diff --git "a/deduped/dedup_0714.jsonl" "b/deduped/dedup_0714.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0714.jsonl"
@@ -0,0 +1,47 @@
+{"text": "This raises the question regarding the potential for similar reactivity from coal that contains pyrite. Experiments were performed to specifically evaluate the role of pyrite in coal dust reactivity. Coal samples containing various amounts of FeS2 were compared for differences in their generation of ROS and degradation of RNA.The harmful effects from inhalation of coal dust are well-documented. The prevalence of lung disease varies by mining region and may, in part, be related to regional differences in the bioavailable iron content of the coal. Pyrite (FeS2, generate ROS and degrade RNA. Coal samples that do not contain pyrite do not produce ROS nor degrade RNA. The concentration of generated ROS and degradation rate of RNA both increase with greater FeS2 content in the coals.Coals that contain iron also show the presence of FeS2 in the coals. Considering the harmful effects of generation of ROS by inhaled particles, the results presented here show a possible mechanism whereby coal samples may contribute to CWP. This suggests that the toxicity of coal may be explained, in part, by the presence of FeS2.The prevalence of coal workers' pneumoconiosis can be correlated to the amount of FeS The occupational risks associated with coal mining are well-documented and range from entrapment in collapsed mining structures to health problems associated with chronic exposure to coal dust (see  for revi2 phases  were then added to the aqueous filtrate in the following order, and at the indicated final concentrations, in a total volume of 2 ml: 100 mM KH2PO4 pH 4 buffer, 41 \u03bcM leuco crystal violet , and 0.5 units/mL HRP (50 \u03bcL from a stock solution of 4.5 mg HRP in 50 ml H2O). Samples were kept in the dark at room temperature (22 \u00b1 2\u00b0C) for 30 minutes, upon which absorbance stabilized. Absorbance measurements were conducted in 1 cm path-length cuvettes and corrected for absorbance in a blank. The zero-H2O2 blank consisted of DI with all reagents in the proper concentrations.Hlsewhere . Leuco c\u2022OH), 3'-(p-aminophenyl) fluorescein  was used. APF is not fluorescent until the aminophenyl group is eliminated from fluorescein by oxidation with \u2022OH, peroxynitrite anions (ONOO-) [2O2. The reactivity of APF is selective for only the very highly reactive oxygen species such as hydroxyl radicals and peroxynitrite anions and once reacted, forms a stable fluorescent product [2O2 with 10 \u03bcM APF in the presence of 2.95 units/mL  HRP in 10 mM potassium phosphate buffer at pH 7.40 in a 4-mL methylcrylate cuvette (Fisher). These solutions were incubated in the dark at room temperature (22 \u00b1 2\u00b0C) for 30 minutes and followed by fluorescence measurements . In experiments performed to evaluate the generation of \u2022OH from coal slurries, coal samples were mixed with 10 \u03bcM APF in 10 mM potassium phosphate buffer, pH 7.40 in 2-mL vials and rotated end-over-end for 24 hrs in the dark. The suspensions were filtered through 0.45 \u03bcm filters and the fluorescence was measured . The fluorescence data are presented on the figures as \u2022OHAPF. Three replicate determinations with the same coal and pyrite composition were performed to estimate the uncertainty of the APF method.For the detection of hydroxyl radicals ( (ONOO-) , or by h product . ResultsThe capacity of the coal samples to degrade yeast RNA was evaluated by determining the decline in the concentration of full-length short strand RNA by loss of dye-binding capacity. This method has been described in detail elsewhere . Yeast R\u2022OH-induced RNA degradation for several reasons. Reaction of \u2022OH with RNA leads to alteration of the bases as well as cleavage of the RNA strands. While UV-Vis absorbance is suitable for determining total nucleic acid base concentrations and inferring nucleic acid concentrations, it is not as sensitive as using RiboGreen for measuring short-strand RNA reacted with \u2022OH. This is because cleavage of short-stand RNA will result in a larger fluorescence reduction with RiboGreen compared to the reduction in light absorbance. RiboGreen fluorescence has been found to be relatively independent of RNA fragment size when strands are 500 bases to 9000 bases in length, but declines with decreasing fragment size for smaller fragments: for example, compared to the intensity of fluorescence from 500 base fragments, a 28% drop in fluorescence was noted for 100-base RNA fragments [Full length short-strand RNA was quantified by binding of RiboGreen (Invitrogen), which fluoresces when bound to RNA. This RNA quantification method was used instead of UV-Vis absorbance measurements for detection of 2/L. 1.5 mg/L RNA solutions were added to the vials to initiate the experiments. The vials were placed in an orbital shaker (Thermolyne) operating at 320 rpm at room temperature (22 \u00b1 2\u00b0C). Samples were withdrawn from the suspensions with syringes at various times and immediately filtered through 0.45 \u03bcm PVDF (Millipore) filters upon collection. 1 mL samples of the filtrates were added to a 4-mL fluorescence cuvette with 1 mL of diluted RiboGreen dye. The cuvettes were kept in the dark and the fluorescence (excitation/emission 490/520 nm) recorded after three minutes.The experiments in this study were conducted according to a protocol described in previous work . RiboGre2 . While pyrite is typically present as cubes or octahedra, marcasite often assumes a tabular morphology [An SEM image and EDAX analysis of the coal sample that contains the highest concentration of sulfur and iron NIST #2685b) shows the presence of small platy grains of FeS685b showrphology .2O2 and the amount increases as a function of both coal loading based on surface area and sulfur content . With the addition catalase and EDTA (or without EDTA), no H2O2 was detected. H2O2 measurements were taken from several coal/water suspension vials that have been mixing from 2 to 30 minutes prior to being filtered followed by addition of the LCV reagents. The H2O2 concentration is highest after around 2 to 3 minutes, after which the H2O2 concentration drops about 90% in 15 minutes and H2O2 is not detected after 30 minutes (data not shown). Results in Figure 2O2 generation and pyrite content of the coal. In addition, H2O2-generation scales with surface area suggesting that the mechanism of H2O2 formation is surface dependent. The samples with the lowest sulfur and iron content  show no H2O2 formation.Experiments were performed to evaluate the generation of hydrogen peroxide from coal/water suspensions. Coal/water suspensions generate Hent Fig. . EDTA wairon eq. . With th\u2022OH in coal/water suspensions. Results show that coal/water suspensions (in absence of EDTA) generate \u2022OH and the quantity of \u2022OH formed scales with coal sulfur content  progressively increasing quantities of low-S coal (#1635), which failed to generate any \u2022OH when added alone to water, were added to a fixed quantity of pyrite  in water without EDTA and (b) progressively increasing quantities of the same sample of pyrite were added to a fixed quantity of low-S coal under the same conditions  was exposed to a 1.5 mg/L yeast RNA solution and the RNA was periodically quantified for a duration of 7 hours. Results from earlier studies using gel electrophoresis show that pyrite causes RNA strand cleavage [Coal samples that contain pyrite degrade RNA Fig. . In thescleavage . Here, c\u2022OH and H2O2 from coal samples that contain pyrite is consistent with our previous finding that pyrite can spontaneously generate \u2022OH [2O2[\u2022OH and H2O2 from coal samples that do not contain pyrite implies that the mechanism involves pyrite and not the organic fraction of coal. The main experimental observations are listed below.The formation of rate \u2022OH  and H2O2 \u2022OH [2O2. The lac\u2022 The sulphur content of coals can be correlated with ferrous iron release into solution2 phase\u2022 Some of the iron content of coal can be correlated to an FeS2O2 or \u2022OH\u2022 Coals containing < 1% sulphur form no detectible H\u2022 Coals containing < 1% sulphur do not degrade RNA2O2 and \u2022OH and degrade RNA\u2022 Coals containing > 1% sulphur form H\u2022 The concentration of sulphur in coal samples can be correlated to:2O2 and \u2022OH formed in solution\u2022 Concentrations of H\u2022 Rate of degradation of RNA2O2 and \u2022OH are schematically presented in a diagram  to form \u2022OH through the Fenton reaction. It is \u2022OH which reacts with and degrades biomolecules such as nucleic acids, lipids, and proteins. A reaction arrow has been drawn from the \u2022OH to the coal surface because it remains unknown whether the organic fraction of coal reacts with \u2022OH. Whether the mechanism(s) whereby coal that contains pyrite involve reactions at the pyrite surface, reactions in solution, or a combination of surface and solution-mediated reactions remains unknown. Huang et al. have shown a correlation between the prevalence of CWP and release of ferrous iron into in an acidic solution from coal samples [\u2022OH formation, reaction of ferrous iron at the pyrite surface with oxygen may also lead to the formation of \u2022OH. We speculate that the toxicity of coals that contain pyrite is not only related to release of ferrous iron into solution but also reactivity at the pyrite surface. In fact, earlier work by our group shows that the presence of solid pyrite promotes the rate of RNA decomposition, exceeding the RNA decomposition rate in the presence of dissolved ferrous iron alone. Experiments in the presence of pyrite lead to a more rapid degradation of RNA, even though the dissolved iron concentration is comparable in both experiments [The mechanisms whereby coal that contains pyrite generates Hram Fig. . In this samples . While feriments .\u2022OH scales strongly with the sulfur content of the coals when the coals are evaluated on an equal surface area basis  content in the US , it is i"}
+{"text": "Pyrite, the most abundant metal sulphide on Earth, is known to spontaneously form hydrogen peroxide when exposed to water. In this study the hypothesis that pyrite-induced hydrogen peroxide is transformed to hydroxyl radicals is tested.Using a combination of electron spin resonance (ESR) spin-trapping techniques and scavenging reactions involving nucleic acids, the formation of hydroxyl radicals in pyrite/aqueous suspensions is demonstrated. The addition of EDTA to pyrite slurries inhibits the hydrogen peroxide-to-hydroxyl radical conversion, but does not inhibit the formation of hydrogen peroxide. Given the stability of EDTA chelation with both ferrous and ferric iron, this suggests that the addition of the EDTA prevents the transformation by chelation of dissolved iron species.While the exact mechanism or mechanisms of the hydrogen peroxide-to-hydroxyl radical conversion cannot be resolved on the basis of the experiments reported in this study, it is clear that the pyrite surface promotes the reaction. The formation of hydroxyl radicals is significant because they react nearly instantaneously with most organic molecules. This suggests that the presence of pyrite in natural, engineered, or physiological aqueous systems may induce the transformation of a wide range of organic molecules. This finding has implications for the role pyrite may play in aquatic environments and raises the question whether inhalation of pyrite dust contributes to the development of lung diseases. The lifetime of \u2022OH is on the order of a few nanoseconds, but its reaction through addition with DMPO results in the lone electron being trapped on DMPO to form the DMPO-OH radical adduct. The adduct has a much longer lifetime and can be detected. The problem with using ESR spin-trapping with DMPO is its susceptibility to artifacts. In the case of studies involving iron-bearing minerals, it is important to note that the presence of ferric iron can induce the formation of a DMPO-OH adduct in the absence \u2022OH  selectively degrades H2O2 and was used to verify that LCV oxidation was due solely from H2O2. Reagents were added to the aqueous filtrate in the following order with final concentrations: 100 mM KH2P4 pH buffer, 41 \u03bcM LCV (dissolved with HCl), and 1 \u03bcg HRP.The Hlsewhere . In bried 590 nm . CalibraN-oxide (DMPO) was purified with activated carbon (Fisher). All spin trap experiments were conducted with a Bruker EMX ESR equipped with an Aqua-X liquid cell. Pyrite samples were exposed to DMPO solutions (for about 15 seconds), immediately filtered, injected into the liquid cell and immediately analyzed at room temperature (25 \u00b1 2\u00b0C) in the presence of O2. The spectrometer settings are as follows: magnetic field of 3470 \u00b1 100 G, microwave power of 20 mW, modulation frequency of 100 kHz and amplitude of 1 G, receiver gain of 2 \u00d7 105, time constant of 0.64 sec, and scan time of 2 min 47 sec. Reagents and final concentrations during analyses: DMPO (Sigma) 100 mM, H2O2 120 \u03bcM, ferrous ammonium sulfate 25 \u03bcM, EtOH 30%, iron (III) sulfate pentahydrate 100 \u03bcM, pyrite 25 mg in 2 mL of solution.The spin trap 5, 5-dimethyl, 1-pyrroline g, 5 min) and filtration (0.45 \u03bcm) to remove impurities. Experiments with pyrite were performed in 50-mL centrifuge tubes. 10 g/L pyrite was added to a 1.5 mg/L RNA solution, stirred and centrifuged  before sampling. RNA was quantified by using a molecular probe specifically designed for RNA (RiboGreen from Invitrogen). RiboGreen was added to solution aliquots following the manufacturers' protocol. Fluorescence measurements were conducted using a Picofluor instrument . With this protocol it is possible to measure RNA strands with less than 100 bases . Unlike the experiment with human ribosomal RNA, the experiment with circular plasmid DNA was conducted in the presence of dissolved molecular oxygen.Ferrous and ferric iron were quantified using HACH UV-Vis spectroscopic methods using 1, 10 phenanthroline and ferrozine, respectively. All analyses were conducted on filtered samples (0.45 \u03bcm pore size).2O2 and \u2022OH. Nucleic acids added to pyrite suspensions degrade rapidly. Experiments with EDTA added to the pyrite suspensions demonstrate that the addition of this ligand stabilizes H2O2 and prevents \u2022OH formation and nucleic acid degradation.Results indicate that in an aqueous suspension, pyrite induces the spontaneous formation of H2O2. In these experiments, pyrite was mixed with water containing EDTA and immediately filtered. Due to reaction of unchelated Fe(II) with H2O2 or to reaction of chelated Fe(II) with H2O2, increasing the reaction time reduces the concentration of H2O2 . In the presence of O2, H2O2 is only detected when the iron chelator, EDTA is added. In the absence of EDTA, H2O2 is not observed. The lack of H2O2 when iron is not chelated with EDTA suggests that most H2O2 formed in pyrite suspensions is rapidly transformed to \u2022OH. This rapid loss keeps the level of H2O2 below the detection limit of the LCV method. A second set of experiments to evaluate the stability of H2O2 in the presence of ferrous iron and ferrous iron with EDTA is presented in the bottom half of Table 2O2 solution, the H2O2 concentration is reduced to 4.2 \u03bcM. However, when 10 mM EDTA is added, H2O2 is stabilized.Pyrite/aqueous suspensions spontaneously generate HO2 Table . As seen\u2022OH when it is suspended in water, experiments were performed using ESR spin-trapping in the presence of dissolved molecular oxygen. \u2022OH reacts with the spin-trap DMPO forming the DMPO-OH radical adduct, which displays a four-line spectrum . In the presence of \u2022OH, ethanol reacts with \u2022OH to form the DMPO-CH(CH3)OH adduct (C). If ethanol is added to a solution of DMPO and ferric iron , ethanol adds to DMPO resulting in the DMPO-OCH2CH3 adduct (D). DMPO-OCH2CH3 and DMPO-CH(CH3)OH exhibit different spectra (compare C and D). When DMPO is in the presence of pyrite, DMPO-OH is formed (E). Pyrite slurries contain trace amounts of ferric iron, so an experiment with ethanol is necessary. With ethanol, two sets of peaks result, one from the DMPO-OH adduct and one from the DMPO-CH(CH3)OH adduct (F), confirming the presence of \u2022OH. While these experiments clearly show that pyrite generates \u2022OH in the presence of water, it is not possible to determine the absolute concentration of the radical using the protocol presented above.To evaluate whether pyrite generates rum Fig. . In the \u2022OH toward nucleic acids was evaluated in the presence and absence of molecular oxygen. Figure The reactivity of pyrite-generated Collectively, the experiments show that the presence of pyrite leads to a decrease in nucleic acid strand length and a loss in fluorescence intensity. The fate of the nucleic acid bases was also investigated with UV spectroscopy. Samples of the yeast RNA samples exposed to pyrite were filtered to remove pyrite particles and wavelength scans were taken. The data shows a continual decrease in the absorbance centered around 260 nm when RNA is exposed to pyrite, which is consistent with a transformation of the bases that leads to a loss of their absorptivity at this wavelength Fig. . In prin\u2022OH, which leads to RNA degradation, may be a combination of solution reactions  and surface-mediated reactions (eq. 3 and 4). Experiments, in the absence of pyrite, were performed to determine the rate of RNA degradation as a function of dissolved ferrous iron concentration in the presence and absence of EDTA in the presence of molecular oxygen . The finding that EDTA inhibits the decomposition of the nucleic acid, but does not prevent the formation of H2O2, suggests that the H2O2-to-\u2022OH conversion takes place primarily in solution. The rationale for this notion is that EDTA forms strong complexes with dissolved iron, which, under the conditions of these experiments, prevents the Fenton reaction from taking place (see control experiment with Fe(II) and EDTA in Fig. 2O2 is formed in pyrite suspensions in the presence of EDTA and molecular oxygen precludes a strong interaction of the ligand with the pyrite surface. Electrochemical studies [2O2 formation via reactions 3 and 4 are expected to be inhibited. Hence, we speculate that pyrite promotes the degradation of nucleic acids and, by extension, the formation of \u2022OH by forming H2O2 at its surface which then can react with dissolved ferrous iron to form \u2022OH.The mechanism for the H studies  as well  studies . If EDTA\u2022OH reacts almost instantaneously after it is formed, it has been suggested that sorption of iron to the nucleic acid strand is a prerequisite for its cleavage [\u2022OH formed in solution may react before reaching an RNA strand. However, reaction of iron bound to the phosphate moieties of RNA with H2O2 may cause a strand cut at that location. By chelating dissolved iron, this site-specific mechanism may be inhibited.EDTA chelation may also prevent iron from binding with the RNA. Given that cleavage ,29. This2O2 is not detected in pyrite slurries in the absence of molecular oxygen, experiments with yeast RNA as well as human ribosomal RNA conducted in an anaerobic glove box show nucleic acid degradation. In earlier work we suggested that a reaction between water and defects on the pyrite surface can produce H2O2. Once H2O2 is produced via this pathway it is likely to be converted to OH. The levels of H2O2 formed via this defect-driven mechanism are much lower than in the presence of molecular oxygen. The low steady-state concentration of H2O2 and the limitations of the H2O2-detection technique used here may explain why H2O2 was not detected in the absence of O2. The result of experiments with yeast RNA in which the RNA solution was replaced periodically indicate that this anaerobic mechanism is not easily exhausted. If the process was limited to surface defects, one would expect that the degradation of RNA would cease after one or two cycles of fluid replacement. By contrast, the reactivity is maintained over as many as five cycles  declare that they have no competing interests.UV-Vis absorbance data used in Click here for fileESR data using in Figure Click here for file"}
+{"text": "Menarcheal age is a sensitive indicator of environmental conditions during childhood. The aim of study is to determine the age at menarche and growth status in adolescents in a rural area of Tarka, Wannune, Nigeria.-2) was used as an index of relative weight.Data on 722 female students (aged 12-18 years) were collected in February 2009. Height and weight were measured. Body mass index  (95% CI: 13.02-13.07), and age 13.00 (SD 2.8) (95% CI: 12.98-13.04), respectively. Girls who reach menarche are significantly heavier and taller with higher BMIs than those of their pre-menarcheal peers.The age of menarche is probably still declining in Nigeria. Although BMI is an important factor in the onset of menstruation, some other unmeasured environmental variables may be implicated in this population. Menarcheal age is the most widely used indicator of sexual maturation and is known to be influenced by genetic factors, environmental conditions, body stature, family size, body mass index (BMI), socioeconomic status and level of education -3. It isThe adolescent age group (10-19 years of age) constitutes about 23% of Nigeria's population  and thisSeveral studies have reported age at menarche to have declined in developed countries -16 and tThe relationship between growth and menarche remains debatable. Stark et al  content Age at menarche has been reported in several parts of the world -16, inclThis anthropometric survey involved 722 students with an average age of 16.19 years (range: 12-18 years old), attending five government-approved secondary schools in Tarka, Nigeria. Tarka LGA is one of the 23 local government councils in Benue State, Nigeria. With an estimated 134, 123 inhabitants [-2). Anthropometric measurements were conducted by the author (DTG), a level II ISAK anthropometrist.Stature and body mass were determined according to the standard anthropometric methods of the International Society for the Advancement of Kinanthropometry (ISAK) . StatureMenarcheal status was based on confidential questionnaire responses about date of birth, whether or not the girls had started menstruating, and age of onset in years and months. The different ages were regrouped in classes of 1 year each and were represented by the sign + .Age at menarche was calculated from date of menarche (month and year) and date of birth. Probit analysis was performed to determine the age at menarche for all girls by estimating the age at which 10, 25, 50, 75, and 90% of the girls reached menarche. Analysis was carried out with SPSS software version 17.0. The level of significance was set at p \u2264 0.05.-2, with 5.0% of Tarka girls classified as underweight, (BMI < 5th centile of WHO reference) [A total of 761 girls who were studied, 39 were excluded due to incomplete data. Consequently, 722 questionnaires were analysed. The girls' mean age was 16.19 \u00b1 1.51 years . Mean BMI was 22.1 \u00b1 2.5 kg mference) . FiguresTable Predictors of the onset of menstruation are shown in Table status quo technique in 722 school girls in Tarka municipality, Nigeria. Among the girls the mean and median ages at menarche were 13.02 and 13.00 years, respectively. The findings contradict the accepted view of delayed menarcheal age in rural communities. The scale (around 1 year) of urban-rural differences lies within the range of variation observed in developing countries [Menarcheal age was assessed by ountries . Our datountries -35, and ountries ,25,32-34Recent longitudinal studies have consistently indicated that adiposity in early childhood predicts early puberty ,40. In oThe prevalence of amenorrhea in our study was 2.6% (six of 320 respondents who were aged 16 years and older), which falls slightly below the reported prevalence of 3-4% ,45. AccoOur data seem to support the theory that BMI is a key factor in the onset of menarche ,52. HoweThe authors declare that they have no competing interests.DTG was the primary investigator for the study, designed the study, supervised data collection and wrote the paper. ALT advised on data collection, analysed the data and helped write the paper. JU participated in designing the study, analysing the data and writing the paper. SW and OMT advised on the design of the study, the analysis of the findings and writing of the paper. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2431/10/60/prepub"}
+{"text": "During the last 3 years, new routes of HIV infection have been reported in our country: addiction and homosexuality. Heroin use and the new ethnobotanic drugs  led to a dramatic increase in mortality in these intravenous drug users (IVDUs). A European multicentre study showed how IVDUs with recent HIV seroconversion are subject to an increased risk of mortality due to pneumonia, endocarditis, sepsis, meningitis, encephalitis, and decompensated liver cirrhosis. Before the availability of HAART, an increased rate of mortality due to heroin overdose and suicide was also recorded among HIV-infected IVDUs. Just the use of elevated heroin dosages associated to a suicidal behavior could be partially responsible for this phenomenon in patients with a newly diagnosed HIV disease and lacking social and psychological support, especially before the introduction of effective antiretroviral drug combinations (HAART).The objective of our study was to evaluate the temporal trend of deaths in a cohort of IVDUs, newly infected with HIV and admitted to our clinic and to assess its relationship with HIV infection and AIDS, and availability of potent antiretroviral therapy.The investigation of the death condition of HIV infected IVDUs was conducted through a retrospective cohort study in the Clinical Hospital of Infection and Tropical Diseases \u201cDr. Victor Babe\u015f\u201d, Casa Andreea, from 01 January 2011 to 31 August 2013. A clinical and etiological analysis of different disorders was done. We excluded the patients missing to follow up and those who died at home.Staphylococcus aureus (37.5%), pulmonary or disseminated tuberculosis (28.1%), pneumonia (18.75%) and few cases of other diseases. Only one IVDU received antiretroviral treatment, without adherence.Out of a total of 249 patients, 32 (13%) IVDUs died , 23 males and 9 females. The large majority of enrolled subjects were born in the Bucharest metropolitan area and surroundings. The mean age at death was 30 years old (limit 18-50). The median value of CD4 lymphocytes was 96/cmm. Most of the patients were unemployed and had no education (only primary school). The main death causes were as follows: AIDS (65.6%), ethnobotanic drug overdose (6.2%), sepsis with methicillin susceptible Stopping drug use, psychological counseling, early diagnosis of HIV status, counseling and social support, initiating tuberculosis and antiretroviral treatment, are some of the measures to be taken to decrease both the number of IVDUs and their death."}
+{"text": "Cytokine administration is a potential therapy for acute liver failure by reducing inflammatory responses and favour hepatocyte regeneration. The aim of this study was to evaluate the role of interleukin-1 receptor antagonist (IL-1ra) during liver regeneration and to study the effect of a recombinant human IL-1ra on liver regeneration.We performed 70%-hepatectomy in wild type (WT) mice, IL-1ra knock-out (KO) mice and in WT mice treated by anakinra. We analyzed liver regeneration at regular intervals by measuring the blood levels of cytokines, the hepatocyte proliferation by bromodeoxyuridin (BrdU) incorporation, proliferating cell nuclear antigen (PCNA) and Cyclin D1 expression. The effect of anakinra on hepatocyte proliferation was also tested in vitro using human hepatocytes.In vitro, primary human hepatocytes treated with anakinra showed significantly higher proliferation at 24h compared to hepatocytes without treatment.At 24h and at 48h after hepatectomy, IL-1ra KO mice had significantly higher levels of pro-inflammatory cytokines  and a reduced and delayed hepatocyte proliferation measured by BrdU incorporation, PCNA and Cyclin D1 protein levels, when compared to WT mice. IGFBP-1 and C/EBP\u03b2 expression was significantly decreased in IL-1ra KO compared to WT mice. WT mice treated with anakinra showed significantly decreased levels of IL-6 and significantly higher hepatocyte proliferation at 24h compared to untreated WT mice. IL1ra modulates the early phase of liver regeneration by decreasing the inflammatory stress and accelerating the entry of hepatocytes in proliferation. IL1ra might be a therapeutic target to improve hepatocyte proliferation. Acute liver failure (ALF) occurs when the extent of hepatocyte death exceeds the liver's regenerative capacity. Furthermore, the regeneration of native liver may be impaired by accumulation of various toxic substances such as ammonia or nitric acid The administration of specific drugs or factors that are able to initiate and accelerate hepatocyte proliferation has been suggested as strategy for the treatment of acute liver failure Among the many cytokine candidates to improve liver regeneration, the cytokine IL-1 receptor antagonist (IL-1ra) has not yet been studied and direct evidence for a role of IL-1ra in liver regeneration has not been clearly reported IL-1ra is a member of the IL-1 family and is produced by hepatocytes as an acute-phase protein in vitro and in vivo and that its inhibition induces an improvement of mitogenic rate of hepatocyte during liver regeneration Recent studies have demonstrated that the activation of IL-1\u03b2 signalling results in decrease of hepatocyte proliferation The plasma IL-1ra/IL-1 ratio in a healthy population is close to 1 and exhibits minimal variation Currently, a non glycosylated recombinant human IL-1ra (anakinra), is available for clinical use. As the endogenous IL-1ra, this drug blocks the effect of IL-1\u03b2 and it is used to treat pain and swelling of patients with rheumatoid arthritis in vivo using knock-out mice in which the gene coding for IL-1ra has been deleted and second to analyse the effect of anakinra (the non glycosylated recombinant human IL-1ra) administration on liver regeneration in wild type mice after 70%-hepatectomy and on isolated human hepatocytes in vitro.The aims of this study were first to evaluate the role of IL-1ra in liver regeneration 10 to 12 week-old male wild-type (WT) DBA1 mice , and IL-1ra knock-out (KO) DBA1 mice weighing 20 to 25g were used. IL-1ra KO breeding was performed from animals previously described Regeneration of the native liver was induced by performing a 70%-hepatectomy. Briefly, under general anaesthesia, a median laparotomy was performed. The left lateral and the median lobe were removed as previously described by Mitchell et al. 70%-hepatectomy was performed in four different groups of DBA1 mice:WT DBA1 mice, n\u200a=\u200a6IL-1ra KO DBA1 mice n\u200a=\u200a5WT DBA1 mice treated with intraperitoneal (i.p.) injection of anakinra (5mg/kg/day)  n\u200a=\u200a5WT DBA1 mice treated with i.p. injection of anakinra (50mg/kg/day) n\u200a=\u200a5Two groups contained sham operated DBA1 mice:WT DBA1 mice treated with i.p. injection of anakinra (5mg/kg/day) n\u200a=\u200a5WT DBA1 mice treated with i.p. injection of anakinra (50mg/kg/day) n\u200a=\u200a5Blood levels of IL-1ra, IL-1\u03b2, TNF-\u03b1 and TGF-\u03b21  and HGF  were analyzed by enzyme-linked immunosorbent assay (ELISA), following the manufacturer's instructions. IL-6, MCP-1 were measured using a cytometric bead array (CBA) mouse inflammation kit  and analyzed with a BD FACSArray Bioanalyzer (BD Biosciences), following the manufacturer's instructions. The CBA data were analyzed with BD\u2122 CBA Software (BD Biosciences). The cytokines were measured from peripheral blood at 4 h, 24 h, 48 h, 72 h, 5 days and 7 days after hepatectomy.ALT was analyzed on peripheral blood of mice treated with anakinra (n\u200a=\u200a3) and with no treatement (n \u200a=\u200a3) by the clinical chemistry unit of University Hospital Geneva using DxC 800 system (Beckman Coulter Inc), following the manufacturer's instructions.Hepatocyte proliferation was evaluated by Bromodeoxyuridine (BrdU) incorporation at 24 h, 48 h, 72 h, 5 days and 7 days after hepatectomy. BrdU (200mg/kg) was given i.p. 2 h before tissue sampling g at 4\u00b0C, the supernatant was collected, protein concentration of the protein extracts was determined using the Bio-Rad protein assay kit  and finally samples were stored at -20\u00b0C until western blot analyses. 30 \u00b5g of total liver proteins were separated by electropohoresis in a 12% sodium dodecyl sulphate  polyacrylamide gel. Proteins were transferred onto polyvinylamide fluoride membranes . Membranes were blocked for 1 h at room temperature in a blocking buffer (Tris-HCl (pH 7.6) buffer containing 150 mmol/l NaCl, 0.1% Tween-20 and 5% non-fat dry milk). The membranes were then incubated overnight at 4\u00b0C with one of the following antibodies diluted in the blocking buffer: for PCNA, mouse monoclonal antibody clone: PC10  diluted 1\u2236500; for Cyclin D1, mouse monoclonal antibody diluted 1\u2236500 . After rinsing in TBS-Tween, the immunoblots were incubated for 1 h at room temperature with a goat anti-rabbit or anti-mouse secondary antibody , whichever appropriate, conjugated to horseradish peroxidase and diluted 1\u22366000 in the blocking buffer.Liver biopsies were removed at 4 h, 24 h, 48 h, 72 h, 5 days and 7 days after partial hepatectomy and frozen at \u221280\u00b0C until protein extracts were prepared by homogenization in a lysis buffer  containing complete protease inhibitors cocktail  and phosphatase inhibitor sodium orthovanadate (1 \u00b5M). After a 20 min centrifugation at 14 000Finally, membranes were developed by enhanced chemiluminescence detection kit  according to manufacturer's instructions. For all blots, amount of loaded proteins was controlled by probing the same membranes with a rabbit polyclonal antibody directed against \u03b2-actin diluted 1/250. Densitometric quantification of each band was determined using Quantity One software  and normalized by comparison with expression of \u03b2-actin in the re-probed blot.Total RNA was extracted from liver samples harvested from WT DBA1 and IL-1ra KO DBA1 mice at 4 h, 24 h, 48 h, and 72 h after partial hepatectomy by Qiagen RNeasy Midi kit  according to manufacturer's instructions. cDNA was synthesized from 0.5 \u00b5g of total RNA using PrimeScript RT reagent Kit  following suppliers instructions.https://www.genevestigator.com).For quantitative PCR, amplification of genes was performed from 2ng cDNA and 300 nM of forward and reverse oligonucleotides using the Power SYBR Green PCR Master Mix  and a SDS 7900 HT machine (Applied Biosystems Inc). Oligonucleotides were obtained from Invitrogen. The efficiency of each design was tested with serial dilutions of cDNA. Oligonucleotides amplicons sequences are described in Human hepatocytes were obtained from surgical liver biopsies of patients undergoing segmental hepatectomies. The protocol for the human studies was approved by the institutional ethics committee of the Department of Surgery and informed consent was obtained from the patients. At the start of the intervention, a wedge of macroscopically normal tissue (15 to 30 g) located within the part of the liver to be resected was excised, immersed in ice-cold phosphate buffered saline.\u22126 mol/l dexamethasone , 1\u00d710\u22128 mol/l 3, 3\u2032-triiodo-L-thyronine, 1\u00d710\u22128 mol/l human insulin , 5 \u00b5g/ml apotransferrin (Sigma-Aldrich GmbH), 15\u00d710\u22123 mol/l Hepes.Human hepatocytes isolations were performed using a two-step collagenase perfusion method as previously described 5 primary human hepatocytes were seeded in 35mm Tissue Culture dish  and incubated at 37\u00b0C for 3 days.2\u00d710in vitro, we treated primary hepatocytes with anakinra (Kineret\u00ae) at various doses (10 \u00b5g/ml and 100 \u00b5g/ml) added to culture medium at 0h for 72h after hepatocyte isolation. After isolation, primary human hepatocytes were cultured for 24h before the beginning of treatment with anakinra.To analyze the effect of anakinra on primary human hepatocytes proliferation After 24h, 48h and 72h, protein extracts were prepared by scrapping primary hepatocytes with lysis buffer (described above) containing complete protease inhibitors cocktail  and phosphatase inhibitor and stored at \u221220\u00b0C until assessment of PCNA protein level expression by western blot analysis.To study the cell viability, we performed a crystal violet assay. Human hepatocytes were first seeded at 100,000 cells/well in 500 \u00b5l culture medium in 24-well plates and allowed to attach for 24h before anakinra treatment. Cell viability was then determined by crystal violet staining . For this assay, human hepatocytes were seeded at a density of 100.000 cells/well in 24-well plates in medium containing 2% FBS, with or without adjunction of anakinra at 10 (n\u200a=\u200a3) and 100 microgr/ml (n\u200a=\u200a3) for 24h and viability was tested at 24, 48 and 72h.After incubation, the cells were fixed with 10% formalin during 10 min. at room temperature and stained for 30 min. at 37\u00b0C with 0.1% crystal violet (Sigma). Then, wells were washed with PBS three times and the dye was eluted under shaking with 500 \u00b5l of 10% acetic acid for 15 min. at room temperature. Supernatants were transferred into a 96-well plates and absorbance of each well was measured at 570 nm using a microplate reader.in vitro studies, statistical differences among three or more groups were examined by Mann-Whitney U test. For in vivo studies, differences between two groups were examined for statistical significance using the Kruskal-Wallis Anova test. Quantitative variation was considered significant at p-value inferior to 0.05. Statistical analysis was performed using STATISTICA .Data analysis results are presented as means \u00b1 SEM. For We analysed hepatocyte proliferation in native liver tissue of WT and IL-1ra KO mice after hepatectomy by immunohistochemistry on liver sections analyzing BrdU incorporation and by western blotting detecting PCNA expression at 24 h, 48 h, 72 h, 5 days and 7 days.As shown in Western blot analysing PCNA expression  increaseIL-1ra, IL-1\u03b2, TNF-\u03b1, TGF-\u03b21, HGF, IL-6 and MCP-1 levels were measured in serum of WT and IL-1ra KO mice at 4 h, 24 h, 48 h, 72 h, 5 days and 7 days after partial hepatectomy. In WT mice, IL-1ra level increased significantly between 4 and 48 h after hepatectomy  . After 41 phase) in hepatocytes To determine whether the delay and decrease of hepatocyte proliferation observed in IL-1ra KO mice could be a consequence of alterations in the G1/S checkpoint of the cell cycle, cyclin D1 expression was analyzed by western blotting at 24 h, 48 h, 72 h and 7 days after 70% hepatectomy in WT and IL-1ra KO mice. Cyclin D1 was recently identified as the most reliable marker for cell cycle  was analyzed by real-time polymerase chain reaction at 0 h, 4 h, 24 h, 48 h, and 72 h after partial hepatectomy .Expression levels of Bcl-xl, C-myc and PPAR\u03b1 were not modified in WT and IL-1ra KO mice  A, C, E.In order to investigate whether the treatment of anakinra has a positive effect on hepatocyte proliferation after injury, we performed a 70% hepatectomy in WT mice treated with anakinra at two doses (5mg/kg/day and 50mg/kg/day).Hepatocytes proliferation from untreated and anakinra treated (5mg/kg/d and 50mg/kg/d for 4 days) WT mice was evaluated by BrdU incorporation  and by PCNA expression  at 24 h, 48 h, 72 h, 5 days and 7 days after 70% hepatectomy. BrdU incorporation was significantly higher in WT mice treated with anakinra at 50mg/kg compared to untreated mice at 24 h  . BrdU inSimilary, PCNA expression level was significantly higher in WT mice treated with anakinra at 50mg/kg/d compared to untreated WT mice at 24 h after 70% hepatectomy  . At the IL-6, MCP-1 and IL-1\u03b2 levels were measured from peripheral blood of WT mice either untreated or treated with two doses of anakinra (5mg/kg/d and 50mg/kg/d for 4 days) at 4 h, 24 h, 48 h, and 72 h, after partial hepatectomy. At 4 h post-hepatectomy, IL-6 levels were significantly reduced in WT mice treated with low and high doses of anakinra compared to untreated WT mice  . AlthougALT was analyzed on peripheral blood of WT mice treated with anakinra (n\u200a=\u200a3) and compared to WT mice without treatment (n\u200a=\u200a3). Our results showed that alanine aminotransferase increase at 4h after partial hepatectomy and returned to normal levels after 72h. The levels of alanine aminotransferase of WT mice without treatment was significantly higher at 24h after partial hepatectomy compared to mice treated with anakinra (5 or 50mg/kg). For treated mice, there was no difference for the protective effect of anakinra between 5 and 50mg/kg .In vitro, proliferation of primary human hepatocytes was evaluated by analyzing PCNA expression by western blotting at 24 h, 48 h and 72 h after treatment with anakinra (10 \u00b5g/ml and 100 \u00b5g/ml). PCNA expression was significantly higher in primary human hepatocytes treated with anakinra at 10 \u00b5g/ml and at 100 \u00b5g/ml in the first 24 h after treatment compared to primary human hepatocytes without treatment  (ctively) . After 4ctively) . In FiguIL-1ra gene disruption and IL-1ra treatment on liver regeneration of mice after partial hepatectomy. IL-1ra deficiency lead to a delay and a decrease in liver regeneration analyzed by BrdU incorporation and PCNA expression compared to WT mice. Peak of hepatocyte proliferation was observed at 72 h post-hepatectomy in IL-1ra KO mice compared to 48 h post-hepatectomy in WT mice and then decreased until reaching basal level at 7 days after hepatectomy.In the present study, we characterized the effects of Studying cytokine secretions after partial hepatectomy, we observed that IL-1ra KO mice demonstrated higher serum levels of IL-1\u03b2, IL-6 at 4 h and MCP-1 levels at 4 h and 24 h (in the proliferation phase) compared to WT mice. Indeed, as shown by several authors using various cell types including hepatic cells, IL-1ra blocks the production of IL-1\u03b2, IL-6 and MCP-1 These increased levels of pro-inflammatory cytokines may explain the delayed and reduced liver regeneration observed in IL-1ra KO mice. Indeed, IL-1\u03b2 has been previously shown to antagonize hepatocyte proliferation The next phase of liver regeneration includes activation of tyrosine kinase receptor, c-met and epidermal growth factor (EGF) ligands, which, in turn, activate expression of transcription factors involved in liver regeneration. The main transcription factors activated after partial hepatectomy are c-jun, C/EBP\u03b2 and cAMP-responsive element modulator (CREM) Another important liver-specific immediate-early gene activated during liver regeneration and implicated in the maintenance of hepatocyte differentiation is the insulin-like growth factor binding protein 1 (IGFBP-1) During liver regeneration, transition through S-phase requires the synthesis of a group of proteins such as DNA polymerase \u03b1, c-myc and cdc2 in vitro that HGF induces its anti-inflammatory effects by upregulating the production of IL-1ra Further progress through the cell cycle is dependent on activation by growth factors including HGF. During the priming phase (from 0 h to 20 h after hepatectomy) and proliferation phase (from 20 h to 5 days), we observed a significant increase in IL-1ra level and HGF in WT mice. These increased levels were observed until 48 h post-hepatectomy (proliferation phase) and then progressively decreased. These results are in accordance with Molnar et al. demonstrating Finally, reduced expression of transcription factors, immediate early genes and growth factors described here were associated with a delayed cell cycle transition of hepatocytes. The evaluation of cell cycle protein expression performed by analyzing cyclin D1 expression demonstrated that the start and the peak of expression was delayed in IL-1ra KO mice compared to WT mice. Because cyclin D1 regulates the G1/S cell cycle transition, the delay of cyclin D1 induction is likely also responsible for the delay and decrease in hepatocyte proliferation in IL-1ra KO mice.The presented data indicate a potential mechanism for IL-1ra involvement in hepatocyte proliferation by promoting cell cycle transition from G1 to S phase. This could be mediated by IL-1ra released from hepatocytes to act upon the cell membrane IL-1 receptor Anakinra, a non glycosylated recombinant human IL-1ra, was already used in various animal models of human diseases and also in several human clinical trials of rheumatoid arthritis with relative success We evaluated the liver regeneration in WT mice treated with anakinra at 5mg/kg and at 50mg/kg after partial hepatectomy. Our results showed that hepatocyte proliferation was significantly higher only in animals treated with anakinra at 50mg/kg 24 h after partial hepatectomy. This finding can be explained by the fact that an efficient inhibition of IL-1 induced biological responses required injection of 100- to 1000-fold molar excess of IL-1ra. This might be due to the differential affinity of IL-1 and IL-1ra for IL-1 receptor In our study, we showed that the treatment of WT mice with anakinra at 5mg/kg and at 50mg/kg after partial hepatectomy decreased levels of IL-6 but did not modify levels of IL-1\u03b2 and of MCP-1 . These rIn this study, we analyzed the levels of ALT on peripheral blood of WT mice treated with anakinra compared to mice without treatment. Our results showed that alanine aminotransferase increase at 4h after partial hepatectomy and returned to normal levels after 72h. The levels of alanine aminotransferase of WT mice without treatment was significantly higher at 24h after partial hepatectomy compared to mice treated with anakinra (5 or 50mg/kg). For treated mice, there was no difference for the protective effect of anakinra between 5 and 50mg/kg . These rIn vitro, we confirmed the proliferative effect of anakinra on isolated human hepatocytes. Primary human hepatocytes treated with anakinra showed a higher hepatocyte proliferation within the first 24 h compared to untreated cells , differences in the timing or level of secretion of cytokines (IL-6), of expression of cell cycle protein (cyclin D1) and of expression of genes  that are involved in priming the hepatocyte for entry into the cell cycle or that regulate the G"}
+{"text": "Purpose of this prospective, multi-institutional Phase I clinical study was to investigate whether MRI-guided transurethral ultrasound ablation (MR-TULSA), a novel minimally-invasive technology to treat organ-confined prostate cancer (PCa), is safe, feasible and effective. It employs directional plane-wave high-intensity ultrasound, which ablates prostate tissue using real-time thermometry with active temperature feedback control.Enrolled were 30 patients with biopsy-proven, low-risk prostate cancer ). Whole-gland prostate ablation was performed with MR-TULSA using the PAD-105  and a 3T MRI  in one single treatment session under general anaesthesia and 3D active MR-thermometry feedback control. Contrast-enhanced MRI (CE-MRI) immediately following the ablation and at 12 months confirmed thermal coagulation.There were no intraoperative complications with normal micturition resuming after catheter removal. Median (range) treatment time and prostate volume were 36 (24\u201361) min and 44 (21\u2013 95) ml, respectively. Maximum temperature during treatment depicted a continuous region of heating shaped accurately to the prostate within 0.1 \u00b1 1.3 mm, with average over- and under- targeted volumes of 0.8 and 1.0 ml, respectively. Regions of acute cell kill on CE-MRI correlated well with treated volume on MR-thermometry. Successful treatment was further confirmed by a median PSA decrease from 5.35 to 0.70 ng/ml at 1 month (n=29), remaining stable to 0.65 ng/ml at 6 months (n=16).Phase I results show that MR-TULSA represents a minimally-invasive treatment option for safe, effective and accurate whole-gland thermal ablation of organ-confined prostate cancer."}
