyM, and show persistent homing of pDC to the gut in the chronic phase.high pDC in LN led us to analyze pDC activation further. The expression of CD40, CD86 and CD95 was studied by flow cytometry (high expression (data not shown). An increase of CD95 expression was also observed and exceeded that of activated cells , suggesting that expression of these activation markers are later events than IFN\u03b1 production, reminiscent of the kinetics we observed following TLR7/8 stimulation in vitro (data not shown). The large increase of CD95 expression on pDC was confirmed in all tissues explored including BM, spleen, LN and gut, and was associated with increased pDC death (+) was much lower than that of CD95+pDC.The increase of CCR7ytometry . In non-ytometry . Activated cells . Indeed,henotype . Remarkare CD86+  or CD40+DC death  althoughOverall, the complexity of pDC phenotype in tissues suggests successive stages in pDC activation leading to immediate but transient IFN\u03b1 production followed by a slower increase of the expression of activation markers, which is associated with a massive increase of both CD95 expression and cell death.+ pDC in both peripheral blood and PLN of Rhesus Macaques (RhM) during acute infection as a consequence of LN homing +pDC in the blood during acute infection than in baseline    , and thi=\u200a0.006) . This su+ and CD34+pDC among total pDC were higher in BM than in peripheral blood  and rectum  , or increased proportions of late-stage pDC precursors lowHLA-DRintCD123high), pDC-b was CCR7lowHLA-DRlowCD123low resembling BM pDC, and pDC-c was CCR7highHLA-DRhighCD123low/high, and was most likely activated/matured pDC. The frequency of PDC-a/immature pDC significantly decreased after infection as the pDC-b/HLA-DRlow late precursors and pDC\u2013c/activated-matured populations increased  ; this suy 9 p.i. , and in y 9 p.i. : this mancreased . Althougncreased , remarkaint/high , were IFN\u03b1+, consistent with their pDC precursor profile. Similar patterns were observed in all tissues in which IFN\u03b1+ pDC were detected , but matured cells remained consistently IFN\u03b1\u2212. The simultaneous increase of these sub-populations in lymphoid tissues coincided with a decrease of IFN\u03b1+ pDC in LN, which most likely contributes to the observed rapid decline of the IFN\u03b1 concentration in plasma, at a time when virus replication is still high. The rapid blunting of acute IFN\u03b1 production at around the time of peak viral load may reduce pDC antiviral efficacy, favor the spread of the virus and facilitate the formation of viral reservoirs. Increased pDC renewal during acute infection in our model is associated with massive CD95/Fas death receptor up-regulation on pDC and increased pDC death in all tissues studied, mostly observed during acute infection. Increased apoptosis of pDC has also been reported in HIV-1 infection in vivo by inducing apoptosis in vivoin vivo in light of a recent report that mDCs are more prone to undergo apoptosis in response to death ligands during acute SIV infection The major finding of this study is the contribution of the dynamics of pDC sub-populations to the regulation of IFN\u03b1 production during acute infection. We show that transient impairment of pDC function during acute infection is a consequence of the increase of pDC precursors as a proportion of the circulating pDC pool. Previous studies showed that engagement of TLR-9 in vitroin vitroAnother finding in our study is that pDC are strongly activated in PLN during acute infection, displaying CD86 and CD40 co-expression as well as HLA-DR and CCR7 up-regulation. This further implicates pDC in the immune response to HIV/SIV infection. Only partial pDC activation during the chronic stage of HIV-1 infection has been described in vivo, may also be relevant to other chronic viral infections when strong pDC activation and death occurs. Further exploration of pDC functions are needed to unravel their complex involvement in early anti-viral immunity and understand their contribution to HIV/SIV induced inflammation and pathogenesis.To conclude, we show for the first time that the dynamics of pDC renewal, which is associated with recruitment, activation and death in lymphoid tissues, reflects the transient decrease of their capacity to produce IFN\u03b1 in response to SIV during acute infection. Our results shows that this mechanism contributes to pDC unresponsiveness and likely blunt acute IFN\u03b1 production during primary SIV infection, a mechanism probably transposable to human HIV-1 primary infection in which similar transient pDC deficiency was reported Macaca fascicularis) were imported from Mauritius and housed in the facilities of the \u201cCommissariat \u00e0 l'Energie Atomique et aux Energies Alternatives\u201d . Non-human primates  are used at the CEA in accordance with French national regulations and under the supervision of national veterinary inspectors (CEA Permit Number A 92-032-02). The CEA complies with the Standards for Human Care and Use of Laboratory Animals, of the Office for Laboratory Animal Welfare  under OLAW Assurance number #A5826-01. All experimental procedures were conducted according to European guidelines for animal care . The use of NHP at the CEA is also in conformity with the recommendations of the newly published European Directive . The animals were used under the supervision of the veterinarians in charge of the animal facility. This study was scientifically reviewed and granted by the \u201cAgence Nationale de Recherches sur le SIDA et les h\u00e9patites virales\u201d and was accredited under statement numbers 12-007, 12-048 and 12\u2013103, by the ethical committee \u201cComit\u00e9 d'Ethique en Exp\u00e9rimentation Animale du CEA\u201d registered under number 44 by the French Ministry of Research.Adult CyM (50) of the isolate SIVmac251. Virus stock was kindly provided by Dr. A.M Aubertin . The experimental design and schedule of sampling are described in 3EDTA tubes . BM aspirates were taken at the iliac crest by punction. Tissue samples were collected in PBS containing 10 \u00b5g/mL Brefeldin A  or snap frozen in liquid nitrogen for storage at \u221280\u00b0C. Two macaques were sacrificed 10 days after infection by intravenous injection of 180 mg/kg sodium pentobarbital  after general anesthesia with ketamine, and samples of spleen, ascending and descending colon, and mesenteric lymph nodes were harvested.Male CyM weighing 5 to 10 kg were used. Fourteen animals were intravenously administered 5,000 animal infectious dose 50%  and mechanically disrupted with a 30-mL syringe equipped with an 18-gauge blunt-end needle and passage through a 70-\u00b5m-pore cell strainer. Cells were then isolated on a 44%/67.5% Percoll gradient Plasma was isolated from EDTA blood samples by centrifugation for 10 min at 950 g, and cryopreserved at \u221280\u00b0C. Experiments were performed on PBLs or suspensions of single cells extracted from tissue. PBLs were isolated from blood samples after red blood cell lysis by hypotonic shock and washing in PBS. Peripheral and mesenteric lymph node cells, and spleen cells, were obtained by mechanical dissociation using GentleMACS dissociator . Suspensions were passed through a 70 \u00b5m-pore size cell-strainer, washed with PBS and red blood cells were lysed. Additional density gradient isolation was used for spleen cells before red blood cell lysis. Cell counts were determined with a Vi-CELL . Suspensions of colorectal tissue cells were obtained from sacrificed animals by a protocol used for humans 6 isolated LN cells were stained for dendritic cells. Aliquots of 50 \u00b5l of whole blood were stained for lymphocytes. All stainings, other than of whole blood, were performed after saturation of Fc receptors with healthy macaque serum (in-house production) for 20 min at 4\u00b0C. To evaluate cell viability and exclude dead cells from analysis, samples were incubated for 15 min with the amine-reactive dye Live/dead Fixable blue using a commercial dead-cell staining kit (Life technologies). Cells were then labeled with monoclonal antibodies (+HLA-DR+ in lineage\u2212 cells as previously described PBL isolated from 500 \u00b5l of blood or 2\u20134\u00d710tibodies  for 15 m6 LN cells were incubated at 37\u00b0C for 30 min with 10 \u00b5g/mL of Brefeldin A (Sigma-Aldrich). Fc receptor saturation and dead cell staining were performed as described above before intracellular labeling of IFN\u03b1. All steps were as previously described For intra-cellular IFN\u03b1 labeling, cells isolated from 500 \u00b5l of blood or 2\u20134\u00d710A BD LSRII apparatus equipped with four lasers  was used to acquire data, and data was analyzed with FlowJo v7.6  or Infinicyt v1.6  software.For longitudinal follow-up, acquisition was performed after calibrations with fluorochrome-tagged beads (BD cytometer setup and tracking beads) and using automated application settings. Additionally, fluorescence minus one controls were performed at each time point as intra assay control. For some experiments, flow data were formatted with Pestle v1.6.2 software  to facilitate the use of SPICE v5.2 +CD3+ gate was multiplied by the lymphocyte count. Absolute pDC counts were determined as the product of total leukocyte counts and the percentage of pDC in the CD45+ gate.Absolute counts were calculated from lymphocyte counts obtained by automated cell counting  combined with flow cytometry data: for lymphocyte counts, the CD4 and CD8 cells as a percentage of the CD45PBL prepared from 300 \u00b5l of blood were cultured for 24 h in RPMI-1640 medium with AT-2-inactivated SIVmac239  in a final volume of 200 \u00b5l. Supernatants were collected and stored at \u221280\u00b0C until use for IFN-I titration. Negative controls included using the same concentration of AT-2-treated SupT1 micro vesicles. AT-2-inactivated SIVmac239 (ARP1018.1) and its negative control (ARP1018.2) were obtained from Dr Jeff Lifson , through the EU Program EVA Centralized Facility for AIDS reagents .Tissue lysates were obtained by mechanical disruption of tissue samples in RLT buffer  with a Precellys system, using 18 CK tubes and ceramic beads . Tissue lysates were diluted to 30 mg/mL in RLT buffer, aliquoted and stored at \u221280\u00b0C. Tissue lysates were passed through a QiaShredder (Qiagen) for homogenization, and total RNA was extracted using RNeasy MiniKits (Qiagen) according to the manufacturer's recommendations. To avoid genomic DNA contamination, an additional DNAse step was included after the RNAse-free DNAse Set (Qiagen) used according to the kit instructions. The QuantiTect Rev-Transcription kit (Qiagen) was used to produce cDNA.50. The IC50 was defined as the concentration that was required for 50% protection against VSV-induced cytopathic effects.Quantitative RT-PCR was used to assay IFN\u03b1. Briefly, the Quantitect Rev-transcriptase Kit (Qiagen) was used to synthesize cDNA, and pre-PCRs were run in triplicate for each sample using FastStart Taq DNA polymerase . A preparation of a plasmid containing macaque IFN\u03b1 or IFN\u03b2 gene of known concentration was amplified during pre-PCR runs as a standard for subsequent qPCR amplification. Quantative PCR was performed with each sample on a Lightcycler using SYBRgreen (Roche) and 0.2 \u00b5l of FastStart Taq (Roche) in a final volume of 25 \u00b5l. Primers  consensuPlasma and tissue vRNA was assayed as previously described Some sets of data were visualized with Tableau Desktop 7.0 software  before statistical analysis. The nonparametric Spearman rank correlation test was used to investigate the relationship between variables. The nonparametric Mann-Whitney test was used to compare groups of macaques after validation with the Kruskall-Wallis test, and the nonparametric Wilcoxon rank sum test was used to compare dependent data (same macaques at different time points) before and after SIV infection. GraphPad Prism 5.03 software  was used for all statistical analyses. In 2-tailed tests, p values of 0.05 or lower were considered significant.Figure S1Schematic diagram of the experimental design.(TIF)Click here for additional data file.Figure S2+ cells.Gating strategy for counting pDC and identification of IFN\u03b1 (A) Gating strategy used for counting pDC in PBL. pDC were identified as CD45+ HLA-DR+ Lineage negative CD123+ cells within a morphological SSCdim/high gate after exclusion of doublets and exclusion of dead cells. Backgated pDC are shown in blue. (B) Gating strategy used to follow IFN\u03b1 expression in different cell lineages in PBL. Gating strategy for DC and monocytes: SSCdim/high population, exclusion of CD3+ T cells (upper panel), gating on HLA-DR+ cells and exclusion of CD20+ cells (middle), pDC were identified as CD123+, mDCs as CD11c+ and monocytes as CD14+. Gating strategy for B cells, T cells and NK cells: SSClow population, NK cells were gated as CD3\u2212CD8+, CD8+ T cells as CD3+CD8+, CD4+ T cells as CD3+CD8\u2212, B cells as CD3\u2212CD20+HLA-DR+. (C) Gating strategy used to define DC and macrophage cell populations in lymph nodes. Intracellular staining for IFN\u03b1 was performed ex vivo after 30 min of incubation in 10 \u00b5g/ml Brefeldin A with no stimulation.(TIF)Click here for additional data file.Figure S3Local viral load drives IFN\u03b1 production by pDC in peripheral lymph nodes. (A) Relative SIVgag mRNA abundance in peripheral lymph nodes at various times after infection. The fast progressor macaque is shown in red and slow progressor in green. ULD\u200a=\u200aUnder the limit of detection. (B) Relative IFN\u03b1 mRNA abundance correlates with relative SIVgag mRNA abundance in peripheral lymph nodes . Spearman correlation.(TIF)Click here for additional data file.Figure S4(A) Evolution of the percentage of each pDC subpopulations identified by PCA following SIV infection . (B) Changes in CD123 expression levels on pDC-a between baseline and day 9 post-infection.(TIF)Click here for additional data file.Table S1Timeline of blood sampling and tissue biopsies, in macaques that were infected by SIV. All sampling time-points are expressed in days except M3 (month 3). n.d: not done. (\u00a7) indicates macaques that were sacrificed at 10 days post infection for additional tissue collection including bone marrow, spleen, peripheral lymph nodes, mesenteric lymph nodes, colon, ileum. Lymph nodes from macaques 30602, 30690 and 30044 were used for assaying pDC function only.(DOCX)Click here for additional data file.Table S2Monoclonal antibodies used for immunophenotyping. Targeted clusters of differentiation, clones, fluorochromes and commercial origin of antibodies are indicated.(DOCX)Click here for additional data file.Table S3Sequences of primers used for qPCR. Sequences of forward and reverse primers used for qPCR are indicated. Primers used for Pre-PCR (OUT) and qPCR (IN) are specified.(DOCX)Click here for additional data file.Table S4Probes used to quantify SIVgag and GAPDH mRNA expression. Sequence is given for each probe used for quantification.(DOCX)Click here for additional data file."}
+{"text": "Unsaturated fatty acids accounts (80.7%), of which 48.2% and 27.7% were linolcic and linolenic, respectively, which make suitable for production of biodiesel. Seed has higher nutrient composition, low antinutritional elements and high calorie value compared to some legumes.Still there is no scientific report about the proximate analysis of seeds and characteristics of oil produced from brebra seed. Objective of this study was to determine proximate and antinutritional characteristics of seeds as well as the physicochemical characteristics of brebra seed oil. Crude oil, protein, fiber, ash, moisture and carbohydrate content of brebra were 48.5\u2009\u00b1\u20090.99%, 29.7\u2009\u00b1\u20090.23%, 2.41\u2009\u00b1\u20090.12%, 3.24\u2009\u00b1\u20090%, 4.24\u2009\u00b1\u20090.04% and11.92\u2009\u00b1\u20090.2%, respectively. Seed has concentrated energy . The respective tannin, oxalate and phytic acid value were 84.3\u2009\u00b1\u20090.89\u00a0mg/100 gm, 20.97\u2009\u00b1\u20090.36\u00a0mg/100 gm and 291.62\u2009\u00b1\u20090.87\u00a0mg/100 gm, respectively. Cyanide was not detected in the sample. Seed contains high concentration of phosphorus (1062.1\u2009\u00b1\u20090.3\u00a0mg/100\u00a0g), potassium (281\u2009\u00b1\u20090.1\u00a0mg/100\u00a0g), magnesium (112.38\u2009\u00b1\u20090.1\u00a0mg/g), sodium (93.26\u2009\u00b1\u20090.1\u00a0mg/g) and calcium (61.55\u2009\u00b1\u20090.01\u00a0mg/g). The oil was analyzed for specific gravity at 20\u00b0C, viscosity at 40\u00b0C, refractive index at 40\u00b0C, acid value, saponification value, iodine value, peroxide value and ester value. Their respective values were 0.942, 40.59\u00a0mm Millettia ferruginea (Hoechst.) Baker is a useful endemic tree species of Ethiopia with great potential for agroforestry. It is belonging to the family Fabaceae (Leguminosae) sub-family Papilionnodeae. This plant is known to have two subspecies, namely, ferruginae and darassana  within the range of 1,600 and 2,500\u00a0m above sea level. The hybrid of the two subspecies believed to be found in the central and western part of Ethiopia , Ensete ventricosum Welw.) Cheeeman, maize (Zea mays L.), sorghum (Sorgum bicolor (L.) Moench s.l. and coffee (Coffea arabica L.) in the Wendo-Genet, Sugallae and Sokicha areas (Southern Ethiopia). According to Muleta (Millettia ferruginea had the highest frequency of occurrence (22.3%). Soil near Millettia ferruginea tree is found to be rich in nutrient  is considered important than that of using edible vegetable oil for biodiesel. Still there is no scientific report about the proximate analysis of seeds and characteristics of oil produced from brebra seed. Therefore, the main objective of this study was to determine proximate and antinutritional characteristics of seeds as well as the physicochemical characteristics of brebra seed oil. Such information may expand the scope of knowledge on the utilization and quality of the extracted oil and oilcake of the seed for different purposes.o Muleta , from 14Millettia ferruginea in Amharic. This Amharic name was literally inherited from behavior of the mechanism of seed dispersal nature, which is the seed mechanically dispersed about 20 meters in average far from the tree in explosive manner. This nature of seed dispersal mechanism poses a problem for seed harvesting. To overcome harvesting problem, the matured pale yellow pods were collected from the tree and covered with teff straw for certain period of time to accomplish its maturity. After maturation, the pods were put into a fiber sac to facilitate aeration and dried there in the sac and lastly released seeds collected in the sac. Fiber sac can provide free ventilation of air in order to avoid deterioration of seed quality by fungi. This method was originally adopted from the society. It is well known that Millettia ferruginea contains a chemical compound that is found to be toxic for fish is known as rotenone  seed was harvested. From an average sized tree, about 150\u00a0kg of pods containing seeds can be harvested. From a single tree it is possible to produce 37.5\u00a0kg seeds. From one hectare of land in average it is possible to plant about 35 trees. Therefore, from one hectare land one can harvest 1350 Kg dry weight of seeds. The whole process of harvesting and extraction of oil is shown on Figure\u00a0Crambe abyssinica oil seed, 45.4  is higher than 3.12 Kcal/gm in eds Ekop  and 5.46The moisture value of the oil in this study which was 4.24% is somehow low when compared with the value of moisture of legumes ranging between 5.0% and 11% reported in the literatures  was found to be relatively high in comparison with tannic acid found in some literatures  is found to be less than the viscosity of cashew nut oil (56\u00a0mm2/s)   which is greater than the range of 77\u201394 gI2/100 gm olive oil, 8\u201310 gI2/100 gm coconut oil, 12\u201318 gI2/100 gm palm kernel, 44\u201358 gI2/100 gm palm oil, 85\u201395 palme oleine, 20\u201345 gI2/100 gm palme stearine, 50\u201360 gI2/100 gm tallow, 60\u201370 gI2/100 gm lard, (http://dec2.tec.agrar.tu-muenchen.de/pflanzoel/rkstandarde.html) 44.4 gI2/100 gm cashew nut oil   for more than a week and then collected in the fiber sac, which is used to ventilate in order to avoid spoilage by fungi. The matured seeds were selected in order to improve the oil meal quality and to increase the capacity and efficiency of the extraction plant. The seeds were dried by using oven at 60\u00b0C more than 8\u00a0hr. The moisture content of the seed was determined by heating at 110\u00b0C for 24\u00a0hr in an oven by the procedure described by AOAC  pods of brebra from the study plant were collected and covered with the straw of teff  and the internal standard and additional amino acid standards were obtained from Phenomenex ,  and Sigma , respectively.To determine total amino acid, 15\u2009\u00b1\u20090.03\u00a0mg sample was mixed to 1.00\u00a0ml 6\u00a0N HCl in 2\u00a0ml screw cap vial. The caps were taped in place with autoclave tape and heated in an oven at 110\u00b0C, 24\u00a0h. On removal from the oven, samples were cooled and 100\u00a0\u03bcL 0.75\u00a0mM norvaline solution added. Samples were mixed thoroughly and evaporated in a centrifugal vacuum concentrator (ThermoSavant). The residue was reconstituted in 1\u00a0ml distilled water and filtered through a 0.2\u00a0\u03bcM PTFE syringe filter  into a fresh vial. A 50\u00a0\u03bcl portion was transferred to a reaction tube (supplied with the EZFaast kit) and the solvent removed in a centrifugal sample concentrator (ThermoSavant).2O: MeOH added. Samples were heated at 50\u00b0C, 10\u00a0min, and cooled for 2\u00a0min and centrifuged at 13400\u00a0rpm for 10\u00a0min. Lastly, 750\u00a0\u03bcL supernatant was transferred to a reaction tube (supplied with kit) and the solvent removed in a centrifugal sample concentrator (ThermoSavant). Sample residues were stored, desiccated at -18\u00b0C.In free amino acid analysis, 15\u2009\u00b1\u20090.03\u00a0mg sample was transferred to a 1.5\u00a0ml microfuge tube and 1\u00a0ml, 0.075\u00a0mM norvaline solution in 80:20 H2O: MeOH with vortexing to ensure complete dissolution. Amino acids were isolated from the samples by ion exchange and derivatized to their propyl-chloroformate derivatives according to the protocol supplied with the EZFaast\u2019.Samples were reconstituted in 0.2\u00a0ml 80:20 HSamples were analysed on a Hewlett Packard 5975C Inert MSD coupled to a 7890A Gas Chromatograph fitted with a Zebron Amino acid ZB-AAA column, split/splitless injector and MPS2 automatic liquid sampler. Two \u03bcl splitless injections were adjusted at purge time of 2\u00a0min with purge flow rate of 20\u00a0ml/min and an injector temperature was maintained at 220\u00b0C. The oven was programmed from 75\u00b0C (2.0\u00a0min) to 320\u00b0C (1.83\u00a0min) at 30\u00b0C/min was used with helium as the carrier gas at 9.5 kPa (1.4\u00a0ml/min), constant pressure. The source, quadrupole and transfer line temperatures were set at 230\u00b0C, 150\u00b0C and 320\u00b0C, respectively. Mass spectra were acquired at 70\u00a0eV over 45\u2013450\u00a0m/z from 3\u201312\u00a0min with an acquisition rate of 3.5\u00a0Hz.-1\u00a0F.W. and 0\u20132667\u00a0nmol.mg-1\u00a0F.W.  were prepared and analysed alongside the samples.Data were quantified on the basis of extracted ion chromatograms (EIC) using the QuanLynx module of MassLynx 4.0 . The results were exported to Microsoft Excel (2003) and sample means and 95% confidence intervals (n\u2009=\u20095) were calculated for the free and total amino acid composition of the flour sample. Calibration curves from 0\u201326667 pmol.mg3 solution. The concentrations of Na, Ca, Mg, Fe, P, K, Zn, Cu, Fe, and Mn was determined using atomic spectrophotometer (Buck Science) absorption, following the method of Angelucci and Mantovani 3 equivalent. The amount of phytate phosphorus content was calculated from the standard curve by assuming that 4:6 iron to phosphorus molar ratio.Phytic acid composition was analyzed according to Wheeler and Ferrel  by usingTo determine oxalate in brebra seed flour, the samples were separated into two fractions using the following procedure: two grams of finely grounded brebra seed flour was extracted with 100\u00a0ml of boiling distilled water for 30\u00a0min, filtered and adjusted to 200\u00a0ml. On the other hand, the hot water extract residue was further extracted with 150\u00a0ml of boiling 1\u00a0M HCl for 30\u00a0min, adjusted to 200\u00a0ml and filtered. The two filtrates were combined together. The content of oxalate in the two fractions was analyzed based on the method of AOAC  with theThe content of cyanide in brebra seed flour was determined by the amount of HCN released on hydrolysis. Brebra seed flour extract was obtained by homogenizing 30 gm of flour in 259\u00a0ml of 0.1\u00a0M orthophosphoric acid for 5\u00a0min. The homogenate was centrifuged at 2,500\u00a0rpm for 20\u00a0min and clear supernatant was taken. An aliquot of the supernatant was used for determination of hydrogen cyanide using an auto analyzer Technicon AAII, according to the method of Rao and Hahan .After extraction of the oil, it was filtered to remove non-oil materials. A layer of sodium sulfate crystals was added to a flask and crude oil was added to remove any trace water. The dry agent was separated by decanting and filtration. The physicochemical determination of the oil for iodine value, saponification value and peroxide value were carried out according to the methods of AOAC . Acid vaThe fatty acid profile was determined as fatty acid esters by gas chromatography. The sample methyl esters were prepared using the method used by the IOOC , averaging out these relationships for all the methyl esters .Determination of physical characteristics such as moisture, specific gravity and density, Kinematic viscosity, refractive index and pH value were carried out according to the methods of ASTM .Bothe B-A and A-G are Associate Professor and most of the time we are engaged in research and management of different research projects."}
+{"text": "Cleft palate is a common congenital disorder that affects up to 1 in 2500 live births and results in considerable morbidity to affected individuals and their families. The aetiology of cleft palate is complex with both genetic and environmental factors implicated. Mutations in the transcription factor p63 are one of the major individual causes of cleft palate; however, the gene regulatory networks in which p63 functions remain only partially characterized. Our findings demonstrate that p63 functions as an essential regulatory molecule in the spatio-temporal control of palatal epithelial cell fate to ensure appropriate fusion of the palatal shelves. Initially, p63 induces periderm formation and controls its subsequent maintenance to prevent premature adhesion between adhesion-competent, intra-oral epithelia. Subsequently, TGF\u03b23-induced down-regulation of p63 in the medial edge epithelia of the palatal shelves is a pre-requisite for palatal fusion by facilitating periderm migration from, and reducing the proliferative potential of, the midline epithelial seam thereby preventing cleft palate. Jag2-induced periderm migration to the oral and nasal epithelial triangles. In addition, p63 plays a central role in maintaining the proliferative potential of the basal layer of the medial edge epithelia. Our study provides significant new insights into the mechanisms that regulate development of the palate by establishing the role of p63 in governing the fate of the midline epithelial cells.Cleft palate is a serious congenital condition which affects approximately 1 in every 2500 births. Cleft palate occurs when the palatal shelves fail to grow, adhere or fuse during development. Mutations in the gene encoding the transcription factor p63 result in cleft palate in humans and mice. However, the role of p63 and how it controls the network of genes to regulate palate development is not well understood.In this study, we demonstrate that p63 controls the spatio-temporal regulation of palatal epithelial cell fate to ensure appropriate palatal adhesion: p63 induces the formation of a flattened layer of epithelial (periderm) cells and controls its subsequent maintenance. We also demonstrate that TGF\u03b23-induced, down-regulation of p63 in the medial edge epithelial cells, through which the palatal shelves adhere and fuse, controls  Cleft palate is a common congenital anomaly with a prevalence estimated at 1:2500 live births, that results from failure of growth, elevation, adhesion and/or fusion of the palatal shelves during embryogenesis [In mice, development of the secondary palate mirrors that of humans; consequently, the mouse is the main model organism for the study of mammalian palatogenesis . In miceAlthough the epithelia of the vertical palatal shelves are in intimate contact with the mandibular and lingual epithelia, pathological fusions between the palate and the mandible and/or the tongue are rare \u20138. NeverTP63 gene encodes at least six protein variants. Different promoters produce two alternative N-termini; TA-isoforms which contain a transactivation sequence and \u0394N-isoforms which possess a shorter activation domain [Fgfr2 to control epithelial and mesenchymal proliferation during palatal growth [Irf6 to regulate palatal fusion [Mutations in the gene encoding the transcription factor p63 result in cleft palate in humans and mice ,14. The n domain . In addin domain . All ison domain \u201317. \u0394Np6n domain , is exprn domain . Despitel growth , cell adl growth ,22, and l fusion , it is uTgfb3-/- mutant mouse, which exhibits cleft palate [in vivo results in sub-mucous cleft palate. In addition, we show that \u0394Np63\u03b1 plays a central role in the spatio-temporal regulation of palatal epithelial cell fate to ensure appropriate adhesion and fusion of the palatal shelves, thereby preventing cleft palate.In the current paper, we use the well-characterized t palate , to demoTgfb3-/- mice which exhibit cleft palate and persistent periderm cells over the MEE [Tgfb3-/- mice genetically. Initially, we generated Tgfb3+/-;p63+/- compound heterozygous mice which did not exhibit any gross abnormalities and in which fusion of the secondary palate proceeded normally. These mice were inter-crossed with Tgfb3+/- mice to generate Tgfb3-/- embryos which were also heterozygous for p63. Histological analysis demonstrated that up to E13.5 palatal development progressed normally in wild-type, Tgfb3-/-, and Tgfb3-/-;p63+/- mice . Although 6.9% (n = 2/29) of Tgfb3-/-embryos displayed a small degree of palatal shelf fusion which was restricted to the anterior region of the secondary palate, this difference is statistically significant  and supports the hypothesis that epistatic down-regulation of p63 in Tgfb3-/- embryos rescues the cleft palate phenotype.As p63 expression is maintained in the MEE of  the MEE ,19,23,24+/- mice . In cont+/- mice  and E15.+/- mice  Tgfb3-/-Tgfb3-/- and Tgfb3-/-;p63+/- mice in greater detail. At E13.5, palatogenesis in Tgfb3-/- and Tgfb3-/-;p63+/- mice was comparable to that observed in their wild-type littermates  [in vitro palatal shelf culture system. During palatogenesis in wild-type embryos, confocal imaging of GFP expression over a 24-hour period revealed that periderm cells migrated out of the MEE towards the epithelial triangles and into the oral and nasal epithelia of the palatal shelves allowing MES degradation to be completed  , was empompleted . As p63  the MEE ,19, we c shelves . In cont embryos .in vivo (p \u22641e-5) (Genomic Regions Enrichment of Annotation Tool (GREAT) [versus p63-/- embryos and identified 889 differentially-expressed genes   on pooled E13.5/E14.5 mouse palatal shelves and identified 6295 genomic regions bound by \u0394Np63\u03b1 p \u22641e-5) . Gene-se (GREAT)  indicategulated) . Consistgulated) . Down-regulated) . RT-qPCRgulated)  while Ch of  shelves . The reme palate .Krt5-tTA;pTRE-\u0394Np63\u03b1 bi-transgenic embryos, although this was not quantitated  including numerous p63 transcriptional targets; for example: p, Lamb3 .p63-/- palatal shelves and selected genes that exhibited a diametric expression pattern. One hundred and four genes identified as being down-regulated in the p63-/- microarray were up-regulated in the Krt5-tTA;pTRE-\u0394Np63\u03b1 microarray (http://amp.pharm.mssm.edu/Enrichr/) of these genes indicated that the most significantly enriched Gene Ontology terms identified were \u2018epithelium\u2019 and \u2018epidermis development\u2019. Clustergram analysis, ranked on P value, highlighted several genes known to be important in periderm and craniofacial development, including the known p63 targets Jag2 [Znf750 [Perp [Bcl11b which has not been implicated in p63 signalling previously. In the latter case, we identified p63 binding to an active enhancer approximately 48 kb upstream of the transcription start site of Bcl11b.Given the large number of differentially-expressed genes, we intersected the results with those obtained from microarray analysis of E14.5 croarray . Enrichm [Znf750  and Perp50 [Perp , as wellin situ hybridization and immunohistochemistry indicated that while Bcl11b, Znf750, Jag2 and Perp were down-regulated in the MEE of wild-type mice immediately prior to adhesion/fusion of the palatal shelves, their expression was maintained in the abnormal MEE of Krt5-tTA;pTRE-\u0394Np63\u03b1 mice  and water at the University of Manchester at a temperature of 20\u201322\u00b0C, with a humidity of 40\u201360% under specified mouse pathogen free conditions with 12 hours light/dark cycle. Genotyping of the BALB/c eviously .Tgfb3 mueviously ; genotypeviously ,34\u201336. E\u2122 Total RNA-Seq Kit. Samples were run on SOLiD\u2122 v4 for single-end 50 bp reads. Poor reads were filtered from the data with SOLiD Preprocess Filter [RNA was isolated from E13.5 and E14.5 mouse palatal shelves using the Qiagen RNeasy kit. RNA-Seq libraries were generated using the SOLiDs Filter . TopHat s Filter  was usedP value threshold of 1 x 10\u22125. Binding sites were associated to genes using RnaChipIntegrator .Palatal shelves dissected from E13.5 and E14.5 mouse were cross-linked with 1% formaldehyde for 20 minutes. Chromatin was prepared by homogenizing the tissue in PBS using an Ultra-Turrax Homogenizer and incubating the resultant cells in PIPES buffer according to the Upstate ChIP assay protocol (Merck Millipore). Chromatin was sonicated using a Sonics Vibracell with seven 10 second pulses set to an amplitude of 40. Chromatin was prewashed with protein A-agarose beads  and incubated with 2 \u03bcg of \u03b1 isoform-specific p63 antibody  overnight at 4\u00b0C. Antibody-bound chromatin was recovered using protein A-agarose beads (Santa Cruz). Sample preparation for sequencing was performed according to the manufacturer\u2019s instructions (Illumina) and sequenced using the Illumina GAII. 32 base-pair single end reads were mapped to the mouse genome  using bowtie 0.12.7  reportinhttp://bioinf.man.ac.uk/microarray/maxd/).Amplified sense-strand cDNA was generated from 100 ng of total RNA (Ambion WT Expression Kit). Fragmentation, labelling , and subsequent hybridization utilizing Affymetrix Genechip Mouse Exon 1.0 ST Array was performed in the Genomic Technologies Core Facility, University of Manchester. Microarray data were analyzed using Partek Genomics Solution . Probe sets of a core subset were quantile normalized and Robust Multi-array Average (RMA) background correction applied. Exons were summarized to genes by calculating the mean of the exons (log 2). To establish relationships and compare variability between replicate arrays and experimental conditions, principal components analysis (PCA) was used . Correcthttp://frodo.wi.mit.edu), and qPCR reactions were performed using Power SYBR Green PCR Master Mix according to the manufacturer\u2019s protocol (Life Technologies). For qPCR analysis of cDNA, exon-spanning primer sets for p63 candidate target genes were used . Primers were designed using Primer 3 , keratin 17 (1/1000), keratin 14  nectin-1, , nectin-4 , plakoglobin , p63  and Bcl11b . In situ hybridization was performed as described previously with detection using BM Purple (Roche) [Tgfb3-/-;p63+/- or Krt5-tTA;pTRE-\u0394Np63\u03b1 bi-transgenic embryos), and to provide control tissue. In all cases, the histological analyses were performed on at least five mutant embryos from all gestational ages . Immunofluorescence and in situ hybridization assays were performed in duplicate.Heads dissected from E12.5, E13.5 and E14.5 mice were fixed in 4% paraformaldehyde and processed for histological examination using standard protocols. For immunofluorescence analyses, sections were treated with 10 m2 before being embedded in 5% UltraPure Low Melting Point Agarose (Life Technologies) in DMEM/F-12 medium. Whole palates were then excised from the agarose gel in blocks and sliced at the midpoint of the antero-posterior axis of the palatal shelves. Slices were positioned mid-palate down in a 35 mm petri dish (Thermo Scientific) and covered in 1% UltraPure Low Melting Point Agarose in DMEM/F-12 medium. Images were collected over a 24 hour period on a Nikon C1 confocal using a TE2000 PSF inverted microscope and a 10x/0.50 Plan Fluor objective. The confocal settings were as follows, pinholes 30 \u03bcm, scan speed 400 Hz unidirectional, format 1024 x 1024. Images for FITC were excited with the 488 nm laser line. When acquiring 3D optical stacks, the confocal software was used to determine the optimal number of Z sections. Only the maximum intensity projections of these 3D stacks are shown in the results. Images were acquired on a Cascade 512 EM CCD camera (Photometrics) through the Elements Software (Nikon).Palatal shelves were dissected from E14.0 embryos and cultured on filters suspended on serum-free DMEM/F-12 medium. Palatal shelves were allowed to contact for 3 hours at 37\u00b0C in 5% COS1 FigA\u2014C) The palatal shelves of wild-type, Tgfb3-/- and Tgfb3-/-;p63+/- mice lie in a vertical position lateral to the tongue. (D\u2014I) While the basal epithelial cells are proliferative and express E-cadherin and p63, there is no evidence of cell death. (J\u2014L) In all genotypes, the palatal epithelia consist of a keratin 14-positive basal layer covered by a distinct keratin 17-positive layer of periderm cells. p: palatal shelves; t: tongue. Scale bars: A-C, 250 \u03bcm; D-L, 100 \u03bcm.((TIF)Click here for additional data file.S2 FigTgfb3-/- and Tgfb3-/-;p63+/- embryos in the anterior (A-C), mid (D-F) and posterior (G-I) regions of the palate at E15.0. p: palatal shelves; t: tongue. Scale bars: 250 \u03bcm.Representative images taken from serial sections of wild-type, (TIF)Click here for additional data file.S3 FigTgfb3-/-;p63+/- embryos: epithelium, P = 0.21; mesenchyme P = 0.37; total palate P = 0.98, all Student\u2019s T Test, n = 3.Proliferative cells were assessed by phosphohistone 3 immunostaining and the percentages calculated for the epithelium, mesenchyme and total palate. No significant differences were found between the wild-type littermate controls and the (TIF)Click here for additional data file.S4 FigA) RNA-seq analysis indicates that transcripts encoding \u0394Np63 isoforms predominate in the developing secondary palate. Transcript reads are indicated by black bars. (B) ChIP-qPCR validation of p63-bound sites. Fold-enrichment for each binding region was calculated relative to a control region in exon 2 of myoglobin , to which p63 does not bind. Asterisks represent the level of significance: * = P <0.05, ** = P <0.01, *** = P <0.001; Student\u2019s t-test, n = 4. (C) p63 binding site distribution relative to RefSeq genes. Binding site regions are divided into TSS flanking region , intragenic region , <25 kb (5\u201325 kb upstream or 25 kb downstream of last exon), or intergenic regions. (D) GREAT functional annotation of the genes associated with the p63-bound regions.((TIF)Click here for additional data file.S5 FigA, B) The palatal shelves of wild-type and Krt5-tTA;pTRE-\u0394Np63\u03b1 embryos lie in a vertical position lateral to the tongue.  In both genotypes, the palatal epithelia consist of a keratin 14-positive basal layer covered by a distinct keratin 17-positive layer of periderm cells. (E\u2014J) The palatal epithelia are proliferative and express E-cadherin and p63. p: palatal shelves. Scale bars: A-C, 250 \u03bcm; D-L, 100 \u03bcm.((TIF)Click here for additional data file.S6 FigTgfb3-/-;p63+/- embryos: epithelium, P = 0.97; mesenchyme P = 0.26; total palate P = 0.31, all Student\u2019s T Test, n = 3.Proliferative cells were assessed by phosphohistone 3 immunostaining and the percentages calculated for the epithelium, mesenchyme and total palate. No significant differences were found between the wild-type littermate controls and the (TIF)Click here for additional data file.S7 FigKrt5-tTA;pTRE-\u0394Np63\u03b1 bi-transgenic embryos in the anterior (A-C), mid (D-F) and posterior (G-I) regions of the palate at E15.0. C, F and I are magnified regions of the boxes represented in B, E and H. p: palatal shelves; t: tongue. Scale bars: A, B, D, E, G, H = 250 \u03bcm and C, F and I = 100 \u03bcm.Representative images taken from serial sections of wild-type and (TIF)Click here for additional data file.S8 FigA) In neonatal wild-type mice, the medial edge epithelia have degenerated to allow mesenchymal continuity across the secondary palate. (B) In contrast, in 50% of neonatal Krt5-tTA;pTRE-\u0394Np63\u03b1 mice, the medial edge epithelia remain intact leading to sub-mucous cleft palate (arrowed).  Immunostaining with anti-HA and anti-\u0394Np63\u2191 antibodies confirms that the transgene is expressed ectopically in the medial edge epithelia of E15.5 Krt5-tTA;pTRE-\u0394Np63\u03b1 mice (arrowed) thereby restoring \u0394Np63\u2191 expression in these cells. p: palatal shelves. Scale bars: 100 \u03bcm.((TIF)Click here for additional data file.S9 FigTgfb3-/-;p63+/- embryos: epithelium, P = 0.31; mesenchyme P = 0.42; total palate P = 0.29, all Student\u2019s T Test, n = 3.Proliferative cells were assessed by anti-BrdU immunostaining and the percentages calculated for the epithelium, mesenchyme and total palate. No significant differences were found between the wild-type controls and the (TIF)Click here for additional data file.S1 VideoThe periderm exhibits a migratory phenotype allowing completion of palatal fusion in wild-type mice. The video is a series of representative images taken at the same Z position over a 24-hour culture period.(MP4)Click here for additional data file.S2 VideoNo migration of the periderm cells was observed. The video is a series of representative images taken at the same Z position over a 24-hour culture period.(MP4)Click here for additional data file.S3 VideoTgfb3-/- mice restores periderm migration and palatal fusion thereby rescuing the cleft palate phenotype. The video is a series of representative images taken at the same Z position over a 24-hour culture period.Reducing p63 dosage in (MP4)Click here for additional data file.S1 Table(XLSX)Click here for additional data file.S2 Table(XLS)Click here for additional data file.S3 Table(XLSX)Click here for additional data file.S4 Table(XLSX)Click here for additional data file.S5 Table(XLSX)Click here for additional data file.S6 Table(XLSX)Click here for additional data file."}
+{"text": "Action potentials (APs) in the mammalian brain are thought to represent the smallest unit of information transmitted by neurons to their postsynaptic targets. According to this view, neuronal signaling is all-or-none or digital. Increasing evidence suggests, however, that subthreshold changes in presynaptic membrane potential before triggering the spike also determines spike-evoked release of neurotransmitter. We discuss here how analog changes in presynaptic voltage may regulate spike-evoked release of neurotransmitter through the modulation of biophysical state of voltage-gated potassium, calcium and sodium channels in the presynaptic compartment. The contribution of this regulation has been greatly underestimated and we discuss the impact for information processing in neuronal circuits. The axon initial segment (AIS) expresses a high density of sodium channels, and therefore it constitutes a hot spot for generation of APs. Once initiated the spike propagates along the axon to the presynaptic terminals where it causes release of neurotransmitter. Neuronal information is thus transmitted to the post-synaptic neurons as discrete spike-evoked packets of neurotransmitter in an all-or-none mode of signaling. Thus, neuronal signaling is considered to be digital: if the spike threshold is crossed the neuron fires and generates an output but if the spike threshold is not reached no output is observed, and neurotransmitter release follows a binary mode of signaling Figure , left. DNeuronal information is not only transmitted in digital mode and subthreshold activity originating from the dendrites and the soma can be conveyed by the axon to the presynaptic terminal where the flow of information is coded in an analog mode Figure , middle.It has been recently shown that analog signals modulate the function of digital synapses. In fact, subthreshold activity in the presynaptic element modulates spike-evoked transmission, leading to the emergence of the concept of hybrid analog-digital (AD) synaptic transmission Figure , right. In both cases, the principle underlying ADF is that membrane potential fluctuations in the cell body is electrically transmitted by the axon over hundreds of micrometers to the terminals where they modulate the biophysical state of voltage-gated potassium, calcium or sodium channels . Kv1 channels are present in the axon of L5 and CA3 neurons where they control the spike duration and subsequently, neurotransmitter release  by the subthreshold depolarization. In the axon of cerebellar interneurons, slow subthreshold depolarizations have been found to activate P/Q type (Cav2.1) Cav channels thus producing an elevation in basal Ca+ and Ca2+ channels. In fact, in excitatory neurons, a large portion of the voltage-gated Na+ (Nav) current in the axon and presynaptic terminal is inactivated at rest. In the axon terminal or the axon proper from dentate granule cells or from L5 pyramidal neurons, the inactivated fraction of Nav channels may reach 70%\u201380% , Centre National de la Recherche Scientifique (CNRS), Fondation pour la Recherche M\u00e9dicale (FRM)  and Agence Nationale de la Recherche (ANR) (AXODE-14-CE13-0003-02).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer AD and handling Editor declared their shared affiliation, and the handling Editor states that the process nevertheless met the standards of a fair and objective review."}
+{"text": "Caenorhabditis elegans results in pioneer axon mistargeting and genetic analysis places APL-1 in the SLT-1 (Slit)/SAX-3 (Robo) repulsive pathway. Slit binds to APP through the E1 domain, which triggers APP ectodomain shedding and recruitment of the intracellular FE65 and Pak1 complex and associated Rac1 GTPase activation. Our study establishes APP as a novel receptor for Slit ligand mediating axon guidance and neural circuit formation.The amyloid precursor protein (APP) is a receptor-like membrane protein. Although APP processing and \u03b2-amyloid production play a central role in Alzheimer\u2019s disease (AD) pathogenesis, the physiological function of APP remains elusive. Here, we identify APP as a novel receptor for Slit that mediates axon guidance and neural circuit formation. APP deficiency abolishes the Slit repulsive effect in a 3D olfactory explant culture, consistent with its callosal projection deficit in vivo and reminiscent of Slit loss. Inactivation of APP ortholog APL-1 in  Genetic and biochemical evidence establishes a central role of amyloid precursor protein (APP) in Alzheimer\u2019s disease (AD). Despite extensive studies, the function of APP is still elusive. Here, we identify APP as a receptor for Slit that mediates axon guidance and neural circuit formation. We also delineate a biochemical pathway whereby Slit binding triggers APP ectodomain shedding and recruitment of an intracellular signaling complex containing FE65 and Pak1. Thus we uncover a novel function of APP in axon pathfinding; the impairment of which may contribute to neuronal dysfunction and AD.Efficient neuronal communications through precise establishment of neuronal circuits are crucial for proper brain function. Abnormal connections as well as altered plasticity are associated with a variety of neurologic and neurodegenerative disorders including Alzheimer\u2019s disease AD; . AlthougAPP null mice. This phenotype is only present on 129 but not C57 background, indicating the presence of strain-specific modifiers (APP and APLP2 double knock-out (dKO) or mice deficient in all three APP members showed axon terminal sprouting of the neuromuscular junction and over-migration of embryonic forebrain neurons  in mammalian system . Numerouodifiers . Analysi neurons . However1 APL-1; , therebyDrosophila, loss of Slit leads to complete collapse of all CNS axons whereas loss of Robo results in a milder axon misrouting at the midline  II, TU3401sid-1(pk3321); uIs69[unc-119p::sid-1], CX3171sax-3(ky200), CX5000slt-1(eh15), MT324 unc-40(n324), and NW434unc-6(ev400). The following worms were derived using standard genetic procedures: MCW451sid-1(pk3321); uIs69; zdIs5, MCW430sax-3(ky200); sid-1(pk3321); uIs69; zdIs5, MCW453slt-1(eh15); sid-1(pk3321); uIs69; zdIs5, MCW518unc-40(n324); sid-1(pk3321); uIs69; zdIs5, MCW519unc-6(ev400); sid-1(pk3321); uIs69; zdIs5. Worms were raised and maintained at 20\u00b0C using standard techniques unless otherwise noted.The following strains were obtained from the Caenorhabditis Genetics Center which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440): sax-3(ky200) line at 25\u00b0C) on RNAi food for 48\u201360 h before counting for AVM axon guidance defect.RNAi clones from the Ahringer library transformed into HT115 cells were streaked on Lysogeny broth (LB) plate with 50 \u03bcg/ml ampicillin and 10 \u03bcg/ml tetracycline; 5 ml of bacteria miniculture in LB with 50 \u03bcg/ml carbenicillin were grown at 37\u00b0C with agitation for 14 h. Bacteria were concentrated by centrifugation to 1 ml and then added to Nematode growth media (NGM) plates with 5 mM Isopropyl \u03b2-D-1-thiogalactopyranoside for overnight induction. Worms were synchronized by standard egg preparation procedures followed by hatching overnight in M9 buffer. L1 worms were fed with RNAi bacteria with either the control vector L4440, or plasmids carrying RNAi of gene of interest. L1 worms were grown at 20\u00b0C  before projecting to the ventral side. AVM mutant percentage reported are average of three to six independent set of experiments, with a minimum of 200 worms. The experimenters were blinded of genotypes.Animals were mounted on agarose pads, anaesthetized with 0.2% sodium azide in M9 buffer, and examined under 20x objective lens on a Leica TCS confocal microscope. Axons of AVM neurons were visible with the transgenic array Brains were harvested, postfixed in 4% paraformaldehyde, dehydrated with 30% sucrose in PBS, and serially sectioned at 40 \u03bcm on a vibratome (Leica). For immunofluorescence, sections were permeabilized in 0.1% Triton X-100/PBS for 10 min and blocked with 4% normal goat serum in PBS/0.1% Triton X-100 for 1 h at room temperature. Sections were then incubated with primary antibodies in 2% serum in PBS/0.1% Triton X-100 overnight at 4\u00b0C. The primary antibodies used in this study were rabbit anti-glial fibrillary acidic protein ; chicken anti-neurofilament H ; rat anti-L1 ; rat anti-Ctip2 , rabbit anti-APLP2 (gift from G. Thinakaran), APP Y188 (AbCam) and 6E10 (Covance). Sections were then washed and incubated with Alexa Fluor 488- or Alexa Fluor 596-conjugated secondary antibody (Invitrogen) for 1 h at room temperature. For myelin staining, mouse coronal sections were incubated with FluoroMyelin Green fluorescent myelin stain  for 20 min at room temperature. After washing with PBS, sections were mounted with Vectashield Mounting Medium with DAPI (Vector Laboratories). Images were captured using a Leica confocal microscope.695, APP\u0394E1, APP\u0394E2, and APP\u0394C expression constructs were described previously (Full-length (FL) human APPeviously . Human Seviously . Construeviously  and Myc-eviously . pRK5-Myeviously .695, Robo1-HA or APP deletion constructs using the lipofectamine reagent (Invitrogen). Twenty-four hours later, the cells were incubated with serial dilutions of previously dosed supernatants from HEK293 cells expressing Slit2-Myc supplemented with 1 \u03bcg/ml heparin for 1.5 h at 37\u00b0C. After washing three times in PBS, cells were fixed in 4% PFA for 20 min at room temperature and permeabilized with 0.1% NP40 in PBS for 15 min. Double immunofluorescent labeling of transfected receptors and bound Slit2 were conducted using the anti-APP antibody , mouse HA antibody  and rabbit Myc antibody  followed by incubation with secondary antibodies. For colocalization quantification, images were background-subtracted and region of interest of one cell was delineated. Quantitative colocalization analysis evaluating the average proportion of Slit2 signals colocalized with Robo, FL, or mutant APP was performed over the entire fluorescence images using the plugin \u2018Coloc 2\u2019 on the Fiji software (ImageJ). The thresholded Manders M1 coefficient was expressed and compared between groups.HEK293 cells were cultured in DMEM supplemented with 10% fetal bovine serum. For cell surface binding assay, HEK293 cells plated on glass coverslips were transiently transfected with either APPKd) values were calculated with Prism 6 software (GraphPad).For quantitative binding assays, HEK293 cells were transfected with either FL APP or HA-Robo. Twenty-four hours later, the cells were incubated with serial dilutions of previously dosed supernatants from HEK293T cells expressing AP-tagged Slit2 and 1 \u03bcg/ml heparin for 2 h at 37\u00b0C. After washing with cold PBS, Alkaline Phosphatase activities in the cell lysates were measured with the Alkaline Phosphatase Assay kit (AbCam). Optical density at 405 nm was determined using a SpectraMax i3x microplate reader (Molecular Devices). Binding curves were fitted using the Hill equation, and corresponding dissociation constant (6 cells/well for 7 days in vitro (DIV). In the coculture assay, the HEK293 cell expressing Slit2 were seeded on cell culture inserts (Costar) and transferred to 6 DIV primary neurons. The conditioned media (CMs) and cell lysates were collected for Western blot analysis 24 h later.Cortical neurons from postnatal day 0 (P0) mouse were plated in six-well poly-D-lysine coated plates at 10Co-IP experiments were performed as described previously . WesternFor glutathione S-transferase (GST) pull-down, the GST-APPE1 fusion construct containing amino acids 22\u2013189 of APP extracellular E1 domain was generated in pGEX-4T-1 (GE Life Science). The fusion proteins were expressed in bacteria and purified by glutathione-agarose as described (Thermo Fisher). GST binding assays were done as previously described . Purifie695 or APP deletion constructs. Twenty-four hours after transfection, media (DMEM + 10% FBS) were replaced. At 48 h after transfection, media were collected and centrifuged for analysis of soluble APP (APPs). Western blot analysis was performed using antibodies against total sAPP (22C11), human or rodent \u03b1-secretase cleavage-specific sAPP . Cells were lysed for measurement of holoAPP and APP-C-terminal fragment (CTF) using the APPc antibody.For APP processing assays, HEK293 cells plated in six-well plates were transiently transfected with Slit2-Myc or empty vector together with APPDual hydrogel micropatterned constructs, designed to present a bipolar choice point that allows neurite outgrowth to respond to different soluble cues, was created using digital projection photolithography using a digital micromirror device (Texas Instruments) and methods similar to those previously described . Brieflyin situ gelling. The Hystem-HP components were prepared according to the manufacturer\u2019s instructions and then mixed in a 2:2:1 ratio of Heprasil:Gelin-S:Extralink. The mixed Hystem-HP solution was carefully added to the center bipolar void within the micropatterned PEG hydrogels using a micropipette. The solution was allowed to gel in a sterile environment at room temperature for 30 min. The two circular voids, one on each end of the bipolar channel, were left as empty wells  to allow for the addition of cells during experiments. Completed inserts were washed overnight in a 2% (v/v) anti/anti solution in PBS to allow rehydration and disinfection of the constructs.A commercially available hydrogel kit, Hystem-HP (ESI-BIO), was used as the inner growth permissive hydrogel. Hystem-HP utilizes thiolated hyaluronan, heparin, and collagen in combination with a thiol-reactive PEGDA to undergo 2 for 72 h.OBs were dissected from embryonic day 15 (E15) embryos, cut into small pieces (\u223c200 \u00b5m in diameter), and carefully placed directly on top of the Hystem-HP and then gently pressed into the Hystem-HP gels within the circular region. Immediately after the addition of OB explants, HEK293 cells expressing Slit2-Myc or empty vector were introduced to the construct by adding the cells to the empty wells at the end of opposite channels. Explants were cultured in Neurobasal medium with 10% B27 supplement, 1% penicillin/streptomycin, 0.5 mM L-glutamine at 37\u00b0C, and 5% COExplants were fixed in 4% paraformaldehyde for 2 h. Neurite staining was performed using neuron-specific \u03b2 III tubulin primary antibody (AbCam). Primary and secondary staining was conducted in PBS with 0.1% Triton X-100 and 2% BSA for 48 h. Images were captured using a Leica confocal microscope. ImageJ  was used for postprocessing of images. Maximum intensity Z-stacks were obtained from the confocal images. To quantify neurite growth, automatic thresholding (mean) was used, followed by pixel volume analysis. A guidance ratio as previously described  was usedHEK293 cells were transfected with APP, starved for 2 h in OptiMEM medium and incubated with supernatants from HEK293T cells transfected with Slit2 construct. Rac1 activation was measured using the Rac1 activation assay kit (Millipore). Briefly, cell lysates were incubated with GST fusion protein, corresponding to the p21-binding domain  of human Pak1 bound to glutathione agarose (Millipore) for 1 h at 4\u00b0C, allowing for coprecipitation of GTP-bound Rac1. Pellets were washed three times, and inputs and pellets were analyzed by Western blotting with the anti-Rac1 antibody.t test and two-way ANOVA followed by the Bonferroni multiple comparison posttest, using Excel or GraphPad Prism. All data were reported as mean \u00b1 SEM; *p < 0.05, **p < 0.01, and ***p < 0.001.Statistical significance was established by Student\u2019s To assess whether APP plays a role in axon guidance, we first examined the expression pattern of APP in developing forebrain. Double immunofluorescence staining of P0 mouse brain sections for APP and neurofilament revealed that APP was highly expressed in corpus callosum (CC), the major axonal projection pathway joining the two hemispheres of the mammalian brain A. MoreovIn addition to axonal projections, APP was also found to be highly expressed in cell bodies of pyramidal neurons B. ColabeAPP, APLP2, or both combined. L1-CAM staining of P0 mouse brains revealed that, consistent with the overlapping expression patterns and compensatory activities, the APP and APLP2 single knockout brains were overtly normal (\u2212/\u2212 and APLP2\u2212/\u2212). However, in APP/APLP2 dKO mice, the axons in the CC failed to cross the midline . In dKO mice, however, the medial projection axons failed to cross the midline and instead turn vertical to form axon fascicles known as Probst bundles , APPAPP/APLP2 dKO mice are early postnatal lethal, to ascertain whether the CC phenotype detected at P0 persists to adulthood, we chose to analyze the APP and APLP2 double conditional knock-out mice , which are viable despite lacking APP and APLP2 in the brain /SAX-3 (Robo) directs repulsive guidance from the dorsal body wall  or slt-1(eh15) mutant worms with control or apl-1 RNAi and assessing the ventral guidance of AVM neurons. We found that on control RNAi, 33% of sax-3(ky200) loss-of-function mutants displayed AVM projection defects at the restrictive temperature 25\u00b0C (apl-1 knockdown failed to further enhance these deficits (unc-6 RNAi in sax-3(ky200) mutants resulted in additional increase in AVM guidance defect (slt-1(eh15) loss-of-function mutants  or unc-40(n324) null mutant worms, in which the attractive axon guidance signaling pathway was abolished. We found that, compared with control RNAi, apl-1 RNAi in both unc-6(ev400) and unc-40(n324) background significantly enhanced the AVM guidance deficits to the degree similar with sax-3 RNAi . In contrast, axons from dKO OB explants extended in a radial pattern toward both control and Slit2-expressing cells in a symmetric pattern  with CM from HEK293 cells overexpressing Myc-tagged Slit2. GST pull-down followed by Western blot analysis using the anti-Myc antibody showed that only the GST fused with APPE1, but not to GST alone, was able to pull-down Slit2 (in vivo.FL APP contains an extracellular domain (EC) that can be subdivided to a cysteine-rich globular domain (E1) and a region rich in acidic residues (E2), a transmembrane domain (TM) and an intracellular domain (IC). To dissect the APP sequences mediating Slit binding, we constructed APP mutants deleting the C-terminal domain (APP\u0394C), extracellular E1 (APP\u0394E1) or E2 domains (APP\u0394E2) and APP mutant deleting the N-terminal domain APP-C99; K. Co-IP wn Slit2 E. To delwn Slit2 F. Thus, wn Slit2 . Finallywn Slit2 G, demonsSince APP and Robo both bind to Slit2N fragment, we asked whether APP and Robo could form a receptor complex. Cotransfection of FL human APP with HA-tagged Robo construct followed by IP with the APPc antibody indeed showed APP-Robo interaction H. ReciprTo corroborate the Slit-APP interaction detected by co-IP and GST pull-down, we performed fluorescent immunocytochemistry to examine whether secreted Slit protein could bind to the surface of cells in an APP-dependent manner similar to Robo A. We traKd for Robo2 and Slit2 binding as 19.6 nM -tagged Slit2 and measured the affinity of APP and Slit2 binding. Using Scatchard plot, we calculated the  19.6 nM C. Interef 2.7 nM D.Many axon guidance receptors, including DCC and Robo, are proteolytically cleaved by Kuzbanian/ADAM10 family proteases at their juxta-membrane region leading to ectodomain shedding . ADAM10 To test whether the results obtained from the APP overexpression system also apply to endogenous APP, we transfected control or Slit2 vectors to HEK293 cells followed by Western blotting of CM for sAPP produced from endogenous APP D. We fouNext, we sought to investigate the intracellular mechanisms downstream of APP in respond to Slit binding. On ligand-receptor interaction, activation of cytoplasmic signaling and cytoskeleton remodeling is critical for neurite outgrowth and axon guidance. The serine/threonine p21-activated kinase 1 (Pak1) is a key molecule in actin cytoskeleton assembly/disassembly, and its activation is under tight control through membrane recruitment of Nck family of adaptor proteins composed of Nck1 and Nck2 . A numbeSince Rac1, a widely expressed member of the Rho GTPase family, is a predominant signaling molecules of Pak that plays an essential role in actin cytoskeleton remodeling, we asked whether Slit2 binding triggers Rac1 activation by cotransfecting APP and Myc-tagged Rac1, pull-down with GST-Pak (aa77-151), which contains the active Rac-interacting domain of Pak, and Western blotting of the active form of Rac1 using the anti-Myc antibody. We observed a significantly increased activation of Rac1 after treatment with Slit2 F, suggesIn summary, our results support a model whereby Slit binding to the APP E1 domain triggers ectodomain shedding, leading to the release of APPs and recruitment of the APP, FE65, and Pak1 intracellular signaling complex and increased Rac1 small GTPase activity G.bona fide neuronal receptor for Slit that mediates axon guidance and circuit formation. First, we report a high frequency of malformation of the major forebrain axon track, CC, in CNS-specific APP and APLP2 null mice. Second, we reveal that Slit2-induced axon repulsion in the 3D ex vivo olfactory explant culture is abolished in the absence of APP/APLP2, demonstrating a functional role of APP in mediating Slit effect. Last, inactivation of APL-1 in C. elegans results in pioneer axon guidance defects supporting a functional conservation, and genetic analysis places APL-1 in the SLT-1 (Slit)/SAX-3 (Robo) repulsive pathway independent of UNC-6 (Netrin)/UNC-40 (DCC)-mediated attraction.APP has long been speculated as a cell-surface receptor . HoweverThe temporal and spatial expression patterns and biochemical characteristics provide additional support for the Slit/APP ligand receptor relationship. We reveal here that APP is highly expressed in developing axons and projection neurons and neuronal APP is known to be anterogradely transported  and targAlthough both APP and Robo bind to Slits, they may not directly compete for ligand binding as we found that APP binds to Slit2 at significantly lower concentrations than Robo C,D, indiPrevious work have shown the resemblance of the CC defects in Robo1/Robo2 and Slit1/Slit2 double mutants, suggesting that Robo mediate the function of Slit1 and Slit2 in the formation of these connections. However, additional receptors have been implicated to account for Robo-independent signaling of Slits . Our anaOur studies reveal that Slit binding triggers APP processing and ectodomain shedding. This event is likely mediated by ADAM10 proteases as ADAM10-specific inhibitor can block Slit2 triggered APP ectodomain shedding. Similar proteolytic cleavages have been observed for other guidance receptors including Robo, DCC, EphB2, and EphA4 . InteresWe present evidence that the scaffolding protein FE65 is a positive regulator of the Slit-APP signaling downstream of Slit guidance cues. FE65 interacts with APP C-terminal sequences through its phosphotyrosine interacting domain , and hasPak is an effector of the Rac/GTPases that play essential roles in the regulation of cytoskeleton dynamics. A number of guidance receptors have been shown to associate with Pak, including Robo . PreviouIn adult brain under normal conditions, Slit-dependent axon guidance may not play prominent roles as neuronal axon pathfinding and circuit formation cease after development. However, under neuropathological conditions, such as traumatic brain injury (TBI) and AD, some of the developmental guidance processes may be re-activated. Indeed, it is known that injury to the adult CNS results in widespread changes in gene expression of guidance cues and their receptors . In partC. elegans, an ex vivo axon guidance assay, and in vitro biochemical studies, we report here that the APP family of proteins function as a physiologic receptor for midline repellent Slit that mediates axon guidance and neuronal circuitry. Slit binding to the APP E1 domain triggers APP ectodomain shedding and promotes intracellular APP/FE65/Pak1 complex and Rac1 GTPase activation essential for cytoskeleton remodeling. In light of the central role of APP in AD pathogenesis, impairment of APP-mediated axon pathfinding may contribute to circuit dysfunction in AD.In summary, using a combination of genetic analysis in mice and"}