+{"text": "Cell wall component-directed molecular detection probes  are an essential asset to the plant glycobiology toolbox. To date, a relatively large set of CWPs has been produced\u2014mainly consisting of monoclonal antibodies, carbohydrate-binding modules, synthetic antibodies produced by phage display, and small molecular probes. In this review, we summarize the state-of-the-art knowledge about these CWPs; their classification and their advantages and disadvantages in different applications. In particular, we elaborate on the recent advances in non-conventional approaches to the generation of novel CWPs, and identify the remaining gaps in terms of target recognition. This report also highlights the addition of new \u201ccompartments\u201d to the probing toolbox, which is filled with novel chemical biology tools, such as metabolic labeling reagents and oligosaccharide conjugates. In the end, we also forecast future developments in this dynamic field.Plant cell walls are highly complex structures composed of diverse classes of polysaccharides, proteoglycans, and polyphenolics, which have numerous roles throughout the life of a plant. Significant research efforts aim to understand the biology of this cellular organelle and to facilitate cell-wall-based industrial applications. To accomplish this, researchers need to be provided with a variety of sensitive and specific detection methods for separate cell wall components, and their various molecular characteristics  In this review, a CWP will be defined as any molecule with the ability to specifically bind (or be incorporated into) a cell wall component, therefore allowing subsequent selective detection, quantification or visualization. Here it is important to note that \u201cchemical probe,\u201d in the field of chemical biology, is a wider term that can also be used to describe molecules that are able to influence the function of the target, e.g., by altering its activity via specific binding  or nuclear magnetic resonance (NMR), can accurately decipher the detailed structure of cell wall components, they are not high-throughput (HTP) and usually require homogenization of samples, harsh pre-treatments or extractions, and a high-level of expertise from the operating personnel. By contrast, CWPs can be used to detect various cell wall components  in a HTP manner, whilst simultaneously providing insights into their molecular structure and interactions with other glycans. In addition, this understanding of the cell wall material can often be acquired by detecting polymers in their native context without having to deconstruct the cell wall. As such, CWPs are vital for the study of different aspects of cell wall microstructure ro Knox, , and canAntibodies are the largest, and possibly the most important, component of the CWP tool box. They are highly specific, versatile, and can be applied to a diverse range of techniques , a feature that is especially important in plant glycobiology. Many polysaccharides are not homogeneous polymers and instead exhibit various molecular alterations to their backbone. A classic example of this is homogalacturonan (HG), which can have different levels and patterns of methyl-esterification , nanogold conjugates of secondary antibodies or protein A/G are required  Figure . By contSeveral new additions to the repertoire of mAbs that recognize land plant polysaccharide structures have been reported over the last 5 years, such as the INRA-AGI-1 mAb, which recognizes the RGI-related arabinogalactan linear chain  is used in a form of \u201cshotgun\u201d immunization. An antigen overload, or presentation of the antigen in the context of the whole cell wall glycome, might hijack the host's immune response  or ELISA-based methods  for in planta studies, not only because of their size. For instance, mAbs are produced at mammalian pH, which is much higher than the normal acidic pH of the apoplast , they usually do not provide sufficiently high-resolution images and their specificity is often questioned. Despite this caveat, some are strongly favored and are not yet replaceable. Such an example of this would be the Yariv reagent for diagnostic detection and purification of arabinogalactan proteins (AGPs), or phloroglucinol (Wiesner stain), an easy and inexpensive reagent to detect lignin. For an overview of cell wall cytological staining methods see Krishnamurthy .in vivo imaging, even when using spinning disc or super-resolution confocal microscopy , and prefers them over any cell wall material in fixed samples . In glycan structures a large fluorophore molecule on the monomer would likely hinder the activity of the necessary glycosyltransferase as it would not be recognized as an appropriate natural donor. However, lignin polymerization is based on radical coupling and fluorescently labeled monolignols have been shown to be efficiently incorporated into lignin in stem cells undergoing formation of secondary cell walls (Tobimatsu et al., in planta via stable transgenic constructs as fusion proteins with a small immunotag or fluorescent protein. Although this approach might be problematic for visualization of epitopes in the context of the whole organism, or tissues, due to the constant and ubiquitous expression, it might be useful for studying the dynamics of cell wall microdomains. It is well-known that the binding of an antibody can influence the antigen's expected biological activity so the genetic approach can also provide entirely new tools for functional analyses of cell wall components. Proteinaceous probes can be further engineered by random or via site-directed mutagenesis to widen the diversity of specificities or to modulate their affinity.Recent progress in plant glycobiology, chemical biology, and HTP analytical methods has expanded the probing tool box plant researchers can use in their studies. However, the development of new CWPs is still progressing, and will undoubtedly mimic the great boost in biomedical probing technologies that we have seen in the past 20 years. We expect that the antibody field will benefit from the recently explored approach of a more biology- than researcher-driven selection process, shifting the current paradigm of anti-glycan antibody production requiring predefined targets. The more widespread use of synthetic antibodies, using recombinant methods and expression, might pave the way for complex targets to be addressed, such as those for which the deconstruction of their native 3D context is an issue in conventional procedures. This is especially relevant for non-covalent interlinks within cell walls. The large collection of mAbs available, as well as CBMs, offer a hitherto unexplored resource for generating genetic probes. In this approach, the DNA coding sequences of the known proteinaceous binders are expressed in muro. Aptamers are DNA/RNA oligonucleotides (Zhang et al., Other tools that have already found important uses in biomedical research, like aptamer and affimer technologies, can also be applied to cell wall components, thus opening new frontiers for replenishing the shortage of probes against supramolecular conformations, intermolecular linkages, and fine 3D arrays of polysaccharides MR: drafted the part dealing with mAbs and CBMs; AH: drafted the part about phage display; SK and JM: drafted the parts dealing with small molecular probes while JM assembled the figures, and performed the compilation and editing.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Pancreatic ductal adenocarcinoma (PDAC) is an aggressive malignancy with poor prognosis. Diabetes is a significant risk factor for PDAC and >50% of PDAC patients have concomitant diabetes. How diabetes influences the initiation and progression of PDAC remains elusive. Here, we show that transgelin-2 is dominantly expressed in PDAC tissues compared with adjacent normal tissues. The high level of transgelin-2 indicates poor survival of patients with PDAC. Remarkably, transgelin-2 expression is correlated with diabetic status. Hyperinsulinemia is frequently observed in type 2 diabetes. Our results indicate that upregulation of transgelin-2 is induced by insulin via sterol regulatory element-binding protein (SREBP)-1-mediated transcription in PDAC cells. Transgelin-2 is a novel target of SREBP-1. Our data support a novel mechanism in diabetes-associated PDAC by which transgelin-2 mediates proliferation of PDAC cells upon insulin stimulation. The insulin/SREBP-1/transgelin-2 network should be further explored as a diagnostic marker or a novel therapeutic target for diabetes-associated PDAC. Approximately 95% of pancreatic cancers are pancreatic ductal adenocarcinoma (PDAC). The average 5-year survival rate is only 8% . ReasonsTAGLN2 gene, is an actin stress fiber-associated protein that has roles in cell transformation and cell morphology. Several proteomic studies have suggested that transgelin-2 is a potential biomarker of tumorigenesis. Transgelin-2 is overexpressed in colorectal cancer, renal cell carcinoma and uterine cervical squamous cell carcinoma [Transgelin-2, encoded by arcinoma \u20135. In coarcinoma , 7. Throarcinoma . These sSREBF1 and SREBF2, which are mainly involved in lipid and cholesterol metabolism, respectively. SREBP-1 knockdown decreases the cell and organ size of flies, indicating that it is essential for cell growth [Sterol regulatory element-binding proteins (SREBPs) are master regulators of genes for central rate-limiting enzymes of lipid and cholesterol metabolism. SREBP transcription factors regulate several enzymes including fatty acid synthase (FASN), acetyl-CoA carboxylase (ACC), stearoyl-CoA desaturase (SCD)-1, ATP citrate lyase (ACLY) and acyl-CoA synthetase (ACS)-2 , 10. Maml growth . Pharmacl growth .In vitro analysis indicated that insulin was a driving factor for expression of transgelin-2 via SREBP-1 transcription factor. These data imply that transgelin-2 is involved in progression of PDAC patients with concomitant diabetes. Diabetes is a key risk factor of PDAC, therefore, understanding the underlying mechanisms involved in diabetes-associated PDAC is important in providing novel biomarkers or therapeutic targets for this type of malignancy.The goal of this study was to characterize the expression pattern of transgelin-2 in PDAC and subsequently unravel the underlying mechanisms involved in dysregulation of transgelin-2. Our data indicated that transgelin-2 was highly expressed in PDAC tissues compared with adjacent normal tissues. Transgelin-2 was predominantly overexpressed in a subgroup of PDAC patients with diabetes. \u22128, Figure \u221210), Logsdon's dataset (p=1.71\u00d710\u22125) and Badea's dataset (p=1.36\u00d710\u22129) consistently showed that transgelin-2 expression was significantly higher in pancreatic tissues than normal tissues -1 have affinity for insulin and IGF-1 receptors because of similar structural homology [Type 2 diabetes is characterized by high levels of insulin, which are presumed to be a driving factor of diabetes-associated cancer , 17. Thuhomology . Thus, wTo elucidate the oncogenic role of transgelin-2 in PDAC, cell proliferation was analyzed when transgelin-2 was silenced in PDAC cells. Of the three specific siRNAs against transgelin-2, transgelin2-siRNA-2 displayed the most significant knockdown effect Figure . The proTAGLN2 transcription start site at an 85% profile score threshold. A putative SRE site for SREBP-1 transcription factor was found at \u22122562/\u22122552 bp on the human TAGLN2 promoter  comprises >90% of all cases of diabetes. T2DM consists of an array of dysfunctions characterized by hyperglycemia, which results from insulin resistance, inadequate insulin secretion, and excessive glucagon secretion. Epidemiological studies clearly indicate that diabetes (predominantly T2DM) is a risk factor for liver, pancreatic and endometrial cancer. Nearly half of PDAC patients have diabetes at the time of diagnosis. Here, we found that transgelin-2 is dominantly expressed in PDAC patients with diabetes, which suggests that transgelin-2 is involved in progression of diabetes-associated PDAC. A homolog of transgelin-2, transgelin, is also highly expressed in PDAC patients with diabetes . We presIt remains unclear whether the association between PDAC and T2DM is direct or indirect . The dirFASN, SCD1 and ACLY are mainly involved in lipid biosynthesis. We have previously identified that regulation of SREBP-1 activity by cyclin-dependent kinase 8 and its partner cyclin C is involved in insulin-induced triglyceride synthesis [Multiple signaling pathways are activated after insulin and IGF-1 interacts with their receptors. Several studies have demonstrated that the PI3K/AKT and RAS/MEK/ERK pathways are extensively stimulated by insulin in PDAC cells. Once activated, these signaling pathways stimulate multiple cancer phenotypes, including proliferation, invasion and metastasis. Besides the direct effects of insulin on PDAC cells, insulin can increase the level of IGF-1 via decreasing the hepatic production of IGF binding proteins . It is wynthesis . Here, wSeveral studies have demonstrated that the level of transgelin-2 is associated with prognosis in various cancers. Transgelin-2 has been linked to lymph node metastasis, advanced clinical stage, and survival of cancer patients. In the present study, lymph node metastasis, histological grade, and tumor stage and size were closely related to the level of transgelin-2 in PDAC. Upregulation of transgelin-2 predicts poor survival of patients with PDAC, and demonstrates that transgelin-2 is involved in cancer progression. Transgelin-2 may be a useful biomarker for diagnosis or evaluation in PDAC. Leptin-deficient ob/ob and leptin-receptor-deficient db/db mice are widely used for T2DM research. Hyperinsulinemia is a common characteristic of these two models. Of note, transgelin-2 transcription is also activated in mouse diabetic models. The expression pattern of transgelin-2 is unable to distinguish between diabetes and PDAC.Perhaps because of its abundance, transgelin-2 has been frequently identified in proteomic profiling studies of cancer . The undThis work was done with the approval of the Ethics Committee of Zhongshan Hospital, and informed consent was obtained from all patients. Formalin-fixed paraffin-embedded tissue blocks containing 70 PDAC and 70 adjacent tumor-free tissues were subjected to immunostaining. All of the patients underwent pancreatectomy between September 2004 and March 2009. There were 38 male and 22 female patients. The median follow-up was 16 months , and 45 of 70 patients died during follow-up. Patients who did not reach the outcome under study were censored at the date of their last visit. For the analyses of overall survival, each patient's time began on the date of diagnosis and ended on the date of death or on the date last seen alive.<sub>2</sub>. All transfections were performed with Lipofectamine 2000  or Lipofectamine RNAiMAX (Thermo Scientific) transfection reagents. Cells were cultured until 40%\u201350% confluence at the time of transfection. At 24\u201348 h after transfection, cells were harvested for quantitative PCR or western blot analysis. For gene knockdown experiments, control cells were incubated with OPTI-MEM and transfection reagent (vehicle group), or with OPTI-MEM and transfection reagent plus no-silencing siRNA (siRNA-NC group). Sequences of siRNA were: transgelin-2#1, 5\u2032-GGUUACAGAUGGGCACCAAUU-3\u2032, transgelin-2 #2, 5\u2032- CCUAAGAAAUCCAAGGAGAUU -3\u2032, trans gelin-2#3, 5\u2032- UCAAGCAGAUGGAGCAGAUUU -3\u2032, SREBP-1, 5\u2032- GGGAGAGCCUGUACAGCUUUU-3\u2032.PANC-1, AsPC-1, BxPC-3, SW-1990 and HEK293T cell lines were purchased from ATCC . Cells were maintained in DMEM or RPMI 1640 supplemented with 10% fetal calf serum and antibiotics  in a humidified atmosphere under 5% COTAGLN2 gene were amplified by PCR and cloned into pGL3 vector. HEK293T cells were co-transfected with 100 ng transgelin2-Luc reporter and 10 ng RGB renilla luciferase . After 24 h transfection, cells were harvested and washed with phosphate-buffered saline (PBS), and lysed on ice in passive lysis buffer. Reporter gene assays were performed with the Dual-Luciferase Reporter Assay System . All experiments were performed in triplicate from independent cell cultures.To construct the reporter plasmid of transgelin2-Luc, fragments of the promoter region of 2O2 for 3 min. Immunostaining scores were independently evaluated by three pathologists. Semi-quantitative scores were used to analyze antibody immunostaining. Intensity of staining was categorized into \u2212, +, ++ or +++, denoting negative (0), weak (1), moderate (2) or strong staining (3). Extent of immunostaining was categorized into 0 (<10%), 1 (10%\u201325%), 2 (26%\u201350%) or 3 (>50%) on the basis of the percentage of positive cells. Three random microscopic fields per tissue were calculated. The final score of expression level was determined by the formula: final score = intensity score \u00d7 percentage score. The final score was ranged from 0 to 9. The final score of \u22643 was defined as low expression, and >3 as high expression.Immunohistochemical staining of paraffin sections for transgelin-2 or SREBP-1 protein was performed with an LSAB kit , using transgelin-2 antibody  or SREBP-1 antibody . The sections were incubated in 3,3\u2032 diaminobenzide tetrahydrochloride with 0.05 % HTo isolate total RNA, an RNeasy RNA isolation kit  was used. The concentration of each RNA sample was measured using the Nanodrop Spectrophotometer (Thermo Scientific). The ratio of absorbance at 260 nm and 280 nm was used to assess RNA purity. The ratio for pure RNA was \u223c2.0. Prior to cDNA synthesis, DNase treatment was performed using the RQ1 RNase-free DNase (Promega). RNA was subjected to cDNA synthesis . Real-time quantitative PCR was performed using the SYBR-Green Master PCR Mix kit (Thermo Scientific). Expression of mRNA was assessed by evaluating threshold cycle (CT) values. The comparative Ct (\u0394\u0394Ct) method was used to determine the relative mRNA level as described previously .. The prProtein lysates were harvested from cells at 48 hours after transfection, washed with phosphate-buffered saline (PBS), and lysed on ice in lysis buffer  supplemented with complete protease inhibitor cocktail . The lysates were centrifuged at 15,000 rpm for 30 min at 4\u00b0C. The supernatant was collected. Protein concentration was quantitated by BCA method. About 30\u201350 \u03bcg of protein were separated by SDS\u2212PAGE and then transferred to PVDF membranes. The membranes were probed with primary antibody for 3 h. After incubation with HRP-conjugated antibody, antibody detection was achieved by chemiluminescence. The primary antibodies used in this study were: as follow anti-transgelin-2 , anti-transgelin , anti-AKT (Santa Cruz Biotechnology), anti-phospho-AKT (Santa Cruz Biotechnology) and anti-GAPDH .4 cells/well were seeded into six-well plates after 24 h transfection. Cell numbers were counted every 24 h. At least three independent experiments were performed. Growth curve assays were performed by counting live cells using trypan blue exclusion. For colony-formation assay, single-cell suspensions (500 cells per dish) were plated and fresh medium was replaced every 48 h. After 10\u201314 days, cells were fixed in methanol for 10 min, and stained with Crystal Violet . Colonies were counted using an inverted microscope.Cell proliferation was performed as described previously . Briefly7\u22121.2\u00d7107 cells/dish). Cells were crosslinked with 1% formaldehyde for 10 min and quenched with glycine for 5 min. Cells were harvested by scraping in ice-cold PBS and resuspended in SDS lysis buffer containing inhibitors (Roche Applied Science) and sonicated on ice to release 200\u2013800-bp DNA fragments. The sheared DNA was incubated overnight with 10 \u03bcg SREBP-1 antibody with rotation at 4\u00b0C and precipitated with protein A/G agarose for 3 h at 4\u00b0C. Quantitative PCR was used to evaluate the enrichment of SREBP-1 on the promoter region of TAGLN2 gene.ChIP was performed using the EZ-ChIP Assay kit  with an antibody to SREBP-1 (Santa Cruz Biotechnology) as described previously . Cells w2 test. The correlation between transgelin-2 score and SREBP-1 score was examined by Spearman's test. For survival analysis, analysis of statistical significance was performed using the long-rank (Mantel\u2013Cox) test. Multivariate logistic regression analysis was used for analyzing risk factors for the level of transgelin-2. Cox proportional hazard model was used to identify the prognostic factors for survival. A difference was considered significant at p<0.05. All statistical analysis was performed using SPSS software, version 22.Experimental results are presented as mean\u00b1SD. Wilcoxon test was used to assess the immunohistochemical score for transgelin-2 protein in cancer tissues and adjacent normal tissues. Correlation analysis of transgelin-2 staining score with clinicopathological features was analyzed by \u03c7"}
+{"text": "Saccharomyces cerevisiae and its closely related yeasts undergo mating type switching by replacing DNA sequences at the active mating type locus (MAT) with one of two silent mating type cassettes. Recently, a novel mode of mating type switching was reported in methylotrophic yeast, including Ogataea polymorpha, which utilizes chromosomal recombination between inverted-repeat sequences flanking two MAT loci. The inversion is highly regulated and occurs only when two requirements are met: haploidy and nutritional starvation. However, links between this information and the mechanism associated with mating type switching are not understood. Here we investigated the roles of transcription factors involved in yeast sexual development, such as mating type genes and the conserved zinc finger protein Rme1. We found that co-presence of mating type a1 and \u03b12 genes was sufficient to prevent mating type switching, suggesting that ploidy information resides solely in the mating type locus. Additionally, RME1 deletion resulted in a reduced rate of switching, and ectopic expression of O. polymorpha RME1 overrode the requirement for starvation to induce MAT inversion. These results suggested that mating type switching in O. polymorpha is likely regulated by two distinct transcriptional programs that are linked to the ploidy and transmission of the starvation signal. Saccharomyces cerevisiae1. Mating type in S. cerevisiae is determined by two nonhomologous alleles in a single mating type locus (MAT), MATa or MAT\u03b12. Each of these sequences encodes transcriptional regulators of the two different haploid mating types. Mating type switching is mediated by a site-specific homologous recombination event that replaces one MAT allele with silent DNA sequences, HMLa or HMR\u03b1 which encodes the opposite MAT allele that is located on the same chromosome. A similar mechanism comprising three mating type gene sequences and the site-specific homothallic switching (HO) endonuclease, which generates a double-strand break, are shared among species closely related to S. cerevisiae such as Candida glabrata, Zygosaccharomyces rouxii, and Kluyveromyces lactis4. Interestingly, the HO gene in K. lactis is non-functional, and new mechanisms inducing DNA double-strand breaks have been acquired during evolution6. In S. cerevisiae, expression of the HO gene is a trigger to induce mating type switching1. Recently, a novel mode of mating type switching was reported in methylotrophic yeast, including Ogataea polymorpha, which utilizes a chromosomal recombination between inverted-repeat sequences flanking two MAT loci8. The inversion is highly regulated and occurs only when cells are haploid and under starvation conditions. However, the links between this information and the mechanism associated with mating type switching remain unknown.Similar to many other organisms, yeast senses and engages appropriate response programs following changes in their environment, including invasive growth, dimorphic transitions, and sexual differentiation. Spore formation, which is often accompanied by mating/meiosis, is a strategy for survival in harsh environments in many yeast species. Homothallism, which is a characteristics observed in some yeasts, allows mating to occur in populations derived from a single cell and is achieved by switching mating type frequently during vegetative growth in a or \u03b1 cells, namely haploid-specific genes (hsgs), are essential for inducing the mating process, whereas they are repressed in situations where both mating type alleles are present in a single cell 2. Many hsgs and their expression patterns appear to be common among ascomycetous yeasts, many of which are components of the mating pheromone-signalling pathway9; however, there may exist differences in the regulatory mechanism9. In S. cerevisiae, hsgs are repressed by a heterodimer of homeodomain proteins a1 and \u03b12, whereas K. lactis hsgs are placed under the direct regulation of Rme1, a conserved zinc finger transcription factor. Unlike S. cerevisiae, K. lactis primarily proliferate as haploid, and mating type switching and subsequent mating are tightly connected, both of which occur only under starvation conditions that lead to the spore formation. The starvation signal is incorporated into these programs through induction of the expression of RME1. Additionally, in K. lactis, a1-\u03b12 is involved in the regulation of hsgs expression through repressing RME1. Rme1 was originally identified as a regulator of mating type switching and it directly binds to MAT as well as activates transcription of the KAT1 gene which encodes a domesticated transposase10.Changes in transcriptional profile underlie the molecular mechanisms that induce mating/meiosis and sporulation in yeast. Genes specifically expressed in 12. In the model systems, S. cerevisiae and the fission yeast Schizosaccharomyces pombe, pheromones and pheromone receptor genes are targets of transcriptional regulation by pheromone signalling, which is transmitted through a heterotrimeric G protein and the downstream MAP kinase pathway to ensures the robustness of the signalling and the engagement of cells to the mating process15. Many of these genes are transcriptionally induced by starvation in yeast species, such as S. pombe, K. lactis, and Candida lusitaniae, where sexual development is restricted under starvation conditions19.Recognition of mating partners is initiated when the pheromone receptor binds to the mating pheromone secreted from cells of the opposite mating typeOgataea polymorpha, including mating type genes and a conserved transcription factor, Rme1, whose orthologue in K. lactis is involved in mating type switching10. Our results indicated that co-expression of a1 gene in MATa and \u03b12 gene in MAT\u03b1 were sufficient to prevent mating type switching, suggesting that the combination of mating type genes generates ploidy information for mating type switching. Furthermore, RME1 deletion resulted in reduced mating type switching, whereas its ectopic expression overrode the requirement for starvation for inducing MAT inversion. There results suggested that mating type switching in O. polymorpha is likely regulated by a1-\u03b12 and Rme1.Here, we evaluated the roles of transcription factors involved in sexual development in methylotrophic yeast a cells8. Because Hanson et al.7 reported the expression of an a2-like gene in O. polymorpha, we sequenced a2 mRNA and revealed that a predicted intron was indeed removed from mRNA to encode an a2 like protein. In order to examine a possible role of a2 in mating, we crossed a2\u2206 cells with deletion mutants of \u03b1-factor and a-factor receptor genes STE2 and STE3, respectively. Because ste2\u2206 cells cannot respond to \u03b1-factor, homothallic ste2\u2206 cells are able to mate with cells expressing a identity. Similarly, ste3\u2206 cells can mate only with \u03b1 cell. In our mating assay, while a2\u2206 cells were able to mate with ste3\u2206 cells, no mating was observed when crossed with ste2\u2206 cells  in the A(\u03b1)-type chromosome in \u03b1 haploid and a/\u03b1 haploid cells. Because it is impossible to distinguish original a/\u03b1 from \u03b1/a diploid cells generated by inverting the MAT-intervening region on both chromosomes, we deleted the centromere proximal inverted repeat (IR2) of the I(a)-type chromosome to prevent the inversion and to obtain a DNA fragment of different size from wild type I(a)-type chromosome in Southern blot analysis /\u03b1-diploid cells.Two sexual differentiation programs, mating and meiosis, are induced by starvation in sis Fig.\u00a08. InversMAT alleles, rather than ploidy. To investigate this possibility, we introduced a MAT\u03b1 allele at the URA3 locus in a cells. As expected, a cells expressing MAT\u03b1 were unable to undergo the MAT inversion  plasmid was unable to inhibit the MAT inversion in a cells, whereas the MAT\u03b1(\u03b11\u2206) plasmid inhibited the inversion to the same degree as that observed by the MAT\u03b1 plasmid. We also performed the same experiment in \u03b1 haploid cells, finding that expression of the a1 gene inhibited the MAT inversion in \u03b1 haploid cells  and crossed with wild type cells. The mating efficiency was severely reduced compared to the parental stable a cells. The equivalent experiment was performed in stable \u03b1 cells with a similar result, although the extent of the mating inhibition was much weaker   was found in the O. polymorpha genome. Because the expression of OpRME1 gene was strongly induced upon starvation . These results suggested that Rme1 played important roles in inducing mating type switching and mating.Rme1 is a transcription factor which plays important roles in sexual differentiation in yeast. A homolog of ion Fig.\u00a0, the rollls Fig.\u00a0, suggesting Fig.\u00a0. The rmeRME1 was expressed in mitotically growing cells from a strong constitutive TEF1 promoter in O. polymorpha  medium were a mixture of A(\u03b1) and I(a) types, whereas wild-type cells maintained their original MAT chromosome type, indicating that MAT inversion occurred in RME1-overexpressing cells in both A-to-I and I-to-A directions  inducing MAT inversion need to be synthesized under starvation conditions. However, other transcription factor(s) responsive to starvation signals might also be involved.Determining the link between starvation and O. polymorpha in a manner similar to that proposed for K. lactis; however, the composition of MAT loci and the molecular mechanism associated with mating type switching appear to differ between K. lactis and O. polymorpha10. While KlRme1 stimulates mating type switching in two ways, one by directly binding to MAT\u03b1 in \u03b1 cells and the other by activating transcription of the KAT1 gene in a cells, the function of OpRme1 is most likely to activate transcription of downstream target genes. Differences in Rme1 regulation is highlighted by the involvement of a1-\u03b12; whereas KlRME1 transcription was repressed by a1-\u03b12, OpRME1 expression was not9. The molecular target(s) of a1-\u03b12 in O. polymorpha that inhibit MAT inversion remain unknown.Rme1 links starvation, mating, and mating type switching in OpRME1 mRNA levels were strongly induced by starvation, their protein levels were affected only moderately under our experimental conditions. Although regulation of Rme1 levels might account for the difference in Rme1 activity between rich and starvation conditions, there might also be another layer of regulation at the post-translational level, such as nuclear import and protein phosphorylation.The mechanisms associated with Rme1 regulation in response to starvation remains unknown. Although MAT inversion is currently unclear. One simple scenario might be that a factor such as an endonuclease is induced by starvation to generate DNA lesions. Such genes would be expected to express only in haploid cells within a small window of time after shifting to the starvation conditions, because we did not observe significant increases in the rate of the MAT inversion after prolonged incubation under starvation conditions. However, we have not been successful in identifying such genes in our RNA-seq analysis. Expression profile in rme1\u2206 cells should be analysed in future. Furthermore, the delay in the timing of the MAT inversion in cell cycle-arrested cells under the starvation condition may suggest that an event associated with cell cycle progression contributes to triggering the MAT inversion in addition to the transcriptional regulations. However, this reduction might be due to the inability to induce the inversion in metaphase when sister chromatids are closely localized and homologous recombination is active. Further analyses are required to clarify these observations.The event that triggers the K. lactis and O. polymorpha, employ this strategy; however, the significance of condition-dependent mating type switching should be carefully examined. In O. polymorpha, any culture where one mating type is dominant is capable of mating with a or \u03b1 cells at similar frequencies, suggesting that the efficiency of mating type switching is not the limiting factor for mating. In the fission yeast S. pombe, where mating is induced by starvation, mating type switching occurs during mitotic growth. Therefore, it is noteworthy that mating efficiency is much higher in S. pombe (~80%) as compared with that observed in K. lactis (~20%) and O. polymorpha (~5%). What determines the overall mating efficiency and how much impact the efficiency of mating type switching has on self-mating frequency would be subjects of future research.It might be rational to restrict mating type switching under conditions where mating can occur, because this will increase the population of minor mating type cells in the original population, thereby offering better chances for sexual reproduction, while avoiding energy consumption for conducting the mating type switching event in asexually reproducing conditions. Both of the haploid species, 24. Sequences of primers used in this study are listed in Supplementary Table\u00a0O. polymorpha cells were transformed by electroporation. The O. polymorpha TEF1 promoter was described previously25.Strains and plasmids used in this study are listed in Supplementary Table\u00a026. All experiments were performed at 30\u2009\u00b0C unless otherwise indicated. Mating and meiosis were induced on MEMA or NaKG plate at 30\u2009\u00b0C8.Yeast strains were grown in YPDS or SD medium supplemented with appropriate amino acids and nucleotides27. DNA was stained with propidium iodide and DNA content was measured by FACSCalibur . To visualize DNA, yeast cells were fixed with 70% ethanol, washed with phosphate-buffered saline (PBS), and incubated in PBS containing 1\u2009\u00b5g/ml 4\u20326,-diamidino-2-phenylindole (DAPI). Images were acquired using Eclipse80i  equipped with Cool SNAP EZ  and driven by Meta Vue ver. 7.7.1.0 . Adobe Photoshop  was used to mount images.Yeast cells were prepared for flow cytometry as described1 and IR2 [A(\u03b1) or I(a)-type] were determined by PCR as previously described with the primers listed in Supplementary Table\u00a08. For Southern blot analysis, O. polymorpha genomic DNA was prepared using a standard protocol. Briefly, DNA was digested with EcoRI restriction enzyme before electrophoresis. A standard protocol was used for blotting and hybridization. DNA probes were prepared, and detection was performed using the AlkPhos direct labeling and detection system with CDP-Star . Signal intensities were quantified with ImageJ version 1.47  and Photoshop  was used to mount the images.Orientation of the region between IRleu1\u20131, ura3\u20131, or ade12-cr3 genotypes were grown at 30\u2009\u00b0C in YPDS until the A663 was between 0.5 and\u00a08 . Cells were washed with PBS, diluted to A663\u2009=\u20091.0, and a 10-\u00b5L cell suspension of the two strains was mixed on a nitrocellulose-membrane filter that was placed on a MEMA or NaKG plate and incubated for 20\u201330 hrs at 30\u2009\u00b0C. Cells were resuspended in PBS, and dilutions were plated on SD plates supplemented with leucine or uracil and adenine or on unsupplemented SD plates that were incubated for 2 days at 37\u2009\u00b0C. The mating percentage was calculated as the number of colonies on unsupplemented plates divided by the number on adenine and leucine- or uracil-supplemented plates .Yeast strains of O. polymorpha as previously described, treated with DNase I, and then further purified using the RNeasy Plus kit or RNeasy MinElute Cleanup Kit . A total of 800 ng-1\u2009\u00b5g RNA was used to synthesize cDNA with SuperScriptIII  or Reverse Tra Ace qPCR RT Master Mix  according to the manufacturer\u2019s protocol, and a 0.1\u20131\u2009\u00b5l cDNA reaction mixture was used in a qPCR reaction with the primers listed in Supplementary Table\u00a0Total RNA was isolated from a, \u03b1, and a cells carrying MAT\u03b1 were sequenced using HiSeq system . The cDNA libraries were prepared with a TruSeq DNA Sample Preparation v2 Kit (Illumina Inc.) according to the manufacturer\u2019s protocol. The reference sequence contains only ORF sequences of O. polymorpha based on The JGI Genome Portal30. Supplementary information Dataset 1\u00a0shows the result of gene expression analysis.RNAs prepared from wild type The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request.Supplementary informationDataset 1Supplementary Table S1Supplementary Table S2"}
+{"text": "Type 2-immunity represents the typical adaptive response to allergen exposure in atopic individuals. It mainly involves Th2 cells and immunoglobulin E, as the main orchestrators of type 2-inflammation. Recently, it has been highlighted that allergens may be responsible for a Th2 response beside specific IgE activation and that a number of other environmental stimuli, such as viruses and pollutants, can trigger the same pattern of inflammation beyond atopy. Emerging data sustain a substantial role of the so-called epithelial dysfunction in asthma pathogenesis, both from anatomic and functional point of view. Furthermore an increasing amount of evidence demonstrates the relevance of innate immunity in polarizing a Th2 impaired response in asthmatic patients. Under this perspective, the complex cross-talking between airway epithelium, innate and adaptive immunity is emerging as a major determinant of type 2-inflammation beyond allergens.This review will include an update on the relevance of dysregulation of innate and adaptive type 2-immunity in asthma pathogenesis, particularly severe asthma, and on the role of the allergens that are associated with severe asthma. Type 2-immunity also will be reviewed in the light of the current and upcoming targeted treatments for severe asthma. Asthma pathogenesis can be explained as the consequence of an epithelial barrier dysfunction, which entails loss of anatomic integrity and impaired functional, mainly immunological, competence, the last aspect being strictly connected with innate immunity.In atopic individuals allergen exposure promotes the activation of Th2 cytokines, particularly IL-4, IL-5, IL-9, and IL-13, which orchestrate and amplify type-2 response.Eosinophil activation is the key-step of type 2-inflammatory cascade, not only, but mostly in the late allergic response, and eosinophils exert a central role in asthma pathogenesis through the release of four main proteins and a number of mediators which sustain amplification of allergic response and remodelling.Sensitization to several specific allergens, including house dust mite (HDM), fungi, pollen, animal dander and cockroach, are associated with a more severe phenotype of allergic asthma.A number of allergens, including HDM and moulds, are able to trigger a type 2 immune response in the absence of specific IgE antibodies, by activating airway epithelial Cells (AECs) via pathogen recognition receptor (PAR) and toll-like receptors (TLR) to produce TSLP, IL-25 and IL-33. The same pattern can be activated by allergens proteases and oxidative damage.Mainly in response to selective TLR  stimulation and to injury operated by environmental stimuli (viruses and pollutants), the epithelial cells produce master regulatory cytokines, including thymic stromal lymphopoietin (TSLP), IL-25 and IL-33, which stimulate Th2 cells and type 2 innate lymphoid cells (ILC2) to produce Th2 cytokines.ILC2 orchestrate a second-line adaptive type 2 immune response, a chronic eosinophilic airways inflammation in patients with asthma, particularly severe asthma, and an altered tissue repair processes responsible for airway remodelling, which further sustains the epithelial physical inefficiency.In the light of the emerging pathogenic role of epithelial dysfunction and innate immunity, even type 2-inflammation should be no more considered as a consequence of allergenic stimuli only, but the result of a complex cross-talking between airway epithelium, innate and adaptive immunity.Th2 immunity actors represent the selective target of a number of current and upcoming biological treatments. Innate immunity, particularly TSLP, is under investigation as a novel target for innovative drugs.Traditionally, type 2-immunity is triggered by allergens or parasitic infection and characterized by the differentiation of na\u00efve T CD4+ cells towards Th2 effector cells, which is typically associated with IgE production, eosinophilia and mast cell activation. The keystone cytokines in type 2 immune response include interleukin (IL) 4, IL-5, IL-9, and IL-13 [In infection, Th2 immune response provides an effective protection against helminths. Th2-induced IgE antibody production, mucus secretion, and mast cell activation could facilitate worm expulsion; while eosinophils recruited by Th2 response directly kill larva . AdditioStudies have shown an important role of Th2 immunity in the immunopathology of asthma, which could determine the severity of the disease. This review will describe the dysregulation of innate and adaptive type 2 immunity in severe asthma, the roles of the allergens that are associated with severe asthma and targeting type 2 immune response in treatment of severe asthma.FH cells. Through specific signalling pathways, Th2 cells move toward the site of inflammation and produce Th2 cytokines, particularly IL-4, IL-5, IL-9, and IL-13, which orchestrate and amplify type-2 response [FH cells are able to induce IgE production by interacting with antigen-specific B cells. Allergen-specific IgE crosslinking on basophils and mast cells high-affinity Fc\u03b5 receptor 1 (Fc\u03b5R1) activates and releases through degranulation a number of cytokines and mediators which further sustain type-2 response [Type 2-inflammation is traditionally sustained by Th2 cells and immunoglobulin E (IgE), as the main orchestrators of type 2 adaptive immunity . In atopresponse . Tissue response . TFH celresponse . In factresponse . Cytosolresponse .Basophils sustain the late phase of allergic response, by promoting eosinophilic inflammation and mucus production. In comparison with mast cells, ILC2s, and eosinophils, they produce relatively high levels of IL-4, thus acting as major Th2 differentiation promoters, including ILC2 activation , 13.Eosinophil activation is the key-step of type 2-inflammatory cascade, not only but mostly in the late allergic response, and eosinophils exert a central role in asthma pathogenesis through the release of four main proteins retained in their cytoplasmic granules and a number of mediators . EosinopFurthermore, eosinophils produce cytokines , lipid mediators and oxygen radicals. Eosinophil activation results in dendritic cells chemotactic activity, endothelial cells damaging, inhibition of muscarinic receptors, altered repair processes and induction of fibrosis, leading to airway hyperactivity and wall remodelling , 16. AllRecently, an increasing amount of evidence has demonstrated that allergens can activate a Th2 response beside specific IgE involvement and that a number of other environmental stimuli can trigger the same pattern of inflammation , 18. In According to the most recent evidence, asthma pathogenesis could be synthetically explained as the consequence of an epithelial barrier dysfunction , 20 Fig, which iSmoke as well can be responsible for tight junctions inefficiency , 24. DatFrom a functional point of view, primary IFN production deficiency in response to common respiratory viruses such as rhinovirus might be responsible for a kind of aberrant differentiation of dendritic cells which become quite inefficient in anti-microbial protection whilst activate pro-allergic pathways , 27. In As a consequence of the impact of environmental agents usually excluded from the exposure to the second line immunity by the epithelial physical and functional barrier, a number of impaired epithelial signalling pathways take place. The disordered response includes a Th2 oriented unbalanced inflammation, and an exaggerated response to injury , 32. TheMainly in response to selective toll-like receptor  stimulation and to injury, the epithelial cells, oriented by a network of transcription factors including FoxA2 and Spdef, start producing key cytokines such as chemokine (C-C motif) ligand (CCL) 17 and CCL22 that exert most of Th2-type T-cell chemotactic activity by interacting with the common CCR4 receptor , 33. OthEmerging data suggest that mast cells, when directly activated by plant-derived allergen proteases, further promote IL-33 and release several cytokines, including IL-2 and IL-4. This results in altered expansion of Treg cells and dysregulated expression of their GATA3 and Th2-type cytokines , which impairs their regulatory and suppressive function towards Th2 inflammation , 38.Dendritic cells (DCs), mainly monocytic DCs, substantially contribute to Th2 polarization even in the absence of specific allergen stimulation , 40, 41.Studies have shown that sensitization to several specific allergens, including house dust mite (HDM), fungi, pollen, animal dander, and cockroach, are associated with a more severe phenotype of allergic asthma . AllergeHDM is one of the most common aeroallergens inducing sensitization in 85% patients with asthma . HDM canAlternaria) that induce airway hyperresponsiveness in sensitized individuals; 2) colonization of fungi  in the airways that produces a persistently allergenic stimulus; 3) fungal colonization outside of the airways (e.g. dermatophyte infection of the skin or nails with Trichophyton) that can trigger immediate hypersensitivity [Sensitization to certain fungi has been associated with increased asthma severity, mortality, hospitalization, and intensive care admissions in adults . There asitivity . The funsitivity , 53, leaFagales, Oleacea, and Cupressacecae families; grasses of the Pooideae, Chloridoideae and Panicoideae families; weeds of the Amaranthaceae, Asteraceae, and Urticaceae families [There is abundant evidence showing the associations of tree, grass, and weed pollen sensitization with severe asthma . The mosfamilies \u201356. Recefamilies . Additiofamilies . Consequfamilies \u201360.Other indoor allergens that are associated with increased asthma risk include animal dander and cockroach. The presence of pets at home and sensitizations to cat or dog allergens were also found to be associated with severe asthma , while sAlthough allergen sensitizations are well-known to be associated with asthma, a number of studies reported a lower frequency of allergen sensitizations, obtained by skin prick tests (SPT) or specific serum IgE measurement, in patients with severe asthma compared to those with moderate or mild asthma , 63. TheTaken together, allergens could induce type 2 immune response in various ways to maintain and/or amplify the airway inflammation and remodelling in asthma, which is associated with severe asthma. Understanding the mechanisms of allergen-induced immune response help select a target therapy in management of severe asthma.The awareness of two different types of inflammation (Th2-high and Th2-low), and that Th2 type is frequently involved in several kinds of severe asthma, has driven research to look for drugs targeting Th2 cytokines or their production mechanisms , 70 Tab. Princip\u03b1 subunit [The main clinical trials assessing the efficacy of mepolizumab , 94\u201398 r subunit , whose a subunit . A pecul subunit , mediate subunit . As well subunit , 107. In subunit , 109. ThIL-4 and IL-13 have been analysed\u00a0as well. IL-4 pathway could be inhibited by either blocking IL-4 or the IL-4/IL-13 receptor. Pascolizumab, a humanized monoclonal antibody (mAb) blocking IL-4, was found to be well tolerated; however, its effect on asthma symptoms and IgE level reduction was insignificant . A mutatTh2 immunity exerts a pivotal role in asthma pathogenesis, beyond allergic sensitization. In fact, not only specific IgE in sensitized individuals but also many other environmental stimuli, such as viruses and pollutants, can trigger a Th2 response. Furthermore, a number of allergens such as HDM and moulds are able to activate both innate and adaptive type 2 immune reaction even in the absence of specific IgE antibodies. An increasing amount of evidence supports the relevance of airways, particularly bronchial epithelium dysfunction, as the predisposing condition of such impaired response. Epithelial barrier efficiency implies two main aspects: anatomic integrity and functional, mainly immunological, competence, the last aspect being strictly connected with innate immunity. Under this perspective the Th2 polarization is the result of a complex cross talking between airway epithelium,\u00a0and innate and adaptive immunity. It entails major clinical implications in terms of preventive and therapeutic options. Particularly, innate response can be considered as a new target for innovative selective treatments."}