+{"text": "Recently, cases of bone defects have been increasing incrementally. Thus, repair or replacement of bone defects is gradually becoming a huge problem for orthopaedic surgeons. Three-dimensional (3D) scaffolds have since emerged as a potential candidate for bone replacement, of which titanium (Ti) alloys are one of the most promising candidates among the metal alloys due to their low cytotoxicity and mechanical properties. However, bioactivity remains a problem for metal alloys, which can be enhanced using simple immersion techniques to coat bioactive compounds onto the surface of Ti\u20136Al\u20134V scaffolds. In our study, we fabricated magnesium-calcium silicate (Mg\u2013CS) and chitosan (CH) compounds onto Ti\u20136Al\u20134V scaffolds. Characterization of these surface-modified scaffolds involved an assessment of physicochemical properties as well as mechanical testing. Adhesion, proliferation, and growth of human Wharton\u2019s Jelly mesenchymal stem cells (WJMSCs) were assessed in vitro. In addition, the cell attachment morphology was examined using scanning electron microscopy to assess adhesion qualities. Osteogenic and mineralization assays were conducted to assess osteogenic expression. In conclusion, the Mg\u2013CS/CH coated Ti\u20136Al\u20134V scaffolds were able to exhibit and retain pore sizes and their original morphologies and architectures, which significantly affected subsequent hard tissue regeneration. In addition, the surface was shown to be hydrophilic after modification and showed mechanical strength comparable to natural bone. Not only were our modified scaffolds able to match the mechanical properties of natural bone, it was also found that such modifications enhanced cellular behavior such as adhesion, proliferation, and differentiation, which led to enhanced osteogenesis and mineralization downstream. In vivo results indicated that Mg\u2013CS/CH coated Ti\u20136Al\u20134V enhances the bone regeneration and ingrowth at the critical size bone defects of rabbits. These results indicated that the proposed Mg\u2013CS/CH coated Ti\u20136Al\u20134V scaffolds exhibited a favorable, inducive micro-environment that could serve as a promising modification for future bone tissue engineering scaffolds. Repair or replacement of bone defects is still a problem for orthopaedic surgeons today, especially if there is a massive loss of bone mass due to trauma or disease. Therefore, within the past decade, bone scaffolds have grown in popularity, and demand for them has increased as an alternative for bone substitutes and as a replacement strategy for autografts and allografts. Proper selection of materials and fabrication methods is required in order to produce scaffolds with optimal osteoconductivity and osteoinductivity properties that are also bio-compatible and have sufficient mechanical properties to withstand frictional and compressional forces after implantation . FurtherMetal implantable materials usually have both higher mechanical strength and ductility as compared to polymers or ceramic materials ,6. ThereIn addition, surface property is always considered to be a modifiable parameter that is critical to the success of scaffolds . NumerouAs mentioned previously, bone is made up of inorganic apatite and organic fibers. This serves as the inspiration for us to attempt to design new inorganic-organic hybrid scaffolds for bone tissue engineering . ChitosaIn this study, we used an Mg\u2013CS/CH coating on 3D-printed Ti\u20136Al\u20134V scaffolds, which not only improved their surface bioactivity but also affected cell behavior. Therefore, our hypothesis is that Si ions may be released from Mg\u2013CS/CH that have an effect on bone regeneration. We also conducted analyses of the coating morphology, physico-chemical properties, composition, and water contact angle. In addition, Human Wharton\u2019s Jelly mesenchymal stem cells (WJMSC) were used in this study to analyze for scaffold efficacy by observing levels of cellular adhesion, proliferation, and osteogenesis when cultured on the developed Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds.\u22122 torr and then filled with Ar to 1 atm to ensure that the oxygen content was low enough to avoid serious oxidation during the SLM process. Using the computer aided design software , we fabricated the cylindrical porous Ti\u20136Al\u20134V scaffold (10 mm diameter \u00d7 10 mm height) using the laser to melt the selected region on the powder bed layer by layer, where the max laser powder was approximately 400 W; the spot size was approximately 70 \u00b5m, and the layer thickness was approximately 30 \u00b5m. After the SLM process, all of the samples were heat treated in a vacuum annealing furnace to eliminate thermal stress that was generated during the high cooling rate SLM process.The pre-alloyed Ti\u20136Al\u20134V powders (Ti64ELI) were purchased from Renishaw, England. The Ti\u20136Al\u20134V powder  is specified in the ASTM F136 specification to ensure that the end product exhibits good corrosion resistance, good biocompatibility, low density, and excellent ductility if the process environment is well controlled. The particle size of the starting Ti\u20136Al\u20134V powders was about 15\u201345 \u00b5m. The additive manufacturing process was conducted using the Renishaw AM 400 system as the selective laser melting (SLM) equipment. Before the SLM process, the building chamber was vacuumed with a mechanical pump to 1 \u00d7 102  and MgO (Sigma-Aldrich) powders were mixed and used as basal materials. CaO, SiO2 and MgO were mixed to a composition of 65:25:10, respectively. The mixture was then placed into a high temperature furnace set at 1400 \u00b0C for a duration of 2 h for sintering, after which the MG\u2013CS powder was placed in 99.5% ethanol and ball milled  for 6 h, followed by another 6 h of drying at 100 \u00b0C. The 10 g powder was then placed into 100 mL of 0.1 N acetic acid and stirred for 12 h followed by triple rinsing with deionized water. Subsequently, the suspensions underwent filtration through 0.22 \u03bcm filter paper and were then dried in a 60 \u00b0C oven.Mg\u2013CS powder was prepared in accordance to previously reported methodologies . Briefly0.5 g of chitosan (CH) powder was dissolved in 100 mL 0.1 N acetic acid and stirred for 12 h at room temperature. The Mg\u2013CS concentrations used in this study were 0%, 0.2%, and 0.5% . In addition, 500 \u03bcL of Mg\u2013CS/CH solution was dropped onto Ti\u20136Al\u20134V scaffold in a 48-well plate for 1 h and then transferred into a freezer at \u221280 \u00b0C for 12 h and freeze-dried. Afterwards, the scaffolds were submerged in 0.1 M NaOH for 30 min followed by triple rinsing with distilled water and dried subsequently in a 40 \u00b0C oven.2O was placed on the surface of the Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffold, and the images were taken with a camera after 10 min. The water contact angle was analyzed using ImageJ . In addition, an EZ-Test machine  was used to measure the compressive strengths of the scaffolds, with a pre-set loading rate of 2.5 mm/min. The stress\u2013strain curves of the Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds were analyzed, and the load-deflection values were recorded as the maximal compressive force that the scaffolds could withstand. Results were obtained from ten independent tests, and data were recorded as mean \u00b1 SD. A scanning electron microscope  accelerating voltage 3 kV was used to observe the morphology of the Ti\u20136Al\u20134V coated scaffolds.First, the phase composition of the Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds was analyzed using X-ray diffractometry  with pre-set settings of 30 kV and 30 mA and a scanning speed of 1\u00b0/min. In order to evaluate the hydrophilicity of the composites, we also analyzed the contact angle of each scaffold at 37 \u00b0C. In brief, a drop of 20 \u03bcL ddH2HPO4, 0.3528 g of NaHCO3, 0.071 of g Na2SO4, 0.2775 g of CaCl2, and 0.305 g of MgCl2\u00b76H2O in 1000 mL of distilled H2O. The solution was made to be similar to human blood plasma. Hydrochloric acid and trishydroxymethyl aminomethane (Tris) were used to adjust the solution to pH 7.4. After immersion for various periods of time, the released Ca and Si ion concentrations were analyzed using an inductively coupled plasma-atomic emission spectrometer . Results were obtained from six independent tests, and data were recorded as mean \u00b1 SD. The Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds were immersed in SBF solution at 37 \u00b0C for various time periods. The SBF solution was made up of 7.9949 g of NaCl, 0.2235 g of KCl, 0.147 g of K4 were directly seeded onto the scaffolds in a 48-well plate with culture medium and incubated in an incubator pre-set at 5% CO2 atmosphere at 37 \u00b0C. After 1 h and 3 h of culture, an enzyme-linked immunosorbent assay kit  was used to analyze the level of Col I and FN secretion at the various time points. This was done in accordance to the manufacturer\u2019s instructions and determined using a standard curve. The results were obtained in triplicate from five independent experimental analyzes were performed for each group.Prior to in vivo testing, all the Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds were placed into 75% ethanol and exposed to 20 min of UV light for sterilization. Human Wharton\u2019s Jelly mesenchymal stem cells (WJMSCs) were obtained from the Bioresource Collection and Research Center  and were subsequently grown in a commercial mesenchymal stem cell medium  to passage 4\u20138. Cells at a density of 5 \u00d7 102SO4 was added to stop and stabilize the oxidation reaction. The colored products were then transferred to new 96-well plates and read using a Tecan Infinite 200\u00ae PRO microplate reader  at 450 nm with reference at 620 nm according to the manufacturer\u2019s recommendations. All experiments were performed in triplicate. Additionally, the scaffolds with cells which were followed the above procedure and incubated with \u03b2-actin antibodies were used as a control.After being cultured for 3 h, the amount of Col I and FN secreted from WJMSC onto the scaffold surface was quantified using the enzyme-linked immunosorbent assay . The cel4 cell/per scaffold) for 6 h and 1 day, the Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds were removed from the medium and washed twice with PBS. In order to fix the WJMSC, all specimens were immersed in a 2% glutaraldehyde (Sigma-Aldrich) solution at room temperature for 2 h. The specimens were subsequently dehydrated by being subjected to sequential dehydration for 20 min with ethanol . After drying and coating with gold, the morphology of the WJMSC on the different Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds was examined using SEM.For this test, the cells were grown in a mesenchymal stem cell medium (Sciencell) up to passage 3\u20136. After culture with WJMSC  assay was used to analyze for the level of cell viability. Briefly, the medium was removed, and the wells were rinsed twice with cold PBS. PrestoBlue\u00ae solution was mixed with fresh medium to a ratio of 1:9 and was placed into each well. Subsequently, the specimens were incubated for an additional 60 min, after which the solution was transferred to a 96-well plate, and a Tecan Infinite 200\u00ae PRO microplate reader was used to measure for the optical density (OD) with a pre-set setting of 570 nm and a 600 nm reference wavelength. Results were obtained in triplicate from six independent tests and recorded.WJMSCs at 10Osteogenesis was done on cells cultured on scaffolds with commercially available differentiation kits  for 3 and 7 days. An alkaline phosphatase (ALP) assay kit  was used to measure for the level of alkaline phosphatase according to the manufacturer\u2019s instructions. The ALP activity was calculated according to the standard curve using ELISA under 405 nm. In addition, the osteocalcin (OC) protein concentration was measured using an OC enzyme-linked immunosorbent assay kit (Invitrogen). This test was done according to the manufacturer\u2019s instructions. The OC concentration was calculated with reference to the standard curve. Blank cartridges were used as controls. Results were obtained in triplicate from six independent tests and recorded.The levels of calcium secretion and deposition by WJMSCs were measured using Alizarin Red S staining (Sigma-Aldrich). For the test, cells were cultured on scaffolds in an osteogenic differentiation kit for 3 weeks, and the staining was done in accordance with previously reported procedures . Briefly2 asphyxiation, and the femur bone specimens of the rabbits were harvested and fixed in 10% formalin for 48 h, after which they were rinsed with PBS several times, embedded in OCT , and sectioned (10-mm thick). Subsequently, 5 \u03bcm longitudinal sections were prepared per specimen using a microtome sawing technique. The sections were prepared and stained using a Von Kossa kit , according to the manufacturer\u2019s instructions. Von Kossa staining in red was used to observe the difference between the osteoid tissue and the calcified bone. The sections were examined using the BX53 Olympus fluorescence microscope  at 200\u00d7 magnification. Finally, a histological analysis was performed, and the area of newly-formed bone was quantified using the image analysis system.All in vivo experimental protocols and statement to confirm that all methods were carried out in accordance with relevant guidelines and regulations, and all experimental protocols were approved by the Ethical Committee for Animal Experiments of China Medical University, Taichung, Taiwan. 6.5 \u00d7 10 mm specimens from the Ti group and CS50 group were implanted into femoral bone defects of adult New Zealand rabbits 12 rabbits with defects created both for right and left posterior limbs. The rabbits were positioned in a stereotaxic frame and immobilized during surgery. The hair over the femur of the animals was shaved, and the underlying skin was aseptically prepared using iodine scrub. The underlying periosteum was accurately incised and elevated to obtain sufficient exposure for the trephine. A trephine with an outer diameter of 6.5 mm was used to remove bone and create critical size defects in the femur 6.5 mm in diameter and 10 mm in depth. The scaffolds from the various groups in this study were then implanted at the site of the 6.5-mm critical lesions. Lastly, the periosteum and the subcutaneous tissue were closed sequentially with sutures. The animals were kept on a surgical bed until they woke and had free access to food and water thereafter. Six weeks post-implantation, the rabbits were sacrificed by COp value < 0.05 were considered statistically significant.Significant differences between the means were measured using a one-way analysis of variance. Scheff\u00e9\u2019s multiple comparison test was used to determine for significance of the deviations in each data. For all tests, results with a A 3D-printed Ti\u20136Al\u20134V scaffold coated with Mg\u2013CS/CH was fabricated A. The coThe surface morphology of the Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds, at both low and high magnification are shown in Next, the hydrophilic behavior of pure Ti and Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds were considered with reference to the contact angle, as shown in \u22121 are exhibited in Representative stress\u2013strain curves of Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds at same strain rate of 0.04 sThe ICP-AES analysis indicated a minimal release of Ca and Si ions from the Ti\u20136Al\u20134V alloys and CS0 after immersion in SBF for various time points, as shown in in p < 0.05) of Col I secretion of 35.0 \u00b1 2.4 and 40.8 \u00b1 2.7 pg/mL, respectively, as compared to only 28.6 \u00b1 2.2 and 21.6 \u00b1 2.3 pg/mL for the CS0 and Ti\u20136Al\u20134V scaffolds, respectively. However, in terms of FN secretion, only the CS50 scaffolds exhibited significantly higher levels (p < 0.05) after 1 and 3 h of culture. The CS20 scaffolds were only able to induce a significant difference in FN secretion at the 1 h mark (p > 0.05). FN secretion in the CS50 scaffolds was approximately 300% that of the Ti\u20136Al\u20134V scaffolds and 158% of the CS0 scaffolds at 24.1 \u00b1 2.5 ng/mL after 3 h of culture. The effect of substrates on the adsorption of Col I and FN were also examined. As shown in p > 0.05) in Col I and FN adsorption between Ti and CS0. The value for CS20 and CS50 groups were significantly (p < 0.05) higher CS0. In a previous study, Col and FN were the main proteins found to be expressed and secreted throughout the phases of cell adhesion [Following initial adhesion onto the Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds, cells secrete components of extracellular matrix (ECM), which further promotes cellular attachment and influences subsequent cell function. Adult stem cells are involved in various tissue regeneration processes throughout a person\u2019s life . Howeveradhesion . In addiadhesion . Col I aadhesion . Our stuThe cross-talk between surface composition and stem cell and subsequent bone-forming osteoblastic cells is of great importance, but remains unclear. Therefore, SEM micrographs of cellular adhesion on the Mg\u2013CS/CH-coated Ti\u20136Al\u20134V scaffolds after 6 and 24 h of culture are shown in p < 0.05) for all time periods and that the CS20 scaffolds had significantly higher (p < 0.05) proliferation from day 3 onwards. Therefore, it is worth noting that proliferation was enhanced based on the concentration of Mg\u2013CS. There was a gradual increase in cell proliferation for all groups from days 1 to 7, and there were no significant differences (p > 0.05) between Ti\u20136Al\u20134V and CS0. The absorbance values of cells cultured on CS0, CS20, and CS50 for 1 day were 1.2, 1.3, and 1.4 times higher than that on Ti, respectively. In addition, the proliferation rate (day 7/day 1 ratio) of CS0, CS20, and CS50 were 3.4, 3.7, and 4.2, respectively. In general, these data implied that the Mg\u2013CS/CH coating contributed to the fabrication of functional Ti\u20136Al\u20134V scaffolds that were shown to be cell friendly and allowed the uniform adhesion of cells that would subsequently up-regulate downstream cellular activities. In previous reports, the results proved that Ca and Si play important roles in metabolism, collagen secretion, and hard tissue mineralization [The quantitative analysis results of cellular proliferation are provided in lization ,46. Theslization ,48. Prevlization , and thilization .p < 0.05) of ALP as compared to those seeded on the CS0 and Ti\u20136Al\u20134V scaffolds after 3 days of culture. On the other hand, after 7 days of culture, the cells seeded on CS0, CS20, and CS50 scaffolds secreted significantly higher (p < 0.05) amounts of ALP as compared to the control Ti\u20136Al\u20134V scaffolds. However, there were no significant differences (p > 0.05) between CS20 and CS50 for all time periods. ALP was observed to increase gradually over time as well as increase with increasing concentrations of Mg\u2013CS. These data indicated that the Mg\u2013CS/CH coated Ti\u20136Al\u20134V scaffolds enhanced the secretion of osteogenic protein ALP, thus implying that these scaffolds were able to promote osteogenesis in cells, thus leading to subsequent improved bone formation. Similarity, a significant synergistic interaction was observed between CH and Mg\u2013CS in enhancing osteogenic differentiation of WJMSC (p < 0.05), as well as increasing OC secretion, as shown in Levels of osteogenic differentiation can be used to determine whether there will be potential subsequent successful bone formation. Many enzymes and genes are involved in different stages of osteogenic differentiation and bone formation, of which alkaline phosphatase (ALP) is a protein enzyme that is commonly secreted in the early phases of bone mineralization and thus is generally used as a marker to analyze the differentiation status of cells. In this study, levels of ALP expression in cells cultured for 3 and 7 days were evaluated . Cells sp < 0.05) than the amounts in CS0 group (Alizarin Red S was used to evaluate the calcium deposition capability of cells so as to better understand the influence of CS\u2013CH coatings on osteogenic mineralization in cells. As shown in S0 group B. The abS0 group . Under aIn this work, it was demonstrated that Mg\u2013CS/CH can be successfully coated onto Ti\u20136Al\u20134V scaffolds with simple immersion techniques to overcome the limitations of neat Ti\u20136Al\u20134V scaffolds. Pore sizes, morphologies, and architectures that are critical to subsequent hard tissue regeneration were maintained after coating, thus showing that such modifications do not alter or modify the physical properties of Ti\u20136Al\u20134V scaffolds. Our results demonstrated that such modifications can render Ti\u20136Al\u20134V surfaces hydrophilic, which is critical for cellular adhesion and proliferation. Our scaffolds can provide suitable micro-environments to support cellular adhesion, proliferation, and differentiation. Osteogenic differentiation and mineralization were enhanced, which makes such coatings a potential candidate for future regenerative medicine applications. Our results provide a platform for future innovative alternatives that can be used to create more robust scaffolds with enhanced biological behavior."}
+{"text": "These data suggest a model that nsaRNAs are located in sufficient proximity to the nuclear genome and\u00a0leave identifiable genomic footprints, thus revealing the parts of genome proximal to nuclear speckles.It remains challenging to identify all parts of the nuclear genome that are in proximity to nuclear speckles, due to physical separation between the nuclear speckle cores and chromatin. We hypothesized that noncoding RNAs including small nuclear RNA (snRNAs) and Malat1, which accumulate at\u00a0the\u00a0periphery of nuclear speckles (nsaRNA [nuclear speckle-associated RNA]), may extend to sufficient proximity to the genome. Leveraging a transcriptome-genome interaction assay (mapping of RNA-genome interactions [MARGI]), we identified clusters of nsaRNA-interacting genomic sequences (nsaPeaks). Posttranscriptional pre-mRNAs, which also accumulate to nuclear speckles, exhibited proximity to nsaPeaks but rarely to other genomic regions. Our combined DNA fluorescence   \u2022MARGI captures interactions of nuclear speckle-associated RNAs (nsaRNA) and DNA\u2022nsaRNA-interacting genomic sequences were clustered (nsaPeaks) in the genome\u2022Posttranscriptional pre-mRNAs and CDK9 proteins exhibited proximity to nsaPeaks\u2022Single-cell images confirmed proximity of nuclear speckles to an nsaPeak Genetics; Molecular Genetics; Data Analysis in Structural Biology It is increasingly evident that positioning and organization of various subnuclear structures are critical for regulating gene expression, and therefore resolving the spatial organization of nuclear components has become a central task to nucleome research . NuclearAdvanced imaging technologies including super-resolution imaging have started to reveal the multilayer structure of nuclear speckles, with the proteins SC35 and SON at the center  and nuclgenome interactions (MARGI) enabled the identification of interacting genomic sequences of chromatin-interacting RNAs  distribution of several types of RNAs in the nucleus. Prominent examples include Xist RNA cloud in adult female cells , accumulGSM2427902 and GSM2427903) and human embryonic stem (hES) cells (GEO: GSM2427895 and GSM2427896) (\u221216) and more than 1,800-fold increase of odds in hES cells , confirming that MARGI data reflected co-localization of nucleolus-associated RNA and DNA.We used the co-localization of nuclear rRNA and rDNA (human rDNA complete repeating unit) in nucleoli  as a tes2427896) , which y2427896) . To test2427896) . CompareWe asked which genomic regions are in proximity to nsaRNAs. At the single-cell level, there are four possible answers (models) to this question, which are (1) there is lack of nsaRNA expression; (2) nsaRNAs do not stably locate in the proximity of any specific genomic region in a single cell; (3) nsaRNAs are proximal to different DNA sequences in different single cells; however, none of these DNA sequences are shared by the majority of the cells; and (4) nsaRNAs are proximal to some DNA sequences and at least a fraction of these DNA sequences are shared by the majority of cells. Experiments with bulk cells could potentially differentiate the fourth model (stable interaction model) from its opposite  B but canhttp://systemsbio.ucsd.edu/margi/) (\u221216), which is reminiscent of lack of nuclear speckle formation in hES cells, where SC35 proteins and nsaRNAs are diffusely distributed in the nuclei  . This pie nuclei .16). The sporadic distribution of nsaRNA-interacting DNA sequences in hES cells is also consistent with the lack of SC35 clusters in hES cells  identified in HEK cells as the genomic regions close to nuclear speckles. We carried out these tests with two other types of nuclear speckle-associated molecules, namely, p-pre-mRNAs and CDK9 proteins.If nsaPeaks are near nuclear speckles, other nuclear speckle-associated molecules besides nsaRNAs may also exhibit enrichment in spatial proximity of nsaPeaks. Although splicing is generally initiated co-transcriptionally, not all splicing events are completed during transcription. The resulting p-pre-mRNAs are observed to cluster at the nuclear speckle domains . The clu\u221216)  B and S2CGSM1249897)   (MACS2) 1249897) , of whic1249897) . These d\u221216, Fisher's exact test)  B. Taken in situ hybridization (FISH) (We examined the proximity of nuclear speckles to nsaPeaks at single-cell resolution using a combination of immunofluorescence staining of a nuclear speckle core protein SC35 and DNA fluorescent n (FISH) . We opten (FISH) A. We iman (FISH) B and 4C.\u22127, chi-square test). We also summarized the proportion of co-localized FISH spots in each image. The 10 images stained with nsaPeak probe exhibited on average 84.0% of their FISH spots co-localized with SC35  . A FISH \u22125, Kolmogorov test). For example, the nsaPeak images exhibited 1\u00a0to 18 center pairs at a distance of 8 voxels, whereas the non-nsaPeak images exhibited 0 to 3 at this distance    and nsaP1081530) A and 6B.1081530) , we mergMore than 150 proteins were reported to be associated with nuclear speckles , includiThe increasing evidence on \u201cnoncoding RNAs functioning as scaffolds in the construction of nuclear bodies\u201d points to the essential role of RNA in nuclear bodies . NuclearA rationale of ChIP-seq and ATAC-seq analyses of bulk cells is that the majority of single cells share the same transcription factor binding regions or transposase-accessible regions, and such commonality would be identified as peaks in bulk cell experiments. This rationale was verified by single-cell data produced by subsequently invented single-cell ChIP-seq  and singRevealing spatial organization of nuclear components has become a central task in nucleome research. This\u00a0task is hindered by the lack of a 3D coordinate system for the nucleus. Without a coordinate system, spatial data obtained from different single cells cannot be aligned, making it difficult to derive or test for any underlying principles.Chromosome territories fill sizable portions of interphase nuclei . The corA major limitation of the proposed mapping strategy is the small number of MARGI-derived nsaRNA-DNA interaction read pairs. The total number of uniquely mapped nsaRNA-DNA read pairs in HEK293T cells from one MARGI experiment was 14,904. Each snRNA was only reflected by hundreds or thousands of read pairs, making it nearly infeasible to distinguish the proximity regions of major and minor spliceosomes. Another possible caveat of this analysis is the distance threshold for identifying p-pre-mRNA-DNA interactions. The currently applied threshold, 2,000\u00a0bp, may not be sufficient to remove all nascent RNA-DNA interactions. However, among the 187,724 identified p-pre-mRNA-DNA read pairs, the vast majority  were interchromosomal interactions. Therefore, even if the distance threshold is significantly increased, it is unlikely to result in large changes to the p-pre-mRNA analysis results.All methods can be found in the accompanying"}
+{"text": "Middle ear application of gentamicin is a common medical treatment for uncontrolled M\u00e9ni\u00e8re\u2019s disease. The objective of the study was to evaluate the impact of endolymphatic hydrops on inner ear delivery.Perilymph gentamicin concentrations and correlation with endolymphatic hydrops in an animal model were assessed. A group of 24 guinea pigs was submitted to surgical obstruction of the endolymphatic sac and duct of the right ear. Gentamicin was applied either to the right ear\u2019s round window niche or through a transtympanic injection. Perilymph specimens were collected at different times. Histologic morphometry was used to evaluate both turn-specific and overall hydrops degree.In animals with endolymphatic hydrops, lower concentrations of gentamicin were observed after 20 or 120 minutes of exposure and in both types of administration, when compared to controls. This difference reached statistical significance in the round window niche application group . A negative correlation between perilymphatic gentamicin concentration and hydrops degree could be observed in both groups, after 120 minutes of exposure .The study indicates that the endolymphatic hydrops degree has a negative interference on the delivery of gentamicin into the inner ear following middle ear application. M\u00e9ni\u00e8re\u2019s disease (MD) is described by episodic vertigo associated with low/medium-frequency sensorioneural hearing loss and fluctuating symptoms  in the affected ear . This diAs the precise ethiopathogenesis of MD has not been elucidated yet, an effective therapy has not been established, except for the control of symptoms via severity and rate of the vertigo episodes . VariabiTranstympanic (TT) administration of aminoglycosides and corticosteroids has proved to be an efficient method for intractable MD aiming to control vertigo episodes after a partial/total vestibular end-organ ablation , as withIn a healthy inner ear, the pharmacokinetics of different agents applied in the middle and inner ear have been intensively studied \u201320. HoweA total of 44 Duncan-Hartley strain guinea pigs  with a positive Preyer\u2019s reflex and weighing approximately 300g were used in this experiment. The Ethical Committee of the University of Porto Medical School approved the use and care of animals in accordance with the European Union directive 2010/63/EU for animal experiments (Project 8.2014). After admission, the animals were given a week to acclimate to the environment. Twenty-four guinea pigs underwent surgical obliteration of the endolymphatic duct of the right ear, as described below. After surgery, the animals were kept in the animal house for six weeks, allowing EH to develop. The remaining 20 animals were used as controls. The guinea pigs were accommodated two animals in each cage, in temperature (21\u201323\u00b0C) and humidity (45\u201365%) controlled conditions and light/dark cycle (12/12 h) controlled rooms. The animals had access to food and water ad libitum and ascorbic acid supplement was administered. Post-surgical surveillance of all animals was performed each 4 hours, on the first day, by a veterinarian. Subsequently, animals were routinely checked each 6 hours by one of the housing staff and twice a week by a veterinarian. An animal care table for animals submitted to surgical procedures, with items such as weight, physical appearance, clinical respiratory signs (respiratory rate), natural behavior and provoked behavior was filled on a daily basis.For the induction of EH, surgical obliteration of the endolymphatic sac and duct of the right ear was performed via an extradural posterior fossa approach, as described by Kimura and Andrews , 24. TheAll animals were anesthetized after an intramuscular injection of ketamine (40 mg/kg) and peritoneal injection of xylazine (5mg/kg), for induction. Anesthesia was maintained with inhaled isoflurane 2,5%. Warming gloves were used to compensate hypothermia. Placed in a prone position with the neck slightly flexed, through a dorsal midline scalp incision, the guinea pig\u2019s occiput was exposed. Through an extradural posterior cranial fossa approach, after exposure of the sigmoid sinus and moving it suitably medially, the bony operculum was identified. A 0.5mm burr  was used to drill from the medial to the operculum and into the endolymphatic sac and duct. The endolymphatic duct was then packed with aseptic bone wax using a straight pick and an otologic elevator and the skull defect was reinforced with Gelfoam , according to a technique described elsewhere, and the wound was closed . PostopeCarl Zeiss Opmi Pico surgical microscope The surgical procedures were performed under sterile conditions and microscopic magnification using a To simulate the standard clinical procedure, gentamicin was transtympanically injected. For a more selective method, gentamicin was applied only to the RW niche.In a left decubitus position, after a retroauricular approach, the tympanic bulla was exposed and opened. With an insulin syringe, a 25G lumbar puncture needle , 1 drop   of a solThe animals were separated into two experimental groups (six in each) according to time to perilymph collection: 1A 20 minutes delay and 1B 120 minutes delay. During this period, the anesthetized animals were maintained in left decubitus position.At the scheduled time, a single 2\u03bcl perilymph sample was collected from the RW through a 26G microlancet tip  adapted to a P10 micropipette . The bulla was rinsed with saline solution and carefully dried before the sample was taken. Immediately after, the same procedure was performed in the left ear. The samples were stored at -80\u00b0C, in a cryotube containing 250\u03bcl of artificial perilymph solution.Two non-operated control groups of three animals each were submitted to precisely the same procedures (groups 1ACTRL\u201420 minutes and 1B CTRL\u2013 120 minutes)In a distinct group of eight animals, where no EH was induced, perilymph was collected through a cochleostomy after 20 minutes (group 1C CTRL) or 120 minutes (group 1D CTRL) to assess possible contamination inaccuracies during the perilymphatic fluid sampling and to attest the quality of the technique employed. A superficial cochleostomy was performed at the basal turn of the cochlea, 2-3mm from the RW, with a 1mm diamond burr, and completed with a 26G microlancet tip  adapted to a P10 micropipette , for a single 2\u03bcl perilymph sample collection.In a left decubitus position, with an ear speculum and an insulin syringe with a 25G  lumbar puncture needle, 0,12ml  of a solution of gentamicin sulphate  was injected in the right middle ear.Twelve animals were separated into two experimental groups according to time of perilymph collection\u2013 2A (n = 6) (20 minutes) and 2B (n = 6) (120 minutes). The left ear was used as an internal control. In the respective schedule the tympanic bulla was opened through a retroauricular approach. Subsequently a 2\u03bcl perilymph sample was collected from the round window using the same technique as in group 1.Two non-operated control groups of three animals each were submitted to the same procedures (groups 2A CTRL\u201420 minutes and 2B CTRL\u2013 120 minutes).After the experimental procedures, the animals were terminally anesthetized with sodium pentobarbital  intraperitoneally (33mg/kg). Under deep anaesthesia, the animals were transcardially perfused with normal saline complemented with heparin (10 units/L), followed by 1,000 millilitres of 4% paraformaldehyde in 0.1M phosphate buffer. The fixed animals were decapitated and both temporal bones dissected and post fixed in the same fixative for 48 hours. Following decalcification with Immunocal  for 48 hours, the temporal bones were embedded in soft Epon . Ten-micrometre thick sections were cut with a tungsten carbide knife (C profile) along the midmodiolar plane. Every slide, in which all turns along the midmodiolar plane were observed, was mounted in glass slides and stained with 1% toluidine blue for light microscopy histologic and morphometric analysis.Leica EC3 Camera  connected to a Zeiss Axioscope 40 microscope  with the Leica Application suite Version 4.6.0 . All image analysis was prepared with Image 1.50i software .Sections were photographed with a modiolus, the area of the scala media (SM) and the scala vestibuli (SV) was evaluated. To estimate a relative measure of the hydrops\u2019 degree in the operated versus the control ear, the \u201cproportion scala media\u201d (PSM) was calculated as: PSM = SM area/ (SM area + SV area) [Hydrops was determined by a previously tested method, which has been described in detail before , 28. EacSV area) , 28. Thiin vitro chemiluminescent micro-particle immunoassay for the quantitative determination of gentamicin in human serum or plasma, was used. The measuring range of the iGentamicin assay was 0.3\u201310 \u03bcg/ml. The samples were adequately diluted with artificial perilymph (KCl (3.5mM), NaCl (125mM), NaHCO3 (25mM), CaCl2 (1.3mM), MgCl2 (1.2mM), NaH2PO4 (0.75mM), Dextrose (5mM)) [An Architect iGentamicin assay (Abbott Laboratories), which is an e (5mM))  to keep Categorical variables were described in absolute (N) and relative frequencies (%), whereas continuous variables were described in average plus standard deviation (SD) or median and percentile. Continuous variables without a normal distribution were analysed with non-parametric tests of Mann-Whitney. To evaluate the strength of an association between two continuous variables a correlation of Spearman was applied to compensate for the biased nature of the variables involved. In every test, it was considered a confidence level of 95% . The analysis was performed with SPSS v.24.0 .A successful surgical obstruction of the right endolymphatic sac and duct, histopathologically expressed by EH on light microscopy, was confirmed in all experimental animals .A slight to severe hydrops occurred in all dissected ears, with a HR average of 1,39  . No EH wOverall, following the delivery of gentamicin to the inner ear, lower levels of the drug were found in ears with histologically confirmed EH in comparison to the controls, which did not undergo endolymphatic sac and duct surgery .This difference was statistically significant when gentamicin was specifically delivered to the RW niche, in both time periods of 20 and 120 minutes , whereas a trend was observed in the TT injection groups. .None of the left ear perilymph samples elicited significant levels of gentamicin, as only vestigial concentrations were detected.When the gentamicin concentrations in perilymph were matched with the HR a negative correlation was observed in both groups in which perilymph samples were collected after 120 minutes of gentamicin exposure  .This work showed that EH has a negative impact on the gentamicin delivery to the inner ear when compared with control animals. This assumption was stronger when the administration was limited to the round window niche but also perceptible after TT injection. The observed negative correlation values when perilymph collections were performed after 120 minutes of exposure  appear to support this statement.In the animal model of EH, the perilymphatic concentration of drugs administered to the middle ear depends on factors such as the time course in the middle ear, entry through the RW and oval window membranes, dilution effects of cerebrospinal fluid (CFS) and elimination to blood or tissues , 20. FacIt has been previously recognized that intratympanically administered drugs reach the inner ear compartment mainly through two passageways: the round window (57%) and the oval window ligament 35%) . Intrins% . Intriscalae, could also have an important impact on the pharmacokinetics of drugs. Evidence on local interscala communications has been provided [The longitudinal distribution along the cochlea, as well as a communication between cochlear provided , as wellprovided , 37, 38,provided .As such, drug levels on the perilymph may depend not only on how fast it passes from the middle to the inner ear but also on how quickly it communicates with these different spaces or is cleared. Significantly, substances entering the cochlea from the middle ear appear to be mostly confined to the basal turn, rather than reaching the upper turns of the cochlea . TherefoAn increased area of a hydropic membranous labyrinth may potentially increase the gentamicin way to the endolymph, reducing its perilymphatic concentration. In the cochlea, Reissner\u2019s membrane is a dynamic structure involved in ion-fluid transportation  and chanConceivably, all or at least some of these modifications in Reissner\u2019s membrane may influence fluid changes between perilymphatic and endolymphatic spaces  and haveElectrophysiological changes may also play a role in the pathophysiology of EH, namely the endolymphatic potential decrement . This woStill, the understanding of pharmacokinetics of drugs in the inner ear is probably not restricted to open fluid spaces of endolymph and perilymph. The soft tissues of the membranous labyrinth to which drugs can distribute, should also play a role, with interference in perilymphatic concentrations. In this line, a recent guinea pig study, estimated that this could represent up to 24% of the total inner ear volume . NeverthPrevious research in human series have likewise addressed drug delivery to the inner ear. In this context, studies of magnetic resonance imaging (MRI) with gadolinium (Gd) have revealed differences in the entrance of Gd to the inner ear that correlated with the severity of EH, although most were associated with the vestibule region. Shi and colleagues observed a compromised distribution of Gd across the oval window, which also correlated with the severity of EH . FurtherWhen a hydropic membranous labyrinth is discussed, as in MD, anatomic distortions are implicit, and appear to occur in a predictable manner, with a pattern suggesting a progression from the cochlea and saccule . A greatAccording to recent evidence, a blood-labyrinth barrier dysfunction, in the microvasculature of vestibular end organs, has also to be accounted for. As such, MRI studies in MD patients revealed a blood labyrinth breakdown with an associated increase in contrast permeability. This was observed not only in the symptomatic but also in the asymptomatic ear, suggesting a systemic abnormality which could potentially be considered, in the future, a biomarker of the disease . This obAltogether, this results and previous observations, both in animals and in humans, complementarily demonstrate that a reduction of the flow from the middle to the inner ear could exist and correlates with the EH state.In spite of an apparently reduced absorption in EH, as supported by this study, Kimura et al., after lateral canal application of gentamicin, have observed higher sensitivity in hydropic ears. He observed an increase of lesions in all sensory epithelia and in particular in the organ of Corti, noting the apparent hypersensitivity of the hydropic inner ear to external aggressions, including sound exposure, aminoglycosides, certain diuretics and hypoxia . AlthougAs noted above, there are still many unanswered questions on this topic. This concept of communication between inner ear spaces and the possible impact of EH has the potential to be one of the research questions in the near future and should be explored. To our knowledge, this is the first published report on gentamicin delivery to the inner ear in an EH guinea pig model.Possible limitations of the current study may include the research model used, with the inherent difficulties of the surgical procedure and the long period of follow-up, in which variable degrees of hydrops were observed in different animals. If a greater series of animals had been used the power of the study might have been higher, but this possibility was excluded for ethical and economic reasons.et al. [et al. [An additional concern was the quantification of the dose of gentamicin administered. Based on the study of Tripp et al.  it was a [et al. . Still, et al. [Finally, perilymph collection and analysis are delicate procedures, demanding a high degree of precision. Possibly, the use of the microdialysis technique could have contributed to an increased accuracy of the collection , howeveret al. . Experimet al.  but, affMiddle ear application of gentamicin is a common medical treatment in uncontrolled MD. Current protocols are not consensual and have been developed on the basis of studies that did not consider the EH degree. This study demonstrates that EH degree has a clear negative correlation with the delivery of gentamicin to the perilymph, when compared to a normal ear."}
+{"text": "Hoffmann\u2019s syndrome (HS) is a rare manifestation of hypothyroidism myopathy that presents with weakness, stiffness, and eventually pseudohypertrophy of muscles, especially calf muscles. We report a case of a 28-year-old male who presented with the history of generalized weakness with swelling in lower limbs and gradual progressive facial puffiness for the past few years. Physical examination of our patient showed diffuse bilateral pseudohypertrophy of deltoid and calf muscles with positive Gowers\u2019 sign (GS). Laboratory results of low serum thyroid hormones and muscle biopsy report confirmed the diagnosis of HS. Pendred syndrome (PS) is a genetic disorder leading to congenital bilateral sensorineural hearing loss with mild hypothyroidism. On account of his congenital bilateral sensorineural hearing loss and negative serum anti-thyroid peroxidase antibodies (anti-TPO Ab), PS\u00a0was declared as the cause of HS in this case. Our patient showed excellent response to levothyroxine therapy with progressive improvement in his symptoms. We outlined this case due to its rarity. A diverse array of presentations of hypothyroidism is seen in routine clinical practice. The symptoms of patients with hypothyroidism vary from mild fatigue to fatal myxedema coma . The incA 28-year-old male, deaf and dumb since birth, presented to the medical department (MD) of Dr. Ruth KM Pfau, Civil Hospital Karachi (CHK) in November 2018 for the evaluation of generalized upper and lower limb weakness along with progressive facial puffiness , his pulse was 82 beats/min, blood pressure (BP) was 110/70, respiratory rate (RR) was 16 breaths/min, and he was afebrile. There was no thyroid enlargement. Lower limbs showed nonpitting edema up to the ankles. Upon neurological examination, bulk showed diffuse bilateral pseudohypertrophy of the calf muscles  of 11.7 gm/dl, raised serum cholesterol of 310 mg/dl, raised TSH\u00a0of 35.2 \u03bcIU/ml [Normal (N) = 0.4-4.0], decreased levels of\u00a0thyroxine (T4) of 0.14 \u03bcg/dl (N = 4.5-12.5), low plasma triido thyronine (T3) of 26.2 ng/dl (N = 84-172), anti-thyroid peroxidase antibody (anti-TPO Ab) <10 (N = <35), elevated creatine phosphokinase (CPK) of 1108\u00a0U/L (N= 85-170), creatine kinase-muscle and brain (CK-MB) of 126 U/L, elevated lactate dehydrogenase (LDH) of 930 U/L (N = 225-450), and raised serum aldolase of 9.3 U/L\u00a0(N = 0-7).\u00a0Blood glucose, liver function tests, blood urea, and serum creatinine were not remarkable. Abdominal X-ray revealed bilateral renal cortical cysts; however, no calculus or hydronephrosis was seen in both kidneys. Evaluation of cardiovascular and respiratory systems did not show any significant abnormality. Electromyography (EMG) and nerve conduction study (NCS) were normal. A biopsy was taken from his right deltoid muscle which showed mild changes in fiber size and local fibrosis. The findings were suggestive of myopathy.\u00a0Immunohistochemistry was not done due to financial constraints.\u00a0A diagnosis of HS was made based on clinical manifestations, laboratory investigations, and confirmatory muscle biopsy report. We further suspected PS as the cause of hypothyroidism in this patient based on his symptoms of congenital deafness and thyroid dysfunction. A tone audiometry was carried out which showed bilateral sensorineural hearing loss. A diagnosis of PS was finally established by performing a perchlorate discharge test which showed an abnormally rapid loss of radioactive iodine from the thyroid gland after the administration of perchlorate.The patient was initially treated with 100 \u03bcg levothyroxine daily which was gradually increased to 150 \u03bcg after two weeks. The patient was assessed after four weeks. His swelling resolved and TSH levels went down to 13 \u03bcIU/ml . The patient is under regular follow up with improvements in his symptoms.In 1897, HS was first elucidated by Hoffmann in an adult with muscle stiffness and hindrance in relaxation of his muscles following thyroidectomy\u00a0. This suUsually primary hypothyroidism leads to thyroid insufficiency, Hashimoto's thyroiditis being the main culprit. Contrary to this, a suspicion of PS as the cause of hypothyroidism was made in this case because of the associated sensorineural hearing loss since birth along with the negative serology for anti-TPO Ab. Immunohistochemistry could not be done due to the nonavailability of funds.Levels of CPK, being the best biochemical indicator of myopathies\u00a0, were drPatients are often misdiagnosed as the clinical picture and biochemical studies might challenge the physician to differentiate this syndrome from polymyositis or muscle dystrophies. EMG, NCS, and muscle biopsy are useful tools for the establishment of diagnosis. In this case, EMG and NCS were normal. Muscle biopsy revealed pale muscle fibers with variation in their size and focal areas of fibrosis without any inflammatory infiltrate, excluding polymyositis. This patient experienced difficulty in walking presumably because of frail contractions of the involved muscles. This weakness of muscular contraction associated with hypothyroidism is caused by muscle fiber transformation from type 2 fast-twitching to type 1 slow-twitching and abnormal oxidative enzymatic function\u00a0. The exaThe treatment comprises exogenous thyroid hormone, in the form of levothyroxine, the dosage being 100-200 \u00b5g/day. Cardiovascular status of this patient was found to be normal as it is vital to rule out any cardiovascular risks prior to starting treatment due to an increased risk of acute coronary insufficiency, more common in elderly. A typical surge in symptoms can be seen in some cases with severe myopathic manifestation after the initiation of treatment, possibly due to raised metabolic demand induced by thyroxine\u00a0. In thesHoffmann\u2019s syndrome is a rare clinical presentation of a very common disorder of endocrine system, hypothyroidism. This case is even more rarer as it indicates PS as one cause of hypothyroidism leading to HS if left untreated. The positive aspect of this unusual entity is that it carries favorable prognosis with complete reversal of symptoms on timely made diagnosis followed by prompt initiation of THRT. As in this case, the patient showed gradual but progressive recovery from myopathy and reduction in elevated levels of TSH and muscle enzymes. Clinicians should be well aware of this rare manifestation of hypothyroidism to prevent the associated morbidity by avoiding misdiagnosis and subsequent delay in management."}
+{"text": "Production of fluent speech in humans is based on a precise and coordinated articulation of sounds. A speech articulation network (SAN) has been observed in multiple brain studies typically using either neuroimaging or direct electrical stimulation (DES), thus giving limited knowledge about the whole brain structural and functional organization of this network. In this study, seven right-handed patients underwent awake surgery resection of low-grade gliomas (4) and cavernous angiomas. We combined pre-surgical resting state fMRI (rs-fMRI) and diffusion MRI together with speech arrest sites obtained intra-operatively with DES to address the following goals: (i) determine the cortical areas contributing to the intrinsic functional SAN using the speech arrest sites as functional seeds for rs-fMRI; (ii) evaluate the relative contribution of gray matter terminations from the two major language dorsal stream bundles, the superior longitudinal fasciculus (SLF III) and the arcuate fasciculus (AF); and (iii) evaluate the possible pre-surgical prediction of SAN with rs-fMRI. In all these right-handed patients the intrinsic functional SAN included frontal, inferior parietal, temporal, and insular regions symmetrically and bilaterally distributed across the two hemispheres regardless of the side (four right) of speech arrest evocation. The SLF III provided a much higher density of terminations in the cortical regions of SAN in respect to AF. Pre-surgical rs-fMRI data demonstrated moderate ability to predict the SAN. The set of functional and structural data provided in this multimodal study characterized, at a whole-brain level, a distributed and bi-hemispherical network subserving speech articulation. Speech articulation is the process of producing individual sounds to compose a word . AccordiSpeech arrest is defined as discontinuation in number counting but with voluntary movements of tongue being possible (anarthria) . BecauseIt has been demonstrated that combining brain stimulation with neuroimaging techniques in a \u201cperturb and measure\u201d approach allows mapping distributed brain activity related to the perturbation of a cortical region . TherefoWith respect to functional connectivity of speech articulation, a recent invasive study characterized the temporal evolution of this network using intracranial recording and stimulation on 10 right handed pediatric epilepsy patients responding a tone listening and repetition task . The autWith regard to structural connectivity of speech articulation a series of studies have reported that intra-operative subcortical stimulation of both the anterior portion of the superior longitudinal fasciculus (SLF III) and the arcuate fasciculus (AF)cause speech arrest . HoweverBased on the findings of above mentioned studies we hypothesized that the structural and functional speech articulation network (SAN) could be characterized at the level of the whole brain in single-subject data by combining pre-surgical resting state fMRI (rs-fMRI) and diffusion-weighted MRI tractography data together with information about speech arrest sites obtained with DES during routine awake surgery. Therefore, we collected and performed a combined analysis of these data in a group of patients with brain tumor and cavernous angiomas with the aim of: mapping the SAN at a whole brain level calculating the rs-fMRI functional connectivity of the speech arrest sites detected with DES with all the other regions of the brain; determining which among the SLF III and AF provides the major associative tract for speech articulation by comparing their density of cortical terminations in the regions of the SAN; evaluating the extent to which pre-operative rs-fMRI networks obtained with independent component analysis (ICA) can predict the SAN as determined using the intra-operative speech arrest seed. This information, in particular, may be helpful if rs-fMRI would be used for pre-surgical mapping of speech articulation areas.Table 1 reports age, gender, lesion location and histology (in case of gliomas) for each patient included in the study. All the surgical  and neuroradiological  procedures performed and described in this study are part of the standard protocol in our Center for pre-operative planning and resections of lesions harboring eloquent areas. All the participants provided an informed consent to the collection of the data and the use for scientific purposes.MRI and intra-operative DES data were acquired and retrospectively analyzed on seven right-handed patients  submitted to routinely surgical removal of low grade gliomas (4) and cavernous angiomas with DES cortico-subcortical mapping. All the patients underwent to a routinely protocol at the \u201cS. Chiara\u201d Hospital of Trento APSS for pre-operative planning for resection of lesions in critical areas, including diffusion-weighted imaging (DWI) for tractography and rs-fMRI. Images were acquired using a clinical Optima MR450w GE 1.5 T scanner  equipped with an 8-channel receive head RF coil.3, ASSET acceleration factor = 2) and a 2D T2\u2217-weighted gradient echo planar imaging sequence for rs-fMRI . During the acquisition of rs-fMRI data patients were asked to lay still with eyes open.The pre-surgical imaging protocol included a 3D T1-weighted inversion recovery gradient echo sequence for structural imaging  = 256 mm, voxel size = 1 \u00d7 1 \u00d7 1 mm3; TR/TE = 13000/95.8 ms; flip angle: 90\u00b0; b values of 0 and 1,000 s/mm2.For tractography, a 60-direction DWI scheme was acquired (one acquisition) using a single-shot multislice spin echo\u2013echo planar sequence with the following attributes: 50 slices; square FOV: 240 mm; voxel size = 2.4 \u00d7 2.4 \u00d7 2.4 mmFor additional tumor characterization, at the end of the MR protocol a second 3D T1-weighted image was acquired  following injection of gadolinium. During the procedure of DES, the spatial coordinates of the speech arrest sites are saved using this post gadolinium structural image as reference.Supplementary Figure S1 and consisted of: removal of the first four EPI volumes to allow the signal to reach steady state magnetization, slice timing and head motion correction, median (r = 2) filtering, de-trending with a fourth order polynomial and low pass filtering with second-order Butterworth filter (f < 0.1 Hz). Head motion shift and rotation parameters and the average time series of WM and cerebrospinal fluid (CSF) tissue masks, obtained from the segmentation and co-registration of the pre Gad T1-weighted images to the rs-fMRI data, were temporally filtered as above and regressed out. Volume outliers were inspected (after head motion correction) and removed using the ArtRepair software version Version 5b1. A volume was classified as an outlier either if its frame by frame head motion was greater than 0.5 mm or its whole brain average time series value was above 2.5 standard deviation the average global signal intensity and it was replaced by interpolating the values from the preceding and subsequent volumes. Finally before iFC analysis rs-fMRI data was spatially smoothed using an 8 mm Full Width Half Maximum Gaussian filter.Resting state fMRI data preprocessing was performed using SPM12, FSL (version 5.09), and custom based MATLAB code (version 8.1.0) following The processing of DWI was performed concatenating a step for pre-processing, a step for voxel model reconstruction, and a step for deterministic tractography. The analyses pipeline was implemented using FSL and Dipy, an open source library for the analysis of diffusion MRI data .2 and a multiple (inclusion/exclusion) regions of interest (ROIs) approach by an expert brain anatomist , as part of the pre-surgical planning and for intra-operative support in neuronavigation. For AF an inclusion ROI was placed at the stem , posteriorly to the posterior sulcus of the insula and below the posterior thirds of STG and middle temporal gyrus (MTG) and an exclusion ROI was placed at the level of the stem of SLF III, in the lateral WM at the most ventral border between frontal and parietal lobe  method, with 106 seeds. The resulting whole-brain tractograms consist of approximately 150 thousand streamlines. The bundles included in this study  were tracked with TrackVistal lobe . Vice veAll patients underwent asleep\u2013awake\u2013asleep surgery with total intra-venous anesthesia using Remifentanil and Propofol infusion stopped before the awake mapping and neuropsychological monitoring. Cortico-subcortical DES was performed to obtain the most reliable mapping of eloquent structures . A bipolz = 0.21, p = 0.01 single voxel and family wise error corrected at a significant level of p < 0.05 using cluster-based thresholding based on cluster-size parameters estimated by AFNI\u2019s 3dClustsim  functional connectivity (iFC) map of the SAN using for each subject the speech arrest sites as ROI seeds for the functional connectivity. For each patient a seed based iFC map of the SAN was generated according to the following pipeline: a 7 mm radius sphere was drawn from the geometrical center of the speech arrest ROI aligned with the T1-weighted post-gadolinium images. The six degree of freedom rigid body matrix to register the T1-weighted post-gadolinium to the T1-weighted (pre-gadolinium) images was determined using FSL-FLIRT. This matrix was subsequently composed with the one calculated to co-register the pre-gadolinium T1-weighted images to the rs-fMRI data and applied it to the 7 mm radius speech arrest sphere. The Pearson\u2019s correlation coefficient was calculated between each voxel of the pre-processed rs-fMRI dataset and the speech arrest ROI average time series and converted to z-score using the Fisher transform. For each patient the obtained cross correlation map was thresholded at Clustsim .z > 0.21) was warped into MNI space . The co-registration matrix was determined by multiplying the inverse of the matrix obtained to co-register the pre-gadolinium T1-weighted images to the motion corrected rs-fMRI data with a 12 degree of freedom matrix calculated using FSL-FLIRT to register the pre-gadolinium T1-weighted images to the FSL T1 template, 2 \u00d7 2 \u00d7 2 mm3. The quality of the co-registration was visually assessed and deemed adequate for each patient by the first author. Finally, as a measure of SAN consistency across subjects, the proportion of patients for which each voxel of the FSL template brain was included in the speech articulation iFC map was calculated  space. To this purpose each subject\u2019s thresholded speech articulation iFC map  determined by probabilistic ICA implemented in MELODIC-FSL . For eacFigure 1. The speech arrest sites were mainly located in right and left frontal inferior and rolandic opercula, in VPMC, according to previous literature findings on the intra-operative detection of anarthria  (Table 2) of each speech arrest ROI center in MNI space . The SAN was consistently and bilaterally observed across all patients in the fronto-ventral, temporal, sensorimotor and inferior parietal lobule regions, regardless of whether speech arrest sites were localized in the left (three cases) or right (four cases) brain hemispheres.The speech arrest seed-based iFC maps for each patient are shown in airment) . We repoSupplementary Figure S2 the group functional connectivity SAN are shown as voxel-wise frequency maps in MNI space at four different frequency threshold . We determined that the group maps thresholded at 40%  could reliably represent a group functional connectivity SAN because it includes on both hemispheres cortical regions known to be involved in speech articulation , working memory/language articulation  and motor articulation (sensorimotor cortex) areas.In culation  while thculation . The GM Figure 4 shows a 3D surface representation of the overlap between the SLF III and AF cortical terminations maps (median across subjects) and the group iFC of speech articulation thresholded at 0.4, as in Figure 3. The analysis of the distribution of cortical terminations across the iFC sites overall showed  a much higher density of the SLF III (range 0.22\u201314.60%) in comparison with the AF (0.30\u20134.35%), according also to the results of the statistical analysis . Specifically the SLF III terminated predominantly in the most ventral and anterior parietal cortices (14.6% for SMG and 13.6% for PostCG) followed by the most ventroposterior cortices of the frontal lobe (13.29% for PCG and 8.75% for rolandic opercula). Minor branches projected toward the posterior third of the STG (2.83%), frontal inferior operculum and insula (0.47 and 0.22%). The terminations of the AF in the same regions were instead observed predominantly in PCG (4.35%), Rolandic Opercula (3.59%), and the Insula (2.2%) followed by the PostCG (3.03%) and SMG (0.3%). We excluded from the analysis of the Heschl\u2019s gyrus because median PTS was 0 for both SLF  and AF .N = 7) degree of correlation between the connectivity of the SAN seed regions and the GOF of the speech articulation component obtained with ICA : r = 0.57, p = 0.2; r = 0.57, p = 0.2; and r = 0.61, p = 0.16, respectively, for 20, 30, and pICA determined number of components. Supplementary Figure S3 shows for each patient the z-score map of the component best matching the SAN template obtained including all the voxels in the speech articulation frequency iFC map with a value higher than 40% (at least three or more patients from the group of seven). The similarity between the automatically selected (highest GOF) ICA and seed based speech articulation iFC maps was not dependent on the number of components the rs-fMRI signal was decomposed into .Prediction of the SAN by pre-surgical rs-fMRI ICA gave promising results as evidenced by the moderate  the intrinsic functional connectivity of the SAN includes a set of speech-specific auditory processing (middle and posterior STG), working memory/language articulation  and motor articulation (sensorimotor cortex) areas mirrored across the left and right hemisphere; (ii) these cortical regions are structurally connected with higher density by WM SLF III fibers; and (iii) pre-surgical rs-fMRI data provides moderate prediction of the articulatory loop network without knowing One of the goals of this study was to characterize at the whole brain level the spatial pattern of the functional SAN, in particular its inter-hemispheric connectivity. To accomplish this, we used a seed-based functional connectivity analysis on pre-surgical rs-fMRI data using as seeds the speech arrest sites determined intra-operatively during standard awake surgery. The cortical areas showing group intrinsic functional connectivity included the PCG, PostCG, the rolandic opercula, pars opercularis of the IFG, SMG, insula, STG (particularly the posterior third), and Heschl\u2019s gyrus both left and right hemisphere. Among the set of cortical areas with the highest frequency within the group (>40%), two regions, the SMG in the parietal lobe and the Heschl\u2019s gyrus in the temporal lobe had not been previously shown to elicit neuronal response for articulation tasks in fMRI studies , 2017. TWith regards to the inter-hemispheric intrinsic functional connectivity of the articulatory loop we found a consistent symmetrical bilateral segregation of the network, across right-handers explored, regardless the brain hemisphere of the speech arrest seeds. This evidence suggests, firstly, that the articulatory network is integrated only partially with the classical left-hemisphere dominated language network, as classically emerging from rs-fMRI studies . The absWe found that the cortical regions more frequently mapped in the speech articulatory network are structurally connected predominantly by the SLF III relative to the AF in this patient\u2019s series.in vivo and multimodal evidence that the SLF III fibers support a functional connectivity pattern for integration of sensorial input and speech output between the temporo-parietal junction (SMG) and the ventroposterior frontal cortices (PCG and Operculi) in both left and right brain hemispheres, as previously reported with DES studies. A role in speech articulation for the SLF III has been hypothesized, in fact, starting from the seminal work by in vivo diffusion MRI data and from the ex vivo tissue analysis  between the two methods for calculating functional connectivity networks. Compared to the findings reported by It would be potentially useful, for example in pre-surgical planning studies, to predict the SAN from the intrinsic rs-fMRI networks without prior knowledge of speech arrest sites. To this aim we assessed the degree of spatial correspondence between the pre-surgical resting state networks obtained using ICA (using different choices for the number of IC) and the intrinsic functional connectivity maps seeded in speech arrest sites found intra-operatively. We found moderate correlation . However, the population of patients we investigated in this work can be considered representative of a larger sample for the following reasons: (a) the balanced distribution of the intra-operatively recorded speech errors across both hemispheres (four right and three left) in right handed patients suggests that the represented bilateral patterns of speech articulation iFC should not be due to a bias in the location of speech arrest points and (b) the inclusion of a mixed sample , including lesions not harboring cortical and subcortical structures supposed to support this network in order to guarantee that the detected areas functionally connected are not the result of recruitment of new cortical hubs due to plasticity phenomena. In addition, none of the mapped speech arrest points was located in spatial proximity with a lesion. Therefore we do not expect that any of the iFCmap may be affected by false negative due to neurovascular uncoupling or lesion related susceptibility artifacts  for downloadThis study was carried out in accordance with the standard pre-operative and operative protocol of the Division of Neurosurgery of \u201cS. Chiara\u201d Hospital for resection of brain lesions harboring critical areas. All subjects gave written informed consent in accordance with the Declaration of Helsinki.DZ processed the data, interpreted the results, and wrote the manuscript. FCo, MD, and GF collected the data, processed the data, and interpreted the results. UR, LA, LZ, and FCh collected the data, processed the data, interpreted the results, and revised the manuscript. PA processed the data, interpreted the results, and revised the manuscript. JJ and SS processed the data, interpreted the results, and wrote and revised the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Human brain pathways supporting language and declarative memory are thought to have differentiated substantially during evolution. However, cross-species comparisons are missing on site-specific effective connectivity between regions important for cognition. We harnessed functional imaging to visualize the effects of direct electrical brain stimulation in macaque monkeys and human neurosurgery patients. We discovered comparable effective connectivity between caudal auditory cortex and both ventro-lateral prefrontal cortex  and parahippocampal cortex in both species. Human-specific differences were clearest in the form of stronger hemispheric lateralization effects. In humans, electrical tractography revealed remarkably rapid evoked potentials in VLPFC following auditory cortex stimulation and speech sounds drove VLPFC, consistent with prior evidence in monkeys of direct auditory cortex projections to homologous vocalization-responsive regions. The results identify a common effective connectivity signature in human and nonhuman primates, which from auditory cortex appears equally direct to VLPFC and indirect to the hippocampus.  \u2022Privileged human auditory to ventral prefrontal connectivity, paralleled in monkeys\u2022Common auditory to parahippocampal effective connectivity in both species\u2022Stronger lateralization of connectivity effects in humans than in monkeys\u2022Human fronto-temporal network rooted in conserved organizational principle Interconnectivity between brain regions crucial for language and declarative memory is thought to have substantially evolutionarily differentiated in humans. Rocchi, Oya and colleagues visualize site-specific brain connectivity in monkeys and human neurosurgery patients. They discover a common neural organizational principle that bridges gaps between primates as neurobiological models and human patients. Brain networks adapted for specialized functions typically show direct, rapid, or effective connectivity between regions crucial for behavior. Finding such connectivity, alongside evidence for evolutionary homology, convergence, or divergence, can be of substantial theoretical significance. Within the motor domain, human and nonhuman primates have direct cortico-spinal projections subserving fine movement control that are indirect in rodents . Also, hLanguage defines us as a species, and because of its prominent role in declarative memory, evolutionary differentiation of human cognitive pathways is expected. Comparative studies often see considerable levels of conservation alongside insights on species-specific differences . Yet cerSpeech and language are supported by a fronto-temporal network, including auditory and ventro-lateral prefrontal cortex (VLPFC) areas, interconnected via dorsal and ventral white matter pathways and processing streams . Left heSensory input to the medial temporal lobe (MTL) in humans is important for declarative memory and may also have evolutionarily differentiated in humans. Monkey recognition memory for sounds is surprisingly more fleeting than for visual items , yet so New approaches for assessing effective connectivity similarly across the species could shed light on human cognitive pathways and their primate origins or specialization. In monkeys, electrical stimulation combined with functional magnetic resonance imaging (es-fMRI) was developed to visualize the impact of site-specific stimulation on neural network effective connectivity . Direct The es-fMRI approach has been used in several disorders to assess the pattern of activated brain regions and the treatment response from stimulating specific brain sites . Safety Z > 2.8) in areas including auditory cortex, motor-related, prefrontal, and MTL regions  of passive current spread is 0.9\u00a0mm, suggesting that stimulating core auditory cortex sites also passively electrically stimulates portions of the adjoining auditory belt and vice versa, a consideration for interpreting the es-fMRI results. For additional macaque es-fMRI results, split by monkey or combining the two sites of stimulation, see Grouping of stimulation sites was conducted across two tonotopically organized fields  versus site 2 (latHG+PT) showed stronger VLPFC activity from stimulating site 1 . Site 1 We assessed whether macaque auditory cortex stimulation differentially activates anatomically defined areas 44, 45, and the FOP in the VLPFC A and 5B.F1,34\u00a0= 7.34; p\u00a0= 0.010), but there were no interactions with other factors, suggesting a similar pattern of es-fMRI effects across the monkeys. The two sites of stimulation did not differentially affect the VLPFC fMRI response, consistent with the whole-brain results. The macaque VLPFC ROI effects were also statistically indistinguishable across the two hemispheres (no significant hemisphere effect). Although the ANOVA revealed only a trend toward a differential fMRI response across the ROIs , the planned post hoc comparisons identified stronger es-fMRI activity in the FOP over areas 45 and 44 in that order  . The vast majority of subjects were left hemisphere language dominant .F1,21\u00a0= 5.26; p\u00a0= 0.032; F1,21\u00a0= 3.14; p\u00a0= 0.090), seen as a weaker albeit not significant site 2 (latHG+PT) es-fMRI effect on the VLPFC subregions  and stimulated hemisphere , seen in For the human MTL ROI effects, the ANOVA did not show significant differential activation between the ROIs, although the weaker pattern was similar to that seen in monkeys with the post hoc comparisons: The PHG had a stronger es-fMRI response than CA4  and DG , and the subiculum response was stronger than CA4 . MTL ROI effects only trended for activated hemisphere . There was no significant species difference in the VLPFC ROI effects (p\u00a0= 0.139), showing statistically indistinguishable VLPFC ROI response patterns across the species  but did not significantly interact with species. There were higher order interactions with species, including hemispheric differences , showing that a key difference across the species for the VLPFC areas is the hemispheric lateralization pattern being stronger in humans.For the VLPFC cross-species comparison, both monkey and human es-fMRI results showed stronger FOP responses than area 45 . The ROIs did not differ in their fMRI response pattern but interacted with species , and the species factor further interacted with\u00a0activated hemisphere , suggesting that hemispheric lateralization in humans was a prominent species difference, as seen for the VLPFC results. For instance, human entorhinal cortex shows greater right hemisphere activation , and there was a significant ROI-by-species interaction . For the cingulate cortex ROIs, there was no significant site of stimulation effect or higher order interactions , as follows. The species factor was significant  between auditory cortex, VLPFC, and hippocampus (https://osf.io/4axx2/). We assessed the polarity and latency of stimulation-induced responses using spatial Laplacian filtering to reduce volume conduction effects and spurious cross-channel correlated responses. Response waveforms in VLPFC showed positive and negative components at different latencies (P) and negativities (N) by latency .Auditory cortex site 1 (medHG) and site 2 (latHG+PT) stimulation induced neurophysiological potentials in VLPFC B and 5C atencies E\u20136H. Ouratencies , identifP(a): average latency: 5.3 and 6.8\u00a0ms, respectively, from stimulating medHG or latHG+PT) followed by an early negativity, N(a), and later positivity and negativity . No other effects or interactions were found.Effects from stimulating VLPFC while recording in HG indicate that connectivity appears to be bidirectional, evident as the presence of both sets of positivities and negativities: compare N(b) latencies in F1.407,45.034\u00a0= 9.399; p\u00a0< 0.001; \u03b5\u00a0= 0.469). No other significant effects or interactions were found.Next, we studied esT effects between hippocampus and auditory cortex. The waveforms recorded in the hippocampus after stimulation of HG, or vice versa, were also distinctly different in shape, with later components much more variable in latency, depending on the direction of stimulation (compare P(a) component (excluding the others) showed it to be significantly earlier when stimulating HG and recording in VLPFC than any of the other combinations of directions or stimulation/recording sites . Notably, this early latency response in VLPFC resulting from stimulating HG appears as early as the one reported from potentials recorded in the posterior STG when stimulating HG . Expectedly, auditory (HG and STG) sites showed strong broad-band speech-driven responses A, includDirectional frequency-resolved CGC analyses were conducted between pairs of contacts with the results conditioned on non-specific effects across all contacts during the neurophysiological responses to speech  with inhibitory neurons reducing signal propagation to other areas . HoweverElectrical stimulation effects can, in principle, result from both\u00a0antidromic and orthodromic propagation along axons. A comparison of electrical stimulation effects on feedforward and feedback influences between visual areas V1 and V4 indicates that orthodromic influences tend to be stronger and less stereotyped in either direction . For insEvidence for human differentiation was clearest in the form of hemispheric lateralization. By contrast, the monkey es-fMRI effects were largely bilateral, even though it was only possible to stimulate the right hemisphere in the monkeys. The human results showed some hemispheric lateralization effects in VLPFC and MTL subregions.There were also differences in effects between humans and monkeys by auditory cortical site of stimulation. We initially stimulated auditory core and belt areas in the monkeys, aiming to identify distinctly different es-fMRI effects, given that belt neurons are known to project to prefrontal cortex . HoweverTo illustrate the power of the approach for the study of brain systems beyond the ones that we focused on in this paper involving the defined VLPFC and MTL areas, we also conducted an analysis of auditory effective connectivity to areas associated with vocal motor production . There aOther systems are also now worth exploring with the comparative es-fMRI approach. In this regard, The effective connectivity approach we used is agnostic to the white matter tracts that interconnect auditory cortex with the fronto-temporal sites. Human diffusion MRI and monkey anterograde tracer studies indicate that the FOP and parts of area 45  show dense labeling , 2002. Alabeling . Also, ilabeling . In thatThe study provides evidence for a rapid electrical-tractography response in VLPFC following HG stimulation. An early positive potential occurred in VLPFC as soon as we could measure it after the stimulation artifact, peaking \u223c5\u20137\u00a0ms after HG stimulation. Auditory cortex and the VLPFC are separated by \u223c10\u00a0cm via the arcuate fasciculus. The latency of this early positivity was significantly longer in the opposite direction (stimulating VLPFC and recording in HG) and between HG and the hippocampus in either direction E\u20136H. TheThereby, our early electrical tractography potential latencies from HG to VLPFC appear similar to those reported from stimulating STG while recording in VLPFC . The resWe observed considerable speech-sound-driven neurophysiological responses in human VLPFC and show conditional Granger causality results on bidirectional effective connectivity between HG and VLPFC. Speech responses in VLPFC are not unexpected. They are typically evident during active speech recognition or difficult listening conditions . Spoken In summary, the findings demonstrate largely comparable effective connectivity signatures between human and macaque auditory cortex and the studied VLPFC and MTL areas. The auditory system as the model sensory system under study was expected to show substantial specialization in humans for speech, language, and declarative memory. However, even these results involving auditory cortex identify a common principle in fronto-temporal effective connectivity across these species. Future studies in other sensory modalities and species could further support or refute these observations.chris.petkov@ncl.ac.ukThe lead contact for the study is Christopher I. Petkov: This study did not generate new unique reagents.https://osf.io/arqp8, PRIMatE Data Exchange https://fcon_1000.projects.nitrc.org/indi/indiPRIME.html and PRIMatE Resource Exchange: https://prime-re.github.io/. For the human data: Open Science Framework https://osf.io/arqp8 or Open Neuro https://openneuro.org/. This study did not generate unique code.The macaque and human datasets generated during this study are available as follows. For the macaque data: Open Science Framework In\u00a0Vivo Experiments (ARRIVE). All persons involved in animal handling and procedures were certified and the work was strictly regulated by the UK Home Office.All the nonhuman animal work and procedures were approved by the university Animal Welfare and Ethical Review Body and UK Home Office. The work complies with the revised UK Animal Scientific Procedures Act (1986), the US National Institutes of Health Guidelines for the Care and Use of Animals for Experimental Procedures and with the European Directive on the protection of animals used in research (2010/63/EU). We support the principles on reporting animal research stated in the consortium on Animal Research Reporting of Macaca mulatta) from a group-housed colony were scanned awake with combined electrical stimulation and fMRI . The pen sizes in the colony range from 130\u00a0\u00d7 240\u00a0cm to 215\u00a0\u00d7 240\u00a0cm. They are 230\u00a0cm high, and hatches between neighboring cages are used to increase the space available to the animals. Given the ethical sensitivities involved in studying nonhuman primates and the 3Rs principles , our work requires using the fewest monkeys possible. A sample size of two is common in neuroscience work with macaques provided that results are robust with each individual and that the effects generalize beyond one animal. Given that our results from several hundred trials and many scanning runs with each animal are statistically robust and consistent in the overall pattern of effects between the animals  there was little ethical justification to test additional monkeys.Two male rhesus macaques  had been implanted for clinical monitoring. The patients\u2019 demographic information and treatment outcomes are shown in The electrical stimulation procedure used in this work is based on methodology developed in prior macaque es-fMRI studies . Here, tPrior to the experiments, an MRI-compatible PEEK head post and chamber were implanted stereotaxically during an aseptic procedure under general anesthesia. The chamber was positioned over the right hemisphere to provide access to posterior auditory cortex, including fMRI tonotopically localized fields A1 and the posterior area adjoining the border between belt fields CL and CM .During each scanning session, a custom-made PEEK microdrive was used to advance the stimulating electrode to auditory cortex. Monopolar electrical stimulation was induced through platinum/iridium microelectrodes coated in parylene-C , with a typical impedance of 100-200 k\u03a9 (electrodes with impedance below 75 k\u03a9 were not used). The stimulating electrode location in auditory cortex was confirmed via MRI structural scans and sound-evoked neurophysiological responses as in previous studies , using aThe target sites were electrically stimulated using a World Precision Instruments (DS8000) waveform generator with an electrical stimulus isolator unit (DLS 100). The system delivered a constant-current, charge-balanced electrical pulse of either 0.5 or 1 mA (fixed within a stimulation session) at a repetition rate of 200\u00a0Hz  signal, using an actively shielded vertical primate-dedicated 4.7 Tesla MRI scanner . The monkeys had been slowly acclimated over several months with reinforcement training to work in the primate scanning chair and with the required periods of head immobilization during fMRI . They we2, on a grid of 88\u00a0\u00d7 88 voxels. Voxel resolution was 1.2\u00a0\u00d7 1.2\u00a0\u00d7 1.3\u00a0mm3 covering much of the brain. A sparse fMRI acquisition paradigm was used to minimize the interference caused by the scanner noise on the auditory cortex response . Functional data were obtained using a gradient-recalled echo planar imaging (GE-EPI) sequence, with the following parameters: echo time (TE)\u00a0= 20\u00a0ms; volume acquisition time (TR)\u00a0= 2000\u00a0ms; flip angle\u00a0= 90 degrees; 32 slices, in plane with a field of view (FOV) of 10.7\u00a0\u00d7 10.7\u00a0cmresponse ; a singlresponse ; namely response B. Each t2 on a grid of 140\u00a0\u00d7 140 voxels. The voxel resolution was 0.75\u00a0\u00d7 0.75\u00a0\u00d7 0.75\u00a0mm3.Anatomical images, including those for helping to visualize the electrode position, were acquired at the beginning and end of each experimental testing session using magnetization-prepared rapid gradient-echo (MP-RAGE) sequences. Typical sequence parameters were: TE\u00a0= 20\u00a0ms; inversion time, TI\u00a0= 750\u00a0ms; TR\u00a0= 2000\u00a0ms; 50 slices with in-plane field of view: 10.7\u00a0\u00d7 10.7\u00a0cmWe performed General Linear Analysis using FEAT in FSL . We cont3 voxel size, TE\u00a0= 3.28\u00a0ms, TR\u00a0= 8.49\u00a0ms, TI\u00a0= 450\u00a0ms, FOV\u00a0= 240\u00a0mm3, flip angle\u00a0= 12 degrees; T2w: 3-D fast spin-echo (CUBE) sequence, 1.0\u00a0\u00d7 1.0\u00a0\u00d7 1.0\u00a0mm3 voxel size, TE\u00a0= 77.21\u00a0ms, TR\u00a0= 3200\u00a0ms, TI\u00a0= 450\u00a0ms, FOV\u00a0= 256\u00a0mm3, flip angle\u00a0= 90 degrees.Details of the human es-fMRI procedure and safety testing are also available elsewhere . Briefly3 resolution, TE\u00a0= 3.44\u00a0ms, TR\u00a0= 1970\u00a0ms, TI\u00a0= 1000\u00a0ms, Flip angle = 10 deg., FOV\u00a0= 250\u00a0mm3). A transmit and receive head coil was used for es-fMRI sessions to obtain both structural and functional scans. Gradient-echo, echo-planar imaging (GE-EPI) was used to obtain the T2\u2217 weighted BOLD scans .During es-fMRI scanning sessions, structural T1-weighted images were obtained using a Siemens Skyra 3 Tesla scanner . The control computer received and timed the electrical stimulation via a trigger from the scanner indicating the start of each EPI volume acquisition. Stimulation was bipolar using adjacent contacts (inter-contact distance was 5 or 10\u00a0mm) with stimulus intensity between 9-12 mA using constant-current electrical stimulation. In-vivo impedance of the electrode contacts ranged from 1.5 k\u03a9 to 5.5 k\u03a9 at 100\u00a0Hz for both depth  and surface (disk) electrode contacts. Electrical stimulus waveforms were charge-balanced biphasic square waves (0.2 and 0.6\u00a0ms duration) with a 0.2\u00a0ms inter-stimulation pulse period at 100\u00a0Hz repetition as illustrated in The stimulation sites in the human es-fMRI  were divided into two categories: 1) postero-medial HG sites (medHG); and 2) antero-lateral HG sites which included some sites on the planum temporale (latHG+PT). The number of es-fMRI runs with Site 1 stimulation and Site 2 stimulation were 23 and 19, respectively.The two sites were categorized according to the electrophysiological responses to click sounds presented at different rates . Click tThe location of the implanted electrodes was determined by comparing pre- and post-electrode implantation structural T1w MRI scans. To compensate for potentially significant displacement of the electrode due to postoperative brain shift, post-implantation volumes were non-linearly warped into pre-implantation MRI volume space using a thin-plate spline (TPS) procedure with manually selected control points for the electrodes in three-dimensional space , 2018. BFor surface grid electrodes, the locations of all grid contacts were identified in a postoperative CT scan. This was accomplished by manually identifying the location of a subset of contacts in the grid on the basis of the characteristic hyper-intense radiological artifacts. Identified contacts included the depth electrode contacts or the full 64- or 96-grid fitted to these locations by TPS warping, using a negligibly small regularization parameter. Applying TPS allowed the non-linear deformation of the grid to be approximated. Accuracy of fitting was evaluated by visually comparing fitted contact locations with the contact artifacts in the CT and by verifying that inter-contact spacing fell within 0.2\u00a0mm of the expected 5-10\u00a0mm contact spacing.After the initial grid locations were determined using CT, these were further corrected using a pre-explantation MR scan. Because displacement of brain parenchyma related to electrode mass-effect and post-operative swelling is often difficult to evaluate accurately on the CT scan, the results of CT-based localization were compared against a T1w MR scan obtained shortly before explantation. When significant discrepancy (greater than approximately 2\u00a0mm) was observed between CT-derived contact locations and corresponding magnetic susceptibility artifacts in the MR scan, a rigid linear transform was used to adjust grid positioning on the basis of clearly identifiable electrode-related artifacts in the MRI scan. The corner contacts were used as control points in this transformation. Individual T1w structural volumes were warped onto the CIT168 template brain  with ANTs symmetric normalization algorithm  and the The anatomical and functional imaging data were pre-processed using the fMRIPrep pipeline .The high resolution T1w image was corrected for intensity non-uniformity using `N4BiasFieldCorrection` and was used as a reference image throughout the workflow. The T1w-reference was then skull-stripped using `antsBrainExtraction.sh` (ANTs 2.2.0) with the OASIS template as a target . Spatial3) obtained during the same imaging session whenever possible. For mapping the BOLD and electrophysiological response onto the brain surface, the FreeSurfer surface meshes were further processed with AFNI\u2019s @SUMA_Make_Spec_FS to create standard icosahedron surfaces with various mesh densities.The subject\u2019s pre-electrode implantation structural MRI and the template brain  were processed with FreeSurfer \u2018recon-all\u2019 procedure to create the surface mesh. For improved pial surface reconstruction, cortical parcellation was facilitated by the T2w structural scans  were estimated before any spatiotemporal filtering using FLIRT in FSL. EPI scans were slice-time corrected using `3dTshift` from AFNI . Principal components were estimated after high-pass filtering the preprocessed BOLD time-series (using a discrete cosine filter with 128\u00a0s cut-off). We also defined two CompCor variants: temporal (tCompCor) and anatomical (aCompCor). Six tCompCor components were also calculated from the top 5% voxel variability within a mask covering subcortical regions. This subcortical mask was obtained by heavily eroding the brain mask, which ensured it did not include cortical gray matter. The head-motion estimates calculated in the motion correction step were also added to the confounding variables file. All resampling was then performed using a single interpolation step by composing all the pertinent transformations . Gridded volumetric resampling was performed using `antsApplyTransforms` (ANTs), configured with Lanczos interpolation to minimize smoothing effects (@lanczos).The above fMRIPrep processing pipeline generally yielded good registration between anatomical and functional imaging data, even with signal dropout due to the intracranial electrodes. If misalignment was obvious in the visual inspection of EPI to T1w registration or as reported in fMRIPrep, a further registration step was implemented. Here, the functional data was clipped in the sagittal plane discarding parts of the functional data that had significant signal dropout and this volume was used for finding the coregistration parameters using AFNI\u2019s \u2018align_epi_anat.py\u2019 program with normalized mutual information as a cost function. During this step, the part of the brain contaminated with the intracranial electrodes was not used for coregistration and this yielded safisfactory coregistration.Electrical stimulation neurophysiological tractography (esT) was conducted in human patients n\u00a0= 13,  accordinA Laplacian procedure was applied to reduce non-specific neurophysiological or electrical stimulation effects evident as cross-correlated potentials common to many electrodes from a common source or far-field potentials . This prTo make the movies, continuous intracranial recordings were cut into trials . The following procedure that we used yields similar results to one extracting high-frequency power (gamma and high-gamma band), but it avoids the need for temporal band-pass filtering and frequency decomposition. Stimulation artifacts (\u22125 to 5\u00a0ms from stimulation) were first replaced with the time-reversed waveform of the same length (10\u00a0ms) during an artifact free pre-stimulus period (\u221210 to \u22125\u00a0ms). Then a peri-stimulus waveform of 12\u00a0ms duration (\u22126 to 6\u00a0ms) was smoothed twice with median filters . This process was done for all single-trial waveforms. The trials were then re-referenced to the average of the surface grid contacts, to reduce the volume conducted artifact waveforms common across the recording surface grid. To extract induced responses (not phase-locked components), each channel\u2019s averaged potential in the re-referenced signal was subtracted from the single trials in that channel . InducedThe magnitude of stimulation-induced responses was calculated by taking the logarithm of the ratio of the magnitude in the pre-stimulus period (0.5 to 0.3\u00a0s before stimulus onset) and post-stimulus period. This yields the relative magnitude change with respect to the pre-stimulus period in dB. To make the movies, averaged induced responses of the surface contacts were calculated for non-overlapping temporal windows (length 5\u00a0ms), then color-coded and plotted onto the MNI template brain for each experimental run and temporal window. We employed bootstrapping (1000 iterations) of the mean activity within 5\u00a0ms temporal windows from the pre-stimulus period (55 to 7.5\u00a0ms before stimulation onset) and thresholded the response at the lower and upper 2.5% points. Responses not exceeding this threshold were set to 0 and thus were not mapped to the brain surface. For patients who had multiple esT sessions for either medHG or latHG sites, we averaged responses for each site separately to create the movies  and S2.To examine the brain\u2019s effective connectivity under a natural sensory stimulation setting, we examined neurophysiological responses to speech sounds. Many of the subjects were the same neurosurgical patients (n\u00a0= 8) who took part in the electrical tractography study  and S4.The experiment used a speech presentation paradigm previously described . The speIntracranial recording data were downsampled to 1000\u00a0Hz. The analysis of the neurophysiological responses focused on five frequency bands: theta (4-8\u00a0Hz), alpha (8-14\u00a0Hz), beta (14-30\u00a0Hz), gamma (30-70\u00a0Hz) and high gamma (70-150\u00a0Hz) denoised using a demodulated band transform-based algorithm . Event-rWe first preprocessed each scanning run using first-level analyses. Individual scanning runs with little evidence of the expected electrically induced activity  in auditory areas around the electrode or in auditory cortex in the opposite hemisphere were not analyzed further. Group higher-level analyses were conducted combining all of the viable scanning runs grouped by stimulation site (Site 1 or 2). Higher-level analyses were conducted using FLAME in FSL with a significance threshold at a cluster corrected  level. FreeSurfer was used to project the results onto the surface-rendered macaque template brain . Table S1 shows the anatomical regions with significant electrically induced es-fMRI activity  resulting from Site 1 or 2 stimulation. The contrast between Site 1 and Site 2 stimulation did not result in any cluster corrected (p\u00a0< 0.05) voxels.ROI analyses used anatomically defined regions from the macaque atlas  registerZ-value across the scanning runs.The MTL subregion analyses used anatomical regions corresponding to the PHG, entorhinal cortex (EC), subiculum (Sub), dentate gyrus (DG) and the CA1, 3 and 4 subregions (CA2 was not used because it is not available in the human brain atlas). No voxels overlapped between ROIs. Polar plots using the ROIs  show theZ-values as the dependent variable, with between-subject factors of Monkey  and Species (in the cross-species comparison: Macaque), within-subjects factors of ROI (VLPFC or MTL ROIs), Hemisphere (left or right) and Stimulation site (Site 1 or 2) as covariate. We ensured that the data fit normality and equality of variance assumptions by using rank-based normalization and reporting Greenhouse-Geisser corrected results as required.Mixed-design ANOVA models were used to examine ROI effects. The statistical test was implemented in SPSS 24  and used scanning run ROI peak The preprocessed functional datasets were subjected to univariate general linear model (GLM) analysis using AFNI\u2019s 3dDeconvolve routine. For the GLM analysis, functional data was spatially smoothed with a Gaussian kernel (FWHM\u00a0= 6.0\u00a0mm). Stimulus times were convolved with a 1-parameter gamma function. Baseline detrending was applied with a Legendre polynomial (5 degrees). Volumes (TRs) that showed large levels of motion (FD > 1.0\u00a0mm) across adjacent TRs were discarded. The first six tCompCor components extracted above and the FD time-series were added to the baseline model as nuisance regressors.A brain mask was created before spatial smoothing using intensity thresholded EPIs excluding areas of signal dropout from the electrodes contributing to the fMRI analyses. The clinically determined seizure onset zone (SOZ) was also excluded from the brain mask. If the SOZ affected any part of an ROI, the result for that run and ROI was excluded from further analysis. We show an incidence map in For the higher-level group analysis we used AFNI\u2019s \u20183dREMLfit\u2019 . DatasetZ-value, with variability across the scanning runs in the humans.Regions of interest analyses of the VLPFC and MTL used anatomically defined ROIs from standard anatomical atlases of the human brain. The VLPFC subregion analyses included as ROIs areas 44 and 45, and the frontal operculum (FOP). For area 44 and 45, the parcellation is based on the J\u00fclich histological (cyto- and myelo-architectonic) atlas using a 25% probability threshold . The humZ-values as the dependent variable, with between-subject factors of Human and Species (in the cross-species comparison: Human), within-subjects factors of ROI (VLPFC or MTL ROIs), Hemisphere of activation (left or right) and Stimulation site (Site 1 or 2) and Stimulated hemisphere (left or right) as covariates. We ensured that the data fit normality and equality of variance assumptions of the models or transformed the data to achieve normal distributions and report Greenhouse-Geisser corrected results as required.Mixed-design ANOVA models were used to examine ROI effects. The statistical test used scanning run ROI peak Mean Z-scores across the individual runs within all of the ROIs in the monkey and human data were used for the classification analysis. The data were centered and normalized with respect to their mean and standard deviation for both species to remove response magnitude difference between the species and among ROIs. The machine learning algorithm used was Catboost, which is based on gradient boosting on decision trees . We usedOverall mean species classification accuracy over 100 10-fold cross validation runs was 73.7% (SD\u00a0= 1.6%). We also performed the same analysis using data with shuffled labels . Mean and standard deviation of the accuracy of the shuffled data analysis was 50.1% and 5.3%, see \u221210; We also conducted the classification of response hemisphere to see whether the classifier could discriminate the hemisphere from which the data was obtained. For this, the classifier was built separately to analyze the human and monkey data. Significance of the variable importance was assessed in the same manner as above. Classification accuracy for human and monkey data was 67.0% and 47.3%, respectively, and significantly differed across species  and areas 8, 6v, 6d, M1 and SMA were used from the Saleem and Logothetis macaque atlas linked to the template brain . For theCGC was used to investigate the directional influence between brain regions during speech processing. The method is multivariate and conditional, in the sense that simultaneous time series from a collection of electrodes are included in order to account for both direct and indirect influences between contacts. Intracranial recordings were downsampled to 100\u00a0Hz and sectioned into trials from \u2212200 to 1000\u00a0ms relative to sound onset. Intuitively, CGC tests if activity in a source area can be used to predict subsequent activity on a target area. We estimated spectral CGC in 500\u00a0ms sliding windows in steps of 50ms to construct trial-averaged time-frequency CGC representations between selected pairs of electrodes . Prior tSeveral significant problems arise in applying standard Vector Auto-Regressive (VAR) based CGC models to intracranial recordings, which are related to downsampling and nonstationarities . Most ofnth-order differential or difference equations. State variables can be reconstructed from the measured recordings but are not themselves measured during an experiment. For modeling directional influence in the brain, it is possible to directly express the interactions between different regional signal time series as a state-space model defined by:m-dimensional state vector, and A, observation matrix C and the steady-state Kalman gain matrix K are estimated using a subspace method (State-space models use state variables to describe a system by a set of first-order differential or difference equations, rather than by one or more VAR e method . Subspace method . The ordTo statistically evaluate the reliability of the connectivity results we used a phase-randomization surrogate data technique to construct a null distribution . This me"}
+{"text": "Tricuspid regurgitation (TR) is a heterogeneous disorder defined by the backflow of blood from the right ventricle into the right atrium, what in normal conditions should be avoided by systolic leaflets coaptation. In almost 90% of TR cases, the valve is anatomically preserved, and the regurgitation is secondary to right ventricular or right atrial dilation  due to left-sided heart disease, atrial fibrillation, or pulmonary hypertension, culminating in tricuspid annular dilation or leaflet tethering.The presence of some TR degree is considered the most common valvular heart disease, affecting from 65 to 85% of the population , what meDespite its high prevalence and the implied two-fold increase in mortality , more thEfforts to change the paradigm of poor outcomes related to TR management, and to reduce the gap between the number of affected and the number of treated patients, make the engagement of the \u201cforgotten\u201d valve in the transcatheter intervention era an urgent necessity, and a new field for device development and clinical research.In this scenario, the recent paper published by Taramasso et al.  \u201cTranscaIn this propensity-matched case-control study the treated group was derived from the TriValve  registry, the largest multicenter, multidevice cohort of patients submitted to transcatheter therapies; while the control was gathered from two large retrospective registries in Europe and North America, providing a high degree of reliability and validity to the study.p<0.0001), as well as reduced 1-year mortality , and the composite endpoint of death or heart failure rehospitalization . The composite endpoint benefit remained statistically significant even after adjusting for sex, New York Heart Association (NYHA) class, right ventricular dysfunction, and atrial fibrillation . A similar magnitude of effect could be observed after further adjustment for mitral regurgitation and pacemaker/defibrillator implanted .Summarizing the main outcomes, the authors showed that transcatheter tricuspid valve interventions (TTVI) was associated with lower rates of 1-year rehospitalization due to heart failure .p=0.8).Regardless the diversity of devices utilized in the study, procedural success, defined as patient alive at the end of the procedure, with device successfully implanted, delivery system retrieved, and residual TR <3+, occurred in 86% of patients and did not differ between the adopted approaches (To realize the importance of this study in the present era, we need first to understand that TR is far from being merely a marker of concurrent cardiac disorders. Instead of this, TR is a real public health crisis, affecting millions of patients, leading to severe heart failure and excess mortality and treated only in a minimal fraction of affected patients .In view of the lack of randomized clinical trials evaluating the role of TTVI in symptomatic severe TR patients, especially elderly, this paper constitutes pioneer evidence supporting a more interventional approach, suggesting that it could be the time to change current guidelines and to include TTVI in the role of TR treatment options."}
+{"text": "Breast cancer survivors (BCSs) are a growing population with a higher prevalence of insomnia than women of the same age without a history of cancer. Cognitive behavioral therapy for insomnia (CBT-I) has been shown to be effective in this population, but it is not widely available to those who need it.This study aimed to better understand BCSs\u2019 experiences with insomnia and to explore the feasibility and acceptability of delivering CBT-I using a virtual assistant (Amazon Alexa).We first conducted a formative phase with 2 focus groups and 3 in-depth interviews to understand BCSs\u2019 perceptions of insomnia as well as their interest in and comfort with using a virtual assistant to learn about CBT-I. We then developed a prototype incorporating participant preferences and CBT-I components and demonstrated it in group and individual settings to BCSs to evaluate acceptability, interest, perceived feasibility, educational potential, and usability of the prototype. We also collected open-ended feedback on the content and used frequencies to describe the quantitative data.We recruited 11 BCSs with insomnia in the formative phase and 14 BCSs in the prototype demonstration. In formative work, anxiety, fear, and hot flashes were identified as causes of insomnia. After prototype demonstration, nearly 79% (11/14) of participants reported an interest in and perceived feasibility of using the virtual assistant to record sleep patterns. Approximately two-thirds of the participants thought lifestyle modification  and sleep restriction  would be feasible and were interested in this feature of the program . Relaxation exercises were rated as interesting and feasible using the virtual assistant by 71% (10/14) of the participants. Usability was rated as better than average, and all women reported that they would recommend the program to friends and family.This virtual assistant prototype delivering CBT-I components by using a smart speaker was rated as feasible and acceptable, suggesting that this prototype should be fully developed and tested for efficacy in the BCS population. If efficacy is shown in this population, the prototype should also be adapted for other high-risk populations. There were an estimated 3.6 million breast cancer survivors (BCSs) in the United States in 2016, and an estimated 30% to 50% of BCSs suffer from insomnia -7. Poor Cognitive behavioral therapy for insomnia (CBT-I) is recommended as the first-line treatment by the American College of Physicians and the National Comprehensive Cancer Network and has shown efficacy in a BCS population -15. Howemetrics of success, which we set out to meet before moving forward with fully developing the prototype and conducting efficacy testing. In this formative work, we solicited responses from survivors distinct from those who gave formative feedback. Our goals were to achieve that the majority of participants would report that they were somewhat to very interested in using the technology, that the majority of participants would report increased knowledge of CBT-I, and that participants would rate the concepts presented as somewhat to very important in addressing insomnia. We also set a target that a majority of participants would rate the perceived feasibility of using this prototype for the delivery of CBT-I components as moderate to high and that the prototype would show better than average system usability (score >68).The aim of our study was to better understand BCSs\u2019 experiences with insomnia and to inform the development of a prototype through focus groups and in-depth interviews that explore how BCSs would perceive and use a screen-free, voice-activated program for CBT-I. We created a series of We recruited women through the George Washington University Medical Faculty Associates (GW MFA) in conjunction with the breast cancer team. We also advertised in the local newspaper, reached out to local breast cancer survivorship groups, and mailed flyers to GW MFA patients who met the basic eligibility criteria. BCSs were considered eligible if they had a history of stage I-III breast cancer and had completed active treatment  at least three months prior. We used the Pittsburg sleep quality index, which has been validated in this population , to screAll formative data were gathered using focus groups in person or using in-depth interviews in person or by phone. The focus groups and in-depth interview guide questions are outlined in We conducted 2 focus groups. In group 1, 6 women participated. In group 2, only 2 women attended out of the 7 scheduled to attend. Last-minute conflicts came up with childcare (n=1), family emergencies (n=3), and rescheduling requests (n=1). Thus, we scheduled in-depth interviews with additional participants. We stopped focus groups and in-depth interviews when we found that responses did not generate any new information beyond what we had already collected.Sleep Helper. Media Rez drew on multiple sources for developing the Sleep Helper program, using the standardized CBT-I protocol that has been evaluated in extensive scientific literature and has demonstrated efficacy in similar populations  for 2 years. So, I have pretty much had 2 years of not having much sleep.The 2 most commonly mentioned strategies used to overcome insomnia included using technology such as a cell phone or television to distract themselves from anxious thoughts and keeping the room temperature cool and comfortable. Some women were familiar with strategies of restricting liquids before bedtime, avoiding alcohol and caffeine, and limiting naps, but participants also expressed difficulty in changing these behaviors..\u201d Other women found the device \u201creally attractive [in] that it\u2019s all put together in [one] package\u201d but also \u201cneeds to offer, a kind of intuitive straightforward easy to use process.\u201dParticipants were eager to have customizable features to be able to personalize the program, but they also expressed a need for simplicity and straightforward use. As one woman expressed \u201cone size does not fit all, you have to acknowledge that what works for one person may not work for someone elseWomen largely had some, but not extensive, experience with using smart speakers. Most participants were not concerned about the security of sharing information about sleep with a smart home device, but they did want information about how data were going to be used. Other issues such as frustration using the device (based on prior voice-activated programs such as Siri not understanding commands) and concerns \u201cif [the smart speaker] started talking randomly\u201d were mentioned. Women also noted that they would not want it to disturb a bed partner .morning, evening, education, and relaxation modules, asking participants open-ended questions about what they thought of the content and how they might or might not want to incorporate it into their home routines. Participants responded that the morning and evening modules were of an appropriate length and that features such as querying on caffeine were good reminders about changing behaviors. \u201cI\u2019ve been trying to do that [note time of last caffeine intake] on my own but haven\u2019t been entirely successful.\u201d Some women suggested wanting encouragement and being congratulated for meeting goals . Participants found that the educational module was surprisingly engaging, but suggested that they might want a menu of choices to know what kind of things they might be able to listen to; this feature will be available on the app that accompanies the virtual assistant program. Most of the participants were happy with short lessons but liked the idea that they could ask the Sleep Helper program to tell them more about a given subject. Participants expressed concerns over privacy but thought that they would probably use the program anyway, saying that they share their data already with other programs and that as long as they knew how data were being used, they would be reassured. Others thought that the benefit of addressing sleep concerns outweighs the risk:We enrolled 14 women who received the prototype demonstration. We demonstrated the Because it is for a specific purpose...it is not to make my life easier it is to give me knowledge, data, and help me rather than just for entertainment purposes...When asked about how long they could imagine using the program for, some women stated that:After 30 days everything becomes a routine...you would look forward to going in there and talking to it.This suggested that they envisioned continuing to use the program on an ongoing basis to record patterns even if sleep had improved. Others were skeptical about wanting to report sleep patterns daily but liked the idea that they could create default settings and then only update things that changed that day. Women also suggested allowing for customization for individual life events or vacations that may affect sleep patterns. \u201cIt should ask did something [that affected your sleep] happen today?\u201d When women were asked how much guidance they needed to use the device, they said that a voice-activated setup guide would be sufficient, although a few women thought they might want to have a number to call if they needed support in using the program.After the demonstration of the key prototype features, and open-ended discussion, participants completed questionnaires. On postdemonstration questionnaires, 79% (11/14) of the BCSs reported that knowledge of insomnia and CBT-I had increased after using the prototype compared with when they had arrived; the remaining participants said they had about the same knowledge after the demonstration. All 14 participants confirmed interest in using the program to treat insomnia symptoms at home, and all the participants reported that based on the demonstration, they would recommend the program to friends or family.All participants completed Likert scale questionnaires about interest, perceived feasibility, and importance of key CBT-I concepts that we had built into the initial prototype . In shorImportantly, all participants said that they would recommend the prototype to friends or family, showing strong potential for future testing. The average SUS score was 82.3 (range 50-100), indicating success in meeting the target usability score of \u226568.somewhat to very interested in using the technology, that participants would rate the program as feasible and highly usable, and that the majority of participants would report increased knowledge of CBT-I. In our demonstration, participants also reported that sleep logs (one of the key components of CBT-I that clinicians depend on to proscribe sleep recommendations) using the prototype was very feasible. This suggests that the data collected by the smart home device can be used by artificial intelligence programming to create personalized recommendations and schedules that go beyond simply presenting sleep hygiene education.In our formative work to understand BCSs\u2019 experiences with insomnia and smart home devices, we found that participants were interested in this technology, particularly if it could be personalized for ease of use. We reached our goal that the majority of participants would report that they were Another qualitative study of cancer survivors similarly showed that insomnia may be exacerbated by anxiety, inability to relax, and use of screen time before bed . Each ofPrevious studies have suggested a need for scalable methods to deliver CBT services, with self-administered CBT-I as a first step in a stepped care model . Our stuThe strengths of our study include formative work, development of an innovative technology, and early user testing to offer feedback on areas for improvement as the product is further developed. We triangulated data from the scientific literature and from formative data collection to frame messages around insomnia that were specific to our target population of BCSs.In this formative work, we gathered information from a limited number of participants, partly due to the short time frame of study funding. Yet, by the end of data collection, we were not observing additional themes that emerged, suggesting feedback saturation. We also demonstrated only a limited prototype, as the device was not fully programmed to incorporate feedback or be used in home testing. However, as our objective during this phase was only to assess perceived feasibility, this should not be considered a major limitation at this point in time. In future studies, we plan to further develop and test this prototype for actual feasibility and efficacy. Furthermore, we did not have demographic information such as income or education, which may have affected participant responses.We anticipate that by using an iterative development process with end users to ensure high user satisfaction, we will be able to further develop a voice-activated program to deliver CBT-I components that will improve insomnia among our target population of BCSs. In the long term, we hope to increase the uptake of this effective therapy in the breast cancer population beyond what has been achieved with in-person visits, videos, or website-based programs. After demonstrating efficacy in the BCS population, we plan to adapt the technology for other high-risk populations."}
+{"text": "Early diagnosis, multidisciplinary care, and optimized and preventive treatments have changed the face of cystic fibrosis. Life expectancy has been expanded in the last decades. Formerly a pediatric disease, cystic fibrosis has reached adulthood. Mutation-specific treatments will expand treatment options and give hope for further improvement of quality of life and life expectancy. Newborn screening for CF fits perfectly into these care structures and offers the possibility of preventive treatment even before symptoms occur. Especially in countries without screening, newborn screening will fulfill that promise only with increased awareness and new care structures. CFTR). CF mainly involves the pancreas and the lungs, but also the upper airways, liver, intestine, skin, and reproductive organs. Improved diagnosis, a multidisciplinary team approach, and symptomatic treatment have improved the health and survival prospects of persons with CF. Early diagnosis by newborn screening (NBS) [Cystic fibrosis (CF) is a life-shortening multisystem disease with an autosomal recessive inheritance pattern that affects nearly 100,000, mainly Caucasian, people worldwide. The disease is caused by dysfunction of the exocrine gland chloride channel protein, the cystic fibrosis transmembrane conductance regulator  [https://www.cftr2.org) [CFTR sequencing, around 1% of CFTR variants have not been identified. To confirm the diagnosis in these cases, in vivo functional CFTR testing, such as nasal potential difference measurement and intestinal current measurement were implemented [A close observation of families with CF led to its description as an autosomal recessive genetic disorder in 1946 , paving s.on.ca) . Functiotr2.org)  and the tr2.org) . Worldwitr2.org) . Despitelemented .CFTR mutations with residual CFTR function, accounts for 10\u201315% of all CF patients [CFTR-related disorders [CFTR dysfunction and the widely varying clinical presentation of CF.Due to the consistent clinical characterization of CF patients, the first pancreatic-sufficient CF patients were reported in the 1950s . This grpatients . They capatients . A normapatients , these ppatients . The expisorders . Internaisorders  have beeCF care today is seen as multidisciplinary, to fit the medical, psychosocial, physiotherapeutic, and nutritional needs of CF patients, prevent chronic infection and malnutrition, minimize deterioration, maintain independence, optimize quality of life, and maximize life expectancy .https://www.cff.org/About-Us/About-the-Cystic-Fibrosis-Foundation/Our-History/). In 1963, the CFF Foundation published the first guidelines for the diagnosis and treatment of CF. These achievements inspired colleagues and parents to establish a national CF foundation and CF care centers across the world and to deliver structured care, including annual checkups and regular outpatient visits [Until the 1950s, many pediatricians took care of CF-patients, and only a few doctors, those dedicated to CF, treated more than a handful of patients. Broader experience with the spectrum of the disease and rare complications, the ability to analyze treatment options and outcome in a more systematic way, and long-term follow-up are the major advantages of CF-center care and also drive clinical research and progress. In 1958, Shwachmann and Kulczycki published their results from a large cohort of 105 patients, marking the beginning of center-based care worldwide . The Cyst visits . The intt visits . This coThe paradigm for comprehensive and preventive treatment programs for CF was introduced by Matthews, who first suggested and funded a program in 1957 in Cleveland . AccuratThe symptomatic treatment of pancreatic insufficiency, which affects 85\u201390% of all CF patients, started in the 1930s (in the absence of pancreatic enzyme replacement) as a low-fat, high-protein diet. Pancreatic enzyme replacement was established in the 1940s, but required high doses due to the enzymes\u2019 lack of resistance to gastric acid. After gastric-acid resistant pancreatic enzyme therapy was established in the 1980s based on a historical comparison of center data, dietary recommendations changed from a low-fat diet to a high-fat, high-calorie diet. Instead of a standard dosage regimen, individual dosage adjustment of pancreatic enzymes and fat-soluble vitamins and nutritional advice from a specialized dietician are critical to overcoming malnutrition and achieving sufficient blood vitamin levels .Symptomatic mucolytic therapy today is mainly based on inhalation of DNase , hypertoStaphylococcus aureus and Pseudomonas aeruginosa (PA) are the most important bugs [P. aeruginosa was established in the 1990s in order to postpone chronic infection [Staphylococcus aureus and nontuberculous mycobacteria are emerging pathogens in CF [Chronic bacterial pneumonia has been a continuous challenge for CF care since the first description of CF. ant bugs . The connfection , which infection . Methicins in CF . Aggressns in CF . A placens in CF . InfectiThe active surveillance of CF-related complications, such as liver disease, diabetes mellitus, bone disease, and their active treatments have become important components of annual checkups and therapeutic concepts . Lung trIn the last decade, causally directed, mutation-specific treatments have been evolving. In contrast to gene therapy,  orally aPseudomonas infection in 16\u201319-year-old patients dropped from 43.9% in 2009 to 25.5% in 2018 in the UK [CF was seen as a pediatric disease for many decades, affecting only a few adult patients. This has changed dramatically since the 1990s. With reduced pediatric morbidity and mortality, more pediatric patients are surviving to adulthood . For exan the UK . Nearly n the UK .During the last decades, great improvements in survival were achieved. In 1980, 31.1 % of the US CF population was over the age of 18 years, compared with 54.6% in 2018. In Belgium, Denmark, Netherland, Norway, and Sweden, adults were reported to make up 60\u201365% of all CF patients in 2017 . This coThese improvements have far-reaching implications in terms of care structures and resources. To fulfill the increasingly promising prognosis, access to care including dedicated multidisciplinary CF teams and a broad range of medicines is critical. Socioeconomic status (SES) is a major confounder and must be taken into account. Studies in the USA have found that medical insurance status  and mediDespite the continuously improving quality of life and life expectancy of patients over the last decades and promising therapeutic developments, CF is still a chronic, life-limiting disease. Early diagnosis and multidisciplinary treatment according to current standards of care are critical in avoiding early severe complications. The following are some key implications of screening that must be discussed.The awareness of cystic fibrosis in general, but especially of the improving prognosis and treatment options, is critical for the success of NBS. The common problems of late diagnosis and underdiagnosis in some countries reflect the low awareness of CF among caregivers, parents, and health authorities. The promising prognosis has to be emphasized. Patient representatives and organizations could help to support this important public health topic by personalizing experiences and helping to create a supportive environment for families after diagnosis. CF caregivers are responsible for advocacy for CF, especially among healthcare professionals, and for providing obstetricians, surgeons, pediatricians, and general practitioners with updated information about CF in general, the spectrum of disease presentation, diagnostic and therapeutic options, and improving overall prognosis. Patient registries are important tools for collecting, reporting, and comparing international and national epidemiologic data. CF caregivers and patient organizations should jointly stand up to raise awareness (and resources) amongst health authorities, provide information about medical needs, and discuss and propose care structures for each country.P. aeruginosa acquisition. Without this essential infrastructure, even the best NBS program cannot succeed [CF core diagnostic and care facilities with established multidisciplinary teams must be established and promoted in each country. Pediatric facilities should be integrated within a NBS tracking system and take an active role in providing information to local caregivers, patients, and health authorities. The confirmation of the diagnosis should be performed at the earliest stage in specialized CF centers. The results have to be discussed by a CF experienced doctor on the day the diagnosis is confirmed. Critical components of the service are a high-quality sweat chloride test to minimize the rate of sweat tests with insufficient volume and give reliable results on the day of the confirmation visit, a multidisciplinary team to counsel the parents and establish the treatment plan immediately, and strict infection control to minimize the risk of  succeed .High specificity of the newborn screening program reduces the recall rate, the parents\u2019 burden and stress, and the burden of CF centers. Due to the low number of CF centers in some countries, the travel distance and burden for families should not be underestimated. The genetic component of each individual NBS program is critical to achieving the goal. The selection of mutations for screening has to be adapted to the genetic and ethnic spectrum of each country/region and could be based on registry data or epidemiologic studies. The detection of mutations with varying consequences through newborn screening should be avoided as it will complicate interpretation and overextend caregivers and patients. An expanded mutation panel or genotyping should not be \u201cabused\u201d to substitute for robust confirmation of diagnosis. Unfortunately, commercial panel testing does not fit this need. Measuring pancreatitis associated protein in addition to immunoreactive trypsinogen might be an additional 2nd tier to reduce the use of genetic analyses . LearninCFTR dysfunction, asymptomatic patients are diagnosed based on proven CFTR dysfunction. In contrast to symptomatic treatment, which is often well received and accepted by parents, the diagnosis and prophylactic treatment of asymptomatic children is often mistrusted and seen as a greater burden by parents. The developing mutation-specific treatments offer great hope for parents of newborns with CF. Only if healthcare providers (including primary care providers) and parents are convinced and have hope that early diagnosis and treatment offers a benefit for the patient, such as avoiding or postponing malnutrition or pulmonary and other complications, will NBS fulfill its promise.Changes in diagnostic and therapeutic dogmas are driven fundamentally by NBS. Unlike symptomatic patients who are diagnosed by confirmation of NBS for CF should be seen as a game changer in CF care, not reduced to simply a diagnostic procedure. Its final success depends on the general awareness of the disease, the integration of NBS within well-established CF care structures, and the engagement and interaction of obstetricians, primary caregivers, pediatricians, CF centers, and health authorities."}
+{"text": "To calibrate the low signal response of the ocean color (OC) bands and test the stability of the Fengyun-3D (FY-3D)/Medium Resolution Spectral Imager II (MERSI-II), an absolute radiometric calibration field test of FY-3D/MERSI-II at the Lake Qinghai Radiometric Calibration Site (RCS) was carried out in August 2018. The lake surface and atmospheric parameters were mainly measured by advanced observation instruments, and the MODerate spectral resolution atmospheric TRANsmittance algorithm and computer model (MODTRAN4.0) was used to simulate the multiple scattering radiance value at the altitude of the sensor. The results showed that the relative deviations between bands 9 and 12 are within 5.0%, while the relative deviations of bands 8, and 13 are 17.1%, and 12.0%, respectively. The precision of the calibration method was verified by calibrating the Aqua/Moderate-resolution Imaging Spectroradiometer (MODIS) and National Polar-orbiting Partnership (NPP)/Visible Infrared Imaging Radiometer (VIIRS), and the deviation of the calibration results was evaluated with the results of the Dunhuang RCS calibration and lunar calibration. The results showed that the relative deviations of NPP/VIIRS were within 7.0%, and the relative deviations of Aqua/MODIS were within 4.1% from 400 nm to 600 nm. The comparisons of three on-orbit calibration methods indicated that band 8 exhibited a large attenuation after launch and the calibration results had good consistency at the other bands except for band 13. The uncertainty value of the whole calibration system was approximately 6.3%, and the uncertainty brought by the field surface measurement reached 5.4%, which might be the main reason for the relatively large deviation of band 13. This study verifies the feasibility of the vicarious calibration method at the Lake Qinghai RCS and provides the basis and reference for the subsequent on-orbit calibration of FY-3D/MERSI-II. Fengyun-3D (FY-3D) is a polar orbiting meteorological satellite launched on 15 November 2017. The main task of the Medium Resolution Spectral Imager II (MERSI-II) onboard FY-3D is to dynamically monitor the ocean, land, atmosphere and other environmental characteristics, especially the important atmospheric and environmental parameters such as clouds, aerosols, land surface characteristics and ocean surface characteristics [Due to the aging of the instrument and external interference after satellite launch, the performance of remote sensors will experience an uncertain degradation. Taking Fengyun-3A (FY-3A) and Fengyun-3B (FY-3B) as examples, within two years after launch, the solar reflective bands decreased significantly. In particular, at band 8 412 nm), the maximum attenuation reached 14% in the first year and 20% in the second year  nm, the . Wen et The Coastal Zone Color Scanner (CZCS), launched on the Nimbus-7 satellite in 1978, was the first sensor used to measure OC data . CurrentVicarious calibration is an on-orbit calibration method using a calibration field with known optical properties. Many scholars have proposed different vicarious calibration methods for OC sensors. Gordon first introduced the concept of vicarious calibration, which predicts the values of the spectral radiance measured by the sensor by combining the surface measurements and the atmospheric radiative transfer process . Zhao etThis paper first introduces the principles and method of vicarious radiometric calibration. At the Lake Qinghai RCS, the water surface and atmospheric optical characteristics were obtained with high-precision instruments. Then the vicarious calibration coefficients were calculated with the radiative transfer model and satellite image data. The precision of the calibration method was evaluated by calibrating two representative satellite remote sensors, Aqua/MODIS and NPP/VIIRS, using the same calibration method. The results of the Dunhuang RCS calibration and lunar calibration were compared to the results of the Lake Qinghai RCS. The results verify the reliability and feasibility of the vicarious calibration for OC sensors and lay the foundation for further realization of domestic satellite calibration.For OC sensors equipped with an onboard calibration system, the vicarious calibration is used as a supplementary test to check the function of the remote sensor, and for OC sensors, such as FY-3D/MERSI-II, vicarious calibration is the main calibration method .For the ocean-atmosphere system, the top-of-atmosphere (TOA) radiance at the sensor can be expressed as ,19,(1)Lnd speed ; La(\u03bb) iaerosols . The varr theory . The quaectively . The forradiance .To obtain the average equivalent radiance As the average DN value of the pixel corresponding to the satellite image is extracted, the calibration coefficients MODTRAN4.0 is an acronym for the MODerate spectral resolution atmospheric TRANsmittance algorithm and computer model, which was developed by the US Air Force Research Labs (AFRL) in collaboration with Spectral Sciences. This model can be used to calculate and simulate the spectral absorption, transmission, emission and scattering characteristics of the atmosphere.The detailed processing of field measurement data is shown as follows.The surface water-leaving radiance of water . ConsideIn accordance with the observation angle recommended by the SeaWiFS marine optical specification shown in Because the value of To obtain the remote sensing reflectance, the white panel was used,Aerosol optical depth (AOD) is the basic parameter of radiative transmission and atmospheric correction, and affects the accuracy of radiometric calibration and atmospheric correction of satellite remote sensors . The optm is the atmospheric mass; According to the Beer-Bouguer-Lambert theorem , the monThe components of gases with significant absorption are water vapor, carbon dioxide and ozone. Regarding the absorption of water vapor, there is a strong absorption zone at 936 nm, and the influence of water vapor on other bands is negligible. Regarding the absorption of ozone, the effect of each band should be considered. The effect on the absorption of carbon dioxide is also negligible at the bands of the solar photometer. According to the Beer theorem, ozone transmittance, Thus, Equation (7) can be reduced to,Since the detection element of the solar spectrophotometer is a linear element, there is a linear relationship between radiance ; therefoLake Qinghai , the largest saline lake in China, is located on the northeastern Tibet Plateau . As one As shown in A variety of observation instruments, shown in An automated sun photometer called the CE-318/Sea-Viewing Wide Field-of-View Sensor Photometer Revision for Incident Surface Measurements (CE-318/SeaPRISM), developed by the CIMEL, automatically obtains the solar irradiance for the AOD. The sun photometer is a high-precision field solar and sky radiance measuring instrument that can be used to simultaneously measure the direct solar radiance and sky scattering radiance of different wavelengths. CE-318/SeaPRISM has nine observation bands with central wavelengths of 412 nm, 440 nm, 500 nm, 531 nm, 550 nm, 675 nm, 870 nm, 936 nm and 1020 nm and a bandwidth of 10 nm.In addition, a GPS radiosonde, consisting of a global positioning system (GPS) module, a meteorological sensor, a radio transmitter and a battery, is also used to measure the pressure, temperature and humidity (PTU) information of the atmosphere. The GPS receiver module carried by the balloon was used to locate the balloon in real-time and calculate the wind direction and speed of the upper atmosphere. Atmospheric PTU sensors were used to measure meteorological elements of the atmosphere in real time. GPS positioning data and PTU data were sent to the ground receiving system by a radio transmitter. The ground receiving system received and processed the data to generate various required information.Whitecap radiance is the radiance produced by foam on the sea surface. According to the assumption that the reflection of the foam is similar to the Lambert reflection, the angle of the sun has little effect, and the whitecap radiance is almost ubiquitous in the satellite image. Gordon\u2019s results show that whitecap radiance is independent of wavelength ,(11)LwcIt can be seen from the formula that the higher the wind speed is, the greater the whitecap radiance. Thus, the experiment was carried out when the wind speed was less than 5 m/s. The results of MODTRAN4.0 are shown in Equation (3) shows that the calibration coefficients can be derived by extracting the satellite meter value. The image area of the satellite should be consistent with the synchronous observation area on the ground. Lake Qinghai can be clearly seen in satellite images, indicating that there were no clouds covering the lake at the time. Taking the longitude and latitude of the measuring point as the center, the average value of the 5 \u00d7 5 pixel range in the satellite image was extracted as the satellite count value of each channel.After excluding the space observations value, the radiance calibration coefficients of each day can be obtained. The results for the calibration coefficients show an average difference of \u221217.056%, 2.278%, 4.799%, 0.061%, \u22120.353% and 11.963% when compared to the prelaunch calibration coefficients. In general, since the launch of the remote sensor, the calibration coefficients of most bands, except bands 8 and 13, are relatively stable, and the relative deviations are within 5%.As typical satellites in the world, Aqua/MODIS and NPP/VIIRS both have high calibration uncertainty. MODIS is an internationally recognized remote sensor for cross calibration that has high calibration accuracy, and its onboard calibration uncertainty is 2% . The VIIThe geometric parameters and atmospheric parameters are listed in The comparison results are shown in On 18 and 23 August 2018, two effective calibration tests were completed at the Dunhuang RCS. The Dunhuang RCS is located in western Dunhuang city, Gansu Province, and has the advantages of flat terrain, uniform surface and good directionality. Internationally, it is agreed that the Dunhuang RCS is suitable for on-orbit radiation calibration of VIS and NIR remote sensors.Detailed atmospheric and geometric information is listed in As lunar calibration is also a well-developed technique in reflective solar bands, Wu proposed an absolute radiometric calibration method based on FY-3D/MERSI-II lunar observation data . The resOverall, the calibration results of the Lake Qinghai RCS are superior to those of the Dunhuang RCS and lunar calibration. Among them, the results of three on-orbit calibration methods show that there were significant errors at band 8, compared with the prelaunch laboratory calibration results, which were 17.1%, 19.2% and 22.9%. We suspect that the sensor decayed considerably at band 8 after launch. According to the pre-launch calibration by Xu et al. , the assMany factors affect the calibration uncertainty of FY-3D/MERSI-II, including the measurement of the water-leaving radiance and the atmospheric parameters, the selection of aerosol model and the calculation error of the radiative transfer model.Absolute radiometric calibration of ASD was carried out in the laboratory before the field test, in which the standard lamp of 1000 W spectral irradiance traced to the National Institute of Metrology and China (NIM) was used as the radiometric calibration light source. The calibration results showed that the uncertainty value of calibration at 400\u2013800 nm was 2.0\u20132.1% . The whiAOD applies the same computation method as Aerosol Robotic Network (AERONET) and the nominal uncertainty value is 1.0\u20132.0% , includiAccording to the error transfer theory, the Quadratic sum of all the uncertainties above gives an uncertainty of 6.3% for the vicarious radiometric calibration. The computation equation is as follows,To reduce the uncertainty and improve the accuracy of the calibration, we will increase the frequency of calibration, improve the measurement accuracy and calibration accuracy of the instruments and establish an effective data processing model.Due to the significant decay of the satellite after launch, it is an urgent and challenging task to calibrate the accuracy and stability of the radiation intensity of FY-3D, which was launched in November 2017. Vicarious radiometric calibration is the main method of calibration available. In this study, an attempt to calibrate of the OC bands for FY-3D/MERSI-II based on the Lake Qinghai RCS is proposed, which is different from the previous land calibration method at the Dunhuang RCS.In this paper, we described the various instruments used in the field campaign, introduced the data processing in detail, and calculated the calibration coefficients via the radiative transfer model and satellite image extraction in reference to the calibration method described. The OC bands of FY-3D/MERSI-II are well calibrated at the Lake Qinghai RCS. The calibration coefficients of most bands are relatively stable and the relative deviations are within 5.0%. Aqua/MODIS and NPP/VIIRS were calibrated to verify the accuracy of the vicarious calibration using the same process as for FY-3D/MERSI-II radiometric calibration. The results show that the relative deviations of NPP/VIIRS are within 7.0%, and the calibration result of Aqua/MODIS is even within 4.1% from 400 nm to 600 nm. The calibration results were also compared with those of the Dunhuang RCS calibration and the lunar calibration. By comparing the results of the three on-orbit calibration methods and the existing research, we were able to determine that band 8 had a post-launch attenuation of 17.1%. Except for band 13, the relative deviations of the remaining bands were better than the existing calibration results. The relative deviation of band 13 reached 12.0%, which might be due to the measurement error of the water surface parameters. We evaluated the uncertainty of the whole calibration system and obtained a total uncertainty value of approximately 6.3%. The uncertainty value of field water surface measurement was 5.4%, which is the main source of calibration error.This paper verified the feasibility of FY-3D/MERSI-II OC bands calibration at Lake Qinghai, and the results show that FY-3D/MERSI-II has good stability. The approach presented in this study, especially for remote sensing satellites without onboard calibration systems, can better monitor the variation in remote sensor response and ensure the quality of remote sensing data."}