+{"text": "In recent years there has been increasing recognition of varying asthma phenotypes that impact treatment response. This has led to the development of biological therapies targeting specific immune cells and cytokines in the inflammatory cascade. Currently, there are two primary asthma phenotypes, Type 2 hi and Type 2 lo, which are defined by eosinophilic and neutrophilic/pauci- granulocytic pattern of inflammation respectively. Most biologics focus on Type 2 hi asthma, including all four biologics approved for treatment of uncontrolled asthma in the United States \u2014 omalizumab, mepolizumab, reslizumab, and benralizumab. Potential new targets for drug development are being investigated, such as IL-13, IL-4\u03b1 receptor, CRTH2, TSLP, IL-25, IL-13, IL-17A receptor, and CXCR2/IL-8. This review will discuss the role of these molecules on the inflammatory response in uncontrolled asthma and the emerging biologics that address them. Through the delineation of distinct immunological mechanisms in severe asthma, targeted biologics are promising new therapies that have the potential to improve asthma control and quality of life. Asthma is a chronic disorder of the airways characterized by inflammation, reversible airflow obstruction and bronchial hyperresponsiveness, which is an increased sensitivity of the airways to a variety of stimuli resulting in bronchoconstriction . BecauseT2-hi asthma is characterized by eosinophilic inflammation. In this pathway, airway epithelial cells and inflammatory cells such as mast cells, T-helper type 2 cells (Th2), type 2 innate lymphoid cells (ILC-2) release cytokines and mediators including IL-4, IL-5, IL-13, IgE, and thymic stromal lymphopoietin (TSLP) to induce airway inflammation [T2-lo asthma  is characterized by a neutrophilic or pauci-granulocytic pattern of inflammation. Mediators of neutrophilic pathway include IL-8, IL-17, IL-23, which are important cytokines for neutrophil growth, differentiation and chemotaxis . CorticoP\u00a0=\u20090.001 vs. 16%; 95% CI -32 to 46; P\u00a0=\u20090.45), high baseline eosinophil counts (\u2265260/\u03bcL) compared to low eosinophil counts (<\u2009260\u00a0\u03bcL)  and high periostin levels (\u2265 50\u00a0ng/mL) compared to low periostin levels (<\u200950\u00a0ng/mL)  vs. 3%; 95% CI -43 to 32, P\u00a0=\u20090.94) [P\u00a0=\u20090.002), and this effect was more notable with higher eosinophil counts: \u2265 200/\u03bcL, 55% mean exacerbation rate reduction ; \u2265 300/\u03bcL, 67% rate reduction ; \u2265 400/\u03bcL, 74% rate reduction rate  [Currently, the FDA has approved omalizumab, mepolizumab, reslizumab, and benralizumab for the treatment of uncontrolled asthma Table . OmalizuP\u00a0=\u20090.003), reduce prednisone use , and decrease the number of sputum and blood eosinophils within normal limits (P\u00a0=\u20090.005 and P\u00a0=\u20090.004 respectively) [P\u00a0<\u20090.0001); 39% at 250\u00a0mg ; 52% at 750\u00a0mg  and blood and sputum eosinophils [P\u00a0=\u20090.008) [P\u00a0=\u20090.03) in patients with eosinophilic asthma, but no improvement in forced expiratory volume in 1\u00a0s (FEV1) was observed [Mepolizumab and reslizumab are monoclonal antibodies to IL-5. Mepolizumab has been shown to increase the median time to exacerbation  . The DREinophils \u201313. The observed . MepolizP\u00a0=\u20090.0068) [1  [P\u00a0<\u20090.0001; study 2- RR 0.41; 95% CI 0.28\u20130.59; P\u00a0<\u20090.0001) [Similarly, reslizumab reduced sputum eosinophils  , improve\u20090.0023)  and redu\u20090.0001) , 16. No \u20090.0001) .P\u2009=\u20090.096), but not at lower doses of 20\u00a0mg and 100\u00a0mg [1 in patients with severe asthma uncontrolled by high-dosage ICS plus long acting beta-adrenoceptor agonist (LABA) with blood eosinophils 300/\u03bcL or greater [1 were noted but these tended to not be clinically or statistically significant. A small study in patients presenting to ER with acute asthma also showed that one dose of benralizumab reduced rate and severity of asthma exacerbations by 50% over 12\u00a0weeks [Benralizumab is a monoclonal IL-5 receptor antagonist that acts by binding to the \u03b1-chain of the IL-5 receptor on eosinophils and basophils to induce apoptosis via antibody-dependent cell-mediated cytotoxicity. Phase 2b clinical trials showed benralizumab 100\u00a0mg decreased exacerbations in patients with uncontrolled asthma and high baseline blood eosinophils , improved FEV1 and Asthma Control Questionnaire scores and decreased Th2 associated inflammatory markers [1 significantly , and similar improvements were also noted in the subgroup with eosinophila <300\u00a0\u03bcL  and overall population  with dupilumab every 2\u00a0weeks [P\u2009<\u20090.001) and increased FEV1 by 0.32\u00a0L , and greater benefits were again seen in patients with blood eosinophilia \u2265300/\u03bcL [P\u2009<\u20090.001) [IL-4\u03b1 receptor is the common receptor domain for both IL-13 and IL-4. Dupilumab is a fully humanized monoclonal antibody to the alpha chain of the IL-4\u03b1 receptor Table . In pati markers . Dupilum 2\u00a0weeks . In Phas \u2265300/\u03bcL . In pati<\u20090.001) .Table 2AIt is currently awaiting FDA approval for use in asthma. Additionally, it is under investigation for the treatment of severe asthma in children and has recently been approved for severe atopic dermatitis in patients over 18 years of age.1 in uncontrolled asthma, particularly in the high-periostin subgroup [IL-13 mediates inflammation through proliferation of bronchial fibroblasts, recruitment of eosinophils and basophils, and IgE synthesis . Periostsubgroup , 28. Howsubgroup . Recent 2 (PGD2), which binds CRTH2 to promote release of type 2 cytokines IL-4, IL-5, IL-13 from ILC-2 and Th2 cells in addition to stimulating eosinophilic chemotaxis and degranulation [1 was 9.2% for patients on treatment with OC000459 (200\u00a0mg twice daily) versus 1.8% placebo (P\u2009=\u20090.037) in the per protocol population, which excluded non-compliant subjects [P\u2009=\u20090.0022) and night-time symptom scores  [1 by 95\u00a0mL in the pooled dose group compared to placebo (P\u2009=\u20090.024) [1 , particularly in a younger population  [1 , Asthma Control Questionaaire-7 (P\u2009<\u20090.001), beta-agonist use (P\u2009<\u20090.001), and symptom free days (P\u2009=\u20090.07) compared to placebo in patients with elevated Th2 associated biomarkers [1 and/or asthma control scores depending on the study [1 or Asthma Control Questionnaire was observed in patients with mild to moderate uncontrolled asthma, but a subgroup analysis suggested improvement of both end points in patients with a FEV1\u2009<\u200970% of predicted at baseline  [1 in asthmatics who were uncontrolled on low dose ICS  though similar results were observed with montelukast [P\u2009=\u20090.0014) [CRTH2 (DP2) is a G protein-coupled receptor expressed on key immune cells, specifically Th2 cells, ILC-2, eosinophils and basophils. Activated mast cells secrete prostaglandin Dnulation . Severalsubjects \u201333. Ther=\u20090.022) \u201333. OC00=\u20090.024) . In the =\u20090.007) . Similaromarkers . BI 6718he study . Resultso P\u2009=\u20090.0 in the ptelukast . In pati\u20090.0014) , 39 and \u20090.0014) , which m1 by 34.0% during the late response to allergen challenge on day 42 (P\u2009=\u20090.09) and 45.9% smaller on day 84 (P\u2009=\u20090.02) in patients with stable allergic asthma [P\u2009<\u20090.0001; by 71% with 210\u00a0mg every 4\u00a0weeks, P\u2009<\u20090.0001; by 66% with 280\u00a0mg every 2\u00a0weeks, P\u2009<\u20090.0001), increased prebronchodilator FEV1  and decreased Th2 markers of inflammation in patients with uncontrolled asthma despite LABA combined with medium or high dose ICS [Airway epithelial derived cytokines such as TSLP, IL-25, and IL-33 drive allergic inflammatory responses to airway damage. TSLP acts on dendritic cells, mast cells, ILC-2 cells, and eosinophils to promote Th2 cell differentiation and secretion of cytokines such as IL-4, IL-5, and IL-13 \u201344. Therc asthma . It alsoc asthma . Recentldose ICS . Interesdose ICS .IL-25  is an epithelial derived alarmin that is a member of the IL-17 cytokine family. It is constitutively produced in bronchial epithelial cells and released on exposure to proteases, such as allergen proteases on dust mite extract, to activate a Th2 response . IL-25 bIL-33 is a member of the IL-1 cytokine family that is produced by airway epithelial cells, smooth muscle cells and endothelium and expressed on immune cells such as dendritic cells, macrophages and mast cells. IL-33 binds to IL-1R1 and IL-1RAcP receptor complex to activate production of various cytokines, including type 2 cytokines IL-4, IL-5, and IL-13 . In partPatients with severe asthma have higher mRNA expression of IL-33 on lung tissue compared to controls . In a meIL-17A and IL-17F are members of the IL-17 cytokine family. Produced by Th17 cells, they act on epithelial cells to potentiate cytokines that induce local recruitment of neutrophils . In patiP\u2009=\u20090.02) in a small subgroup with high bronchodilator reversibility (post bronchodilator FEV1 improvement \u226520%) at a dose of 210\u00a0mg [IL-17A and IL17F bind to receptor complexes that have IL-17RA as the common subunit. Brodalumab is a human monoclonal antibody that binds to IL-17RA, thereby blocking activity of IL-17A, IL-17B, and IL-25 Table . In a raf 210\u00a0mg . Howeverf 210\u00a0mg . Prelimif 210\u00a0mg . CCJM112P\u2009=\u20090.03), but only a trend towards improved asthma control was observed [IL-8 is a potent chemoattractant that mediates activation and migration of neutrophils to the sites of inflammation via the high affinity CXCR2 receptor. Increased sputum levels of IL-8 often preceded asthma exacerbations in severe asthmatics, and sputum IL-8 levels also correlated with development of late phase allergic airflow obstruction in atopic patients , 71. IL-observed . A subseobserved . AdditioAsthma is a complex, heterogeneous disease with varying phenotypes that affect treatment response. The characterization of the T2-hi profile has led to the development of specific biological agents that target the immune cells and cytokines in the inflammatory cascade. Currently, all of the FDA approved biologics  and the majority of potential therapeutic targets focus on this pathway. While some targeted therapies have had promising preliminary results, others have not shown a significant biological or clinical response due to several potential limitations. First, blocking a single cytokine or inflammatory cell may be insufficient to reduce inflammation, possibly because of compensatory response from a different cytokine. Studies with cytokine deficient mice have shown the importance of integrated signaling activity between IL-13, IL-4, and IL-5 . Thus, t"}
+{"text": "Vaginal fistulas (VF) represent abnormal communications between the vagina and either the distal portion of the digestive system or the lower urinary tract, but lack an accepted classification and standardised terminology. Regardless of the underlying cause, these uncommon disorders result in profound physical, psychological, sexual and social distress to the patients.Since diagnosis of VF is challenging at gynaecologic examination, ano-proctoscopy and urethro-cystoscopy, imaging is crucial to confirm the fistula, to visualise its site, course and involved organ, and to characterise the underlying disease. The traditional conventional radiographic studies provided limited cross-sectional information and are nowadays largely replaced by CT and MRI studies.Aiming to provide radiologists with an increased familiarity with VF, this pictorial paper summarises their clinical features, pathogenesis and therapeutic approach, and presents the appropriate CT and MRI acquisition and interpretation techniques that vary according to the anatomic site and termination of the fistula. The current role of state-of-the art CT and MRI is presented with examples regarding both entero-  and urinary  VF. The resulting combined anatomic and functional cross-sectional information is crucial to allow a correct therapeutic choice and surgical planning. Vaginal fistulas are broadly categorised as they affect either the distal bowel  or urinary tract Among the spectrum of causes, in Western countries, iatrogenic surgical injuries represent an increasing concernCT diagnosis of bowel vaginal fistulas benefits from small field-of-view oblique and sagittal interpretation, and optional intrarectal contrastIf not contraindicated, focused MRI provides superior visualisation of ano- and rectovaginal fistulasCT-urography and additional CT-cystography now represent the mainstay techniques to diagnose urinary VFFistulas of the female genital tract were described in medical literature since ancient times: among them, vaginal fistulas (VF) are the most prevalent and are defined as abnormal epithelium-lined communications between the vagina and other pelvic organs . The speThe majority of patients with VF are initially referred to a gynaecologist; however, despite more or less evident clinical signs, vaginal exploration may identify the fistulous orifice in less than 80% of cases . SimilarTraditionally, imaging demonstration of VF relied on fluoroscopic studies such as contrast medium (CM) enema, intravenous excretory urography, voiding and retrograde cystography, which may opacify a patent fistulous tract but provide very limited information on the affected organs , 9. AlthIn recent years, CT and MRI studies are largely replacing conventional radiologic techniques. With appropriate acquisition and focused interpretation, state-of-the art cross-sectional imaging may provide optimal visualisation of VF, involved organs and underlying diseases, which is crucial for correct choice between conservative and surgical treatment and appropriate surgical planning. Aiming to improve radiologists\u2019 familiarity with these uncommon but challenging entities, this pictorial essay provides a concise review of VF types, clinical features, causes and mechanisms, then presents with examples the state-of-the art CT and MRI techniques and appearances of VF.Although lacking an accepted classification scheme or standardised terminology, VF may be broadly separated into either entero- or urinary VF according to involvement of the distal bowel or lower urinary tract, respectively. Both categories are further subdivided on the basis of the target organ , 10.Entero-VF Fig.\u00a0 may invoIn developing countries, VF are still common and almost invariably secondary to obstructed labour , 12. ConRegardless of type, all VF cause distressing symptoms including persistent vaginitis despite treatment, dyspareunia, painful perineal dermatitis and excoriation. Entero-VF are heralded by foul-smelling enteral or faecal discharge through the vagina. Faecal incontinence may develop secondary to associated loss of anal sphincter function , 5.The characteristic symptom of urinary VF is continual leakage of urine from the vagina and vulvar irritation. In recently operated patients, specific symptoms of VF are often masked by common post-operative problems such as abdominal and flank pain, hematuria, worsening renal function, fever and paralytic ileus. Not unusually, iatrogenic damage to the urinary tract is heralded by imaging detection of fluid collections representing urinoma. Biochemical assay of discharge fluid for creatinine levels and intravesical injection of methylene blue dye are helpful to confirm the presence of the VF , 4.MRI arguably represents the best imaging modality to visualise the normal pelvic and perineal structures including the anal sphincter muscles and to elucidate suspected vaginal disorders , 18. TheIn particular, the most recent European Crohn\u2019s and Colitis Organisation (ECCO) guidelines recommend MRI as the first-line, most accurate modality for preoperative diagnosis of perianal involvement in Crohn\u2019s disease (CD), as it dramatically affects medical and surgical therapy planning and improves the outcome .Apart from fasting some hours before the examination, generally no special bowel preparation is required before MRI. However, some centres suggest that preliminary distension with ultrasound gel may ease identification of the vagina . Ideallyb value diffusion-weighted (DW) acquisition compared with T2-weighted images , 4443, 4On either CT-cystography or excretory-phase CT-urography, a urinary VF is heralded by the presence of opacified urine in the vagina Figs.\u00a0 and 16. Small non-malignant urethro- and vesico-VF may be managed conservatively with prolonged catheterisation or undergo electrocoagulation. Transvaginal surgical repair with or without flap techniques may be either performed early or postponed after healing of inflammation and necrosis, aiming to reduce morbidity. Similarly to iatrogenic and traumatic bladder rupture, a transabdominal approach is required in complex injuries, intraperitoneal leaks and cranial vesico-VF , 47, 48.Sinus tracts differ from VF in that they do not connect to an organ but are blind-ending or terminate into an abscess collection , 21.Rare conditions that may mimic a VF both clinically and at imaging are peritoneal and lymphatic fistulas Fig.\u00a0, in whicIn the developing world, obstructed labour and perineal lacerations during spontaneous or instrumental delivery remain the most prevalent causes; conversely, in Western countries, VF are increasingly iatrogenic in nature as they develop as complications of various pelvic, urologic and gynaecologic procedures. Although uncommon, VF result in substantial morbidity for patients. The ideal cross-sectional techniques depend on the anatomic site and affected organ. With appropriate acquisition and focused interpretation, state-of-the art CT and MRI provide optimal visualisation of entero- and urinary VF that is crucial for correct therapeutic choice and surgical planning."}
+{"text": "Moreover; the possibility to distinguish wine samples on the base of permitted levels of fault compounds content was shown.The potentiometric electronic tongue system has been tested as a potential analytical tool for brand uniformity control of monoculture Apulian red wines (Primitivo and Negroamaro). The sensor array was composed of eight porphyrin coatings obtained by electrochemical polymerization process and was employed for both wines discrimination and quantitative detection of wine defect compounds: \u201coff-odour\u201d 3-(methylthio)-propanol; isoamyl alcohol fusel oil; benzaldehyde (marker of the yeast activity) and acetic acid (marker of vinegar formation). PLS-DA applied to Electronic tongue output data has permitted a correct discrimination of more than 70% of analysed wines in respect to the original brand affiliation. Satisfactory PLS1 predictions were obtained in real wine samples; with R The well recognizable organoleptic properties of food and drink products are essential to maintain the brand uniformity and play a major role in consumer choices and preferences. In wine, the combination of taste and aroma but also of bouquet, appearance and mouth feel results in the unique appearance of a determined brand . The winAn application of wet chemistry procedures  and seveAn involvement of professional wine tasting panels remains until nowadays indispensable in the wine authentication analysis. However, recent studies show that the human perception of wine organoleptic characteristics is very subjective and it is very difficult to identify wines in blind tastings. Even being very skilled, human panellists may perform only few assessments per day, due to the saturation of tongue receptors, and, as reported in , among tThe possibility to substitute human sensory panels with artificial olfaction and taste sensory systems, such as Electronic Nose (e-Nose), Electronic Tongue (e-Tongue), has been actively investigated over the last two decades ,13,14 anAmong different types of electrochemical sensors, potentiometric sensors and sensor arrays have been actively employed for wine analysis ,21, sincVarious options for ligand grafting, such as photopolymerization , covalenIn the present work, an e-Tongue system based on porphyrin electropolymers, obtained by electrodeposition of n-alkyl-(1-pyrrole) phenyl-substituted porphyrins or aminophenyl substituted porphyrin polymeric coatings, was employed for the authenticity assessment of 24 samples of Apulian wines produced by different cantinas and made of 100% Primitivo (10 wines) or Negroamaro (14 wines) grape varieties. Moreover, the correct discrimination of authentic Negroamaro wine and wine contaminated with several fault compounds was performed by the developed e-Tongue system. The possibility to detect in analysed Apulian wines the defects related to the presence of so-called wine \u201coff-odour\u201d compound 3-(methylthio)-propanol (methionol), isoamyl alcohol fusel oil, the marker of the yeast activity benzaldehyde and acetic acid as wine acidification marker was also investigated; the satisfactory results were obtained for isoamyl alcohol and acetic acid in particular.2Cl2) were from Sigma-Aldrich. 5,10,15-tris(4-aminophenyl)-20-phenylporphyrinates of Cu(II) and Co(II) (1 and 4), mono 5-(4-aminophenyl)-10,15,20-phenylporphyrinates of FeCl(III) and Mn(III) (2 and 3), 5-{4-[5-(pyrrol-1-yl) pentyloxy] phenyl},10,15,20-(triphenyl) porphyrin of Co(II) (5), 5-{4-[5-pyrrol-1-yl)decyloxy]phenyl},10,15,20-(triphenyl) porphyrin of Co(II) (6), 5,10-di4-[5-(pyrrol-1-yl) phenyl],10,20-(di-mesityl) porphyrin (7), 5-{4-[5-(pyrrol-1-yl)-decyloxy]phenyl},10,15,20-(trimesityl) porphyrin (8) were synthesized in our laboratories according to the previously reported procedures [4, Fluka, Buchs, Switzerland) were used. Solutions for potentiometric and optical evaluations were prepared with distilled water. Tartaric acid, acetic acid, ethyl alcohol, isobutyl alcohol, isoamyl alcohol, 3-(methylthio)-propanol and benzaldehyde were purchased from Sigma-Aldrich . The solvents acetonitrile (ACN) and dichloromethane  reference electrode. The chemical structures of the employed porphyrin monomers are given in The e-Tongue array was composed by 8 potentiometric chemical sensors obtained by electrodeposition of n-alkyl-(1-pyrrole) phenyl- and aminopenyl- substituted porphyrin polymeric coatings on flat Pt working electrodes surface (3 mm in diameter). The properties of utilized porphyrin electropolymer sensing films were studied in our previous works ,29. The 1\u20134, a polyaniline (PANI) backbone with incorporated porphyrin units was formed on Pt WE surface, 5\u20138, during the electropolymerization at high oxidative potentials the polypyrrole (PPy) backbone bearing side-linked active porphyrin units was formed on Pt WE through the 2,5-positions of pyrrole, 4, served as anionic dopants in order to maintain the polymer electroneutrality. As can be seen in 2, 4 and 6, since their the voltammogram profiles did not change during all 20 cycles of electropolymerization; while in other cases  the oxidative current was growing with increase of film thickness, indicating formation of conductive film on WE surface. The morphology of obtained polymeric coatings was characterized with AFM and SEM techniques [The typical CV curves for electropolymer depositions are shown in chniques ,33. The chniques  and the \u22127\u201310\u22121 M in buffer background (pH 5.5 to 8.6), or in distilled water (with simultaneous pH control), as described in detail in [s-standard concentration, Ca-alarm concentration, Cd1-defect concentration 1, Cd2-defect concentration 2. In total 16 calibration solutions were prepared. All the measurements were performed in triplicate and the final data matrix had a dimension: 4 compounds \u00d7 4 concentrations \u00d7 3 replicas \u00d7 8 sensors = 384 points. Between the measurements the solutions were stored in sealed containers with limited headspace.The potentiometric responses of the sensors have been studied in solutions of several salts, in a concentration range of 10etail in ,29. SensThe 24 samples of monovarietal Italian red wines produced in the Apulia region and bottled in 2007 by different cantinas were evaluated by e-Tongue array in order to confirm wines authenticity and reveal possible adulterations. Among them, 10 wine samples were made of 100% Primitivo and 14 wine samples were made of 100% Negroamaro grapes varieties correspondingly, 2, of predicted versus measured correlation line was used to evaluate the efficiency of applied regression model. Data treatment was performed with a commercial Unscrambler  software.Principle component analysis (PCA) and Soft Independent Modelling by Class Analogy (SIMCA) were applied for wines identification and supervised classification respectively. Partial Least Regression (PLS1) method was used in order to correlate e-Tongue output with known amounts of wine defect compounds in calibration solutions. PLS Discriminant analysis, PLS-DA was employed for wines discrimination. Validation was performed using one-leave-out procedure. The RMSEP (Root Mean Square Error of Prediction) and correlation coefficient, R1\u20138 selection [The porphyrin electropolymers for e-Tongue have been chosen thanks to their particular binding properties when interacting with metal cations (for free base-porphyrins) or several anions . Moreover, the enhanced cross-sensitivity of porphyrin electropolymers was shown recently and was one of the main criteria for the compounds election ,29,31. No tests on sensors sensitivity towards wine defect compounds were performed previously; for this reason, as a first task of the present work we have evaluated the e-Tongue array response toward several compounds responsible for the wine organoleptic faults: methionol (ME), isoamyl alcohol (IA), benzaldehyde (BA) and acetic acid (AA) in a wide range of concentrations  . The artSchizosaccharomyces japponicus). The typical BA concentration in wine varies significantly, usually being 0.015 mg/L but it may rich up to 6 mg/L; while olfactory threshold is 1.5\u20133.5 mg/L. BA provides to wine aroma and taste of bitter almonds; BA concentrations higher than 3 mg/L are considered as a wine defect. AA in wine is often referred to as volatile acidity (VA) or vinegar taint and it can originate from many wine spoilage yeasts and bacteria and forms either as by-product of fermentation, or due to the spoilage of finished wine by acetic acid bacteria, Acetobacter and Gluconobacter. Further during the esterification with ethanol, AA produces ethyl acetate and together this fault compounds give to wine a smell of vinegar, paint thinner and nail polish remover. The typical concentration of acetic acid in wine is in the range of 100\u20131150 mg/L, the sensory threshold for acetic acid is 700 mg/L; in concentrations greater than 1.2\u20131.3 g/L it becomes to be unpleasant.ME arises as a reduction \u201coff-odour\u201d defect attributable to heavy sulphur compounds (as methionine), present in the must and providing an unpleasant odour of cooked cabbage. The ME formation occurs via methionine deamination and decarboxylation, followed by methional aldehyde formation, which is then enzymatically reduced to ME. ME perception threshold is 1.2 mg/L and higher concentrations are considered as a wine defect. IA is also called \u201cfusel oil\u201d and it is formed by yeast metabolism during alcoholic fermentation process from sugars and from amino acids (Erlich mechanism). IA is the major higher alcohol found in wines (more than 50%) and its concentration in wine has been reported in the range of 90 to 292 mg/L. IA may influence aromatic wine profile and hence its amount must be controlled. BA is the marker of the yeast activity in wine, it arises from enzymatic oxidation of benzyl alcohol by yeasts  one-leave-out cross-validation of calculated model was employed. The obtained results are given in Inspired by the obtained result, we have performed an assessment of real Negroamaro wines, in order to identify the possible presence of defect compounds in the threshold, alarm and/or defect amounts. On the 2cal = 0.994  and R2cal = 0.999  correspondingly, while the lower correlation coefficients were received for other wine fault compounds. Then the analysis of real Negroamaro wine samples was done in order to identify the presence of added defect compounds in the threshold, alarm and/or defect amounts. The adequate predictive power of e-Tongue was found for IA and AA, RFinally, we have focused on the possible Primitivo and Negroamaro wines classification in relation to four fault compounds, BA, ME, IA and AA, tested in two-component SIMCA models. Negroamaro wine samples with added fault compounds in three different concentrations  were used to create the models along the Coomans plot axis. Almost all Apulian wines were all classified as non-containing fault compounds in concentrations higher than the maximum permitted amount, In this paper, we have reported a potentiometric e-Tongue based on polymeric coatings obtained from pyrrole- and aminophenyl-substituted porphyrins for Apulian red wines recognition and defects qualitative evaluation. The results obtained indicate a potential utility of the developed e-Tongue system as an effective tool of wine brand uniformity control, permitting an inexpensive, rapid and accurate monitoring of several fault compounds in concentrations higher than the maximum permitted amount."}
+{"text": "Brown adipose tissue (BAT) dissipates energy to produce heat. Thus, it has the potential to regulate body temperature by thermogenesis. For the last decade, BAT has been in the spotlight due to its rediscovery in adult humans. This is evidenced by over a hundred clinical trials that are currently registered to target BAT as a therapeutic tool in the treatment of metabolic diseases, such as obesity or diabetes. The goal of most of these trials is to activate the BAT thermogenic program via several approaches such as adrenergic stimulation, natriuretic peptides, retinoids, capsinoids, thyroid hormones, or glucocorticoids. However, the impact of BAT activation on total body energy consumption and the potential effect on weight loss is still limited. Other studies have focused on increasing the mass of thermogenic BAT. This can be relevant in obesity, where the activity and abundance of BAT have been shown to be drastically reduced. The aim of this review is to describe pathological processes associated with obesity that may influence the correct differentiation of BAT, such as catecholamine resistance, inflammation, oxidative stress, and endoplasmic reticulum stress. This will shed light on the thermogenic potential of BAT as a therapeutic approach to target obesity-induced metabolic diseases. In recent years, adipose tissue has become a central focus of studies on the mechanisms involved in obesity-related diseases. In humans, this tissue is composed mainly of white adipose tissue (WAT), which stores energy in the form of triglycerides, and brown adipose tissue (BAT), which is responsible for thermogenesis. Much has been learned in the past decades about the pathophysiology of obesity in relation to WAT molecular deregulation . HoweverBAT mass and activity also change with age. In newborns, an increased BAT mass at birth has been related to decreased body fat accumulation during the first 6 months of life . In adulAlthough a few studies have described some characteristics of BAT in a mouse model of diet-induced obesity, the molecular mechanisms involved remain unclear. Recently, it was demonstrated that BAT from obese and hyperglycemic mice shows higher levels of inflammation (macrophages and T cell infiltration), endoplasmic reticulum (ER) stress, oxidative damage, and enhanced mitochondrial respiration activity . The resMost brown adipocytes originate from precursor mesenchymal stem cells (MSC) in the somites during embryonic development. These somatic multipotent precursor cells are characterized by the expression of certain transcription factors such as myogenic factor 5 (Myf5), paired box protein 7 (Pax7), and engrailed-1 (En1) . SkeletaAlthough the upstream factors that determine brown fat lineage remain unclear, the developmental origin of classical brown adipocytes has been studied in depth . Many trUcp1) expression during adipogenesis , has been described as an essential mediator of brown adipocyte commitment and terminal differentiation . EBF2 haic genes . HoweverPgc-1\u03b1, Prdm16  is a new critical candidate for progenitor cells to commit to brown fat lineage . BMP7 is, Prdm16 , as wellin vitro . Althoug of BMP7 . A multimination .An increase in BAT mass could emerge as a promising strategy against obesity and related metabolic diseases. Approaches could entail increasing the mass of active cells by promoting differentiation and proliferation or reducing apoptosis of precursor cells.18F-fluorodeoxyglucose and computed tomography (18F-FDG PET-CT) allows visualization of the tissue from a functional perspective, since the technique is based on detecting radioactive-labeled glucose uptake by the active tissue. Other imaging techniques, recently reviewed in Prior to the analysis of factors that regulate brown adipocyte recruitment in obese patients, it is important to note that we lack imaging techniques to unequivocally detect the presence of BAT in humans. The traditional combination of Cold-induced adrenergic stimulation is the best-studied intervention for activating the thermogenic program of BAT. Noradrenaline release stimulates UCP-1 expression and WAT lipolysis, which, together with glucose, supplies BAT with energy-rich substrates that are easily oxidable. KO mice models lacking key genes of BAT lipolysis have been used recently to demonstrate that cold-induced thermogenesis requires WAT lipolysis rather than BAT lipolysis .18F-FDG PET-CT (n = 5) and BAT activity was measured rather than BAT volume, as discussed above.Coupled with this observation, an increase in brown adipocyte recruitment has been reported in rodents since the 1960s  and moreG PET-CT . Even inG PET-CT . A similG PET-CT , althoug3K)  , mammali3K) , and ext3K) . Howeverferation .in vitro model to enhance brown adipocyte differentiation from an immortalized line of mouse MSC by reducing the incubation temperature from 37 to 32\u00b0C for 9 days Interrupting cAMP intracellular signaling. IKK\ud835\udf00 overexpression drives the activation of NF-\u03baB and phosphodiesterases, which reduces the availability of cAMP .(2)Reducing the synthesis of catecholamines. Traditionally, it was claimed that the obesity-induced phenotype shift from M2 anti-inflammatory macrophage to M1 pro-inflammatory macrophage was accompanied by loss of the capacity to express tyrosine hydroxylase , the rat(3)Enhancing the clearance of catecholamines. Growth differentiation factor-3 (GDF3), a member of the TGF-\u03b2 family, enhances the activity of monoamine oxidase in macrophages through activation of the inflammasome system. This promotes noradrenaline uptake and degradation .During obesity development, mitochondrial dysfunction due to increased substrate oxidation, together with the action of other oxidases, increases the production of reactive oxygen species (ROS). As a compensatory mechanism, the expression of antioxidant enzymes is upregulated via NRF2 and FOXO, which maintains the intracellular redox state. Oxidative stress occurs when excessive production of ROS overrides the antioxidant defense, causing macromolecule oxidation. In WAT, oxidative stress is one of the mechanisms that accounts for malfunction of the adipocyte, since it has an impact on insulin signaling or inflammation, among other factors . Obese mThe relevant role of oxidative stress in BAT recruitment lies in the dual effect of ROS as pro-oxidative molecules at high pathological concentrations when they surpass the antioxidant defense, and their action as second messengers in cell signaling processes at physiological levels .in vitro differentiation of 3T3-L1 adipocytes was accompanied by an increase in ROS formation. These results have been reproduced in other in vitro models of white preadipocytes . Briefly, the UPR tries to restore the function of the ER through three pathways: decreasing protein translation, enhancing protein folding, and triggering cellular apoptosis if the repair process fails. Key markers of UPR such as ese mice . Howeveregulated .A recent report uses two approaches to inhibit UPR in brown preadipocytes: incubation with 4-phenyl butyric acid (4-PBA), an inhibitor of ER stress, and siRNA for Xbp1. Both approaches drastically reduced differentiation and adipogenesis, which indicates the key role of the activation of UPR during differentiation. Furthermore, the incubation of brown preadipocytes with capsaicin, a component of red chili peppers, stimulates brown adipogenesis as well as the expression of UPR genes such as Xbp1 or Chop . More reThese results may suggest that reparative branches of the UPR must be activated for brown preadipocyte differentiation, in a similar manner to that previously observed in white differentiation . HowevermiRNAs are a type of single-stranded mRNA with a variable size ranging from 21 to 25 nucleotides. They play a key role in the regulation of gene expression, mainly by binding to the 3\u2032UTR of target mRNAs and blocking their translation. In the last few years, the role of several miRNAs in adipose tissue biology has been revealed . More spAlthough not completely understood yet, brown adipocyte differentiation involves a complex network of transcription factors, genes, and miRNAs that are apparently interrupted in obesity.The relations between the pathological basis of obesity and strategies to recruit active BAT are summarized in MA, MC-D, and MV participated in the conception of the study and in the preparation of the manuscript. LH and DS participated in the preparation of the manuscript and critically reviewed the final draft.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Hamate fractures are commonly divided into hook fractures and body fractures. The coronal fractures as a special form of hamate\u2019s body fracture are very rare injuries. Because of unspecific clinical findings and the mostly inconclusive x-ray imaging, these fractures are frequently overseen or misdiagnosed. This leads to further complications like secondary arthritis, persisting pain, and functional deficits in patient\u2019s wrist mobility. In our study, a collocation of coronal hamate fractures is analyzed and evaluated with respect to functional outcome after operative treatment and compared to the literature. Furthermore, we compare the strategies for diagnosis and treatment in our clinical center with those presented in the literature. Our standard in the initial diagnostic process is to obtain radiographs in an anterior-posterior, lateral, and 30\u00b0 oblique view of the wrist. For further diagnosis and preoperative planning, a CT scan of the wrist is obligatory. Due to the high occurrence of comorbidities  all patients in our cohort obtained operative treatment.In long-term post-operative evaluation, we present the following results:2 DASH) imposed with an average of 26.22 points (MD=22/ SD=11.31/MIN=18/MAX=52). None of the re-evaluated patients sorrowed for severe pain in rest. Four patients stated pain  after heavy burden . In exploring the range of motion of the operated hand the following results are obtained: dorsal extension: average 83.33\u00b0 (MD=85\u00b0/SD=3.54\u00b0/MIN=75\u00b0/MAX=85\u00b0), flexion: average 77.78\u00b0 (MD=80\u00b0/SD=4.41\u00b0/MIN=70\u00b0/MAX=80\u00b0). Additionally, a performance testing was conducted: fist clenching sign: complete without pain in 100%, pinch grip: complete in 77.78%, opposition digitus manus I\u2013V complete in 66.67%. The Manchester-Modified Disability of the Shoulder, Arm and Hand Score . The open approach has its advantages compared to a closed operative procedure and should always be intraoperatively considered as an operative expansion. The hamate bone consists of two different anatomic parts: the hook and the body. Proximally it forms an articulation with the triquetrum and distally it articulates with the fourth and fifth metacarpals . Fractures of the hamate bone are stated with 2\u20134% of all carpal injuries , [2], 33, [4],  and wereWithin Milch\u2019s classification, the coronal fracture of the body has not been considered. In further studies, other classifications have been introduced, such as Cain\u2019s or Ebraheim\u2019s classification with a more specific interest on body fractures of the hamate , 8], , . The coronal fracture in general appears mostly after punch injuries with a radial-abducted and approximately 10\u00b0 flexed hand , 12] ag ag12] agThe diagnostic is intricate because of few clinical findings and often inconclusive initial x-ray observances , 5], , , 8], , , 11], , , 16], , , 20], , , 24], , , 26]. . 26]. Moreover, even the treatment of coronal hamate-fractures is still unclear nowadays , 5], , . RadioloThis paper aims to show a more sensitive diagnostic approach as well as different surgical options in treating coronal fractures of the hamate. We present the largest case series ever published and performed a long-term follow-up of the patients treated in our centre, to create a more detailed view on this specific carpal injury.From 2009 through 2014, 19 cases of coronal hamate fractures were diagnosed in the Centre for Musculoskeletal Surgery of Charit\u00e9 Berlin, Campus Virchow Clinic. Initially patients were examined in the emergency unit and transferred to our specific outpatient clinic for hand surgery for further diagnostic and treatment afterwards. Retrospectively, patients\u2019 medical recordings have been reviewed. Therefore, age and gender, previous medical history, trauma history, accompanied injuries, operative technique , pre- and postoperative radiological images, outcome up to three months after operation, and healing rates were analyzed and summarized under short-term evaluation. Furthermore, a long-term evaluation was performed in nine patients. \u00ae) , 33, [4], . ConcernGenerally, hamate fractures have to be subdivided into hook fractures and fractures of hamate\u2019s body. Hook fractures were not discussed and included within this paper. Body fractures at all, are less frequent , 24]. T. T24]. TFor preoperative planning, we used Ebraheim\u2019s variant of subdivision because we hypothesized, that this might deliver the best information necessary for treatment considerations. Some main facts about the specific anatomy and over all biomechanical situations in the healthy ulnar carpal region and its articulation with the metacarpal bones are necessary to know to understand the trauma leading to a fractured hamate bone. The precise use of hand functions is essential for everyday-life and a substantive factor of human beings. This evolutionary asset is realised through the concise interaction of different anatomical structures and bonds in the human hand. Sangole et al. postulated, that the kinematics of the CMC joints are necessary to let the palm form a bow and therefore realising a precise grip , 30]. T. T30]. TEl-Shennawy et al. performed a biomechanical study with special regard to the carpometacarpal joints (CMC) and their differences. The working group concluded that the degrees of movement are increasing from radial to ulnar. Therefore, the CMC V possesses the greatest range of motion (ROM) with special regard to the ROM of the fifth CMC depending on the unaffected movement of the fourth CMC , 32], , . The reaFractures of the metacarpal bones IV and V as well as dislocations in the carpometacarpal joints can be accompanied by coronal fractures of the hamate , 2], , , 9], , , 11], , , 13], , , 15], , , 18], , , Coronal fractures of the hamate appear mostly after punching injuries or motor vehicle accidents , 4], , , 8], , , 11], , , 13], , , 16], , , 19], , , 21], , , 25], , , 35], , , 40], , . Other mTypically, the coronal fracture of the body of the hamate imposes with a dorso-ulnar pain, accentuating by manual pressing or passive movement, dorsal ecchymosis and swelling , 2], , , 6], , , 11], , , 13], , , 15], , , 18], , , 20], , , 26], , , 37], , , 43]. F. F43]. FAdditionally, the coronal fracture of hamate\u2019s body can be accompanied with either fractures of the fourth and/or fifth metacarpal bone or dislocations of the fourth and/or fifth CMC or a combination of both comorbidities. This causes a piano key phenomenon on the dorso-ulnar hand , 36] du du36] duIn most of our cases, the symptoms caused by accompanied injuries were predominant in comparison to those caused by hamate\u2019s fracture itself. Without specific clinical findings caused by certain comorbidities or complications of hamate\u2019s body fracture, the initial diagnosis is even more difficult. There is wide consent in literature, that the conventional x-ray images are incommensurate for diagnosing the coronal fracture of hamate\u2019s body , 6], , , 11], , , 14], , , 16], , , 20], , , 24], , , 26], , . Table 2However, some authors described the initial x-rays without any obvious indications for a hamate\u2019s fracture at all. This leads to an often-delayed diagnosis and therapy  , 5], , , 18], , , 21], , , 42], , . LangenhHowever, the right angle seems to be unclear as well: there are different opinions whether 15\u00b0, 30\u00b0 or 40\u201350\u00b0 delivers the information needed , 7], , , 18], , , 31], , . TherefoNonetheless, for further therapeutic planning, the performance of a computed tomography study is indispensable. Concerning this point, there is nearly unified consent in literature , 4], , , 8], , , 11], , , 13], , , 15], , , 17], , , In synopsis of all these findings and opinions concerning an adequate diagnostic process for coronal fracture of hamate\u2019s body, we would like to recommend the following algorithm: Primarily, history with special regard to trauma mechanism and the clinical examination  is necessary. The conventional x-ray analysis is supplemented with an additional 30\u00b0 supination oblique image, to provide better visibility of CMC joint. A computer tomographic scan completes the diagnostic approach and forms the basis of further therapeutic planning. There is no clear treatment algorithm published in current literature. All advice given so far is based on experts\u2019 opinions and either case reports or smaller case series with no statistical significance and plain evidence. Generally, there is a choice between a conservative or operative approach. The main point within this deliberation is, whether the coronal fracture of the hamate is supposed to be stable or unstable. By comparing the current literature, there is no clear consent towards this issue , 3], , , 11], , . WhereasThe conservative treatment can only be an option for coronal fractures without any dislocation at all. Gala et al. stated that this fracture type is exceedingly rare . AdditioReasons leading to the decision for operative treatment are mostly the dislocations in CMC joints, the instability of the fracture and included joint involvement , 7], , , 10], , , 12], , , 20], , , 37], , .The results of CRIF  against ORIF  are difficult to compare because of the lack of larger case series or randomized trials. Additionally, even the indication for either the one or the other procedure is not defined clearly and inconclusive comparing different studies. Mainly, the decision for either ORIF or CRIF is influenced by the habitus of the fracture, visible in the CT scan preoperatively. If there are only a few fragments and the fracture dislocation is considered to be reconstructable with a closed approach including K-wire osteosynthesis, and there are no co-injuries requiring an open treatment, CRIF might be a valid option. In accordance to Ebraheim\u2019s suggestions and his classification Figure 6 , we deciIn type A and type B fractures an ORIF with either screw or plate osteosynthesis was performed. Closed reduction and internal fixation was chosen for type C fractures to reach anatomical reconstruction again .The statements concerning follow-up examinations are very poor in current literature. Only Valente et al. described a functional impairment by evaluating deficiencies of 14\u00b0 in flexing and 20\u00b0 in extending CMC after CRIF , whereasBased on our own examinations, we hypothesize that there can be no clearly defined treatment algorithm for coronal hamate fractures at all. This is caused by a diversity of accompanied injuries, which demands for a high grade of experience to evaluate the situation of stability for each fracture individually. Plainly, in our opinion, there is no complete \u201cstable\u201d or \u201cunstable\u201d situation as hypothesized by some authors. Therefore, it has to be proven whether the fracture can be repositioned in a closed approach or if an open surgery is necessary. When performing ORIF, the surgeon has the choice between K-wire, screw, or plate osteosynthesis. As indicators for the different material serve the number of fragments, the extent of co-injuries, and their purport for stability in the ulnar carpal region and the expertise of the surgeon himself. Due to few case numbers, there was no option to perform an advanced subgroup analysis for comparing the outcome of these different material for osteosynthesis. Because of the rarity of hamate fractures in coronal plain, a multicenter and larger study has to be considered to generate reliable data for giving further advice. We can only say that the outcome of the patients treated and examined in long-term yields good results leading to the hypothesis that the different materials used are not the specific determining factors for functional outcome and patients\u2019 satisfaction.Limitations of this paper are the still small number of recruited patients and the amount of patient\u2019s non-response. This furthermore leads to a small number of subgroups (e.g. plate versus screw in the ORIF group). Therefore, a significant analysis as well as valid and reliable outcomes comparing these subgroups are not feasible. There is specific need for subsequent investigations especially in randomized controlled groups to create more objective data. However, the here presented case series of coronal hamate fractures is, to our knowledge, the largest ever published. The clinical examination as well as the surgical therapy was performed by the same physician, which prevents interrater bias. The use of clearly defined algorithms in diagnostics and therapy avoid arbitrary decisions in single cases.In hamate fractures, the standard radiographs including an anterior-posterior and a lateral view only, are mostly inconclusive and incommensurate for the definite diagnosis and evaluation. Therefore, the diagnostic approach has to be completed with an oblique view of the carpal region and a CT scan, providing the basis for therapeutic planning. The conservative treatment is not to be recommended, due to high complication rates such as chronic subluxations in CMC joints and absent in pain relief. The open reduction and internal fixation, in comparison to the closed approach, offers the following advantages: anatomical repositioning of the fractured hamate bone, physiological restoration of articular surfaces, and possible remedying of co-injuries. The good postoperative results, in short- and long-term evaluation, are justifying the open approach. Especially the \u201cadd\u201d case in the given list of cases shows the disadvantages of a conservative treatment in hamate\u2019s coronal fracture. The closed reduction and internal fixation remain an option for type C body fractures (according to Ebraheim\u2019s classification). Open reduction should always be considered intraoperatively as an operative extension.The authors declare that they have no competing interests."}