+{"text": "Limited by the on-orbital calibration capability, scaling the measured radiance in accuracy and stability is challenging for the Earth observation satellites in the reflective solar bands (RSBs). Although the lunar calibration is a well-developed technique in the RSBs, limited work has been done for Chinese Earth observation satellites. To improve the on-orbital calibration performance, the advanced MEdium Resolution Spectral Imager (MERSI II), which is the primary payload of the fourth satellite of the Fengyun 3 Series (FY-3D), expands the space view angle of the imager in order to capture better lunar images. In this study, we propose an absolute radiometric calibration method based on the FY-3D/MERSI lunar observation data. A lunar irradiance model named ROLO/GIRO has been used together with the necessary data procedures, including dark current count estimation, single pixel irradiance calculation, and full disk lunar irradiance calculation. The calibration coefficients obtained by the lunar calibration are compared with the pre-launch laboratory calibration. The results show that the deviations between the two calibration procedures are in a reasonable range in general. However, a relatively high non-linear response was found in the low energy incidence for some detectors, which leads to the large deviation in the corresponding bands. This study explored an ideal and independent method to validate MERSI on-orbit radiometric performance. The lunar calibration practiced for MERSI also gave a valuable example that can be recommended to the other Chinese Earth observation satellites. Radiometric calibration is critical for the quantification of changes in the Earth observation from the satellite. However, scaling the measured radiance in accuracy and stability is still a challenging process. It is more practical in the wavelength of the reflective solar bands (RSBs) because of the limited capability of the on-orbital facility in this spectral region. From the satellite field of view, the Moon is stable in radiance  and has The MEdium Resolution Spectral Imager (MERSI) is one of primary payloads onboard the Chinese FengYun 3 (FY-3) meteorological series satellite ,6. The a\u22128/year [Using the radiometric calibration coefficient, the MERSI on-orbit output digital number (DN) can be converted to a reflectance or radiance value. In the pre-launch phase, a traceable spherical integrating source is used as the radiometric reference to calibrate the MERSI RSBs in the visible (VIS) and near infrared (NIR) spectra in the laboratory . In the \u22128/year ,13; low-The moon is an ideal target for the space-based instruments in the moderate resolution. The SeaWifs uses lunar data to monitor the radiometric stability over its lifetime, and the biases of lunar calibrations are 2\u20133% . Both thThe space view (SV) field angle for MERSI on the FY-3C satellite was increased to enable it to acquire full-disk moon images. This was the first time that the FY-3 series satellite imager could capture full-disk moon images. Wu  used theFurthermore, in order to obtain the absolute radiometric calibration coefficient, a lunar irradiance model should be used. For the VIS and NIR spectrum, the two existing models, i.e., the Miller and Turner Model MT2009)  and the 09  and tThe Global Space-based Inter-Calibration System (GSICS), which is sponsored by the World Meteorological Organization, is used to inter-calibrate global remote sensing instruments and associate them with a common reference. They have developed the GSICS Implement of ROLO (GIRO) in order to define a common unique calibration reference for the international community. Considering it is recommended by GSICS, the GIRO model developed from the ROLO model was selected as the radiometric reference to implement the MERSI lunar calibration in this study. Based on the ROLO model, Zhang  discusseFY-3D/MERSI was launched in November 2017. Its SV samples are twice as much as FY-3C/MERSI, which improves the qualities of lunar observation data . Based oThe remainder of this paper is organized as follows. MERSI uses a 45\u00b0 scanning mirror to obtain 25 bands data, and the spectral configuration and key specifications of FY-3D MERSI are shown in MERSI lunar observation is realized through the SV field, which is set at 69.5\u00b0 from the nadir and 90\u00b0 clockwise to the direction in which the satellite is moving. In general, the SV DN is used to provide dark current measures for calibration. However, at a special geometric angle, which is shown in MERSI is a multi-detector parallel scan remote sensor with two resolution settings. The 250-m resolution band is combined with 40 detectors, which means that 40 lines of scan data are obtained simultaneously for each frame scan at this resolution. In contrast, 10 lines of scan data are simultaneously obtained for the 1000-m resolution band. Overall, through the SV field, MERSI captures 192 and 48 samples per line for the 250-m and 1000-m resolution bands, respectively. Bands 1\u20134 are 250-m resolution bands, whereas the other bands are 1000-m resolution bands.FY-3D MERSI got its first lunar observation data with good data quality on 29 December 2017. As a typical study case, these data are used to demonstrate the performance of the lunar calibration method to MERSI.Due to the relative motion between the moon and satellite, a set of SV moon images are captured. In these images, the moon appears at different positions between scans as it moves from one side to the other of the scanned torus; this is shown in For one single frame scan, the viewing angle of the 40-detector system is about 0.6888\u00b0; thus, the viewing angle of the 192 acquired samples is about 2.26\u00b0, whereas the solid angle of the moon is about 0.5\u00b0 for an observer on Earth. This indicates that MERSI can obtain the moon images for all bands using a single frame via SV. Thus, it satisfies the calibration requirement wherein an image of the entire moon is required to calculate lunar irradiance. Based on the integrity of the moon disk in the images, the frame data of the SV images, whose bands contain the full-disk moon, are selected and extracted.As previously specified, in our study, we use GIRO  as the sGIRO requires the observation time, the location of the sensor, the selenographic longitude of the Sun, and the selenographic latitude and longitude of the observer as inputs to calculate the absolute phase angle of the moon. Finally, the lunar spectral irradiance for the bands described by the SRFs of the sensor can be outputted.With GIRO, satellite agencies can use the same lunar irradiance model to calibrate their remote sensing instruments. As a consequence, the accuracies of these instruments can be easily compared with each other.For FY-3D/MERSI, the first lunar observation occurred on 29 December 2017, and the corresponding lunar observation geometry is listed in 2 and (1.2 mrad)2 for the 250-m and 1000-m resolution bands, respectively. For MERSI, the irradiance of a single pixel can be calculated as follows:The full-disk irradiance of the moon is calculated by integrating all the moon pixels over the SV image. Considering that the image is discrete data, the integral sign is replaced by the sum sign as follows:Combining Equations (1) and (2), the calibration coefficient The full-disk moon image can be captured using two methods. First, as is shown in In both types of images, an oversampling effect has been considered in two orthogonal directions, namely the detector array direction and scan sample direction. The oversampling effect means that two adjacent pixels are overlapping for some same parts. The energy of the pixels is overestimated and needs to be corrected by the oversampling factor. The oversampling factor here is defined as the percent of the effective area after removing the overlapping area. In the case of oversampling in the scan sample direction, corresponding to the width of the moon image, a 27% overlap is observed between two sample intervals, which indicates that the oversampling factor in this direction  for a MERSI lunar pixel is almost the same order of magnitude as the DC value. The accuracy of the dark current count has a significant influence on the calibration coefficient.When the moon is being observed through the SV field, the dark current count cannot be estimated directly. The dark current calculated from the SV observation fluctuates on the basis of the position of the satellite in this paper. The SV observations for the RSBs of the MERSI on 29 December 2017, are shown in The on-orbit working conditions of the detectors are different from those used in the ground laboratory test, such as the FPA temperature. At the same time, the SV field may be polluted by stray light, which increased the observed DC count to be higher than the pre-launch measurements. Both of these two effects will result in the large DC deviation. From In this section, the lunar calibration results for all of the FY-3D MERSI RSBs are compared with the pre-launch calibration, which was conducted in the laboratory based on the traceable spherical integrating sources (SIS). With these SISs, the full dynamic characterizations of the MERSI in the RSBs are described in the laboratory. However, the ambient environment has been changed after the launch. It leads to the on-orbit performance, which always differs from the laboratory. It is vital to validate the calibration status on the orbit with an independent method such as the lunar calibration.The lunar calibration was conducted using 29 December 2017 data, and the results are listed in The detectors of the SWIR bands are made from the photovoltaic (PV) HgCdTe materials and work at 130 K ambient temperature on the orbit. The pre-launch calibration is conducted in a small vacuum tank to simulate the on-orbital conditions. However, the environment cannot be congruent completely, which will lead to the bias. We found that the DC deviations between the lunar calibration and the pre-launch calibration results in the SWIR bands are obviously lager than in the other bands. Especially for the band 7  also faces a similar problem. Generally, the lunar calibration is helpful to find the nonlinear effect by supplying the low reflectance information for the MERSI. In addition, if we desire a full dynamic calibration, the other vicarious calibration methods can be introduced based on integrated calibration , such asScaling the measured radiance in accuracy and stability in the RSBs of Fengyun satellites is challenging work since the performance of the OBC is poor. As a stable natural target, the moon has been used as a radiometric traceable reference to calibrate the satellite measurements. In this study, a lunar calibration approach has been proposed to be implemented for the FY-3D/MERSI. From the SV field of MERSI, the lunar observation data have been obtained. With the ROLO/GIRO model as the radiometric reference, the MERSI calibration coefficient is calculated.The results from the lunar calibration are compared with the pre-launch laboratory measurements. Generally, the good consistency (within 10%) between the lunar and pre-launch calibration is obtained for the most RSB of the MERSI except the band 19 and bands in the SWIR. Considering the changed orbital conditions after the launch and the crosstalk contamination, the lunar calibration method is not recommended for the MERSI SWIR bands. As the center spectral of the band 19 is at the edge of the spectral response of the silicon detectors where the performance is hard to control, the relatively high non-linear radiometric response was found by the lunar calibration in this paper.As a conclusion, this study explored an ideal and independent method to validate the MERSI on-orbit radiometric performance. The lunar calibrated results remain encouragingly consistent with those from the pre-launch laboratory test for the most MERSI RSBs. The lunar calibration implemented to the MERSI also gave a valuable example that can be recommended to the other Chinese Earth observation satellites. In the future, all the lunar observation data since the FY-3D MERSI working on-orbit will be processed using the method described in this paper, and the results would be compared with other methods results, such as DCC, PICS, or RadCalNet."}
+{"text": "Inflammation plays a key role in the aetiology and progression of Alzheimer\u2019s disease (AD). However, the immunophenotype of the second most common neurodegenerative cause of dementia, dementia with Lewy bodies (DLB), remains unclear. To date there have been no studies examining peripheral inflammation in DLB using multiplex immunoassay and flow cytometry concomitantly. We hypothesised that, using blood biomarkers, DLB would show an increased proinflammatory profile compared with controls, and that there would be a distinct profile compared with AD.93 participants  completed a single study visit for neuropsychiatric testing and phlebotomy. Peripheral blood mononuclear cells were quantified for T and B cell subsets using flow cytometry, and serum cytokine concentrations were measured using multiplex immunoassay.We detected reduced relative numbers of helper T cells and reduced activation of B cells in DLB compared with AD. Additionally, interleukin (IL)-1\u03b2 was detected more frequently in DLB and the serum concentration of IL-6 was increased compared with controls.Peripheral inflammation is altered in DLB compared with AD, with T cell subset analysis supporting a possible shift towards senescence of the adaptive immune system in DLB. Furthermore, there is a proinflammatory signature of serum cytokines in DLB. Identification of this unique peripheral immunophenotype in DLB could guide development of an immune-based biomarker and direct future work exploring potential immune modulation as a novel treatment. There are an estimated 35.6 million people living with dementia worldwide,Dementia with Lewy bodies (DLB) is the second most common neurodegenerative cause of dementia, accounting for 4.2%\u20137.5% of cases.The occurrence of acute systemic infections, chronic peripheral infections such as periodontitis, and conditions associated with chronic inflammation such as atherosclerosis and obesity, have all been implicated in the aetiology or accelerated progression of AD.Few studies have investigated peripheral cytokine concentrations in DLB, compared with AD.In addition to innate immune signatures, there is increasing evidence of changes to adaptive immunity in neurodegenerative diseases. Alterations in peripheral blood mononuclear cell (PBMC) subsets in AD have not yet been consistently replicated. CD4+ helper T cell subsets have been shown to be reduced in AD and PDHerein, we present the findings from an observational study, which used a clinical cross-sectional cohort of DLB and patients with AD with the aim to compare peripheral immunophenotype. We hypothesised that DLB would show a proinflammatory state compared with controls, and that the immune profile would differ from AD. We also hypothesised that associations would be detected between markers of inflammation and the clinical features of DLB.https://www.joindementiaresearch.nihr.ac.uk). All participants were aged between 50 and 100 years and were proficient in English. Patients with dementia had a reliable study partner, and were required to satisfy either the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer\u2019s Disease and Related Disorders Association criteria for probable AD or international consensus diagnostic criteria for probable DLB.Patients with AD or DLB were recruited from local memory clinics and the Join Dementia Research platform  and use of major modifiers of the immune system .Participants attended a single study visit for interview, physical examination and phlebotomy. Cognition was tested using the MoCA. DLB and AD participants were further tested using the free and cued selective reminding test-immediate recall (FCSRT-IR) to assess recall, clinician assessment of fluctuation (CAF) for quantification of cognitive fluctuations, neuropsychiatric inventory (NPI) to assess for psychiatric symptoms, Cornell Scale for Depression in Dementia (CSDD) to assess mood and the Movement Disorder Society Unified Parkinson\u2019s Disease Rating Scale (UPDRS) to quantify motor symptoms.Venous blood was taken at a fixed time point (10:00\u201312:00), to minimise the influence of diurnal cytokine variation. Whole blood was allowed to clot for 30 min at room temperature and centrifuged at 1750 g for 10 min to allow storage of aliquoted cell-free serum at minus 80\u00b0C. Blood was collected in EDTA vacutainer tubes for analysis of apolipoprotein E \u03b54 (APOE \u03b54) allele status. Blood was collected in heparinised vacutainer tubes for PBMC isolation, by density gradient separation at 950 g for 25 min on Ficoll paque-plus . PBMC were two times washed for 8 min using phosphate buffered saline  at 700 g. Cell viability was determined using Trypan Blue , following which PBMC were suspended in 80% foetal calf serum and 20% dimethyl sulfoxide  at a concentration of one million cells per millilitre. Aliquots of PBMC were cryopreserved at minus 80\u00b0C before transfer to a liquid nitrogen facility for storage until batch phenotype analysis using flow cytometry.Serum concentrations of IL-1\u03b2, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12, IL-13, TNF\u03b1 and interferon (IFN)-\u03b3 were measured by multiplex immunoassay . Calibrators were used as per manufacturer\u2019s instructions. Sensitivity was indicated by the lower limit of detection (LLOD) measured in pg/mL: 0.04 for IL-1\u03b2, 0.09 for IL-2, 0.02 for IL-4, 0.06 for IL-6, 0.04 for IL-8, 0.03 for IL-10, 0.11 for IL-12, 0.24 for IL-13, 0.04 for TNF\u03b1 and 0.20 for IFN-\u03b3. All samples were analysed blind to group and in duplicate, with the mean value used for analysis. Duplicate serum cytokine concentrations below the LLOD were deemed undetectable and revalued as 0.Eight-colour flow cytometry was used to examine PBMC subsets by measuring relative numbers of: CD3+, CD4+ and CD8+ T lymphocytes; CD19+ B lymphocytes; CD14+ monocytes; CD45RA+ na\u00efve T lymphocytes; CCR7+ central T lymphocytes; and HLA-DR+ activated cells.Cryopreserved PBMC were fast thawed in a water bath at 37\u00b0C, then twice washed for 5 min at room temperature with warm complete medium at 300 g. After re-suspension in PBS, viability staining was performed using Zombie violet . PBMC were incubated with fluorochrome-conjugated antibodies against CD3 , CCR7  and CD4 , and CD8 (PE), CD14 (PerCP-Cy5.5), CD19 (FITC), CD45RA (APC) and human leucocyte antigen-antigen D related (HLA-DR) (PE-Cy7) . Data from at least 10 000 T cell events were analysed using FACSDiva software on the FACSCanto II system . Fluorescence minus one experiments were used as negative controls.The gating strategy was agreed prior to data analysis. Forward scatter height versus forward scatter area (FSC-A) plots were used to exclude doublet cells. Side scatter area (SSC-A) versus cell viability marker plots were used to exclude dead cells. SSC-A versus FSC-A plots helped to identify lymphocyte and monocyte populations from granulocytes. Cell populations were defined relative to the parent population, apart from HLA-DR activation which was measured as mean fluorescent intensity (MFI) of each defined cell subset.Power was based on a study that showed increased plasma concentration of IL-1\u03b2 in PD compared with controls by a ratio of 1.45, with a mean of 73.7 pg/mL (SD 16.3 pg/mL) in PD, compared with 50.8 pg/mL (SD 5.9 pg/mL) in controls.2), MoCA score and education , neuropsychiatric test scores and disease duration (Mann-Whitney U), and frequency of cognitive enhancers, antipsychotics and anti-Parkinsonian drugs (Pearson \u03c72).Statistical analysis was performed using IBM SPSS statistical software (V.25.0). Demographic and clinical characteristics were compared using parametric or non-parametric tests. Groups were assessed for differences in age , post-hoc Tukey), gender and APOE phenotype (\u03c72) and post-hoc pairwise (logistic regression) differences were tested. PBMC subsets and MFI were assessed for group differences using either ANOVA or Kruskal-Wallis tests, depending on distribution. For significant results using ANOVA, linear regression and t-tests were used to detect post-hoc significant pairwise differences adjusted for age and gender.Serum cytokine concentration distributions were skewed. Group  and post-hoc pairwise (Dunn-Bonferroni) differences were tested. Significant cytokine variables were log10 transformed to correct for age and gender. IL-6, IL-10 and TNF\u03b1 concentrations were log10 transformed to normal distribution and linear regression used. A high number of cases showed IL-1\u03b2 concentrations below the LLOD and thus it was considered a binary variable (detectable classified as present and non-detectable as absent). Group .Ninety-six participants took part in our study. Of these, 32 had DLB, 32 had AD and 32 were cognitively unimpaired healthy controls. One participant originally recruited to the AD group was subsequently excluded due to the diagnosis of dementia being withdrawn by the principle investigator. Phlebotomy was unsuccessful in two participants (one control and one DLB), leaving 31 participants in each group with full clinical and cytokine data. Sufficient viable PBMC were not isolated from a further three controls, five AD cases and four DLB cases.Participant characteristics are summarised in No control participants were taking cognitive enhancers or anti-Parkinsonian medication. Significantly more patients with DLB and AD were taking cognitive enhancers than controls. Antipsychotic and anti-Parkinsonian medication use was more prevalent in the DLB group compared with controls and AD. Use of non-steroidal anti-inflammatory drugs were similar across groups. There was no difference in prevalence of rheumatoid arthritis, hypertension or diabetes mellitus between groups.Data from flow cytometry are summarised in The relative number of CD8+ cytotoxic T cells appeared higher in DLB compared with controls and AD, but this did not meet statistical significance (p=0.053). Relative numbers of CD8+ terminal effector cells appeared elevated in DLB while na\u00efve cytotoxic T cells were depleted compared with controls, but there were no significant group differences to justify post-hoc testing.2(2)=15.030, p=0.001), with IL-1\u03b2-positive cases more prevalent in the DLB group (54.8%) compared with controls , and AD , following adjustment for age and gender  after correction for age and gender. Differences in serum TNF\u03b1 and IL-10 concentration were not statistically significant when linear regression was used to adjust for age and gender. IL-1\u03b2 concentration was significantly different between groups , UPDRS (Parkinsonism), CAF (fluctuations), NPI , CSDD (depression) and FCSRT-IR .In DLB, we have revealed diminished markers associated with humoral adaptive immunity, and a proinflammatory innate immune signature, supporting a unique peripheral immunophenotype. This was only possible by investigation of peripheral adaptive immunity using flow cytometry for the first time in this disease. Our findings have important implications in furthering our understanding of the aetiology of DLB.Our study benefited from DLB and AD groups that were well matched for age, disease duration and educational attainment. Statistical correction was used to account for the significantly younger control group and non-significant differences in gender. All groups demonstrated low proportions of anti-inflammatory drug use. As anticipated, patients with DLB scored higher on scales associated with clinical features that characterise the disease for example, fluctuations (CAF) and motor features of Parkinsonism (UPDRS).We demonstrated significantly lower relative numbers of CD4+ T cells in DLB compared with AD using flow cytometry. We found a trend for higher relative numbers of CD8+ T cells in DLB, but this was not statistically significant. Our findings are supported by previous PBMC analysis in both AD and PD showing reduced populations of helper T cellsFurther examination of T cell subsets and phenotype, using CD45RA and CCR7, allowed some preliminary insights into stage of maturity or differentiation. We observed significantly decreased activation of HLA-DR+ B cells in DLB compared with AD. Reduced B cell activation could demonstrate a diminished level of humoral adaptive immunity in DLB, perhaps secondary to an impaired proliferative response to infection. This is supported by previous literature in PD that shows a reduction in B cells compared with controls.We report that IL-1\u03b2 was detected more frequently in DLB compared with AD and controls, and elevated IL-6 concentration was found in DLB compared with controls. IL-1\u03b2 is a major, acute phase, proinflammatory protein that is known to be a potent inducer of IL-6.Two previous clinical studies have examined blood cytokine concentrations in DLB. One demonstrated unchanged cytokine concentrations in DLB, but increased levels of IL-1\u03b2, IL-2, IL-4 and IL-10 in MCI-DLB, the first three of which were lower in more severe disease.We did not find significant associations between peripheral inflammation and the clinical features of DLB. Previous studies have reported elevated serum IL-10 with increased Parkinsonism,The strengths of this study include the large cohort of patients with AD and DLB identified using consensus diagnostic criteria and use of flow cytometry to examine PBMC subsets. Cryopreservation of PBMC allowed batch analysis using flow cytometry, a method that is widely used and although it can reduce cell viability it is comparable to using fresh whole blood,Lymphocyte biomarkers could be used to aid early diagnosis of patients with AD but standardisation and validation of findings is not yet satisfactory.In conclusion, we have demonstrated hypothesis-generating alterations to adaptive and innate immunity in DLB. Further work is warranted to explore the immunophenotype of DLB across the spectrum of disease severity. This should include large-scale genetic work to examine the possibility as to whether polymorphisms in genes associated with inflammation are implicated in DLB. Longitudinal analysis of peripheral inflammation in DLB, from prodromal to terminal disease, will enhance our understanding of the aetiology of DLB and may identify diagnostic biomarkers and novel targets for intervention."}
+{"text": "Reconstituted histone complex Incorporation into chromatin of Permeabilized cell) assay, in which epitope-tagged histone complexes are introduced into permeabilized cells and incorporated into their chromatin. Using this method, we found that H3.1 and H3.3 were incorporated into chromatin in replication-dependent and -independent manners, respectively. We further found that the incorporation of histones H2A and H2A.Z mainly occurred at less condensed chromatin (open), suggesting that condensed chromatin (closed) is a barrier for histone incorporation. To overcome this barrier, H2A, but not H2A.Z, uses a replication-coupled deposition mechanism. Our study revealed that the combination of chromatin structure and DNA replication dictates the differential histone deposition to maintain the epigenetic chromatin states.In eukaryotes, histone variant distribution within the genome is the key epigenetic feature. To understand how each histone variant is targeted to the genome, we developed a new method, the RhIP ( Eukaryotic genomic DNA is packaged into chromatin, in which the basic structural unit is the nucleosome. The nucleosome is composed of around 150 base pairs of DNA and a histone octamer consisting of two copies of each core histone, H2A, H2B, H3, and H4 . ChromatDrosophila melanogaster. Thus, the importance of M6 in the organism was evident; however, its molecular mechanism remained elusive.Among the chromatin associated proteins, histones have a significant impact on the chromatin structure. In humans, the canonical histones, H2A, H2B, and H3.1, have non-allelic variants with distinct expression and/or localization patterns . CanonicHistone deposition and exchange have been studied for more than 30 years . An in vH2A- and H2A.Z-specific chaperones have also been identified . FacilitThe precise distribution of histones is crucial for chromatin organization and its epigenetic states. The ChIP-seq analysis method is powerful and useful to visualize steady state histone localizations; however, it does not enable the analysis of the incorporation of each histone into open/closed chromatin or both (genome-wide). To analyze histone incorporations, several approaches using fluorescence imaging, mass spectrometry, inducible tagged proteins, and labeling of newly synthesized proteins have been developed . ImagingPermeabilized cells are useful to dissect the molecular pathways in nuclear events . In assaReconstituted histone complex Incorporation into chromatin of Permeabilized cell). Since the histone complexes are reconstituted in vitro using epitope-tagged recombinant histones, RhIP with sequencing allows the analysis of incorporations at the DNA sequence level, without the need for specific antibodies. We found that the chromatin structure regulates the histone incorporations, which may be necessary for maintaining the epigenetic state of chromatin.In the present study, we developed a new method, in which a reconstituted histone complex, instead of a fluorescent protein-tagged histone, was added to permeabilized cells. We named this the RhIP assay  . The recCAF-1 and HIRA are key factors for the H3.1 and H3.3 depositions in vivo, respectively . We therWe further examined whether the cellular extract is essential or replaceable by the histone chaperones, NAP1 or ASF1 . NAP1 anAmong the H2A family members, canonical H2A and the H2A.X variant show even and broad genome-wide distributions, but H2A.Z specifically localizes in open chromatin, including promoters and enhancers . To testWe further analyzed the incorporation of H2A and H2A.Z into replicating chromatin by a RhIP-ChIP assay, as in The replication timing in S phase strongly correlates with the chromatin configurations . In geneThe RhIP-ChIP assay showed that the H2A.Z deposition on nascent DNAs was constant in the early and late S phases . In contWe then examined whether the efficiency of the histone incorporation into closed chromatin changes during S phase . We perfAs endogenous H2A.Z predominantly localizes in transcription start sites (TSS) , we furtAs H2A.Z is incorporated into the same regions of the endogenous H2A.Z in the RhIP assay, the pre-incorporated H2A.Z in the chromatin may be dynamically exchanged with the exogenously added H2A.Z in the RhIP assay. The exchange reaction requires the H2A.Z-H2B complex to be evicted from nucleosomes, and ANP32E has this eviction activity . We thenIn addition to eviction activity, chromatin remodeling is a key determinant for the H2A.Z localizations. The SRCAP and TIP60/EP400 complexes are chromatin remodeling factors that replace nucleosomal H2A with H2A.Z. These factors were found in the permeabilized cells, suggesting that chromatin remodeling is also involved in H2A.Z deposition in the RhIP assay . A serieDrosophila melanogaster , the RhIP assay is suitable for the biochemical analysis of ChIP samples. The effects of post-translational modifications (PTMs) of histones on their incorporation have remained elusive. Methods to produce histones with PTMs in vitro have been developed , as C-terminal 3HA-His6 or 3FLAG-His6 fused genes. The human H2A, H2A.X, H2A.Z, and H2A.Z_M6 genes were inserted in the pET15b vector (Novagen) as N-terminal His6-3HA, His6-3FLAG or His6-V5 fused genes. All the genes were overexpressed in the BL21(DE3) E. coli strain, by adding 0.5 mM isopropyl-\u03b2-D-thiogalactopyranoside. Each histone was then purified as described previously, using Ni-NTA affinity chromatography , containing 7 M guanidine hydrochloride and 20 mM 2-mercaptoethanol, and incubated on ice. After 1 hr, the samples were dialyzed against reconstitution buffer  containing 2 M NaCl, overnight at 4\u00b0C. The NaCl concentration was then decreased by three steps of dialysis against reconstitution buffer containing 1 M NaCl for 4 hr, 0.5 M NaCl for 4 hr, and 0.1 M NaCl overnight. After the dialyses, the precipitants were removed by centrifugation and the supernatants were analyzed by Superdex 200 gel filtration chromatography .2, 1 mM dithiothreitol and 1\u00a0\u00d7\u00a0proteinase inhibitor cocktail ) was added to each dish to swell the cells, and the dishes were incubated for 5 min in a cold room. After repeating this step once, the excess buffer was removed by leaning the dishes against a wall for 5 min. The cells were then scraped off the dish and disrupted with 35 strokes in a 1 ml Dounce homogenizer with a loose-fitting pestle (Wheaton). Nuclei were removed by centrifugation at 1,500\u00a0\u00d7\u00a0g for 5 min at 4\u00b0C, and the collected supernatant was further centrifuged at 14,000\u00a0\u00d7\u00a0g for 5 min at 4\u00b0C. The supernatant was then flash-frozen with liquid nitrogen. After 30 min at \u221280\u00b0C, the cellular extract was thawed and the debris was removed. The concentration of the cellular extract was then measured with a protein quantification kit (MACHEREY-NAGEL). Usually, 3\u20134 ml of 5\u20138 mg/ml cellular extract were obtained.The cellular extract was prepared as previously described, with modifications . ConflueFor the preparation of the ATP-depleted cellular extract, HeLa cells were grown to confluence in a 15 cm dish, and further incubated for 60 min at 37\u00b0C in DMEM without glucose and fetal bovine serum, supplemented with 6 mM 2-deoxy-D-glucose and 10 mM sodium azide . The celCGUACGCGGAAUACUUCGAdTdT siRNA against ANP32E gene: AUGGAUUUGAUCAGGAGGAdTdT.For the preparation of the knockdown cellular extract, HeLa cells were transfected with siRNAs against the luciferase or ANP32E gene using the Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher), according to the manufacturer\u2019s instructions. After 72 hr, the cellular extract was prepared as described above. The siRNAs used are as follows: siRNA against luciferase gene: 5 per well. The cells were chilled on ice and rinsed twice with 2 ml of ice-cold PBF . To permeabilize the cells, 1 ml of PBF containing 0.2% Triton X-100 was added, and the cells were incubated for 5 min on ice and then rinsed twice with 2 ml of ice-cold PBF. As the permeabilized cells were easily detached from the coverslips, all subsequent steps were performed gently. The coverslips with the attached permeabilized cells were moved onto parafilm laid on an aluminum block, and incubated at 30\u00b0C. Then, a 50 \u03bcl portion of a RhIP-reaction mixture, containing 100 nM histone complex, 3.6 \u03bcg/\u03bcl cellular extract, 2.5% Ficoll, 100 mM CH3COOK, 10 mM Na2HPO4, 30 mM KCl, 1 mM dithiothreitol, 1 mM MgCl2, 100 \u03bcM each of dNTPs, and NTPs (Roche) with or without 250 nM Cy5-dUTP (Enzo Life Sciences), was added to the permeabilized cells, and incubated for 60 min at 30\u00b0C. The coverslip was placed in a well of a 12-well plate, and the cells were washed twice for 5 min with 1 ml of PBS containing 0.1% Tween 20 (PBST), at room temperature. The cells were then fixed with 4% PFA (Electron Microscopy Sciences) in PBS for 20 min at room temperature, and rinsed three times with PBS. The cells were treated with 1% BSA in PBST for 1 hr at room temperature, and then incubated for 2 hr at room temperature with one of the following primary antibodies: anti-HA , anti-HA (only used in HeLa cells were grown on a coverslip in a six well dish to 2.5\u00a0\u00d7\u00a010AAUGAUAACAAGGAGCCGGAGdTdT siRNA against p150 gene: CUGUCAUGUGGGUUCUGACdTdT siRNA against HIRA gene: ON-TARGET SMARTpool siRNA L-013610-00-0005 (Dharmacon).For the RhIP-immunostaining assay with the CAF-1- or HIRA-knockdown, HeLa cells were transfected with siRNAs against the luciferase (negative control), CAF-1 (p60), CAF-1 (p150), or HIRA gene using the Lipofectamine RNAiMAX Transfection Reagent (ThermoFisher), according to the manufacturer\u2019s instructions. To knockdown the CAF-1 complex, the siRNAs against the CAF-1-p60 and CAF-I-p150 genes were added simultaneously. After an incubation for 8 hr, the cells were collected by trypsin/EDTA treatment, and the CAF-1- or HIRA-knockdown cells were mixed with control-knockdown cells and re-plated and co-cultured for 64 hr. For the CAF-1-knockdown experiment, 2 mM of thymidine was added to synchronize the cells in S phase, 18 hr before the permeabilization. Immunostainings were then performed as described above. siRNAs used for this experiment are as follows: siRNA against p60 gene: 2 was then added to a final concentration of 2 mM. The cells were treated with 150 mU/\u03bcl of micrococcal nuclease  for 5 min at 37\u00b0C, to generate soluble chromatin fragments. The reaction was terminated by adding 10 mM EDTA, and the solubilized chromatin fragments were separated from the pellets by centrifugation at 16,000\u00a0\u00d7\u00a0g for 5 min at 4\u00b0C. The samples were then mixed with 50 \u03bcl of anti-HA-tag mAb-Magnetic Beads  in 15 mM Tris-HCl, pH 7.5, 300 mM NaCl, and 0.1% NP-40. After an overnight incubation at 4\u00b0C with gentle mixing on a wheel, the beads were washed three times each with 500 \u03bcl of ChIP buffer , ChIP buffer containing 500 mM KCl, and TE. The DNA was then eluted with a Proteinase K solution , and 0.5 mg/ml Proteinase K) and extracted with phenol-chloroform. The DNA was precipitated with ethanol and resuspended in 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA. The resulting DNA samples were separated by electrophoresis on a 2% agarose gel  (The RhIP-ChIP assays shown in  35 min)  and 2F o 35 min)  in 1\u00a0\u00d7\u00a0TThe H3.3 enrichment shown in AAAGGGTGCAGCTGAGCTAGGAPDH forward: TACGAAGCCCTTCCAGGAGAGAPDH reverse: CCGGTGTCAAATGTCACAATGAALINC02199 forward: GGGGTTTTGAGGATTCCAAAGTG.LINC02199 reverse: RhIP-ChIP-seq was performed in the same way as RhIP-ChIP with modifications. HeLa cells were used in Drosophila spike-in chromatin (Active Motif) was mixed with the rest of the chromatin. Two \u03bcg of spike-in antibody (Active Motif) per 50 ng of Drosophila spike-in chromatin were mixed with ProteinA/G magnetic beads (Pierce). The spike-in antibody beads were then mixed with 50 \u03bcl of anti-HA-tag mAb-Magnetic Beads and the chromatin mixture. Subsequent steps were performed as described above.For the spike-in normalization performed in extract-method=regex --bc-pattern='(?p<umi_1>.{6}){s\u00a0<=\u00a02}'. The extracted reads were mapped to the human genome (GRCh38) using hisat2 (version 2.1.0) (2(ChIP/Input) after normalization of the total reads. The signal tracks (bigwig files) were created at 1 bp intervals on the genome, and then the counts were normalized as CPM (Reads Per Million reads), using deepTools (For ChIP-seq data shown in n 2.1.0) . The PCRn 2.1.0) . The defn 2.1.0) . The BEDeepTools . ChIP-seeepTools . The PeaeepTools . The muleepTools . The comeepTools  were defFor the spike-in normalization used in Escherichia coli strain BL21-CodonPlus (DE3)-RIL cells (Agilent Technologies) were freshly transformed with the vector, and cultured at 30\u00b0C. After the cell density reached an A600\u00a0=\u00a00.8, 1 mM isopropyl- \u03b2-D-thiogalactopyranoside was added, and the culture was continued at 18\u00b0C for 12 hr to induce His6-tagged Asf1 expression. The cells were collected and resuspended in 20 mM Tris-HCl, pH 7.5, containing 500 mM KCl, 10% glycerol, 0.1% NP-40, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 2 mM 2-mercaptoethanol. After cell disruption by sonication, the debris was removed by centrifugation , and the clarified lysate was mixed gently with 4 ml (50% slurry) of nickel-nitrilotriacetic acid (Ni-NTA)-agarose resin (Qiagen) at 4\u00b0C for 1 hr. The Ni-NTA beads were washed with 200 ml of 20 mM Tris-HCl, pH 7.5, containing 500 mM NaCl, 10% glycerol, 10 mM imidazole, and 2 mM 2-mercaptoethanol. The His6-tagged Asf1 was eluted by a 100 ml linear gradient of 10 to 500 mM imidazole in 50 mM Tris-HCl buffer (pH 7.5), containing 500 mM NaCl, 10% glycerol, and 2 mM 2-mercaptoethanol. PreScission protease  was added to remove the His6 tag from the ASF1. The sample was dialyzed against 20 mM Tris-HCl, pH 7.5, containing 100 mM NaCl, 1 mM EDTA, 10% glycerol, and 2 mM 2-mercaptoethanol. The ASF1 was further purified by chromatography on a Mono Q (Cytiva) column, eluted with a 25 ml linear gradient of 100\u2013600 mM NaCl in 20 mM Tris-HCl, pH 7.5, containing 1 mM EDTA, 10% glycerol, and 2 mM 2-mercaptoethanol. The eluted Asf1 was further purified by chromatography on a Superdex 75 (Cytiva) column, eluted with 1.2 column volumes of the same buffer containing 100 mM NaCl. The Asf1 was repurified by Mono Q chromatography, concentrated, and dialyzed against 20 mM Tris-HCl (pH 7.5), containing 150 mM NaCl, 1 mM dithiothreitol, 0.5 mM EDTA, 0.1 mM PMSF, and 10% glycerol.Human NAP1 was purified as described previously . The humSemi-confluent HeLa cells in a 10 cm dish were chilled on ice and rinsed twice with 5 ml of ice-cold PBF. To permeabilize the cells, 2.5 ml of PBF containing 0.2% Triton X-100 was added, and incubated for 5 min on ice. The supernatant was collected as the soluble fraction. The permeabilized cells were rinsed twice with 5 ml of ice-cold PBF and scraped off the dish. After centrifugation at 800\u00a0\u00d7\u00a0g for 5 min at 4\u00b0C, the pellets were resuspended in 250 \u03bcl of RIPA buffer  and treated with benzonase. The supernatant was then collected by centrifugation at 16,000\u00a0\u00d7\u00a0g for 5 min at 4\u00b0C as the soluble fraction. The insoluble fraction was diluted ten-fold with PBF containing 0.2% Triton X-100 to adjust the dilution ratio between the soluble and insoluble fractions.Samples for western blots were separated by SDS-8% PAGE and transferred onto PVDF membranes (Cytiva) with a semi-dry blotter (Bio-Rad) at 120 mA for 60 min. For SRCAP, samples were separated by SDS-6% PAGE and transferred onto PVDF membranes with a wet blotter (Bio-Rad) in an ice-cold 1\u00a0\u00d7\u00a0AquaBlot (Wako) solution containing 0.05% SDS, at 120 V for 60 min. After blotting, the membranes were blocked with blocking One , and then probed with the following primary antibodies: anti-HIRA , anti-p60 , anti-H3 , anti-SRCAP , anti-TIP60 , anti-ANP32E  or anti-GAPDH . For the secondary antibodies, sheep horseradish peroxidase (HRP)-conjugated anti-mouse IgG or -rabbit IgG  was used. Signals were developed using Chemi-Lumi One Super  and were detected by an Amersham Imager 680 (Cytiva). public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.Our editorial process produces two outputs: i) Acceptance summary:The method presented in this article, named RhIP, will be of interest for all fields that interface with chromatin dynamics. It provides a new tool to dissect the mechanisms of chromatin assembly and disassembly genome-wide, and to determine how cell cycle and chromatin structure influence these dynamics.Decision letter after peer review:[Editors\u2019 note: the authors submitted for reconsideration following the decision after peer review. What follows is the decision letter after the first round of review.]eLife as a Tools and Resources article. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Senior Editor. The reviewers read each other's reviews and discussed their comments.Thank you for submitting your manuscript to Although the general enthusiasm is high, significant doubts remain with regard to how faithfully RhIP recapitulates endogenous remodeling activities. In addition, it is unclear how feasible it is to use RhIP to dissect mechanism. For example, can a specific remodeling pathway be blocked by factor depletion? Since substantial amounts of additional work are required to substantiate the conclusions claimed in the paper, we are unable to accept the manuscript in the current form. We are however happy to reconsider if the following concerns are addressed.1. Given the unique genomic localization of H2A.Z, the authors wisely used H2A.Z as a benchmark to assess the robustness of the RhIP approach. Indeed, site-specific deposition was observed when permeablized cells were incubated with recombinant H2A.Z and (cytosolic) extracts. While this is an interesting result, it remains unclear how well the H2A.Z sites observed by RhIP-ChIP-seq correlate with endogenous H2A.Z sites. The authors should report the percentage of H2A.Z sites correctly identified by RhIP. Scatter plots should be used to compare the relative occupancy of H2A.Z between the RhIP-ChIP-seq data and known H2A.Z sites. Are there H2A.Z sites in the RhIP-ChIP-seq data not seen in vivo. When presenting anecdotal evidence as in Figure 4A, endogenous H2A.Z tracks should be included for comparison.2. Genomic data analyses generally lack rigor. This is epitomized in Figure 4-supplement 2. The fraction-against-rank plots give little information on the concordance of the two replicates. Do the H2A.Z sites identified in the replicates correlate spatially , quantitatively (e.g. peak height), and qualitatively (e.g. width of peaks)? For example, relative H2A.Z occupancy at known H2A.Z sites of the two H2A.Z RhIP-ChIP-seq replicates should be plotted against each other. The H2A RhIP-ChIP-seq datasets could serve as negative control.3. It is important to assess how individual factors contribute to a particular remodeling pathway. Given that the steady-state H2A.Z occupancy is a net result of deposition and eviction and that multiple remodeling factors are involved in these processes, whether the observed H2A.Z peaks in RhIP-ChIP-seq represent the consequence of one or more of these factors should be evaluated. For example, are SRCAP and p400/TIP60 responsible for different H2A.Z sites across the genome? Is ATP required for H2A.Z deposition? Is ANP32E responsible for removing H2A.Z at enhancers and insulators? Does transcription contribute to H2A.Z eviction? Proper spike-in controls should be incorporated into the RhIP-ChIP-seq samples before and after the addition of factor-depleted extracts to allow quantitative assessment. Since cytosolic extracts were used, it is not surprising that some factors may be under represented. If such biases do exist, the authors should consider using nuclear extracts and/or provide evidence on how much remodeling factors partitioned into the fractions relative to input (e.g. SRCAP western blots).4. The title suggests that RhIP is generally applicable to all histones. But there was no mention of the H3 results in the Abstract or the Discussion. In addition, while immunostaining shows H3.1 and H3.3 are incorporated into the nucleus of permeabilized cells at the expected cell cycle stages, microscopy lacks the resolution necessary to validate if H3.1 and H3.3 are targeted to the expected genomic locations. For example, is H3.3 more enriched at active genes? CAF1 and HIRA knockdown should be used to verify if H3.1 and H3.3 are indeed deposited by these pathways. Finally, to show that H3.1 and H3.3 are indeed inserted into nucleosomes, the MNase experiment similar to the one in Figure 3C should be performed.5. Major improvement of the description of methods is required to allow rigorous assessment of the approach. The current methods section lacks critical details necessary to carry out the experiments.Reviewer #1:Tachiwana and coworkers have developed a histone deposition assay called RhIP that recapitulates site-specific incorporation of tagged histones into the chromatin of permeabilized cells using cellular extracts. The authors showed that RhIP recapitulates replication-dependent and -independent deposition of histone H3.1 and H3.3, respectively. They also showed that RhIP allows site-specific deposition of H2A, H2A.X and H2A.Z. However, the paper falls short in showing that RhIP can actually be used to dissect molecular mechanisms. For example, if extracts from chaperone/remodeler-depleted cells were used, could a specific histone deposition step be blocked? Could purified proteins then be added back to restore histone deposition activity? In addition, what contribution endogenous factors (i.e. from the permeabilized cells) have on RhIP is unclear.eLife's Tools and Resources article does not require to report major new biological insights; however, it must be able to demonstrate such advances can be made by applying the new tools. In this respect, whether the RhIP approach can be used to dissect mechanism cannot be evaluated. Therefore, I do not recommend the manuscript in the current form to be published in eLife.An Other major issues:1. 'Open chromatin' and 'close chromatin' are loosely defined terms. The authors should use specific histone marks (e.g. H3K4me3 or H3K27me3) as reference for co-localization analysis of the incorporated histones.2. Based on the data presented in Figure 4, the robustness of site-specific incorporation of H2A.Z using RhIP cannot be rigorously evaluated. For example, while H2A.Z appears to be deposited at the promoters of some genes, there are H2A.Z peaks outside of promoters. Are these mis-incorporated H2A.Z molecules (i.e. RhIP artifact)? Or are they bona fide H2A.Z sites. The authors should provide endogenous H2A.Z ChIP-seq data for comparison and evaluate how well RhIP recapitulates endogenous H2A.Z deposition.3. Transfection reagents for proteins, such as the Chariot system, have previously been used to deliver chromatin factors into mammalian cells . What is the deposition efficiency of RhIP compared to Chariot?4. A related question is how efficient is RhIP? What is the percentage of nascent histones incorporated by RhIP? The authors should perform western blots to compare the relative amounts of tagged and untagged histones.Reviewer #2:The manuscript by Tachinawa et al. presents a new method  that monitors incorporation of histone dimers into permeabilized cells. The authors test H3.1 and H3.3 containing H3-H4 dimers and then they primarily focus on the incorporation of H2A-H2B dimers and their variants containing H2A.X or H2A.Z. The readouts of the assay range from immunofluorescence, to Chromatin IP (ChIP) and ChIP-seq.Overall, the method is interesting and may become a powerful tool to study chromatin dynamics. However, I have some comments that may improve the current manuscript.1. As this has been submitted as a Tool and Resource article, I was expecting a much clearer explanation of how the RhIP is carried out. In the method section, every step of the procedure need to be spelled out more clearly. Currently one has to go back to older publications and it becomes quite difficult to recapitulate what has been done in details.2. If I understand correctly, the authors co-incubate different histone dimers In Figure 1-2 and 5, but not in Figure 3 (and 4 perhaps). This means that the Immunofluorescence results depend on the \"competition\" between the H2A and the H2A.Z (or h3.1-H3.1) dimers, while the ChIP and ChIP-seq data in figure 3 and 4 only look at incorporation of a single dimer type (without competition for binding between different variants). This makes the comparison of the results quite challenging. What would the result of Figure 1-2 and 5 be if the different histone dimers would be added individually, rather than as a mixture? This would greatly clarify what are the properties that control dimers incorporation in this assay.3. The authors do not really acknowledge that the incorporation observed in their studies is the net result of assembly AND disassembly pathways. This needs to be part of the narrative, because the experiments do not address which of these pathways is involved and to what extent. For example, on page 11, lines 10-14, or in page 12, line 1-2 or line 18-19, only suppression of deposition mechanisms are taken into account in the interpretation of the data, but a strong disassembly activity here may result in the same effect.4. The MNase digestions in Figure 3 are very interesting. Can the authors include a higher exposure gel to show that the overall incorporation of Cy5dUTP is the same for H2A and H2A.Z input samples?5. In Figure 4 C and E (and supplement 1), are the differences between samples statistically significant, or are these only trends? And what about Figure 1D?Please clarify this.6. The title and the discussion suggest that the RhIP method is generally applicable and validated both for \"histones\" ). I found the H3-H4 part rather thin compared to the H2A-H2B (and variant) analysis. This is to the point that H3-H4 are completely omitted from the final model of the manuscript. Can the author address this with a title and discussion that focuses on H2A-H2B rather than \"histones\"?Reviewer #3:The manuscript \"Chromatin structure-dependent histone incorporation revealed by a genome-wide deposition assay\" by Tachiwana et al. put-forward a novel method, termed RhIP that allows a detailed investigation of mechanisms fostering histone deposition. In this approach the authors substitute permeabilized cells with recombinantly expressed tagged histones and cytosolic extracts (or chaperone proteins), and then measure histone chromatin deposition using various methods, ranging from immunofluorescence microscopy to RhIP/ChIP-sequencing. While this is an interesting method, some technical questions remain that need to be addressed and clarified. Most importantly, the authors need to show that the factors (chaperones) responsible for a faithful temporal and spatial histone variant deposition (or ejection) are actually still present in the permeabilized cell nucleus or available in the cell extract. The observation that H2A.Z is deposited into open but not condensed chromatin, could be explained by lack of (one) H2A.Z-specific chaperone/remodelling complex(es) after permeabilization. The authors need to demonstrate that these observations are not caused by a rather artificial experimental system that might not resemble the in vivo situation.My specific concerns are listed in more detail below:1. There are some clarifications on technical aspects of the RhIP assay missing. As I understood it, this assay was performed with a cytosolic extract, at least this is mentioned in the Materials and methods section. It would be interesting to see whether the known H2A.Z-specific chromatin remodeller complexes, such as SRCAP, p400/TIP60, ANP32E, INO80, etc. that are mostly nuclear proteins and required for H2A.Z deposition/ejection, are also present in this extract. The extracts as well as the cells after permeabilization and reconstitution should be immunoblotted for these chaperones to verify their presence. Additionally, have the authors performed these experiments in the presence or absence of ATP?2. Figure 2: The authors have shown in Figure 2E that the H2A.Z signal overlaps with the dUTP signal in early but not in late S-phase cells. This result is in contrast to other studies using EdU-staining and microscopy in living cells that observed H2A.Z signals only overlapping with late (constitutive heterochromatin) replicating cells  and other studies showing H2A.Z levels at transcriptional start sites  to be decreased during S-phase . This discrepancy needs to be explained and discussed.3. Figure 5: This is a relevant experiment, and a RhIP-ChIP-seq experiment should be included to show in greater detail that H2A.Z-M6 resembles more H2A than H2A.Z when looking at TSS .eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Jessica Tyler as the Senior Editor. The reviewers have opted to remain anonymous.Thank you for submitting your article \"Chromatin structure-dependent histone incorporation revealed by a genome-wide deposition assay\" for consideration by The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.Essential Revisions:Here we share detailed comments to tackle the limitations of the study:1. While replication-dependent mechanisms are well captured by RhIP, it is less clear if transcription and chromatin remodeling is functional in this system and thus if transcription-dependent nucleosome exchange processes are faithfully recapitulated. It is important to improve the comparison of RhIP with 'in vivo' (i.e. existing ChIP-seq datasets) localisation and explicitly develop hypotheses why in some cases the data matches the 'in vivo' situation and in others not.a. Lines 279-301 and Figure 4. There is moderate correlation between genome-wide H2A.Z RhIP-ChIP-seq and H2A.Z ChIP-seq . However, it seems H2A.Z RhIP-ChIP might be selectively detecting TSS specific signals rather than gene body specific associations . It would be helpful to comment on the genetic elements (e.g. gene body) at which H2A.Z RhIP-ChIP and H2A.Z ChIP show low or no correlation and make a comparison. This way strengths and weaknesses of the assay can be better evaluated and compared to already existing protocols. The image resolution of Figure 4A should be improved.b. Suppl. Figure 1.1 H3.3 distribution across the active and inactive genes were plotted in Suppl Figure 1. However, how active and inactive status of genes was defined, and which data was utilized for this analysis were not indicated under the Methods. These parameters and data source should be included. Transcript levels for GAPDH and LNC02199 should also be indicated or the reader should be referred to a table containing transcription data (i.e. RNA-Seq). I also think that it would be helpful if the authors can comment on the efficiency of H3.3-HA ChIP compared to pull down of endogenous H3.3 by comparing RhIP-ChIP-seq and previously reported H3.3 ChIP-seq analyses.c. The genomics analysis presented in Figure 3 is somewhat rudimentary, the signals from H2A and H2A.Z appear overall very correlated , albeit the correlation genome-wide calculated in Figure 3-S2 is 'medium'. The scatter plot could be shown better to see potentially different 'population of loci, some that correlate well and 'outliers'. Judging from Figure 3B, it appears that there is a good correlation across broad chromatin states with the notable excavation of active TSS. This is in line with the known H2A.Z mechanism, but could be elaborated in plots a bit clearer. How do the profiles look across highly expressed and non-expressed genes?The cell-cycle-synchronized plots are only summarized in the heatmap in Figure 3C,D. Example loci could be shown as in Figure 3A.2. It would be helpful to improve the interpretation of the data to include all existing caveats to the assay setup.a. The new ATP addition experiments (figure 5E-F) are interpreted as if the only effect of ATP is on chromatin remodellers. It is well possible that by adding ATP in this conditions, additional factors  are being affected and responsible for the effect.b. The authors alternate setups where they either co-incubate different histone dimers, or they use a single histone dimer isoform. It is really unclear to the readers what is the reason for this and how does this affect the results/interpretation. In cases where a mixture of histone dimers were present , competition between the H2A/H2A.Z-X or H3.1/H3.3 dimers may take place, while in the others this competition is not present. This makes the comparison of the results quite challenging, and their conclusions unclear. This should be discussed at the very least, as it has implications on understanding the properties that control histone incorporation during RhIP.c. The RhIP-ChIP-seq protocol uses formaldehyde crosslinking instead of native mononucleosomal IP as used in Figure 1H, leaving room for interpretation if the pull-down histone is indeed incorporated into chromatin. Immunofluorescence also does not necessarily prove incorporation of histones into chromatin, since i.e. the fractionation in Figure 1-S2 shows that HIRA and CAF1 remain tightly bound to the isolated nuclei. Thus, accumulation of the epitope-tagged H3 in the nucleus of cells could merely mean that is bound to the histone chaperones present in the nucleus (competing away endogenous histones). It is not possible to discern from the data what the incorporated amount versus the chaperone-bound fraction of recombinant histone is.d. The functional assessment of ANP32E knockdown lacks statistical analysis \u2013 clearly the quite robust knockdown  does not majorly abrogate TSS incorporation of H2A.Z. Is the difference statistically significant? What is the explanation for the relatively small effect size?e. Lines 275-277. Please revisit the conclusion and make the statement clearer on H2A.Z incorporation and elimination.We suggest adding these references:The authors make a thorough effort to place their method in the context of existing pulse-labeling methods, but Tet-ON based pulsing methods, which do give similar results have not been discussed: Mito, Y., Henikoff, J. G. and Henikoff, S. Genome-scale profiling of histone H3.3 replacement patterns. Nat. Genet. 37, 1090-1097 (2005); Yildirim, O. et al. A system for genome-wide histone variant dynamics in ES cells reveals dynamic MacroH2A2 replacement at promoters. PLoS Genet. 10, e1004515 (2014); Ha, M., Kraushaar, D. C. and Zhao, K. Genome-wide analysis of H3.3 dissociation reveals high nucleosome turnover at distal regulatory regions of embryonic stem cells. Epigenetics Chromatin 7, 38 (2014).Additional notes (not needed for revision):Finally we list additional suggestions that were made by the reviewers. These comments are shared with you, but the reviewers do not expect these experiments to be performed in the revised version of the manuscript. We hope these will help you improve the discussion part and future studies.Figure 1Deposition of H3.3 seems rather inefficient as judged from the genome-wide profiling RhIP-ChIP-seq experiment in Figure 1-S1, and deposition appears to only occur at TSS but not across the gene bodies of active genes as observed in cells (please make sure to provide primary data on GEO for a revised submission). As I understand, the RhIP-ChIP-seq protocol uses formaldehyde crosslinking instead of native mononucleosomal IP as used in Figure 1H, leaving room for interpretation if the pull-down histone is indeed incorporated into chromatin. Immunofluorescence also does not necessarily prove incorporation of H3.1/H3.3 into chromatin, since the fractionation in Figure 1-S2 shows that HIRA and CAF1 remain tightly bound to the isolated nuclei. Thus, accumulation of the epitope-tagged H3 in the nucleus of cells could merely mean that is bound to the histone chaperones present in the nucleus (competing away endogenous histones). It is not possible to discern from the data what the incorporated amount versus the chaperone-bound fraction of recombinant histone is. Potentially, the product of the RhIP reaction could itself be fractionated using e.g. a salt gradient, which would provide evidence if the retained H3 histones are nucleosomal (retained up to ~500mM NaCl) or non-nucleosomal and dissociating at lower salt concentrations.Further, in Figure 1H shoes that Cy5-labeled mononucleosomes are at very low abundance within the input  but highly enriched in both H3.1 and H3.3 IP. The fraction of replicated chromatin in each lane can be estimated by the Cy5/SYBR gold ratio. Assuming completely random (i.e. replication-independent) incorporation of recombinant histones, the Cy5/SYBR gold ration after IP  should be equivalent to that ratio before IP . Yet, in lanes 6,7, there's much more Cy5 signal thus, a strong enrichment for replicating chromatin. This suggest that not only H3.1 but also a considerable fraction of H3.3 is incorporated replication-dependent in this assay. This is entirely possible given the known role of HIRA/H3.3 in gap-filling after replication fork, especially if normal replication-dependent pathways are impaired . Again it needs to be stressed that the IF experiment Figure 1C do not necessarily prove that H3.3 is incorporated into nucleosomes in cells not undergoing replication.Lastly, the knockdown experiments in Figure 1-S2 appear to confirm known roles of CAF-1 and HIRA, but important controls have and opportunities to both validate the system and learn something new have been missed: following the flowchart of Figure 1-S2B, it is evident that there's ample opportunity to test the authors hypothesis that RhIP assay indeed recapitulates the assembly pathways known in cells. For example, CAF-1 and HIRA knockdown should each be tested for epitope tagged H3.1 and H3.3, to exclude the possibility that what we are looking at here is chromatin assembly and not mere binding to nuclear chaperones. Furthermore, replication can only proceed in the presence of all four deoxynucleotides whereas chromatin remodeling requires only ATP. Thus by adding, or not, nucleotides, it can be explicitly tested if active replication is needed. Consider following setup and expected results:no siRNA + dNTPs + ATP \u2192 nuclei are positive for H3.1 and H3.3 no siRNA \u2013 dNTPs + ATP \u2192 no replication! So nuclei should be negative for H3.1 unless the H3.1 signal is actually coming from H3.1 binding to CAF1. But H3.3 incorporation should be unaffected if truly replication-independent!no siRNA \u2013 dNTPs \u2013 ATP \u2192 in the absence of nucleotides and ATP there is no energy to remove existing nucleosomes. Since we have to assume that DNA in isolated nuclei is normally chromatinized, chromatin assembly with epitope-tagged histones H3 would require prior nucleome eviction. This cannot happened without energy. Thus, in this control nuclei should be negative for H3.3. If they are still positive, then H3.3 is most likely bound by nuclear chaperones but not incorporated.siCAF + dNTPs + ATP \u2192 nuclei are negative for H3.1  but should be positive for H3.3 (not assayed). If gap-filling assembly via HIRA is active in RhIP assay, than H3.3 signal should even increase upon CAF1 depletion!siHIRA + dNTPs + ATP \u2192 nuclei are negative for H3.3  but should be remain for H3.1 when in replication (not assayed).Figure 1 figure supplement 1B: It would make the argument stronger if the authors could show that this difference is not observed for H3.1-containing dimers.Figure 1 figure supplement 1B: It would make the argument stronger if the authors could show that this difference is not observed for H3.1-containing dimers.Figure 2Since there is no negative control present for H2A, H2A.X, H2A.Z incorporation , there remains an more pertinent concern that some or most of the fluorescent signal observed after RhIP could arise from non-incorporated histones that accumulate with chaperones in the nucleus. Again, a biochemical fractionation could cleanly show this, potentially also a pre-extraction protocol before immunostaining. A negative control  should be established, or a -ATP control as used for the genomics experiment in Figure 5.In Figure 2F, as with Figure 1H, it is evident that replicated chromatin is overrepresented in both H2A and H2A.Z pulldowns, suggesting that both are deposited also in a replication-dependent manner . Comparison to the very similar looking fold-enrichment from pure synchronized S phase population Figure 2-S2 actually may suggest that most incorporation into proper nucleosomes is replication-dependent in this assay.Figure 5Is ANP32E acting catalytically ? What's maybe more surprising is that ATP depletion is not really effective. Histone eviction requires ATP. Thus this mean there are many pre-existing nucleosome-free regions? Or could this suggest that much of the signal observed does not correspond to properly assembled nucleosomes?Given the hypothesis put forward from Figure 5 (ATP-dependent remodeling and ANP32E together facilitate H2A.Z incorporation), then it should be tested if combined ANP32E + ATP depletion has an synergistic, additive or no additional effect beyond the single treatments.Figure 6The image-based analysis does support the conclusion that the M6 mutant behaves H2A-like, but it is unclear what the mechanistic insight gained from this experiment is, again acknowledging that this mutant has been constructed according to known reports.Figure 1H: beyond demonstrating that the epitope-tagged histone associates with nucleosomal-sized DNA, a protein gel or blot would be revealing to demonstrate a stoichiometric relationship of H3, H4, H2A, H2B. A very interesting question could be addressed by assessing the ratio of epitope-tagged H3.1/3 to untagged H3 in these nucleosomal fragments: do replication-dependent and independent deposition pathways assemble homotypic H3/H4 tetramers with only exogenous (tagged) H3.1, H3.3? Or is the tagged histone H3 mixed equally with endogenous (untagged) histone H3, thus suggesting that one new H3/H4 dimer is paired with an existing H3/H4 dimer during the assembly process.I would highly recommend performing time-course experiments to really understand the kinetics, dynamic range and saturation of the system. [Editors\u2019 note: the authors resubmitted a revised version of the paper for consideration. What follows is the authors\u2019 response to the first round of review.]Although the general enthusiasm is high, significant doubts remain with regard to how faithfully RhIP recapitulates endogenous remodeling activities. In addition, it is unclear how feasible it is to use RhIP to dissect mechanism. For example, can a specific remodeling pathway be blocked by factor depletion? Since substantial amounts of additional work are required to substantiate the conclusions claimed in the paper, we are unable to accept the manuscript in the current form. We are however happy to reconsider if the following concerns are addressed.1) Given the unique genomic localization of H2A.Z, the authors wisely used H2A.Z as a benchmark to assess the robustness of the RhIP approach. Indeed, site-specific deposition was observed when permeablized cells were incubated with recombinant H2A.Z and (cytosolic) extracts. While this is an interesting result, it remains unclear how well the H2A.Z sites observed by RhIP-ChIP-seq correlate with endogenous H2A.Z sites.Thank you for this comment. We agree that it is important to clarify how well the H2A.Z sites observed by RhIP-ChIP-seq correlate with the endogenous H2A.Z sites detected by ChIP-seq. Accordingly, we have reanalyzed our data, and made new figures in our revised manuscript. To clearly answer this question, we separated your comments and answered each one, as below.The authors should report the percentage of H2A.Z sites correctly identified by RhIP. Are there H2A.Z sites in the RhIP-ChIP-seq data not seen in vivo.According to this comment, we visualized the H2A.Z sites of the RhIPChIP-seq read density across the endogenous H2A.Z peaks determined by ChIP-seq, using heatmaps . We found that the H2A.Z incorporated by the RhIP assay exists in almost all endogenous H2A.Z peaks, while the H2A is excluded from the H2A.Z peaks. The reversed heatmap, which depicts the H2A.Z of the ChIP-seq read density across the H2A.Z peaks determined by the RhIP-ChIP-seq, showed that only 3% of the H2A.Z peaks are specific for the RhIP assay . We described these analyses on page 15, lines 297-303.Scatter plots should be used to compare the relative occupancy of H2A.Z between the RhIP-ChIP-seq data and known H2A.Z sites.We drew scatter plots showing the comparison between the RhIP-ChIP-seq and ChIP-seq data at known H2A.Z sites. We found a moderately linear relationship between H2A.Z (RhIP-ChIP-seq) and H2A.Z (ChIP-seq), but little to no correlation between H2A (RhIP-ChIP-seq) and (ChIP-seq) . We described this on page 15, lines 293-297.2) Genomic data analyses generally lack rigor. This is epitomized in Figure 4-supplement 2. The fraction-against-rank plots give little information on the concordance of the two replicates. Do the H2A.Z sites identified in the replicates correlate spatially , quantitatively (e.g. peak height), and qualitatively (e.g. width of peaks)? For example, relative H2A.Z occupancy at known H2A.Z sites of the two H2A.Z RhIP-ChIP-seq replicates should be plotted against each other. The H2A RhIP-ChIP-seq datasets could serve as negative control.Thank you for this suggestion. In the revised manuscript, we confirmed the reproducibility of the RhIP-ChIP-seq of H2A.Z according to this suggestion. We plotted the H2A.Z RhIP-ChIP-seq replicates at known H2A.Z sites, which showed a quite high correlation (0.95 Pearson correlation coefficient), while the H2A and H2A.Z RhIP-ChIP-seq data showed a weaker correlation, as compared to one of the replicates . Moreover, the aggregation plots of the two H2A.Z RhIP-ChIP-seq replicates at known H2A.Z sites showed similar accumulation patterns . In contrast, the aggregation plot of the H2A RhIP-ChIPseq showed the exclusion of H2A at the known H2A.Z sites . We described these findings on page 18, lines 377-382.3) It is important to assess how individual factors contribute to a particular remodeling pathway. Given that the steady-state H2A.Z occupancy is a net result of deposition and eviction and that multiple remodeling factors are involved in these processes, whether the observed H2A.Z peaks in RhIP-ChIP-seq represent the consequence of one or more of these factors should be evaluated. For example, are SRCAP and p400/TIP60 responsible for different H2A.Z sites across the genome? Is ATP required for H2A.Z deposition?According to these suggestions, we first examined the permeabilized cells for the presence of SRCAP, TIP60 and ANP32E. The fractionation and following western blot analysis confirmed that SRCAP and TIP60 are still in the permeabilized cells, suggesting that the chromatin remodeling activity may be involved in the H2A.Z deposition in the RhIP assay. Since chromatin remodeling requires ATP, we then prepared the ATP-reduced cellular extract and tested it in the RhIP assay with or without ATP supplementation . As a result, ATP promoted the H2A.Z depositions in active TSS and enhancer regions, suggesting that the H2A.Z deposition in the RhIP assay requires a chromatin remodeling activity that hydrolyzes ATP. We described these new results on pages 1617, lines 329-341.Is ANP32E responsible for removing H2A.Z at enhancers and insulators? Does transcription contribute to H2A.Z eviction?Our fractionation and western blot analysis showed that ANP32E is removed from permeabilized cells during the permeabilization process . As ANP32E is present in the cellular extract, which is used in the RhIP assay, we prepared the ANP32E-knockdown cellular extract and performed a RhIP-ChIP-seq analysis of H2A.Z . As a result, the efficiency of H2A.Z incorporations into active TSS and enhancer regions, where endogenous H2A.Z is predominantly localized, was decreased upon the ANP32E-knockdown . This indicates that the ANP32Edependent evictions of the pre-incorporated H2A.Z in active TSS and enhancer regions promotes the incorporation of exogenously added H2A.Z in the RhIP assay. We described these data on page 16, lines 313-328.We note that a previous paper reported that ANP32E-knockout mouse embryonic fibroblast (MEF) cells showed an increased number of H2A.Z peaks in insulator regions. In the RhIP assay using the ANP32Eknockdown cellular extract, the changes in the efficiency of the H2A.Z deposition in the insulator regions were less than those in the active TSS and enhancers . This discrepancy may arise from the fact that the H2A.Z distribution pattern of the knockout MEFs represents chromatin reorganization over a long time during embryogenesis, thus facilitating the adaptation to the ANP32E-knockout condition. This may include compensation for the ANP32E-mediated H2A.Z evictions. In contrast, our RhIP-seq analysis using the ANP32E-knockdown cellular extract instead represents the chromatin dynamics after the acute depletion of ANP32E. Consistent with our data, another previous paper showed that the introduction of recombinant ANP32E to zebrafish embryos resulted in the global loss of H2A.Z from the nucleus .Murphy, P. J., Wu, S. F., James, C. R., Wike, C. L., and Cairns, B. R.(2018). Placeholder Nucleosomes Underlie Germline-to-Embryo DNACell, 172(5), 993\u20131006.e13. http://doi.org/10.1016/j.cell.2018.01.022Methylation Reprogramming. Proper spike-in controls should be incorporated into the RhIP-ChIP-seq samples before and after the addition of factor-depleted extracts to allow quantitative assessment.Thank you for this critical comment. Accordingly, we performed the ATPand ANP32E-depleted RhIP-ChIP-seq analysis using the spike-in controls  .Chen, K., Hu, Z., Xia, Z., Zhao, D., Li, W., and Tyler, J. K. (2015). TheOverlooked Fact: Fundamental Need for Spike-In Control for Virtually All Genome-Wide Analyses. Molecular and Cellular Biology, 36(5), 662\u2013667. http://doi.org/10.1128/MCB.00970-14Egan, B., Yuan, C.