+{"text": "To evaluate the intra and interobserver reproducibility of a new system that assesses the three-dimensional humero-scapulo-thoracic kinematics using wearable technology in an outpatient setting. To obtain normative data with the system for scapular angular motions in three planes.The SHoW Motion 3D kinematic tracking system is a motion analysis system that uses wireless wearable non-invasive inertial-magnetic sensors to assess the three-dimensional kinematics of the shoulder girdle. The sensors are placed over the skin in the sternum, scapular spine and arm to precisely define angular motions of the humerus and the scapula with three Degrees of Freedom (DOF) for each segment.The system was used to measure the scapular angular motions in three planes  during two shoulder full-range movements (flexion/extension and abduction/abduction) in both shoulders of 25 healthy volunteers . In a first measuring session one examiner made two evaluations alternating with another examiner that made a third evaluation. In a second session, one week apart, the first examiner made a fourth evaluation.A mean curve was computed from the normalized data for each measurement to obtain normative data for scapular angular kinematics. Intra and inter-observer reproducibility was evaluated using Root Mean Square Error Estimation (RMSE) and Coefficients for Multiple Correlations (CMC).Both shoulders of the 25 volunteers were evaluated four times. The two hundred resulting kinematic analyses were pooled to get normative values for relations between humeral elevation angles and the three angular movements of the scapula.The system showed at least very good (CMC\u2009>\u20090.90) intra and inter-observer reproducibility for scapular tilt and upward-downward rotations both in flexion and abduction. For scapular internal-external rotation the results were acceptable (CMC\u2009>\u20090.75) but not as good, especially for the abduction movement. RMSE calculations showed consistently good reproducibility with RSME<\u20094\u00b0 for all three angles evaluated in flexion and abduction.The SHoW Motion 3D kinematic tracking system is a quick, reproducible and easy to use system for the assessment of scapular angular kinematics in healthy adults. The data obtained is similar to that obtained with other validated methods.Level II.The presented system is portable, easy to use and fast. It also has good intra and inter-observer reproducibility, making it a good tool to assess objectively scapular dyskinesis in the clinical setting. The normative data obtained is consistent with previous information available. In all ematics\u201d  to cuff ematics\u201d  or acromematics\u201d , there aProbably the main obstacle to correctly identify and manage scapular dyskinesis is the difficulty to assess it in a standardized, objective manner. Imaging studies are static and fail to identify the dynamic alterations. Physical exam has also limitations, and there is general consensus that clinical evaluation is limited to identifying whether there is an altered scapular movement pattern  and to a couple of clinical test .A more precise scapular kinematic assessment can be obtained in an experimental setting using motion tracking systems that either use cumbersome equipment , 2 or inThe objective of this study was to evaluate the intra and interobserver reproducibility of a new scapular motion tracking system, the SHoW Motion 3D kinematic tracking system\u00ae, that is specifically designed to be easy to use in clinical practice. Also, normative data for a healthy population was obtained.The SHoW Motion 3D kinematic tracking system  is a tool that uses motion tracking to monitor the motion pattern of the shoulder. The system includes five wireless miniature inertial measurement units (MIMU) Fig.\u00a0. Each MIFirst, the sensors are placed on the standing subject  according to an standardized protocol (the INAIL Shoulder and Elbow Outpatient protocol ). The anThe scapular angular kinematics (SAK) are dynamically visualized in three angle\u2013angle plots for each plane of humerus motion (flexion or abduction), in which the three scapulothoracic angular motions are plotted against humero-thoracic elevation or abduction Figs.\u00a0 and 3.FA standard measurement session  can be performed by a trained operator in less than 10\u2009min.Based on the recommendations of Eliasziw et al.  for goniTwenty-five healthy subjects  agreed to participate in this research study. The inclusion criteria were: adult age (>\u200918\u2009years old) and no previous history of shoulder or back pathology. The kinematic analysis of both shoulders was performed in all subjects. Since agreement between measurements does not depend on the side in which measurements are made, right and left shoulder of the subjects were considered independently for a total of 50 shoulders.Written informed consent to participate in the study was obtained for each subject. The study was approved by the Local Institutional Review Board Two examiners took part in data collection, both had extensive experience using the system. Four measurement sessions were completed for each subject: three by examiner A  and one by examiner B (named session B), following the A1-B-A2-A3 sequence. The actual examiner assigned to the role of A and B was randomized for each patient. Sessions A1, B1 and A2 were planned in the same day to investigate the \u201csame day\u201d intra and inter-observer reproducibility. Session A3 was acquired a week later to investigate the \u201cdifferent day\u201d intra-observer reproducibility. Between same-day sessions, all sensors were removed, making sure that no specific marks of the sensor placement remained, and re-applied by the new examiner, who also repeated the static calibration.For the measurement of SAK, each movement (FL-EX and AB\u2013AD) was split into an upward and a downward phase from 0\u00b0 to 120\u00b0. We analysed the SAK for shoulder flexion and abduction only from 0\u00b0 to 120\u00b0, to avoid data dispersion at higher humeral elevations, as previously reported . Each cuA mean curve was computed from the normalized data for each subject and for each angle\u2013angle plot. The mean curve was offset by the scapula rotation at resting position. Six angle-angle plots were obtained for each subject (three for flexion and three for abduction). The curves were averaged and merged to obtain the population prediction bands (\u00b1 2 standard deviations).MATLAB software  was used to perform the statistical analysis. The intra and inter-observer agreement of the data were assessed using Coefficients of Multiple Correlation (CMC) and Root-Mean-Square Error (RMSE).CMC are a very good alternative for reproducibility assessment of angle-angle plots such as those obtained here, as these explore the general similarities of the SAK curves, assessing the ROM, shape, offset and slope of the curves . CMC anaRMSE is one of the most frequently used measures of the goodness of fit of generalized regression models and is a well-validated method to assess reproducibility of systems that output data in a waveform , 21, 25.The prediction bands representing, for each angle\u2013angle plot, the mean curve (\u00b1 2 standard deviations) acquired over all the subjects analysed, are reported in Fig.\u00a0The intra-subject variability using the preliminary CMC calculation was higher than 0.90 in 81% cases for abduction and in 77% cases for flexion. Cases with lower values were excluded from the computation of the inter and intra-operator CMC. The values for all three CMC and for each scapula rotation are presented in Tables\u00a0For both flexion and abduction tasks, the RMSE, expressed in degrees, is reported in Fig.\u00a0The most important finding of this study is that the SHoW Motion 3D kinematic tracking system is a reproducible method to assess scapular angular kinematics during flexion and adduction shoulder movements in healthy adults. Normative data from 50 shoulders regarding angular kinematics in three planes was also obtained. This system has some advantages for the clinician: it is simple to use, requires only one examiner, uses equipment that is highly portable, and it is fast enough to be used in a typical clinical setting.Scapular dyskinesia has a significant role in many shoulder problems , 22, NevA lot of analysis (200 shoulder studies) were performed to present the scapular angular kinematics of a young, healthy population. The data presented in Fig.\u00a0Two statistical procedures were used to evaluate the reproducibility of the data obtained with the new system: CMC and RMSE. CMC are often used to test the reproducibility of scapular kinematics assessment systems , 21, 23.In our study the only scapular movement that had limited interobserver reproducibility was scapular internal/external rotation during abduction. This might be because internal/external rotation of the scapula measurement is more sensible to variations in the initial positioning of the sensors on the scapular spine with respect to the other rotations. Despite of this, the results (CMC for intraobserver around 0.75 and for interobserver around 0.60) are similar to those of Parel et al.  using anOne limitation of this study is that there is not a direct comparison with any previously validated system. Although the system is reproducible, we cannot confirm that the measurements follow closely those found with more complicated measuring systems. Despite of this the data presented in Fig.\u00a0Another limitation of this study is sample size, specifically regarding the obtention of normative data for healthy individuals. A sample size calculation for the reproducibility analysis was performed (something most studies in the field don\u2019t do ) but theThis study has limited clinical relevance as it does not prove the system is useful in identifying and characterizing specific shoulder problems. But it provides normative data from a healthy populations and confirms that the system can be used consistently by different investigators to obtain data that is consistent in time.The SHoW Motion 3D kinematic tracking system is a quick, reproducible and easy to use system for the assessment of scapular angular kinematics in healthy adults. The data obtained is similar to that obtained with other validated methods.Additional file 1 Video 1: a typical abduction and flexion measurement session using the SHoW Motion 3D kinematic tracking system."}
+{"text": "To increase our understanding of the psychological attachment styles in order to develop a preventative strategy that could potentially improve patients\u2019 perioperative outcomes. A comprehensive literature search was performed utilizing major electronic databases. The search was done from inception to January 2019. All of the relevant papers have been extracted and critically appraised in this review. Understanding the psychological aspects of patients is crucial for a satisfactory postoperative outcome. Depression and anxiety have been shown to increase both mortality and morbidity after coronary artery bypass graft surgery, independently of medical factors, although the behavioural and biological mechanisms are poorly understood. Psychosocial assessment is an important part of the pre-transplant evaluation process. The majority of individuals undergoing a transplant have significant psychosocial problems and can either be deferred or denied the transplant until these psychosocial issues are approached and managed. Psychological distress has been shown to affect long-term prognosis of cardiac patients and as a result, it should be addressed during follow-up of cardiac arrest survivors due to cardiac cause. Several studies have considered different approaches and analyses of different psychological attachments, and the understanding of such parameters perioperatively could possibly minimise perioperatively complications. Since psychological distress affects long-term prognosis of cardiac surgery patients, it should be addressed during follow-up of cardiac arrest survivors due to cardiac cause. Adult attachment styles can have an impact on cardiovascular disease and its relevant outcomes throughout the disease management process.Attachment theory draws on concepts from ethology, cybernetics, information processing, and developmental psychology and psychoanalysis in order to describe the way that children develop relationships through to adulthood-4. Patients with anxious or avoidant attachment styles are at a greater risk than those with secure attachment styles,6.In the recent years, several studies established direct relationship and impact of preoperative psychological distress on the perioperative morbidities and mortalities of patients undergoing cardiac surgeryBy increasing our understanding of the psychological attachment styles, we can begin developing a preventative strategy that could potentially improve patients\u2019 perioperative outcomes.-11. Bowlby\u2019s and Ainsworth\u2019s studies in childhood development led to the conclusion that a secure strong attachment to their primary caregiver provided children with the foundations required to form a \u2018securely-attached\u2019 adult,12. This so-called \u2018secure attachment\u2019 is critical to personal development, and failure to provide this in childhood results in a great deal of developmental energy to be expended by children in the search for stability and security. This can persist all the way to adulthood, resulting in non-secure attachment styles, as reported by Hazan and Shaver-15.In 1991, Ainsworth and Bowlby transformed the way we view the importance of parental relationships and their disruption through separation, deprivation, and bereavement,17.The main differing attachment styles are outlined in  as outlined in Adult attachment styles were summarised by Fraley and Shaver. Insecure attachment styles often lead to psychological distress, which in turn has a detrimental effect on health. Evidence suggests that accommodating and addressing patients\u2019 sources of psychological distress not only reduce preoperative anxiety by making patients feel well-informed, but also increase their sense of control over recovery, which manifests as a facilitated physical recovery and has even been shown to reduce the incidence of postoperative hypertension in cardiac surgery by 32.5%.As we are biologically driven to form attachments with others, it serves as a coping mechanism, allowing adults to overcome illness. Extensive efforts have been made to show the effect that emotional vulnerability has in the manifestation of medical disorders and in cardiovascular disease in particular. As our understanding of attachment style has evolved, we have begun to understand how poor attachment underpins the basis and instigates already well-known risk factors associated with cardiovascular disease such as: stress, anxiety, depression, anger, poor social support, marital status, educational level, poor coping mechanisms, including smoking and excessive alcohol intake, as well as other areas of lifestyle-24.Most cardiovascular diseases are preventable through controlling and treating predisposing risk factors Anxiously-attached individuals are more prone to experience this than other individuals. Depression is common in cardiac surgery patients, as physiological and behavioural factors such as endothelial dysfunction, platelet abnormalities, autonomic nervous system dysfunction, and reduced engagement in health-promoting activities link depression with adverse cardiac events. It influences not only the recovery period but may also lead to increased morbidity and mortality rates-30.Patients undergoing cardiac surgery have been reported to react to the operation as a realistic threat to life, and it can be seen as a life-changing event. Presence of anxiety may lead to coping through denial as a maladaptive mechanism to overcome this threat. For patients who may experience this sense of anxiety during pre- and postoperative periods, open conversation and psychological support may enable for this healing process to begin, and for the experience of surgery to be relabeled as a positive one.It is important to note that through knowledge of our attachment style, we are capable of dealing with the intense emotions, the pain of separation anxiety, and the grief that may have shaped our current worldview. It is possible to reappraise and reconstruct our inner representations of attachment relationships and shift our reaction to negative events. This is thought to be due to poor mentalization and deactivation of affect.Apart from consequential depression and anxiety, patients may also develop cardiac psychosis. Dismissive-avoidant attachments are over-represented in psychosis with associations being found between a dismissive attachment pattern and positive psychotic symptoms, negative symptoms, and poor engagement with services; in individuals who do however seek help, impaired recovery from these negative symptoms has been found. It is estimated that it has an incidence rate of up to 9%; this is potentially a preventable occurrence through preoperative psychiatric input, prompt diagnostic and therapeutic intervention, and implementing psychosocial means of support,36.Cardiac psychosis was described as early as 1806 by Corvisart as a triad of depression, restlessness, and irritability, which are accompanied by rising extremes of excitement alongside confusion, hallucinations, and delusions examined the association between attachment and inflammatory responses in 167 patients undergoing coronary artery bypass grafting (CABG) surgery. Inflammatory markers measured through blood samples included interleukin-6 (IL-6), C-reactive protein, and tumour necrosis factor-alpha. The study demonstrated an association between increased circulating levels of IL-6 postoperatively in patients with anxious attachment styles only, supporting the hypothesis that attachment anxiety is important in physical recovery from surgery.The attachment style may not also predict psychiatric sequelae after cardiac surgery, but also contributes to the length of in-hospital stay and postoperative inflammatory response. A study by Kidd et al.. Numerous studies have suggested that postoperative neuropsychological test performance is associated with cognitive deterioration five years post CABG,39. In contrast, other studies attribute the cardiac risk factors as the contributors for the deterioration and suggest that this decline is modest.CABG is one of the most scrutinized procedures in the literature relating psychology and cardiac surgery due to its association with neuropsychiatric sequelae.Despite this, it has been agreed upon that there is a cognitive deterioration after CABG surgery. The debate lies on whether this decline is due to psychological distress , and therefore it is potentially responsive to intervention, or whether it is due to the advancement of vascular pathology that potentially perpetuates the rate at which cerebral damage is sustained intraoperatively. This innate reaction has been studied over time by different authors and institutes internationally,5,42,43. While traditionally it was thought that these were the main contributors, there is evidence that surgical procedures initiate the attachment response, and thus it can directly influence the outcomes.Attachment styles determine the consequent reaction to a perceived or actual threat to the self, which can fall into three categories: personal threat , environmental threat , and relational threat (separation from partner). Despite these factors not directly affecting neuropsychological functions, depression confers a risk for delirium occurrence.Depression and anxiety have been shown to increase both mortality and morbidity after CABG surgery, independently of medical factors, although the behavioural and biological mechanisms are poorly understood.Unipolar depression is characterised by low mood and apathy, amongst other symptoms. The reported prevalence of unipolar depression among CABG surgery patients is thought to be between 15 to 20% reported occurrence of depression symptoms at 13% and 9% in a group of 124 CABG patients at postoperative one month and twelve months, respectively. With patient satisfaction and outcome being so interlinked, these findings call for a preventative approach to mental health in patients undergoing cardiac surgery.McKhann et al. explained how newly developed depressive symptoms result from the stressors of surgery that lead to a reactive-depression. In these cases, identifying depression is a complicated process as it may result in complicated somatic symptoms being experienced postoperatively.Furthermore, Peterson et al.. Their study showed that anxious-attachment style was a significant independent predictor of depressive symptoms at six to eight weeks following surgery (P=0.026). However, dismissive-avoidant style was not a significant predictor for the development of depressive symptoms (P>0.05). These results support the current literature evidence that suggests how levels of depression prevalence occur more frequently in individuals who are anxiously attached. It is, therefore, noted that there is strong association between anxious attachment, depression, and anxiety, which results from the negative working cognitive models that are activated during perceived times of threat, such as the perioperative period.Attachment anxiety has been shown to be a significant independent predictor of depression post CABG surgery in a study by Kidd et al.. This can perpetuate a sense of hypervigilance in individuals with insecure attachment styles, particularly those who are anxiously attached. If this is prolonged, negative views of sense and self are perpetuated, and depression and anxiety may ensue.The recovery period for CABG patients can be difficult due to increased dependence on others, restricted mobility, and therefore overall poorer quality of life emotionally. Taking these findings further, the study also showed that anxiety increases the odds for incident atrial fibrillation after CABG surgery . General anxiety disorder was also associated in a separate study by Tully et al. with acute in-hospital morbidity events such as renal failure, stroke, and myocardial infarction .Preoperative anxiety has also been associated with greater-all cause mortality  and it was independent of age, renal disease, concomitant valve procedure, cerebrovascular disease, and peripheral vascular disease in the study by Tully et al.. These individuals are as a result, by suppressing these means of seeking support, able to undergo acute stress episodes with low subjective levels of distress.It is of interest to note that dismissive-avoidant attachment did not predict the development of anxiety or depression. In certain ways, this is not surprising, as individuals with dismissive-avoidant attachment styles are able to deactivate strategies of affect regulation, which in turn results in inhibition of appraisal and monitoring threat, supressed thoughts, and suppressed proximity seeking behaviours of 62,665 CABG patients showed that 9% of cases with existing PTSD and major depression diagnosis preoperatively had a greater risk of in-hospital mortality than patients with either PTSD or major depression alone (P=\u22640.001). Other studies that simultaneously assessed both depression and anxiety symptoms showed that each negative emotional state foreshadowed a nearly two-fold increased risk of unplanned hospital readmissions.It can be speculated that dismissive-avoidant attachment is momentarily protective on mood during stress situations such as CABG surgery. However, it is important to note that failure of expression of dismissive-avoidant attachment may be due to the accustoming of repressing emotions, which may eventually be expressed in the forms of anger, apathy, and guilt due to a sense of vulnerability; and in extreme cases, it may present as post-traumatic stress disorder (PTSD). The study by Dao et al.It is, therefore, of paramount importance that we begin an open discussion with our patients regarding their mental health and we screen for depression that can occur postoperatively and plan their management accordingly, in order to provide adequate and on-time recovery from such major stress procedure.. With heart valve disease progression, once symptomatic, it severely restricts the performance of daily living, leading to feeling fragile and poor performance, which in turn could lead to depression over time.Heart valve disease is becoming a public health matter due to increasing life expectancy and new surgical approaches being developed of 648 patients undergoing either mitral or aortic valve replacements without CABG, 29.9% of the patients were found to be depressed at baseline. The unadjusted six-month mortality rate was 13.2% for depressed patients compared with 7.6% for non-depressed patients (P=0.03). In multivariable analyses, depression remained significantly associated with increased mortality . The findings in this study were consistent amongst patients undergoing aortic valve replacement, mitral valve replacement, and valve replacement without CABG.In a prospective study by Ho et al. of 52 patients who were not known to have history of depression and underwent elective valve replacement, 52% of the patients had scores consistent with depression when assessed on the geriatric depression scale questionnaire postoperatively. Higher rate of postoperative complications, lower haemoglobin concentration, and longer in-hospital stay were found to be significant predictors for postoperative depression . This study called for systematic screening and early prevention to be implemented in patients, considering the predictors to ensure better health outcomes.In a separate prospective observational study by Faria et al. of 10 patients undergoing heart valve replacement showed that patients reported overall a sense of suffering, weakness, and struggle to resume normality postoperatively.A qualitative study by Kikkenborg Berg et al.The statements used by the patients to explain that despite quantifiable improvements in their medical condition, their mental perception did not allow them to see the benefit of the procedure were notable: \u201cI improved my exercise capacity by 37% but I didn\u2019t feel it\u201d. Regarding bodily attention, patients complained of being overly aware of their body, working out to compensate for their scar or worrying about how their heart responded to activities. Despite these common themes, the study showed that over time patients gained vitality and returned to their daily life..For most patients, the psychological stress and adjustments associated with heart transplantation originates prior to undergoing the procedure, at the discovery of the life-threatening illness. They undergo a process of grief, as described by Kubler-Ross, in an attempt to process the information, which includes: denial of the severity of illness, anger of fate, bargaining behavior, such as exercise in the hope of improving cardiac health, and depression when nothing stops the progression of the disease.In adults, changes in income, social circumstances, relationships, and sense of self may precipitate this grieving process until the patient comes to acceptanceAcceptance as a transplant candidate involves recognizing their own mortality. The wait for an appropriate donor is often described by patients as \u201cinterminable\u201d. It has been found that the most overriding fear is that of dying before a donor heart is found; this in turn has a detrimental effect on everyday functioning, with some patients withdrawing from social relationships due to fear of leaving their home or areas they consider safe. Individuals with anxious attachment are more prone to this anxiety and depression, whilst individuals with dismissive-avoidant attachment are more vulnerable to developing PTSD.Hospitalization after heart transplants also comes with its own psychological challenges. The period of psychological adjustment can be divided into three distinct phases characterized by initial euphoria, followed by depression, and finally achieving a sense of pseudo-acceptance, whereby patients are emotionally fragile but their self-confidence increases. These stages are explained in more detail in  of 158 recipients and 142 family caregivers, a total of 10.5% of recipients met the Psychiatry Diagnostic and Statistical Manual of Mental Disorders-3rd Edition Revised (DSM-III-R) criteria for PTSD, and an additional 5% were probable cases. The DSM-III-R criteria are outlined in Post-transplantation psychological adaptation is complex. In a study by Stukas Jr. et al.. In a retrospective study by Schneekloth et al., a total of 164 heart transplant recipients were assessed to evaluate the outcomes of patients who initially had significant psychosocial problems but had addressed these and received a heart transplant. The study found out that after addressing the primary psychosocial issues before transplant, post-transplant length of stay, organ rejection, and survival rate were the same as of those without prior psychosocial concerns.Psychosocial assessment is an important part of the pre-transplant evaluation process. The majority of individuals undergoing a transplant have significant psychosocial problems and can either be deferred or denied the transplant until these psychosocial issues are approached and managed, a cohort of 72 heart transplant recipients were followed longitudinally during their first year post transplantation. The study aimed to identify pre-transplant and perioperative psychosocial factors associated with increased vulnerability to and maintenance of psychological distress postoperatively. The study found out that anxiety and depression were elevated in the early post-transplant period, relative to normative data. One third of patients remained with high distress levels at follow-up assessments. Factors such as a personal history of psychiatric disorders, a younger age, lower social support from primary caregiver, poor self-esteem, exposure to major life events involving loss, a poor sense of mastery, and use of avoidance to cope with health problems were susceptible to these high levels of distress. This study supports that dismissive-avoidant attachment may contribute to distress postoperatively in heart transplant patients. In anxiously attached individuals, distress may manifest due to low social support, which may leave them with a sense of \u2018abandonment\u2019 similar to that experienced in childhood, perpetuating their anxiety.In a study by Dew et al., a group of 50 heart transplant patients were evaluated to assess their coping mechanisms and how these related to their quality of life. The study found out that higher use of denial was associated with poorer mental health functioning. Denying the existence of a stressor is a common coping strategy of dismissive-avoidant individuals. This presented to be dangerous for post-transplant patients, due to their underreporting of symptoms, and this in turn led to a detriment in their quality of life.In a study by Burker et al.Based on the abovementioned findings from several studies, addressing each patient\u2019s psychological needs, we can aim to start reducing distress postoperatively in patients undergoing heart transplants..Survivors of cardiac arrest show high rates of mental illness, with more than 40% of them suffering from anxiety, 30% from depression, and 20% from PTSDAnxiety is a normal response following a major cardiac event; patients with anxious attachments are more prone to develop anxiety after major cardiac events due to their negative affectivity. In its extreme form, PTSD can result in detrimental patient outcomes. . These patients are also prone to avoidance, and so avoiding any triggers that could ignite a memory of the event, the hospital, medication and situations in which they can experience their heart rate increasing, such as sexual activity or exercise. Patients with previous dismissive-avoidant attachment styles are more prone to this avoidance response due to their repressive coping style.It has been shown that cardiac arrest survivors are prone to develop re-experiencing and somatization, manifesting as flashbacks of the medical interventions and surgical procedures, distressing dreams, recalling the defibrillators\u2019 shocks, and recalling the cardiac event to the point where it causes significant distress,64.It is estimated that the rates of this resulting PTSD vary across cardiac populations. Patients who have experienced a cardiac arrest have the highest rates of PTSD, followed by patients with implantable cardioverter defibrillators, and lastly patients who experience acute coronary syndrome.A meta-analysis of six prospective studies investigating the relationship between PTSD and cardiac disease, including patients free of cardiovascular disease at baseline, concluded that PTSD is independently associated with a higher risk for incident cardiovascular disease without  and with adjustment for depression .Furthermore, there appears to be a dose-response relationship whereby individuals with higher levels of distress are at considerably greater risk of cardiotoxic effects; these results have been widely reproducible in other studies,69.A prospective study of 1059 women demonstrated that those with more than five symptoms of PTSD were at 3.21 times the risk of incident coronary heart disease compared to those with no symptoms. A better outcome was reported in an Australian study of 106 survivors five years after cardiac arrest where 84% of patients were living at home independently, and only 11% reported marked or severe disability. Despite this, 71% of patients reported varying degrees of anxiety.In regard to other psychological and psychiatric sequelae, in a retrospective Dutch study of 63 survivors with a mean follow-up of three years after open heart surgery, 74% of patients reported low participation levels in society, over 50% of patients reported severe fatigue, 38% reported feelings of anxiety/depression, and 24% of patients reported a decreased quality of lifeTherefore, since psychological distress affects long-term prognosis of cardiac patients in general, it should be addressed during follow-up of cardiac arrest survivors due to cardiac cause.Understanding patients\u2019 perception of recovery following open heart surgery is of paramount. Despite improvements in cardiac surgery techniques and practice, patients' reactions to these events appear to remain unchanged. Introducing a lifeworld perspective based on patients\u2019 own experience, attachment style, and expressions can not only improve patients\u2019 perception of recovery but also overall patients\u2019 outcomes in short and mid-terms."}