-C., Craske, M. L., Labhart, P., Guler, G. D., Arnott, D., et al. (2016). An Alternative Approach to ChIP-seq Normalization Enables Detection of Genome-Wide Changes in Histone H3 Lysine 27 Trimethylation upon EZH2 Inhibition. PLoS ONE, 11(11), e0166438. http://doi.org/10.1371/journal.pone.0166438Orlando, D. A., Chen, M. W., Brown, V. E., Solanki, S., Choi, Y. J., Olson, E. R., et al. (2014). Quantitative ChIP-seq normalization reveals global modulation of the epigenome. Cell Reports, 9(3), 1163\u20131170. http://doi.org/10.1016/j.celrep.2014.10.018Since cytosolic extracts were used, it is not surprising that some factors may be under represented. If such biases do exist, the authors should consider using nuclear extracts and/or provide evidence on how much remodeling factors partitioned into the fractions relative to input (e.g. SRCAP western blots).As mentioned above, our fractionation analysis indicated that SRCAP and TIP60, components of major H2A.Z deposition complexes, were retained in the permeabilized cells. Even though ANP32E was extracted during the permeabilization process, ANP32E was added back to the RhIP reaction as the ANP32E present in the cellular extract. These data indicate that these factors are not underrepresented in the RhIP assay.Together with the results mentioned above, we conclude that the H2A.Z deposition in the RhIP assay is a net result of the ANP32E-mediated eviction and deposition of H2A.Z and the replacement of pre-incorporated H2A with H2A.Z by chromatin remodeling, and that the cellular H2A.Z deposition pathways are recapitulated in the RhIP assay.4) The title suggests that RhIP is generally applicable to all histones. But there was no mention of the H3 results in the Abstract or the Discussion.Thank you for this advice. We added sentences regarding the H3 results in the Abstract and Discussion on page 2, lines 6-8 and page 19, lines 390-396.In addition, while immunostaining shows H3.1 and H3.3 are incorporated into the nucleus of permeabilized cells at the expected cell cycle stages, microscopy lacks the resolution necessary to validate if H3.1 and H3.3 are targeted to the expected genomic locations. For example, is H3.3 more enriched at active genes?We agree with this comment. We performed the RhIP-ChIP-seq analysis of H3.3 and found its enrichment at active genes . In addition, the RhIP-ChIP-qPCR analysis showed higher enrichment of H3.3 in the active gene (GAPDH) than the inactive gene (LINC02199) . We described these data on pages 8 and 9, lines 143-162.CAF1 and HIRA knockdown should be used to verify if H3.1 and H3.3 are indeed deposited by these pathways.We confirmed the CAF-1 and HIRA requirements for the H3.1 and H3.1 depositions in the RhIP assay by immunostaining , since previous SNAP-tag based analyses clearly showed their requirement by imaging . First, we checked for the existence of CAF-1 and HIRA in permeabilized cells. Our fractionation followed by western blotting analysis showed that these factors were retained in permeabilized cells . We then prepared the CAF-1- or HIRA-knockdown permeabilized cells and performed the RhIP-immunostaining assay of H3.1 or H3.3 . In this assay, we co-cultured the control and knockdown cells on the same coverslips for a precise evaluation. The knockdown cells were judged by immunostainings for CAF-1 (p60) and HIRA. As a result, we found that the intensities of both the incorporated H3.1 and H3.3 were significantly decreased in the CAF-1- and HIRA-knockdown cells, respectively. Therefore, H3.1 and H3.3 are deposited by the CAF-1- and HIRA-dependent pathways in the RhIP assay, respectively. We described these results on pages 9 and 10, lines 163-180.Ray-Gallet, D., Woolfe, A., Vassias, I., Pellentz, C., Lacoste, N., Puri, A., et al. (2011). Dynamics of histone H3 deposition in vivo reveal a nucleosome gap-filling mechanism for H3.3 to maintain chromatin integrity. Molecular Cell, 44(6), 928\u2013941.Finally, to show that H3.1 and H3.3 are indeed inserted into nucleosomes, the MNase experiment similar to the one in Figure 3C should be performed.According to this comment, we performed an MNase experiment similar to that in the previous Figure 3C , using H3.1 and H3.3 . As a result, we confirmed their incorporations into the chromatin of permeabilized cells. Moreover, we found that the amount of nascent DNA in the H3.1 RhIP-ChIP sample was more than that in the H3.3 RhIP-ChIP sample. This is consistent with the results of the RhIP immunostaining assay shown in the new Figures 1C-E. We described these data on pages 8 and 9, lines 143-154.5) Major improvement of the description of methods is required to allow rigorous assessment of the approach. The current methods section lacks critical details necessary to carry out the experiments.We rewrote the methods section on page 23, lines 480-482, pages 24-30, lines 495-637, page 31, lines 658-672 and page 32, lines 701-724 in the revised manuscript. We hope the new methods section is sufficient for readers to perform the RhIP assay. If more information is needed, we will be happy to provide any details. We then express this in Data availability as If more information, or tips are needed, we will/are willing to provide upon reasonable requests.[Editors\u2019 note: what follows is the authors\u2019 response to the second round of review.]Essential Revisions:Here we share detailed comments to tackle the limitations of the study:1. While replication-dependent mechanisms are well captured by RhIP, it is less clear if transcription and chromatin remodeling is functional in this system and thus if transcription-dependent nucleosome exchange processes are faithfully recapitulated. It is important to improve the comparison of RhIP with 'in vivo' (i.e. existing ChIP-seq datasets) localisation and explicitly develop hypotheses why in some cases the data matches the 'in vivo' situation and in others not.We thank the reviewers for this important comment. Based on the suggestions, we performed additional analyses as described below, which allowed us to hypothesize that the difference between the RhIP-ChIP-seq and ChIP-seq may reflect the recycling frequency of the evicted histone complexes.a. Lines 279-301 and Figure 4. There is moderate correlation between genome-wide H2A.Z RhIP-ChIP-seq and H2A.Z ChIP-seq . However, it seems H2A.Z RhIP-ChIP might be selectively detecting TSS specific signals rather than gene body specific associations . It would be helpful to comment on the genetic elements (e.g. gene body) at which H2A.Z RhIP-ChIP and H2A.Z ChIP show low or no correlation and make a comparison. This way strengths and weaknesses of the assay can be better evaluated and compared to already existing protocols.According to this suggestion, we have re-analyzed our data and created a new scatter plot between the RhIP-ChIP-seq and ChIP-seq data of H2A.Z at known H2A.Z sites in gene bodies, exclusively . As this reviewer pointed out, we found that there is a fairly linear relationship between them in the gene bodies, indicating that the RhIP-ChIP-seq preferentially detects TSS-specific incorporation. This may have originated from the fact that H2A.Z can be exchanged more dynamically at TSS, as compared to gene bodies. Alternatively, as the histones that are evicted during transcription can be recycled , the lower correlation between RhIP-ChIP and ChIP of H2A.Z in gene bodies may reflect the lower frequency of de novo H2A.Z deposition and the higher frequency of H2A.Z recycling during transcription. We described these analyses on page 15, lines 301-304 and discussed them on page 22, lines 453-457.1. Torn\u00e9 J, Ray-Gallet D, Boyarchuk E, Garnier M, Le Baccon P, Coulon A, Orsi GA, Almouzni G. (2020) Two HIRA-dependent pathways mediate H3.3 de novo deposition and recycling during transcription. Nature Structural Molecular Biology 27(11):1057-1068. doi: 10.1038/s41594-020-0492-7.2. Jeronimo, C., Poitras, C., and Robert, F. (2019). Histone Recycling by FACT and Spt6 during Transcription Prevents the Scrambling of Histone Modifications.Cell Reports, 28(5), 1206\u20131218.e8. http://doi.org/10.1016/j.celrep.2019.06.097The image resolution of Figure 4A should be improved.We improved the image resolution of Figure 4A, from 144 dpi (previous) to 300 dpi (current). Please note that all of the bigwig files shown in this study were created with 1 bp intervals on the genome and not smoothed. This may be the reason why the image appears to have low resolution as compared with the smoothed bigwig files.b. Suppl. Figure 1.1 H3.3 distribution across the active and inactive genes were plotted in Suppl Figure 1. However, how active and inactive status of genes was defined, and which data was utilized for this analysis were not indicated under the Methods. These parameters and data source should be included.We thank the reviewer for this comment. We defined genes with 5 or more read counts in the RNA-seq data (GSE140768) as expressed genes and the rest as non-expressed genes. We now describe these parameters in the Methods on page 33, lines 698-700.Transcript levels for GAPDH and LNC02199 should also be indicated or the reader should be referred to a table containing transcription data (i.e. RNA-Seq).We have created the suggested table, and now show it in the new Figure 1\u2014figure supplement 1C.I also think that it would be helpful if the authors can comment on the efficiency of H3.3-HA ChIP compared to pull down of endogenous H3.3 by comparing RhIP-ChIP-seq and previously reported H3.3 ChIP-seq analyses.According to this suggestion, we assessed the signal-to-noise ratios as part of the efficiency of the methods. We have calculated and compared the S/N ratios of RhIP-ChIP-seq and the previously reported ChIP-seq of H3.3, and created new figures . We found that the S/N ratios are almost the same. We now describe these results on page 11, lines 199-201.c. The genomics analysis presented in Figure 3 is somewhat rudimentary, the signals from H2A and H2A.Z appear overall very correlated , albeit the correlation genome-wide calculated in Figure 3-S2 is 'medium'. The scatter plot could be shown better to see potentially different 'population of loci, some that correlate well and 'outliers'.We thank the reviewer for this important comment. First, we would like to explain that the analysis presented in Figure 3A shows the entire genome-wide pattern. On the other hand, the scatter plots in Figure 3\u2014figure supplement 2A were calculated at H2A.Z peaks detected in ChIP-seq. As this reviewer pointed out, H2A.Z and H2A are differently incorporated at H2A.Z peaks locally, as the correlation is moderate (Pearson correlation is 0.48). This is consistent with the results shown as the heatmap in Figure 4D, in which the H2A of RhIP-ChIP-seq showed no accumulation at the H2A.Z peaks of ChIP-seq. On the other hand, they are globally incorporated with certain similarity . We describe this on page 13, line 257 and page 16, lines 307-309.Judging from Figure 3B, it appears that there is a good correlation across broad chromatin states with the notable excavation of active TSS. This is in line with the known H2A.Z mechanism, but could be elaborated in plots a bit clearer. How do the profiles look across highly expressed and non-expressed genes?Thank you for this suggestion. We have recalculated our data and revised the aggregation plot to show the expressed and non-expressed genes separately . It is now clear that H2A.Z predominantly accumulated at the TSS of active (expressed) genes. We described this on page 15, line 296.The cell-cycle-synchronized plots are only summarized in the heatmap in Figure 3C,D. Example loci could be shown as in Figure 3A.In the revised manuscript, we show the example loci in the new Figure 3\u2014figure supplement 1B.2. It would be helpful to improve the interpretation of the data to include all existing caveats to the assay setup.Thank you for this suggestion. We addressed this comment, as described below.a. The new ATP addition experiments (figure 5E-F) are interpreted as if the only effect of ATP is on chromatin remodellers. It is well possible that by adding ATP in this conditions, additional factors  are being affected and responsible for the effect.We agree with this comment. We discussed the possible effects of ATP addition, on page 18 lines 353-355.b. The authors alternate setups where they either co-incubate different histone dimers, or they use a single histone dimer isoform. It is really unclear to the readers what is the reason for this and how does this affect the results/interpretation. In cases where a mixture of histone dimers were present , competition between the H2A/H2A.Z-X or H3.1/H3.3 dimers may take place, while in the others this competition is not present. This makes the comparison of the results quite challenging, and their conclusions unclear. This should be discussed at the very least, as it has implications on understanding the properties that control histone incorporation during RhIP.We agree with this reviewer\u2019s concern. We understand that the proper combination of histone chaperones and histone variants ensures the correct localizations of histone variants. However, if one histone variant is increased, then the excess histone variant may bind to unsuitable histone chaperones, leading to ectopic localization. Indeed, the overexpressed histone H3 variant, CENP-A, in cells aberrantly binds to the H3.3 chaperone, DAXX, leading to ectopic localizations (1). In this study, we performed the RhIP assay with two different histone variants simultaneously, which do not share the same chaperone. Therefore, if the amounts of added histone complexes are appropriate, then they would only interact with their defined chaperones and be deposited in a specific manner. As a result, we observed different staining patterns in the same nucleus when H3.1 and H3.3 or H2A/H2A.X and H2A.Z were co-incubated , which proved that they were incorporated into the chromatin by specific mechanisms, rather than non-specifically incorporated. These results also indicate that there is little to no competition under these conditions. Therefore, the results are unlikely to change if one or two histone variant(s) was/were used for the RhIP assay. However, as the reviewer mentioned, the competition assay using this system is worth trying, to analyze the overexpression situations of a specific histone variant. We added this discussion on page 20, lines 402-412.1. Lacoste N, Woolfe A, Tachiwana H, Garea AV, Barth T, Cantaloube S, Kurumizaka H, Imhof A, Almouzni G (2014) Mislocalization of the centromeric histone variant CenH3/CENP-A in human cells depends on the chaperone DAXX Molecular Cell 53(4):631-44. doi: 10.1016/j.molcel.2014.01.018.c. The RhIP-ChIP-seq protocol uses formaldehyde crosslinking instead of native mononucleosomal IP as used in Figure 1H, leaving room for interpretation if the pull-down histone is indeed incorporated into chromatin. Immunofluorescence also does not necessarily prove incorporation of histones into chromatin, since i.e. the fractionation in Figure 1-S2 shows that HIRA and CAF1 remain tightly bound to the isolated nuclei. Thus, accumulation of the epitope-tagged H3 in the nucleus of cells could merely mean that is bound to the histone chaperones present in the nucleus (competing away endogenous histones). It is not possible to discern from the data what the incorporated amount versus the chaperone-bound fraction of recombinant histone is.Thank you for this comment. This point is critical and must be clarified experimentally. We therefore performed an additional RhIP-immunostaining assay. We treated the cells with PBST containing 300 mM NaCl after the RhIP reaction, to wash out the nuclear proteins that are associated with chromatin, and then fixed the cells. In fact, CAF-1 and HIRA were no longer detected by the immunostaining; however, the exogenously added H3.1 and H3.3 were still detected in the permeabilized cells. This result indicates that the exogenously added H3.1 and H3.3 were mostly incorporated into the chromatin of the permeabilized cells in the RhIP assay, as shown by the native ChIP experiment. We added these data in the new Figure 1\u2014figure supplement 3 and described them on page 10, lines 175-184.d. The functional assessment of ANP32E knockdown lacks statistical analysis \u2013 clearly the quite robust knockdown  does not majorly abrogate TSS incorporation of H2A.Z. Is the difference statistically significant?-50. We would like to be cautious about mentioning this, because we included more than forty thousand loci for each in our analysis. With such a large number of samples, the p-value tends to be close to zero; therefore, it does not necessarily show practical significance (1).We thank the reviewer for pointing out this issue. We think the TSS incorporation of H2A.Z. significantly changed upon the ANP32E knockdown, with a p-value below 101. Lin, M., Lucas, H. C., Jr., and Shmueli, G. (2013). Too big to fail: Large samples and the p-value problem. Information Systems Research, 24(4), 906\u2013917. https://doi.org/10.1287/isre.2013.0480What is the explanation for the relatively small effect size?We agree with the reviewer that the reduction of TSS incorporation of H2A.Z is relatively small in the ANP32E knockdown cellular extract. We suggest the presence of a redundant mechanism, which is consistent with the previous report that ANP32E knockout mice did not exhibit any apparent effects on their viability (1), even though proper H2A.Z incorporation is essential for cell survival and proliferation. We also found that ATP promotes the H2A.Z depositions in the RhIP assay. Since ATP is essential for many biological processes, such as ATP-dependent chromatin remodeling and transcription, the H2A.Z deposition in the RhIP assay may require ATP-dependent processes. Taken together, the H2A.Z deposition in the RhIP assay is the net result of the ANP32E-mediated eviction and deposition of H2A.Z, and the replacement of pre-incorporated H2A with H2A.Z by ATP-dependent processes. This is our explanation for the limited effects of the ANP32E knockdown on the H2A.Z incorporation. We discussed this on pages 21-22, lines 443-457.1. Reilly PT, Afzal S, Wakeham A, Haight J, You-Ten A, Zaugg K, Dembowy J, Young A, Mak TW. (2010) Generation and characterization of the Anp32e-deficient mouse PLoS One, 5(10):e13597. doi: 10.1371/journal.pone.0013597.e. Lines 275-277. Please revisit the conclusion and make the statement clearer on H2A.Z incorporation and elimination.According to this comment, we rewrote the conclusion, on page 15, lines 284-286.We suggest adding these references:The authors make a thorough effort to place their method in the context of existing pulse-labeling methods, but Tet-ON based pulsing methods, which do give similar results have not been discussed: Mito, Y., Henikoff, J. G. and Henikoff, S. Genome-scale profiling of histone H3.3 replacement patterns. Nat. Genet. 37, 1090-1097 (2005); Yildirim, O. et al. A system for genome-wide histone variant dynamics in ES cells reveals dynamic MacroH2A2 replacement at promoters. PLoS Genet. 10, e1004515 (2014); Ha, M., Kraushaar, D. C. and Zhao, K. Genome-wide analysis of H3.3 dissociation reveals high nucleosome turnover at distal regulatory regions of embryonic stem cells. Epigenetics Chromatin 7, 38 (2014).Thank you for this suggestion. We have already cited the first paper on page 9 line 155, to refer to H3.3 incorporation in the genome. We newly added the second and third references to introduce the tetracycline-based methods, on page 6, lines 99-101."}
+{"text": "Maternal anemia continues as a global public health concern particularly in developing countries including Ethiopia. It is associated with an increased risk of maternal death, obstetric complications, preterm birth, and low birth weight. Even though maternal anemia is the commonest problem in Ethiopia, there is limited evidence on the spatial distribution and determinants of iron supplementation. Therefore, this study aimed to investigate the spatial distribution and determinants of iron supplementation among pregnant women in Ethiopia.p-value of less than 0.2 in the bivariable analysis were considered in the multivariable multilevel analysis. In the multivariable multilevel analysis, the Adjusted Odds Ratio (AOR) with 95% Confidence Interval (CI) was used to declare significant determinants of iron supplementation.A secondary data analysis was conducted based on the 2016 Ethiopian Demographic and Health Survey (EDHS) data. A total weighted sample of 7589 women was included for analysis. For the spatial analysis; ArcGIS version 10.6, and SaT Scan version 9.6 statistical software were employed to explore the spatial distribution, and to identify significant hotspot areas of iron supplementation in Ethiopia. For the determinant factors, multilevel logistic regression analysis was fitted to identify significant individual and community level determinants of iron supplementation. Deviance, Median Odds Ratio (MOR), and Intra-class Correlation Coefficient (ICC) were used for model comparison and for assessing model fitness. Variables with a p\u2009<\u20090.001). The SaTScan analysis identified a total of 271 significant clusters, of these 89 clusters were primary clusters located in the Southwest Somali and Central Oromia regions . ANC visit , community education [AOR\u2009=\u20091.31, 95%CI, 1.07, 1.59), media exposure , distance to health facility , region and household wealth index were statistically significant determinant factors of iron supplementation.The spatial distribution of iron supplementation was significantly varied across the country with Global Moran\u2019s index value of 0.3 (Iron supplementation among pregnant women were significantly varied across the country. Therefore, the finding of this study could help to design effective public health interventions targeting areas with low iron supplementation and maternal health services should be delivered in all areas of our country. Besides, public health programs should enhance iron supplementation through promoting ANC visits, media exposure, and giving special emphasis to marginalized and remote areas. Globally, the prevalence of anemia among pregnant women is estimated to be 41.8%. Of which half of this burden occurs due to iron deficiency or lack of iron tablet supplementation . Iron DeAnemia during pregnancy increases the risk of maternal death, obstetric complications, preterm birth, and low birth weight \u201310. TimeFactors associated with iron supplementation among pregnant women include advanced maternal age , 14, parSecondary data analysis was conducted based on the 2016 Ethiopian Demographic and Health Survey (EDHS) data. EDHS 2016 was the fourth survey conducted in Ethiopia. It is the most populous country in the horn of Africa. The country covers 1.1 million square kilometers and has a great geographical diversity, which ranges from 4550\u2009m above water level right down to the Afar depression to 110\u2009m below the water level. There are nine regional states (list of regions in bracket) and two city administrations (Addis Ababa and Dire Dawa) subdivided into 68 zones, 817 districts, and 16,253 kebeles  [www.measuredhs.com, after permission was secured through an online request by explaining the purpose of this study. The women\u2019s Individual data set was used. The raw data was collected from all parts of the country among pregnant women using a structured and pre-tested questionnaire.The study used data from the Ethiopian Demographic and Health Survey (EDHS) 2016. The EDHS 2016 used a two-stage stratified cluster sampling technique to select study participants using the 2007 Population and Housing Census (PHC) as a sampling frame. Stratification was achieved by separating each region into urban and rural areas. In total, 21 sampling strata have been created because the Addis Ababa region is entirely urban. In the first stage, a total of 645 Enumeration Areas (EAs)  proportional to EA size were selected. At the second stage, 28 households per each cluster were systematically selected . The stuThe surveys were based on a nationally representative probability sample that covered the entire country. Women aged 15\u201349\u2009years were interviewed using a woman\u2019s standard questionnaire and several variables like socio-economic and demographic information was collected from women and households.The target participants of this study were all reproductive age women living in Ethiopia prior to 5\u2009years of the survey and consequently, 15,683 reproductive age (15\u201349) women who were usual residents in the selected households before the survey were eligible and interviewed. Among those, women interviewed a weighted sample of 7589 pregnant mothers who had a pregnancy in the preceding 5 years were included in this study.Iron supplementation use during pregnancy, coded as \u201c1\u201d if a pregnant woman was supplemented with iron and \u201c0\u201d if not supplemented with iron during pregnancy, was our outcome variable. After reviewing different kinds of literature, for our study, both individual and community-level variables were considered as independent/explanatory variables.The individual-level variables include: maternal age , religion, wealth index was assembled using household asset data via Principal Components Analysis (PCA) to categorize individuals into wealth quintile , occupational status (employed and unemployed), family size, mass media exposure , women\u2019s education , and Antenatal Care (ANC) visit .The community-level variables were residence, region, perception of distance from the health facility, and community women education. Community-women education was created by aggregating the individual level factor women education since it was not directly found in the DHS data but known to a significant factor for the outcome variable. Since this variable was not normally distributed we used the median value to categorize it as low (communities with low proportions of women education) and high (communities with higher proportions of women education).www.measuredhsprogram.com), editing, recording, and analysis were done using STATA 14, ArcGIS 10.6, and SaTscan version 9.6. The data were weighted using sampling weight, primary sampling unit, and strata to restore the representativeness of the data and to get a reliable estimate.After downloading the data from the DHS program official database (p\u2009<\u20090.05) can lead to rejection of the null hypothesis (iron supplementation is randomly distributed) and indicates the presence of spatial dependence.For the spatial analysis, ArcGIS version 10.6 and SaTScan version 9.6 statistical software were used for exploring the spatial distribution, global spatial autocorrelation, spatial interpolation, and for identifying significant hotspot areas of iron supplementation. The Global spatial autocorrelation was done to assess whether the spatial distribution of iron supplementation is random or not. The spatial autocorrelation  is the correlation coefficient for the relationship between a variable and its surrounding values. Moran\u2019s I is a spatial statistics used to measure spatial autocorrelation by taking the entire data set and produce a single output. Moran\u2019s I value ranges from-1 to 1. A value close to 1 shows a strong positive spatial autocorrelation whereas a value close to \u2212\u20091 shows a strong negative spatial autocorrelation. If Moran\u2019s I close to 0, it indicates that there is no spatial autocorrelation. A statistically significant Moran\u2019s I value  and Median Odds Ratio (MOR) were computed to measure the variation between clusters/to assess the community level variability, and Proportional Change in Variance (PCV) was calculated to assess how much iron supplementation use was explained by the final model , 20. Foup-value <, 0.05 were considered as statistically significant. Adjusted Odds Ratio (AOR) with their corresponding 95%CI was determined to identify factors associated with iron supplementation use among pregnant women. Multi-collinearity was also checked using the Variance Inflation Factor (VIF). Accordingly, all variables had VIF\u2009<\u20095 and tolerance greater than 0.1 indicating that there is no multi-collinearity.In the multivariable multilevel logistic regression analysis variables with a A total of 7589 respondents were included in the study. Above one fourth 2165, (28.5%) of the respondents were within the age range of 25\u201329\u2009years. About 1654 (21.8%) respondents were from households with poorer wealth quantile category. The majority, 4406 (58%) of the respondents perceived distance from the health facility as a big problem whereas only 2414 (32%) had four or more ANC visits. Concerning media exposure, 2564 (33.8%) study participants had media exposure. Of all the respondents, 662 (87.2%) were rural dwellers. Regarding region, about 3129 (41.2%) were Oromia whereas only 33 (0.4%) were from Dire Dawa. Moreover, about 4799 (63.2%) of participants were from communities with lower community levels of female education  and Somali (27.7%) regions respectively Fig.\u00a0.Fig. 1Rp\u00a0<\u20090.001)  Fig.\u00a0.Fig. 2SP-value<\u20090.01). Whereas the significant cold spot areas (areas with high iron supplementation) were located in Tigray, North Amhara, East Addis Ababa, and North West Harari regions  were located in the Northeast Somali, South Afar, North West Gambela, West, and east SNNPR, and Southwest Oromia regions  clusters. The primary clusters were located in southwest Somali and central parts of the Oromia region centered at 5.330795\u2009N, 41.837597 E of geographic location with 441.87\u2009km radius, a Relative Risk (RR) of 1.35 and Log-Likelihood ratio (LLR) of 66.68, at The intraclass correlation within the null model indicated that 27% of the variability in iron supplementation was attributable to community-level variability. Also, the median odds ratio which was 3.3 in the null model indicates that there was a variation of iron supplementation between clusters. If we randomly select women from two different clusters women at the cluster with higher iron supplementation had 3.3 times higher odds of experiencing iron supplementation as compared with women at the cluster with lower iron supplementation. Moreover, as shown by PCV in the final model, about 70% of the variability in iron supplementation was explained by both individual and community-level factors  was the best-fitted model for this study because this model had a high likelihood and low deviance.In the multivariable multilevel logistic analysis, individual-level factors like wealth index, ANC visit, women\u2019s education, and media exposure were found to be significantly related to the odds of iron supplementation. Among the community-level factors region, and perception of distance from the health facility were significantly related to iron supplementation.Women who attended a minimum of four ANC visits had 3.59 times  higher odds iron supplementation use as compared to those they didn\u2019t attend the minimum requirement of ANC visit (<\u20094 ANC visit). The odds of iron supplementation were 1.28 times  higher among those mothers who had media exposure as compared to their counterparts. Those mothers who were from the poorer, middle, and richer households had 1.37 , 1.30 , and 1.37  times higher odds of iron supplementation as compared with women from poorest households. Regarding the perception of distance from the health facility, women who perceived distance from the health facility had 1.31  times higher odds of iron supplementation as compared to their counterparts.With adjusting other covariates, women\u2019s in Tigray, Afar, Amhara, and Dire Dawa regions were 5.29 , 1.61 , 2.04  and 1.52  times higher iron supplementation use than that of women\u2019s in Somali region, respectively.Moreover, women with primary and higher education were 1.24 [AOR\u2009=\u20091.07, 95%CI, 1.07, 1.44), and 1.59  times higher odds of iron supplementation as compared to those women with no education, respectively Table .The spatial analysis revealed that the spatial distribution of iron supplementation among reproductive-age women was significantly varied across the country. The significant hotspot areas with low iron supplementation were located in Northeast Somali, South Afar, North West Gambela, West and East a part of SNNPR, and Southwest Oromia regional states were statistically significant hot spot areas for iron supplementation (low iron supplementation) and the SaTscan analysis identifies significant primary (Most likely clusters) clusters in Southwest Somali and central part of Oromia region. The possible explanation might be due to the lowest ANC utilization rate was reported in hot spot areas as compared to cold spot areas lowest ANC service utilization in the border areas of the country . This miANC visits, community women\u2019s education, region, media exposure, household wealth index, and perception distance to health facility were associated factors of iron supplementation use among pregnant women in Ethiopia.ANC visits were significant determinants of iron supplementation. This was consistent with the study findings reported in the study is supported by a study done in Ethiopia , TanzaniMedia exposure is positively associated with iron supplementation among pregnant women. This study was supported by a study in Asia . This isThe region is also significantly associated with iron supplementation among pregnant women. Those pregnant women from Tigray, Afar, Amhara, and Dire Dawa regions had a higher chance of taking the iron tablet as compared to the Somali region. This could be explained by the difference in the coverage of ANC utilization across these regions, lower ANC visit was observed in the Somali region compared to other regions . This isThe household wealth index is another important factor of iron supplementation among pregnant women. Mothers who were in poorer, middle, and richer wealth quantile categories higher chance of taking iron supplementation as compared within the poorest wealth quantile. This study finding is consistent with a study finding reported in Senegal . The posEthiopia has performed amazingly to decrease maternal and child health burden. Particularly, strong strategic leadership and political guarantee to the creation and delivery of health programs that drive primary care are especially significant for maternal and child health care. Anemia among pregnant women had a double burden and it is a very serious problem. To prevent this problem administering iron tablets for pregnant women is a very critical issue to create a healthy community. In Ethiopia, the coverage of iron supplementation during pregnancy is still low and has not fulfilled the World Health Organization (WHO) standard recommendations. Besides, iron supplementation among pregnant women varies across Ethiopia. Therefore, investing more in the determinant factors and making an intervention on the high-risk areas by designing different policies and strategies very crucial issue to improve maternal and child health in Ethiopia.The strengths of this study, first, the study was based on nationally representative weighted data and can be generalized at the national level. Second, the use of spatial analysis to explore the spatial distribution and significant hotspot areas of iron supplementations and the use of multilevel analysis. The limitations of this study were, it shares the limitations of cross-sectional studies. Besides, self-reported data were included in this study like the perception of the distance to health facility lead to self-reported bias.This study investigated that the spatial clustering of poor iron supplementation among pregnant women was found in North East Somali, South Afar, North West Gambela, Western, and Eastern parts of SNNPR and Southwest Oromia regions. Community education, household wealth index, ANC visit, region, media exposure, and perception of distance to a health facility were significant predictors of iron supplementation among pregnant women. To enhance iron supplementation, targeted intervention should be taken on these identified high-risk areas. Intervention programs that can increase the frequency of ANC visits, education level, and use of mass media need to be done."}
+{"text": "Thirty years after the transition period, starting from 1989, Central and Eastern European countries (CEECs), representing one-fifth of the entire European population, share many historical, societal, political, economic, and cultural characteristics. Although accumulating data on coronary heart diseases and cerebrovascular diseases support these observations, in the case of peripheral arterial disease, data are scarce. The present review attempts to summarise the shreds of data that may highlight a divide in this field between CEECs and Western European countries. Disparities in risk factors and peripheral vascular care across Europe seem to be tangible and can be seen as a signal of existing differences. Improvements in research and development and the collection and cross-border share of scientific data are essential to initiate and facilitate convergence in this field. The history of the European Union (EU) since the 1957 signing of the Treaty of Rome by the six founding members , may be seen as waves of successful enlargements. From 1973 to 1995, nine other members joined , forming the EU15 countries. After a long process of cooperation and preparation, an unpreceded accession took place with the integration of several countries from the Central and Eastern European Region. In the first wave of accession in 2004, eight states  joined. Romania and Bulgaria followed them in 2007, and Croatia joined in 2013, leading the formation of EU13 countries, including Malta and Cyprus. The latter countries represent a different evolution compared with the former socialist states. Only fifteen years after the transition from a more or less totalitarian political regime, planned economy, and socialism towards a democratic regime, a market economy, and capitalism, these Central and Eastern European Countries (CEECs) were markedly challenged in many aspects of reshaping their system. The population of CEECs represents one-fifth of the entire population of the EU. In the 1990s, several studies had already indicated that this population exhibited poorer health and shorter life expectancy than the population of the Western European countries (WECs) [Around the accession dates of the CEECs, data from this region suggested apparent disadvantage in many aspects of health, including life expectancy and mortality due to cancer or external causes. Rate of deaths due to cardiovascular disease (CVD), ischaemic heart disease, or cerebrovascular disease was also higher in CEECs than in WECs . The amoIn the present review, we seek to summarise data on a potential East\u2013West divide across Europe in the peripheral vascular field by  assessinA comprehensive narrative electronic search was performed by the authors using the search engine PubMed  to access databases from MEDLINE, OLDMEDLINE, and PubMed Central. We used a combination of the following search terms, including appropriate synonyms: European health divide AND peripheral artery disease.An array of reports highlighting the existence or, in some cases, the absence of disparities in the traditional risk factors for vascular diseases between CEECs and WECs is available. Demographic characteristics are important factors that are associated with atherosclerosis. In this sense, while the entire European population shows shrinking and ageing, a marked divide is discernible in the long-term population trends of WECs and CEECs. WECs are experiencing a rising population due to a mild natural population increase and positive net migration from CEECs and non-EU countries. In contrast, in CEECs, a fast shrinking of the population is observed due to lower fertility rates and significant negative net migration. Emigration from these countries is mainly of the working-age population, driven by opportunity differentials , and impacts both the size and the age structure of these populations . AlthougThere is a consensus that smoking represents the single largest avoidable health risk in Europe . AccordiIn addition, the loss of life attributable to premature death caused by tobacco use is much higher in CEECs than in WECs. This was also observed for rate of deaths caused by CVD and cancer. Moreover, the highest value of disabled life burden (YDL), expressed in years that was attributable to smoking-related CVD across the globe was found in Eastern Europe in 2016. In Central Europe, a small reduction was seen in men during the same period. However, the values of YDL were lower in WECs in both sexes . In a reElevated cholesterol level is a well-established risk factor for atherosclerotic vascular diseases and requires effective lifestyle modification, changes in diet, and aggressive lipid-lowering therapy . Based oBased on the data from the International Diabetes Federation, in 2019, the age-adjusted prevalence of diabetes in Europe was 6.3% on average, which ranged from 4.9% to 9.2% across the different countries, emphasising a marked variation. In CEECs and WECs, the prevalence of diabetes was 7% vs. 9%, respectively [An analysis of the worldwide trends in blood pressure from 1975 to 2015 (1479 studies that had measured the blood pressures of 19.1 million adults) showed that the highest worldwide blood pressure levels have shifted from high-income countries to low-income countries in South Asia and sub-Saharan Africa, while blood pressure has been persistently high in the CEEC region. Central and Eastern Europe, sub-Saharan Africa, and South Asia had the highest mean blood pressures in 2015 . Not onlAccumulating observations support that the socioeconomic status of the individual and their environment profoundly influence the cardiovascular prognosis ,24. ThusIn these dimensions, several findings show disparities between CEECs and WECs. In the study of Health, Alcohol and Psychological factors in Eastern Europe (HAPIEE), six psychosocial and socioeconomic factors  were associated with increased risk of death from CVD . The difIn CEECs, health system outcomes are thought to be influenced by a wide range of economic, political, social, and systemic factors that may contribute to the overall risk of vascular conditions .Using Donabedian\u2019s framework, which defines quality in health care as a function of three domains  , furtherRegarding structure , according to a recent report by the European Commission, marked inequalities in access to health care across Europe are discernible. This simplified concept of access includes additional interlinked dimensions, such as (a) population coverage, (b) affordability of health care (cost-sharing), (c) basket of care, and (d) availability of health care  .In the comparison of CEECs with WECs, a significant difference can be seen in the public health expenditure of the societies. The CEEC region shows a continuous lag in health expenditure, as indicated by an analysis of the period from 1994 to 2014 . In 2017No validly comparable data are found on spending on vascular care in CEECs and WECs. However, many other areas of the healthcare service show an East\u2013West divide (worse in CEECs), including lack of availability of health professionals due to reduced numbers of professionals entering the labour market, or medical professionals leaving to work in more attractive areas (particularly urban centres) or to work abroad or in the private or non-contracted sector, regional disparities in health services, underfunding of the health system, and staff shortages in the publicly funded sector . No in-dIn this sense, the free mobility of healthcare professionals in Europe seems to be at odds with the WHO global code of practice on the international recruitment of health personnel, which emphasises, as a guiding principle, that migration should equitably strengthen health systems (Art 3.2). There is more evidence for the drawbacks of mobility for the healthcare systems in the source countries than for its merits, but both the destinations and the sources experience positive and negative effects . This coProcess indicators reflect how vascular service is delivered and what is being done to improve the outcomes. Several features of these metrics support their use in service quality assessment . The comOur report from Hungary, which included a rough comparison, revealed that the volume of lower limb revascularisation procedures per capita is a fraction (50%) of the similarly defined procedures performed in the more developed WECs. In addition, according to the principle of the endovascular-first strategy, the characteristic predominance of endovascular procedures took place ten years later in Hungary compared with WECs . This la6, respectively) [However, marked heterogeneity can be seen on this regards in WECs. In addition, as previous VASCUNET reports revealed, the average rate of popliteal artery aneurysm repairs per capita was lower in Hungary and in Serbia than in WECs (5.4 vs. 7.4 per 10ctively) . Regardictively) .In conclusion, a comprehensive comparison of data on process indicators of peripheral vascular care in WECs and CEECs is not feasible due to the scarcity of information. However, available data show a palpable disparity, and these data can be considered a signal of unwarranted variation between countries with room for improvement in CEECs. This was especially emphasised by the number of vascular procedures per capita and technological development.Although process indicators seem more appropriate to assess the specific quality of care, outcome measures serve as hypothesis-generating tools that may contribute to the better understanding of complexity of vascular care.One of the most solid outcome measures of CVD is the mortality associated with it. While CVD mortality shows a remarkable decline in Europe, in CEECs it is notably higher. Not only the CVD death rates are higher, but they occur in younger ages. Beneficial trends in WECs are thought to be the consequences of combined effects of lifestyle changes, public policy, and new, more effective medical treatments for CVD . This asWhile an abundance of data can be found on the mortality of patients with peripheral arterial occlusive disease , lower l5. These values are 42 per 105 in Hungary [5 in Slovakia [5 in Poland [5 in Romania [5 [Lower extremity amputations serve as an essential distal outcome measure of vascular care. While several reports on and comprehensive analyses of amputation statistics from the WECs have emerged in the past decade, similar data from the CEECs are sparse . Moreove Hungary ,56, 29 pSlovakia , 38 per n Poland , and 43  Romania . In contmania [5 ,59 , and outcomes. Considering data collection, it became evident that a meaningful comparison is significantly hindered by the lack or paucity of robust scientific data on vascular care from CEECs. Although the CEECs successfully adopted cohesion policy instruments of the EU in many fields, they are still somewhat behind in the development of science and innovation. As a consequence, a lag in scientific research and development and, specifically, scientific reporting from CEECs challenged our efforts. The disparity in scientific publication activity, measured by any metrics , accounts for a spatial unbalance of data . UnderreBeyond the support and development of HTA in CEECs, the facilitation of scientific data gathering and sharing in this region seems to be essential to explore disparities. In this regard, research and reports on national data, as well as cross-European scientific collaborations using large data from administrative or clinical registries, are of primary importance ,67.While our exploratory analysis revealed a marked disparity on more aspects of vascular care between WECs and CEECs, more research and a systematic review of the available literature would be required. In addition, differences among CEECs, and time trends, also remain to be explored.While the EU Member States have the main responsibility for health policy and the provision of health care, there are areas where addressing common challenges at the EU level may provide added value . EU instIn this comprehensive narrative review of the literature, a marked disparity between Western vs. Central and Eastern European Countries was found in terms of healthcare provided to patients with cardiovascular disease, emphasising an unwarranted variation. While there are data suggesting that Central and Eastern European Countries are underprivileged in different domains of vascular care, it also became evident that there is a distinct paucity of research data generated in those countries."}
+{"text": "To analyse nationwide changes in neurointerventional center size of all German hospitals performing mechanical thrombectomy (MT) in stroke patients from 2016 to 2019. Furthermore, we assessed cross-district patient migration for MT for the first time using hospitals\u2019 structured quality reports and German Diagnosis-Related Groups data in 2019.n\u00a0=\u200936) to 2019 (n\u00a0=\u200971), and these neurointerventional centers performed 71% of all MT procedures in 2019. The overall increase in MT procedures was largely driven by these high-volume neurointerventional centers with ability to perform MT 24/7 . The highest cross-district patient mobility/transfer of stroke patients for MT was observed in districts adjacent to these high-volume neurointerventional centers with existing neurovascular networks.Number of hospitals performing more than 100 MT procedures/year doubled in Germany from 2016 (The substantial increase in MT procedures observed in Germany between 2016 and 2019 was almost exclusively delivered by high-volume stroke centers performing more than 100 MT procedures per year in established neurovascular networks. As there is still a reasonable number of districts with low MT rates, further structural improvement including implementation of new or expansion of existing neurovascular networks and regional tailored MT triage concepts is needed. We compared data from 2019 with our last analysis in 2016, in which a detailed description of the methods used can be found [Provision of mechanical thrombectomy (MT) 24/7 for all eligible patients with acute ischemic stroke (AIS) due to large brain vessel occlusion imposes intensive human and technical resource requirements including i.e. possibility to perform multimodal stroke imaging, organization of teleradiology networks, interregional medical service, and organised interplay between regional stroke units and comprehensive stroke centers . We thern\u00a0=\u200936) to 2019 (n\u00a0=\u200971), and these centers performed almost three quarters (71%) of all MT procedures in 2019  in patients with admission or in-hospital diagnosis of an AIS based on the structured quality reports, compared to 161 hospitals in 2016. The proportional distribution of MT procedures performed was categorized into seldom (5\u201314 MT/year), occasional (15\u201349 MT/year), regular (50\u2013100 MT/year), frequent (100\u2013200 MT/year) and high volume (>\u2009200 MT/year) hospitals , and cross-district patient migration for MT was substantially higher in districts directly adjacent to hospitals performing MT on a frequent or high volume level, resulting in a continuous unequal access to and/or substantial longer transfer distances in AIS patients eligible for MT. This finding is most likely the main reason for the observed high regional variability of MT rates (from 1.4 to 15.2%) in German AIS patients in 2019 1 in 2016."}
+{"text": "In this study, we compare the predictive value of clinical scoring systems that are already in use in patients with Coronavirus disease 2019 (COVID-19), including the Brescia-COVID Respiratory Severity Scale (BCRSS), Quick SOFA (qSOFA), Sequential Organ Failure Assessment (SOFA), Multilobular infiltration, hypo-Lymphocytosis, Bacterial coinfection, Smoking history, hyper-Tension, and Age (MuLBSTA) and scoring system for reactive hemophagocytic syndrome (HScore), for determining the severity of the disease. Our aim in this study is to determine which scoring system is most useful in determining disease severity and to guide clinicians. We classified the patients into two groups according to the stage of the disease (severe and non-severe) and adopted interim guidance of the World Health Organization. Severe cases were divided into a group of surviving patients and a deceased group according to the prognosis. According to admission values, the BCRSS, qSOFA, SOFA, MuLBSTA, and HScore were evaluated at admission using the worst parameters available in the first 24\u00a0h. Of the 417 patients included in our study, 46 (11%) were in the severe group, while 371 (89%) were in the non-severe group. Of these 417 patients, 230 (55.2%) were men. The median (IQR) age of all patients was 44 (25) years. In multivariate logistic regression analyses, BRCSS in the highest tertile  was determined as an independent predictor of severe disease in cases of COVID-19. In multivariate analyses, qSOFA was also found to be an independent predictor of severe COVID-19 . The area under the curve (AUC) of the BRCSS, qSOFA, SOFA, MuLBSTA, and HScore was 0.977, 0.961, 0.958, 0.860, and 0.698, respectively. Calculation of the BRCSS and qSOFA at the time of hospital admission can predict critical clinical outcomes in patients with COVID-19, and their predictive value is superior to that of HScore, MuLBSTA, and SOFA. Our prediction is that early interventions for high-risk patients, with early identification of high-risk group using BRCSS and qSOFA, may improve clinical outcomes in COVID-19. COVID-19, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a pandemic infectious disease that causes morbidity and mortality. The prognosis of the disease may range from complete well-being to severe acute respiratory distress syndrome or death. Clinicians use different scoring systems to predict the prognosis of the disease, but there is no proven prognostic scoring system yet. The fact that many clinical, hematological, and biochemical parameters change during the inflammation process of COVID-19 suggests that it is possible to form an idea about the prognosis of the disease with scoring systems. Rapid and accurate clinical identification of patients infected with SARS-CoV-2 who are at risk of poor outcomes is a priority.1. The SOFA score was originally determined to focus especially on organ failure and morbidity in order to show morbidity severity2. From the patient\u2019s baseline risk, if the SOFA score is 2 or higher, the mortality risk is approximately 10% in relation to the general hospital population with presumed infection. We can also assume that risk of death is increased by 2 to 25 times compared to patients with a SOFA score of less than 23. A SOFA score of\u2009\u2265\u20093 signifies organ failure for the relevant system4. For patients who have higher SOFA scores and lymphocytopenia on admission, there is a greater risk of developing severe COVID-19 disease2.The Sequential Organ Failure Assessment (SOFA) score has value as an important diagnostic marker for sepsis and septic shock1. In a study where qSOFA was calculated in the emergency department for patients with suspected infection, the mortality rate was 3% for patients with qSOFA scores of\u2009\u2264\u20091 compared to 24% for patients with qSOFA scores of\u2009\u2265\u200925. However, Ferreira et al. reported that qSOFA was not significant for identifying a COVID-19 patient with poor outcomes typical of sepsis6.The quickSOFA (qSOFA) system has also been developed as a bedside clinical scoring system to classify patients clinically according to the severity of sepsis. If the qSOFA score is 2 or higher, it may be predictive of poor prognosis8. In one study, the neutrophil-to-lymphocyte ratio (NLR) was found to be significantly and positively correlated with MuLBSTA scores in patients with COVID-199.The MuLBSTA score  can be used as an early mortality predictor among patients with viral pneumonia, and it has been suggested that it may play a role in predicting early mortality for COVID-19 patients10, which is usually known as macrophage activation syndrome (MAS) when it is secondary to a rheumatic disease11. Recently, the HScore has been suggested to evaluate critically ill COVID-19 patients to be able to start immunosuppression at the right time, because cytokine assays are expensive and not always available in general practice12. On the other hand, some authors have said that it may not be appropriate to use the HScore to guide the use of immunomodulatory therapy14.Fardet et al. developed the HScore to help clinicians in the differential diagnosis of reactive hemophagocytic syndrome (RHS)16.During the management of COVID-19 patients, intensivists have had limited guidance on management. Researchers created the Brescia-COVID Respiratory Severity Scale (BRCSS) to help clinicians distinguish the severe form of COVID-19 from non-severe cases by sharing experiences between physicians of different specialties. The BCRSS score is suggested to be\u2009\u2265\u20093 for tocilizumab treatment19. Furthermore, it is crucial to distinguish severe from non-severe COVID-19 at admission. To date, there is no antiviral treatment proven to be effective for COVID-19. That is why it is important to recognize and closely monitor high-risk patients to perform the necessary interventions on time. In this study, we compare the predictive values of the clinical scoring systems that are already in use in patients with COVID-19, namely the BCRSS, qSOFA, SOFA, MuLBSTA, and HScore, for determining the severity of the disease. Our aim in this study is to determine which scoring systems are most useful in determining disease severity and to guide clinicians.Since intensive care units are costly units with limited numbers of beds, proper use of resources is required. The use of scoring systems is required in intensive care units to reduce costs, use resources effectively, and guide clinical decisions and practices2, d-dimer, fibrinogen, complete blood count, biochemical parameters, CRP, sedimentation rate, and thorax CT findings at admission to the emergency department. Demographic, clinical, laboratory, imaging examination, treatment, and outcome data were collected using a standardized case-report form. All data were checked by 2 physicians (EG and IA), and then a third researcher (SB) determined any differences in interpretation between the 2 primary reviewers.In this study, 417 patients older than 18\u00a0years of age who were hospitalized in the internal diseases and infectious diseases wards of Ankara City Hospital due to COVID-19 were evaluated retrospectively. Patients younger than 18\u00a0years old, patients with active malignancy, and pregnant women were excluded from the study. Ethical approval of the study was obtained from the Ethics Committee of Ankara City Hospital . The age, gender, comorbidities, and medications of the patients were recorded, as well as fever, respiratory rate, SpO21.All of the patients included in this study were tested for influenza A virus, influenza B virus, respiratory syncytial virus, and parainfluenza virus, and these infections were excluded by serological test. Nasal and/or pharyngeal swab specimens were collected from all patients, and reverse transcriptase-polymerase chain reaction assays were performed. In our tertiary medical facility, the patients received the diagnosis either by positive polymerase chain reaction (PCR) for COVID-19 or by fulfilling any 4 of 5 clinical criteria including fever, respiratory symptoms, history, compatible chest imaging findings, and decreased lymphocyte count22. Severe cases were divided into a group of surviving patients and a group of deceased patients according to their final prognosis.In this study, we classified the patients into two groups according to the stage of the disease (severe and non-severe) and adopted interim guidance of the World Health Organization23.Hospitalization, treatment, management, and discharge of the patients were decided according to the guidelines of the Turkish Ministry of Health16.Five scores were included in this analysis to understand the relation between the severity groups of the COVID-19 patients, including the BCRSS, qSOFA, SOFA, MuLBSTA, and HScore. According to admission values, the BCRSS, qSOFA, SOFA, MuLBSTA, and HScore were evaluated at admission using the worst parameters available in the first 24\u00a0h16.In our study, it was aimed to calculate the sensitivity and specificity values according to the cut-off values in the literature, as well as finding the best cut-off value of the scores. The cut-off values in the literature were used for these calculations, and the BCRSS, qSOFA, SOFA, MuLBSTA, and HScore values were 3,\u2009\u2265\u20092,\u2009\u2265\u20092,\u2009>\u200912, and\u2009>\u2009169 in the calculations, respectively3. However, since its validity was determined in patients with non-sepsis organ dysfunction, it was later renamed \u201cSequential Organ Failure Assessment\u201d (SOFA). Six organ systems  are scored between 1 and 4 points, with a total score between 6 and 243. The score is based on the worst value in the last 24\u00a0h. If there is a value that cannot be measured, scoring is performed according to the closest measurement value.The Sepsis-Related Organ Failure Assessment score was developed by the European Society of Intensive Care Medicine to define the degree of organ failure due to sepsis5. QuickSOFA (qSOFA) is a bedside clinical score to clinically categorize a septic patient. In out-of-hospital, emergency department, or general hospital ward settings, adult patients with suspected infection can be rapidly identified as being more likely to have poor outcomes typical of sepsis if they have at least 2 of the following clinical criteria of qSOFA: respiratory rate of 22/min or greater, altered mentation, or systolic blood pressure of\u2009\u2264\u2009100\u00a0mmHg. This definition was later confirmed in the emergency department for patients with suspected infection5.The Sepsis-3 definitions have facilitated earlier identification of patients at risk of developing sepsis for treatment8. All parameters defined in the MuLBSTA score are clinically easy to obtain, and it is recommended that all examinations be performed on admission. The MuLBSTA score was developed as a marker that shows the risk in the clinical prediction of patients specifically diagnosed with viral pneumonia8. The risk categories and death rates for each grade are suggested as follows: MuLBSTA 0\u201311, low risk, mortality of 5.07%; and MuLBSTA 12\u201322, high risk, mortality of 33.92%8.The MuLBSTA score is a scoring system developed to predict 90-day mortality in viral pneumonia patients with multilobular infiltration, lymphopenia, bacterial coinfection, smoking history, hypertension, and age of\u2009\u2265\u200960\u00a0years10. The best cut-off value in hemophagocytic syndrome (HPS) for the HScore was 169, and it exactly classified 90% of patients with 93% sensitivity and 86% specificity10.Nine variables are used for the HScore as follows: three clinical variables , five biochemical variables , and one cytological variable (findings of hemophagocytosis in the bone marrow)16. Since the beginning of the COVID-19 pandemic in Lombardy, a daily multidisciplinary meeting has been held to coordinate patient care and transfer between units. Participants of these meetings have included intensive care, infectious diseases, chest diseases, immunology, rheumatology, and internal medicine specialists. The BRCSS uses clinical criteria to rank non-intubated patients. It assigns patients a score of 0\u20133 based on 4 test criteria: (1) dyspnea or staccato speech, defined as being unable to count rapidly up to 20 after a deep breath, at rest, or during minimal activity, such as sitting up in bed, standing, talking, swallowing, or coughing; (2) respiratory rate of\u2009>\u200922 breaths/min; (3) PaO2 of\u2009<\u200965\u00a0mmHg or SpO2 of\u2009<\u200990% with supplemental oxygen; and (4) significant worsening of chest radiography. In intubated patients, PaO2/FiO2 below 150\u00a0mmHg determines whether the score is 5 or above, and the use of adjunctive therapies including prone positioning and neuromuscular blockade agents further increases the score16. The BRCSS may be useful for practicing clinicians to gauge the clinical improvement or worsening of patients infected with SARS-CoV-19. It may be used in other countries, as well15.The Brescia-COVID Respiratory Severity Scale (BRCSS) was created by sharing experiences among physicians of different specialties2) test was used to compare qualitative data. The consistency of the data with normal distribution was evaluated by the Kolmogorov\u2013Smirnov and Shapiro\u2013Wilk tests. As a result, the median was used because not all of the data were homogeneously distributed. The Mann\u2013Whitney U test was used to compare the data not consistent with normal distribution. While the receiver operating characteristic (ROC) curve method was used to determine the discrimination of the variables, binary logistic regression was used to determine the risk rates. The variables for which the unadjusted p-value was\u2009<\u20090.10 in logistic regression analysis were identified as potential risk markers and included in the full model. We reduced the model by using backward conditional elimination multivariate logistic regression analyses and eliminated potential risk markers by using likelihood ratio tests. The clinically valuable ones of the correlations were added.The data were analyzed using SPSS for Windows version 25.0  and MedCalc 15.8 . While frequency, percentage, mean, standard deviation, median, and IQR were used as descriptive statistical methods, the chi-square  were in the severe group, while 371 (89%) were in the non-severe group. Of these 417 patients, 230 (55.2%) were men. The median (IQR) age of all patients was 44 (25) years  Table . HemogloThe median (IQR) SOFA score was 3 (3) in the severe patient group and 0 (1) in the non-severe patient group (p\u2009<\u20090.0001). The median (IQR) qSOFA score was 2 (2) in the severe patient group and 0 (0) in the non-severe patient group (p\u2009<\u20090.0001). The median (IQR) MuLBSTA score was 11 (6.5) in the severe patient group and 5 (6) in the non-severe patient group (p\u2009<\u20090.0001). The median (IQR) HScore was 75 (47.25) in the severe patient group and 44 (48) in the non-severe patient group (p\u2009<\u20090.0001). While the median (IQR) BRCSS was 3 (4) in the severe patient group, it was 0 (1) in the non-severe patient group (p\u2009<\u20090.0001).Demographic data, clinical data, laboratory parameters, and scores of patients compared in terms of survival versus death are shown in Table Serum aspartate aminotransferase, serum alanine aminotransferase, lactate dehydrogenase, C-reactive protein, sedimentation rate, ferritin concentration, and white blood cell count values were significantly higher in the severe-deceased patient group compared to the severe-surviving group  Table . PlateleThe median (IQR) SOFA score was 8 (7) in the severe-deceased patient group and 2 (1) in the severe-surviving patient group (p\u2009<\u20090.0001). The median (IQR) qSOFA score was 3 (0) in the severe-deceased patient group and 1 (1) in the severe-surviving patient group (p\u2009<\u20090.0001). The median (IQR) MuLBSTA score was 15 (5) in the severe-deceased patient group and 9 (6) in the severe-surviving patient group (p\u2009<\u20090.002). The median (IQR) HScore was 96 (77) in the severe-deceased patient group and 74 (45) in the severe-surviving patient group (p\u2009<\u20090.011). While the median (IQR) BRCSS was 7 (1) in the severe-deceased patient group, it was 3 (0) in the severe-surviving patient group (p\u2009<\u20090.0001).A multivariate logistic regression model for severe disease consisting of the variables of age, any comorbidity, SOFA, qSOFA, MuLBSTA, HScore, and BRCSS is shown in Table The values of these five scores in all patients with severe cases of COVID-19 were calculated, and the predicted values of these scores were compared in ROC analysis 2. Although higher SOFA score at admission was identified as an independent predictor for developing severe SARS\u2011CoV\u20112 infection in some research, we could not detect SOFA as an independent predictor when we evaluated it along with other scores in multivariate analysis26.The SOFA score has great value to show the severity of multiple organ dysfunction27. In a study conducted by Jang et al., the qSOFA score was found to be significantly higher in critically ill patients, similar to our study28. Another study reported that the qSOFA scores of ventilated patients with COVID-19 were 1 or less in 27 patients (87%) and only 4 patients had a 2-point qSOFA, while none had 3 points. Therefore, in the study of Ferreira et al., the authors anticipated that the qSOFA was not appropriate to identify COVID-19 patients having poor outcomes typical of sepsis6. Another study about COVID-19 showed that the risk factors significantly associated with admission to the intensive care unit were a qSOFA score above 0  upon multivariate analysis29. In our study, qSOFA was found to be an independent predictor of severe disease in COVID-19 cases upon multivariate analyses . The qSOFA cut-off value of\u2009\u2265\u20091 had the highest AUC  after the BRCSS in predicting severe disease.Compared to the SOFA score, the qSOFA is a simpler and more useful criterion to indicate severity prediction for in-hospital mortality . It was also reported that qSOFA was statistically superior to SOFA or change in SOFA score in non-ICU patients7. In a study by Xiao et al., the MuLBSTA score was found to be more significant in determining the severity of COVID-19 infection compared to other scores, and it was stated that it could play a role in determining mortality in the early stages of the disease30. In our study, the MuLBSTA score in severe cases was found to be significantly higher than those of non-severe patients. In addition, in our study, the median MuLBSTA score was found to be 15 in severe-deceased patients, while it was 9 in severe-surviving patients (p\u2009=\u20090.002). In a study in which patients with COVID-19 were evaluated according to MuLBSTA scores, the score was 6.73\u2009\u00b1\u20092.29 in the non-ARDS group and 8.94\u2009\u00b1\u20092.69 in the ARDS group (p\u2009<\u20090.001)31. In that study, for the ROC analysis of the MuLBSTA score to predict ARDS, when the MuLBSTA value was\u2009>\u20098.00, the AUC was 0.730 31. In our study, for the ROC analysis of the MuLBSTA score to predict severe disease, when the MuLBSTA value was\u2009>\u20095, the AUC was 0.860. In parallel with our study, the studies in the literature show that the MuLBSTA score is a reliable scoring system to show the severity of COVID-19 infection, but further evaluation is required for this scoring system in cases of COVID-19 pneumonia. When the cut-off value of the MuLBSTA score in the literature was evaluated by ROC analysis, its sensitivity was found to be 45.65%, while the specificity was found as 96.23%. However, we did not find this score to be an independent predictor for severe disease in multivariate analysis.Chen et al. showed that the MuLBSTA score has a strong predictive ability for 90-day mortality in COVID-1932. A recent study showed that high HScore values were more indicative of MAS patients than severe COVID-19 patients . The same study results showed that all MAS patients met the diagnostic cut-off value of the HScore (>\u2009169), but only 10% of severe COVID-19 patients did. Thus, further investigations are required to assess its effectiveness for severe COVID-19 cases33. Another study showed that the HScore could not predict the clinical severity of COVID-19 patients characterized by hyperinflammation-mediated respiratory failure, and it also found that it was not effective in predicting admission to the intensive care unit10. Similarly, according to our study, the HScore was insufficient in detecting cases in the early period. On the other hand, the presence of underlying disease is an important factor for cut-off values recommended for the HScore34. Although it is more successfully used in the diagnosis of hemophagocytic lymphohistiocytosis, it has several limitations in the evaluation of COVID-19 patients. Hyperferritinemia is an important marker for secondary hemophagocytic lymphohistiocytosis (sHLH), but although increased ferritin is observed in patients with COVID-19, the HScore threshold of 2000\u00a0ng/mL is seen in late stages of the disease and may delay the treatment given to these patients35. In our study, the HScore values of patients with severe disease were found to be significantly higher compared to those of non-severe patients. In addition, the HScore values of severe-deceased patients were found to be higher than those of severe-surviving patients. However, these values are far from the cut-off values used for sHLH in the literature, and this may be due to the limitations mentioned above. In addition, it is not easy to perform invasive procedures such as bone marrow aspiration during pandemic processes. Because of that, bone marrow aspiration could be a disadvantage of the HScore. As a result, the limitations of the HScore are the need for both bone marrow aspiration and calculations36. If the HScore is to be used in COVID-19, a new cut-off value should be determined without bone marrow aspiration.In a study by Bhattacharjee et al., it was stated that the HScore can be used to determine the time to initiate immunotherapy in patients with severe COVID-19 infection38. The BCRSS classifies the severity of patients according to the factors of oxygen supplementation and ventilatory support requirements, and it guides the clinician in decisions about further therapeutic investments like antiviral and/or anti-inflammatory drugs. In a study of 236 patients by Moreno-Perez et al., low comorbidity assessed by the BCRSS and early response to tocilizumab treatment were associated with survival and were evaluated as a guide in the follow-up of COVID-19 patients treated with tocilizumab38. In parallel with these studies, in our study, the median BCRSS was found to be 7 in severe-deceased patients, while it was 3 in severe-surviving patients. In our study, BCRSS was found to be an independent predictor of severe disease in cases of COVID-19 based on multivariate analyses . The BRCSS cut-off value of\u2009>\u20091 had the highest AUC value  compared to other scores in predicting severe disease. In a recent article in which 17 patients who were given anakinra treatment were evaluated retrospectively, it was found that the rate of patients with BCRSS scores of 3 or above was 88.2%39. The BCRSS determines the clinical summary of the status of the patients in a simple way and helps clinicians easily compare among patients. In our opinion, the reason why the BRCSS recognizes severe disease better in the early period is that the creators of this score included intensive care, infectious diseases, chest diseases, immunology, rheumatology, and internal medicine specialists16. Furthermore, the BCRSS uses patients\u2019 examinational status according to the degree of respiratory supply  to recommend treatment modalities .The BCRSS, on the other hand, is a scale used to determine the respiratory severity of COVID-19 pneumonia, showing the patient\u2019s need for oxygen and mechanical ventilation, and it yields a score between 0 and 8. As the score increases, the respiratory severity of COVID-19 pneumonia and the patient\u2019s need for oxygen increaseOur study had some limitations. First of all, this study was conducted in a single center and was a retrospective study. For validation, multiple neutral prospective studies need to be done. Secondly, this study included only five scoring systems to predict the severity of COVID-19 disease, but further studies may include additional scores. The third limitation of this study was that all the markers and measurements were evaluated only one time, at admission; therefore, changes in those parameters could not be evaluated. Our final limitation is that the introduction and discussion sections of this article are somewhat long due to the fact that we have examined five scores together.The advantages of our study are as follows: compared to other current studies, many scores in the literature were evaluated together in our study, and we have investigated which scores best recognize severe patients earlier at admission. Our study differs from others since both the number of parameters and the number of patients are higher.Calculation of the BRCSS and qSOFA scores at the time of hospital admission can predict critical clinical outcomes in patients with COVID-19, and their predictive value is superior to that of the HScore, MuLBSTA, and SOFA. By early detection of the high-risk group using the BRCSS and qSOFA, early interventions for high-risk patients can improve clinical outcomes in COVID-19 patients. The reason for the low accuracy of the HScore and MuLBSTA in COVID-19 clinical outcome prediction of is the presence of many \u201csilent hypoxemia\u201d patients among severe cases. Even if they seem to be breathing comfortably, their measured oxygen saturation is low in pulse oximetry. Thus, the HScore and MuLBSTA have a disadvantage in the prediction of severe cases. On the other hand, the reason for high accuracy in clinical outcome prediction of COVID-19 by the BCRSS can be explained by the fact that it evaluates breathing, hypoxia, and oxygen requirements.According to these scores, patients are evaluated in terms of triage and hospitalization is decided in the intensive care unit, the necessary interventions are done by predicting the medical results of the patients, the procedures are developed in the hospital, and the budget and resources are used effectively. The early recognition of patients at risk of developing severe disease allows an appropriate approach that would be started at the time of ICU admission, and this would help reduce mortality. Furthermore, early prognosis prediction would help alleviate the shortage of medical resources.The data collected for our study included the patients\u2019 test results at first admission. In our study, the HScore, MuLBSTA, SOFA, qSOFA, and BRCSS scores were all significantly high in the group of patients with severe COVID-19. All parameters identified in the BRCSS and qSOFA systems are clinically easy to obtain, and all examinations are recommended to be done at admission to the hospital. The BRCSS and qSOFA may help clinicians communicate and determine their treatment plans in the early period of COVID-19. These prognostic markers can be used to prioritize patients requiring intensive care and aggressive management."}