+{"text": "This suggests that only changing food consumption practices will not suffice towards achieving carbon reduction targets: Systemic changes to food provisioning processes are also necessary. Finally, men with higher education had the highest dietary GHG emissions per gram of food, and the highest disease burden scores. Win\u2013win policies to improve health and sustainability of Swiss diets would increase whole grain consumption for all, and decrease alcohol and processed meat consumption especially for men of higher education levels.The first Swiss national dietary survey (MenuCH) was used to screen disease burdens and greenhouse gas emissions (GHG) of Swiss diets , with a focus on gender and education level. The Health Nutritional Index (HENI), a novel disease burden-based nutritional index built on the Global Burden of Disease studies, was used to indicate healthiness using comparable, relative disease burden scores. Low whole grain consumption and high processed meat consumption are priority risk factors. Non-processed red meat and dairy make a nearly negligible contribution to disease burden scores, yet are key drivers of diet-related GHGs. Swiss diets, including vegetarian, ranged between 1.1\u20132.6 tons of CO Food systems  are major drivers of impacts on human health and the environment. In response, there is a growing need for food system transformation, with shifting diets as a key lever of transformational change. Specifically, in developed countries like Switzerland, shifting consumption away from animal-based foods  and towards more plant-based foods  is one of the main recommendations to meet sustainability goals from both health and environmental perspectives ,2. In adThere remains a major knowledge gap regarding how scientific information on health and sustainability influence perception and actual practices of consumers . When itThe aim of this study is to assess the actual practices of diets that are perceived to be healthy and sustainable, rather than assuming hypothetical substitutions  or recommended diets . To do this, we consider recent sociological research uncovering the pervasive perceptions of healthy and sustainable eating in Switzerland  and the Through this work we aim to address the following questions: (a) What are the comparative magnitudes of disease burdens and GHG related to the average Swiss diet and other self-reported diets  in Switzerland? and (b) What factors  are the main influencers of these impacts for various dietary patterns? Through answering these questions, we discuss the evidence for targeted policies to reduce diet-related disease burden and decrease GHG through dietary shifts in Switzerland.A first methodological step was to bridge the gap between the perceptions of healthy and sustainable diets in Switzerland versus what is actually practiced. To do so, we identified dominant \u201cfood prescriptions\u201d, i.e., any guideline or recommendations stating what or how to eat, in relation to health and sustainability in Switzerland through previous work by sociologists . The purIn order to match closely the existing perceptions for healthy and sustainable diets in Switzerland, we compared these prescriptions and emerging trends to the data available on self-reported practices related to \u201cspecial diets\u201d in the first Swiss national MenuCH nutrition survey  by the SPrevious work by Chatelan et al. (2017)  used MenFurthermore, because parallel sociological research by the authors suggests that in Switzerland education level  as well as gender may influence dietary choices, we also distinguished diets reported by people of three levels of education , and by declared binary gender (men and women). These various categories are all referred to as \u201cdiets\u201d. In summary, in this study the following diets were assessed for both men and women: Average, vegan, vegetarian, slimming, gluten-free and different education levels were also investigated. Results were sensitive to the type and quality  of meat as reported in the survey.The average grams per day of each reported unique food name were calculated for each diet from MenuCH data. Life cycle inventory data, which are internationally recognized data used within LCA, were used as the basis to estimate the GHG of each food . Life cycle inventory data are a quantitative description of the inputs  and outputs  of agricultural processes . A complThe Quantis internal life cycle inventory database as of 2018  and ecoiThere were two main methodological steps to link nutritional survey data to life cycle inventory. As described in more detail below: First, all of the food items within MenuCH were matched to life cycle inventory databases, and second, the discrepancy between the produced to consumable food amount was resolved . The life cycle inventory database entries were then run through SimaPro software to quantify the Global Warming Potential based on a 100 year time horizon (GWP100) in accordance with the IPCC 2013 AR5 report [In MenuCH, 1519 unique food names were reported . These food names were matched to the life cycle inventory databases. Composite foods  were matched to a maximum of 3 database entries representing major ingredients using simplifying assumptions for proportions. It was not within the scope of this study to perform a full analysis of the food production balance in Switzerland , and in any case life cycle inventory data availabilities to complement such an analysis are limited. Therefore, datasets were selected to represent European or global trade-based market averages, and not necessarily Swiss production. When there were multiple life cycle inventory entries that could be associated with a food name , the most downstream life cycle inventory entry \u201cclosest to the consumer\u201d was preferentially selected. Due to the data available and the inherent differences between how foods are consumed in practice, the system boundaries of every life cycle inventory entry was not the same , but represented the best available life cycle inventory data to match the item being consumed. Due to data unavailability we did not attempt to account for missing data across the life cycle of food items, and in this way the reported environmental impacts should be seen as an indication of the greenhouse gas emissions related to producing food to supply the swiss diet, and not the entire \u201cfood system\u201d impacts which include e.g., transformation, transport and logistical (storage), and cooking impacts. The implications of this methodological choice on the result magnitude are further discussed in the discussion and limitations section of the study.After matching to life cycle inventory, the next step was to resolve the difference between consumed amounts with the corresponding produced amount. Losses across supply chains , inedible food parts , and moisture gains/losses from cooking require adjustments of the consumed food quantity to obtain the produced quantity. To adjust for losses (before retail) and wastes (at retail and by consumers) we used the supplementary data from Beretta et al. (2017)  on food To investigate the relative magnitude of disease burden we used the Health and Nutritional Index (HENI), a disease burden-based nutritional assessment tool built on the work from the Global Burden of Disease study series . HENI quWe then calculate for each diet, the reported cumulative intake in each risk component  by multiplying the daily consumption of each food item  by its risk component profile  and summing up across all food items consumed in the considered diet. The result of this is available in For each diet, we finally calculate the disease burden associated with each risk factor by multiplying each of the 18 dietary risk factors by the difference between the reported cumulative intakes and the corresponding theoretical minimum risk levels (TMRL) considered in the global burden of disease work. TMRLs indicate the intake level for each risk factor that theoretically leads to no increase in disease risk. TMRL provides minimum level of risk for both diets \u201clow in\u201d certain elements  and for diets \u201chigh in\u201d certain elements (where below the TMRL there is no incurred risk that can be quantified).To determine the HENI-relevant food groups and nutrients profile for each of the 1519 unique food names in MenuCH we first identified food groups corresponding to each food-based dietary risk factor using the subcategories listed directly in MenuCH . We then determined the nutrient profiles for each nutrient-based dietary risk factor using the default nutrition data per 100 g of each food provided by MenuCH. Lastly, for food groups and nutrients unavailable in MenuCH data  we matched the food names in MenuCH to the closest name in the United States (US) National Health and Nutrition Examination Survey (NHANES)  which inn = 158) and especially vegans (n = 15), the diets assessed in this study should only be seen as indicative and not as statistically significant or representative of what various sub-populations are consuming across Switzerland.As for the composition of these diets A,B the aOur analysis revealed that self-identified diets may not be aligned in practice with what is generally recognized as the dietary prescription; for example, a subset of self-reported vegans  and vegetarians  reported consuming dairy and meat respectively. Sixteen out of the 104 surveyed vegetarians reported eating meat leading to an average of 11 g per person per day (g/p/d). One self-identified vegan participant reported eating 56 g of processed meat, which led to a group daily average of 4 g/p/d, and 13 out of 15 vegan survey responses reported dairy consumption leading to an average of 40 g/p/d. It is unclear if these practices represent an issue or misunderstanding with the survey or flexibility between self-declared dietary preferences and actual practices. Furthermore, other observed differences in vegan and vegetarian diets  suggest that the actual practices for these diets may be tied to lifestyle choices that are not restricted to only consumption of animal products.Slimming diets contained more animal products than average, while gluten-free diets contained more fruits and vegetables than average and overall less mass, dry mass, and dietary energy than slimming or average diets. Total consumptions slightly increased with education level, with slightly higher intakes of legumes, nuts and seeds, whole grains, and dairy products such as yogurt and cheese (but less milk). Analysis of dietary patterns by gender showed that men consumed nearly double the amount of meats and cereals compared to women. Men also reported drinking more sugary sweetened beverages and alcohol whereas women drank more teas and herbal infusions. Men of higher education levels also tended to eat more expensive cuts of meat , for example with the secondary education level actually consuming slightly less red meat than primary education level, but higher proportion of more expensive cuts . We foun2e per person per year (tCO2e/p/y) with 1.7 tCO2e/p/y for food items and 0.4 tCO2e/p/y for beverages. For the average diet, red meat and dairy (solid and liquid) were each 20% of the total GHG footprint, with other meats (including fish) contributed another 15%, meaning animal products contributed to about half of the average diet GHG footprint. Other significant contributors were cereal products (10%), and alcohol (10%). The total carbon footprint of all diets and the relative contribution of various food and beverages are depicted in GHG results are summarized in 2e/p/y) and vegetarian (1.4 tCO2e/p/y). Vegan and vegetarian diets had similar associated GHG, however explainable by different types and quantities of food consumed.The diets with the lowest carbon footprint were the average vegan  had a larger range than diets reported by women (1.1\u20131.7 tCO2e/p/y), where for diets other than vegetarian and vegan for women had a more restricted range from 1.6\u20131.7 tCO2e/p/y whereas for men these same diets ranged from 1.9\u20132.5 tCO2e/p/y. The larger range observed in the male diets was largely sensitive to the amount and type of meat consumed, where for example the men in the secondary education group consumer larger amounts of more expensive meat cuts leading to a higher impact per kilogram of meat than in the primary education level. Beverages also played a role, where for example none of the male vegans  reported consuming alcohol, leading to a substantially lower footprint for the beverages consumed by male vegans.The impacts of diets reported by men . Processed meat consumption by the average man was associated with an increased risk of 24 \u03bcDALY/p/d which can be interpreted as approximately 13 min of healthy life lost each day; increased risks were then followed by low whole grains, low nuts and seeds, and high alcohol. The associated health benefits with eating fruit and vegetables, whole grains, legumes, etc. were similar among men and women, where women consumed only slightly more beneficial foods than men overall. When adjusting by the total quantity of kilocalories consumed (data not shown) there is nearly no difference between the disease burden scores of men and women, 0.054 and 0.055 \u03bcDALY/kcal consume respectively, and the largest benefit is seen for vegans having only 0.024 \u03bcDALY/kcal consumed.The magnitude of possible improvement between the average diet and global burden of disease reference diet  was ranked for each food category  accordinThe novel contribution of this study is providing an analysis of self-reported practices in a given population to identify priority (and non-priority) policies that can simultaneously improve health and GHG emission. Similar work has been performed recently, for example for the United States . A key nThe priority levers of change identified in this study  are not key aspects of the current discourse at various stakeholder and scientific events attended by the authors or the studied \u201cpro\u201d or \u201cno\u201d meat public discourse in Switzerland which tends towards specific moral and emotional messaging. Generally discourse around food tends to focus on processed foods, and \u201cpro\u201d or \u201cno\u201d meat consumption in general. Emotional messaging and debate regarding meat  consumption in Switzerland tends to use associations of national pride to promote meat and cheese, or use imagery leading to disgust to denounce animal husbandry . FurtherIn this study we first related sociological findings on predominate perceptions of healthy and sustainable diets (referred to as \u201cprescriptions\u201d) in Switzerland  to the dIn relation to the first scientific question we aimed to address about the comparative magnitudes of health and environmental impacts, we found that vegan and vegetarian men had the lowest disease burden scores, and men with secondary education had the highest disease burden scores . Given tFor our second research question on most influential factors, disease burden scores for vegetarians, vegans, gluten-free, and other special diets were largely influenced by whole grains, nuts and seeds, processed meat, and alcohol. This finding, along with findings regarding differential use of bottled water between special diets , suggests that there may be additional consumption choices important for health and/or sustainability performed by people self-declaring special diets, but that are beyond the definition of the special diet. Future study could be expanded to understand what drives this larger set of practices or lifestyle choices for example to also consider people\u2019s mobility or social interactions.As our results are based on the robustness of the global burden of disease study and epidemiological evidence, which is evolving, the results of this study would change if there are changes in the global burden of disease results due to new evidence or interpretation of evidence.  The global burden of disease work does not include risk factors where there is a lack of conclusive epidemiological evidence e.g., there is insufficient evidence to consider risks from general sugar consumption (apart from beverages) , as wellA limitation of using disease burden metrics is a lack of insight on nutritional adequacy. As a parallel analysis we also checked quantities of key nutrients that have been raised in other studies as potentially inadequate in vegan and vegetarian diets, specifically protein and vitamins B2 and B12 . We did Screening the comparative magnitudes of GHG demonstrated that vegan, vegetarian, and gluten-free diets all had similar low impact profiles , and the average diet reported by men having the highest GHG. Based on 15 respondents, vegan diets had the lowest GHG emission and disease burden scores per gram and per kilocalorie, and this finding held true even given higher amounts of losses and wastes in supply chains related to the products consumed in these diets. We were unable to assess differences in household food waste between different diets which could be substantial given the finding that the prescriptions may be associated with other lifestyle choices. One unexplainable finding was that the vegans according to the MenuCH data reported to consume more mass and kilocalories than other diets. Possible explanations could be a statistical anomaly due to low sample size , other lifestyle choices such as increased physical activity, or physiological aspects e.g., feeling of satiation. It was not the goal of this study to do a robust statistical analysis to understand the margin of error on the Swiss MenuCH survey results which has been done in other studies  albeit n2e/kg soy product consumed due to losses and wastes across the supply chain  they were modeled as soy, with a relatively high impact for a plant-based food with 6 kg COly chain . This vaDairy and beef have high importance historically and currently in Switzerland. Dairy and milk were substantial drivers of GHG emissions, even for self-reported Swiss vegetarian diets and vegans . In our study further increasing dairy consumption was not found to be a major lever to improve health based on the current evidence used to create global burden of disease risk factors related to dairy and also due to the relatively high consumption of dairy in Switzerland. This finding is in contrast to media reports that the data from MenuCH show a need to increase dairy consumption in Switzerland to improve health metrics . Beef prAs for education levels, a recent US study suggested people with higher education have substantially higher diet-related GHG . In our 2e/p/y. The differences across diets for life cycle processes such as food processing, refrigeration, cooking, and packaging related to various consumer practices could be interesting to investigate in a separate study.The overall magnitudes of GHG of all the diets are well-aligned with previous findings for average and special diets in other European countries . As the 2e/p/y suggested by the federal office for the environment in Switzerland [2e/p/y suggested by other sources reach the sustainable development goal of not exceeding a 1.5 degree temperature rise by the year 2030. These targets include all forms of consumption, such as mobility, housing, and material goods, and food [In all, especially given this study represents the impacts of food production and not all related dietary impacts , this study demonstrated that all diets, including diets with restricted animal product consumption (vegan and vegetarian), would still far exceed the limit of 0.6 tCOtzerland , as welland food , shiftinand food . If reduThis study was also able to identify areas where the available survey data were not aligned with the data needed to assess healthy and sustainable eating in Switzerland. Specifically, there were insufficient data on the location and mode of production of the foods consumed in order to make any claims about organic or local diets. Including such data in a dietary survey may not be practical and pose additional burden on the participants and surveyors, thus identifying priorities related to specific to mode and location of production, such as biodiversity loss, should likely be targeted by research that is not dependent on survey data. As a separate finding, there were no data regarding the contents of whole grain and omega-3 fatty acids within the products listed in the MenuCH survey, which are key dietary risk factors. In order to obtain the consumptions related to these risk factors, we needed to match MenuCH to a secondary source introducing substantial workload. A recommendation would be to include omega-3 fatty acids and most importantly whole grains in future dietary surveys.The results in this study are intended to be interpreted as screening values to indicate generally beneficial directions or \u201cwin\u2013win\u201d situations for national policy advice on healthy and environmentally sustainable diets, and should not be used as individual medical advice . Sources of uncertainty include the Swiss national survey (MenuCH) data which are reported food consumption from memory recall  ,52, and As the first study to screen the first Swiss national survey (MenuCH) in relation to comparative health and environmental metrics, we contribute to a novel methodological approach and findings relevant for future research and policy-makers interested in transitions to healthy and sustainable diets. The methodological approach started with sociological research on prescriptions, or guidelines for conduct around \u201chealthy and sustainable\u201d food consumption in Switzerland. We then related food consumption in the MenuCH survey to relative health and environmental metrics.2e capita per year sustainability target [The key findings are: First, and similarly to other research on European diets, all Swiss diets (including vegetarians and vegans) are far above the suggested 0.6 tonnes COy target , which iIn relation to further study, we recognize limits of the MenuCH data in relation to accounting for consumer perceptions and practices regarding healthy and sustainable diets. In particular, \u201clocal\u201d diets which are often seen as a proxy for healthy and sustainable diets in Switzerland, were not able to be assessed although general evidence to date have not demonstrated that eating \u201clocally\u201d is especially material for GHG and health. Finally, MenuCH is a snapshot in time of current diets and may not be able to tell us much about people\u2019s actions when they shift diets; a longitudinal approach could shed more light on practices and how they may change.A \u201cwin\u2013win\u201d policy recommendation would be to increase what is both healthy and less impacting in diets at the expense of what is not healthy and more impacting, with a focus on men\u2019s diets and decreasing processed meat and alcohol, while increasing whole grains and nuts and seeds. Decreasing dairy and red meat  also offer a GHG benefit with a relatively small influence on health scores. Given the complexity of food consumption and its interrelation with other aspects of society, a food policy forum in Switzerland could help engage discussions on how to implement policies and interventions, for example in relation to other dimensions of everyday life, such as mobility, the world of work, and eating out."}
+{"text": "Interest in percutaneous mitral valve repair has increased during recent years. This is mainly driven by the significant number of patients being declined for mitral valve surgery because of a\u00a0high risk of surgery-related complications or death. In this subset of patients, percutaneous edge-to-edge repair using the MitraClip device  has become an established treatment option, proven to be safe, efficient and associated with improved functional status. In contrast to primary mitral regurgitation (MR), clinical outcomes after mitral valve surgery appear to be less favourable as regards secondary MR due to heart failure. In the MITRA-FR and COAPT trials, patients with moderate to severe and severe secondary MR with reduced left ventricular function received either medical treatment (control group) or MitraClip implantation plus medical treatment (device group). Results were conflicting, with only the COAPT trial showing better clinical outcomes in the device group. However, both trials are now seen as complementary and provide useful information especially regarding patient selection for MitraClip therapy. The goal of this review is to delineate which subset of patients with secondary MR will potentially benefit from percutaneous mitral valve repair. Mitral regurgitation (MR) is the second most frequent indication for valve surgery . WorldwiMVS in primary MR has been extensively studied. As we know, in this group of patients the indication for surgery has been clearly defined with better clinical outcome compared to medical treatment alone , 6. HoweImportantly, about 50% of the patients with an indication for MVS are considered not suitable for surgery. These patients are denied surgery due to their age, poor LV function, frailty and significant co-morbidity . In thisMore than 70,000 implants have been performed to date worldwide and a\u00a0large amount of outcome data is available. However, these data are mainly from observational studies whose value is too limited to support clinical indication as in guidelines.Recently, the findings of two eagerly awaited randomised controlled trials (RCTs) have been published. Both MITRA-FR and COAPT investigated the role of MitraClip treatment in patients with reduced LV function and ischaemic or non-ischaemic secondary MR, who remained symptomatic  .p\u202f=\u20090.004). Because experience of operators in this study was limited, a\u00a0second clip was underused. An improvement in quality of life, NYHA functional class and LV dimensions could nevertheless be seen at 1\u00a0year in the MitraClip group with no significant difference between the two groups. Moreover, superior safety was seen in the MitraClip group compared to patients undergoing surgery [p\u202f=\u20090.01). The difference was caused by a\u00a0higher rate of MR grade 3+/4+ and more MVS being performed in the first 6\u00a0months after MitraClip implantation. Beyond 6\u00a0months there was no difference between these two endpoints. These results confirmed the durability of the MitraClip system [The EVEREST\u00a02\u00a0study was the first RCT in which patients underwent either MVS (repair/replacement) or percutaneous MV repair (MitraClip system). Importantly, high-risk patients for cardiac surgery were excluded from this study and only 27% of these patients had secondary MR. At 1\u2011year follow-up, MR grade \u22653 was more frequent in the device group  and moderate to severe MR or severe secondary MR receive either medical treatment (control group) or undergo MitraClip implantation plus medical treatment (device group) , 15.2 assessed by echocardiogram. Furthermore, these patients had a\u00a0left ventricular ejection fraction (LVEF) between 15% and 40% and symptoms of heart failure (NYHA class p\u202f=\u20090.53)  \u226530\u202fml/beat or an effective regurgitant orifice area (EROA) of \u226520\u202fmm2 and/or RV of \u226545\u202fml. Severe MR was defined by an EROA of \u226540\u202fmm2 and/or a\u00a0RV \u226560\u202fml.In the COAPT trial, patients with moderate to severe (grade\u00a03+) or severe (grade\u00a04+) secondary MR were included. Moderate to severe MR was defined by an EROA of \u226530\u202fmmp\u202f\u2264\u20090.001). All-cause mortality was also significantly lower in the device group . Additional secondary endpoints were also in favour of the device group: quality of life, functional capacity, MR grade and LV remodelling. These results could be reproduced in all subgroups, including patients who had ischaemic or non-ischaemic cardiomyopathy. MR severity, LV function and volume also did not influence the outcomes. Lastly, 96.6% of the patients were free of device-related complications, confirming the safety of the MitraClip system.All of these patients had a\u00a0LV function between 20% and 50% and heart failure symptoms  of the patients had an EROA of <30\u202fmm2. In contrast, in the COAPT trial, mean EROA was 41\u202fmm2. Only 14% of the patients had an EROA of <30\u202fmm2. From these findings we can conclude that the definition of severe MR differed between the two studies. The MITRA-FR trial used the 2017 ESC guidelines of valvular heart disease to evaluate MR severity. As we know, severe MR is present when EROA is \u226540\u202fmm2 and/or when RV is \u226560\u202fml. However, for secondary MR it was proposed that these criteria should be less strict due to a\u00a0substantially higher mortality risk in patients with secondary (ischaemic) MR with an EROA \u226520\u202fmm2 or a\u00a0RV \u226530\u202fml [2 and/or a\u00a0RV \u226560\u202fml. As a\u00a0result, when applying the original MR grading system, the majority of the patients in the MITRA-FR trial had moderate MR. More specifically, only 16% of the patients in the MITRA-FR trial had an EROA \u226540\u202fmm2 vs 41% of the patients in the COAPT trial.First, the sample size of the COAPT trial were larger (614 vs 304 patients). Secondly, there are obvious differences in echocardiographic definition of severe MR, optimal usage of heart failure medication and patient selection between these two studies \u201325. In tV \u226530\u202fml . In the Another difference can be found in the heart failure medication used. In the COAPT trial, heart failure medication was controlled by heart failure specialists from a\u00a0central committee to ensure that maximum tolerated doses of the medication were taken by the patient before randomisation. Only patients on maximum tolerated doses of heart failure medication were enrolled in the study. When indicated, resynchronisation therapy and/or coronary revascularisation was applied. As a\u00a0consequence, medication doses were infrequently changed during follow-up. In the MITRA-FR trial, although usage of heart failure medication was guideline-directed, we can assume that not all patients received an optimal dose of heart failure medication. Thus, the use of heart failure medication showed more variability in the MITRA-FR trial, which may more closely represent real-world practice. No details were available about the titration of the medication dose during follow-up.Also, technical success was higher in the COAPT trial with less residual MR grade \u22653\u00a0compared to patients in the MITRA-FR trial (5% vs 9% post-procedure and 5% vs 17% at 12-month follow-up respectively). An important detail is that a\u00a0second clip was placed more frequently in the COAPT trial (55% vs 45%). Nonetheless, these results should be interpreted with the knowledge that different echocardiographic parameters are used in grading MR and that substantial echocardiographic data are missing at 1\u2011year follow-up in the MITRA-FR trial.When looking at additional echocardiographic parameters, it is essential to acknowledge that patients with severe pulmonary hypertension (systolic pulmonary artery pressure >70\u202fmm\u202fHg) and moderate to severe right ventricular dysfunction were excluded from the COAPT trial, but not from the MITRA-FR trial. In addition, a\u00a0left ventricular end-systolic dimension (LVESD) of >70\u202fmm was an exclusion criterion in the COAPT trial. The mean left ventricular end-diastolic volume (LVEDV) of patients in the MITRA-FR trial was considerably higher than the mean LVEDV of patients in the COAPT trial (252\u202fml vs 192\u202fml). The rationale behind the exclusion of patients with a\u00a0severely dilated LV in the COAPT trial was that these patients were considered to be beyond MV repair. This is based on previous studies which have concluded that severe LV dilatation (left ventricular end-diastolic dimensions of >65\u202fmm and/or LVESD >55\u202fmm) and severe LV dysfunction (LVEF <20%) are associated with less reverse remodelling and a\u00a0higher mortality rate , 28.2 and/or a\u00a0RV \u226560\u202fml) and a\u00a0LV which is not severely dilated (LVESD \u226470\u202fmm).The COAPT trial confirmed that MitraClip implantation is favourable in a\u00a0specific subset of patients: heart failure with reduced ejection fraction (HFrEF) patients treated with optimal heart failure medication, with severe secondary MR (defined by an EROA of \u226540\u202fmm2) with a\u00a0dilated LV on echocardiography (mean LVEDV of 252\u202fml). Thus, the severity of MR could be fully explained by the amount of dilatation of the LV. In these patients the severity of MR is proportionate to the degree of LV dilatation. In comparison, patients in the COAPT trial had a\u00a0mean EROA of 41\u202fmm2 with less severe LV dilatation (mean LVEDV 192\u202fml). As a\u00a0result, the severity of MR was more than would be expected from the degree of LV dilatation and is therefore called disproportionate MR.Grayburn et\u00a0al. proposed a\u00a0new conceptual framework in response to these trials . It was In cases of proportionate MR, the disease primarily involves the left ventricle and it is known that, in these patients, heart failure medication and resynchronisation therapy will lead to better clinical outcomes. Commonly, a\u00a0reduction of the MR will be seen due to reversal of LV remodelling. Most importantly, a\u00a0MV intervention will not be more advantageous in this type of patients. LV disease is in this case expected to determine the poor prognosis. On the other hand, in disproportionate MR the primary disease can still be found in the left ventricle. As a\u00a0result, heart failure medication and resynchronisation therapy remain effective in these patients. Nevertheless, due to the fact that injury of the MV is disproportionate, the severity of MR is more than would be expected. Therefore, it seems logical to believe that percutaneous MV repair will benefit this type of patient.2 is associated with mild MR. Hence, an EROA of \u22650.3\u202fcm2 is needed for MR to be classified as severe. Moreover, in patients with more severe LV dilatation (LVEDV >300\u202fml) an even higher EROA is expected for severe MR. Additionally, EROA is also influenced by the systolic pressure gradient between the left ventricle and the left atrium. In patients with HFrEF and secondary MR, the systolic pressure gradient tends to be low, necessitating an EROA of \u22650.4\u202fcm2 in order to reach the criteria for severe MR. As mentioned before, 52% of patients included in the MITRA-FR trial had an EROA <0.3\u202fcm2 whereas only 16% presented with an EROA of \u22650.4\u202fcm2. Hence, in these patients with proportionate MR more than half had only mild to moderate MR and, as a\u00a0consequence, a\u00a0percutaneous MV intervention would not improve the prognosis. Consequently, in patients with a\u00a0LVEDV of 160\u2013200\u202fml and an EROA of \u22650.3\u202fcm2, the severity of MR is disproportionately high. Most of the patients in the COAPT trial had disproportionate MR with a\u00a0mean LVEDV of 192\u202fml and 86% of the patients had an EROA of \u22650.3\u202fcm2.If it is expected that patients with disproportionate secondary MR will benefit from percutaneous MV repair, how can we differentiate between proportionate and disproportionate MR? In order to answer this question, we first need to realise that the EROA depends on LVEDV and LVEF. In general, patients with HFrEF have a\u00a0dilated left ventricle. For example, patients with a\u00a0LVEF of 30% are expected to have a\u00a0LVEDV of 200\u2013250\u202fml. In these patients, an EROA of 0.2\u202fcmIn the study of Grayburn et\u00a0al.  an estimThe results of the MITRA-FR and COAPT trials have shown us that percutaneous MV repair can lead to better clinical outcomes in patients with moderate to severe or severe secondary MR. The conflicting results have made us aware that better patient selection is crucial. While optimal dosage of heart failure medication is important, a\u00a0novel conceptual framework has given us new insights in patients with secondary MR. By dividing patients with secondary MR into those with proportionate MR and those with disproportionate MR, we can better define which patients may benefit from percutaneous MV repair. In the case of proportionate MR, the severity of MR can be linked to the LV dilatation. Therefore, reversal of the LV disease should be targeted as it is expected that the MR itself will not influence the prognosis. In disproportionate MR, the MR severity is worse than would be expected from the LV dilatation. Therefore, the MR should be treated. Primary intervention on the MV itself should have an influence on the prognosis. This hypothesis has been confirmed by the positive outcomes of the COAPT trial, in which primarily patients with disproportionate MR were included in contrast to the neutral outcomes in patients with proportionate MR in the MITRA-FR trial.Future studies applying this new conceptual framework should give us more clarity as to whether the differentiation between \u2018proportionate\u2019 and \u2018disproportionate\u2019 MR will indeed lead to consistently better clinical outcomes."}
+{"text": "The models were validated by internal cross-validation in 10 groups from the training set and by the external test set. All of them showed good predictive ability, but the xgboost model displays the most prominent ability to identify immunogens by recognizing 84% of the known immunogens in the test set. The combined RSM-kNN model was the best in the recognition of non-immunogens, identifying 92% of them in the test set. The three best performing ML models  were implemented in the new version of the server VaxiJen, and the prediction of bacterial immunogens is now based on majority voting.The identification of protective immunogens is the most important and vigorous initial step in the long-lasting and expensive process of vaccine design and development. Machine learning (ML) methods are very effective in data mining and in the analysis of big data such as microbial proteomes. They are able to significantly reduce the experimental work for discovering novel vaccine candidates. Here, we applied six supervised ML methods (partial least squares-based discriminant analysis,  Immunogenicity is the ability of a foreign biomacromolecule  to produce a humoral and/or cell-mediated immune response in the host organism. If the immune response leads to the production of memory cells, the immunogen is assigned as a protective immunogen. Protective immunogens of pathogenic origin are perspective vaccine candidates . The ideDuring the last ten years, several approaches for immunogenicity prediction of whole protein antigens have been developed . Most ofOnly a few approaches have applied machine learning (ML) methods to classify a protein as immunogen/non-immunogen. They use positive and negative training sets of proteins of bacterial origin. Such positive sets are defined as known protective immunogens collected from the literature. The negative sets mirror the positive sets including randomly selected proteins from the same species without similarity to the positives. One of these ML approaches, VaxiJen , presentRecently, a good benchmarking review of in silico tools for immunogenicity prediction was published by Rappuoli\u2019s group . They cok nearest neighbor (kNN), random forest (RF), support vector machine (SVM), random subspace method (RSM) with kNN estimator, and extreme gradient boosting (xgboost). The derived ML models were validated by receiver operating characteristic (ROC) statistics on an external test set. The three best performing models were implemented in the new version of the server VaxiJen and evaluated by the test set used in the benchmarking review [In order to improve the fold-enrichment and PVC fraction predicted by VaxiJen, in the present study, we applied a variety of ML methods on an updated set of known bacterial antigens . The appg review . http://www.ddg-pharmfac.net/vaxijen/dataset [PubMed was searched for papers containing data for novel immunogenic proteins tested on humans until March 2017. Corresponding protein sequences were collected fromNCBI  and UniP/dataset . A mirror dataset of 317 non-immunogenic proteins was collected from the same bacterial species as the immunogens after a BLAST search with no sequence identity to known immunogens . The non-immunogens were selected to be similar in length to the immunogens. The collection and usage of datasets in the present study are illustrated in The immunogenic and non-immunogenic proteins were separated into 28 groups according to their length. Each group included between 12 and 34 proteins. Proteins in each group were scrambled and 20% of them were selected randomly as members of the test set. Thus, the training set consisted of 250 immunogenic and 250 non-immunogenic proteins and the test set contained 67 immunogenic and 67 non-immunogenic proteins. Neisseria gonorrhoeae, Neisseria meningitides, Staphylococcus aureus, Streptococcus pyogenes, Helicobacter pylori, Chlamydia pneumoniae, Campylobacter jejuni, Borrelia burgdorferi, Escherichia coli, Streptococcus pneumoniae, and Treponema pallidum. For each species, a list of BPAs with the corresponding references is reported in The dataset used to evaluate the new version of VaxiJen server consisted of the proteomes of 11 bacterial species and their known bacterial protective antigens (BPA) . The speE-descriptors were used in the present study to quantitatively characterize the protein sequences. The E-descriptors were proposed by Venkatarajan and Braun [E1 has a strong correlation with the hydrophobicity of the amino acids. The second component E2 gives information about the molecular size and the steric properties. The components E3 and E5 describe the amino acid propensity for occurrence in \u03b1-helices and \u03b2-strands, respectively. The component E4 takes into account the partial specific volume, the number of codons, and the relative frequency of amino acids in proteins.The nd Braun . They den elements, where n is the protein length. As the strings were of different length, they were transformed into uniform vectors by the auto- and cross-covariance (ACC) transformation. Dataset statistics are given in Each protein in our datasets was presented as a string of 5j and k refer to the E-descriptors (j \u2260 k); the index i indicates the position of amino acid in protein ; n is the number of amino acids in protein; and L is the lag . Lag is the length of the frame of contiguous amino acids, for which jjA and jkC are calculated. Examples of ACC transformation are given in The ACC transformation of protein sequences was introduced in 1993 by Wold et al.  as an alSeveral ML methods were applied in the present study and are described below. The WEKA software tool was used for data mining and ML . The ACCPLS-DA uses a regression method for classification. PLS algorithm forms new attributes, named principal components (PC), as linear combinations of the initial attributes and then uses them as predictors of the dependent variable . ClassifkNN measures the distances between the test data and each of the training data and classifies a data point based on how its k neighbors are classified [kNN algorithm with distance weighting equal to 1/distance. assified . We usedSVM uses vectors (cases) to define a hyperplane between two classes of data by maximizing the margin between the two classes. The vectors (cases) that define the hyperplane are called support vectors. The SVM algorithm in the present study was optimized by the WEKA gridsearch algorithm. The LibSVM library  was usedRF is an ensemble of individual decision trees . The RF kNN algorithm as an estimator was used. RSM-kNN is known to be suitable for datasets with a number of features much larger than the number of training points such as gene expression data [RSM, also known as feature bagging, reduces the correlation between estimators in an ensemble by training them on random samples of features instead of the entire feature set . RF is aion data .Gradient boosting is a decision-tree-based ensemble ML algorithm proposed by Breiman  and lateFeature selection  is a preprocessing technique for choosing the most significant features by removing the irrelevant and redundant ones. A large number of features in one model might result in an overfitted model. The dimensionality reduction achieved through the feature selection process improves the performance of the subsequent ML algorithms .Several different methods for feature selection before applying the ML algorithms were used in the present study as implemented in WEKA: correlation-based feature subset selection and consistency subset evaluation with the best first, genetic, greedy stepwise, and evolutionary search algorithm, chi-squared attribute evaluation, classifier attribute evaluation, correlation attribute evaluation, cross-validated attribute evaluation, information gain attribute evaluation, gain ratio attribute evaluation, one R attribute evaluation, and symmetrical uncertainty attribute evaluation with the ranker search algorithm.ROC statistics. Four outcomes are possible in ROC statistics: true positives ; true negatives ; false positives ; and false negatives . On the basis of these outcomes, four parameters were calculated: sensitivity  , specificity , accuracy ((TP + TN)/total) and precision (TP/(TP + FP)). These were calculated at different thresholds and the areas under the ROC curve (sensitivity vs. 1-specificity) (AROC) and the PR curve  were estimated. AROC is a quantitative measure of the predictive ability and varies from 0.5 for random prediction to 1.0 for perfect prediction. The ML models were also assessed by the Matthews correlation coefficient (MCC), which accounts for the quality of two-class classifications [F1 score, which is the weighted average of precision and recall. The ML models derived in the present study were validated by internal cross-validation in 10 groups and by the external test set. The predictive ability of the models was estimated by ications  and by tThe ML models with the best performance were implemented on a web server using the Python and Django framework. The prediction of bacterial immunogens by the server is based on the majority voting of the models. PVCs/proteome);Fraction of proteome called potential vaccine candidates (PVC) (sensitivity).Fraction of BPA identified within the set of PVCs .The performance of the new version of VaxiJen as a tool for bacterial vaccine antigen discovery was assessed by the dataset and the measures from Rappuoli\u2019s benchmarking review . The datn E-descriptors where n is the number of amino acid residues. The strings of different lengths were transformed into uniform vectors by ACC-transformation with lag of 8. The lag of 8 equals the shortest peptide in the dataset. Thus, the training set was transformed into a 500 \u00d7 200 (8 \u00d7 52) matrix and the test set into a 134 \u00d7 200 matrix. Examples are given in A dataset of 317 immunogenic and 317 non-immunogenic proteins from 47 bacterial species was collected as described above. They formed a training set of 250 immunogenic and 250 non-immunogenic proteins and a test set of 67 immunogenic and 67 non-immunogenic proteins. The proteins were presented as numerical strings of 5Six supervised ML algorithms were applied to the training set to derive classification models for immunogenicity prediction. The performance of the derived models was assessed by 10-fold cross-validation on the training set and by prediction on the external test set. The ML methods used in the present study are described above. The workflow of model development is given in accuracy 65% and 70%, respectively. This accuracy was significantly lower than the accuracy of the model in VaxiJen [kNN model, the k values varied between one and 10. The best performance in terms of accuracy and AROC curve was achieved at k = 1. The SVM model in the present study used a radial basis function for kernel type and the hyperparameters were tuned by the gridsearch algorithm. The best prediction was achieved at gamma = 100, cost = 1, and default WEKA parameters for LibSVM library. The RSM was used with the kNN estimator. The highest predictive ability was achieved at k = 1 and subspace size 0.4. The subspace size shows the size of the feature subspace used as a percentage of all of the features. The xgboost method was applied after parameter optimization. The best prediction was achieved at maxdepth = 4, eta = 1, nrounds = 150, and default parameters of xgboost package for R.The PLS-DA algorithm was applied on the training and test sets and showed  VaxiJen . The RF sensitivity of the ML models derived in the present study ranged from 0.64 (PLS-DA) to 0.76 (kNN) in the 10-fold cross-validation on the training set and from 0.61 (PLS-DA) to 0.84 (xgboost) for the test set. The best performance was shown by the xgboost algorithm: 84% of the immunogens in the test set were recognized. This prediction was better distinguishable than the predictions made by the rest of the models. Apart from the PLS-DA model, all ML models performed better or equally well on the external test set than on the cross-validation in 10 groups of the training set. This is evidence for the good prediction ability without overestimation.The specificity of the ML models spanned from 0.67 (PLS-DA) to 0.80 (SVM) for the training set and from 0.75 (xgboost) to 0.92 (RSM-1NN). The RSM-1NN model showed the best performance: 92% of the non-immunogens in the test set were recognized. This was followed by the kNN and SVM models with 84% specificity. Again, the predictions on the test set were better than the cross-validated predictions on the training set.The accuracy of the ML models was from 0.65 (PLS-DA) to 0.78 (RSM-1NN) for the training set and from 0.70 (PLS-DA) to 0.82 (RSM-1NN) for the test set. The highest accuracy of 82% on the test set was achieved by the RSM-1NN model followed by the kNN and xgboost models (79% accuracy). The precision of the models gave values close to their accuracies. The AROC was highest for the RSM-1NN model on the test set (0.88), followed by the xgboost and RF models . The APR values were similar to AROC ones. The MCC and F1 values confirmed the good quality of the classification models. All MCCs were above 0. The highest MCC (0.66) belonged to the RSM-1NN model, while the highest F1 (0.80) was for RSM-1NN and xgboost. The range of the overall kNN algorithm. The models derived in the present study better recognized the non-immunogens than the immunogens and had similar accuracies.The results showed that the xgboost model had the highest ability to recognize immunogenic proteins of bacterial origin, while the RSM-1NN model was the most powerful in the recognition of non-immunogens. Both models were derived by ensemble methods . The first one used decision trees, the second used the AROC\u2014RSM-1NN, xgboost. and RF with feature selection\u2014were trained on the total set of 317 bacterial immunogens and 317 non-immunogens and the derived models were implemented in the new version of VaxiJen\u2014VaxiJen v3.0. The prediction of bacterial immunogens was based on majority voting: if two of the three models classify a given protein as an immunogen, VaxiJen returns a result \u201cProbable ANTIGEN with probability 67%\u201d. The three best-performing algorithms in terms of The performance of VaxiJen v3.0 as a tool for bacterial vaccine antigen discovery was evaluated by Rappuoli\u2019s benchmarking dataset and using the same performance measures  as descrhttps://ddg-pharmfac.net/vaxijen3/. It allows an input of protein sequence in plain format (single letter code) or upload of a file with proteins in fasta format and returns probability for immunogenicity of the tested proteins. VaxiJen v3.0 is freely accessible at In this study, we applied six supervised ML methods on a dataset of 317 known bacterial immunogenic proteins and on a mirror dataset of non-immunogenic proteins from the same species to derive models for immunogenicity prediction. The ML models were derived after parameter optimization. The models were validated by internal cross-validation and by the external test set. All showed good predictive ability, but the most prominent ability to identify immunogens belonged to the xgboost model, while the RSM-1NN model was the best to filter the non-immunogens. The best-performing models\u2014xgboost, RSM-1NN, and RF\u2014were implemented in the server VaxiJen v3.0. VaxiJen v3.0 is as user friendly and comprehensive as the previous version, but shows better performance in terms of fold-enrichment and fraction of PVCs. VaxiJen is a widely used server for immunogenicity predictions with more than 500 citations . The current updated version of VaxiJen offers more robust predictions of bacterial immunogens while maintaining the advantages of ultra-short running time, maximum observed BPAs, highest sensitivity, and expected BPAs."}