+{"text": "Coronavirus disease 2019 (COVID-19) has posed a great threat to global public health. There remains an urgent need to address the clinical significance of laboratory finding changes in predicting disease progression in COVID-19 patients. We aimed to analyze the clinical and immunological features of severe and critically severe patients with COVID-19 in comparison with non-severe patients and identify risk factors for disease severity and clinical outcome in COVID-19 patients.The consecutive records of 211 patients with COVID-19 who were admitted to Zhongnan Hospital of Wuhan University from December 2019 to February 2020 were retrospectively reviewed.Of the 211 patients with COVID-19 recruited, 111 patients were classified as non-severe, 59 as severe, and 41 as critically severe cases. The median age was obviously higher in severe and critically severe cases than in non-severe cases. Severe and critically severe patients showed more underlying comorbidities than non-severe patients. Fever was the predominant presenting symptom in COVID-19 patients, and the duration of fever was longer in critically severe patients. Moreover, patients with increased levels of serum aminotransferases and creatinine (CREA) were at a higher risk for severe and critical COVID-19 presentations. The serum levels of IL-6 in severe and critically severe patients were remarkably higher than in non-severe patients. Lymphopenia was more pronounced in severe and critically severe patients compared with non-severe patients. Lymphocyte subset analysis indicated that severe and critically severe patients had significantly decreased count of lymphocyte subpopulations, such as CD4+ T cells, CD8+ T cells and B cells. A multivariate logistic analysis indicated that older age, male sex, the length of hospital stay, body temperature before admission, comorbidities, higher white blood cell (WBC) counts, lower lymphocyte counts, and increased levels of IL-6 were significantly associated with predicting the progression to severe stage of COVID-19.Older age, male sex, underlying illness, sustained fever status, abnormal liver and renal functions, excessive expression of IL-6, lymphopenia, and selective loss of peripheral lymphocyte subsets were related to disease deterioration and clinical outcome in COVID-19 patients. This study would provide clinicians with valuable information for risk evaluation and effective interventions for COVID-19. In December 2019, an outbreak of viral pneumonia, now known as coronavirus disease 2019 (COVID-19), was reported in Wuhan, Hubei Province, China . The etihttps://www.who.int/). Due to the high mortality rate and immense economic damage caused by the COVID-19 pandemic, great efforts are being made to develop effective vaccines/drugs to prevent and control the transmission of SARS-CoV-2. Thus, it is of paramount importance to clearly characterize the clinical, laboratory, and radiologic manifestations of this disease in large cohorts of patients. Previous studies have shown that COVID-19 patients can experience a range of clinical manifestations, from asymptomatic/mild symptoms to severe illness. Common symptoms include fever, dry cough, headache, shortness of breath, muscle soreness, fatigue, loss of taste and/or smell  data, there have been more than 102 million confirmed cases of COVID-19 worldwide as of 1 February 2021 with over 2.2 million related deaths, representing a fatality rate of approximately 2.2%  with COVID-19 were analyzed . Severe There have been some large-cohort studies that describe the clinical characteristics of COVID-19 patients. For example, p=0.276). The average ages of the non-severe, severe and critically severe groups were 47 \u00b1 15.6, 60 \u00b1 16.1, and 65 \u00b1 14.8 years, respectively. Clinical characteristics, demographic information, laboratory examinations and chest CT scans of the patients were reviewed using electronic medical records. Laboratory examinations included routine blood tests, cytokine measurement, lymphocyte absolute values and lymphocyte subset analysis. The laboratory data for some patients were missing due to the absence of types of tests or delayed results. Patients in the non-severe, severe and critically severe groups were given corresponding treatment measures according to their clinical situation following admission, including antivirals, glucocorticoids, antibiotics, intravenous immunoglobulin, mechanical ventilation  scans, all patients received a clinical diagnosis of COVID-19 according to the WHO interim guidance. Moreover, some patients had a history of exposure to the Huanan Seafood Wholesale Market, or else had been in contact with people who had been diagnosed with COVID-19. The dates of disease onset and hospital admission were recorded. The onset date was defined as the day when any symptoms were noticed by the patients. Based on disease severity, the patients were divided into non-severe , severe  and critically severe  groups according to the Diagnosis and Treatment of Novel Coronavirus Patients (the Fifth Pilot Ed.). There was no statistical significance in sex distribution among the three groups .The serum levels of six different cytokines  in COVID-19 patients were detected using a BD FACSCalibur flow cytometer  and commercially available cytokine kits  according to the manufacturers\u2019 protocols. In brief, 25 \u00b5L of serum sample was mixed with capture antibody-coupled beads, and the mixture was then added to 25 \u00b5L fluorescently labeled detection reagent. The samples were incubated at room temperature in the dark for 2.5\u00a0h. The beads were subsequently washed and re-suspended in 100 \u00b5L sheath fluid and analyzed using flow cytometry. A recombinant protein standard for each cytokine was included to serve as an internal control.Samples of EDTA-anticoagulated peripheral blood were collected from patients with COVID-19 on admission. The counts of CD3+ T cells, CD4+ T cells, CD8+ T cells, B cells and NK cells were analyzed on a BD FACSCalibur flow cytometer.2 test or Fisher\u2019s exact test. The Pearson correlation test was performed to analyze correlations between lymphocyte subset counts and cytokine levels. Similarly, correlations between peripheral lymphocyte subpopulations and disease progression were constructed using Pearson correlation analysis. Receiver operating characteristic (ROC) curves were established to define the optimal cut-off values. The area under the curve (AUC) was used to compare the predictive ability of peripheral lymphocyte subpopulations. The demographics and laboratory indexes were assessed by multivariable logistic regression analyses to explore the independent predictors and risk factors for severe (vs. non-severe) and critical (vs. non-severe) diseases in COVID-19 patients. Age, sex, the duration from symptom onset to hospital admission, the length of hospital stay, body temperature, comorbidity, complete blood count, liver and renal function indicators, inflammatory cytokines, lymphocyte subsets, and T cell subsets were included in the multivariable logistic regression model. A two-sided p value less than 0.05 was considered to be statistically significant.Categorical variables were shown as frequencies and percentages, and continuous variables were described with the mean \u00b1 standard deviation (SD) or median  as appropriate. All analyses were carried out using SPSS software . The non-normally distributed data were analyzed using the Kruskal-Wallis test. The enumeration data were analyzed using the \u03c7vs. 47  years, p<0.001; vs. 47  years, p<0.001]. Additionally, 101 patients (47.9%) were male, and 110 patients (52.1%) were female. The proportions of men in the severe (56.1%) and critically severe (67.8%) cases were higher than those in the mild cases (34.2% men). Male patients had more underlying comorbidities than female patients  had at least one underlying disease, including hypertension (53 [25.1%]), diabetes [28 (13.3%)], cardiovascular and cerebrovascular diseases [25 (11.8%)] and respiratory system diseases [15 (7.1%)]. A higher percentage of severe [22 (53.7%)] and critically severe [36 (61.0%)] patients had these concomitant diseases than the non-severe group [16 (14.4%)]. Severe patients were more likely to have accompanying hypertension and diabetes than non-severe patients [16 (39.0%) vs. 11 [9.9%], p<0.001; and 10 [24.4%] vs. 4 [3.6%], p=0.001; respectively]. Critically severe patients showed more underlying comorbidities than non-severe patients, such as hypertension , diabetes  and cardiovascular and cerebrovascular diseases .From 21 December 2019 to 14 February 2020, 211 patients with confirmed SARS-CoV-2 infection were hospitalized with a median follow-up of 13 days . The endpoint of follow-up was 13 March 2020. The demographic and clinical characteristics of the COVID-19 patients were shown in vs. 37.8\u00b0C, p<0.01; 38.2 vs. 37.8\u00b0C, p<0.01). The distribution density curves of temperatures substantially overlapped among these groups. Following hospital admission, critically severe patients had a higher percentage of fever cases [27 (45.8%)] than non-severe [9 (8.1%)] and severe [8 (19.5%)] patients. The cases of fever fell to 15 (16.0%) at 15 days after admission. In critically severe cases, 11 (28.2%) patients had a temperature over 37.3\u00b0C, with four (10.3%) reporting temperatures within 38.1-39.0\u00b0C and two (5.1%) exceeding 39\u00b0C. Only a minority of patients presented with fever in the non-severe and severe groups . At 15 days after admission, the median body temperature of critically severe patients was significantly greater than that of non-severe patients ]. Among the patients, 76 (36.0%) had a temperature varying from 38.1 to 39.0\u00b0C, and 24 (11.4%) had a temperature that exceeded 39.0\u00b0C before hospital admission. Seventy-nine (71.2%) non-severe patients reported fever, 36 (87.8%) severe patients and 47 (79.7%) critically severe patients developed fever. As shown in Moreover, 11.4% (24/211) of COVID-19 patients never had fever, and 73.0% (154/211) suffered from fever for no longer than five days. A total of 89.2% (99/111) of non-severe patients had fever lasting no more than five days . There were no significant differences in the serum levels of ALT, AST or CREA between the severe and critically severe groups.All patients with COVID-19 underwent laboratory examinations on admission Table 2.The relationship between the levels of ALT, AST or CREA and underlying diseases was determined. Diabetes, one of the most common comorbidities, was tightly associated with disease progression in COVID-19 patients . Patientp=0.514, p=0.296, p=0.064; vs. 21.8 pg/mL, p<0.001; 140.6 vs. 33.3 pg/mL, p<0.05). The IL-10 level was within the reference range in 34 of 52 (65.4%) COVID-19 patients  counts and infection-related biomarkers among the non-severe, severe and critically severe groups Table 2.vs. 845.2/\u03bcL, p<0.01; 370.6 vs. 845.2/\u03bcL, p<0.001; + T lymphocytes than the non-severe cases . Taken together, these lymphocyte subpopulations had good accuracy in predicting disease severity in COVID-19 patients.ROC curve analysis was performed to assess the correlation between peripheral lymphocyte subsets and disease progression in COVID-19 patients (p=0.048) (p=0.033) , TNF-\u03b1 , IL-2 , IL-4 , IL-6  and IL-10  , 5 (9.6%), 16 (30.1%), 99 (86.1%), and 18 (34.6%) patients on admission. The potential correlation between peripheral lymphocyte subpopulations and cytokines was assessed. CD8+ T cell count was negatively correlated with IFN-\u03b3 level . SARS-CoV-2 infection can cause impairment of the immune system during disease progression  were reported to decline in the peripheral blood of patients with COVID-19 . In the Cytokine storms play a critical role in the acute lung injury of severe patients with COVID-19 . It was vs. 21.8 pg/mL, p<0.05; 140.6 vs. 21.8 pg/mL, p<0.001). Notably, the concentration of IL-6 was significantly higher in non-survivors than in survivors . All data were collected anonymously and recorded following the international standards for the protection of privacy and personal information. Written informed consent was waived by the institutional review board for emerging infectious disease.MW and YF analyzed and interpreted the data. YC and WC contributed to clinical data collection and literature searches. MW drew the figures and wrote the manuscript. KW, JC and XH supervised the project, provided crucial ideas and revised the manuscript. All authors contributed to the article and approved the submitted version.This work was supported by the National Natural Science Foundation of China (No. 81701991) and the Applied Basic Research Program of Qingdao, China (No. 17-1-1-59-jch).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "During mitosis, transcription is globally attenuated and chromatin architecture is dramatically reconfigured. We exploited the M- to G1-phase progression to interrogate the contributions of the architectural factor CTCF and the process of transcription to genome re-sculpting in newborn nuclei. Depletion of CTCF during the M- to G1-phase transition alters short-range compartmentalization after mitosis. Chromatin domain boundary re-formation is impaired upon CTCF loss, but a subset of boundaries, characterized by transitions in chromatin states, is established normally. Without CTCF, structural loops fail to form, leading to illegitimate contacts between cis-regulatory elements (CREs). Transient CRE contacts that are normally resolved after telophase persist deeply into G1-phase in CTCF-depleted cells. CTCF loss-associated gains in transcription are often linked to increased, normally illegitimate enhancer-promoter contacts. In contrast, at genes whose expression declines upon CTCF loss, CTCF seems to function as a conventional transcription activator, independent of its architectural role. CTCF-anchored structural loops facilitate formation of CRE loops nested within them, especially those involving weak CREs. Transcription inhibition does not significantly affect global architecture or transcription start site-associated boundaries. However, ongoing transcription contributes considerably to the formation of gene domains, regions of enriched contacts along gene bodies. Notably, gene domains emerge in ana/telophase prior to completion of the first round of transcription,\u00a0suggesting that epigenetic features in gene bodies contribute to genome reconfiguration prior to transcription. The focus on the de novo formation of nuclear architecture during G1 entry yields insights into the contributions of CTCF and transcription to chromatin architecture dynamics during the mitosis to G1-phase progression. Higher-order chromatin structure is temporarily disrupted during mitosis. Here the authors show that loss of the architectural factor CTCF results in failure to form structural loops and leads to inappropriate cis-regulatory contacts and alterations of compartmental interactions after mitosis. Furthermore, they show global 3D architecture is set up without transcription, but that transcription contributes to proper gene domain formation. Studies of chromatin dynamics during entry into and exit from mitosis have informed the mechanistic basis underlying the hierarchical organization of chromatin. During mitotic exit, A/B compartmentalization is detectable as early as in ana/telophase but intensifies and expands thereafter5. Contacts between CREs such as promoters and enhancers are re-established with variable kinetics, some forming gradually and plateauing deeper into G1 while others are transient in nature being developed fully in ana/telophase only to fade upon G1-entry1. Resumption of transcription follows similarly variable characteristics: some genes display a spike in activity early in G1 and settle down at later stages whereas others are activated in a gradual fashion7.The mitotic phase of the cell cycle is characterized by rapid and extensive re-organization of chromatin architecture and global attenuation of transcription10. Accordingly, acute depletion of CTCF or cohesin leads to widespread weakening of boundaries in interphase cells15. CTCF and cohesin are evicted from mitotic chromatin to varying extents19, and measuring the rates by which they return to chromatin has enabled correlative assessments of their roles in post-mitotic genome folding and transcriptional activation. Upon mitotic exit, CTCF is immediately recruited back to chromatin prior to the formation of domain boundaries and architectural loops1. The rate-limiting step in the formation of these latter structures appears to be the accumulation of cohesin at CTCF-bound sites, which occurs more gradually as chromatid extrusion proceeds.The multi-functional transcription factor CTCF frequently co-localizes with boundaries of contact domains, such as topologically associated domains (TADs), and is proposed to assist their formation in collaboration with the cohesin ring complex through a process termed \u201cloop extrusion\u201d21, but the role of transcription in boundary formation is still being debated. Inhibition of transcription compromises boundary strength in Drosophila melanogaster embryos21. Yet, neither genetic nor chemical inhibition of transcription elicited a significant impact on higher-order structures of mammalian genomes23. A recent gain-of-function study demonstrated that ectopic insertions of TSSs can lead to the formation of new domain-like structures spanning the lengths of the de novo transcripts24.Another feature frequently associated with domain boundaries is transcription start sites (TSS)25. The transition from mitosis into G1-phase offers a chance to examine genome refolding in relation to CTCF binding and gene activation. Here, we interrogated the contributions of CTCF and the process of active transcription to the establishment of post-mitotic chromatin architecture by acutely depleting CTCF through the auxin-inducible degron (AID) system alone or jointly with chemical inhibition of transcription during the mitosis to G1-phase transition26. We demonstrate that CTCF loss alters short-range compartmental interactions after mitosis, suggesting a previously underappreciated role for CTCF in genome compartmentalization. CTCF is required for the proper re-formation of contacts among regulatory elements and normal transcription reactivation. Active transcription contributes minimally to higher-order chromatin re-organization. However, gene domains were shaped by the concerted action of transcription elongation and pre-existing epigenetic features along gene bodies. In sum, our findings elucidate how CTCF and transcription impact post-mitotic genome architectural dynamics.Most studies on how CTCF depletion or transcription inhibition impact chromatin architecture were carried out in asynchronously growing cells and thus do not distinguish requirements for establishment versus maintenance of genome structure26. A TIR-expressing construct was transduced into the cells to allow for rapid auxin-induced CTCF degradation  , and 3370 \u201cdual-function loops\u201d with both anchors containing CREs  in control cells  the CREs Fig.\u00a0. To quanCTCF depletion weakened a subset of CRE loops after mitosis Fig.\u00a0, suggest6. This spiking pattern was overwhelmingly maintained in the absence of CTCF  with 203 up-regulated and 223 down-regulated after mitosis  model to call high confidence enhancer\u2013promoter (E\u2013P) contacts32 Fig.\u00a0. Using a32 Fig.\u00a0. This arWe next explored how CTCF loss could lead to up-regulation of genes. We found that E\u2013P pairs associated with up-regulated genes were significantly strengthened in the absence of CTCF after mitosis Fig.\u00a0. To quan25. We next sought to investigate whether transcription facilitates post-mitotic compartment and boundary reformation. We treated cells with triptolide, a drug that inhibits transcription initiation, during the mitosis-to-G1 phase transition   Fig.\u00a0, suggestES) Fig.\u00a0. HoweverES) Fig.\u00a0. Of noteES) Fig.\u00a0. TranscrES) Fig.\u00a0, indicatES) Fig.\u00a034. This Examination of the earliest stages of transition from pro-metaphase into G1 phase affords a unique view into how chromatin is configured de novo in newborn nuclei. The AID protein degradation system enabled investigation into the role of CTCF in this process. A meaningful interpretation of the experiments in this study requires that CTCF degradation does not significantly impede cell cycle progression. This was demonstrated by (1) flow cytometry measuring DNA content, cell size, and GFP-MD levels, (2) the presence of highly comparable contact decay curves across all post-mitotic time points, and (3) relatively stable post-mitotic gene expression patterns, including widespread gene spiking. As observed previously, only prolonged depletion of CTCF (36\u2009h) was found to delay cell cycle progression . While the mechanism underlying this observation is unclear, it is possible that the distance sensitivity of CRE contacts to the disruptive effects of extruding structural loops might be a function of the cohesin complex reaching and being arrested at CTCF sites more frequently. Fourth, CTCF-anchored loops may facilitate interactions between CREs by providing structural support. Weaker CREs appear to be more reliant on such \u201csupportive\u201d structural loops.Our data suggest that CTCF influences chromatin structure at several levels during G1 entry. First, CTCF-based structural loops constrain short-range B\u2013B compartmental interactions while promoting local A\u2013A compartmental interactions, revealing a previously underappreciated role for CTCF in chromatin compartmentalization. We speculate that these observations are driven by altered loop extrusion after CTCF loss. Removal of CTCF may allow cohesin to travel beyond CTCF-binding sites, thereby increasing loop sizes. Structural loops originating within A-type compartment domains may thus extend into flanking B-type compartment domains and increase their contact probability Fig.\u00a0. The risops Fig.\u00a0. Third, 38. However, we cannot rule out that disruption of shorter-range E\u2013P loops, undetectable in our Hi-C experiments, might account for down-regulation gene transcription.Up-regulation of genes caused by CTCF loss was associated with enhanced interactions between promoters and enhancers and was observed at the earliest measurements (1\u2009h after mitosis), suggesting a tight temporal relationship of promoter\u2013enhancer proximity and transcription. Additionally, we found that the down-regulated genes generally did not display measurable loss in E\u2013P contacts, but instead appear to depend on CTCF binding at their TSS. This implies that at these genes CTCF might function as a transcriptional activator, independent of its role in chromatin looping. This observation diverges from previous reports that CTCF depletion can diminish E\u2013P interactions and result in transcription loss39. However, comparing the kinetics of transcription re-activation and gene domain reformation, and inhibiting transcription pharmacologically revealed that the process of transcription per se does not account for the entirety of post-mitotic gene domain formation  or OsTiR-IRES-GFP-MD (to isolate ana/telophase cells) in G1E-ER4 CTCF-AID-mCherry cells with the retroviral vector MigR1. or positive cells were enriched via FACS based on GFP signal.G1E-ER4 cells were cultured in suspension as previously described and maintained at a density of not exceeding one million/\u03bcl5 cells from each line were treated with or without 1\u2009mM auxin, and cells were counted at 12, 24, and 36\u2009h, respectively.To measure cell growth of G1E-ER4 CTCF-AID-mCherry cells with or without OsTiR-IRES-GFP, 10G1E-ER4 CTCF-AID-mCherry cells expressing OsTiR-IRES-GFP were treated with 1\u2009mM auxin for 0, 30, 60, 120, or 240\u2009min. Cells were fixed with 1% formaldehyde and subject to flow cytometry for mCherry signal. Wildtype G1E-ER4 cells were used as control.For \u201c+auxin\u201d samples:To enrich cells at prometaphase, early-G1 phase, or mid-G1 phase, the G1E-ER4 CTCF-AID-mCherry cells overexpressing OsTiR-IRES-GFP were treated with nocodazole (200\u2009ng/ml) for 7\u20138.5\u2009h at a density of around 0.7\u20131 million/ml. To degrade CTCF during mitosis, auxin (1\u2009mM) was added to the culture during the last 4\u2009h of nocodazole treatment so that CTCF was removed by the end of prometaphase synchronization. To acquire post-mitotic populations, nocodazole-treated cells were pelleted at 1200\u2009rpm for 3\u2009min. Cells were then washed once and immediately re-suspended in a warm nocodazole-free medium containing 1\u2009mM auxin for 60\u2009min (early-G1) and 120\u2009min (mid-G1), respectively. To enrich for cells at ana/telophase, G1E-ER4 CTCF-AID-mCherry cells overexpressing OsTiR-IRES-GFP-MD were first synchronized as above described and then released from nocodazole for 30\u2009min before harvest.Control samples underwent the exact same treatment except that no auxin was added.G1E-ER4 CTCF-AID-mCherry cells expressing OsTiR-IRES-GFP were arrested in prometaphase with nocodazole (200\u2009ng/ml) as above. Triptolide (1\u2009\u03bcM) was added to the cultures during the last hour of nocodazole exposure. For \u201c+auxin\u201d samples, auxin was added during the last 4\u2009h of nocodazole treatment. Cells were released into the warm nocodazole-free medium with 1\u2009\u03bcM triptolide and with or without 1\u2009mM auxin for 2\u2009h.1. Briefly, for in situ Hi-C experiments, cells were pelleted at 1200\u2009rpm for 3\u2009min. Cells were then re-suspended in 1\u00d7 PBS and crosslinked with 2% formaldehyde for 10\u2009min at RT. Crosslinking was quenched with 1\u2009M  glycine for 5\u2009min at RT. Cells were permeabilized by 0.1% Triton X-100 for 5\u2009min at RT and stained with antibody against the mitosis-specific antigen pMPM2  for 50\u2009min at RT. Cells were then treated with APC-conjugated F(ab\u2032)2-goat anti-mouse secondary antibody  for 30\u2009min at RT. Cells were pelleted and re-suspended in 1\u00d7 FACS sorting buffer  containing 20\u2009ng/ml DAPI at a density of about 50\u2013100 million cells/ml. Prometaphase cells were purified via FACS on the basis of pMPM2 signal (+) and DAPI signal (4N). To harvest populations after mitotic exit, cells were pelleted and crosslinked with 2% formaldehyde at designated time points . Crosslinking was halted with 1\u2009M  glycine at RT, and cells were permeabilized with 0.1% Triton X-100. Finally, cells were re-suspended in 1\u00d7 FACS sorting buffer and subjected to FACS sorting. Ana/telophase cells were sorted based on GFP signal (reduced) and DAPI signal (4N). Early-G1 and mid-G1 cells were sorted based on the DAPI signal (2N). In addition, mCherry positive and negative populations were gated to collect untreated control and auxin-treated samples, respectively, for all mitotic and post-mitotic time points. Sorted cells were snap-frozen and stored at \u221280\u2009\u00b0C. FACS plots were generated by FlowJo software (version 10.4.0)Control and \u201c+auxin\u201d samples were acquired as described previouslyThe exact same procedure was carried out for cells that had undergone triptolide treatment.For PolII ChIP-seq: Cells with or without auxin treatment were harvested at 0\u2009min (prometa), 60\u2009min (early-G1), 120\u2009min (mid-G1), or 240\u2009min (late-G1) after nocodazole release. Cells were re-suspended in 1\u00d7 PBS and crosslinked with 1% formaldehyde for 10\u2009min at RT. Crosslinking was stopped with 1\u2009M glycine followed by permeabilization with Triton X-100. All samples  were stained with anti-pMPM2 antibody  for 50\u2009min at RT, followed by APC-conjugated F(ab\u2032)2-goat anti-mouse secondary antibody  for 30\u2009min at RT. Cells were re-suspended in 1\u00d7 FACS buffer containing DAPI and subjected to FACS sorting. Prometaphase cells were purified via FACS based on pMPM2 signal (+) and DAPI signal (4N). Early-, mid- and late-G1 cells were sorted based on DAPI signal (2N). mCherry positive and negative populations were gated to collect untreated control and auxin-treated samples for all mitotic and post-mitotic time points. Sorted cells were snap-frozen and stored at \u221280\u2009\u00b0C. Note that protease inhibitor and PMSF were added to all buffers during the entire sample preparation procedure.1. Briefly, sorted cells (5 million for prometaphase and ana/telophase and 10 million for early- and mid-G1 phase) were lysed in 1\u2009ml cold cell lysis buffer  for 10\u2009min on ice. Nuclei were pelleted at 4\u2009\u00b0C and washed with 1.2\u00d7 DpnII buffer. Nuclei were permeabilized with 0.3% SDS for 1\u2009h at 37\u2009\u00b0C and quenched with 1.8% Triton X-100 for 1\u2009h at 37\u2009\u00b0C. Chromatin was digested with 300U DpnII restriction enzyme  in situ at 37\u2009\u00b0C overnight with shaking. 300U DpnII restriction enzyme was added for an additional 4\u2009h at 37\u2009\u00b0C with shaking. Nuclei were incubated at 65\u2009\u00b0C for 20\u2009min to inactivate DpnII. After cool down, digested chromatin fragments were blunted with pCTP, pGTP, pTTP and Biotin-14-dATP  using 40U DNA Polymerase I, Large (Klenow) fragment . DNA was ligated in-situ with 4000U T4 DNA ligase  for 4\u2009h at 16\u00b0C followed by further incubation for 2\u2009h at RT. Nuclei were then incubated in 10% SDS containing proteinase K (3115879 BMB) at 65\u2009\u00b0C overnight to reverse crosslinking. RNA was then digested with DNase-free RNase at 37\u2009\u00b0C for 30\u2009min. DNA was then extracted by phenol\u2013chloroform extraction, precipitated, and dissolved in nuclease-free water. DNA was sonicated to 200\u2013300\u2009bp fragments  and purified with AMPure XP beads (Beckman Coulter). Biotin-labeled DNA was purified by incubation with 100\u2009\u03bcl Dynabeads MyOne Streptavidin C1 beads  at RT for 15\u2009min. DNA libraries were constructed using the NEBNext DNA Library Prep Master Mix Set for Illumina . To elute DNA, streptavidin bead-bound DNA was incubated in 0.1% SDS at 98\u2009\u00b0C for 10\u2009min. DNA was purified with AMPure XP beads and index labeled with NEBNext multiplex oligos for six cycles on a thermal cycler, using the NEBNext Q5 Hot Start HIFI PCR master mix. Index labeled PCR products were then purified with AMPure XP beads and sequenced on an Illumina NextSeq 500 sequencer. Sequencing data was collected through NextSeq Control Software 2.2.0.In-situ Hi-C experiments were performed as previously described1. Briefly, following sorting, cells were re-suspended in 1\u2009ml pre-cooled cell lysis buffer supplemented with protease inhibitors (PI) and PMSF for 20\u2009min on ice. Nuclei were pelleted and re-suspended in 1\u2009ml Nuclear Lysis Buffer  for 10\u2009min on ice. 0.6\u2009ml IP dilution buffer  was added followed by sonication  for 45\u2009min. Samples were pelleted at 15,000\u2009rpm for 10\u2009min at 4\u2009\u00b0C to remove cell debris. The supernatant was supplemented with 3.4\u2009ml IP dilution buffer fresh supplemented with PI and PMSF, 50\u2009\u03bcg isotope-matched IgG, and 50\u2009\u03bcl protein A/G agarose beads  and rotated at 4\u2009\u00b0C for 8\u2009h to preclear the chromatin. 200\u2009\u03bcl, chromatin was set aside as input chromatin. Precleared chromatin was then incubated with 35\u2009\u03bcl\u2009A/G agarose beads (A:G\u2009=\u20091:1) pre-bound with anti-RNA PolII antibody (5\u2009\u03bcg/IP) at 4\u2009\u00b0C for overnight. Beads were washed once with IP wash buffer I , twice with high salt buffer , once with IP wash buffer II  and twice with TE buffer . All washing steps were performed on ice. Beads were moved to RT and eluted in 200\u2009\u03bcl fresh-made elution buffer . 12\u2009\u03bcl of 5\u2009M NaCl, 2\u2009\u03bcl RNaseA (10\u2009mg/ml) was added to IP and input samples and incubated at 65\u2009\u00b0C for 2\u2009h, followed by addition of 3\u2009\u03bcl protease K (20\u2009mg/ml) and incubated at 65\u2009\u00b0C overnight to reverse crosslinking. Finally, IP and input samples were supplemented with 10\u2009\u03bcl of 3\u2009M sodium acetate (pH 5.2), and DNA was purified with a QIAquick PCR purification kit (QIAGEN 28106). ChIP-seq libraries were constructed using Illumina\u2019s TruSeq ChIP sample preparation kit . Libraries were size-selected using the SPRIselect beads  before PCR amplification. Libraries were then quantified through real-time PCR with the KAPA Library Quant Kit for Illumina . Finally, libraries were pooled and sequenced on an Illumina NextSeq 500 platform using Illumina-sequencing reagents. Sequencing data was collected through NextSeq Control Software 2.2.0.Chromatin immunoprecipitation (ChIP) was performed using anti-RNA Polymerase II antibody  as described previously41. PCR duplicates were removed and uniquely mapped reads were paired to generate a validPair file. The output validPair file was converted into \u201c.hic\u201d file using the hicpro2juicebox utility. For merged samples, similar steps were taken on reads merged from each biological replicate.For each biological replicate, paired end reads were aligned to the mouse reference genome mm9 using bowtie2  through the Hi-C Pro (2.10.0) software31. Positive and negative EV1 values of each 100\u2009kb bin were assigned to A- (active) and B- (inactive) compartments, respectively, based on gene density. Compartments were called on both replicate-merged samples and individual biological replicates across all conditions. Chromosome 3 was excluded from compartment analysis due to chromosomal translocation.Compartments were called based on the \u201c.hic\u201d files through eigenvector decomposition on the Pearson\u2019s correlation matrix of the observed/expected value of 100\u2009kb binned, Knight\u2013Ruiz (KR) balanced cis-interaction maps (Eigenvector utility of juicer_tools_1.13.02)cis observed/expected contact matrix was extracted from each \u201c.hic\u201d file through the DUMP utility of juicer_tools (1.13.02)31. For untreated control samples, the contact matrices were transformed in the same way such that each row and column of bins were reordered based on the eigenvector 1 (EV1) values associated with the mid-G1 sample, so that they fall into ascending order from top to bottom and from left to right. A similar transformation was applied onto auxin-treated samples across all cell cycle stages, based on their mid-G1 samples. Also, a similar transformation was performed on triptolide-treated G1-phase samples either with or without auxin treatment. After the transformation, bins at the top-left corner are associated with B\u2013B compartment interactions. Bins at the bottom-right corner are associated with A\u2013A compartment interactions. Bins at the top-right and bottom-left corners are associated with B\u2013A and A\u2013B compartment interactions, respectively. The transformed contact maps from each chromosome were divided into 50 equal sections and averaged to create the genome-wide saddle plots. The compartment strength of each individual chromosome was computed as following: compartment strength\u2009=\u2009(median (top20% AA)\u2009+\u2009median (top20% BB))/(median (top20% AB)\u2009+\u2009median (top20% BA)). The compartment strength from each individual chromosome was averaged and log2 transformed as genome-wide compartment strength. The compartment strength of individual replicates and merged samples were computed independently.To visualize compartment strength, we generated saddle plots. Briefly, 100\u2009kb binned Knight\u2013Ruiz (KR) balanced 1. R(s) curve was established to indicate the distance-dependent level of compartmentalization. To compute the R(s) curve, 100\u2009kb binned KR balanced cis observed/expected matrix was extracted from \u201c.hic\u201d files. For each interaction bin\u2013bin pair separated by a given genomic distance (s), we computed the product of two EV1 values corresponding to the 2 bins. We then calculated the Spearman correlation coefficient R between EV1 products and the observed/expected values of all bin\u2013bin pairs that are separated by s. R(s) was then set to demarcate the level of compartmentalization for genomic distance s. To generate the R(s) curve across different genomic distances, we computed R when s equals 100\u2009kb, 200\u2009kb, 300\u2009kb\u2026\u2026125\u2009Mb. R(s) curves of each chromosome were then averaged to generate the genome-wide R(s) curve. R(s) curve of individual biological replicates and merged samples for both untreated control and auxin treated samples were computed independently across all cell cycle stages. For interactions close to the diagonal of contact maps, well-compartmentalized regions, i.e. interactions between bins from the same type of compartments (A\u2013A or B\u2013B) tend to display high observed/expected values and positive (>0) EV1 products, whereas interactions between bins from different types of compartments (A\u2013B or B\u2013A) tend to exhibit low observed/expected values and negative (<0) EV1 product. Thus, R tends to be high in well-compartmentalized regions. At weakly compartmentalized regions, interactions between bins tend to be low also when distant from the diagonal regardless of whether the two bins are from the same type of compartment or not. Thus, R tends to be low in weakly compartmentalized regions.The analysis of the progressive compartmentalization spreading across cell cycle stages has been described previouslyTo quantify the interactions between closely positioned compartments, we adopted a high resolution (50\u2009kb binned) A/B compartment profile from the mid-G1 untreated control sample as reference. To measure interactions between local B\u2013B compartments , we extracted genomic coordinates of all A-type compartments from the reference A/B compartment file. For each A-type compartment, we computed the average observed/expected values between the 250\u2009kb region upstream of the start site and the 250\u2009kb region downstream of the end sites across all cell cycle stages in both untreated control and auxin treated samples as well as G1-phase samples treated with triptolide. The resulting observed/expected values were denoted as interaction strengths between each closely spaced B\u2013B compartment pair. We also computed more distally separated tier2 (with two A-type compartments in between) B\u2013B interactions. For each given tier2 B\u2013B compartment pair, we computed the average observed/expected values between the 250\u2009kb region upstream of the start site of the first A-type compartment and the 250\u2009kb region downstream of the end site of the second A-type compartment. A similar approach was taken to calculate tier3 (with three A-type compartments in between) and tier4 (with four A-type compartments in between) B\u2013B interaction. Interactions between tier1 to 4 A\u2013A compartment pairs were calculated using the same approach.42. Randomly shuffled bed files were used as input to compute the interaction strengths between 250\u2009kb up-stream and down-stream flanking regions for each entry.For distance-matched random controls, we randomly selected 500 A- or B-type compartments and shuffled their genomic coordinates for each entry using the \u201cshuffle\u201d function of bedtools31. The following steps were taken to generate unique non-redundant lists of loops in untreated controls and auxin-treated samples across all cell cycle stages. (1) We used HICCUPS to call preliminary loops on the untreated control samples at each cell cycle stage using 10\u2009kb binned matrices with the Juicer_tool_1.13.02. The inner and outer diameters of the donut filter were set to be 4 bins and 16 bins, respectively, and an FDR of 0.2 was adopted. (2) We repeated the above step on 10\u2009kb binned auxin-treated samples across all cell cycle stages with the exact same parameter set. (3) Loop calls from (1) and (2) were merged to generate a non-redundant loop list across all cell cycle stages and auxin treatment conditions for 10\u2009kb matrices. (4) False-positive calls introduced by exceptionally high outlier pixels were usually present in all samples irrespective of cell cycle stage and auxin treatment condition. To eliminate these artifacts, we removed pixels that were called in more than 6 of the 8 total samples. (5) In certain scenarios, pixels identified at different cell cycle stages or different auxin treatment conditions tended to cluster together. These clusters of pixels could actually be considered as one loop instead of many. Therefore, we implemented a method to merge these clustered pixels. To begin with, for a given loop in the non-redundant list from step (4), we recorded a value qmin which represents the lowest q value across all cell cycle stages in both untreated controls and auxin treated samples. We then ordered the loops in ascending order based on their qmin. In this way, pixels at the top of the list were the most confident calls. We then focused on the top pixel and scanned through the rest of the list to identify pixels that were within a 20\u2009kb radius of the top pixel. If no additional pixel were found nearby, we then considered the top pixel as a loop by itself without pixel clustering. If pixels existed that fulfilled the above requirement, we then consider these pixels together with the top pixel as a loop cluster. Pixels within the loop cluster were removed from the non-redundant loop list. We then recalculated the centroid of the loop cluster and computed the distance s between the centroid and the far cluster edge. We then started the second round of pixel merging by scanning the rest of the list to identify pixels that are within a radius of 20\u2009kb\u2009+\u2009s from the centroid. Pixels within the loop cluster after the second collapsing step were removed from the non-redundant loop list. Next, we focused on the top pixel of the remaining list and repeated the above clustering steps, until no further pixels remained in the pixel list. After pixel merging, we generated a list of loop clusters that contained 1 or more pixels. For each loop cluster, we defined a cluster summit which was represented by the pixel with the lowest qmin. If a loop cluster only contained pixels called in the untreated controls but not in the auxin treated samples, we defined it as a \u201clost\u201d loop. Conversely, if a loop cluster did not contain pixels from the control samples, it was defined as a \u201cgained\u201d loop. The remaining loop clusters were categorized into \u201cretained\u201d, indicating that these loops were detected in both \u201c-auxin\u201d and \u201c+auxin\u201d samples. (6) We next performed step (1) through (5) on 25\u2009kb binned matrices with an inner donut filter diameter of 1 bin and outer donut filter diameter of 6 bins. FDR of 0.01 was adopted. (7) Loops called on 25\u2009kb binned matrices were then merged with those called on 10\u2009kb matrices. If a 25\u2009kb loop cluster overlaps with a 10\u2009kb loop cluster, the 25\u2009kb loop was dropped.Chromatin loops were called using a previously described HICCUPS method with modificationsWe noticed that some visually solid loop-like pixels were dropped by the HICCUPS due to a lack of surrounding significant pixels. To recover these potentially false-negative calls, we took advantage of our biological replicates. Specifically, we continued to complement our non-redundant loop calling list with the following steps. (8) For untreated control samples, we extracted all raw significant pixels from HICCUPS before clustering across cell cycle stages and combined them. (9) We then computed the donut FDR of the above pixels in all biological replicates across cell cycle stages in the untreated control samples through juicer_tools_1.13.02. (10) To determine if a pixel represented a loop, we implemented the below filters: (1) For ana/telophase or early-G1 phase, we required that a pixel must display an FDR\u2009<\u20090.2 in both replicate-merged and individual biological replicates. (2) For ana/telophase or early-G1 phase, a pixel was required to show an observed/donut-expected value of over 1.5 in replicate-merged and individual biological replicates. (3) For ana/telophase or early-G1 phase, a pixel had to exhibit an observed value of >10 in replicate-merged and individual biological replicates. (4) For the mid-G1 phase, the above three criteria had to be satisfied in at least 3 of the following 4: replicate-merged, biological replicate 1, 2, and 3. A pixel had to fulfill all the above filters to be viewed as valid in a given cell cycle stage, and it had to be valid in at least one post-mitotic cell cycle stage to be considered a valid loop for the untreated controls. (11) We then repeated steps (8) through (10) to get a list of valid pixels in auxin-treated samples. (12) We combined the valid pixels from untreated controls and auxin-treated samples and filter out pixels with the highest 5% observed/donut-expected values in prometaphase in untreated control samples as well as pixels with a distance of over 2\u2009Mb. (13) We further removed pixels that were overlapping or next to the loops identified in step (9). In this manner, we obtained valid loops that had been previously missed by HICCUPS. (14) Finally, we performed step (5) on the remaining pixels at (13) to merge valid pixels that were clustered together. In total, we ended up with 16,370 non-redundant loops across all samples.1. Our analysis focused on the following possibilities: (1) Two loop anchors harbor CTCF/cohesin co-occupied sites with neither harboring CREs. (2) Both loop anchors harbor CTCF/cohesin co-occupied sites with one anchor also harboring a CRE. (3) Both loop anchors each harbor a CTCF/cohesin co-occupied site and a CRE. (4) None of the loop anchors harbor CTCF/cohesin co-occupied sites but both contain CREs. (5) One loop anchor a harbors CTCF/cohesin co-occupied site and two anchors harbor CREs. Groups (1) and (2) loops were defined as \u201cstructural loops\u201d, loops from group (3) as \u201cdual-function loops\u201d, and loops from the groups (4) and (5) as \u201cCRE loops\u201d.We categorized loops into different classes based on whether ChIP-seq peaks of CTCF and cohesin and annotations of promoters or enhancers were present at their anchors. For a peak to intersect with a loop anchor, it had to have at least 1\u2009bp overlap with a 30\u2009kb region centered on the midpoint of the loop anchor summit. We employed the CTCF/cohesin co-occupied peak list and the peaks of H3K27ac (CRE) from our previous studyz-scores of loop strength across all cell cycle stages in untreated control samples and performed k-means clustering using the three post-mitotic time points. We were able to recover four-loop clusters with distinct reformation kinetics. To assess the effect of CTCF depletion on cluster1 transient CRE loops, we attempted to further sub-categorize them using the loop strength from both untreated controls and auxin-treated samples. We computed the z-scores of loop strength across all cell cycle stages in both untreated as well as auxin-treated samples. We then performed k-means clustering using the three post-mitotic time points from both untreated controls and auxin-treated samples.To measure the change of post-mitotic loop formation as well as the impact of CTCF depletion on loop formation, we defined a metric to measure the strength of each loop. For a given loop, we considered its summit pixel as well as eight surrounding pixels and computed their observed/donut-expected values across cell cycle stages in both untreated controls and auxin-treated samples. For a specific cell cycle stage and auxin treatment condition, the loop strength was recorded as the average of the observed/donut-expected values from the 9 pixels. To dissect the wildtype CRE loop reformation patterns after mitosis, we focused on the 3232 CRE loops that were detected in untreated control samples. We then computed the P-values were computed with the Fisher\u2019s exact test in R. Lastly, we defined for each cluster of CRE loops whether or not they were supported by structural loops. A similar approach was taken to calculate the odds ratio and P-values for each CRE loop cluster at each scenario.To quantify the degree to which CRE loops are disrupted or supported by structural loops, we performed the following enrichment analysis. We first focused on structural loop interpolation. For a given cluster of CRE loops (e.g. cluster1-R), we defined two scenarios based on whether or not they are interpolated by structural loops. The two scenarios were: (1) neither of the two CRE anchors were covered by a structural loop (not interpolated) and (2) either one or both of the CRE anchors were covered by structural loops (interpolated). For each scenario, we constructed a 2\u2009\u00d7\u20092 contingency table based on in which scenario a given cluster of CRE loops fell, and whether or not the rest of the CRE loops fell into that scenario. Odds ratios and https://github.com/tanlabcode/rGMAP)30. To call domains in untreated control samples, we extracted 10\u2009kb binned KR balanced cis contact matrices from replicate-merged \u201c.hic\u201d files of each cell cycle stage, using the DUMP utility of juicer_tool (1.13.02)31. The contact matrices were used as input to feed in rGMAP for domain calling. For each cell cycle stage, we started by performing the following domain sweep: (1) Maximally three levels of domains were allowed (dom_order\u2009=\u20093). (2) Maximal contact distances of 2\u2009Mb were allowed (maxDistInBin\u2009=\u2009200). This step generated a basic list of domains. To capture sub-domain-like structures, we performed an additional domain sweep, which allowed a maximal contact distance of 500\u2009kb (maxDistInBin\u2009=\u200950). Additional sub-domains were then added to the basal list to create a preliminary list of domains for each cell cycle stage. A similar approach was carried out to generate the preliminary domain list in the auxin-treated samples. As a reference, we also performed rGMAP to call domains in late-G1 phase parental cell samples, using the same criteria as above.Domains were independently identified in untreated controls and auxin-treated samples across all cell cycle stages, using the rGMAP algorithm (1.4)  Domains called at prometaphase had to overlap with at least three domains identified in the subsequent four cell cycle stages  to be considered valid. (2) Domains called at ana/telo, early-G1 or mid-G1 had to overlap with at least one domain identified in subsequent cell cycle stages to be considered valid. To claim that a domain detected in prometaphase is also present at a later cell cycle stage, we require that at least one domain exists in the later time point, whose upstream and downstream boundaries are within \u00b18 bins of those of the original domain. We performed this step across all subsequent cell cycle stages to identify all potentially \u201coverlapping\u201d domains. If at least three subsequently identified domains overlap with our query domain, we then separately average the up- and down-stream boundaries of all \u201coverlapping\u201d domains to replace the boundaries of the original prometaphase domain. A similar approach was carried out in the ana/telo, early-G1, and mid-G1 phases. These steps produced a list of high confidence domains that were detected across different cell cycle stages in the untreated control samples.Next, we implemented a merging step to adjust boundary locations so that domains across cell cycle stages with highly similar boundaries would share a single consistent boundary . As a start, we generated an overall non-redundant boundary list from all domains. Boundaries were then sorted based on their genomic coordinates from 5\u2032 to 3\u2032. Starting from the first boundary, we swept throughout the rest of the boundaries on the same chromosome and removed boundaries that are less than 80\u2009kb away from the first boundary. We then merged these boundaries into one and applied the mean of their genomic coordinates as the genomic coordinate of the final merged boundary. These boundaries were then removed from the overall boundary list. We then performed this step iteratively on the remaining boundaries until all boundaries were processed. The final averaged boundary coordinates were then reassigned to corresponding domains. For a boundary shared by multiple domains, the time point of emergence of this boundary is determined by the earliest associated domain.The same approach was carried out to process domains and boundaries identified in the auxin-treated samples across all cell cycle stages.43. Briefly, we implemented a 12 bin\u2009\u00d7\u200912 bin window, which slides along the diagonals of the 10\u2009kb binned KR balanced contact matrices. The sliding window was set to be one bin away from the diagonal. Genomic regions with low read counts (<12 counts) were discarded from the analysis. Windows interrupted by the starts or ends of chromosomes were also discarded. For each 10\u2009kb bin, the sum of reading counts of each window was then normalized to the chromosomal average and log2 transformed. A pseudo-read count was added to the chromosomal mean as well as each window before log transformation.Insulation scores were computed as previously describedWe noticed that in a few cases domain boundaries were shifted by several bins from the local minima of insulation, and thus did not accurately reflect the \u201creal\u201d boundary position. To solve this issue, we fine-tuned boundary positions such that boundaries were adjusted to the local minima of insulation. This adjustment was performed on untreated control samples. For each given boundary, we defined a wiggle room by sectioning a \u22126 bin to +6 bin genomic region that centered around the boundary. We then recorded the mid-G1 phase insulation scores of each bin within the wiggle room. The bin with the lowest insulation score for the mid-G1 phase was defined as the final position of the boundary, representing local minima of insulation scores. The adjusted boundary locations were then re-assigned to their corresponding domains. After boundary adjustment, domains smaller than 100\u2009kb were filtered out to eliminate spurious domains. In some outlier cases, boundaries after adjustment ended up being extremely close to each other (within 20\u2009kb). We, therefore, implemented a final step to merge boundaries using the same approach as described above.After boundary position adjustment, we obtained an intermediate list of domains and boundaries that were detected at each cell cycle stage for the untreated control samples. We then added domains and boundaries from \u201c+auxin\u201d samples to this list to create a final complete domain list before quality check. We carried out the flowing merging steps: For a given domain in the auxin treated samples, if both of its boundaries were <80\u2009kb away from the up- and downstream boundaries of a \u201c\u2212auxin\u201d domain, we then considered these two domains as \u201coverlapping\u201d and recorded the boundary coordinates of the \u201c\u2212auxin\u201d domain in the final list. If the upstream (but NOT downstream) boundary of the \u201c+auxin\u201d domain was <80\u2009kb away from any boundaries in the \u201c\u2212auxin\u201d list, we then considered this \u201c+auxin\u201d domain a new domain and recorded the \u201c\u2212auxin\u201d boundary coordinate as the upstream boundary for this \u201c+auxin\u201d domain. Similarly, if the downstream (but NOT upstream) boundary of the \u201c+auxin\u201d domain was <80\u2009kb away from any boundaries in the \u201c\u2212auxin\u201d list, we considered this \u201c+auxin\u201d domain as a new domain and recorded the \u201c\u2212auxin\u201d boundary coordinate as the downstream boundary for this \u201c+auxin\u201d domain. Finally, if both upstream and downstream boundaries of the \u201c+auxin\u201d domain were more than 80\u2009kb away from boundaries in the \u201c\u2212auxin\u201d list, we considered this \u201c+auxin\u201d domain as a new domain and recorded its own boundary coordinates in the final list of domains.12. For each domain, the start and end coordinates were recorded as i \u2009\u00d7\u200910,000 and j\u2009\u00d7\u200910,000, respectively. Therefore, we could use  to mark the position of the corner pixel. We then marked our four horizontal stripes and four vertical stripes that were just inside the domains. The positions of the horizontal inner stripes are: , ,  and , respectively. The positions of vertical inner stripes are: , ,  and , respectively. We then also marked out an additional four horizontal and four vertical stripes that were outside of the domain. The positions of horizontal outer stripes were , ,  and , respectively. The positions of vertical outer stripes were , ,  and , respectively. The inner stripes and outer stripes had the same genomic separations. We computed the sum of observed/expected values for pixels within inner stripes and then divided this value by the sum of observed/expected values for pixels within outer stripes. The final result was log2 transformed and recorded as the ADA score of the domain. Note that domains smaller than 150\u2009kb was filtered to minimize the possibility of outer stripes stretching into another domain.We noticed that in some rare cases, domains spanning large low-mappable regions were also called by the algorithm. To filter out low confidence domains, we implemented an aggregated domain analysis which measures the ratio between interactions just inside the domain and interactions just outside the domain. We computed ADA scores on the 10\u2009kb-binned KR balanced observed/expected contact matrices as previously reported with modificationsTo eliminate domains covering low-mappable regions, we placed the following filters: (1) For a given domain, we examined all pixels in the inner and outer stripe regions. If any pixel displayed an observed/expected value of over 30, we dropped this domain from further analysis. This step was to filter out high outlier pixels that are usually associated with low-mappable regions. (2) For a given domain, if either or both of the two outer stripe regions contained less than 5 non-zero pixels, the domain was dropped from further analysis. (3) For a given domain, if either or both of the two inner stripe regions contain less than 10 non-zero pixels, the domain was dropped from further analysis. To further ensure the validity of our domain calls, we also implemented a dynamic filter. This filter was established based on the rationale that true domains would gradually become stronger after mitotic exit and thus their ADA scores would be higher in post-mitotic time points compared to prometaphase. Specifically, we require that for a domain to be valid, at least 1 of the 6 post-mitotic samples  had to show at least a 1.25-fold ADA score enrichment compared to both prometaphase samples .We quantified boundary strength as follows: We selected a \u2212120 to +120\u2009kb region centered on a boundary of interest and searched for the highest insulation score within this 240\u2009kb region. This maxi-IS value was then unlogged and subtracted by the insulation score (unlogged) at the boundary itself. The resulting \u0394IS was then denoted as the strength of the target boundary.k-means clustering on the \u0394IS of all boundaries across all 8 samples (4 cell cycle stages in both untreated control and auxin-treated samples). Specifically, for each boundary, we computed the z-scores of their \u0394IS across all 8 samples. We then performed k-means clustering on the z-scores of 6 post-mitotic samples . We found that when we chose k\u2009=\u20095 clusters, we were able to recover the most biologically interpretable clusters. Note, cluster5 was mostly spurious boundaries and thus was excluded from the analysis.To examine the reformation dynamics of boundaries and measure the effect of CTCF depletion on the dynamic boundary formation after mitosis, we performed 44. For each target boundary, we selected a \u221250 to +50\u2009kb genomic region and sectioned it into 10 bins (10\u2009kb/bin). To assess chromatin state transition, we adopted the two histone marks H3K36me3 and H3K27me3, the former and latter representing transcriptionally active and inactive chromatin, respectively. We then calculated the mean G1E-ER4 ChIP-seq signals of these two marks (from asynchronously growing cells) in each 10\u2009kb bin, using the UCSC toolkit (BigWigAverageOverBed). The ChIP-seq intensities of these marks were organized into two matrices such that each row represents the 100\u2009kb region around a boundary, and each of the 10 columns represents a 10\u2009kb bin. The columns were ordered based on their genomic positions from upstream to downstream. Each column was then normalized to the column sum such that the ChIP-seq intensity values from each column add up to 1. After normalization, the two matrices of H3k27me3 and H3K36me3 were stitched horizontally yielding a final matrix with 20 columns. We then applied principal component analysis (PCA) on the final matrix using the R function prcomp (3.6.1). We noticed that PC1 was able to accurately describe the transition of chromatin states in a way that boundaries with either highest or lowest PC1 projection values were typically at chromatin transition points (5\u2032 active\u2009\u2192\u20093\u2032 inactive or 5\u2032 inactive\u2009\u2192\u20093\u2019\u2032 active), whereas boundaries with median level PC1 projection values were not.To assess histone modification features associated with different clusters of boundaries, we adopted a PCA-based approach as previously described45. Alignments with MAPQ score lower than 10 and PCR duplicates were removed using SAMtools (v0.1.19)46. Reads aligned to mitochondria, random contigs, and ENCODE blacklisted regions were also removed for downstream analysis using BEDtools (v2.27.1)42. Peaks were called using MACS2 (v2.1.0) with default parameters and a 0.01 q-value cutoff. Fragment pileup and local lambda track files in bedGraph format were created during MACS2 peak calling and normalized to one million reads per library 47. The latter was the track was subtracted from the former using MACS2 (\u201cbdgcmp -m subtract\u201d), negative values were reassigned as zeros and converted to bigwig format for visualization using the UCSC Toolkit (\u201cbedGraphToBigWig\u201d). Finally, a non-overlapping union set of peaks was created by merging peaks in all replicates using BEDtools such that all peaks that overlap by at least 1\u2009bp were merged. Tracks of PolII ChIP-seq was generated using the python package pygenometracks (3.1).Reads were aligned against the mm9 reference genome using Bowtie2 (v2.2.9) with default parameters and soft clipping allowed 49. A PolII ChIP-seq peak at the TSS does not necessarily mean that the corresponding gene is active. In certain cases, inactive genes positioned closely downstream of the 3\u2032 UTR of active genes could also display positive PolII signals at their TSS, potentially leading to false assignment as an active gene. Therefore, we filtered out genes with low H3K27ac or ATAC signals to ensure that the genes were within \u201copen\u201d chromatin and more likely to be active. (4) The PolII ChIP-seq signal (+500\u2009bp from TSS to TES) of at least 1 of the six post-mitotic samples  had to be \u22651.5 fold that of the two prometaphase (\u201c\u2212auxin\u201d and \u201c+auxin\u201d) samples.Active genes were called based on the overall PolII ChIP-seq peak list with the following filters: (1) The TSS of a gene had to overlap with at least 1 positive PolII ChIP-seq peak. (2) The length of a gene had to be over 1\u2009kb to ensure that enough reads were obtained over the gene body (+500\u2009bp from TSS to TES) and discernible from the reads at the TSS. (3) We further filtered out the genes with the lowest (10%) H3K27ac signal or ATAC signal at the promoter regions PCA was performed separately on PolII ChIP-seq signals from control and auxin-treated samples. For untreated samples, we computed the replicate-merged PolII ChIP-seq signals (+500\u2009bp from TSS to TES) of each active gene across all cell cycle stages, using the UCSC toolkit (BigWigAverageOverBed). The PolII signals from each cell cycle stage were then normalized such that they sum up to 1. PCA was performed on the last three cell cycle stages using the R package (prcomp). As described above, the PC1 values of each gene describe the \u201cspikiness\u201d of their post-mitotic reactivation pattern. We set the direction of PC1 projection values such that genes with high (positive) PC1 values were the most \u201cspiky\u201d after mitosis, whereas genes with low (negative) PC1 values displayed a gradual increase of PolII ChIP-seq signal after mitosis. The same procedure was performed on auxin-treated samples. The PC1 values of each gene from control and auxin-treated samples were highly correlated, suggesting that the post-mitotic transcriptional spiking was maintained after CTCF depletion.50. P.adj cutoff of 0.05 and fold change cutoff of 1.25 were adopted to call differentially expressed genes for each post-mitotic cell cycle stage. A gene was considered differentially expressed if it was significantly different in at least one post-mitotic time point. In total, we identified 426 differentially expressed genes during mitotic exit after CTCF depletion. To determine whether these genes were up- or down-regulated over time, we performed k-means clustering using the log2FC output of DESeq2 across the early-, mid- and late-G1 phase. Finally, we identified 223 genes that were down-regulated after CTCF depletion, and 203 genes that were up-regulated after CTCF depletion during the mitosis to G1-phase transition.Gene expression levels were assessed by the number of PolII ChIP-seq read counts over the gene body (+500 from TSS to TES). To measure differential gene expression after CTCF depletion during mitotic exit, we first extracted raw PolII read counts over gene bodies from the bam files of each individual biological replicate using the \u201cmulticov\u201d function of bedtools. This step was performed on the three post-mitotic cell cycle stages in both \u201c\u2212auxin\u201d and \u201c+auxin\u201d samples. DESeq2 (1.24.0) was adopted to perform differential expression analysis between \u201c\u2212auxin\u201d and \u201c+auxin\u201d samples for each post-mitotic cell cycle stage independently. Raw read PolII ChIP-seq read counts were used as input for DESeq2 with default parametershttps://github.com/broadinstitute/ABC-Enhancer-Gene-Prediction)32. To simulate enhancer activity, we used H3K27ac ChIP-seq and ATAC-seq signals from asynchronously growing G1E-ER4 cells. These datasets were used in combination with six replicate-merged Hi-C datasets in this study  to predict enhancers in each of the three post-mitotic cell cycle stages with or without auxin treatment independently. We called E\u2013P and P\u2013P connections in each sample when the ABC score threshold equals to 0.01, 0.02, 0.03, 0.04, and 0.05, respectively. Higher the ABC score thresholds resulted in fewer but higher confidence connections. Note that we identified on average ~1.86 (fewer than the recommended 3) enhancers per gene when the ABC score threshold was set to 0.04, suggesting that 0.04 is a relatively stringent threshold. For a given ABC threshold (e.g. 0.01), we combined the predicted connections in each sample to generate an overall non-redundant list of high confidence E\u2013P and P\u2013P pairs. Each E\u2013P or P\u2013P pair was then assigned to genes with different responses  to CTCF depletion.To predict enhancers of active genes and establish E\u2013P and P\u2013P connections, we adopted a recently proposed ABC model  R package. Since the trend of CRE contact changing was overwhelmingly consistent between early and mid-G1 phase samples, we treated the samples from these two-time points as equal biological replicates. Thus, we had five biological replicates (two from early-G1 and three from mid-G1) for control and auxin-treated samples. LIMMA was used to determine differentially interacting E\u2013P contacts. 51. For unscaled aggregated peak analysis (APA), loops smaller than 100\u2009kb were removed from the plots to avoid influence from pixels close to the diagonal. For unscaled aggregated plots of compartment transition points, compartments smaller than 300\u2009kb were removed from the plots, again to minimize the influence from pixels near the diagonal.To generated aggregated plots, we first cool files from \u201c.hic\u201d files using the python package hic2cool (0.8.0). Aggregated plots were then generated through the python package Coolpup (0.9.2) and Plotpup (0.9.2) using cool files as inputFurther information on research design is available in the\u00a0Supplementary informationDescription of Additional Supplementary FilesSupplementary Dataset 1Supplementary Dataset 2Supplementary Dataset 3Supplementary Dataset 4Reporting Summary"}