+{"text": "Numerous economic models have assessed the cost-effectiveness of antipsychotic medications in schizophrenia. It is important to understand what key impacts of antipsychotic medications were considered in the existing models and limitations of existing models in order to inform the development of future models.This systematic review aims to identify which clinical benefits, clinical harms, costs and cost savings of antipsychotic medication have been considered by existing models, to assess quality of existing models and to suggest good practice recommendations for future economic models of antipsychotic medications.An electronic search was performed on multiple databases  to identify economic models of schizophrenia published between 2005\u20132020. Two independent reviewers selected studies for inclusion. Study quality was assessed using the National Institute for Health and Care Excellence (NICE) checklist and the Cooper hierarchy. Key impacts of antipsychotic medications considered by exiting models were descriptively summarised.Sixty models were included. Existing models varied greatly in key impacts of antipsychotic medication included in the model, especially in clinical outcomes used for assessing reduction in psychotic symptoms and types of adverse events considered in the model. Quality of existing models was generally low due to failure to capture the health and cost impact of adverse events of antipsychotic medications and input data not obtained from best available source. Good practices for modelling antipsychotic medications are suggested.This review highlights inconsistency in key impacts considered by different models, and limitations of the existing models. Recommendations on future research are provided. Antipsychotic medications have been the mainstay of treatment for schizophrenia since the 1950s \u20135, each Clinical trials capturing the health and cost outcomes of antipsychotic medications can be complex, time-consuming, and costly. In addition, clinical trials often do not cover all antipsychotic medications of interest, have a short time horizon and use surrogate endpoints or focus only on specific adverse events instead of assessing the entire spectrum of relevant adverse events. Health economic modelling is therefore advocated as a systematic and transparent method for synthesising all available evidence obtained from multiple sources \u201311. AlthModels are simplifications of reality which focus only on key relationships and are therefore unable to capture all impacts of using one intervention . TherefoThis systematic review was conducted according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) recommendations for reporting systematic reviews and meta-analyses of studies that evaluate healthcare interventions . The sysa priori. Studies were included if they met all of the following criteria: (i) model-based economic evaluation adopting either a cost-effectiveness analysis (CEA) or cost-utility analysis (CUA) approach; (ii) young people (under 18 years of age) and/or adults (18 years and older) with a non-specific diagnosis of psychosis or with a diagnosis of schizophrenia ; (iii) evaluation of antipsychotic medications versus each other, placebo or nothing. The reason why non-specific diagnosis of psychosis was included is because in clinical practice, it may take up many years before symptomatic patients receive a formal diagnosis of schizophrenia [Inclusion and exclusion criteria were defined ophrenia . Before ophrenia . No resthttps://ovidsp.ovid.com/). In addition, the NHS Economic Evaluation Database (NHS EED) and the Health Technology Assessment (HTA) Database were searched, accessed through the Cochrane library interface (http://onlinelibrary.wiley.com/cochranelibrary/search8). The search strategies included Medical Subject Heading (MeSH) terms and text words. Each follows a similar structure: population terms AND economic evaluation terms AND modelling terms AND limitation terms. The original search, first update search and second update search were conducted by one reviewer (HJ) on 22nd June 2015, 4th March 2018, and 21st January 2020, respectively. The full search strategy is reported in Electronic biomedical and psychological databases searched included MEDLINE (including in-Process & other non-indexed), EMBASE and PsycINFO, accessed through the Ovid interface  interpedently performed the first screening of the literature search results, by comparing titles and abstracts to the inclusion criteria. The full articles were then obtained for possibly useful studies and checked against the review inclusion criteria by two reviewers . Final inclusion of studies in the review was determined by agreement of both reviewers, with disagreements resolved by discussion. A number of strategies were devised to help ensure that relevant studies were not missed. Firstly, the reference lists of all studies included in the current review were checked for any additional studies that may have been missed by the electronic search strategies. Secondly, key papers and the publications of key health economists were checked for inclusion and for additional relevant papers. Thirdly, published systematic reviews relevant to the target population were located through a separate search of the clinical guidelines and technology appraisals produced by the National Institute for Health and Care Excellence (NICE) and NIHR health technology assessment (HTA) reports. The search terms used by the located systematic reviews were used to inform the development of search strategies for the current systematic review, and the studies included by those reviews were checked for relevance to the inclusion criteria of the current systematic review. Finally, the included studies of all literature reviews identified by the search conducted for the current systematic review were checked for any additional studies that may have been missed by the electronic search strategies.Seven commonly used checklists for economic evaluations \u201328 were The Cooper hierarchy focuses only on the quality of the data sources used to inform the parameters in a model and was modified from the potential hierarchies of data sources for economic analyses developed by Coyle and Lee . The CooTwo reviewers  performed quality assessment for included studies, with disagreements resolved by discussion.A data extraction form was drafted by one reviewer (HJ) using Microsoft Word  and checked by a second reviewer (EA). The developed data extraction form was piloted on ten studies. The results of pilot testing were discussed among the team to incorporate any necessary refinements before completion of data collection from all included studies. The formal data extraction was conducted by one reviewer (HJ) and checked by a second reviewer , with disagreements resolved by discussion. The following information was extracted from all included studies: author, year, country, study objective, method of economic evaluation, intervention and comparator, modelling method, key impacts of antipsychotic medications to include in the model, and rationale for choosing those impacts. The template for data extraction is reported in Study characteristics and conclusions were synthesised within a narrative review. No quantitative synthesis was undertaken.A total of 1,557 abstracts were retrieved from electronic searches. The detailed results of the literature search are reported in A summary of the characteristics of included studies are reported in As reported in The antipsychotic modelled by included studies are reported in None of the included studies reported a rationale for selection of the different impacts of antipsychotic medications modelled, including choice of clinical benefits, clinical harms, costs and cost savings. To support understanding of the breadth, perspective and strengths and limitations of economic models, it is valuable to report the impacts of antipsychotic medication that were considered for inclusion in the model, the impacts that were included in the final model and the reason for inclusion or exclusion of each impact. For example, it is useful to know if a key impact was excluded due to lack of data rather than due to irrelevance to the question the model is trying to answer, as the former reason, unlike the latter, highlights a limitation of the model and a gap in the literature.Two types of clinical benefits of using antipsychotics were identified:Reduction of psychotic symptoms . All included studies modelled antipsychotics\u2019 effectiveness in reducing psychotic symptoms, but the clinical outcomes that they measured varied and included: risk of relapse ; response rate to antipsychotic ; scores on psychiatric symptom scales   and the Positive and Negative Syndrome Scale (PANSS)), and number of successfully treated patients  . FifteenReduction in mortality . Mortality was modelled in thirty-one studies : twenty assumed antipsychotic medications have no impact on patients\u2019 mortality , five assumed antipsychotic medications reduce patients\u2019 mortality risk  \u201345, fiveTwo types of clinical harms of antipsychotic medications were identified, both of which are associated with adverse events of antipsychotic medications:Reduction of patient\u2019s utility due to adverse events for CUA studies . The most frequently modelled adverse events were weight gain , movement disorders , and diabetes/impaired glucose tolerance . A bar chart showing the frequency of all adverse events modelled is reported in Increase in mortality due to adverse events 6/60, 10.0%). The adverse events which were assumed to increase patients\u2019 mortality risk included diabetes  , 46, 47,, 10.0%. Two categories of cost related to antipsychotic medication use were modelled by included studies:Acquisition costs of antipsychotic medications .Cost of treating adverse events of antipsychotic medications . Of the thirty-six studies that included the cost of treating adverse events, the most frequently modelled adverse events were movement disorders , weight gain  and diabetes/impaired glucose tolerance . All modelled adverse events and their frequency are shown in The main cost savings resulting from the use of antipsychotic medication related to psychiatric services avoided . Of the fifty-eight studies that included the cost of psychiatric services, fifty-five studies included inpatient and outpatient/community services (94.8%), one study included the cost of inpatient services only (1.7%) , and twoThe performance of included studies on all items of Section 2 of the NICE checklist and the Cooper hierarchy are reported in According to the quality assessment results of the NICE checklist, fifty-four studies were deemed to have very serious limitations (90.0%), four were deemed to have potentially serious limitations (6.7%) , 64\u201366, Of the six categories included in the Cooper hierarchy , three oet al. [Based on findings of this review and the hierarchy of evidence suggested by Cooper et al. , good prThis review found that the key impacts of antipsychotic medications considered by existing models are:clinical benefits: reduction in psychotic symptoms and reduction in patients\u2019 risk of suicide;clinical harms: the impact of adverse events on patients\u2019 health-related quality of life and mortality;costs: cost of antipsychotic medication, and cost of treating adverse events of antipsychotic medication;cost savings: inpatient and outpatient psychiatric services.The results of this review suggest that models assessing antipsychotic medications were subject to considerable inconsistencies, particularly with respect to two aspects of the analyses: (1) clinical outcomes used for assessing reduction in psychotic symptoms, which included response rate, risk of relapse, scores on psychiatric symptom scales and number of successfully treated patients; and (2) types of adverse events considered in the model. One possible explanation for the variation in choice of adverse events is that different antipsychotic medications are associated with different adverse event profiles. For example, compared to first-generation antipsychotic medications , second-generation antipsychotic medications (e.g. olanzapine) are less likely to cause EPS but more likely to cause weight gain and diabetes. Therefore, models which only assess second-generation antipsychotic medications may choose to include weight gain and diabetes, but not EPS. However, even for studies assessing the same antipsychotic medications, the choice of adverse events still differed.In addition, the review found the quality of existing models assessing antipsychotic medication is generally low. Common reasons for low-quality included failure to capture the health and cost impact of adverse events of antipsychotic medications, input data not obtained from the best available source and potential conflicts of interest. In order to improve the consistency and quality of future models in antipsychotic medications, good practices are suggested based on the findings of this review.This study has three main strengths. Firstly, to our knowledge, this is the first systematic review which explores the key impacts of antipsychotic medications considered by existing health economic models. Secondly, based on the findings of this review, good practice for modelling antipsychotic medications are suggested. These good practice recommendations can be used to improve the consistency and methodological and reporting quality of future health economic models assessing antipsychotic medications. Thirdly, a number of strategies were devised to help ensure that relevant studies were not missed, including checking key papers and the publications of key health economists, and checking references of published systematic reviews.This review is subject to three main limitations. First, only models using a CEA or CUA approach were included. Models using other approaches, such as cost-benefit analysis (CBA), cost-consequences analysis (CCA) and cost-minimisation analysis (CMA), were excluded. However, it has been reported that CBA, CCA and CMA have problems with their reliability, validity and even morality , 68, andS1 Text(DOCX)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file.S4 Table(XLSX)Click here for additional data file.S5 Table(DOCX)Click here for additional data file.S6 Table(DOCX)Click here for additional data file.S7 Table(DOCX)Click here for additional data file.S1 Checklist(DOC)Click here for additional data file."}
+{"text": "Voluntary work behavior (VWB) refers to spontaneous workplace behaviors that extend beyond role norms, including extra-role behaviors that benefit the organization  and negative behaviors that may harm the organization . This study examined the relationship between self-control and VWB and the mediating role of job satisfaction. A total of 1,101 full-time employees from China completed a battery of self-report measures online. The results show that self-control positively predicts employees' OCB and negatively predicts employees' CWB. Moreover, job satisfaction significantly mediates the relationship between self-control and OCB/CWB. The results confirm that employees with high self-control are more public-spirited, which previous studies have described as being \u201chighly committed\u201d (high OCB) or \u201cless harmful\u201d (low CWB). This finding closely relates to the observation that employees with high self-control tend to have more satisfying work outcomes or higher workplace status than those with low self-control. Voluntary work behavior (VWB) refers to spontaneous behaviors that extend beyond specific role requirements, including desirable  and undesirable behaviors  . After some copies of questionnaires were excluded because they contained too many identical answers, 1,101 valid surveys remained for the analysis (a response rate of 94.3%). Among these 1,101 employees , the participants ranged in age from 18 to 64 years , and the average work tenure was 4.47 years (SD = 5.07). These individuals provided consent prior to answering self-report measures online to enter a drawing for 100 RMB (~15 U.S. dollars).Data were collected from a variety of organizations in southeastern China. In total, 1,167 full-time employees  were willing to complete the surveys via an online advertisement  developed by Tangney et al.  to 5 (very much like me). The average score for all items was calculated, and a higher score indicates better self-control. BSCS has been shown to have good psychometric properties in different cultures  developed by Arvey et al. (very dissatisfied) to 5 (very satisfied). The average score for all items was calculated, and a higher score indicates greater job satisfaction. The MSQ can be applied to evaluate job satisfaction, drawing attention to key work facets and grouping them into two dimensions: intrinsic satisfaction  and extrinsic satisfaction .y et al. . This scOrganizational Citizenship Behavior Scale (OCBS) developed by Aryee et al. (strongly disagree) to 7 (strongly agree). The average score for all items was calculated, and a higher score indicates more OCB. Sample items include \u201cmakes suggestions to improve work procedures\u201d and \u201cexpresses opinions honestly when others think differently.\u201dPositive voluntary behavior at work was measured with the e et al. . This scCounterproductive Work Behavior Checklist (CWBC) developed by Spector et al. (never) to 5 (every day). A higher score indicates more negative voluntary behavior at work. Sample items include \u201cPurposely wasted your employer's materials/supplies\u201d and \u201cInsulted or made fun of someone at work.\u201dNegative voluntary behavior at work was measured with the 10-item short version of the r et al. . This meage, gender, and income to control for their potentially spurious effects.Consistent with previous research , \u0394\u03c72 (33) = 4,120.62, p < 0.001, including a model in which self-control and job satisfaction were combined and the two dependent variables were combined (M3), \u0394\u03c72 (35) = 6236.28, p < 0.001. The four-factor model was also superior to a one-factor model that combined all four variables into one factors (M2), \u0394\u03c72 (36) = 8558.96, p < 0.001. We concluded that the four variables were empirically distinct from one another, representing four distinct constructs. Therefore, results did not provide evidence for common method bias.As shown in r = 0.22, p < 0.001) and OCB  and negatively related to CWB. Job satisfaction was positively association with OCB  but negatively associated with CWB . These findings provide preliminary support for the hypothesized relationships.Means, standard deviations, correlations, and coefficient alphas of the variables are presented in p < 0.001) but associated with lower levels of employees' CWB  after controlling for age, gender, and monthly income.We first assessed the direct effect of self-control on OCB/CWB. Model results consistent with Hypotheses 1a and 1b indicated that self-control was associated with higher levels of employees' OCB , CFI = 0.99, SRMR = 0.011. As shown in p < 0.001). Also, employees' job satisfaction was positively related to OCB , while it was negatively related to CWB . Finally, as shown in Next, the mediational model was tested which included employees' job satisfaction. The model fit to the data well, \u03c7The present research sought to reveal the relationship between self-control and VWB (OCB/CWB) and the mediating role of job satisfaction in Chinese employees. As expected, we found that self-control was positively related to OCB and negatively associated with CWB, consistent with the findings of previous studies  on their behavior in the organization. Based on this finding, organizations should pay more attention to employees' self-control ability. For example, in the process of employee recruitment, organizations can take interviewees' self-control ability into account by applying self-control tests. Second, when selecting candidates for promotions, important positions, or assignments, organizations can consider employees' self-control ability as a predictor of greater OCB. Additionally, organizations can provide specific training to improve employees' self-control ability, which can benefit both the organization and employees in the long term.Previous studies have shown that motivation can have an impact on the implementation of self-control . Third, the literature on the mediating mechanism in the relationship between self-control and VWB is limited. Future studies may also examine other possible mediators to better understand VWB. Finally, given the practical implications of our findings, several practical issues require further attention. Although we revealed that self-control plays an important role in OCB, research on methods for self-control inventions is needed to better apply self-control for practical use.The datasets generated for this study are available on request to the corresponding author.The studies involving human participants were reviewed and approved by Ethics Review Committee of Education School, Guangzhou University. The patients/participants provided their written informed consent to participate in this study.Y-JW and KD: conceptualization, data curation, and investigation. Y-JW, K-YC, and KD: formal analysis, methodology, software, and writing\u2014original draft. KD: project administration. Y-JW, KD, and Y-ZL: resources. KD and Y-ZL: supervision. Y-JW, K-YC, KD, and Y-ZL: writing\u2014review and editing. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Additionally, microCT analysis of 6-month-old females and 7-month-old males did not detect any difference in trabecular or cortical bone mass between genotypes. These results indicate that expression of Scarb1 in cells of the osteoblast lineage does not play an important role in bone homeostasis and, therefore, it is not essential for the effects of PC-OxPL on these cells.The scavenger receptor class B member 1 (SR-B1 or Scarb1) is a cell surface receptor for high density lipoproteins. It also binds oxidized low density lipoproteins and phosphocholine-containing oxidized phospholipids (PC-OxPL), which adversely affect bone homeostasis. Overexpression of a single chain form of the antigen-binding domain of E06 IgM\u2013a natural antibody that recognizes PC-OxPL\u2013increases trabecular and cortical bone mass in female and male mice by stimulating bone formation. We have previously reported that Scarb1 is the most abundant scavenger receptor for PC-OxPL in calvaria-derived osteoblastic cells. Additionally, bone marrow- and calvaria-derived osteoblasts from Scarb1 knockout mice (Scarb1 KO) are protected from the pro-apoptotic and anti-differentiating effects of OxPL. Previous skeletal analysis of Scarb1 KO mice has produced contradictory results, with some studies reporting elevated bone mass but another study reporting low bone mass. To clarify the role of Scarb1 in osteoblasts, we deleted Scarb1 specifically in cells of the osteoblast lineage using Osx1-Cre transgenic mice. We observed no difference in bone mineral density measured by DXA in either female or male Osx1-Cre;Scarb1 The scavenger receptor class B member 1 (SR-B1 or Scarb1) is a glycosylated cell surface receptor for high density lipoproteins (HDL), most abudantly expressed in the liver and in steroidogenic tissues such as adrenal glands, ovaries, and testis , 3. In tIn addition to HDL, Scarb1 can bind, albeit with much lower affinity, to bovine serum albumin and advanced glycation end-product modified proteins, bacterial cell components such as lipopolysaccharides (LPS), apoptotic cells, and other lipoproteins including VLDL and LDL , 11. In We have previously shown that physiological levels of PC-OxPL reduce bone mass. Specifically, we found that male and females transgenic mice expressing a single chain (scFv) form of the antigen-binding domain of E06 IgM (E06-scFv), which binds and neutralizes PC-OxPL, have increased trabecular and cortical bone mass at 6 months of age , 15 and In addition to Scarb1, PC-OxPL is recognized by the scavenger receptor CD36 and by the toll-like receptors 2, 4 and 6 , all of in vitro fertilization in the UAMS Genetic Models Core facility. To delete Scarb1 in the entire osteoblast lineage, we crossed Scarb1 floxed mice with Osx1-Cre mice obtained from the Jackson laboratories (stock number 006361) [C57BL/6J (stock number 000664) and Scarb1 KO mice in the C57BL/6J background (stock number 003379) were obtained from the Jackson Laboratories. The mouse line harboring the Scarb1 conditional allele [C57BL/6N-Scrib<tm1c(NCOM)Mfgc>/Tcp] was created as part of the NorCOMM2 project with C57BL/6NScrib<tm1a(NCOM)Mfgc>/Tcp produced from NorCOMM ES cells  at the T 006361) . The Osx 006361)  and line 006361) .fl/fl, and the experimental mice Osx1-Cre;Scarb1fl/fl mice. All mice strains were fed a doxycycline-containing diet [Bio Serv doxycycline diet (S3888) 200 mg/kg ] from conception until one week prior to the start of the second cross, at which time they were switched to regular chow to activate the Cre transgene [LabDiet 5K67 Mouse/Auto6F Diet ]. Mice were group housed under specific pathogen-free conditions and maintained at a constant temperature of 23\u00b0C, in a 12:12-hour light-dark cycle; they had ad libitum access to diet and water.We used a two-step breeding strategy to obtain the experimental animals. We initially crossed hemizygous Osx1-Cre transgenic mice with heterozygous Scarb1 floxed mice to generate heterozygous Scarb1 floxed mice with and without a Cre allele. Those mice were used in the second cross to generate the 3 control groups and the experimental mice: WT mice, Osx1-Cre, mice homozygous for the ScarB1-floxed allele, hereafter referred to as Scarb15\u2019-GCTAAACATGCTTCATCGTCGG-3\u2019, Cre-Rev: 5\u2019-GATCTCCGGTATTGAAACTCCAGC-3\u2019, product size 650bp; Scrib-WT-Fwd: 5\u2019-AAAGAGGGCAGGTGCAGTAAGCGAAG-3\u2019, Scrib-WT-Rev: 5\u2019-TTTCAGTGACAGTGGGCTTCTCTGGG-3\u2019, product size wild type 223bp, heterozyous 223 and 346 bp; Scrib_tm1c distal loxp-Fwd: 5\u2019 GCGCAACGCAATTAATGATAAC-3\u2019, Scrib_tm1c distal loxp-Rev: GTCCAAGACTCCCTCCAAACGCACG-3\u2019, product size floxed 222 bp.We genotyped the offspring by PCR using the following primer sequences: Cre-Fwd: Bone mineral density (BMD) measurements and percentages of lean and fat body mass were calculated by dual-energy X-ray absorptiometry (DXA) of sedated mice (2% isoflurane) using a PIXImus densitometer (GE Lunar) , 25. TheBone microarchitecture was measured using a micro-CT40 scanner  as previously described , 15. We L1-L3 vertebra were dissected, placed in fixative , dehydrated with ethanol, and stored in 100% ethanol until embedding in methyl methacrylate . Five \u03bcm thick longitudinal sections of trabecular bone were stained for tartrate-resistant acid phosphatase (TRAP) with toluidine blue counterstaining to allow the measurement of static indices of osteoclast and osteoblast number. Histomorphometric determinations were made at L2, as previously described in a blinded fashion using Osteomeasure version 7 V4.3.0.0  . Histomofl/fl littermate neonatal pups mice by sequential digestion with collagenase type 2  as previously described  according to manufacturer\u2019s instructions.fl/fl group could not be analyzed by microCT because it was damaged during the harvest. In No experimentally derived data were excluded. In Figs t-test, ANOVA or ANOVA repeated measures as appropriate. When ANOVA indicated a significant effect, pairwise multiple comparisons were performed and the p-values adjusted using the Tukey\u2019s pairwise comparison procedure or the Holm-Sidak method as appropriate. Statistical analysis for the data shown in Figs Statistical analyses were performed using GraphPad Prism (versions 7.0.4 and 8.0.1). Group mean values were compared by Student\u2019s two-tailed in vivo studies, the sample size was adequate to detect a difference of 1.2 standard deviations at a power of 0.8, and p<0.05 Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0NoReviewer #2:\u00a0Partly********** <font color=\"black\"> 2. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #1:\u00a0YesReviewer #2:\u00a0I Don't Know********** <font color=\"black\"> 3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #1:\u00a0YesReviewer #2:\u00a0No********** <font color=\"black\"> 4. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0Yes********** <font color=\"black\"> 5. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0This manuscript describes studies of the phenotype about Scarb1 conditional osteoblast-specific knockout mice using Osx1-Cre mice. The authors do not explain the phenomena that this conditional KO mice exhibited normal bone mass and analyze the reason of the dissociation between in vitro and in vivo experimentally. It is little of rationale. Unfortunately, I cannot recommend this paper to publish in PLoS One.Reviewer #2:\u00a0In this study, the authors investigated specific deletion of Scarb1 in bone marrow osteoblast lineage on bone mass of male and female mice.Based on the findings that no differences in trabecular or cortical bone mass between the controls and Scarb1(fl/fl) in femur or spine, authors concluded that Scarb1 in osteoblast lineage does not play an important role in bone homeostasis and is not essential for the effects of PC-OxPL on osteoblasts (lines 39-40), or Scarb1 is not needed for osteoblast differentiation and function (lines 85-86).As we know, bone mass reflects the balance of formation and resorption or the number and activity of osteoblasts and osteoclasts. Neither osteoblast nor osteoclast function was evaluated in the study.Calvaria- or bone marrow-derived osteoblasts from these mice could be cultured to evaluate osteoblast function. Alternatively, osteoblast and osteoclast in bone tissue from these mice can be examined.Line 220, the method is lacking on how vehicle or OxLDL was givenFigure 1, why only measure mRNA of osteocalcin and ALP? Were osteoblast colony, bone nodule, ALP staining performed on calvaria- or bone marrow osteoblast cultures?Figure 1, data presented in the figure are different with the cited reference (lines 175-176) describing relative gene expression using 2(-Delta Delta C(T)) Method. Please provide raw CT data of either osteocalcin or ALP including the calculation of relative mRNA.Lines 115-121 and Figure 2, instead of showing gDNA, can you show genotypes in gel as shown in page 4 of this paper to confirm deletion of Scarb1? Genomic DNA from the surfaces of bone doesn\u2019t mean from osteoblasts only.:2607-19. doi: 10.1128/mcb.22.8.2607-2619.2002.)********** <font color=\"black\"> 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #1:\u00a0NoYes:\u00a0Jay CaoReviewer #2:\u00a0https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at\u00a0figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool,\u00a0 28 Feb 2022Dear Dr. Xing-Ming Shi,We appreciate the constructive criticism and the opportunity to revise our manuscript. In the revised version, we have incorporated all the changes recommended by the reviewers to the best of our ability. As requested, we have addressed the comments of Reviewer 2. Please find attached the document \"response to reviewers final\" for a detailed reply to all the comments.AttachmentRESPONSE TO REVIEWERS FINAL.docxSubmitted filename: Click here for additional data file. 10 Mar 2022Deletion of the scavenger receptor Scarb1 in osteoblast progenitors does not affect bone massPONE-D-21-32691R1Dear Dr. Ambrogini,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Xing-Ming Shi, Ph.DAcademic EditorPLOS ONEAdditional Editor Comments :Reviewers' comments:Reviewer's Responses to Questions <font color=\"black\"> Comments to the Author </font> 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #2:\u00a0All comments have been addressed********** <font color=\"black\"> 2. Is the manuscript technically sound, and do the data support the conclusions? </font> The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2:\u00a0(No Response)********** <font color=\"black\"> 3. Has the statistical analysis been performed appropriately and rigorously?  </font> Reviewer #2:\u00a0(No Response)********** <font color=\"black\"> 4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified. </font> The Reviewer #2:\u00a0(No Response)********** <font color=\"black\"> 5. Is the manuscript presented in an intelligible fashion and written in standard English? </font> PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #2:\u00a0(No Response)********** <font color=\"black\"> 6. Review Comments to the Author </font> Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #2:\u00a0(No Response)********** <font color=\"black\"> 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. </font> Reviewer #2:\u00a0No 21 Mar 2022PONE-D-21-32691R1 Deletion of the scavenger receptor Scarb1 in osteoblast progenitors does not affect bone mass Dear Dr. Ambrogini:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr Xing-Ming Shi Academic EditorPLOS ONE"}
+{"text": "Arabidopsis thaliana in a Saccharomyces cerevisiae strain with mutation in its endogenous N-degron pathway. The two enzymes re-constitute part of the plant N-degron pathway and were probed by monitoring the stability of co-expressed GFP-linked plant proteins starting with Arginine N-degrons. The novel assay allows for straightforward analysis, whereas in vitro interaction assays often do not allow detection of the weak binding of N-degron recognizing ubiquitin ligases to their substrates, and in planta testing is usually complex and time-consuming.The N-degron pathway is a branch of the ubiquitin-proteasome system where amino-terminal residues serve as degradation signals. In a synthetic biology approach, we expressed ubiquitin ligase PRT6 and ubiquitin conjugating enzyme 2 (AtUBC2) from  S. cerevisiae has a single ubiquitin ligase, UBR1, with specificity for N-degrons consisting of an unmodified amino-terminal residue with large side chain, animals and plants have several N-recognins with this specificity.The ubiquitin-proteasome system for protein turnover is well conserved in all eukaryotes. In an enzymatic cascade, the ubiquitin carboxyl terminus is linked to a Cys residue of ubiquitin activating enzyme to form a thioester. From there, ubiquitin is transferred to the active site of a ubiquitin conjugating enzyme. With help of ubiquitin ligases, ubiquitin is transferred to the \u03b5-amino groups of Lys residues  in protein substrates. Ubiquitin conjugation changes substrate properties and often leads to rapid degradation. For instance, N-recognins, i. e. ubiquitin ligases that recognize first amino acids in their substrates , usually attach a ubiquitin chain that results in turnover of the substrate by a multi-subunit protease, the proteasome. While many aspects of ubiquitylation are conserved, species-specific features are also an inherent characteristic. In particular, the increasing complexity of multicellular organisms is mirrored in an increasing number of ubiquitin ligases and ubiquitin conjugating enzymes. This pertains also to the degradation routes for N-degrons. Whereas baker\u2019s yeast Plants have distinct substrates and possess several N-recognins that do not occur in animals or in fungi . Even thIn vitro reconstitution has been used extensively for many enzymes of ubiquitin conjugation. Modification of potential substrates could often be shown  can then be analyzed by co-expression with additional proteins including ubiquitin conjugating enzymes and substrates, to assess functional competence. The strategy has previously been used to elucidate the substrate specificity of plant N-recognin PRT1  was transformed with a KanMX cassette .Yeast strain CB80 . Insert sequences are listed in cDNAs for potential PRT6 substrates were cloned from isolated mRNA. Constructs to fuse model substrates or Arabidopsis ORFs with the fluorescent protein were generated after BamHI and AatII sites). From there, the ORF was inserted into expression vector YCplac22  was normalized to incubation time and protein content.For \u03b2-galactosidase substrates, protein extracts were prepared from cultures inoculated with freshly transformed yeast colonies. These were suspended in synthetic medium containing 2% glucose and grown overnight at 30\u00b0C. Aliquots were transferred into medium containing 2% galactose and 0.1% glucose. After 4.5 h growth, these cultures were diluted in 15 ml selective medium with 2% galactose so that O/N growth resulted in an OD600 of 0.8. Extracts were prepared from cell pellets of 10 ml of culture by shaking with glass beads (FastPrep24 bead beating grinder) in buffer . Cleared extracts were used for determination of protein content , and for \u03b2-galactosidase activity using ortho-nitrophenyl-\u03b2-D-galactoside  as a substrate, by incubating 100 \u03bcl of extract with 900 \u03bcl of Z buffer at 28\u00b0C. After addition of 200 \u03bcl ONPG solution, extracts were incubated and the reaction was stopped by addition of 0.5 ml 1 M NaFor fluorescent proteins, cultures adapted to galactose medium were diluted to an OD600 of 0.3 and distributed into 96 well microtiter plates. Samples encompassed both biological (independently transformed yeast colonies) and technical replicates. In a microtiter plate reader (BioTek Synergy H1), GFP emission at 515 nm was measured after excitation at 485 nm. In addition, OD600 and path length were recorded to obtain values for cell density determination.In vitro stability analysis of MetCys-initiating proteins was carried out using a rabbit reticulocyte lysate (RRL) assay, that contains all the components of the Arg/N-degron pathway, as described in In vitro translation was done for 30 min at 30\u00b0C using Promega TNT \u00ae Coupled Rabbit Reticulocyte Lysate System as per manufacturer\u2019s instructions. Reaction mixes with constructs containing MC-initiating proteins were set up with or without 50 \u03bcM MG132/bortezomib. After 30 min incubation, 1 \u03bcl of 2.6 mM cycloheximide  was added and samples were collected at indicated time points. Western blots were carried out as previously described  followed by HRP-conjugated goat anti-mouse antibody  and Western Bright chemiluminescent detection reagent (advanstra). ChemiDoc MP (BioRad) was used for detection.ubr1 and its parent CB80 were used as isogenic pair in this work.In order to re-constitute plant N-degron dependent turnover in baker\u2019s yeast, we generated a yeast strain lacking the classical Arg/N-degron pathway by deletion of UBR1, the single yeast N-recognin for unblocked amino-terminal residues with large side chains. Yeast strain CB80 \u0394ubr1, which has the single yeast N-recognin UBR1 deleted, the Arg-\u03b2Gal model substrate has 58% the abundance of Val-\u03b2Gal , it is surprisingly small. After 24 h, when cells reach late log or stationary phase, the difference is comparable to cells expressing PRT6 and AtUBC2  lose their initiator methionine by the action of methionine aminopeptidase. Thereafter, the fate of the protein depends on several processing enzymes, and on the presence of molecular oxygen. Plant cysteine oxidases can, provided that the concentration of oxygen is high enough, oxidize Cys to cysteic acid. After oxidation, Arg tRNA protein transferase adds an Arg residue to the amino terminus. These maturation steps are listed in via anti-GFP Western blotting. Absence of AtUBC2 abrogates the difference between fusion proteins starting with Arg and Ala, indicating N-degron dependence , and the two closely related small proteins BBX30 and BBX31 . Pfam assigns a single Zinc finger-like B-BOX domain to BBX30, whereas this same domain was not identified in BBX31. All of these ORFs are relatively short and probably serve as nuclear DNA- or chromatin-binding proteins. In addition to the three proteins with S. cerevisiae ATE1 by A. thaliana ATE1 coding sequence might allow to study additional features, similarities and differences between the two enzymes. AtATE1 activity has been demonstrated in vitro , and for RIN4-III the in planta turnover status could also not be resolved, although a slight stabilization in the ate1 ate2 background could be detected for a fusion protein containing this fragment at amino-terminal position . This is consistent with the published results that this fragment is not a good in vivo substrate for PRT6 . Western blotting  allowed us to demonstrate the contribution of PRT6 to turnover. It is possible that mutants in well-known yeast quality control ligases such as SAN1  could imThe original contributions presented in the study are included in the article/AK, NW, TT, JR, KR, LN, CD, TB, SB, and GS carried out the experiments. NW, MJH, and AB designed the experiments and contributed to manuscript writing. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "To compare fetuses with intrauterine growth restriction (IUGR) and those with normal growth, in terms of skull and brain measurements obtained by magnetic resonance imaging (MRI).This was a prospective cohort study including 26 single fetuses , evaluated from 26 to 38 weeks of gestation. Using MRI, we measured skull and brain biparietal diameters (BPDs); skull and brain occipitofrontal diameters (OFDs); corpus callosum length and area; transverse cerebellar diameter; extracerebral cerebrospinal fluid (eCSF); and right and left interopercular distances (IODs).p = 0.0029); brain BPD ; skull OFD ; eCSF ; right IOD ; and left IOD . The skull BPD/eCSF, brain BPD/eCSF, skull OFD/eCSF, and brain OFD/eCSF ratios were also lower in IUGR fetuses.The following were significantly smaller in IUGR fetuses than in control fetuses: skull BPD (76.9 vs. 78.2 mm; IUGR fetuses had smaller OFD and BPD, both skull and brain, and less eCSF when compared to normal growth fetuses. The variety of etiologies and the lack of prenatal interventions to prevent or correct growth deficit make the management of IUGR a challenge. The leading cause of IUGR (responsible for 80% of cases) is placental insufficiency, which results in progressive and relatively predictable fetal impairment.Intrauterine growth restriction (IUGR), which occurs in 5-10% of pregnancies, is a major cause of perinatal mortality and morbidity, resulting in disorders of psychomotor and neuromotor development, as well as cardiovascular diseases and endocrine disorders in adults,4. Although ultrasound is the primary modality for evaluating the fetus, ultrasound examinations have limited ability to detect these types of abnormalities. Fetal magnetic resonance imaging (MRI) adds information to ultrasound examinations and is a highly accurate method for the early detection, confirmation, or exclusion of suspected changes. It has been used in order to estimate fetal brain oxygenation or to evaluate brain changes due to IUGR,6. Some MRI-based studies have shown that IUGR neonates have reduced gray matter and hippocampal volumes, as well as significant delays in cortical development, with conflicting patterns of gyration and sulcation,8. In a recent study, Kyriakopoulou et al. quantified the brain growth of normal fetuses throughout the second half of pregnancy using two-dimensional and three-dimensional biometric parameters on MRI scans. Thus, the cranial MRI scans of IUGR fetuses could be compared with those of normal fetuses, which would improve knowledge of the neurodevelopmental patterns associated with fetal malnutrition. Therefore, MRI may be an auxiliary method for diagnosing neurological lesions associated with chronic fetal hypoxia and for the early identification of fetuses at high risk for future neurological impairment. However, the few MRI studies of IUGR fetuses have limited clinical applicability, especially because of the long acquisition time and complex image processing, which are often affected by fetal movement. Therefore, the objective of this study was to compare the MRI measurements of the skull and brain obtained in IUGR fetuses with those obtained in normal fetuses.The neurological deficits associated with IUGR seem to be the result of brain reorganization, as suggested by studies showing differences between infants with and without IUGR in terms of brain metabolism, morphology, and connections, as well as neurological microstructureThis was a prospective cohort study including singleton IUGR fetuses (IUGR group) and normal fetuses (control group), all evaluated from week 26 to week 38 of gestation. The control group comprised one healthy fetus for each week of gestation , the pregnant women having been randomly selected from the database of our institution, and the IUGR group comprised one IUGR fetus for each respective week of gestation, the diagnosis of IUGR having been established during ultrasound examinations of the pregnant women. Therefore, the fetus pairs were matched for gestational age (GA), as calculated from the date of the last menstrual period and confirmed by ultrasound in the first trimester. In the control and IUGR groups, the MRI examination was performed within three days after the ultrasound. All of the pregnant women were recruited from among those screened in 2016 at the Hospital das Cl\u00ednicas of the University of S\u00e3o Paulo at Ribeir\u00e3o Preto Medical School. This study was approved by the Research Ethics Committee of the Hospital das Cl\u00ednicas (Reference no. 13840/2015), and all participants gave written informed consent.. In the control group, birth weights were appropriate for GA, defined as being between the 10th and 90th percentiles, and the umbilical artery (UA) Doppler ultrasound findings were normal.The control group included pregnant women referred for MRI after ultrasound, according to defined clinical criteria such as maternal diseases, suspected fetal congenital anomalies, obesity preventing adequate fetal ultrasound evaluation, and suspected placental diseases: an estimated fetal weight (EFW) below the 3rd percentile or between the 3rd and 10th percentiles; and a UA resistance index (RI) above the 95th percentile, with or without a cerebroplacental ratio (CPR) < 1. Pregnant women in whom there were major structural or chromosomal fetal abnormalities diagnosed in the neonatal period were excluded, as were those who were lost to follow-up and those who had claustrophobia severe enough to preclude MRI. All of the women were followed to delivery. Apgar scores, hospitalizations in neonatal intensive care units, and adverse perinatal outcomes were recorded.The IUGR group included pregnant women in whom no fetal structural abnormalities were identified and a diagnosis of IUGR was made on the basis of the consensus criteria established by Gordijn et al., and EFW. The single deepest pocket of amniotic fluid was measured and considered abnormal if below the 5th percentile for the GA. Doppler ultrasound of the UA was obtained at the level of umbilical cord insertion into the placenta and was considered abnormal if the RI was above the 95th percentile. Doppler ultrasound of the middle cerebral artery was obtained at the circle of Willis after its origin from the internal carotid artery, and an RI below the 5th percentile was considered abnormal. The CPR was calculated as the ratio between the RI of the middle cerebral artery and that of the UA, the ratio being considered abnormal if < 1. Doppler ultrasound of the ductus venosus was obtained in the longitudinal plane of the fetal upper abdomen, beginning at the umbilical portion of the portal vein, a pulsatility index above the 90th percentile being considered abnormal.The same ultrasound system  was used in all ultrasound evaluations. The following biometric parameters were measured: biparietal diameter (BPD), occipitofrontal diameter (OFD), head circumference (HC), femur length, abdominal circumference (AC), cephalic indexhttps://www.osirix-viewer.com/osirix/overview/). Linear dimensions were calculated from images reconstructed from sequential MRI slices, including brain BPD and OFD; skull BPD and OFD; HC; corpus callosum length and area; pons width and height; transverse cerebellar diameter; cerebellar vermis height, width, and area; left and right atrial diameters; extracerebral cerebrospinal fluid (eCSF); and left and right axial and coronal interopercular distances (IODs).The MRI scans were acquired in a 3.0-T scanner . A 16-channel body coil was positioned anteriorly over the maternal abdomen and centered on the fetal brain, which was evaluated in the coronal, sagittal, and axial planes with single-shot turbo spin-echo T2-weighted sequences, with additional axial T1- and T2-weighted fat-saturated gradient-echo and diffusion-weighted sequences. All MRI scans were saved as Digital Imaging and Communications in Medicine format files in the Picture Archiving and Communication System and subsequently transferred to a workstation  IODs were measured in the transverse plane of the fetal skull and corresponded to the distances between the anterior and posterior edges, respectively, of the Sylvian fissure in its outer brain portion, at the level of the 3rd ventricle. The left and right craniocaudal  IODs were measured in the coronal plane of the fetal skull and corresponded to the distances between the upper and lower edges, respectively, of the Sylvian fissure in its outer brain portion, also at the level of the 3rd ventricle .p < 0.05 were considered statistically significant.The data were analyzed with the Statistical Package for the Social Sciences, version 13.0 . The primary outcome measures were the dimensions of the brain structures. Secondary outcome measures were the Apgar scores, hospitalization in a neonatal intensive care unit, adverse perinatal outcomes . In both groups, differences between variables were analyzed with the Wilcoxon test (for continuous variables) or the chi-square test . Values of A total of 78 pregnant women were enrolled. Of those 78 women, 52 were excluded from the analysis, for the following reasons: failure to appear for the MRI (n = 6); claustrophobia (n = 16); missing data in medical records (n = 9); having delivered before the MRI (n = 18); and major fetal structural anomalies having been detected on MRI (n = 3). Therefore, the final sample comprised 26 pregnant women (13 in each group). Demographic variables of the women are shown in p = 0.054). There were also significant differences in terms of the eCSF measurements, the eCSF being below the 10th percentile present in nine (69.2%) of the IUGR fetuses compared with only two (15.4%) of the control fetuses, as well as in terms of the skull BPD/eCSF, brain BPD/eCSF, skull OFD/eCSF, and brain OFD/eCSF ratios, all of which were lower in the IUGR fetuses. Left and right axial IODs were smaller in the IUGR fetuses.p = 0.002). No significant differences were observed between the IUGR and control groups considering Apgar scores. found that maternal age > 35 years is an independent risk factor for IUGR. In the present study, we found no significant association between maternal smoking and IUGR, probably because our sample size was relatively small. Hammoud et al. reported that, although maternal smoking had no effect on fetal HC or femur length growth rates, fetal AC growth rates were lower among women who smoked during pregnancy than among those who did not.The findings of the present study provide a better understanding of possible cranial changes in IUGR fetuses. Maternal age was the only demographic variable that differed between the IUGR and control groups. Odibo et al. analyzed pregnant women with IUGR fetuses and reported that neurological outcomes were worse when the BPD growth rate was < 40% and the birth weight was < 700 g.We found no significant differences in BPD, as measured with ultrasound, between the IUGR and control groups. However, the BPD percentile was significantly lower for the IUGR fetuses than for the control fetuses. Hasegawa et al. used diffusion-weighted MRI scans to evaluate the reorganization of white matter brain connections in one-year-old IUGR infants, trying to correlate their findings with neurodevelopmental outcomes evaluated with the Bayley Scales of Infant and Toddler Development. The authors reported significant differences between the IUGR and control infants, showing a correlation between abnormalities of connectivity and poorer performance in the IUGR infants. Lepp\u00e4nen et al. followed extremely low birth weight infants until two years of age and concluded that intracranial Doppler ultrasound parameters were related to intracranial volume, and that reduced brain volume was associated with abnormal neurological outcomes. Those data are relevant, given that more than half (53.8%) of the IUGR fetuses in our study presented an abnormal CPR. However, the probability of IUGR insults leading to abnormal development of brain structures varies by structure, because no significant differences were seen between the IUGR and control fetuses in terms of the dimensions of the fetal HC, pons, and cerebellum.In the present study, fetal MRI showed that skull and brain BPDs were significantly lower in the IUGR group, as were skull OFDs. Batalle et al. found that IUGR fetuses showed reduced gray and white matter, in a distribution pattern different than that seen in normal fetuses, with significant reductions in the size of the temporal and insular lobes. Therefore, a reduced axial IOD may be directly related to a reduction in the size of the temporal lobe. CSF is produced by the choroid plexus in the lateral, third, and fourth cerebral ventricles, circulating through the subarachnoid space between the arachnoid mater and the pia mater, and its measurement is predominantly affected by the development of the temporal lobes. We identified a significant difference between IUGR and control fetuses in terms of the size of the eCSF. The differences between the two groups in terms of the skull BPD/eCSF, brain BPD/eCSF, skull OFD/eCSF, and brain OFD/eCSF ratios, all of which were lower in the IUGR fetuses, suggesting that IUGR results in a relevant reduction in the CSF. Another hypothesis to explain CSF reduction is the destruction of the blood-brain barrier caused by a hypoxic process, which would allow the passage of a greater quantity of CSF than could be reabsorbed.This study presented some interesting additional findings related to the IOD and eCSF. Right and left axial IOD measurements were smaller in IUGR fetuses than in the control fetuses. The cerebral operculum contains parts of the frontal, temporal, and parietal lobes that cover the insula and unite to form the sylvian fissure. Ega\u00f1a-Ugrinovic et al.The strengths of the present study include the facts that we evaluated the fetuses in accordance with strict growth restriction criteria and that we followed the subjects prospectively, as well as that the fetal ultrasound and MRI images were analyzed by specialists in the respective fields. In addition, the technique described here has the potential to be a simpler method to evaluate growth-restricted fetuses. The main limitation of our study was the relatively small sample size. Consequently, studies involving larger samples should be conducted before this technique is incorporated into clinical practice.In summary, the skull BPD, brain BPD, skull OFD, brain OFD, HC, eCSF, and axial IOD are all smaller in IUGR fetuses. There is a need for further studies evaluating the impact that those aspects have on the psychomotor and neuromotor development of IUGR children."}
+{"text": "To mitigate the potentially devastating effects of the COVID-19 pandemic, it is vital to identify psychosocial and moral resources. The care, preservation, protection, and well-being of social communities are attributes of prosocial behavior that can be such a resource. The purpose of the study is to identify the features of prosocial orientation of Russian youth during the COVID-19 pandemic, as well as to identify strategies for prosocial behavior during the COVID-19 pandemic. The sample consisted of 447 people. The study was conducted in May 2020 in the form of an online survey of subjects using Google Forms . The research made it possible to establish that Russians were dominated by norms of care, fairness, purity; values of benevolence-universalism, security, and self-direction. During the COVID-19 pandemic, the prosocial orientation of Russians may manifest itself in the following behavioral strategies: proactive prosocial strategy of \u201ccaring for others\u201d ; egoistic strategy of prosocial behavior \u201cself-care through caring for others\u201d ; conventional prosocial strategy \u201cself-care\u201d (self-isolation and preventive behavior). In the long run, it is necessary to identify personal and environmental resources that allowed people to effectively implement a prosocial self-isolation strategy during the COVID-19 pandemic, as well as various forms of volunteerism. Changing of our collective behavior is crucial to saving lives in the face of a new infectious disease. To mitigate the potentially devastating effects of the COVID-19 pandemic, it is vital to identify psychosocial and moral resources  as a social responsibility norm (encourages a person to help those who need it), a social reciprocity norm (people should help those who help them), a social fairness norm (rules on fair and just distribution of resources) , \u201cfairness\u201d (\u201chonesty\u201d) , \u201cloyalty\u201d (\u201ccollectivism\u201d) , \u201crespect for authority\u201d (\u201cpower\u201d) , \u201cpurity\u201d (\u201choliness\u201d)  . The goal of the media project is to draw attention to professionalism, altruism, caring, and empathy, which in all its forms helped individuals, cities, countries, and the whole of humanity to win the fight against the pandemic. The site contains stories about the helping behavior, heroism and self-sacrifice of doctors, patients, scientists, teachers, politicians, civil servants, businessmen, law enforcement, military, civil activists, volunteers, journalists, and ordinary people  or prosocial perception  of others for a number of indicators  declared their readiness to provide volunteer assistance to people under quarantine, including single people. Every sixth Russian (15%) has already had to provide gratuitous help to elderly people or those who are under home quarantine due to the coronavirus .In the face of a pandemic, a proactive strategy of prosocial behavior shall be a strategy of \u201ccaring for another person,\u201d which can exist in the form of volunteering, charity, and situational help to a stranger. The proactive strategy bases on the ethics of \u201clove for a distant\u201d and \u201cduty motives,\u201d and is related to the ability to accumulate and use economically any kind of resources necessary to achieve time-distant life goals    who participated in a sociological poll are self-isolating. Moreover, 76% have limited their contacts, stay at home or have gone to a faraway location WCIOM, .As Leontiev notes, sociological researches allow to fix the change of attitude to many realities being on the surface of consciousness , university students in Moscow, Ivanovo, Kostroma, Yaroslavl; 57.7%\u2014had experience in volunteer activities. A sampling is formed from young persons, because they are the most active and mobile part of society, involved in various social processes , and are faster to respond to the changes and adapt to them, including those related to the moral and value orientations.The sample consisted of 447 people  aged 17 to 25 years . All universities taught using distance learning, and students were studying at home. Anti-epidemic restrictions were in effect in the cities . The procedure of \u201cconvenience\u201d sampling was used; the students voluntarily took part in the research for additional points in the academic ranking. The study was conducted in May 2020 in the form of an online survey of subjects using Google Forms. Students were sent an email to their personal e-learning accounts.The prosocial orientation was assessed based on indicators of the moral norms development and value orientations.During the COVID-19 pandemic, it is important that people take care of the health and well-being of others. Care can be expressed in donations, participation in volunteer actions, psychological support, observance of social distance and rules of behavior, etc. Answer the questions given the COVID-19 pandemic situation.\u201dThe initial stimulus used for the survey was \u201cThe evaluation of the level of moral norms development was carried out with the help of Moral Foundations Questionnaire method (MFQ)  , Pearson's correlation analysis. Calculations were made based on the SPPS 23 statistical software package.The resulting empirical data were processed using Friedman's two-factor dispersion analysis for related samples, hierarchical cluster analysis (intergroup bonding method), Mann-Whitney The study was conducted in accordance with the ethical code of The Russian psychological society, and the Protocol was approved by the Academic Council of the faculty of psychology of the Russian State Social University (Protocol No. 4 of 28.04.2020) and with the ethical standards of the World Medical Association Declaration of Helsinki. The questionnaire included the item \u201cI confirm that I have read and understood the purposes, procedure, method, and possible inconveniences of participation in the research. I give my consent to participation in the research. I can give up or end the questionnaire at any time.\u201dThe research revealed that for all scales of MFQ technique, the average values correspond to the average level of moral norms development (from 17 to 27 points). Quite high indicators of internal consistency of the questionnaire scales were confirmed  see . FriedmaTo identify the value orientations (indices) of Russians using the PVQ-21 method, an arithmetic mean (from 1 to 6) was calculated for each scale since the scales were measured in different ranges. The research made it possible to establish that for all scales of the PVQ-21 method, the average values correspond to the average level of formation of value indices (from 3 to 4 points). Quite high indicators of internal consistency of the questionnaire scales were confirmed . Friedman's two-factor dispersion analysis was used to identify dominant value orientations in the sample under study see .To test the second hypothesis of three prosocial behavioral strategies  for Russians during the COVID-19 pandemic, a hierarchical cluster analysis (intergroup communication method) was conducted see , 2.U-test , we compared two groups using Mann-Whitney test see .A linear regression analysis (step method) was performed to identify Russians' prosocial orientation predictors during the COVID-19 pandemic see .Pearson's correlation analysis also revealed the existence of correlation relationships between the value indices of benevolence-universalism (care), conformism, security, stimulation, self-direction (PVQ-21) see .The data in The cluster analysis allowed to distinguish three classes (types) of social orientation of Russians during the COVID-19 pandemic see , 2.The first type of social orientation can be characterized as \u201ccaring for others\u201d proactive prosocial strategy. This type is defined by the moral norms of care, fairness and purity (MFQ) or the values of benevolence , self-discretion and stimulation (PVQ-21). Harvey and Erdos note that the psychological factors of risk-assisted behavior in an emergency area are altruism, heroism, and prosocial orientation of the individual  (MFQ) or the values of security and conformism (PVQ-21), can be described as a conventional strategy. Conventional norms directly relate to the \u201cself-care\u201d prosocial strategy through respect for sanitary standards and norms of social distance. Campos-Mercade et al., The third type of social orientation can be described as a selfish strategy \u201cself-caring through caring for others,\u201d defined by the values of hedonism and achievement-power (PVQ-21). Studies conducted in China have shown that prosocial coping with psychological pressures and stresses caused by the COVID-19 pandemic contributed to reducing mental health problems . Yamamoto notes that as social animals, we humans strive for contact, compassion, and concern for nature and others ; egoistic strategy of prosocial behavior \u201cself-care through caring for others\u201d ; conventional prosocial strategy \u201cself-care\u201d (self-isolation and preventive behavior).In the long run, it is necessary to identify personal and environmental resources that allowed people to effectively implement a prosocial self-isolation strategy during the COVID-19 pandemic, as well as various forms of volunteerism.The resulting empirical results should be interpreted in light of several important limitations. First, it was a \u201cconvenience sampling.\u201d Thus, temporal order and causality cannot be verified. Future studies should use some longitudinal structures for further examination of the regularities we have found. The sampling is not necessarily representative for the entire Russian society. Replication with the use of different sampling methods  is necessary. Future studies can confirm the reliability of the obtained results by analyzing various forms of prosocial behavior directly during the COVID-19 pandemic  and personal characteristics .https://www.europeansocialsurvey.org/about/country/russian_federation.Publicly available datasets were analyzed in this study. This data can be found here: The studies involving human participants were reviewed and approved by Academic Council of the faculty of psychology of the Russian State Social University (Protocol No. 4 of 28.04.2020). Written informed consent for participation was not required for this study in accordance with the national legislation and the institutional requirements.PK conducted a comprehensive analysis of the state of research on the problem of prosocial behavior. ES justified the methodological basis of the study. Both authors conducted analytical work on the processing and analysis of the results of empirical research.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "In unmanned aerial vehicle (UAV)-assisted networks, UAV acts as an aerial base station which acquires the requested data via backhaul link and then serves ground users (GUs) through an access network. In this paper, we investigate an energy minimization problem with a limited power supply for both backhaul and access links. The difficulties for solving such a non-convex and combinatorial problem lie at the high computational complexity/time. In solution development, we consider the approaches from both actor-critic deep reinforcement learning (AC-DRL) and optimization perspectives. First, two offline non-learning algorithms, i.e., an optimal and a heuristic algorithms, based on piecewise linear approximation and relaxation are developed as benchmarks. Second, toward real-time decision-making, we improve the conventional AC-DRL and propose two learning schemes: AC-based user group scheduling and backhaul power allocation (ACGP), and joint AC-based user group scheduling and optimization-based backhaul power allocation (ACGOP). Numerical results show that the computation time of both ACGP and ACGOP is reduced tenfold to hundredfold compared to the offline approaches, and ACGOP is better than ACGP in energy savings. The results also verify the superiority of proposed learning solutions in terms of guaranteeing the feasibility and minimizing the system energy compared to the conventional AC-DRL. Unmanned aerial vehicle (UAV)-assisted communication has been widely applied to various domains, e.g., aerial inspection, precision agriculture, traffic control, and after-disaster rescue . CompareHowever, one of the most critical issues of UAV-assisted networks is the limited on-board energy, which may shorten the UAVs\u2019 endurance and lead to service failure. Therefore, minimizing the UAV\u2019s energy consumption is of great importance. In , the autThe user scheduling schemes in , 9 are bOptimization-based solutions, e.g., successive convex approximation  or LagraDeep reinforcement learning (DRL) learns the optimal policy from the interaction between environment and actions, instead of directly solving the optimization problem. DRL combines artificial neural networks with a reinforcement learning architecture to improve learning efficiency and solution quality. Different from deep neural networks (DNNs), DRL is not necessary to prepare a large amount of data in advance for offline training. To maximize the energy efficiency, the authors in  and 15]15] appliActor-critic-based DRL (AC-DRL) can tackle both discrete and continuous action space. For the problem with continuous variables, e.g., power control, AC-DRL adopts a stochastic policy to select an action by probability. In , an enerWe formulate a non-convex mixed-integer programming (NCMIP) problem to minimize both backhaul energy and access energy in UAV-assisted networks.To approach the optimum, we first transform the non-linear terms to linear by piecewise linear approximation and McCormic envelopes, leading to a mixed-integer linear programming (MILP) problem, which can be solved optimally by branch and bound (B&B).We provide a near-optimal algorithm with lower computation time than the optimal method. First, the original NCMIP problem is relaxed to a continuous optimization problem. Second, the relaxed problem is converted to a linear programming (LP) problem by piecewise linear approximation. Then, the heuristic solutions can be obtained after taking a rounding-up operation.Being aware of the high-complexity optimization methods, we propose ACGP and ACGOP learning schemes. To enable the learning algorithms to adapt to the considered NCMIP, in ACGP and ACGOP, we improve the conventional AC-DRL by a set of approaches, i.e., action filtering and reward re-design, to improve learning performance and avoid infeasible solutions.From the numerical results, we conclude that, compared with non-learning algorithms, ACGP and ACGOP have superiority in computational time efficiency, while compared with conventional AC-DRL, ACGP and ACGOP achieve better performance in delivering feasible solutions. Experiments also show that the combined learning-optimization scheme, i.e., ACGOP, achieves better energy-saving performance than ACGP.The rest of the paper is organized as follows. Section In this paper, we propose two tailored AC-DRL-based schemes: AC-based user group scheduling and backhaul power allocation (ACGP), and joint AC-based user group scheduling and optimization-based backhaul power allocation (ACGOP). The main contributions are summarized as follows:Notations: Some mathematical operators are defined as follows. For a vector x and y, x and a variance y. For a random variable X, X.K single-antenna GUs and each has I is the maximum number of timeslots, given by We consider a UAV-assisted communication system including both backhaul and access links, as shown in Fig. mentclass2pt{minimThe ABS and UAV are equipped with ve model  which islocation . The matng level . Thus, tK. The group combination is g, and k-th GU of the g-th group. We form g. Based on the MMSE, the precoding vector k-th column of the MMSE precoding matrix k in group g is fixed, denoted as g can be expressed as:From Fig.  applied . The siglication , we assumentclasspt{minimaU [The propulsion power can be modeled as a function with regards to the flying velocity U , which iS is expressed as S is a constant parameter such that the flying velocity that minimizes the flying energy is:In the hovering phase, the UAV flies circularly around a hovering point with a small radius. To minimize the hovering power, the hovering velocity is given by: methods . Therefoprotocol , the minIn the considered scenario, the UAV visits and serves each cluster\u2019s data requests in a sequential manner according to the predetermined trajectory and visiting orders. Before taking off, the UAV pre-optimizes the trajectory according to different requirements at the dock station. We keep the trajectory design flexible. For example, if the UAV task is time-critical, the flying path can be determined by the clusters\u2019 priorities, e.g., the higher-priority cluster is served first. If the task is energy-critical, we apply Dijkstra\u2019s algorithm to obtain the shortest or minimal cost path which is mainly adopted in this paper .The timeline of UAV actions is depicted in Fig. The main notations are summarized in Table Our goal is to minimize the total system energy consumption via a joint design for user-timeslot scheduling and backhaul power allocation subject to the users\u2019 quality of service requirements. The total energy consumption consists of four parts: (1) the flying energy, (2) the hovering energy, (3) the backhaul transmission energy, and (4) the access transmission energy. As analyzed in the previous section, the flying energy is independent from the scheduling and power transmission decisions and hence can be skipped in the joint design. On the other hand, the hovering energy is determined by the transmission time and hence needs to be optimized.We denote a set of binary variables indicating timeslot allocation as follows:given in  and 15)\\documentIn , the fird on Eq.  guaranted on Eq.  states td on Eq.  is to avd on Eq.  upper bostraints  and (19gDue to the non-convex items t}dbh(\u03bc) . Thus, tnvelopes . The resnvelopes . When thg and the backhaul link are continuous values:To reduce the computation time of the problem nt}P2 in . After rx method . In pracWhen Being aware of the high computation complexity of the iterative optimal and suboptimal algorithms, We develop ACGP and ACGOP toward real-time applications.t, the current environment is represented as a state To make the paper self-contained, we provide a brief overview of the adopted AC-DRL framework first. Basic RL is modeled as a Markov decision process (MDP) with three elements: state, action and reward. At each time step  methods . AC-DRL a under state t, an action For the actor, the stochastic policy is applied, which is denoted as nt}\u03c7(st) . At eachficiency . In TD l theorem , the graHowever, approximating vergence . To redu Q-value . Thus, wThe GUs\u2019 requests have been completed.The service runs out of time.Based on the AC-DRL framework, we consider two schemes: (1) A straightforward learning approach ACGP, i.e., the agent makes decisions for all the variables. (2) A combined AC learning and simple optimization approach, i.e., ACGOP.We first reformulate P1 by defining states, actions, and rewards, such that an RL framework can apply. Next, we propose two AC-based solutions with highlighting the differences from conventional AC-DRL and tailored design for solving k at timeslots t. The actions t, given by:For ACGP, the system states ed by Eq.. Then, tproblems , where \\In ACGOP, we observe that when user scheduling is fixed, the remaining backhaul power allocation becomes a single-variable optimization problem that is computationally light. Thus, the agent in ACGOP only takes actions for user scheduling while the backhaul power is determined by an efficient golden-section search approach. Specifically, the state Assumeis a unique function with a unique minimum point inSee appendix Figure mentclass2pt{minimn search . After td by Eq. . The enex to a continuous space x to a discrete space Denote The size of discrete space All the constraints in 1 except  can be m1 except  cannot bnegative . Second,acing Eq., Eq. : McCormick envelopes + B&B  : ApplyinIn addition, we simulate two conventional AC-DRL schemes based on [In this section, we evaluate the performance of the proposed solutions and other three non-learning benchmarks:based on  for perfThe parameter setting is similar to that in . We consmentclass2pt{minimd by Eq. , respect05 (GHz) . The maxTwo fully connected DNNs are employed as the actor and the critic. The adopted parameters in ACGOP and ACGP are summarized in Table K. We can observe that ACGOP has 3.97% gap to the optimum, while for ACGP, the gap increases to 10.27%. Prop-HEU obtains a near-optimal solution with 1.61% average gap but requires much more computation time, e.g., see Fig. We compare the performance of the algorithms in terms of energy minimization and computation time. Figure Figure K. The computation time refers to the time from giving inputs to algorithms until receiving the results. From Fig. K. When K=10, the computation time reaches 11 (s) and 90 (s), respectively. ACGOP, ACGP, and SUS-HEU can provide online solutions by applying the after-learned DRL policy or low-complexity SUS strategy to avoid directly solving complex optimization problems, thereby saving tenfold to hundredfold computation time compared with OPT and Prop-HEU. The average computation time of the three algorithms is relatively close. However, by recalling the energy-saving performance, ACGOP saves 8.21% and 15.28% energy compared to ACGP and SUS-HEU, respectively.Figure Figures Figures In Fig. In this paper, we studied a joint user-timeslot scheduling and backhaul power allocation problem to minimize the energy consumption of UAV-assisted communication systems. We developed an optimal method and a heuristic algorithm as the non-learning benchmarks. Due to the high computation time, the above methods cannot provide real-time solutions. We then proposed two learning schemes, i.e., ACGP and ACGOP, based on actor-critic deep reinforcement learning. Different from conventional AC-DRL, the proposed ACGOP combines AC and optimization to accelerate learning performance. In addition, we design a set of approaches, such as action filtering and reward re-design, to reduce huge action space and guarantee feasibility. Numerical results demonstrated that ACGOP and ACGP improve computational efficiency and guarantee solution feasibility. Simulations also showed that ACGOP achieves better energy-saving performance than ACGP.An extension of the current work is to investigate the robustness of the communication links. Considering link failure probability and allowing re-transmission, we can develop an energy-saving and robust joint user group scheduling and re-transmission scheme for UAV networks."}
+{"text": "Adolescents are likely to suffer from negative emotions such as depression and anxiety due to the rapid development of biological, cognitive and social changes. Previous studies have indicated possible risk (rumination) and protective  factors for depression and anxiety among this age group. The present study is the first to investigate the association between social support and negative emotions during the Outbreak of Omicron variant, on this basis, to further determine the mediating role of rumination and sleep quality on this link.Mage = 13.80, SD = 1.20) completed a psychosocial battery, including the Social Support Rating Scale (SSRS), the Pittsburgh Sleep Quality Index (PSQI), the Ruminative Responses Scale (RRS), the Depression Anxiety Stress Scale (DASS). Serial multiple mediation analysis was conducted using PROCESS macro based on SPSS.A total of 1,065 Chinese middle- and high-school students . Further, rumination and sleep quality were found to partially mediate the relationship between social support and negative emotional states.For early detection and prevention of depression and anxiety, providing sufficient social support is necessary for adolescents, because rumination and sleep problems are reported during stressful periods, such as the COVID-19 pandemic. Negative emotions such as depression and anxiety are common when facing a life-threatening event like the COVID-19 pandemic . These nResearch has revealed key predictors of negative emotional states such as social support, sleep quality, rumination and allostatic load \u20138. SociaRumination is a type of unpleasant experience that individuals present repetitive and passive thinking about the same event or thing . SeveralAmong the many pathways, sleep appears to have a particularly important role . A relatTo our knowledge, no previous studies have explored the associations among of social support, sleep quality, rumination, and negative emotional states. Therefore, the aim of the present study was to propose a serial multiple mediation model to examine the mediating effects of sleep quality and rumination between social support and negative emotional states. Accordingly, we hypothesized that: (1) negative emotional states would be negatively correlated with social support and sleep quality, and positively correlated with rumination; (2) rumination and sleep quality play mediating roles in the relationship between social support and negative emotional states.n = 114) were removed, and valid answers were obtained from 1,065 participants . This study protocol (PN-2020-041) was approved by the ethical committee of Shenzhen University before data collection.Four high schools (HS) from Shenzhen, China, were selected from March to April 2022 using convenience sampling. Students aged 12\u201318 years old from the selected schools were recruited. Permission for this in-school survey was obtained before the investigation from schools, legal guardians, and students. Participants were asked to complete an electronic questionnaire through a platform , with the background, aim, and anonymity of the study being presented at the top of the questionnaire. A total of 1,179 HS and junior high school (JHS) students volunteered to take part in this study. After all the participants had completed the study, the data with and unacceptably short duration for response (<3 min to complete the e-questionnaire), or failing the lie detector quiz ],The Chinese version of the Pittsburgh Sleep Quality Index (PSQI) was used to measure sleep quality in the sample , 37. ThiThe Ruminative Responses Scale (RRS) is a widely used self-administered measure of rumination , 39. It Social support was assessed using the Social Support Rating Scale . The SSr = \u22120.12, p < 0.001) and sleep quality  but it is positively linked to negative emotion , it was considered as a covariate in this study.Sedentary time was also measured using a part of the International Physical Activity Questionnaire-short form . A SD). Pearson's correlation was used to examine the association between each two continuous variables, after controlling for several co-variables including gender, age and BMI (Body mass index). To understand the mechanism of social support, sleep quality, rumination and negative emotional states, hypothesized mediation analyses were examined using the PROCESS macro. Multiple mediation analyses were based on bootstrapping  with 95% confidence intervals (CI). An effect was considered as significant at the 0.05 level if the 95% bias-corrected bootstrap CI of the mediation effect does not contain zero. Gender, age and BMI were considered as covariates in the model. P-values < 0.05 were considered statistically significant when a two-tailed test was used.Data were analyzed with SPSS 22.0 and PROCESS which is a widely used a macro program for SPSS to analyze mediation and moderation models . DescripResults for gender difference on socio-demographic and anthropometric variables are presented in Correlations for the key study variables under the control of gender, age and BMI are presented in Multiple mediation analysis was conducted in PROCESS to explore the mediators of social support and negative emotional states among teenagers, with gender, age, BMI, and sedentary time as covariates. The total, direct, and indirect effects are listed in The aim of the present study was to examine the possible links between social support, rumination, sleep quality and negative emotional states . Consistent with previous studies \u201347, our The allostatic load model suggests that when repetitive allostatic responses are activated, the body undergoes a cumulative \u201cwear and tear\u201d which may become an important trigger for negative emotional states such as depression and anxiety . SpecifiThe results of the multiple mediation model further showed that the sleep quality related to rumination was another significant mediator of the association between social support and negative emotional states, extending previous findings about this relationship among older adults . SpecifiFurthermore, the most critical finding of the present study was that social support exerts an influence on negative emotional states is mediated by rumination and sleep quality among Chinese adolescents. Specifically, the pathway is social support \u2192 rumination \u2192 sleep quality \u2192 negative emotional state. COVID-19 outbreak is a very serious life stress event, which is likely to cause negative emotional states such as depression and anxiety . We holdSeveral limitations of this study should be mentioned. Firstly, allostatic load is a well-researched theory that has been very influential in terms of the generation and development of negative emotions. However, due to the epidemic, this study could not collect the relevant physiological data of the allostatic load model. Secondly, this study did not rule out the existence of other potential mediating variables. Thirdly, social support was measured by self-report of perceived support, which could be influenced by one's state of emotions. Lastly, a cross-sectional examination of the mediation model was performed, which limits conclusions about causality.The original contributions presented in the study are included in the article/supplementary materials, further inquiries can be directed to the corresponding authors.The studies involving human participants were reviewed and approved by the Ethical Committee of Shenzhen University. Written informed consent from the participants' legal guardian/next of kin was not required to participate in this study in accordance with the national legislation and the institutional requirements.LZ and TG participated in the design of the study and the manuscript editing. ZZ and TG participated in the manuscript drafting and data reduction/analysis. AT and DH contributed to data reduction/analysis and manuscript editing. AY and AK contributed to the interpretation of results and manuscript editing. All authors have approved the final version of the manuscript and agreed with the order of presentation of the authors.This project was supported by National Natural Science Foundation of China (31871115), Start-up Research Grant of Shenzhen University (20200807163056003) and Start-Up Research Grant (Peacock Plan: 20191105534C).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "Salinispora arenicola during induced heterologous symbiosis with a wild Solanaceae plant Nicotiana attenuata under in vitro conditions. Here, we further explore the heterologous symbiotic association, germination, growth promotion, and stress relieving activity of S. arenicola in tomato plants under agricultural conditions and dig into the possible associated mechanisms. Tomato plants were grown under normal and saline conditions, and germination, bacteria-root system interactions, plant growth, photosynthetic performance, and the expression of salt stress response genes were analyzed. We found an endophytic interaction between S. arenicola and tomato plants, which promotes germination and shoot and root growth under saline or non-saline conditions. Accordingly, photosynthetic and respective photoprotective performance was enhanced in line with the induced increase in photosynthetic pigments. This was further supported by the overexpression of thermal energy dissipation, which fine-tunes energy use efficiency and may prevent the formation of reactive oxygen species in the chloroplast. Furthermore, gene expression analyses suggested that a selective transport channel gene, SlHKT1,2, induced by S. arenicola may assist in relieving salt stress in tomato plants. The fine regulation of photosynthetic and photoprotective responses, as well as the inhibition of the formation of ROS molecules, seems to be related to the induced down-regulation of other salt stress response genes, such as SlDR1A-related genes or SlAOX1b. Our results demonstrate that the marine microbial symbiont S. arenicola establishes heterologous symbiosis in crop plants, promotes growth, and confers saline stress tolerance. Thus, these results open opportunities to further explore the vast array of marine microbes to enhance crop tolerance and food production under the current climate change scenario.To ensure food security given the current scenario of climate change and the accompanying ecological repercussions, it is essential to search for new technologies and tools for agricultural production. Microorganism-based biostimulants are recognized as sustainable alternatives to traditional agrochemicals to enhance and protect agricultural production. Marine actinobacteria are a well-known source of novel compounds for biotechnological uses. In addition, former studies have suggested that coral symbiont actinobacteria may support co-symbiotic photosynthetic growth and tolerance and increase the probability of corals surviving abiotic stress. We have previously shown that this activity may also hold in terrestrial plants, at least for the actinobacteria  Plant biostimulants (PBs) based on microorganisms have emerged as sustainable alternatives to traditional agrochemicals by enhancing plant stress tolerance and increasing crop yields and quality under suboptimal conditions. Nowadays, PBs are becoming essential components of strategies to mitigate the effects of climate change. In their native environments, plants live and grow with many symbiotic microorganisms. However, intensive cultivation practices and the indiscriminate use of fertilizers and agrochemicals, which at one point increased the ecological success of plants, have modified the natural microbiota of crop soils. Microorganism-based PBs take advantage of the symbiotic microorganisms that typically occur in nature and reintroduce them into empty crop soil, which enables plants to withstand environmental changes that threaten the global crop industry .+ ions into the plant cells results in the displacement of K+ ions from many enzymes and cofactors, which affects plant metabolism . Nevertheless, the potential of this HAHS species to relieve salt stress and any associated mechanisms remain unexplored in terrestrial plants of agricultural interest.Recently, it was shown that the marine actinobacteria nditions  and reli+/Na+ proportion, such as high-affinity Na+ and K+ transporters  is an agriculturally important crop, and its responses to salt stress have been abundantly reported. Some of the most recognizable effects of salinity in tomato plants are reduced growth; decreased dry weights (DW) of roots, stems, and leaves; and leaf senescence  was isolated from Porites lobata obtained from the Tropical Central Pacific coral reef system  and cryopreserved at \u221270\u00b0C in 15% glycerol . Tomato seeds were cleaned by immersion on a 10% v/v household soapy solution for 1 min and washed thrice with sterile distilled water. They were then disinfected with 3% sodium hypochlorite for 10 min and washed thrice with sterile distilled water. Subsequently, the seeds were either treated with S. arenicola X29 or not and then sown in phytagel-agar media for the germination and fluorescence in situ hybridization (FISH) experiments or with peat moss in germination trays and later treated at the seedling stage with S. arenicola X29 for subsequent plant response analyses (\u20131 m\u20132).All experiments were conducted using tomato plants  right after cleaning  and 3.2 g L\u20131 Gamborg\u2019s B-5 Basal Medium with Minimal Organics (Sigma-Aldrich)], with or without 100 mM NaCl . Seeds were then incubated at 28/17\u00b0C with a 16:8 light/dark photoperiod (155\u2013300 \u03bcm s\u20131 m\u20132) in a growth chamber. After 30 days, the roots were harvested, fixed with formaldehyde, and stored at \u221220\u00b0C until needed for Giemsa staining and FISH hybridization.Tomato seeds were cleaned as previously described and incubated for 2 h in 3 mL of cleaning . Then, tGiemsa-stained roots were then observed under a light microscope  for 2 h , which was modified by adding the actinobacteria or A1 medium  as previously described. Approximately 800 surface-sterilized seeds were mixed with 3 mL of  for 2 h . Under s2). Seed germination was measured every day for 8 days and only when the radicle was at least 2 mm long. The germination percentage was determined using the following formula:The salt stress experiment was run with 8 mL of 100 mM NaCl or sterile distilled water (control). Four groups, each containing 100 seeds, were included in each experiment. The seeds were incubated in a growth chamber at 28\u00b0C with a 16:8 light/dark photoperiod , and the morphological properties of the seedlings were analyzed. Specifically, the plumule and radicle lengths (cm) of the seedlings were measured, and the dry weight of the seedlings was determined after oven drying at 50\u00b0C to a constant weight. Nitrogen, carbon, and polyphenol content were determined in seedlings to evaluate any nutritional or antioxidant benefits induced by the actinobacteria.Germination was followed daily for 8 days after sowing. The seed germination data were fitted to the Gompertz equation: Nitrogen and organic carbon percentages were determined according to the methodology established by the Association of Analytical Chemists 955.04; . Total pS. arenicola X29 suspension at a bacteria concentration of 1 mg/mL or water (control). The treated seedlings were transplanted into pots with 500 g of soil mixture composed of vermiculite, peat moss, and soil  every second day. Photosynthetic performance and morphological parameters were analyzed for all treatments 9 days after inducing salt stress with saline water irrigation  chlorophyll-fluorometer . All photosynthetic parameters from the fluorescence measurements were obtained as described by Chlorophyll-\u20132 s\u20131 (800 ms) to measure maximum fluorescence when all PSII reaction centers were closed. This pulse was followed by 40 s of darkness to reestablish a basal F0 measurement, after which the leaf was subjected to 20 min of high actinic light . Saturating light pulses (SP) were emitted during this lighting period every 30 s. The rapid light curves (RLCs) were set with 12 light levels (each turned on for 30 s): 25, 45, 65, 90, 125, 190, 285, 420, 625, 820, 1,150, and 1,500 \u03bcmol photon m\u20132 s\u20131. As in the induction curve experiments, the RLCs began with a saturating light pulse of 10,000 \u03bcmol photons m\u20132 s\u20131 (800 ms) to measure maximum fluorescence when all PSII reaction centers were closed. All experiments began early in the morning and were completed before noon. The induction curve and RLC parameters were obtained from the automatic data output of the Junior PAM software.The NPQ induction curves began with a saturating pulse of 10,000 \u03bcmol photons mg for 10 min. The supernatants were recovered and stored at \u221220\u00b0C until use. Pigment quantification was performed with a 1200 Infinity HPLC system  coupled to a diode array detector (DAD) with a C-8 column . The mobile phases consisted of eluent A  and eluent B  delivered with the following gradient scheme : 100/0, 0; 60/40, 22; 5/95, 28; 5/95, 38; and 0/100, 40. The flow rate was fixed at 1 mL per min. All solvents were HPLC grade . Pigments were identified by comparing their retention times with standards . Pigment coefficients were calculated to evaluate the photosynthetic and photoprotective status of whole-treated plants. Total chlorophyll was obtained by the sum of Chl a + Chl b and was used as a proxy for photosynthetic capacity. The chlorophyll ratio was obtained by dividing Chl a by Chl b and was used as an estimator of LHCII antenna size and the light acclimation state. The pool size of the xanthophyll cycle pigments (\u2211XC) was obtained by the sum content of the three xanthophyll pigments  and was used to estimate the photoprotective capacity to dissipate thermal energy. The percentage of xanthophyll cycle pigments in deepoxidated state DEPS was obtained by the formula XC pool. The \u03b2-carotene:total chlorophyll ratio,Photosynthetic pigments were extracted and measured using the method described by g, and the supernatant was collected for metabolite analysis.Phenol, flavonoid, and reducing sugar content were determined from acidified ethanol extractions conducted with fresh frozen leaves (six plants per treatment) that were pulverized and lyophilized (ILSHIN BIOBASE Table Top Freeze Dryer). A total of 25 mg of lyophilized leaves was extracted in 70% ethanol (acidified with 0.1% HCl) for 24 h at 4\u00b0C in the dark. The mixture was centrifuged at 4\u00b0C for 20 min at 10,000 \u00d7 2CO3 (15%) was added to the solution. The mixture was incubated at 45\u00b0C for 10 min. A total of 200 \u03bcL of the reaction mixture was placed into a 96-well plate. The absorbance was measured at 730 nm in a microplate reader  after mixing and an 80-min incubation in the dark. A standard curve using gallic acid was recorded (10\u2013200 \u03bcg/mL). Phenol content was expressed as gallic acid equivalents  per gram of DW (mg GAE/g DW).Total polyphenol content was determined using the Folin-Ciocalteu (F-C) colorimetric method adjusted for micro-determination  with somThe reducing sugar assay was conducted according to the methodology of N-(2-Hydroxyethyl)piperazine-N\u2032-(2-ethane sulfonic acid) buffer at pH 7.4, and 5 mM MgCl2]. The mixture was incubated at 4\u00b0C for 10 min with shaking and then centrifuged at 10,000 \u00d7 g at 4\u00b0C for 10 min. The supernatant was transferred to a new tube and concentrated by vacuum centrifugation using a Maxi Dry Lyo . The precipitate was dissolved in 100 \u03bcL of HEPES buffer  with MgCl2 (5 mM). A 100-\u03bcL aliquot of the former solution was added to 200 \u03bcL of a solution containing glacial acetic acid 60% (v/v), ethanol 20% (v/v), and ninhydrin 1% (w/v). The mixture was boiled at 95\u00b0C for 20 min, cooled to room temperature, and the optical density was