+{"text": "Restricting the movement of the public to gathering places and limiting close physical contact are effective measures against COVID-19 infection. In Japan, states of emergency have been declared in specific prefectures to reduce public movement and control COVID-19 transmission. We investigated how COVID-19 infection related experiences including people with a history of infection, people with a history of close contact, and people whose acquaintances have been infected, affected self-restraint from social behaviors during the second state of emergency in Japan.A prospective cohort study was conducted among workers aged 20\u201365\u00a0years using data from an internet survey. The baseline survey was conducted on December 22\u201325, 2020, and a follow-up survey was on February 18\u201319, 2021. There were 19,051 participants who completed both surveys and were included in the final analysis. We identified eight social behaviors: (1) eating out (4 people or fewer); (2) eating out (5 people or more); (3) gathering with friends and colleagues; (4) day trip; (5) overnight trip (excluding visiting home); (6) visiting home; (7) shopping for daily necessities; and (8) shopping for other than daily necessities. We set self-restraint regarding each social behavior after the second state of emergency was declared in January 2021 as the dependent variable, and COVID-19 infection related experiences as independent variables. Odds ratios were estimated using multilevel logistic regression analyses nested in the prefecture of residence.Significant differences by COVID-19 infection related experiences were identified: compared to people without COVID-19 related experiences, people with a history of COVID-19 were less likely self-restraint from most social behaviors. People whose acquaintance had been diagnosed with COVID-19 were significantly more likely to refrain from most social behaviors. There was no significant difference in any social behaviors for people with a history of close contact only.To maximize the effect of a state of emergency, health authorities should disseminate information for each person in the target population, taking into account potential differences related to the infection related experiences. The coronavirus disease 2019 (COVID-19) has been spreading worldwide since 2019. The known routes of COVID-19 infection include droplet infection, aerosol infection, and contact infection, so many infections occur in places where people gather or are in close physical contact [One of effective control measures for COVID-19 infection is to reduce opportunities for people to go to places where people gather or have close physical contact with others , and theThe effectiveness of such lockdown policies and states of emergency is likely to be influenced by how much the citizens actually refrain from social behaviors such as outing and gathering. Some studies have been conducted on sociodemographic factors that influence on social behaviors. Women, older people, highly educated people, and high-income earners are reported to more likely to refrain from social behaviors during a lockdown \u201314. HoweCOVID-19 infection related experiences may also influence the effectiveness of lockdown policies and states of emergency. COVID-19 infection related experiences can be classified into (1) people with a history of infection, (2) people with a history of close contact, and (3) people with acquaintances who have been infected. It was reported people who thought they had had COVID-19 were more likely to think that they had some immunity to the virus and were less likely to adhere to social distancing measures . ConversIndividual behavior is known to be influenced by the behavior of others, and they sometimes choose bad behavior , so it in\u2009=\u200933,087) were aged 20\u201365\u00a0years and employed at the time of the baseline survey. Respondents to the CORoNaWork study were sampled taking into account region, occupation, and sex. After excluding 6,051 initial subjects who provided invalid responses, we ultimately included 27,036 in the database. Invalid responses were determined as follows: response time\u2009<\u20096\u00a0min, body weight\u2009<\u200930\u00a0kg, height\u2009<\u2009140\u00a0cm, inconsistent answers to similar questions, and wrong answers to a question used solely to identify unreliable responses.This prospective cohort study was undertaken by a research group from the University of Occupational and Environmental Health, Japan, called the Collaborative Online Research on Novel-coronavirus and Work study (CORoNaWork study). This survey was conducted as a self-administrated questionnaire by the internet survey company Cross Marketing Inc. . The baseline survey was conducted on December 22\u201325, 2020, and the follow-up survey was on February 18\u201319, 2021; both periods were during the third wave of the pandemic in Japan. Details of the study protocol have been previously reported [These subjects were given a follow-up survey, and 19,941 people responded (74% follow-up rate). We excluded five participants who gave an inappropriate age and 885 participants who gave incorrect answers to a question that were only used to identify unreliable answers in the follow-up survey. Finally, 19,051 participants were included in the analysis. The flow diagram is shown in Fig.\u00a0The present study was approved by the Ethics Committee of the University of Occupational and Environmental Health, Japan . Informed consent was obtained in the form of the website from all participants.We identified eight social behaviors which the Japanese government requested for self-restraint : (1) eatIn the baseline survey, we asked participants three questions about their COVID-19 infection related experiences: \u201cHave you ever been infected with COVID-19?\u201d, \u201cHave you ever been in close contact with someone with COVID-19?\u201d, and \u201cDo you have an acquaintance who has been infected with COVID-19?\u201d Respondents answered each question with \u201cYes\u201d or \u201cNo\u201d, and were classified into the four following types: people with a history of COVID-19; people without history of COVID-19 but with a history of close contact with cases of confirmed COVID-19 (hereinafter referred to as people with a history of close contact); people without a history of COVID-19 or close contact with cases of confirmed COVID-19 but who had an acquaintance who had been diagnosed with COVID-19 (hereinafter referred to as people whose acquaintance had been diagnosed); and people without history of COVID-19 or close contact with cases of confirmed COVID-19, and who did not have an acquaintance diagnosed with COVID-19 (hereinafter referred to as people without history of COVID-19 or close contact).Covariates included demographics, socioeconomic factors, job type, underlying disease, and prefectures with and without the second state of emergency. Age was expressed as a continuous variable. Education was classified into three categories: junior high or high school, vocational school or college, and university or graduate school. Marital status was classified into three categories: married, divorced or widowed, and never married. Equivalent income was classified into four categories:\u2009<\u20092.50 million Japanese yen (JPY); 2.50\u20133.74 million JPY; 3.75\u20135.24 million JPY; and\u2009\u2265\u20095.25 million JPY  . Job typMultilevel logistic regression analyses were used to examine the association between COVID-19 infection related experience and self-restraint from social behaviors after the second state of emergency. An analysis was performed on each of the eight social behaviors. We estimated age-sex adjusted odds ratios (ORs) and multivariate adjusted ORs for each social behaviors using multilevel logistic regression analyses nested in the prefecture of residence to take account of regional differences in the infection status of COVID-19. The model included age, sex, education, marital status, equivalent income, job type, underlying disease, and prefectures with and without the second state of emergency. A p-value of less than 0.05 was considered statistically significant. All analyses were conducted using Stata Statistical Software .Table Table We examined the association of COVID-19 infection related experiences with self-restraint from social behaviors during the second state of emergency. People with a history of COVID-19 reported significantly lower self-restraint from social behaviors than did people without a history of COVID-19 or close contact, except regarding shopping for daily necessities. Visiting home was also not significant but self-restraint tended to be less. People whose acquaintance had been diagnosed were significantly more likely to refrain from social behaviors except for shopping for daily necessities. The results of people with a history of COVID-19 and people whose acquaintance had been diagnosed were similar to what we had expected. It has been shown that risk perception for infection is involved in infection prevention behavior \u201325.Risk perception for infection includes perceptions of the possibility and severity of infection . The reaConversely, people whose acquaintance had been diagnosed were considered to have increased risk perception. A survey of Japanese people showed that the risk to oneself is underestimated than the risk to society when comparing the degree to which one feels dangerous to oneself and the degree to one feels dangerous to society for the same infectious disease . HoweverFor people with a history of close contact, the results were different from our assumptions, and no significant difference was observed in any of social behaviors. The reasons for this result are not clear from this survey, but it is possible that there were both those who refrained from social behaviors and those who did not. In Japan, epidemiological surveys are conducted by health centers on each infected person, and close contacts are identified. After certification, close contacts undergo an RT-PCR test to check for infection and are quarantined at home for 14\u00a0days at the time of our survey, even if negative . As mentRegarding the specific aspects of social behaviors, for shopping for daily necessities, neither people with a history of COVID-19 nor people whose acquaintance had been diagnosed showed a significant difference compared with people without history of COVID-19 and close contact. This may be because shopping for daily necessities is a daily activity necessary for daily life, unlike other social behaviors. Regarding eating out, similar results were seen in eating out with four people or fewer and with five or more, suggesting that they have a similar perception of the risk of infection.Our results suggested that it is necessary to pay attention not only to sociodemographic factors that have already been investigated \u201316, but There are several limitations to this study. First, we conducted an internet survey, which includes the possibility of selection bias. However, sampling was balanced by sex, occupation, and area of residence at the start of the study to reduce the potential for bias. Second, we classified the COVID-19 infection related experience using data from the baseline survey, so there may have been new people infected, close contacts, and people whose acquaintance had been diagnosed until January 2021 when the second state of emergency was declared. However, the ratio in each category implies that the number of newly applicable people was very small, and the period between the baseline survey and the second state of emergency was short, so we believe that it was unlikely to have a significant impact on the results. Third, we did not confirm the timing of the COVID-19 infection related experiences. For example, people who were recently infected may have thought that they were at lower risk of reinfection. There may be differences in risk perception depending on timing of the infection related experiences, but we have not taken this into account. Fourth, the outcome of interest in this survey was a decrease in self-restraint, the degree of social behaviors before the state of emergency and the specific degree of self-restraint during the declaration was not investigated. It may have been possible to clarify the impact of infection-related experiences on self-restraint in social behavior by confirming changes in social behaviors before and after the state of emergency, but we did not investigate the social behaviors before the declaration. In addition, those who had not done social behaviors at all before the second state of emergency was declared were included in the group who did not respond to self-restraint. However, the movement of people during the non-declaration period does not appear to have been significantly suppressed compared with before the COVID-19 epidemic . This imOur results show that the level of self-restraint from social behaviors due to a state of emergency differs depending on a subject\u2019s experiences related to COVID-19 infection. When declaring a state of emergency in response to COVID-19 or other new infection pandemics in the future, in order to maximize the effect of the declaration, officials should consider measures that focus on the infection related experiences, such as disseminating information in a way that makes the infection feel more familiar."}
+{"text": "Recent studies have shown that obesity is largely influenced by heredity and created by the interactions between several genes and environmental and behavioral factors. This study aimed to examine association between variant rs17782313 near melanocortin-4 receptor (MC4R) gene and behavioral and hormonal factors then evaluated interactions between variant MC4R rs17782313 with behavioral and hormonal factors on obesity.This cross-sectional study included 403 subjects, overweight and/or obesity, aged 20\u201350\u00a0years from Iran. The MC4R rs17782313 data were measured by the PCR\u2013RFLP method. Dietary intake, physical activity, stress, anxiety, depression, appetite and emotional eating were assessed by using validated questionnaires. Ghrelin, glucagon-like peptide-1 and cortisol were measured by radioimmunoassay in plasma samples. Participants were also divided into three groups based on rs17782313 genotype and BMI.p \u02c20.05). Also, significant interactions were observed between fat intake (p-interaction\u2009=\u20090.002), protein intake (p-interaction\u2009=\u20090.01), energy intake (p-interaction\u2009=\u20090.01), emotional eating (p-interaction\u2009=\u20090.02), appetite (p-interaction\u2009=\u20090.04), stress (p-interaction\u2009=\u20090.04), ghrelin (p-interaction\u2009=\u20090.03), cortisol (p-interaction\u2009=\u20090.04) and physical activity (p-interaction\u2009=\u20090.04) and MC4R rs17782313 in terms of BMI.After adjustment for age, gender, energy intake and PA, significant associations were observed between food intake, appetite, emotional eating, stress and physical activity with MC4R rs17782313 (Interactions between the CC genotype and high intakes of fat and energy, emotional eating, high appetite, and too much stress with high levels of cortisol and ghrelin probably can have an effect on BMI in overweight/obese subjects.The online version contains supplementary material available at 10.1186/s12902-022-01129-w. Obesity has become a worldwide epidemic and still rising at an alarming rate. It can dramatically affect the quality of life and increase the risk of metabolic disorders including diabetes, hypertension, and cardiovascular complications . ObesityEvidence suggested that brain melanocortinergic system especially MC4R has a well-established role in stress-induced changes, behavioral responses to stress and stress-related psychological disorders . GlucocoThe glucagon-like peptide-1 (GLP-1) is a gut-brain hormone that coordinates several prandial and postprandial metabolic functions, including gastric emptying, incretin effect and satiation , 21. TheA limited number of studies have examined the association between MC4R rs17782313 polymorphism and obesity-related behaviors as well as the interaction of these factors with MC4R rs17782313 on obesity. Therefore, we decided to investigate the association of MC4R rs17782313 polymorphism with food intake, emotional eating, appetite, appetite hormones, physical activity, stress, and stress hormone. Furthermore, potential interactions between above factors and MC4R rs17782313 for obesity have been also tested. Considering that previous studies have identified this polymorphism as the most significant MC4R polymorphism associated with obesity, the research focused only on obese and overweight individuals.2 \u02c2 BMI \u02c2 40\u00a0kg/m2) within the age range of 20\u201350\u00a0years were included in this cross-sectional study. The study population was collected from all regions of Zahedan, using community-based sampling and cluster sampling. Patients receiving thermogenic or lipogenic drugs, or those diagnosed with diabetes mellitus, chronic renal failure, hepatic diseases, hyperthyroidism, hypothyroidism or cancer were excluded from the study. All subjects were genotyped for the near MC4R rs17782313, using a Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR\u2013RFLP) of their MC4R genotypes. The data were collected from June to October 2019. The study was approved by Ethics Committee of Tehran University of Medical Sciences (NO: IR.TUMS.VCR.REC.1398.260). All participants were informed of the study nature and gave written consents. The study was conducted at the Department of Cellular-Molecular Nutrition, TUMS.Two hundred twelve men and 191 women healthy overweight or obese . Genomic DNA was extracted from whole blood using the GeneAll, Exgene\u2122Cell SV kit  based on the constructor's protocol. DNA fragment containing a thymine-to-cytosine (T \u02c3 C) substitution in 188\u00a0kb downstream of MC4R gene was genotyped by PCR\u2013RFLP as follows. The PCR amplification of the genomic DNA fragment for MC4R was performed by the forward primer 5\u2032 AAG TTC TAC CTA CCA TGT TCT TGG 3\u2032 and reverse primer 5\u2032 TTC CCC CTG AAG CTT TTC TTG TCA TTT TGA T 3\u2032  , 27. TheBlood samples were collected from all subjects in the morning, after 10 to 12\u00a0h of fasting and were centrifuged at 4\u00a0\u00b0C, and the plasma was stored at -80\u00a0\u00b0C for subsequent analysis. Plasma GLP-1 , ghrelinWe collected general information, such as age, educational level, marital status, and history of weight loss in recent years using standard questionnaires. Weight and height were measured using the Seca scale  with light clothing and no shoes on. BMI was calculated as the weight in kilograms divided by the square of height in meters. Waist circumference (WC) was measured midway between the iliac crest and the lower costal margin along with hip circumference (HC) and waist-to-hip ratio (WHR) was calculated as WC/HC. All anthropometric measurements were taken in accordance with World Health Organization standards . The offDietary intakes were assessed by expert dietitians using a validated, 3-day food record . The parVisual analogue scales (VAS) of 100\u00a0mm in length were fill out for assessment of self-reported appetite sensations while fasting . An overall appetite suppression score was calculated based on four appetite parameters using the following formula (satiety\u2009+\u2009fullness\u2009+\u2009[100 \u2013 hunger]\u2009+\u2009[100 \u2013 prospective food consumption])/4, with 0 indicating higher appetite/less satiety and 100 indicating lower appetite/more satiety (primary assessment of the self-reported appetite sensations) .The self-report Emotional Eating Questionnaire (EEQ) was used at the beginning of the program to assess emotional eating behavior. This tool has been directly developed and validated in a Spanish population consisting of overweight and obese people . This 10Depression, anxiety, stress scale-21 (DASS-21) which is a validated questionnaire  was utilStatistical analysis was carried out by using SPSS software for Windows (version 26) . The normality of variable distribution was tested by the Kolmogorov\u2013Smirnov test. A chi-square test was used to assess Hardy\u2013Weinberg equilibrium. Association between variables and MC4R rs17782313 genotypes was analyzed in different groups. One-way ANOVA and kruskal\u2013wallis were used to compare continuous variables among different genotypes with normal and abnormal distribution, respectively.The difference between distribution of macronutrients  and energy in study groups was calculated with regard to age and sex using analysis of covariance (ANCOVA) method according to 3 genotypic groups of MC4R rs17782313 after adjustment. The categorical variables were analyzed by using chi-square test. Any significance relationship between variables was further investigated with regression analysis.Relationship between appetite factors, cortisol, food intakes and physical activity with different MC4R genotypes in study groups was determined using multivariate linear regression. The results of linear regression were presented as (\u03b2) coefficients and confidence intervals (95% CI). Also, the relationship between emotional eating, stress, anxiety and depression with different MC4R genotypes in study groups was performed using logistic regression. The results of logistic regression were presented as odds ratio (OR) and 95% CI. In regression analysis, in the crude model, the raw relationship (without adjust) of variables with genotypes was examined and in the first model, this relationship was adjusted for age, sex, and energy intake. In the second model, this relationship was adjusted for age, sex, energy intake, marital status, smoking status, occupation, education, and physical activity. To examine the interaction between the MC4R rs17782313 variants and behavioral and hormonal factors on obesity, logistic regression models were used for interaction terms in addition to the potential confounders. P-value \u02c2 0.05 was considered statistically significant.The present study examined research variables in three groups: overweight, obese, and the entire population  based on three genotypic groups: TT, CT, and CC. The goal of this grouping was to examine\u00a0the separate relationships between overweight, obese, and the entire\u00a0population and study variables.p \u02c2 0.001). The means and standard deviation (SD) of age, weight, BMI, and WC of total, overweight and obese subjects were , , , and , respectively.The frequency of minor allele of MC4R is 44%. The distribution of MC4R rs17782313 genotypes  is not in Hardy\u2013Weinberg equilibrium (p \u02c20.001) and obese subjects (p\u2009=\u20090.008), waist circumference of individuals with obesity (p\u2009=\u20090.03) and all subjects (p\u2009=\u20090.001) and WHR of all participants (p\u2009=\u20090.02) between different genotypes of MC4R. However, no significant differences were found in other anthropometric variables between different genotypes of MC4R rs17782313. A statistically significant difference was found in physical activity of different genotypes of MC4R rs17782313 in individuals with obesity (p\u2009<\u20090.001) and all subjects (p\u2009<\u20090.001) (Table The baseline characteristic of subjects according to MC4R rs17782313 genotypes is given in Table p \u02c20.001).Table p \u02c20.05). TT genotype experienced lower level of stress and depression than C-allele carriers   Table .p \u02c20.05). There was also a statistically significant difference between GLP-1 (p\u2009=\u20090.03) and cortisol levels (p\u2009=\u20090.002) in different genotypes of MC4R rs17782313 in individuals with obesity  and all participants (p\u2009=\u20090.007). CC genotype carriers had higher intake of energy than TT carriers. A statistically significant difference was also found between mean intake of carbohydrate and different genotypes of MC4R rs17782313 in all subjects (p\u2009=\u20090.01) . There was a statistically significant difference between mean intake of fat and different genotypes of MC4R rs17782313 in all study groups (p \u02c20.001). TT genotype carriers had lower intake of fat than CC and CT genotype carriers . A significant difference was also found in carbohydrate intake of CC carriers compared to TT carriers in all study groups according to Model 2. Carbohydrate intake in CC carriers in overweight people, CC carriers in individuals with obesity, and CC and CT carriers in all participants was less than TT genotype carriers by (-18.69), (-27.3), (-21.13), and (-9.54) units respectively.Table p: 0.01). However, according to Model 1, both CC and CT carriers showed a lower intake of protein than TT genotype carriers in the total sample population  (Supplementary Table p\u2009=\u20090.002). However, after stratification of the population into overweight and obese the results remained significant in the obese individuals (p\u2009=\u20090.04). (Supplementary Table p\u2009=\u20090.04). A significant and positive relationship was found between CC carriers and cortisol level in individuals with obesity in Model 2 after adjustment for confounders (p\u2009=\u20090.04)  carriers scored lower in visual analogue scale and had higher appetite than TT genotype carriers in all study groups (p \u02c20.05). However, after stratification of the population into overweight and obese the results remained significant in the CC genotype obese individuals  . The results of logistic regression analysis showed no statistically significant relationship between anxiety and MC4R rs17782313 genotypes in all study groups. There was also a statistically significant difference between CC genotype and stress in individuals with obesity according to Model 2. Stress level of CC carriers was 23% higher than TT carriers in individuals with obesity (Table In Table p \u02c2 0.05)   Table .Table 5Ip\u2009=\u20090.002). However, high carbohydrate intake and MC4R rs17782313 were not risk factor for obesity (p \u02c3 0.05). Interaction of high protein intake and CT genotype was a significant risk factor for obesity (p\u2009=\u20090.01). High protein intake reduced obesity risk by 17% in CT heterozygotes. Physical activity reduced obesity risk by 14% in CT heterozygotes (p\u2009=\u20090.04) (Table There was a significant interaction between high fat intake and CC genotype. The interaction increased the risk of obesity by 23.43 in CC genotype (y p \u02c3 0.0. Interacp\u2009=\u20090.02). CC genotypes were more likely to show emotional eating behavior, which increased obesity risk by 8.82 times. The interaction of depression and anxiety with MC4R rs17782313 was not significant (p \u02c3 0.05) (Table p\u2009=\u20090.04). The risk of obesity was 4.31 times higher in CC genotype carriers who experienced high level stress. The interaction of CC genotype and appetite increased obesity risk by 55% (p\u2009=\u20090.04). Ghrelin and cortisol levels were significantly higher in different MC4R rs17782313 genotypes. High ghrelin level increased obesity risk in CC genotype by 26% (p\u2009=\u20090.03). In turn, high cortisol level increased obesity risk in CC genotype by 9% (p\u2009=\u20090.04). There was no significant interaction between low levels of GLP-1 and MC4R polymorphism (p \u02c3 0.05)  is an important genetic factor in obesity that disrupts energy homeostasis . This st7782313 iMinor allele frequency (MAF) of MC4R polymorphism (rs17782313) varied from 25% to 31.6% in some populations , 38\u201340. Khalilitehrani et al.  showed aExperimental studies showed that loss of MC4R function is associated with overeating, hyperinsulinemia, and obesity. Despite similar food intake, these studies have shown that C-allele carriers gain more weight than homozygous dominant in mice. It was suggested that C-allele carriers had lower energy expenditure than energy intake and gained more weight . These r. found out that carriers of C-allele in MC4R polymorphism had high plasma levels of ghrelin, but they found no difference in the appetite of their study groups [. did not find any significant difference in ghrelin levels between C-allele and T-allele carriers in MC4R gene [Many studies have reported the association between MC4R variants and obesity, especially rs17782313 . Appetity groups . ArizablC4R gene . Differe. showed that C-allele in rs17782313 variant was associated with increased emotional eating behaviors and food craving [There is not adequate information on the mechanism of MC4R rs17782313 and high BMI. Few studies have assessed the role of eating behavior in the association of MC4R rs17782313 with BMI. This study showed an association among minor allele carriers in all participants and CC genotype in obese people with emotional eating. The results showed that emotional eating behavior in CC genotype is a risk factor for obesity. This is an interesting finding. An imaging study offered preliminary evidence for the involvement of MC4R in emotional eating . Yilmaz  craving . The ass craving . Dopamin craving , 60. Man craving .. found out that the interaction of C-allele in MC4R gene with high stress was a risk factor for obesity [Many studies showed that MC4R expression in the hypothalamus leads to excessive energy intake. Stress activates hypothalamic\u2013pituitary\u2013adrenal (HPA) axis that regulates energy balance . This wa obesity . There w obesity . Neverth obesity .\u03b1-Melanocyte-stimulating hormone (\u03b1-MSH) that consequently increases MC4R levels. MC4R activates the HPA axis and adrenocorticotropic hormones (ACTH) which increase the release of cortisol in response to stress [Acute stress activates POMC, which releases o stress . Variouso stress .Several limitations of the current study should also be considered. First, Similar to Jeffery's study on interleukin-18 polymorphism, genotypes were not in Hardy\u2013Weinberg equilibrium. This may have been due to the small sample size resulting from time and financial constraints. Therefore, future studies are recommended to work with larger sample sizes . Second,In conclusion, this study for the first time produced initial evidence that there may be an interactive effect between food intake, behavioral and hormonal factors and the MC4R rs17782313 genotypes on BMI. We found that adherence to a high-energy and fat diet and low protein diet in subjects with the C allele of MC4R rs17782313 is related to a higher BMI. These data also emphasize that individuals with the C allele of rs17782313 in MC4R with a high-emotional eating, appetite, stress, cortisol, ghrelin and low physical activity had higher BMI; in fact, these subjects are more susceptible to being overweight/obese. Additional studies are needed by including the clinical level to clear up the biology of MC4R rs17782313 and its impact on the relationship between behavioral and hormonal factors and degree of obesity.Additional file 1: Supplementary Table 1. Association of MC4R variant rs17782313 with appetite and biochemical parameters in general linear models. Supplementary Table 2. Association of MC4R variant rs17782313 with physical activity in general linear models."}
+{"text": "Lichen planus is a chronic disease affecting the skin, appendages, and mucous membranes. A cutaneous lichen planus is a rare disease occurring in less than 1% of the general population, while oral illness is up to five times more prevalent; still, both forms equally impair the patient\u2019s quality of life. The etiology of lichen planus is not entirely understood. Yet, immune-mediated mechanisms have been recognized since environmental factors such as hepatitis virus infection, mechanical trauma, psychological stress, or microbiome changes can trigger the disease in genetically susceptible individuals. According to current understanding, lichen planus immunopathogenesis is caused by cell-mediated cytotoxicity, particularly cytotoxic T lymphocytes, whose activity is further influenced by Th1 and IL-23/Th-17 axis. However, other immunocytes and inflammatory pathways complement these mechanisms. This paper presents a comprehensive insight into the actual knowledge about lichen planus, with the causal genetic and environmental factors being discussed, the immunopathogenesis described, and the principal effectors of its inflammatory circuits identified. Lichen planus (LP) is a chronic, immune-mediated, mucocutaneous inflammatory disorder . The claAlthough the cutaneous disease has numerous clinical variants, its typical form is the classic LP, presenting with small, sharply demarcated, flattened and polygonally shaped erythematous-livid papules, which may coalesce as the disease progresses . A promiOral LP (OLP) occurs in about 70% of patients with classic skin disease, while in 20\u201330% of patients it represents the only manifestation of the illness. Although it can appear in six different forms, the reticular one predominates and is followed by the erosive form, characterized by pain, chronic, recalcitrant course, and possible malignant transformation into squamous cell carcinoma ,7. In adRecent studies have shown that patients with LP will more likely suffer from certain comorbidities ,11. The The cause of LP has not been fully determined; however, genetic and environmental factors are thought to play a significant role in the onset of the disease .Genetic predisposition to disease was first suspected after noticing the LP presence in identical twins and 10% of the patients\u2019 first relatives . This obCandida and Malassezia mycotypes in instigating the LP antigen expression and consequential Th17 lymphocytes\u2019 reaction [Solobacterium, Fusobacterium, Porphyromonas, Prevotella, Candida, Aspergillus, Alternarium, tick-borne encephalitis virus, brochotrix bacteriophage virus and bacillus virus SPO1 and lower levels of Streptococci, Actinobacteria and Firmicutes compared to healthy controls [Since the clinical course of the classic cutaneous LP is mainly marked by the acute beginning of one episode of the disease and its self-limiting nature, the microorganisms were often suspected as an LP causative agent. The association of LP with hepatitis C virus (HCV), which is up to thirteen times more common in LP patients, is best studied and verified by the results of several reports and meta-analyses conducted during the last decades ,29,30,31reaction . Furthercontrols ,56. Sinccontrols ,56.phosphodiesterase (PD)-1 inhibitors, and biologicals such as anti-TNF-\u03b1 and dupilumab, can induce lichenoid reactions [However, in addition to microbial factors, it has been shown that OLP can be caused by contact allergens, primarily dental filling metals, such as mercury and gold ,58,59, weactions ,67,68,69eactions . Likewiseactions ,72. It heactions ,74,75.According to recent research, succinate accumulates in the tissues and cells, and upregulation of the mTOR glycolysis pathway indirectly causes apoptosis, meaning metabolic change may be a significant causative factor in LP .Cutaneous LP is a rare dermatosis whose etiopathogenesis has yet to be fully elucidated since animal or human investigations on this disease are generally missing. The LP pathogenesis is, in a certain part, similar to that of another related disease, psoriasis . NeverthLP initiation, maintenance, and progression heavily depend on antigen-focused action, while the nonspecific and humoral mechanisms complement it to a lesser extent . Based oIn the progression phase, T1 and T17 lymphocytes, expressing skin-homing receptors, leave the bloodstream and migrate to the inflammation site, attracted by innate cells-derived cytokines and chemokines and facilitated by increased expression of adhesion molecules, such as LFA-1, ICAM-1 and VCAM-1, and basement membrane extracellular matrix proteins . Memory In addition to effector cells arriving by blood, the condition is further complicated by the tissue-resident memory T cells (TRM). TRM form a local skin reservoir of chronic inflammation since they can be repeatedly activated at the previous inflammation site, causing LP reactivation and flare . The regThe action of mast cells, chemokines and matrix metalloproteinases (MMPs) contributes to nonspecific immune mechanisms . In the DCs play a central role in antigen presentation and T-cell response control . All DC Macrophages are attracted to the lesional tissue by chemotactic signals and are found in increased numbers in LP changes ,98,99. PThe inflammatory infiltrates of the developed LP lesions composed of T lymphocytes with \u03b1\u03b2-TCR, located at the dermal-epidermal border, causing epidermal damage is the hallmark of the disease . The CD4CD4+ T lymphocytes can recognize antigens within MHC-II molecules presented by APC or keratinocytes in the early phase of LP and, upon activation, they release cytokines that mobilize inflammatory cells but also mediate the CD8+ T lymphocytes activation and control their cytotoxicity . The incIncreased concentrations of Tregs were found in the lesional tissue and the blood of the LP patients compared to healthy controls, suggesting that a balance among the various lymphocyte subtypes could influence the clinical behavior of the disease ,92,99. FA possible Th17 lymphocyte plasticity change based on the surrounding milieu, as well as delicate balance and interconnections between Th1, Th17 and Treg lymphocytes, could have a decisive contribution to the LP pathogenesis .The CD56dimCD16- population of NK cells, which possesses cytotoxicity and TNF-\u03b1, IFN-\u03b3, IL-22, and IL-17 production properties, was found in the lamina propria of OLP lesions and formed up to 10% of inflammatory infiltrate of LP skin lesions ,113. In Keratinocytes are the target cells of programmed cell death or apoptosis, which is a prominent pathohistological feature of LP lesions . AlthougMast cells have been found in greater numbers in the lesional lamina propria and near the basement membrane destruction . They haPolymorphonuclear neutrophils (PMNs) are an essential component of innate immunity with a primary function in anti-microbial host protection. However, they can be involved in the pathogenesis of inflammatory and autoimmune diseases. The data on the PMNs\u2019 role in LP are scarce, but a recent investigation by Khattab et al. demonstrated elevated serum levels of neutrophil activation marker calprotectin in LP patients . CalprotMost studies on patients\u2019 tissue and peripheral blood samples have indicated that the Th1-immune response dominates in LP . IFN-\u03b3 iThe combined effect of IFN-\u03b3 with TNF-\u03b1 is particularly pronounced in the cutaneous LP. TNF-\u03b1 is produced by various cells, including T lymphocytes, NK cells, DC cells, macrophages, keratinocytes, and mast cells . The dirIL-12, whose primary source in LP are DCs, promotes disease by stimulating the IFN-\u03b3 and IL-2 production by CD4+ T lymphocytes, ultimately leading to the activation of CD8+ T lymphocyte and NK cell cytotoxicity . It is aA recent study revealed a high expression of IL-21 in LP. This cytokine stimulates the differentiation and function of CD4+/CD8+ T cells, Tfh lymphocytes and NK cells, and its expression is regulated by IL-12, IL-6 and IL-21, all of which were found upregulated in the skin of LP patients . A high IL-23 is mainly produced by DCs and macrophages and is thought to be the central cytokine of many inflammatory diseases . After bExcessive IL-23 and IL-17 expression in revealed LP patients compared to controls suggest a potential role of the IL-23/Th-17 axis in the LP pathogenesis. Indeed, several studies have already recognized IL-17 as a critical mediator of LP immunopathogenesis . AlthougWhile high serum levels of antibodies to antidesmoglein-1 and antidesmoglein-3 have been found in patients with erosive OLP and the globular IgM deposits have been confirmed by immunofluorescence studies, it is thought that B lymphocytes and humoral immunity contribute to LP to a smaller extent . One immLP is a papular, immune-mediated dermatosis. Although it can manifest as a persistent disease affecting mucous membranes, skin appendages, and other organ systems, the classic cutaneous LP is typically a self-limiting disease with a good prognosis. The pathogenesis of LP has only recently begun to be intensively studied, and its cause is mostly undetermined. Nonetheless, according to current knowledge, cytotoxic mechanisms of cellular immunity make the critical part of LP immunopathogenesis, while the Tc influence is complemented by the action of the Th1 and Il-23/Th-17 axis. Besides the main LP effectors, i.e., Tc, Th1 and Th17 lymphocytes, other participants such as DCs, keratinocytes, NK cells, macrophages, mast cells, and Tregs also form a part of this complex inflammatory network. Recent data indicate the role of antibodies in LP pathogenesis; therefore, initiation, maintenance, and progression of LP are obviously mediated by the close interaction of both cellular and humoral immunity. Still, more investigations are needed to unravel the tangle of LP inflammation and precisely explain the nature of its immune dysregulation. Considering the therapeutic resistance of individual LP types, elucidation of immunopathogenetic mechanisms will undoubtedly contribute to developing and implementing targeted therapy that could reduce clinical symptoms and the negative impact of disease on patients\u2019 QoL, and potentially benefit comorbidities."}
+{"text": "To assess whether more than one Epley\u2019s maneuver in the same session, compared to a single one, decreases the number of sessions necessary to suppress positional nystagmus.Epley\u2019s maneuver was done in 123 patients with BPPV due to unilateral posterior semicircular canal canalolithiasis. The number of sessions for positional nystagmus suppression was compared in two groups of patients. Group I consisted of 75 patients submitted to a single Epley\u2019s maneuver on weekly sessions and group II consisted of 48 patients that were submitted to four Epley\u2019s maneuvers during the first session.Group II showed greater nystagmus latency and duration than group I (p<0.05). The number of sessions and standard deviation showed by group I was greater than in group II (p=0.008). We observed a significant association between number of sessions and group (p=0.039) studied. Group II had 21.4% more nystagmus-free patients following only one session (CI95% [7.7% - 35.1%]).Repeated Epley\u2019s maneuvers in less sessions rendered more positional nystagmus-free patients when compared to those submitted to more sessions of single maneuvers. Benign paroxysmal positional vertigo (BPPV) is the most common cause of peripheral vertigoSymptoms were present for an average of 30 months before therapeutic intervention in patients with BPPVBPPV is characterized by brief spells of vertigo, nausea and/or positional nystagmus at head position changeBPPV may be triggered by a head injury, infectious labyrinthitis, vertebro-basilar insufficiency, after ear surgery, endolymphatic hydrops, vestibular neuritis, or middle ear disease; however, in most of the cases it is idiopaticAs to the physiopathology, there are two theories: cupulolithiasis, in which statocone debris are attached to the cupullaThe theory of posterior canal canalolithiasis is considered the most convincing one, explaining BPPV\u2019s pathogenesis and one that is supported by the efficiency of specific therapeutic maneuversBPPV most frequently affects the posterior semicircular canalThe canal involved may be identified by the very characteristics of the positional nystagmus. Nystagmus and vertigo usually happen after a latency of some seconds, has a limited duration and is fatigable by repeating the provocative maneurverIn BPPV, vertigo may happen dissociated from nystagmus. Nystagmus may be absent because of interferences of habituation processes, or because the triggering head movement is enough to cause vertigo, however does not reach the necessary stimulation threshold to trigger ocular movementBPPV may resolve spontaneously in untreated patientsBPPV may be treated with the use of therapeutic maneuvers, that would move the statocone debris back to the utricleIn the posterior semicircular canal BPPV, different therapeutic approaches used one single Epley\u2019s maneuver per sessionThe original proposal of particles repositioning for the treatment of BPPV in the posterior semicircular canal already advocated procedure repetition in the same session, from one to five times, until nystagmus was no longer seen; the procedure should be repeated weekly, until both vertigo and nystagmus stopWe proposed repetitive maneuvers in one single session, until nystagmus was no longer seenPatients with posterior canal canalolithiasis underwent repositioning maneuver repetition in one single session. When the Dix-Hallpike test became negative 20 minutes after the maneuver, the treatment was considered a success, and when it remained positive, a second maneuver was carried out after 20 minutes. Following, if the positional nystagmus persisted, up to four additional maneuvers were carried out in the same session, which were well tolerated by the patients. We did not find statistically significant differences in efficacy between one single session of repeated maneuvers and one session with one single maneuver. The elimination of vertigo and nystagmus with maneuvers repetition in the same session is clinically more convenient, because it allows to show the patient the treatment efficacy for there is a progressive symptoms improvement during the procedure.Facing the scarcity of related studies in this area, there was this interest in verifying the clinical evolution of patients with BPPV submitted to the Epley\u2019s maneuver repeated in the same session.The goal of the present investigation is to assess repeated Epley\u2019s maneuver in one same session and see if it results in less sessions necessary to completely abolish positional nystagmus when compared to one single Epley\u2019s maneuver per session.This prospective case-controled study, approved by the Ethics in Research Committee, includes 123 patients with vertigo and diagnostic hypothesis of BPPV.1)anterior or lateral semicircular canal involvement;2)nystagmus lasting for more than 1 minute, characterizing cupulolithiasis;3)signs and symptoms of central nervous system involvement;4)hearing involvement, unless if matching criteria for presbycusis;5)bilateral involvement of posterior semicircular canal;6)physical restrictions that would prevent the diagnostic or treatment maneuvers;7)patients with dizziness only, without positional at the diagnostic maneuver;8)use of medication that could influence the vestibular system.We included patients with BPPV by unilateral posterior semicircular canal canalolithiasis who complained of vertigo and positional nystagmus of latency and duration of less than 1 minute and fatigable at the Dix-Hallpike test. Exclusion criteria in the study were:For the positional nystagmus investigation we carried out the Dix-Hallpike testThe patient\u2019s ocular movements were observed with the help of Frenzel\u2019s goggles. The test was started at the position that triggered the vertigo and/or the nystagmus, according to information obtained from each patient. If the patient did not know how to report on which position would be responsible for vertigo onset, the maneuver started on the right side.Patients were classified according to the posterior semicircular canal involved, indicated by the nystagmus triggering position and its direction. Treatment involved maneuvers to reposition statocones according to the semicircular canal involved. Epley\u2019s maneuver was used, without the mastoid vibrator or patient sedation. The first maneuver was carried out immediately after neurotologic assessment.Patients were subdivided in two groups. Group I was made up of patients who underwent one single Epley\u2019s maneuver per weekly session, until positional nystagmus cessation at the Dix-Hallpike maneuver. Group II was made up of patients who underwent four Epley\u2019s maneuvers in the first session, at two minute intervals, to one maneuver per week until positional nystagmus cessation at the Dix-Hallpike test. Both groups were compared in terms of clinical development. We considered the number of statocones re sessions necessary to eliminate positional nystagmus at the Dix-Hallpike test.The data underwent statistical analysis. Qualitative analysis were expressed as as number and percentage and the quantitative ones as mean \u00b1 standard deviation for age, and as median (minimum and maximum) for months since symptoms onset, latency and nystagmus duration.Chi-squared test was used to assess the association between qualitative variables, and, in those cases in which one of the frequencies expected were bellow five, we used the Fisher\u2019s Exact Test, or its generalization. The student t test was used to compare the mean values and, in those cases in which data normality assumption was not met, we used the Mann-Whitney test. 5% was the significance value used, in other words, results with a p-value bellow 5% (p<0.05) were considered significant. Statistically significant results were marked with an asterisk.The study sample was made up of 123 patients, being 75 (61.0%) in group I and 48 (39.0%) in group II.According to According to According to One female patient from Group II had nausea and vomit right at the first session and was taken off the sample. In order to compare the number of sessions carried out, the groups were made up of 75 (61.5%) patients in group I and 47 (38.5%) in Group II.The sample power with 75 patients in group I and 47 patients in Group II was of 80.0% in order to detect a difference of 0.214 between the null hypothesis, in which the proportion of patients who needed only one session in both groups was of 0.680 and the alternative hypothesis, in which the proportion in Group II was of 0.894, using the chi-squared test with a significance level of 5%.In this study, group I, made up of patients who underwent one single Epley\u2019s maneuver per weekly session until total remission of positional nystagmus and group II, made up of patients who underwent four Epley\u2019s maneuvers in the first session and one weekly maneuver until positional nystagmus remission, they were homogeneous as far as age, gender, dizziness type and dizziness onset are concerned and as to the labyrinth involved at the Dix-Hallpike test. There was a higher proportion of Caucasian patients in group II, treated with repeated maneuvers per session.Nystagmus latency and duration in Group II patients who underwent four maneuvers in the first session were higher than those in Group I, treated with one single maneuver in the first session, which could suggest a greater difficulty in resolution. Even with this apparent obstacle, patients from group II needed less sessions (1.2 sessions in average) of rehabilitation than the other group , and the difference was statistically significant. The percentage of patients who needed only one session in order to get rid of positional nystagmus was 21.4% higher in Group II. Maneuver repetition in one single session was considered more convenient, since it allowed us to show the patient the treatment\u2019s efficacy, confirmed by the progressive improvement in symptoms during the procedure, although we did not find significant differences between one single session with up to four maneuvers and one session with only one maneuverProcedure tolerance was considered good in both groups we treated. Only one patient had nausea and vomits at maneuver repetition in one single session. The session with repeated maneuvers was well tolerated by the patientsAmong the 123 patients in the present investigation, we did not see any case of posterior semicircular canal BPPV moving on to the anterior or horizontal canals after the maneuvers, which is in agreement with the findings of a study that used the single or repeated maneuversIn the literature studied we did not find other studies which compared the single maneuver versus the repeated maneuver in the first session, as to BPPV treatment efficacy and tolerance.Having the results we achieved, we can state that BPPV\u2019s treatment by repeating Epley\u2019s maneuver in one single session proved to be more efficient than one single maneuver per session."}
+{"text": "Parkinson's disease (PD) is the second most prevalent neurodegenerative disease, substantially impacting quality of life and economic burden. Currently available treatments, including pharmacological interventions, rehabilitation, and brain stimulation, undoubtedly help to reduce disease symptoms. This Frontiers of Neurology unique Research Topic brings us several new insights into improving brain stimulation interventions.Brain stimulation is one of the fastest-growing neuroscience areas involving medical and bioengineering fields. Brain stimulation is inherently non-destructive, reversible, and, most importantly, adjustable. Whether invasive or non-invasive, the electrical intervention can modulate the nervous system function, leading to improved neurological symptoms and better quality of life.Deep brain stimulation (DBS) has been clinically useful in the treatment of PD at all stages, especially in those patients with motor symptoms only partly controlled by dopaminergic drugs, such as severe rest tremor or off-period dystonia, and motor fluctuations. However, many DBS issues remain challenging, for instance, choosing a suitable stimulation target to maximize clinical outcomes, while minimizing side effects. As a highly heterogeneous disease, one DBS solution does not fit all patients.Shi et al. used microstimulation during microelectrode recordings to localize the subthalamic-substantia nigra border. The authors provided evidences that it can be easily and routinely employed to achieve better lead placement in the STN and superior therapeutic effectiveness.Neurosurgeons commonly face the challenge of precisely localizing tiny surgical targets. Indeed, successful application of DBS relies on optimal lead placement, among several factors. In this regard, Zeng et al. assessed the outcome differences of stimulating STN or GPi in the same individual. A significant improvement in motor symptoms occurred after STN stimulation. Effects of unilateral STN stimulation were seen on both sides of the body, while unilateral GPi stimulation mainly acted on the contralateral side, thus providing evidence favoring STN DBS.There has been much debate on the best DBS target for PD. DBS targeting the subthalamic nucleus (STN) and the internal Globus pallidus (Gpi) reduces PD's motor and non-motor symptoms. Comparative studies suggested that STN and GPi DBS have similar outcomes. Nevertheless, GPi DBS likely causes less impact on both gait and cognition. Baumgartner et al. gifted us with a comprehensive review of the relationship between LFP oscillations in the STN and the sleep architecture of PD patients. This knowledge may allow future closed-loop optimization of electrical parameters to treat sleep dysfunction in PD.Adaptive DBS has gained space in the research and clinical fields. This novel approach might improve troublesome side-effects from conventional DBS, such as speech disturbances, disabling gait disorders, and behavioral changes. By enabling the recording of patient-specific local field potential (LFP) signals through electrode contacts adjacent to the stimulating electrode contact of the same DBS lead, adaptive DBS may allow for automated brain stimulation adjustment and better management of PD symptoms. This closed-loop approach demands familiarity with electrophysiological biomarkers associated with distinct clinical manifestations. On this field, Many factors may contribute to DBS outcomes in PD, and the genetic profile is undoubtedly one of them. About 25% of individuals undergoing DBS have a genetic form of PD. Given the individual variability in clinical evolution and surgical responses, it is reasonable to hypothesize that genetic variability may relate to distinct phenotypes and DBS outcomes. Accordingly, patients with LRRK2, parkin, VPS35, and SNCA mutations respond well to DBS treatment, whereas patients with glucocerebrosidase (GBA) mutations may disclose faster cognitive decline and poorer responses following DBS.David et al. analyzed the differences between left and right STN resting-state beta power in GBA mutation carriers with PD. The differences in peak beta ratio in GBA-mutation carriers correlated to the clinical findings, suggesting a distinctive physiologic signature from sporadic PD. Additional research on LFP attributes according to the PD genetic profile will provide resources for adaptive DBS programming.Beyond neuropathological issues, electrophysiological differences may justify differences in DBS outcome. Wang et al. demonstrated the impact of coordinated STN DBS reset on motor parkinsonism. Preliminary evidence supports shuffled STN CR-DBS producing significantly better therapeutic effects on parkinsonian symptoms, with the additional gain of reducing side-effects by minimizing the current spread.DBS research may also explore alternative ways of electrical stimulation. An animal study by Miao et al. on functional magnetic resonance imaging (fMRI) to investigate modulatory DBS effects on brain activity, shed light on DBS impact on functional connectivity. The authors reviewed studies on the mechanism of DBS action, the effects of chronic stimulation on motor networks, the impact on different inter-regional connectivity, the effects on non-motor symptoms in PD, and differences in levodopa and DBS actions on brain activity.The systematic review, by DBS immediately modulates the cortico-basal ganglia-thalamocortical loop, leading to significant physiological modifications in the thalamus, globus pallidum, and cerebellum. The primary motor cortex activation changes correlate with motor symptoms and PD phenotypes. The impact of DBS on brain activity depends on several factors, such as programming parameters, subject's activity while being scanned, PD subtypes, and medication intake. Future use of fMRI should allow individualized surgical planning and help identify optimal anatomical targets as per symptoms. Overall, fMRI must enhance the understanding of DBS mechanisms in PD and help to improve clinical outcomes.Wu et al. broadly discusses the role of rTMS and TBS in LID in PD. The authors explored the therapeutic mechanism of TMS in the management of LID, which involves understanding many neural circuits that take part in the occurrence of LID. Identifying brain regions involved in LID mechanisms is critical. The right stimulation target or combination of different areas might prolong therapeutic efficacy. Pan et al. highlighted the shortness of TMS efficacy protocols. They showed that high-frequency rTMS over the left dorsolateral-prefrontal cortex (DLPFC) only provides short-term improvements for alleviating fatigue in patients with multiple system atrophy.Non-invasive brain stimulation (NIBS), as theta-burst stimulation (TBS), proposes managing several PD symptoms. Furthermore, novel targets for rTMS, such as the prefrontal cortex, motor cortex, cerebellum, and spinal cord, focus on different symptoms like depression, apathy, motor symptoms, and gait disturbance. The mini-review performed by Cheng et al. systematically and quantitatively analyzed the therapeutic effect of TBS for PD treatment. TBS leverages repetitive TMS due to its short time of single treatment and low stimulation intensity compared to traditional rTMS. Accordingly, TBS over the supplementary motor area significantly improved motor burden in the off-medication period. Additionally, intermittent TBS over the motor cortex and DLPFC impacted the slowing of gait and depression.Costa et al. gathered evidence of the neurophysiological changes associated with NIBS in PD. They evidenced the NIBS' impact on the cortical activity as measured by electroencephalogram. On the other hand, the systematic review by Oliveira et al. found no significant short-term effect of tDCS on motor function, balance, gait, dyskinesia, or motor fluctuations in PD, regardless of brain area or targets stimulated. These opposite findings might reflect differences in the quality of the studies, the low number of studies, and especially variability in NIBS intervention.NIBS may change quantitative electrophysiological signs in PD patients. The scoping review of Lee et al. investigated the behavioral GVS effects under different stimulation frequencies and the interaction between GVS effects and anti-parkinsonian medication. Clinical response varied considerably across participants under the tested conditions. Moreover, dopaminergic drugs significantly influenced GVS effects in PD patients. Kazemi et al. searched for EEG predictive measures of impaired motor vigor in PD, which may provide valuable leads for GVS modulation.NBIS new technologies, such as galvanic vestibular stimulation (GVS), are being increasingly explored in PD. Pfeifer et al. shared the study protocol on clinical efficacy and dosing of vibrotactile coordinated reset stimulation (VCR) in PD symptoms. VCR is a non-invasive therapy that delivers gentle vibrations to the fingertips. VCR might desynchronize abnormal brain rhythms within the sensorimotor cortex, thus relieving motor and non-motor symptomatology in PD.Finally, From the evidence shown in this Research Topic, advances in brain stimulation are encouraging, but there are still many critical issues to address. We must fully clarify its mechanisms of action at the cellular level, its related neurophysiological events, and its impact on the regular and pathological neuronal networks. Besides, it is imperative to use multimodalities of PD biomarkers to better predict the outcome at the individual level as a tool for individualized medicine. Integrating neurophysiology, neuroimaging, and genomics into patient care is a highly strategic priority.All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Glioma is the most common malignant tumor of the central nervous system. Tumor purity is a source of important prognostic factor for glioma patients, showing the key roles of the microenvironment in glioma prognosis. In this study, we systematically screened functional characterization related to the tumor immune microenvironment and constructed a risk model named Glioma MicroEnvironment Functional Signature (GMEFS) based on eight cohorts. The prognostic value of the GMEFS model was also verified in another two glioma cohorts, glioblastoma (GBM) and low-grade glioma (LGG) cohorts, from The Cancer Genome Atlas (TCGA). Nomograms were established in the training and testing cohorts to validate the clinical use of this model. Furthermore, the relationships between the risk score, intrinsic molecular subtypes, tumor purity, and tumor-infiltrating immune cell abundance were also evaluated. Meanwhile, the performance of the GMEFS model in glioma formation and glioma recurrence was systematically analyzed based on 16 glioma cohorts from the Gene Expression Omnibus (GEO) database. Based on multiple-cohort integrated analysis, risk subpathway signatures were identified, and a drug\u2013subpathway association network was further constructed to explore candidate therapy target regions. Three subpathways derived from Focal adhesion (path: 04510) were identified and contained known targets including platelet derived growth factor receptor alpha (PDGFRA), epidermal growth factor receptor (EGFR), and erb-b2 receptor tyrosine kinase 2 (ERBB2). In conclusion, the novel functional signatures identified in this study could serve as a robust prognostic biomarker, and this study provided a framework to identify candidate therapeutic target regions, which further guide glioma patients\u2019 clinical decision. Glioma is the most common malignant tumor of the central nervous system (CNS), accounting for 30% (80%) of all brain  tumors, which displayed the representative characteristics of strong genetic heterogeneity, high mortality, and chemotherapy resistance , 2. AccoGlioma tissue included both cancer cells and non-transformed cells, which included predominantly resident microglia from the brain and circulating blood monocytes (macrophages), comprising 30%\u201350% of the cellular content of these tumors . The gliIn this study, by analyzing available glioma expression profiles with survival data of a total of 3,486 samples from eight cohorts, we utilized the Least Absolute Shrinkage and Selection Operator (LASSO) model to construct the Glioma MicroEnvironment Functional Signature (GMEFS) model, which consisted of 25 immune microenvironment signatures. To test the prognostic performance of GMEFS, we further obtained two independent glioma cohorts from The Cancer Genome Atlas (TCGA) database, and the nomogram was constructed for evaluating the prognostic performance. Meanwhile, the associations between GMEFS and glioma molecular subtypes, tumor purity, or stromal score, as well as immune cell infiltration, were explored. The GMEFS score was also evaluated in multiple-level brain tumor formation and glioma recurrence from a large number of glioma samples from multiple cohorts. Finally, we identified risk subpathways related to the GMEFS score and constructed a comprehensive drug\u2013subpathway network for candidate target region screening, which provided important guidance for glioma clinical treatment.We searched the available mRNA expression profiles with prognosis information from several tumor resources, such as the Gene Expression Omnibus (GEO) database, Chinese Glioma Genome Atlas (CGGA) database, and Pan-Cancer Analysis of Whole Genomes (PCAWG) database for glioma prognostic microenvironment identification. For the datasets from the GEO database, the cohorts with at least 40 samples were considered and a total of six public glioma cohorts were downloaded. We also collected two glioma cohorts (LGG and GBM) from TCGA database and the multi-omics data including gene expression, methylation level, and copy number variations (CNVs) from the Human Glioma Cell Culture (HGCC) collection as the independent testing set. Finally, 6,920 brain samples from 27 cohorts were included in our study, and the total information was shown in We collected 175 immune microenvironment-related signatures from diverse literature for glioma prognostic signature identification. In detail, 28 signatures were obtained from the work of Bindea et\u00a0al. , 11 signThe datasets from GEO, CGGA, and PCAWG databases were treated as the training set, and the datasets from TCGA were treated as the testing set. Based on the 175 tumor microenvironment signatures, we firstly utilized the single sample Gene Set Enrichment Analysis (ssGSEA) method implemented in the R package to calculate the normalized enrichment score (NES) for each glioma sample from the training set . To remoBased on the merged NES matrix, which consisted of 175 immune microenvironment signatures and 4,887 glioma samples, we firstly performed univariable Cox proportional hazards regression analysis using 3,486 samples with survival analysis. A set of 141 signatures was identified with a prognostic P-value <0.05. The detailed univariable Cox results, including the hazard ratio (HR) value, 95% CI, and P-values, of these microenvironment signatures were provided in i is the HR and NESi is the NES for the ith immune microenvironment signature.where HRThe ESTIMATE score, tumor purity, and stromal and immune scores for each glioma sample were calculated by using ESTIMATE package in R with default parameters . The difBased on the HGCC resource , we obtaAccording to the GMEFS score, all glioma samples from both training and testing sets were classified into two groups based on the consistent cutoff as the training set. Then, the Kaplan\u2013Meier (KM) curve and survival P-value calculated by the log-rank test were performed by using R survminer package. The glioma molecular subtypes  of the glioma patients were obtained from a previous study . For botMaterials and Methods). The GMEFS consisted of 25 glioma immune microenvironment signatures, and the detailed LASSO results of these 25 signatures were displayed in Materials and Methods). With the same formula, the samples from the testing set were stratified into high and low GMEFS groups by the cutoff value obtained from the entire training set. As shown in Based on the training set that consisted of a total of 8 glioma cohorts, we constructed a microenvironment-based prognostic model named GMEFS  was constructed by using patients from the training set. Based on the nomogram results, a score can be calculated for a glioma patient for predicting the 3-, 5-, and 10-year overall survival for an individual, suggesting the power of GMEFS score in contributing the risk point . As shown in To test the associations between GMEFS and molecular subtypes, we obtained the glioma subtype information , TGF-beta response, and wound healing, were compared between the high GMEFS group and the low GMEFS group from TCGA LGG cohort . The higher expression activity of these genes was enriched in samples from the hyperplastic blood vessels, microvascular proliferation, and perinecrotic zone. These gene signatures displayed a lower expression level in infiltrating tumor and leading edge , which performed RNA sequencing (RNA-seq) on microdissections of glioma anatomical structures from hematoxylin and eosin (H&E) staining . As shown in In our previous studies , 33, we In this study, the relative quantitative infiltrate levels of 175 immune microenvironment signatures in a total of 4,887glioma patients from multiple cohorts were estimated, and a novel prognostic model (GMEFS) consisting of functional signatures was constructed. To test the predictive performance of the GMEFS, we further obtained independent glioma cohorts from TCGA. In addition, many other glioma cohorts from the GEO database were also obtained to analyze the different GMEFS scores between brain tumor and normal samples. Data from one glioma cell line from HGCC were utilized to construct a drug-related network. In a word, a total of 6,920 brain samples were utilized in this study to comprehensively identify and explore the glioma immune microenvironment characterization for prognosis analysis.For the input in LASSO-Cox regression analysis, we have collected as many tumor-related microenvironment signatures as possible, including the functional signatures from the study of Bagaev et\u00a0al. . A totalRecently, a large scale of bioinformatics studies utilized public data resources to identify glioma prognostic signatures, including gene signatures \u201340, lncRBased on TCGA-LGG cohort with available treatment information, we further observed that the GMEFS was significantly decreased in patients with complete or partial response when compared with those with stable or progressive disease. The effectiveness of the GMEFS value in predicting the response of cancer patients to immunotherapy was also verified  can be found in the article/CZ, WM, and YXZ analyzed and interpreted the data. CZ, GT, YX, and FL performed the bioinformatics analyses. YZ, XZ, ZZ, GT, and YPZ performed the biological evaluation. CZ, YX, and YPZ wrote the article. All authors read and approved the final article.This work was supported by the National Natural Science Foundation of China (Grant Nos. 62172131 and 62101164).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "If people with episodic mental-health conditions lose their job due to an episode of their mental illness, they often experience personal negative consequences. Therefore, reintegration after sick leave is critical to avoid unfavorable courses of disease, longer inability to work, long payment of sickness benefits, and unemployment. Existing return-to-work (RTW) programs have mainly focused on \u201ccommon mental disorders\u201d and often used very elaborate and costly interventions without yielding convincing effects. It was the aim of the RETURN study to evaluate an easy-to-implement RTW intervention specifically addressing persons with mental illnesses being so severe that they require inpatient treatment.The RETURN study was a multi-center, cluster-randomized controlled trial in acute psychiatric wards addressing inpatients suffering from a psychiatric disorder. In intervention wards, case managers (RTW experts) were introduced who supported patients in their RTW process, while in control wards treatment, as usual, was continued.p\u00a0=\u00a00.14). Intervention patients returned to their workplace earlier than patients in the control group (p\u00a0=\u00a00.040).A total of 268 patients were recruited for the trial. Patients in the intervention group had more often returned to their workplace at 6 and 12\u00a0months, which was also mirrored in more days at work. These group differences were statistically significant at 6\u00a0months. However, for the main outcome (days at work at 12\u00a0months), differences were no longer statistically significant (The RETURN intervention has shown the potential of case-management interventions when addressing RTW. Further analyses, especially the qualitative ones, may help to better understand limitations and potential areas for improvement. Mental illnesses are among the most common diseases worldwide , 2. In GMental illness and employment interact in many ways. On the one hand, mental illnesses prevent persons from finding and keeping regular employment  and are People with episodic mental health conditions and fixed employment are a large group of society, however, they are often neglected in clinical practice and research . If thosExisting return-to-work (RTW) programs have nearly exclusively focused on \u201ccommon mental disorders\u201d . Their approaches vary substantially including, for example, cognitive behavioral therapy (CBT) programs , rehabilThe study was designed as a multi-center, cluster-randomized controlled trial in acute psychiatric wards in southern Germany addressing inpatients suffering from a psychiatric disorder . In inten\u00a0=\u00a028 acute wards (=clusters) in seven psychiatric hospitals in the greater Munich area. All patients admitted to these wards were consecutively recruited for the trial when they fulfilled the following inclusion criteria:Age 18\u201360\u00a0years.Diagnosis of a mental illness .Admission to inpatient treatment.Existing employment.The study was implemented on Exclusion criteria were mental retardation, insufficient proficiency in German language to engage with the case manager, employment in a mini-job , and a main diagnosis of an organic mental disorder (F0), substance abuse (F1), or an eating disorder (F5).The intervention consisted of the implementation of RTW experts in the intervention wards . The RTWAccording to the manual RTW experts offered five structured sessions to patients during the inpatient stay  and three sessions after discharge from hospital (including the possibility of a joint discussion with the employer). The services of the RTW experts could be claimed by the patients during inpatients stay and for up to half a year after discharge. The minimum of intervention was defined as at least two meetings between RTW experts and patients\u2014one appointment during the inpatient stay and one after release (\u201cper protocol\u201d). RTW experts aimed at activating existing support services of the hospitals  and to offer specific support , if there was a limitation of resources. Overall, this intervention was oriented toward the competencies (and capacities) of social workers in mental health in order to facilitate implementation into routine care in case of positive study results.Staff (and patients) of the control wards acted under \u201cTAU\u201d conditions. To avoid contamination bias as much as possible , wards were chosen in a way so that there was no overlap in personnel and that there was no regular patient transfer between wards.The same data were collected at the same time points in the intervention group and control group . In the In addition, we obtained several potentially mediating factors such as the uptake of available support strategies . Furthermore, we documented the patients\u2019 subjective readiness to return to their workplace and their feeling of being supported in this process by using self-rated visual analog scales. Finally, clinical data on illness severity , social functioning (GAF), quality of life (EuroHisQol), and relapses (patient self-report) are reported.n\u00a0=\u00a014 wards each to the intervention group or control group) to minimize contamination effects [Randomization was done at cluster level  were fitted.The primary analysis was a comparison of days at work at 12\u00a0months after discharge between the intervention group and control group. To assess the effect of the intervention on the continuous primary outcome (days at work 12\u00a0months after discharge), a linear mixed model was fitted with ward (cluster) as a random effect term to account for non-systematic variance related to the ward and intervention group as a fixed effect using the lme4 R package. The point estimate for the intervention effect is reported together with the corresponding 95% confidence interval. A The trial has been approved by the local review board (Ethikkommission der Technischen Universit\u00e4t M\u00fcnchen) and has been registered at Deutsches Register Klinischer Studien (DRKS00016037). All participating patients had to give written informed consent.Recruitment for the RETURN study took place in 28 psychiatric wards from January 2019 until February 2020. A total of 268 patients were recruited for the trial, 137 in the intervention group and 131 in the control group. As expected, there was a considerable number of dropouts during the study period  intervention patients were judged to be healthier/less socially impaired .Table 2.Regarding standardized support resources  there was no higher uptake in the intervention group compared to the control group. Likewise, patients in the intervention group did not feel more prepared for their return to work .Table 3.p\u00a0=\u00a00.004) and at 12\u00a0months . Likewise, intervention patients had more days at work at 6\u00a0months  and at 12\u00a0months . These group differences were statistically significant at 6\u00a0months. However, for the main outcome (days at work at 12\u00a0months) these differences were no longer statistically significant. Patients in the intervention group returned to their workplace earlier than patients in the control group (p\u00a0=\u00a00.040). There were no significant group differences regarding quality of life or relapses , however, the group difference was not significant.Our study has focused on a subgroup of psychiatric inpatients, that is, those still having workplaces in the competitive labor market. Therefore, our results are not transferable to patients aiming at reentering the labor market. Here, supported employment (IPS) is an established approach . In addiOur intervention led to patients returning earlier to their workplaces and going to work more frequently compared to control group patients at 6\u00a0months follow-up. The patients in the control group returned later to their workplace. Thus, they needed 12\u00a0months to reach the share of returned patients that the intervention group reached at 6\u00a0months. The numerical difference in days at work persisted within 12\u00a0months, however, this difference (main outcome) proved not to be statistically significant.We believe that a number of factors might be responsible for this (negative) finding for the main outcome after 12\u00a0months. First, this might be due to a \u201cceiling effect\u201d as 86% of the patients in the intervention group were already back at work after 6\u00a0months. Possibly, we had underestimated the wake of a labor market in the Munich area, which has been increasingly characterized with skills shortage\u2014even during the Corona pandemic (which did not lead to relevant increase in unemployment rates). Second, statistical effects  might be responsible for the negative finding.Third, there is evidence that the recovery rate increases, when health insurance benefits end . With poRegarding potential mediators of the effects observed, we could not find the expected relationships, for example, a higher uptake of structured RTW measures or a better feeling of preparedness in the intervention group. Thus, on the one hand, it might not be the mere uptake of existing measures but rather their (case)managed implementation within a context that sees RTW as a desirable process. On the other hand, intervention patients might have suffered from an increase of anxiety when confronted with RTW  making tDespite the non-superiority of our intervention regarding the main outcome, our study still yielded stronger/comparable effects compared to other studies focusing on common mental disorders. Thus, for adjustment disorders, CBT alone was found not to reduce time to RTW , while fIf we follow the claim that \u201cwork is a critical mental health intervention\u201d , the RETTo conclude, the intervention studied has shown the potential of case-management interventions when addressing RTW. Further analyses, especially the qualitative ones, may help to better understand limitations and potential areas for improvement."}
+{"text": "Dobbs v. Jackson Women\u2019s Health Organization has far-reaching implications that go beyond the practice of obstetrics and gynecology. The ruling and subsequent laws and bills impact many specialties and have implications for healthcare as a whole. The rapidly changing medicolegal landscape has significant bearings on and implications for the fields of neonatology and pediatrics. These rulings have an impact on the patient-physician relationship and a shared decision-making approach to care. Furthermore, there are significant sequelae of forced birth and resuscitation. This review provides a clinically relevant update of the current medicolegal landscape and applications to the practice of neonatology.The Supreme Court ruling in  Dobbs v. Jackson Women\u2019s Health Organization, subsequent trigger laws, and proposed state bills reach beyond obstetrics and maternal-fetal medicine (MFM), impacting healthcare as a whole. With the overturn of Roe and increasingly restrictive abortion laws, the average distance to travel for abortion-related healthcare will increase by 97 miles [The Supreme Court ruling in 97 miles . Greater97 miles \u20134. This 97 miles \u20138. IndivThe ramifications, though, are not limited to obstetrics or fetal status. There are consequences for fertility and reproductive health, oncologic treatment of pregnant individuals, and availability of life-saving medications. Nationally, there have been questions about when physicians can intervene to save a pregnant individual\u2019s life if the intervention may result in abortion; refusal to fill prescriptions for medications used to treat complex diagnoses if the medications can also be used to treat ectopic pregnancies; and criminal charges against a woman who sought care for miscarriage when the prosecutors questioned if the miscarriage was the result of an abortion , 10\u201312. Dobbs ruling will interfere with the patient-physician relationship and harm families in need of perinatal palliative care [This still does not fully encompass the impact of these laws and bills. The American Academy of Hospice and Palliative Medicine expressed concern that the ive care . As neonCeding control over medical decisions regarding abortion to states has led to ancillary legislative activity. Currently, 44 states prohibit abortion at some point in pregnancy and 6 states prohibit abortion when the fetus has a genetic anomaly, some of which may be life-limiting , 19. ForCollectively, recent legislation establishes a precedent that medical decisions are made by the state, not patients and their physicians. Most lawmakers lack the knowledge or training to understand medical appropriateness and are therefore ill prepared to dictate standards for medical care. For instance, several proposed bills would mandate aggressive treatment for any infant displaying movement, sound, heartbeat, or pulsating umbilical cord. These measures do not independently reflect voluntary movement, effective respirations capable of sustaining life, or effective cardiac output. As a result, this would necessitate futile interventions for previable infants and infants with life-limiting anomalies when they would not be beneficial or if families perceive them as causing suffering. It would significantly alter the end-of-life experience for the family and in certain instances impact their ability to bond and make memories with their baby. It contradicts recommendations from AAP and other medical associations, undermines patient autonomy, and undervalues the patient-physician relationship .State v. Messenger affirmed parental rights to refuse life-sustaining interventions, Miller v. HCA and Montavola restricted their role in such decisions [The legal implications of these bills and laws may alter options discussed with families. Historically, most states have deferred judgment of viability to physicians . While Secisions , 31. Somecisions . In realecisions Restricting abortion, redefining personhood, and mandating resuscitation impacts the counseling and care our patients receive. While counseling about life-limiting fetal diagnoses, we discuss appropriate medical options including abortion, pregnancy continuation, and neonatal treatment paths. With increased restrictions, we must remain knowledgeable of state laws to direct patients to appropriate care and prepare families that, given individual time and financial constraints, abortion may not be feasible. This increases the workload for an already over-burdened medical system, decreases the quality of patient care, and worsens inequities in maternal and neonatal-perinatal care. Many women who seek abortions are from marginalized and minoritized ethnic and racial groups and 75% have incomes at or near the poverty line .When parents are excluded from pregnancy and resuscitation decisions, they have higher rates of depression, anxiety, and post-traumatic stress . PerceivProposed bills mandating pregnancy continuation or resuscitation before viability or with life-limiting diagnoses are harmful and assume that all families desire interventions. It implies elected officials rather than the patient and physician are responsible for making medical decisions. Moreover, the bills are predicated on the assumption that interventions will improve survival, which may be inaccurate. These complex decisions can and should only be made by families and physicians or advanced practitioners who have knowledge and training to understand limitations of interventions, explore family values, and navigate goals of care .With greater abortion restrictions, whether due to inherent risks with continuation of pregnancy or abortions provided without strict oversight and supervision, maternal and neonatal morbidity and mortality will increase . PregnanRoe, whether by parental choice or state mandate, this number will increase. The decision to continue such a pregnancy is incredibly personal and complex. Pregnancy continuation leads to lost income, lost work productivity, lost reproductive potential, and increased risks of medical complications. There is often increased testing, medical visits, hospitalizations, and emotional trauma [Further highlighting the public health impact, each year there are >15,000 neonatal deaths in the United States and >3% of pregnancies are complicated by a life-limiting diagnosis , 43. Curl trauma . These ll trauma , 46. Thil trauma , 48.Some suggest hospice as an alternative to abortion for life-limiting or medically complex fetal diagnoses. However, some parents feel this is not in their fetuses\u2019 best interest. Beyond that there remains wide variability in the availability, scope, and services of palliative care programs . Not allIrrespective of resources, forced delivery and resuscitation are traumatic for all. It negates physicians\u2019 judgment of what is medically appropriate and families\u2019 right to choose what is in their child\u2019s best interest. We have cared for families with pregnancies complicated by life-limiting conditions who sought abortion but were unable to obtain one. The pregnancy continued and most families elected for comfort care. Many had painful experiences of strangers asking about their baby and the future they anticipate. Some felt guilt and pressure to pursue interventions when they did not feel it was in their child\u2019s best interest. Others valued time with their baby but were traumatized because they were forced to continue their pregnancy and feel their baby suffered. They felt helpless and betrayed, asking what else they could do, how the state could mandate they have a child when lawmakers do not understand what it means for them and their baby, and how they are supposed to give birth knowing their baby is dying. These moments, patients, and conversations stay with us and with\u00a0the families. Elected officials lack this insight and perspective.As neonatologists, we counsel families about all appropriate medical options and support them as they navigate difficult circumstances to make the best decision for their family. As with any medical decision, we cannot let our personal views impact the conversations we have with patients. We are taught to have equipoise and are held to high professional and ethical standards. Choices regarding abortion and delivery resuscitation are ones that should only be made by patients and their physicians. Legislative restrictions on medically appropriate and sometimes necessary treatments are worrisome. Politics, nonmedical professionals, and fear of litigation or retribution should not dictate the counseling and treatments we provide. We must continue to provide evidence-based medical care to families and ask the Department of Health and Human Services to protect healthcare providers from criminal and civil liability\u00a0on this matter. Global and regional health policies protecting the interest of our patients are also necessary.We must remain cognizant of state and federal laws to help families seek abortion services or hospice care when desired and minimize delays in such care. We must call on the healthcare system to provide equitable resources to states that offer abortions so they can facilitate care for citizens regardless of where they live and accommodate the influx of out-of-state patients. This means protected work leave for families, insurance coverage for travel and medical expenses, and support for maintaining and protecting an adequate pool of credentialed physicians and advanced practitioners. We must prepare the healthcare system for more medically complex children. To make pediatric subspecialties and palliative care enticing to trainees we can facilitate work-life balance, promote equity and inclusion, and highlight opportunities for professional growth. The healthcare system will need more physicians, nurses, social workers, ancillary staff, hospitals, equipment, and resources. The government must provide the funding requisite and reform payment structures for hospitals, hospice programs, palliative care resources, and home-health care. Families may require social supports to meet the care needs of children with complex chronic medical conditions. We currently do not have the resources to meet these needs.Advocacy is important as we navigate the impact of these laws and proposed legislation for our patients. Commitment to advocacy should exist in operational ways that leverage our status as physicians to protect women\u2019s rights, allow physicians and families to determine what is in a neonate\u2019s best interest, decrease maternal and neonatal mortality, and provide resources for infants and families. We must stay current on legislative activities and openly discuss the impact of these rulings with our colleagues so that we can continue to provide the highest level of care. We must advocate for our patients, encouraging them to vote and supporting them in making their voices heard. At the local level, we can educate our patients, communities, and policymakers and call on hospitals to speak out against legislation that shifts medical decision-making to the state. At the state level, we can make our views known to state medical boards and increase our knowledge of how board members are appointed. At a federal level, we can participate in professional organizations and unify their lobbying goals.Advocacy may come at a cost. Hospitals and institutions may not wish to become publicly involved with a morally and theologically charged topic or be prepared for the financial implications of doing so. Individual involvement may lead to disciplinary action or harm academic advancement. There is a risk of legal repercussions if advocacy equates to supporting illegal activities. It is also important to remember families have views on abortion. They may perceive a physician advocating for decisions regarding abortion to be made by a patient and physician, instead of the government, to be reflective of the physician\u2019s personal views of abortion. This could lead to mistrust or a breakdown of the therapeutic relationship. These concerns, though, should not inhibit physicians from advocating for their patients as individual citizens outside of their affiliation with their employers. Even so, it is imperative that our employers and organizations recognize the gravity of this moment and support physicians in our efforts.First and foremost, we must do no harm. As neonatologists we have a great privilege: we care for the most vulnerable individuals. We must meet our ethical obligation to act in the best interests of pregnant individuals, fetuses, and neonates without fear of prosecution altering the care we provide. To think these issues will only impact our obstetric and MFM colleagues is erroneous and short-sighted. These rulings infringe upon the medical community\u2019s ability to make determinations about appropriate care and practice according to established medical and ethical principles. Politicization of medical care undermines the physician/patient relationship we hold sacred, abolishes our ability to provide evidence-based medical care in the best interests of patients, and negates both patient autonomy and parental authority. We must advocate for our ability to continue to practice medicine in the full scope of our specialties."}
+{"text": "Plasmodium with most morbidity and mortality caused by P. falciparum. With rates of infection plateauing and rebounding in some areas , there have been increasing calls for new initiatives that can reduce malaria incidence towards local elimination or the hoped for goal of global eradication. In 2021, the World Health Organisation approved the first malaria vaccine RTS,S/AS01 , indicating it to be safe for use in young children and advocating its integration into routine immunisation programmes. Approval of this vaccine clearly represents a major landmark in global efforts towards malaria control and eradication aspirations. RTS,S modest efficacy, however, points at the need to better understand immune responses to the parasite if we hope to design next generation malaria vaccines with increased potency.Malaria remains a huge burden on global public health. Annually there are more than 200 million cases with\u2009>\u2009600,000 deaths worldwide, the vast majority of which occur within Sub\u2010Saharan Africa . Malaria disease is the consequence of infection by a protozoan parasite from the genus  et\u00a0al (in this issue of EMBO Mol Med) that investigates the molecular characteristics and protective potential of human monoclonal antibodies against the highly immunogenic Plasmodium falciparum circumsporozoite protein (PfCSP) C\u2010terminal domain.J. Baum and J. Murdoch discuss the study by Opeyemi Oludada  The NANP repeat induces a strong IgG antibody response which is thought to be the\u00a0main mediator of protection . A significant portion of recent efforts have focussed on investigating the protective efficacy of human monoclonals (mAbs) against PfCSP that arise post\u2010vaccination. Oludada et\u00a0al\u00a0, in thisl\u00a0et\u00a0al,\u00a0, with thet\u00a0al isolated the circulating PfCSP\u2010reactive memory B cells (towards immunoglobulin characterisation) from all donors 14 and 35\u2009days after their third immunisation. Immunoglobulin variable heavy\u2010chain genes (IGVH) undergo somatic hypermutation (mutation rate 106\u2010fold higher than background rate), which means each B cell population ends up with a\u00a0distinct heavy\u2010chain variable region. Oludada et\u00a0al discovered that genes encoding variable heavy chains VH3\u201021 and VH3\u201033 were highly enriched in PfCSP\u2010reactive memory B cells. VH3\u201033\u2010containing antibodies were associated with an IgM response. Mature yet naive B cells express IgM, which have a lower affinity for antigens, but due to the pentameric structure have a higher avidity. In contrast, the VH3\u201021 genes were associated with IgG response. IgG is a bivalent immunoglobulin with four subclasses (IG1\u20104). It is the product of an IgM B cell undergoing isotype\u2010switching recombination and affinity maturation (characterised by a higher somatic hypermutation rate) within germinal centres. IgG antibodies typically have substantially higher affinities for antigens than IgM antibodies.To compare the anti\u2010C\u2010CSP and anti\u2010NANP antibody responses, Oludada et\u00a0al produced 73 C\u2010CSP mAbs and 102 NANP mAbs respectively. One C\u2010CSP, mAb showed signs of cross\u2010reactivity towards both NANP and the N\u2010junction region, whereas the rest of the anti\u2010C\u2010CSP mAbs were highly specific, with half the anti\u2010C\u2010CSP mAbs encoded by VH3\u201021. In contrast, a significant proportion of anti\u2010NANP mAbs showed cross\u2010reactivity with the N\u2010junction and were mostly encoded by VH3\u201033 genes. These NANP repeats may mediate cross\u2010linking of multiple B cell receptors, which would bias the response towards an IgM VH3\u201033 response. Alternatively, the structural differences between the disordered yet flexible NANP repeat region and the structured C\u2010terminal domain may explain the epitope\u2010associated differences in affinity maturation. Investigating the binding characteristics further, only three C\u2010CSP mAbs showed reactivity towards linear epitopes, while the vast majority shared specificity for identical or overlapping conformational epitopes in the polymorphic Th2R/Th3R regions of CSP, a C\u2010terminal domain containing a thrombospondin type 1 repeat (TSR) domain  P. berghei sporozoites  expressing PfCSP. They found that none of the TSR C\u2010CSP antibodies bound to live sporozoites, which corroborates previous observations that the TSR domain is not accessible on the surface of sporozoites. This inaccessibility fits with the idea that CSP processing may regulate the exposure of surface epitopes  and L9 (minor repeat NVDP) mAbs, these data highlight that while the C\u2010terminus is clearly immunogenic, it appears to be irrelevant in\u00a0the context of an effective humoral response.Oludada et\u00a0al also did a deep structural dive into how antibody binding is mediated. Their focus centred on investigating the C\u2010linker region\u2010specific mAb 3764, the only C\u2010CSP mAb encoded by a VH3\u201033 gene. Solving the crystal structure of mAb 3764 in complex with its target motif DPN, they demonstrate how the C\u2010linker domain is recognised by a non\u2010cross\u2010reactive human anti\u2010PfCSP mAb. This shows the steric constraints that inhibit cross\u2010reactivity, highlighting the importance of peripheral residues within epitopes in mAb binding specificity and cross\u2010reactivity.To explore the nature of mAb action, Oludada et\u00a0al in characterising human mAbs following whole sporozoite immunisation and their characterisation with respect to the C\u2010terminus could prove fundamentally important in guiding future malaria vaccine design. While there might be a temptation to read this as a negative result (i.e. that C\u2010terminus antibodies lack in vivo parasite inhibitory activity), the work provides some clear insights that may be critical for next\u2010generation development of RTS,S\u2010like sub\u2010unit vaccines based on PfCSP. Of keen interest, their work demonstrates the inaccessibility of the C\u2010terminus in the native context (on the sporozoite surface) to neutralising antibodies. This provides tantalising insight into the nature of PfCSP on the sporozoite surface, something that has never been visualised  in situ. It also raises questions about the inclusion of the C\u2010terminus in the current RTS,S vaccine design. Should future efforts drop this domain entirely? One caution is the key role that CD4+ and CD8+ T responses play in protective responses to malaria, and with known T\u2010cell epitopes within the C\u2010terminus  target for a subunit\u2010based malaria vaccine, given it is clearly evolved to mitigate an inevitable human immune response. Recent findings have shown that targeting the repeat regions in"}
+{"text": "Cryptococcus antigen in serum by lateral flow assay (CrAg LFA) without nervous system involvement and with treatment in accordance with the results. Materials and Methods. A retrospective, longitudinal, analytical study was performed. Seventy patients with cryptococcosis initially diagnosed by serum CrAg LFA without meningeal involvement between January 2019 and April 2022 were analyzed for medical records. The treatment regimen was adapted to the results of blood culture, respiratory material, and pulmonary tomography imaging. Results. Seventy patients were included, 13 had probable pulmonary cryptococcosis, 4 had proven pulmonary cryptococcosis, 3 had fungemia, and 50 had preemptive therapy without microbiological or imaging findings compatible with cryptococcosis. Among the 50 patients with preemptive therapy, none had meningeal involvement or cryptococcosis recurrences to date. Conclusion. Preemptive therapy avoided progression to meningitis in CrAg LFA-positive patients. Preemptive therapy with dose adjustment of fluconazole in patients with the mentioned characteristics was useful despite the use of lower doses than recommended.Cryptococcosis is one of the most serious opportunistic diseases in patients living with HIV. For this reason, early diagnosis and appropriate treatment are important. Objectives. The aim of the study was to understand the development of patients diagnosed with cryptococcosis by detection of  Cryptococcosis is an opportunistic mycosis of worldwide distribution. It particularly affects immunocompromised patients, and is one of the main causes of morbidity and mortality in people living with HIV (PLHIV) ,2. For tIn 2011, the WHO recommended in a rapid advice guideline  the use The high sensitivity of this test in serum was proven in several studies ,5. For tDifferent economic circumstances, infrastructure, lack of trained personnel, or lack of medication mean that, in many places, different screening and early therapy schemes are used ,7. The oThe current recommendations propose that CNS involvement should be ruled out and early treatment should be employed  in thoseThe respiratory tract is the main entry site for the infection. Most primo infections are self-limited, as a result of the immune response. In cases in which the immune system achieves control of the infection, granulomas with yeasts are generated inside of the macrophages. This state is known as latent infection, is asymptomatic, and is the main source of secondary reactivations . It occuIt is known that meningeal cryptococcosis (MC) is the most frequent presentation; however, this fungus can involve various organs such as the respiratory tract, peripheral lymph nodes, bone marrow, and skin, among others .For this reason, it is important, in cases with positive CrAg LFA, to perform an exhaustive semiological examination of the skin, take samples for blood cultures, perform mycological examination of CSF, chest tomography, and eventually mycological examination of respiratory material, in order to evaluate the clinical situation of the patient and thus indicate the correct treatment.Objective. To understand the development of PLHIV hospitalized with a diagnosis of cryptococcosis by detection of CrAg LFA without central nervous system involvement and with early treatment adjusted according to the results .A retrospective, longitudinal, analytical study was performed. The medical records of 203 patients with cryptococcosis diagnosed at the Mycology Unit of the F. J. Mu\u00f1iz Infectious Diseases Hospital between January 2019 and April 2022 were analyzed. .All PLHIV hospitalized with initial diagnosis of cryptococcosis by serum CrAg LFA without meningeal involvement. All patients aged 18 years or older.Patients with recurrent cryptococcosis due to treatment or prophylaxis interruption. All the patients whose diagnosis of cryptococcosis was initially made by blood culture, sputum, bronchoalveolar lavage, scarification of skin or mucosal lesions, or deep biopsies. Patients who suffered meningeal cryptococcosis (MC) or who received antifungals in the 30 days previous to hospital admission. HIV-negative individuals and patients referred from other hospitals or health centers.CSF: All samples were processed at the Mycology Unit according to its procedure manual ,13.All CSF samples were centrifuged and before processing the material 0.5 mL of the supernatant was aseptically separated to carry out antigen detection. A drop of sediment was mixed with Indian ink for direct microscopic examination (100\u2013400\u00d7). The rest of the material was seeded on Sabouraud-dextrose agar, sunflower-seed agar, both incubated at 28 \u00b0C, and brain-heart infusion agar (BHI-agar) at 37 \u00b0C. Every culture tube was observed daily, and they were maintained for 14 days before discarding as negative.Blood culture: blood samples were taken for blood cultures by the lysis-centrifugation method according to the technique developed in the Mycology Unit . BrieflyOther materials: in patients with respiratory involvement, bronchoalveolar lavage (BAL) or sputum samples were taken. In cases with cutaneous-mucosal lesions, scarifications or biopsies were performed. Other materials such as ascitic fluid and bone marrow aspiration were also analyzed. All these samples were processed with the usual methodology for mycological diagnosis .Direct microscopic examination of all these samples was performed by wet mount preparations and Giemsa stain. Cultures on Sabouraud-agar, sunflower-seed agar, and BHI-agar at 28 \u00b0C and 37 \u00b0C were maintained for two weeks.Cryptococcus isolates: Every yeast colony compatible with Cryptococcus was typified by phenoloxidase production on Niger seed agar, urease on Christensen medium, grown capacity at 37 \u00b0C. Phenotypical differentiation between Cryptococcus neoformans and Cryptococcus gattii was carried out by seeding on glycine-canavanin-bromothimol blue agar (GCB) and glycinecycloheximide-phenol red agar  [Identification of  medium) .Isolation of fungal DNA  for preparation of the DNA library, which was kept at \u221220 \u00b0C.Amplification of Ura 5 gene by end-point PCR.Detection of the amplicon obtained by electrophoretic in 1% agarose gel.RFLP of Ura 5 with Sau96I and HhaI restriction enzymes.Detection the products with restriction enzymes on 3% agarose gel.C. neoformans var. grubii: CBS 10085 VNI and CBS 10084 VNII; from C. neoformans hybrid AD: CBS 10080 VNIII; from C. neoformans var. neoformans: CBS 10079 VNIV; and from C. gattii: CBS 10078 VGI; CBS 10082 VGII; CBS 10081 VGIII and CBS 10101 VGIV) [The RFLP patterns were assigned by comparison with the patterns obtained from reference strains (01 VGIV) .Molecular identification through PCR-RFLP of URA5 gen was performed according to the following procedure:Cryptococcus isolates to amphotericin B (AMB)  and fluconazole (FCZ) . As clinical breakpoints for Cryptococcus are not still determined, the epidemiological cutoffs (ECV) were used as reference to differentiate between wild-type and non-wild-type isolates [Minimal inhibitory concentration (MIC) by means of the broth microdilution technique according to M27 4th Edition and M27S4 documents of the Clinical Laboratory Standard Institute\u2013USA, was assessed to study the antifungal susceptibility of isolates ,18,19,20Cryptococcus capsular polysaccharide antigen (CPA): detection of this antigen in serum was performed by immunochromatography  [Detection of ma, USA) .In our hospital, this determination is performed in patients admitted to the hospital wards with LTCD4+ < 200 cells/\u00b5L or with an opportunistic disease. Semi-quantitative detection of CPA in serum and CSF is then performed using the latex agglutination (LA) technique . To determine the titer, samples were used undiluted and in dilutions of 1:10; 1:100; 1:1000; 1:5000, and 1:10,000 ,12.Patients with inclusion criteria and with positive serum CRAg LFA were subjected to lumbar puncture, after neurological evaluation, to determine whether they had meningoencephalic involvement. In addition, blood culture and chest tomography were performed. Patients with respiratory symptoms or CT images compatible with pulmonary cryptococcosis were required to undergo sputum mycological examination and/or bronchoalveolar lavage.The therapeutic regimen was adapted to the results of blood culture, respiratory material, or pulmonary tomography imaging. Patients with proven or probable fungemia and/or pulmonary cryptococcosis (PC) were medicated with two weeks of fluconazole 800 mg/day, then continued for a further 8 weeks with fluconazole 400 mg/day (consolidation) and after that switched to secondary prophylaxis or maintenance therapy with fluconazole 200 mg/day.Patients who suffered hemodynamic decompensation or respiratory failure were treated with liposomal amphotericin B 3\u20135 mg/kg/day plus fluconazole 800 mg/day. Patients without pulmonary involvement and negative blood culture after 2 weeks of fluconazole 800 mg/day continued with fluconazole 200 mg/day (secondary prophylaxis or maintenance) .Cryptococcus neoformans or Cryptococcus gattii were considered as proven PC.Patients with positive serum CrAg LFA and pulmonary image compatible with PC, and for whom direct we performed examination of respiratory material with capsulated yeasts and/or culture with development of Patients with positive serum CrAg LFA and pulmonary image compatible with PC were considered probable PC.Patients with PC or fungemia who were also receiving rifampicin (a potent inducer of cytochrome P450) due to tuberculosis, received fluconazole 800 mg/day during the entire consolidation period.Patients who were due to switch to prophylaxis but were also receiving rifampicin or for whom the blood culture was performed late (after starting fluconazole) completed the 8-week regimen with fluconazole 400 mg/day (prolonged consolidation therapy). In some patients with tuberculosis, rifampicin was changed to another medication.p-value of <0.05 was considered significant. Statistix\u00ae 8.0 software was used for the analysis.Data for continuous variables were expressed as mean or median when applicable. The categorical variables were expressed as frequencies. The Fisher\u2019s exact test and the chi-square test were used to show statistical differences between groups. A In the period analyzed, 1698 serum CrAg LFA tests were performed in hospitalized PLHIV. One hundred ninety-nine were positive (11.7%). Considering only the cases with extrameningeal cryptococcosis, this methodology made possible the diagnosis in 4.1% of the patients hospitalized in that period (70 patients).p = 0.0002), followed by cerebral toxoplasmosis (7), pneumocystosis (6), bacterial pneumonia (5), hepatitis C (4), COVID-19 (2), and disseminated CMV (2).Seventy patients met the inclusion criteria; 39 were male (55.7%), the median age was 40 years (range: 22\u201369 years), the median LTCD4+ was 35 cells/\u00b5L (range: 3\u2013162 cells/\u00b5L). The most frequent comorbidity with significant differences was tuberculosis (TB) , followed by cough (24), dyspnea (15), diarrhea (10), and motor focus (7).The two most frequent symptoms at admission with significant difference were fever and impregnation syndrome  a, thirteIn relation to the pulmonary cryptococcosis tested, in three cases the development of this fungus was obtained in the culture. In only one case it was visualized in the direct examination in fresh and with the addition of Indian ink to the respiratory material to evidence the characteristic capsule. In this last case, the fungus did not develop on the usual culture media.All the Cryptococcus isolates belonged to C. neoformans complex, and their genotype was VNI.Susceptibility tests showed that the AMB was tested onsix C. neoformans isolates, and all showed a MIC value \u22641 \u00b5g/mL. Susceptibility to FCZ was determined in six isolates, and was \u22648 \u00b5g/mL. All the isolates presented MICs lower than the ECV , for both drugs.Two patients with probable PC were treated during consolidation with fluconazole 800 mg/day due to concomitant pulmonary tuberculosis.Two patients died. One of them had proven severe PC and pneumocystosis  Figure b, the otCandida and Aspergillus species. The limited use of strategies to diagnose cryptococcal disease early, before the onset of meningitis, contributes to increased morbidity and mortality, particularly in resource-poor settings. Diagnostic tests have been used for several years to identify patients with cryptococcosis. These include the latex agglutination (LA) test and enzyme immunoassay (EIA). However, in resource-limited settings, both are difficult to use, as they require refrigeration, pre-treatment with additional enzymes, such as pronase in the case of LA, and specialized equipment, such as a spectrophotometer in the case of EIA [Cryptococcal infection is increasingly recognized as a major cause of invasive fungal condition not only in PLHIV, also in solid organ transplant recipients. However, in solid organ transplant recipients, a study of more than 1000 patients identified cryptococcal infection as the third most frequent fungal pathology after those caused by e of EIA .In 2009, a new lateral flow assay (LFA) was developed that allows rapid detection of the cryptococcal glucuronoxylomannan polysaccharide capsule, and in 2011  it was aTo measure fungal burden, semi-quantitative studies can be done with serum CrAg titers using either LFA or LA, but it should be noted that LFA is 4\u20135 times more sensitive.As with quantitative cultures, antigen titers can predict progression to meningitis, and when antigenemia titers by LFA are >160 the patient is at increased risk of mortality . On the Cryptococcus species and to recognize which genetic factors contribute to their pathogenicity and virulence. As in most parts of Latin America, the most frequent genotype in this study was VNI [Molecular methods have made it possible to understand the genetic differences between the various  was VNI .Firacative also published results indicating that the majority of 570 Latin American isolates proved to be wild-type against fluconazole, amphotericin B, itraconazole, voriconazole, 5-fluorocytosine, and posaconazole. However, non-wild-type VNI strains were isolated for fluconazole and amphotericin B in Brazil and Argentina . In our Preemptive therapy is defined as the indicated treatment with fluconazole in high-risk, asymptomatic patients with positive serum LFA CrAg.The use of serum LFA CrAg to detect patients with cryptococcosis was initially recommended in countries or cities with a prevalence of the disease greater than 3% . HoweverThe first cost-effectiveness studies carried out on the use of early therapy with fluconazole vs. without antifungal treatment showed that it increased survival . It has Despite the use of the screening methodology recommended by the WHO with subsequent anticipatory therapy, some authors continue to report high mortality. This is probably due to the fact that many cases with meningeal or other organ involvement are treated with fluconazole alone ,33. ScreWe should look for and confirm the clinical presentation of the patient once the result of a positive CrAg LFA is available and before starting any treatments . Any orgIn immunosuppressed individuals with positive serum CrAg LFA, pulmonary cryptococcosis or in other localizations, especially meningitis, should be ruled out by CSF mycological study, since the presence of CNS involvement alters the dose and duration of induction therapy and the need to monitor intracranial pressure . It has In cases in which the diagnosis is made through serum CrAg LFA without target organ involvement, early therapy and subsequent secondary prophylaxis is employed in order to avoid meningitis, immune reconstitution syndrome, or unmasking when antiretroviral therapy is indicated.Originally, LFA CrAg was recommended in patients with LTCD4+ < 100 cells/\u00b5L, but today it is also used in patients with LTCD4+ < 200 cells/\u00b5L . At the As we observed in this group of patients, the symptoms that lead to consultation are very unspecific, so it is necessary to perform this determination in all patients who are hospitalized with less than 200 cells/\u00b5L LTCD4+ or with suspicion of opportunistic disease.Non-contrast chest CT is essential because many of the patients have pulmonary nodules of probable fungal etiology and no respiratory symptoms. The most frequently observed pulmonary images in PC are interstitial pneumonitis and pulmonary nodules , in someSome authors, once they exclude meningeal involvement, have considered starting treatment with fluconazole 1200 mg/day for the first two weeks , in otheTo date, there are no clinical trials for cases of cryptococcosis in which there is no pulmonary or central nervous system involvement. Therefore, there are differences in the way to treat with antifungals when the CrAg LFA is positive and there is no involvement of the meninges, lungs, or other organs.Patients with mild pulmonary disease have been successfully treated with fluconazole monotherapy 400 mg/d  and in sThe heterogeneity of the treatments and complementary studies used in patients diagnosed with serum CrAg LFA+ is probably related to the diversity of diagnostic and economic possibilities.In our cases, it was possible to adapt the treatments to the results obtained by the different chest images and clinical samples analyzed.Reducing the dose of fluconazole in cases without pathological findings is likely to improve patient adherence to the different treatments.In patients suffering from CM it is established that ART should be started 4\u20136 weeks after initiation of antifungal therapy . HoweverIdentifying the different clinical presentations is essential in order to initiate an early therapy properly adjusted to the results obtained. It is very important that microbiological studies or mycological examinations are performed prior to initiating therapy with fluconazole. Interactions of this antifungal drug with other medications should be evaluated on a case-by-case basis. It should be remembered that tuberculosis is a very frequent disease in our environment, especially in PLHIV. In that disease, rifampicin is an essential drug for the good development of the patients. This drug is an inductor of the cytochrome P450 system at the hepatic level (a potent inducer of CYP3A4) and therefore accelerates the metabolism of many drugs that share this metabolic pathway, causing a decrease in their plasma concentrations. Fluconazole is metabolized by CYP3A4, therefore the use of both drugs causes lower fluconazole concentrations in peripheral blood. This could lead to subtherapeutic doses of fluconazole, resulting in treatment failure or the possibility of fluconazole resistance if used at low doses.It remains important to remember that although our study is based on hospitalized patients with suspected opportunistic disease, we should always evaluate the possibility of performing LFA in all patients with less than 200 LTCD4 before initiating antiretroviral therapy (ART).Early initiation of ART in patients with CM can lead to life-threatening immune reconstitution syndrome (IRIS), so delaying ART is recommended.However, many cases of CM and IRIS that occur after initiation of antiretroviral therapy could be prevented .In addition, it should be considered that the increase of cryptococcosis cases in non-HIV immunocompromised patients  requires the use of rapid diagnostic techniques such as LFA CrAg in serum to detect this pathology early and to be able to indicate the appropriate treatment.It is important to mention that this study has the limitation of being a retrospective study of a single center and with a limited number of patients from Argentina. For this reason, further studies are needed to confirm the findings of our work.In patients with positive serum CrAg LFA, it is essential to evaluate the clinical situation of the patient, with a thorough semiology examination, request lumbar puncture to rule out central nervous system involvement, perform blood cultures and thoracic CT scan with possible mycological examination of respiratory material, and then evaluate the best treatment based on the results.Finally, this treatment with dose reduction of fluconazole in patients in whom the mentioned focuses were ruled out was useful even with doses lower than those recommended."}
+{"text": "Transcutaneous blood gas monitoring allows for continuous non-invasive evaluation of carbon dioxide and oxygen levels. Its use is limited as its accuracy is dependent on several factors. We aimed to identify the most influential factors to increase usability and aid in the interpretation of transcutaneous blood gas monitoring.In this retrospective cohort study, transcutaneous blood gas measurements were paired to arterial blood gas withdrawals in neonates admitted to the neonatal intensive care unit. The effects of patient-related, microcirculatory, macrocirculatory, respiratory, and sensor-related factors on the difference between transcutaneously and arterially measured carbon dioxide and oxygen values (\u0394PCO<sub>2</sub> and \u0394PO<sub>2</sub>) were evaluated using marginal models.A total of 1,578 measurement pairs from 204 infants with a median [interquartile range] gestational age of 27<sup>3</sup>/<sub>7</sub> [26<sup>1</sup>/<sub>7</sub>\u201331<sup>3</sup>/<sub>7</sub>] weeks were included. \u0394PCO<sub>2</sub> was significantly associated with the postnatal age, arterial systolic blood pressure, body temperature, arterial partial pressure of oxygen (PaO<sub>2</sub>), and sensor temperature. \u0394PO<sub>2</sub> was, with the exception of PaO<sub>2</sub>, additionally associated with gestational age, birth weight Z-score, heating power, arterial partial pressure of carbon dioxide, and interactions between sepsis and body temperature and sepsis and the fraction of inspired oxygen.The reliability of transcutaneous blood gas measurements is affected by several clinical factors. Caution is recommended when interpreting transcutaneous blood gas values with an increasing postnatal age due to skin maturation, lower arterial systolic blood pressures, and for transcutaneously measured oxygen values in the case of critical illness. Additio2, tcPO2, heating power levels, and the sensor temperature were logged at 1 Hz . Standard of care patient monitoring data including heart rate (ECG or pulse oximetry), invasive arterial blood pressure, and body temperature  was logged at 1 Hz. High-frequency (100 Hz) blood pressure tracings were recorded as standard of care. Demographic data, data on ventilation methods, FiO2, blood cultures, antibiotic treatment, and laboratory data were collected from the electronic patient records .TcPCO2 and \u0394PO2), marginal models were used. The described variables were included in the models, with PaO2 only in the CO2 model and PaCO2 only in the O2 model. To allow for non-linearity in the relation between continuous explanatory variables and the outcome, splines were evaluated with boundary knots at the 5th and 95th percentile. The following interactions were considered and added to the model when significant: FiO2 and ventilation mode; FiO2 and sepsis state; arterial systolic blood pressure and sepsis state; body temperature and sepsis state. To account for the within-subject correlations of repeated measures, a compound symmetry covariance matrix was applied in the CO2 model and a continuous first-order autoregressive covariance matrix in the O2 model. Additionally, the relation between \u0394PO2 and \u0394PCO2 was evaluated using a marginal model, adjusting for all significant variables from the CO2 model. A two-sided p value of <0.05 was considered statistically significant. All analyses were performed using R statistical software , using the nlme package [Categorical variables are presented as number (%) and continuous variables as median (interquartile range). Agreement between transcutaneous blood gas measurements and arterial blood gas samples was calculated according to Bland and Altman, accounting for multiple measurements per patient . To iden package .n = 58), during therapeutic hypothermia (n = 60) and surrounding a calibration (n = 201), 1,578 samples from 204 patients were included for analyses. Table 2 and \u221216.1 (\u221263.1\u201330.9) mm Hg for O2.A total of 1,897 data pairs were obtained from 214 patients during the study period. After exclusion of pairs measured at a sensor temperature of 39\u00b0C .None of the interactions significantly improved the model and were therefore not included. The \u0394PCO2 was significantly influenced by GA, birth weight Z-score, postnatal age, arterial systolic blood pressure, body temperature, FiO2, PaCO2, heating power, sensor temperature. Interactions were significant between FiO2 and sepsis state and between body temperature and sepsis state  affects transcutaneous blood gas measurements [Transcutaneous blood gases are often measured in hemodynamically instable neonates. Arterialization of the skin reduces vascular autoregulation, making cutaneous flow primarily blood pressure dependent , 20. Oururements , 21. Heaurements . The facurements .2. This suggests that during sepsis cutaneous flow is sufficient to provide accurate tcPCO2 values, to which the high diffusion speed of CO2 attributes [2 levels were consistently lower in septic infants, in particular when accompanied by an elevated body temperature. Unfortunately, a limited number of samples with a body temperature above 38\u00b0C were available. Future studies should investigate the effect of sepsis.The presence of sepsis had no effect on \u0394PCOtributes . However2 leads to an increase in PaO2 and tcPO2. The increase in tcPO2 levels found in this study was limited, possibly indicating a maximum diffusion capacity of the skin [2 and PaCO2 could be a consequence of changes in regional blood flow, invoked by changes in tissue O2, CO2, and pH that alter local metabolic activity [Under physiological pulmonary and microcirculatory conditions, an increase in FiOthe skin . This efthe skin , 12. Theactivity .2 was found. A higher heating power was related to a larger \u0394PO2, and this could be attributed to a combined effect of changes in blood flow and other factors, such as skin thickness. Analysis of continuous heating power data and the inclusion of blood flow measurements may provide more insight into this phenomenon.The interaction between the heated sensor and the microcirculation is expressed in several parameters. The effect of sensor temperature has been investigated extensively , 25, yet2 with an increase in \u0394PCO2. Although the diffusion gradients in unheated skin have opposing directions, in heated skin they are directed outward and to a different degree affected by the same factors. This suggests a common dependency on the blood flow under the sensor.An interesting finding of this study was the increase of \u0394PO2 does not influence diffusion of oxygen toward the sensor. Results should be interpreted with care when study results are compared to measurements obtained with the traditionally used Clark electrode.Correct use of transcutaneous blood gas monitors, including frequent calibrations, leak-free sensor fixation, and timely renewal of the sensor membrane, is paramount for obtaining valid measurements. Sensor location and the presence of edema at the measurement site could influence accuracy, but were not recorded in this study. Sensor calibrations were mandatory for measurement continuation. The NICU staff received frequent and extensive training on sensor use and quality assessment, limiting the influence of these sensor-related factors. For continuous variables, such as the heart rate, only a single measurement value during arterial blood gas withdrawal was included in the analysis. The effect of fluctuation of these variables could therefore not be evaluated. In addition, the fluorescence quenching technique for measurement of tcPO2 and O2 levels in infants. When used correctly, transcutaneous blood gas measurements provide a valuable continuous evaluation of blood gases in neonates. The complexity of using and maintaining transcutaneous sensors is the main reason that the convenience of using pulse oximetry is often preferred despite their inaccurate estimation of oxygenation. Besides the use of transcutaneous blood gases for respiratory monitoring, there is an increasing interest in its value as an indicator of tissue perfusion and hemodynamic failure, such as cardiac decompensation, shock, sepsis, and clinical outcome [Clinical interpretation of transcutaneous blood gas measurements is challenging due to the many factors simultaneously influencing accuracy. Arterial blood gas measurement remains the golden standard for intermittent evaluation of CO outcome , 26. Thi2 and tcPCO2 following the first period after birth.Maturation of the skin reduces accuracy of both tcPOAn arterial systolic blood pressure below approximately 50 mm Hg significantly impairs transcutaneous blood gas measurements.2 measurements.Hypocapnia leads to an inaccuracy of tcPO2 may deviate from arterial values.Caution is recommended with critical illness, as tcPOSeveral clinical factors have been identified that influence the agreement between arterial and transcutaneous blood gas values.The Medical Ethical Review Board of the Erasmus MC, Rotterdam, The Netherlands, waived approval for this study .The authors have no conflicts of interest to declare.This study was partly funded by Sentec AG. Sentec AG had no role in the design and conduct of the study, data analysis, interpretation of results, or writing of the manuscript.Tanja van Essen, Norani H. Gangaram-Panday, Willem van Weteringen, Tom G. Goos, Irwin K.M. Reiss, and Rogier C.J. de Jonge conceptualized the study. Tanja van Essen, Norani H. Gangaram-Panday, and Willem van Weteringen collected the data and wrote the first draft of the manuscript. Tanja van Essen and Norani H. Gangaram-Panday analyzed the data. All authors have provided valuable input on the writing of the final manuscript.All data generated or analyzed during this study are included in this article and its online supplementary material. Further inquiries can be directed to the corresponding author.Supplementary dataClick here for additional data file."}
+{"text": "The combination of accelerated digitalization and the recent COVID-19 crisis has increased the number of remote workers worldwide to unimaginable proportions. Among the large number of remote workers that execute their projects from home, there is a significant number of permanently self-employed remote workers, usually referred to as freelancers. Despite the importance of this kind of business activity for modern project management society, perceived drivers of freelancing are still unknown. The goal of this paper was to shed some light on the general subjective well-being of freelancing activity and investigate differences concerning gender, age, and education. The study was performed in late 2020 and included 471 freelancers from Serbia, Bosnia and Herzegovina, Macedonia, and Montenegro that participated in an online questionnaire evaluating their subjective well-being while participating in the \u201cgig\u201d economy. Factor analysis was used as a primary statistical method and two major groups were identified: (1) Impact of working from home on a freelancer\u2019s personal life and health and (2) Fulfillment of expectations in the economic and professional sense. Gender was found not to be significant for overall work satisfaction. However, older freelancers proved to be more satisfied with the fulfillment of economic and professional expectations, which correlate with years of professional experience. Another conclusion is that more educated freelancers are generally less satisfied with both groups of drivers - fulfillment of personal life and professional expectations. Understanding how the combination of occupations, technological infrastructure, and demographic characteristics in the region has affected the well-being of freelancers may help policymakers and organization owners, as well as future entrepreneurs, better prepare for this model of work in the future. It also increases the possibility of exploring individual dimensions of wellbeing useful for targeting interventions at the level of each country separately. In line with this, the present study contributes to the existing body of knowledge and the impact of hybrid models of work on the subjective well-being of workers in the \u201cgig\u201d economy. One of the most significant subgroups among these self-employed individuals is the freelancer group . FreelanThe latest report from the Online Labor Index (OLI) that provides information on the current state of the freelance (gig) economy ranks Western Balkans Countries (WBC) relatively high by the number of freelancers, putting Serbia in 12th, Bosnia and Hercegovina in 47th, North Macedonia in 70th and Montenegro in 110th place on the global scale .Satisfaction with personal life and subjective well-being (SWB) indicates how individuals feel and perceive their lives, with many studies associating cognitive evaluations of people\u2019s lives with various individual characteristics of responders . HoweverThis paper aims to contribute to the increasing body of knowledge by shedding some light on the SWB of freelancers and drivers that contribute to the significant increase of these activities in the WBC region .The paper addressed the research problem using a two-phase analysis to understand the relationship between working in the \u201cgig\u201d economy and perceived subjective well-being. Since SWB accompanies multiple life domains , factor The structure of this paper is as follows: The first section introduces the main goals and starting points of this research paper. The second section showcases a review of the existing literature on the \u201cgig\u201d economy, subjective well-being, and drivers of freelancing activity. The third section provides information on research methodology, which includes a description of the data and variables used, statistical approach, and data preprocessing. The Results, discussion, and final remarks are in the last two sections.2.There are many definitions of what \u201cgig economy\u201d means, some describing it as an exchange of labor for money between different parties over online platforms that enable matchmaking and payments between them , while oFreelancing is usually associated with the specific relationship between a client and a worker that is not permanently working for that client , sometimFurthermore, an increasing number of people work in project-based non-traditional environments without a clearly defined organizational structure, shared workspaces, and long-term engagements, which fundamentally changes the relationship dynamics in these organizations between workers and employers . They ge2.1.Virtual project teams are gradually becoming a norm as more and more companies move to the remote-first or async strategies that go beyond outsourcing and employing freelancers on company projects. Of course, leading this kind of project where there is at least one remote team member may pose different challenges than when all the team members are collocated. There is also a notable rise in the popularity of working as a freelance project manager , which mIn a survey conducted among professionals working remotely, \u201cengaging remote participants\u201d was the most common response to the question of challenges in remote project settings , and theWhen comparing aspects of remote work to the \u201cAgile Manifesto\u201d principles, which emphasize face-to-face conversations and team meetings, the authors of another study on a similar topic conclude that there are significant differences between collocated and remote teams . Therefo2.1.1.In a recent study on the social and economic advantages and limitations of working from home in the region of Western Balkans it was showcased that the most participants would recommend working in this manner, with some still hesitant to do so . FurtherIn addition, new forms of employment that include platform work or working remotely by utilizing online marketplaces are gaining more popularity because of the very high unemployment rates in the WBC region and better opportunities to earn a decent income .2.1.2.One number of analyzes showed that there is a trend of deteriorating working conditions and worker rights in the \u201cgig\u201d economy, directly comparing the present situation in the markets with the working conditions at the beginning of the past century . FurtherThe Terms of Service usually define the relationship between intermediaries and clients where the risk of providing necessary tools and equipment is on the worker, which enhances vulnerability and instability for them . Also, tOn the other hand, the agreement between the intermediaries and the clients usually diminishes any liability for platforms . The autFurthermore, freelancing takes a toll on workers by introducing precarity, highly intense stress, uncertainty, and alienation into everyday life by blurring the lines between personal and work commitments .2.1.3.Many studies have been done on the topic of drivers and experiences of workers in the gig economy during recent years, trying to identify and explain the motivators, incentives, and reasons for participation in this type of economy . For exa2.2.Throughout history, happiness has been the highest good and the greatest motivation for human action within the experience of the individual making subjective well-being a central point in measuring the quality of life . DimensiThe literature also shows that evaluative questions are usually used for this purpose , with a 2.2.1.There is a growing trend among women to become solo entrepreneurs to fulfill other life commitments while attaining a better work-life balance . Further2.2.2.Better access to flexible work arrangements may become crucial for the older population to be engaged in the labor market but may provide fewer benefits for younger participants in the \u201cgig\u201d economy . Also, eFurthermore, previous research done in the United Kingdom on the topic of employment of people over 50\u2009years old showcased the impact the \u201cgig\u201d economy has on enabling flexible work arrangements for elderly workers engaged in portfolio jobs, freelancing, or consulting , but var2.2.3.On the topic of education, there is a clear trend toward lifelong learning and on-demand certification that is becoming very important in the \u201cgig\u201d economy, as workers need to attain new skills quickly and showcase their proficiency to stay relevant in this type of economy . FurtherBecause of such activities, often employees in the \u201cgig\u201d economy fail to define their career path, sometimes having too many options in choosing the next job they will work on, which ultimately leads to demotivation and dissatisfaction and shifts the \u201cradical responsibility\u201d of short-term or long-term economic survival to the worker. Also, workers in the \u201cgig economy\u201d cannot expect training from employers, so they must complete the relevant training and education in their own time to perform specific assignments. Specialization has proven not to be a good long-term strategy for workers in this economy, as market demands frequent change. Consequently, participants in this economy must be committed to learning throughout their lives, i.e., to renew their knowledge and move between different areas of expertise.Considering the findings showcased above, we propose hypothesis as follow:H1: Working as a freelancer impacts subjective well-being in the domain of life satisfaction.H2: Subjective levels of well-being in the domain of life satisfaction can be highly affected by a freelancer\u2019s gender, age, and education.3.3.1.The online survey was conducted in 2020 during the COVID-19 pandemic while workers practiced remote work in a new setting and included 13 questions on freelancers subjective-well-being and experiences working in the \u201cgig\u201d economy. Our research focused on investigating the subjective well-being of 989 respondents including 370 respondents from Serbia, 197 from Montenegro, 221 from North Macedonia, and 201 from Bosnia and Herzegovina.Afterwards, we excluded the responses with missing data and the ones that stated having permanent work contracts from the data sample to examine satisfaction among freelancers only and to maintain data integrity. Therefore, the final data sample included 471 freelancers whose SWB was analyzed and measured.The questionnaire was made based on the literature review and commonly found topics on this subject. The provided answers to the asked questions were given to the respondents in a form of five-point Likert-type scale measuring SWB from 1 (Completely disagrees) to 5 (Completely Agrees).Because of the multidimensional nature of the research model, exploratory factor analysis  and the 4.The Cronbach\u2019s alpha coefficient  validateThe results displayed in The Kaiser-Meyer-Olkin (KMO) test  indicateFactor 1\u2013The impact of working from home on a freelancer\u2019s personal life and healthFactor 2\u2013Fulfillment of expectations in the economic and professional senseUsing the results from the rotated component matrix , the fol5.The results show a high negative impact of working from home on subjective well-being, with respondents acknowledging feeling tense and anxious, having trouble separating work and private life, and neglecting other commitments, as also found in the previous research on this topic . There iFurthermore, their subjective well-being may vary depending on their motives for joining this kind of economy and the source of income that it provides, as previous studies have shown . This paRegarding gender, the analysis did not find any significant differences by using the t-Test on the independent samples, confirming the findings of a recent study done in the same region on a similar topic . The resThere is also a clear correlation between respondents\u2019 age and the fulfillment of expectations in a monetary and professional sense , as manyBetween the level of education and both factors negative correlation was also found , showcasFurthermore, there is a clear benefit for organizations in regard of resilience and business continuity by engaging workers in the \u201egig \u201ceconomy, especially when implementing already available frameworks for that purpose .Based on the findings above, we conclude that the first hypothesis \u201cWorking in the \u201cgig\u201d economy impacts subjective well-being in the economic, professional, and personal life domains\u201d is confirmed and that the second hypothesis \u201cThe subjective well-being levels depends on freelancers\u2019 gender, age, and education\u201d is only partially confirmed with no significant differences when considering gender , 8.6.The contribution of our research is that it is one of the first attempt to empirically explain the relationship between freelancing and subjective well-being in Western Balkans. In line with this, our study concludes that flexible working conditions, professional and economic fulfillment, and improved work-life balance are the primary motivators for freelancers working in the \u201cgig\u201d economy in selected countries. Furthermore, there is a clear trend regarding heightened subjective well-being scores and freelancing from home compared to workers who provide traditional services from home, especially when engaged in the passion economy.The analysis of workers in the \u201cgig\u201d economy concerning their subjective well-being reveals that satisfaction levels drop significantly with the education level of the respondents. Also, there seems to be a trend toward higher satisfaction among the older population participating in the gig economy. As for several other domains of SWB, there are differences between highly educated workers performing their domain work and those working on low-skilled tasks, like transportation or delivery. Furthermore, the results did not show any significant differences between genders among freelancers, but the impact of age and education variables is observable.By reviewing the survey results and showcasing the findings, this paper contributes to the previous body of knowledge on the topic of motivators for freelancing and its impact on SWB of the participants in the \u201cgig\u201d economy in a limited capacity and calls for further research by investigating the impact of self-employment and peculiar work arrangements on the quality of life and other domains of subjective well-being. Furthermore, limiting factors of our research are related to the fact that due to the pandemic, we were able to collect data electronically, i.e., through a web questionnaire and not directly in the field. Additionally, the authors recommend analyzing the differences between freelancers, self-employed individuals, and part-time contingent workers and their perspectives on subjective well-being in future research.The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.Ethical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. The patients/participants provided their written informed consent to participate in this study.MV and GA prepared the research concept and literature review, and gave their take on the results. MM defined the methodology and questionnaire and provided final conclusions. DR reviewed and provided perspective on the legal issues and challenges of freelancing. AD and DM did statistics and data preparation and presentation. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."
\ No newline at end of file