recorded at 520 nm in the Multiskan\u2122 GO microplate reader (Thermo Fisher Scientific).The proline assay was conducted as described by \u2219 in 70% ethanol) were mixed for 30 min at room temperature in the dark. Subsequently, a 250-\u03bcL aliquot of each sample was placed in the 96-well Multiskan\u2122 GO microplate (Thermo Fisher Scientific) and read at 515 nm. The result was expressed in micromol equivalents of Trolox per gram of tissue (DW) using a calibration curve ranging from 1\u20131,000 \u03bcM/mL.Antioxidant capacity was measured according to the methodology of \u00ae Green detection in 96-well plates in a StepOnePlus System . Reactions were prepared in a total volume of 15 \u03bcL with 1.5 \u03bcL of cDNA template (1:10), 7.5 \u03bcL SYBR\u00ae Select Master Mix (Applied Biosystems), and forward and reverse gene-specific primers (300 nM). The cycling conditions were set as follows: initial denaturation step at 95\u00b0C for 5 min, followed by 40 cycles of denaturation at 95\u00b0C for 10 s, and annealing at 60\u00b0C for 30 s. A melting curve analysis was used to evaluate reaction specificity. The RT-qPCR system software automatically determined the baseline and cycle threshold (Ct). Relative expression was calculated using a comparative cycle threshold method  following manufacturer recommendations. The cDNA was obtained from 2 \u03bcg of RNA using GoScript reverse transcriptase  and oligo-dT (15) primers. qPCR amplifications were performed using SYBRd method  and SlGApost hoc Tukey HSD tests after both normality and homogeneity of variance were tested with Shapiro\u2013Wilk and Bartlett tests, respectively. When these assumptions were not met, a permutational ANOVA (PERMANOVA) was used. All statistical analyses were conducted in Sigma Plot v. 12  and PRIMER + PERMANOVA software .The data sets were analyzed by a one-way ANOVA and S. arenicola and Nicotiana attenuata roots was observed in vitro. To confirm the presence of such interactions in tomato plants in this study, tomato seeds inoculated with S. arenicola and controls (bacteria-free) were grown under either saline or salt-free conditions and analyzed by Giemsa staining and FISH , although the relationships with polyphenols and carbon showed different patterns. Polyphenol content decreased in the control tomato seedlings under salt stress conditions but increased in the plants treated with S. arenicola under salt stress. The high polyphenol content in HAHS-treated tomato seedlings could be related to the enhanced antioxidant activity that protected tomato seeds during germination. This is supported by the high correlation between the germination percentage and polyphenol content (Pearson correlation: r = 0.95). Furthermore, high correlations were found between %N and %C content and germination .Additionally, in the germinated seedlings, we measured %N, %C, and polyphenol (mg/Kg) content and the radicle and plumule heights on day 13 . SalinitS. arenicola suspension (HAHS-treatment) or water (control) before being transplanted into pots with soil and allowed to grow for 15 more days  were submerged in either an ore days . Afterwat growth . With siectively .P = 0.001). Moreover, we still observed that HAHS-NaCl plants substantially outgrew bacteria free-plants under saline conditions (NaCl), with 26.8% and 42.2% differences in shoot and root lengths, respectively, and differences of 17.1% and 24.6% in the number of leaflets and compound leaves, respectively , a marginally but statistically significant increase in the maximum photochemical quantum yield of PSII , and \u223c15% higher dissipation of absorbed energy in the PSII antenna through a thermal dissipation pathway ; the non-regulated quantum yield of fluorescence emission from PSII, Y(NO); and light-regulated quantum yield of non-photochemical fluorescence quenching, Y(NPQ)] confirmed the bacterial benefits to photosynthetic performance. HAHS treatment induced a 40% increase of Y(II) compared to that of the control plants and a drop in the non-regulated Y(NO) and regulated Y(NPQ) energy distribution pathways in HAHS-treated compared to those of HAHS-free plants. This points to an increased capacity of HAHS-treated plants to allocate light-derived energy into the carbon assimilation pathway induced by the actinobacteria .V/FM, although a reduction of \u223c9% in NPQ and an increase of \u223c20% in ETRMAX were observed. On the other hand, HAHS-treated plants showed no increase in FV/FM, but in contrast, a significant increase in NPQ (\u223c74%) and a decrease in ETR MAX (\u223c7%) under saline stress was observed when compared to those of the control plants. This agrees with the observed changes induced by saline stress in yield coefficients, which showed a decrease in the proportion of Y(NO) of \u223c17%, a marginal reduction in Y(II) of \u223c7%, and a high increase in Y(NPQ) of \u223c42% in HAHS-treated plants  was observed in HAHS-treated plants under salt-free irrigation , chl b (\u223c22%), Zeaxanthin (\u223c11%), and Beta-carotene (\u223c19%)] and on the xanthophyll cycle pool size (\u223c16%). In contrast, treatment with HAHS prior to saline stress partially lessened the reduction in light collector molecules (chl a down to 12% and chl b to 17%) and the xanthophyll cycle pool (down to 6%) with respect to those of the control conditions. Furthermore, the content of Zeaxanthin and Beta-carotene was enriched up to 2 and 40%, respectively, which suggests induced zeaxanthin-related photoprotective and beta-carotene-related antioxidant activity by the actinobacterium S. arenicola.In HAHS-free plants, salt stress caused a significant reduction in all analyzed pigments [chl Antioxidant metabolites, such as proline and phenol, and DPPH antioxidant activity tended to increase in plants under salinity as a strategy to mitigate stress by reducing the cellular osmotic potential and free radical scavenging. We found an increase in all of these parameters after saline irrigation. However, the increase was onefold lower in HAHS-treated plants than in untreated plants for both proline and DPPH . This reStudies have also reported changes in sugar accumulation after saline stress , which aSlHBF7, a transcription factor regulator of salt tolerance; SlRD29B, a gene involved in early responses to desiccation; SlSDR1A, a responsive gene involved in ABA biosynthesis; SlHKT1,2, a cation transmembrane transporter involved in Na+/K+ homeostasis; and SlAOX1b, a gene related with oxidative stress-related genes and ROS scavenging  and abscisic acid ABA; . HoweverMAX in HAHS-treated plants under salt stress conditions. ETRMAX increased in HAHS-free plants under salt stress conditions, although this does not seem to be consistent with the observed arrested growth. It could be argued that the electron flow in these plants was directed toward an alternative electron sink pathway, such as photorespiration  and ETRpiration . Photorepiration . Absicicpiration . Stomatapiration . Photorepiration . Therefoechanism  allows tSphingobacterium BHU-AV3 in tomato plants, increases phenols and antioxidative enzymes and directly alleviates the induced oxidative stress  to sustain the symbiotic relationship with the bacteria. The symbiotic consumption of photosynthetically produced sugars has been demonstrated for other root symbiotic interactions, such as mycorrhizal interactions (MAX levels, which were increased by salt stress in HAHS-free plants. However, considering that growth was inhibited, the flow of the electrons at ETRMAX may follow alternative electron sink pathways. Moreover, the rapid secretion of photosynthetically produced molecules other than sugars, such as osmolytes, can lead to high ETRMAX but low growth rates (MAX by redirecting quantum energy to dissipative NPQ mechanisms and a decrease in the sugar used, as suggested by the reduced growth. This coordinated response may favor the plant by avoiding energy waste and oxidative stress.The presence of bacteria alone induced a drop in reducing sugars even though ETRractions . On the th rates . Interes+ ions. A potential hypothesis is that the activation of ion transporters ameliorates some of the adverse effects of Na+. Which is line with many other studies that have shown that the activation of HKT1 transporters under saline stress conditions increases salinity tolerance in plants (SlHKT1,2 in HAHS-treated plants with regular or saline irrigation (SlHKT1,2 in HAHS-treated plants, even in the absence of salt stress, could serve as a mechanism that prepares the plants to withstand stress by ameliorating other stress responses. In agreement with this, HKT1 induction has been proposed as a protective mechanism to salinity stress conditions in halophytes (SlHKT1,2 gene behavior in response to HAHS even in salty or regular conditions, needs further investigation. Additionally, the decreased expression of SlAOX1b and SlHBF7 under saline conditions in HAHS-treated plants compared with those of the control plants indicates lower damage caused by free radicals and other salt-related effects. Salinispora is endemic to marine ecosystems, and Salinispora strains offer a vast array of potential benefits to their ubiquitous hosts. These strains are recognized for their antimicrobial activity (Salinispora is a ubiquitous symbiont. However, we were surprised to find that this actinobacterium was able to sustain a stable interaction with a terrestrial plant, although S. arenicola is closely related to several terrestrial actinobacteria (S. arenicola metabolism that allows it to interact with terrestrial plants. A better understanding of the interactions between S. arenicola and terrestrial plants may allow us to identify the fundamental mechanisms necessary for sustaining symbiotic relationships, promoting growth, and alleviating saline stress. We define this interaction as a habitat-adapted heterologous symbiosis following the guidelines of S. arenicola could inhibit the growth of some marine phototrophs. Therefore, it is essential to further study actinobacteria interactions to mitigate any potential side effects in terrestrial plants.Proline accumulation in the leaves and roots is considered to be a salt-sensitive trait in tomato plants that may be used to select varieties with different degrees of tolerance . Many ren plants . This alrigation . The inclophytes  or in salophytes  and syntlophytes  induced activity , abilityactivity , and abiactivity , seaweedactivity , soft coactivity , and spoactivity , which sbacteria . Thus, tThe original contributions presented in this study are included in the article/HO-A, AB-E, and RH-H designed and formulated the concept of the study. AB-E, RH-H, RP-R, CS-H, PP-S, EJ-C, OP, FC, ML-G, MH-O, LM-M, and HO-A performed part of the measurements in laboratory and interpreted part of the results. AB-E, IM-C, FR-Z, and HO-A carried out the analysis of the data. AB-E, RH-H, IM-C, and HO-A draft the manuscript with contributions of CS-H and PP-S. All authors approved the final manuscript."}
+{"text": "Furthermore, they caused a susceptibility effect resulting in a reduction of signal intensity on MRI. An increase in the concentration of nanoparticles caused an increase in the MR contrast effect but a reduction in US intensity. The concentration of nanoparticles in a shell of PCNDs was optimized to obtain a dual-mode contrast effect. Biocompatibility, hemocompatibility, and immunogenicity assays showed that PCNDs were safe and non-immunogenic. Another finding was the dual-mode potential of unloaded PCNDs as T1 MR and US contrast agents. Results suggest the excellent potential of these PCNDs for use as dual-mode contrast agents for both MRI and US.Recently, dual-mode imaging systems merging magnetic resonance imaging (MRI) and ultrasound (US) have been developed. Designing a dual-mode contrast agent is complex due to different mechanisms of enhancement. Herein, we describe novel phase change nanodroplets (PCNDs) with perfluoropentane encapsulated in a pre-polyglycerol sebacate (pre-PGS) shell loaded with polyethylene glycol (PEG)-coated iron oxide nanoparticles as having a dual-mode contrast agent effect. Iron oxide nanoparticles were prepared via the chemical co-precipitation method and PCNDs were prepared via the solvent displacement technique. PCNDs showed excellent enhancement in the in vitro US much more than Sonovue Medical imaging has long been among the first line of investigation for the diagnosis and prevention of disease. With the advancement in imaging modalities, the use of multiple modalities for disease diagnosis is common. None of the imaging modalities alone can be called ideal as all of them have certain limitations . ComputeContrast agents in medical imaging are used to enhance the differentiation between tissues, highlighting pathological processes from anatomical ones, perfusion imaging, and functional imaging at a molecular or cellular level ,3. In duIn MRI, contrast enhancement occurs due to the shortening of longitudinal (T1) and transverse (T2) relaxation times. Gadolinium-based contrast agents are currently approved for the T1-weighted positive contrast effect, i.e., an increase in image intensity in regions of contrast uptake, and superparamagnetic iron oxide nanoparticles (SPIONs) for the T2-weighted negative contrast effect, i.e., a decrease in signal intensity upon contrast administration .With the advent of fusion imaging, interest in the development of dual-mode contrast agents for MRI and ultrasound is increasing. However, the design of dual-mode contrast agents is complex due to different mechanisms of enhancement of both modalities. For fabricating a dual-mode contrast agent, nanoparticles are needed to be incorporated into the core or shell of microbubbles. However, the incorporation of nanoparticles increases the stiffness of the shell leading to decreased oscillations in the acoustic field, resulting in low echogenicity or making it suitable only for therapeutic applications involving a high-frequency ultrasound range . For des3O4 loaded PLGA microbubbles for theragnostic applications. Since PFH has high boiling point, MBs are responsive for HIFU applications [Recently, magnetic liposomes have been used as a dual-mode contrast agent for MRI and ultrasound ,14. Amonications . Anotherications .Stride et al. studied the effect of gold nanoparticles in the shell of microbubbles and found that the acoustic response of microbubbles increased at lower mechanical index (MI) values due to an increase in backscatter . The phe\u00ae microbubbles. The predicted resonance frequency for bubbles with a radius of 1 to 10 \u00b5m lies within the diagnostic range, i.e., 1 to 10 MHz [Elastomers are a new class of polymers, known for their high viscoelastic properties, i.e., low elastic modulus and high failure strain. Most of them are applied in the field of tissue engineering as patches for cardiac valves, nerve conduits, and skin grafts. In the field of acoustics, they have been used as sound enhancers in piezoelectric transducers and as phantom material for ultrasound imaging due to their acoustic impedance near body tissues ,18. Polyo 10 MHz . In the o 10 MHz . \u2018Phase 2), Di-mercapto succinic acid (DMSO) and ethanol (99% purity) were purchased from Sigma Aldrich . Ferric chloride hexahydrate (FeCl3\u00b76H2O) and ferrous chloride tetrahydrate (FeCl2\u00b74H2O) were purchased from DUKSAN . Perfluoropentane was purchased from Shanghai Tianfu . PBS tablets were purchased from Oxoid . The thrombin reagent was purchased from Roche Pharma . Gadovist was purchased from Bayer\u2019s Pharmaceuticals . Sonovue\u00ae  was purchased from Shifa International Hospital Pharmacy . The ELISA kit was purchased by Nanjing Pars Biochem Ltd.  The kit contained standards, antibody-coated microtiter plate, chromogen A, chromogen B, HRP conjugate and stop solution.Sebacic acid (99% purity), glycerol (99% purity), polyethylene glycol , sodium hydroxide, acetone, span 20, tween 80, calcium chloride  were purchased from a local pharmacy. LPS extracted from E. coli was a gift from the National Institute of Health, Islamabad, Pakistan. MCF-7 cell lines (HTB-22\u2122) were purchased from ATCC .Pre-PGS was synthesized via melt condensation reaction reported in the literature ,22. Brie3) and ferrous chloride (FeCl2) solutions in a stoichiometric ratio of 2:1 were stirred at 800 rpm at 80 \u00b0C under an inert atmosphere. Precipitation was carried out by dropwise addition of sodium hydroxide solution. The reaction proceeded for 30 min. The change of color to black indicated the formation of iron oxide nanoparticles. In total, 1 mL of PEG was added and the reaction was further continued for 1 h to coat the nanoparticles. The prepared particles were decantated and washed with acetone and water followed by heating in a drying oven at 60 \u00b0C.Iron oxide nanoparticles were prepared via the chemical co-precipitation method. Briefly, iron precursor solutions were prepared by dissolving iron chlorides in deionized water. The ferric chloride (FeClPCNDs were prepared via the solvent displacement method. For the synthesis of unloaded PCNDs (without nanoparticles), the pre-polymer was dissolved in the organic phase (ethanol) with a span of 20. PFP emulsion (5%) was prepared by dropwise addition of PFP in an aqueous phase with tween 80 under probe sonication. Sonication was performed via Hielscher Ultrasonicator (UP400S) at 120 W for 10 min with a 1 min cycle of sonication preceded by a 1 min break upon ice bath. The aqueous phase was extruded via a 0.4-micron filter and added dropwise into an organic phase. For solvent evaporation solution was stirred for 3 h at room temperature. Synthesized unloaded PCNDs were washed three times via centrifugation at 2000 rpm. For the synthesis of loaded PCNDs, PEG-SPIONs were incorporated in both the shell and core of PCNDs. For incorporation of PEG-SPIONs in the shell, they were added in pre-PGS and heated at 120 \u00b0C for 10 min. Successful incorporation of nanoparticles in pre-PGS was indicated by a change of white-colored pre-PGS to brown without any residual particles. The SPION-loaded pre-PGS were dissolved in ethanol with a span of 20 and used as an organic phase. The rest of the procedure was the same. For the incorporation of nanoparticles in the core of PCNDs, nano-particles were added to the PFP emulsion during the sonication step. This nanoparticle-containing emulsion was extruded and then added dropwise to the organic phase with pre-PGS. The rest of the procedure was the same.\u22121 in the range of wavenumber (450\u20134000 cm\u22121). The spectrum was acquired using a Spectrum-100 .For analysis of functional groups in all constructs, Fourier transform infrared spectrometry (FTIR) was performed. The potassium bromide disc method was used and the spectrum was taken at a resolution of 4 cmThe water contact angle measurements were performed by sessile drop technique by placing 3 \u00b5L of ultra-pure water on a glass slide evenly spread with samples. Measurements were taken via Fibro DAT 1100 . The angle between the liquid/vapor interface and the solid/liquid interface (contact angle) was measured by using the ADVANCE software installed in the drop shape analyzer.XRD analysis was performed via XRD, STOE, Darmstadt, Germany (Theta-Theta S/N 65022) with Cu-K\u03b1 (\u03bb = 1.54) with 2\u03b8 ranging from 0 to 90\u00b0.EE is encapsulation efficiency, Wi is the amount of PFP in solution and Wt is the amount of PFP added initially.The encapsulation efficiency of PFP was calculated via UV-visible spectrophotometry  at a wavelength of 270 nm. Ice-chilled 75:15 methanol:water was used as a blank. For releasing PFP, the PCNDs pellet was suspended in the ice-chilled methanol:water and centrifuged at 4000 rpm. This results in the disruption of PCNDs with a PFP release in solution and pre-PGS settling at the bottom. For calculation of exact quantity, a calibration curve of PFP was drawn by taking different concentrations of PFP in the ice-chilled methanol: water. The absorption of the sample was compared with the calibration curve of PFP. The encapsulation efficiency of PFP in PCNDs was calculated by the following formula:Both phase-converted and non-converted PCNDs were visualized under an optical microscope. PCNDs counting was performed via a hemocytometer grid. For phase conversion, PCNDs were first heated at 35 \u00b0C and then drop was placed on a slide and set on stage for microscopic visualization.To confirm the core-shell morphology core, PFP was mixed with fluorescein with an excitation wavelength of 475\u2013490 nm while pre-PGS was mixed with crystal violet dye with an excitation wavelength of 550 nm. The rest of the methodology for synthesis was the same as mentioned above. A drop of PCNDs was visualized and captured via an XDY-2 inverted fluorescence microscope.For size and morphological analysis of the nanoparticles and PCNDs, scanning electron microscopy was performed using SEM-JEOL . Samples were diluted in PBS and a drop was placed on a 1 cm \u00d7 1 cm glass slide. The slide was dried in a vacuum desiccator followed by sputtering with gold. Images were taken with an accelerating voltage of 10 kV at different magnifications. Size and roughness measurements were performed via the ImageJ software.Dynamic light scattering (DLS) analysis of nanoparticles and PCNDs was performed via a zeta size analyzer  to obtain an average size distribution, polydispersity index, and zeta potential (\u03b6), i.e., surface charge. Samples were prepared by diluting in PBS followed by pipetting into a plastic cuvette and measured using a zeta analyzer at room temperature.The magnetic properties of PEG-coated iron oxide nanoparticles were studied via a vibrating sample magnetometer (VSM)  at room temperature. For VSM measurements, powder samples were taken in the sample holder and the external magnetic field was changed between \u221210 and +10 kOe. The hysteresis loop was taken at a frequency of 40 Hz with an amplitude of 3 mm and a phase shift of 123\u00b0.For checking the contrast effect of T2 weighted images on MRI, an agar phantom was made containing falcons of PCNDs loaded with different concentrations of PEG-coated SPIONs. For comparison with control, Gadovist at high concentration was used to obtain a negative contrast effect on T2. MRI was performed in a 0.3 T machine with a time to repeat (TR) of 5450 ms, time to echo (TE) of 117 ms, window width of 1024, window level of 456 and slice thickness of 5.60 mm. Image intensities were measured using a Micro DICOM viewer. Measurements were taken thrice; mean and standard deviations were then calculated. ANOVA analysis was performed to check the significance between positive and negative control and constructs. Tests were performed in GraphPad Prism version 8. P-value was taken significantly at 0.05.6 PCNDs were added to 1000 mL of water. Sonovue\u00ae MBs were used as positive control while water served as a negative control. The change in intensity was measured via MATLAB code. Measurements were taken thrice; mean and standard deviations were then calculated.The contrast effect of unloaded and loaded PCNDs with different concentrations of PEG-coated SPIONs was checked via in vitro ultrasound imaging  using a 3.5 MHz curvilinear transducer with an MI range from 0.1 to 1.5. The PCNDs number density was determined via a hemocytometer used for cell counting under a light microscope (Optika). In total, 1 \u00d7 10For estimating the biodegradability profile of 1 g pre-PGS based PCNDs at blood pH and temperature, PCNDs were incubated in PBS at 37 \u00b0C After every 3 days, samples were centrifuged and weighed. For estimating the shelf life of both vaporized and non-vaporized PCNDs, ultrasound analysis was performed to check for any change in the contrast effect.7, 1 \u00d7 106, 1 \u00d7 105, 1 \u00d7 104, and 1 \u00d7 103 PCND.mL\u22121 of PBS. In total, 20 \u03bcL of the sample was incubated with 180 \u03bcL of the diluted blood cell suspension for 30 min at 37 \u00b0C with agitation. Samples were then centrifuged at 1500 rpm. Followed by dilution of supernatant in 9:1 PBS: supernatant. Optical density (OD) of diluted supernatant was taken at 550 nm. Triton X-100 (0.1%) was taken as the positive control and PBS as the negative control. The experiment was run in triplicate. The percentage of hemolysis was calculated from mean optical densities by the following formula:OD is represented as OD as OD as To establish the safety profile of contrast agents on red blood cells (RBCs), a hemolysis test was performed. Briefly, 3 mL of ethylene diamine tetra acetic acid (EDTA)-stabilized human blood samples were centrifuged at 6000 rpm for 10 min to remove the buffy coat and plasma. The residual red blood cells (RBCs) were washed five times with 3 mL of isotonic PBS to remove the traces of plasma. Washed RBCs were suspended in PBS. Unloaded PCNDs and PCNDs loaded with 10 mg of PEG-coated SPIONs were then diluted in PBS to obtain the PCNDs number densities of 1 \u00d7 107, 1 \u00d7 105 and 1 \u00d7 103 PCNDs.mL\u22121 at 37 \u00b0C for 10 min. Aspirin was taken as positive control while PRP and PRP with PBS were taken as negative controls. The thrombin reagent was then added and the time taken for the plasma to clot was measured.For thrombin time measurements, citrate blood was taken. Platelet-rich plasma (PRP) was obtained by centrifugation at 2000 rpm for 10 min. PRP was incubated and unloaded with 10 mg PEG-coated SPIONS and loaded PCNDs with number densities of 1 \u00d7 102. Time taken in the formation of thread-like structures was noted.Blood was collected in sodium citrate blue vials. Firstly, platelet-rich plasma (PRP) was separated by centrifugation of blood at 2000 rpm for 10 min. Then, PRP was further centrifuged for 5 min at 3000 rpm to obtain platelet-poor plasma (PPP). In total, 40 \u00b5L of different concentrations of microbubbles were incubated with 100 \u00b5L of PPP for 10 min at 37 \u00b0C. Aspirin was taken as positive control while PPP and PPP with PBS were taken as negative controls. Clotting was induced by the addition of 20 \u00b5L 0.16 M CaClFor the MTT assay, MCF-7 cell lines were cultured and plated in 96 well plates followed by incubation for 24 h. Afterward, 200 \u00b5L of different concentrations were added to the wells and incubated for 24 h. The plate was then injected with 15 \u00b5L of prepared MTT and incubated for 3 h at 37 \u00b0C. MTT was pipetted out and 150 \u00b5L of DMSO was added to every well followed by incubation at room temperature. The plate was read by an OD reader and measurement of the absorbance was carried out at 550 nm wavelength after 24 h. The experiment was run in triplicate.7, 1 \u00d7 106, 1 \u00d7 105, 1 \u00d7 104, and 1 \u00d7 103 PCNDs.mL\u22121 For positive control, lipopolysaccharide (LPS) from E. coli was used, as it is a potent activator of the complement system. PBS was used as the negative control. For ELISA, briefly, samples, standards and positive and negative controls were added to C5b antibody-coated microtiter plate. Blanks were set separately and the plate was incubated for 30 min at 37 \u00b0C followed by washing with a wash buffer 5 times. HRP conjugate was then added and incubated again for 30 min at 37 \u00b0C followed by washing with wash buffer 5 times. Chromogen A and Chromogen B solutions were then added and placed in the dark for 15 min at 37 \u00b0C. The stop solution was then added and the plate was read under ELISA Plate Reader at 450 nm.To assess complement activation in response to PCNDs, complement factor 5b (C5b) ELISA was performed via an ELISA kit purchased by Nanjing Pars Biochem LTD. Briefly, blood was collected from two donors in serum gold cap vacutainers with a clot activator and gel separator. Blood was allowed to stand for 20 min followed by centrifugation at 3500 rpm for 10 min. Serum was carefully collected and stored at \u221220 for an hour. Afterward, serum was incubated with PCNDs at different concentrations, positive and negative control for 45 min at 37 \u00b0C to trigger an immune response. PCNDs were serially diluted to obtain the number densities of 1 \u00d7 10\u22121. The same peaks can be observed in PEG-coated iron oxide nanoparticles but with reduced intensity. These peaks are consistent with peaks reported in the literature [Dark brownish-black colored iron-oxide nanoparticles were prepared as a result of the coprecipitation technique. PEG-coated particles were a little lighter, i.e., brown. Magnetic properties of particles were confirmed via placing a simple bar magnet and decanting them. Chemical composition was further confirmed via FTIR analysis. Bare nanoparticles showed a characteristic peak of Fe-O bond at 630, 795, and 880 cmterature .\u22121. The formation of unloaded PCNDs shifted the ester peak towards the lower wavenumber due to bounding with surfactants. Pre-PGS PCNDs showed C-F bond vibration between 1230 and 1460 cm\u22121, signifying the encapsulation of perfluoropentane inside the PCNDs. Loaded PCNDs showed similar peaks of unloaded microbubbles at 3440 cm\u22121 and 1631 cm\u22121, but showed a broad peak at 650 cm\u22121, encompassing a characteristic Fe-O peak at 630 cm\u22121. The peak at 2920 was consistently seen in iron oxide nanoparticles, PEG-coated iron oxide nanoparticles and PEG-coated SPIONs PCNDs, but not in unloaded PCNDs. Unloaded PCNDs were white, just like the pre-polymer, while loaded PCNDs had a slight brown color. Pre-PGS polymer showed a characteristic ester peak at 1734 cmThe water contact angle measurements of the synthesized nanoparticles are shown in Encapsulation efficiency of PFP was found to be 52.6 % . Both liThe hydrodynamic diameter of PEG-coated SPIONs was found to be 190.1 nm. DLS of liquid perfluorocarbons near their boiling point always results in polydispersity due to the presence of both phase converted (larger size) and non-phase converted PCNDs  depending upon their boiling point . In the Colloidal stability of nanoformulations is determined via zeta potential measurements. Zeta potential values of \u221230 to +30 mV are considered stable resulting in less agglomeration . The surFor magnetic characterization of synthesized PEG-coated superparamagnetic iron oxide nanoparticles (SPIONs), vibrating sample magnetometry was performed. \u00ae, predominantly a T1 contrast agent due to the non-availability of Resovist\u00ae (T2 contrast agent). Since gadolinium did not affect T2 contrast intensity at low concentration, a high concentration of Gadovist\u00ae was used to obtain the T2-susceptibility effects. The results showed comparable response and intensity dropped from 1300 to 20 AU, which in itself depicts a high T2 susceptibility. A significant difference (P < 0.0001) was found between the mean intensity of loaded construct and water (NC) while no difference was found between PEG SPIONs (PC) and loaded PCNDs  (SPIONs are famous for their ability to reduce transverse relaxation time T2) by causing increased dephasing between proton spins. SPIONs can be incorporated in both the shell or core of a microbubble for multi-modal properties  by causi. While i 0.5318) .Different studies are focused on developing magnetic microbubbles and optimizing the concentration to obtain the dual modal response. The majority of the work focuses on magnetic liposomes ,50,51,52For T1 contrast enhancement (increased T1 weighted image intensity), the contrast agent should be capable of decreasing longitudinal relaxation time. This is effectively carried out by paramagnetic agents. Superparamagnetic agents have very little effect on T1 intensity. The materials which have a short T1 time can also be used as T1 contrast agents. Recently, copper oxide (CuO) nanoparticles have been reported to be T1 shortening agents. The particles were also able to speed up the ultrasonic wave and carry the potential of dual-modal imaging . CationiAn interesting effect was noted in this study. The unloaded PCNDs, i.e., those constructed without any iron oxide nanoparticles, appeared bright both on T1 and T2 weighted images . A signiThe incorporation of nanoparticles changed the spin\u2013lattice interaction, therefore resulting in a reduction of signal intensity. Techniques optimizing the concentration of iron oxide or chelating with other materials can help make an agent capable of shortening both T1 and T2 relaxation times. Recently, hyperbranched polyglycerol has been successfully conjugated with Gd to make a T1 contrast agent . In anot\u00ae microbubbles. For characterization of acoustic enhancement by magnetic microbubbles, in vitro ultrasound imaging was performed. Images were taken with different concentrations of PEG-coated SPIONs to get an idea about the change in shell characteristics, i.e., elasticity upon the incorporation of iron oxide nanoparticles. Unloaded PCNDs showed 100 times more enhancement at almost all MI values, which shows its excellent potential to be used as an ultrasound contrast agent. The incorporation of 10 mg PEG-coated SPIONs increased the image intensity up to 120 times. This could be due to an increase in non-linear oscillation or an increase in backscatter upon the incorporation of iron oxide nanoparticles . HoweverThe majority of dual-mode contrast studies are focused on high-frequency applications, while most abdominal and cardiac examination involves 3.5 MHz frequency ultrasound ,16,60,61In the current study, a 10 mg concentration of SPIONs gave the best response in 3.5 MHz ultrasound and also an acceptable response in MRI with a decrease in intensity up to 32.2 AU from 1200 AU of water . TherefoBoth non-suspended unloaded and loaded PCNDs showed no mass loss and similar contrast levels upon ultrasonography when stored at room temperature 25 \u00b0C, even after 6 months, while PCNDs suspended in PBS buffer and incubated at 37 \u00b0C, mimicking body temperature, showed complete degradation in 27 days. The degradability of loaded PCNDs was faster than unloaded PCNDs with complete degradation in 21 days .Systemically administered nanoparticles first came into contact with blood cells where they can disturb hemostatic and hemodynamic functions. Studies have also reported some serious complications as a result of intravenous administration including hemorrhagic and thrombotic complications. Therefore, tests for coagulation profile, thrombosis, hemolysis and complement activation as recommended by ISO-10993-4 for medical devices interacting with blood should also be performed for intravenously administered nanoparticles . For est7 PCNDs) showed less than 6% hemolysis which is considered negligible according to ISO standards [A hemolysis assay was also performed to check PCND\u2019s interaction with red blood cells. Even the highest concentration  is the most common type of immune reaction . CARPA rPEG-coated SPION-loaded PCNDs show excellent potential to be used as multimodal contrast agents for both MRI and ultrasound. PCNDs with 10 mg nanoparticle concentration showed excellent enhancement in ultrasound, a high susceptibility effect on T2 weighted MR images and good hemodynamic compatibility without eliciting any immune response. Another interesting finding was the multimodal potential of unloaded pre-PGS shell-based PCNDs as T1 MR contrast agent and ultrasound contrast agent which needs to be further explicated."}
+{"text": "Acute lymphoblastic leukemia is the most common blood cancer in pediatric patients. Despite the enormous progress in ALL treatment, which is reflected by a high 5-year overall survival rate that reaches up to 96% in the most recent studies, there are still patients that cannot be saved. Treatment of ALL is based on conventional methods, including chemotherapy and radiotherapy. These methods carry with them the risk of very high toxicities. Severe complications related to conventional therapies decrease their effectiveness and can sometimes lead to death. Therefore, currently, numerous studies are being carried out on novel forms of treatment. In this work, classical methods of treatment have been summarized. Furthermore, novel treatment methods and the possibility of combining them with chemotherapy have been incorporated into the present work. Targeted treatment, CAR-T-cell therapy, and immunotherapy for ALL have been described. Treatment options for the relapse/chemoresistance ALL have been presented.Acute lymphoblastic leukemia is the most common blood cancer in pediatric patients. There has been enormous progress in ALL treatment in recent years, which is reflected by the increase in the 5-year OS from 57% in the 1970s to up to 96% in the most recent studies. ALL treatment is based primarily on conventional methods, which include chemotherapy and radiotherapy. Their main weakness is severe toxicity, which prompts dose reduction, decreases the effectiveness of the treatment, and, in some cases, can lead to death. Currently, numerous modifications in treatment regimens are applied in order to limit toxicities emerging from conventional approaches and improve outcomes. Hematological treatment of pediatric patients is reaching for more novel treatment options, such as targeted treatment, CAR-T-cells therapy, and immunotherapy. These methods are currently used in conjunction with chemotherapy. Nevertheless, the swift progress in their development and increasing efficacity can lead to applying those novel therapies as standalone therapeutic options for pediatric ALL. Acute lymphoblastic leukemia is the most commonly diagnosed type of cancer in pediatric patients. It accounts for approximately 26% of malignances in children ,2. In thOverall survival (OS) and event-free survival (EFS) are the main indicators in the treatment of ALL. The enormous progress of ALL treatment is reflected by the increase in the 5-year OS from 57% in the 1970s to up to 96% in the most recent studies. Furthermore, currently the 5-year EFS reaches 92% ,11,12.According to the 2017 revision to the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia, based on the immunophenotype assessment, ALL cases can be classified as B-cell precursor ALL (B-ALL), which occurs in 85% of diagnosed patients and T-cell ALL (T-ALL), which accounts for the remaining 15% of cases ,14.Currently, treatment with conventional methods has reached its limit mostly because of the tremendous toxicities that are seen in children during treatment. Modifications of the treatment regimens are used to reduce multiple toxicities. The introduction of safer therapies has become a priority in the management of hematological pediatric patients. Targeted therapy or immunological methods such as chimeric antigen receptor T (CAR-T) cells or bispecific T-cell engager (BiTE) are the perspectives for the not-too-distant future. These novel agents are a significant step in pursuing the goal of the 100% OS in childhood ALL . When co\u22124 methods [\u22124\u201310\u22126. The analysis of immunoglobulin (Ig) and the T-cell receptor (TCR) gene rearrangements are used as MRD markers in this technique (Ig/TCR-RQ-PCR) [3 (good response to steroids). Patients with a poor response to steroids with peripheral blasts \u2265 1000/mm3 are assigned a higher risk. Patients between 1 and 10 years old also have a significantly better overall prognosis [3 show worse response to treatment. In contrast to patients with pre-B-ALL, age and WBC count play less of a role in determining prognosis in patients with T-cell ALL (T-ALL) [ETV6::RUNX1 rearrangements are associated with a good prognosis. Hypodiploid karyotype, BCR::ABL1, KMT2A rearrangement, TCF3::HLF fusion gene, or Ph-ALL-like subtype are connected with the poor prognosis. Intermediate prognosis is associated with TCF3::PBX1 fusion or newly identified ETV6::RUNX1-like rearrangement. Some of them are suitable candidates for molecular targeted therapy.As treatment of leukemia has improved over the past several decades, research has focused on looking for prognostic factors that influence a patient\u2019s final response to treatment. Prognostic factors determine the assignment to a given risk group and thus the selection of the appropriate intensification of therapy. In developed countries, different protocols are used to treat ALL, and each of them distinguishes risk groups and prognostic factors: minimal residual disease (MRD), response to steroids therapy, immunophenotype, genetic factors, age of patient, white blood counts (WBC) at diagnosis used to qualify patients . One of  methods . Flow cy-RQ-PCR) . Recentl-RQ-PCR) . Anotherrognosis . High WB (T-ALL) . GeneticFirst-line treatment of pediatric ALL is conducted in several phases such as induction, consolidation, intensification , and remission maintenance therapy. Induction of remission is based on steroid therapy accompanied by administration of cytostatic. Prednisone and dexamethasone were among the first drugs used in the treatment of ALL and remain an essential part of therapy. Consolidation of remission and maintenance therapy in most protocols is based on systemic and intrathecal cytostatic administration. Steroids have the ability to bind to the glucocorticoid receptor, resulting in inhibition of cytokine production, altered oncogene expression, cell cycle inhibition, and eventually cell apoptosis . The genThe UKALL 2003 trial was going on between October 2003 and June 2011. This study enrolled 3207 children and young adults (to 25 years old) with ALL. The 5-year EFS was 87%, and the 5-year OS was 91.5%. In this study, 1101 serious adverse events were reported, and 16% of them were serious infections. Bacterial infections were the most common, followed by fungal infections. During the induction phase, 17 deaths were reported, mainly due to infection . The stun = 112). In previous studies conducted by COG-POG 9061 and POG 9412, patients received radiotherapy at doses of 24 and 18 Gy and delayed radiotherapy for 6 to 12 months. The 3-year EFS and OS for patients on COG AALL02P2 (n = 118) were 64.3% \u00b1 4.5% and 79.6% \u00b1 3.8%. Compared to late CNS-R B-ALL patients (n = 50) on POG 9412 (previous study conducted by the COG), the 3-year EFS for COG AALL02P2 was significantly inferior . The 3-year cumulative recurrence rate was 26.7%, with a higher incidence in HR patients. These studies demonstrate that CNS involvement is still a challenge in the treatment of ALL, and radiotherapy significantly improves outcomes in these patients. However, dose reduction and delayed radiotherapy should be continuously pursued to reduce toxicity [BCR::ABL1, t KMT2A::AFF1, intra-chromosomal amplification of chromosome 21 [n = 1498), 1285 patients received TBI, and 213 patients received chemotherapy before HSCT. Among group 2 (n = 1556), 1345 patients received TBI, and 211 patients received chemotherapy before HSCT. The EFS rate in both groups was higher in patients who received TBI than in patients who received chemotherapy; in the CR1 group, 63.8% vs. 61.4%, and in the CR2 group, 53.7% vs. 29.4% [p < 0.0001). Similarly, 2-year EFS was also higher in the TBI group than in the patients who were given conditioning chemotherapy . TBI conditioning was also associated with a lower risk of relapse, as the 2-year cumulative incidence of relapse (CIR) rate was lower in this group  [In addition to chemotherapy, radiation is used to treat acute lymphoblastic leukemia in select groups of patients. Formerly, craniospinal irradiation was a crucial departure point in the treatment of leukemia. Currently, eligibility for radiation therapy depends on a specific central nervous system (CNS) status at diagnosis. The criteria for CNS involvement are, subsequently: status 1\u2014absence of CNS involvement; status 2\u2014pleocytosis \u2264 5/\u00b5L with clearly identified blasts on cytospin of cerebro-spinal fluid (CSF) contaminated with blood; status 3\u2014non-traumatic lumbar puncture with pleocytosis >5/\u00b5L or damage to the brain/meninges seen in imaging studies or the presence of neurological symptoms . Due to toxicity . For patosome 21 . Most chosome 21 . The ress. 29.4% . The pha 0.0001) .The effectiveness of HSCT has been demonstrated in many studies. For example, in 2018, a study report of 119 patients aged 1 to 18 years who received HSCT at AIEOP transplant centers was published. The aim of the study was to quantify MRD in patients immediately after transplantation as well as in the third trimester after bone marrow transplant. After HSCT, 61 patients from the study group achieved disease-free status, which allowed for the estimation of EFS and the 10-year OS at the level of 50% and 54%, respectively. Forty-eight patients relapsed after transplantation, with a median duration of 7 months after transplantation . In lighThe genetic characterization of ALL has revolutionized clinical treatment approaches. Currently, childhood ALL can be divided into more than 30 genetic subgroups that are associated with individual patient prognosis. Several groups in which the presence of a mutation or chromosome translocation leads to activation of particular metabolic pathways can be distinguished. This is usually associated with a poor diagnosis, as these pathways are commonly associated with increased cell survival. Nevertheless, over the years, methods of targeting those overactivated cascades in ALL have been developed. Mitigating consequences of overexpressed pathways significantly improve prognosis in previously HR groups. Furthermore, agents targeting signaling cascades contribute to decreased treatment toxicity.BCR and ABL genes. This is followed by activation of the tyrosine kinases ABL1 and ABL2, which transduce signals through multiple pathways such as: the JAK/STAT pathway, the mTOR pathway, the MAPK/ERK pathway, the TRIAL-included pathway, and the differentiation pathway mediated by CEBP [n = 97) was receiving imatinib, and the second one (n = 92) dasatinib (II generation TKI). The group of patients who were administered dasatinib had significantly higher rates: the 4-year event-free survival (71.0% vs. 48.9%) and overall survival (88.4% vs. 69.2%) [BCR::ABL fusion gene were found [The Philadelphia chromosome occurs in approximately 3\u20135% of patients with ALL. It is associated with a worse prognosis; before the introduction of targeted therapy, it was only 30% . ALL Ph+ by CEBP . Tyrosin by CEBP . The fir by CEBP ,53. Alon. 69.2%) . Despitere found . Due to re found . Becausep < 0.01) reduced blast count in 5 of 6 xenograft models. Importantly, the efficiency of ruxolitinib was independent of the presence of JAK/STAT activating mutations; thus, it was suggested that this drug can be used in a larger group of patients than it was expected [The interleukin-7 (IL-7)/Janus kinase (JAK)/signal transducer and activator of transcription (STAT) signaling pathway is involved in both T and B-cells\u2019 development ,57,58,59expected . In a stexpected . RuxolitNovel targeted therapies are currently used in order to support conventional cancer therapy. The innovative approaches are implemented to reduce the toxicity burden and improve outcomes. Monoclonal antibodies represent a group of new, targeted drugs aiming at specific antigens presented by the neoplastic cells. Those drugs induce cytotoxicity by stimulating the immune system against cancer cells. Nowadays, the most common targets in pediatric ALL patients are: CD19, CD20, and CD22. Antibody-based drugs aiming for these antigens cover a range of monoclonal antibody-based treatments, as well as treatment approaches based on antibody-drug conjugates.For now, the only registered FDA monoclonal antibody is blinatumomab, a bispecific T-cell engager (BiTE) that comprises two antibodies directed against CD19 and CD3. CD19 is expressed on all precursor B-cells, whereas CD3 is a mediator of T-cell-dependent signaling, and this combination enables the strong engagement of T-cells and thus the proliferation of activated T-cells and tumor cell lysis .Blinatumomab-based therapy was applied in different subtypes of relapsing/remitting childhood ALL in March 2021. The results of two randomized blinatumomab trials involving B-ALL-pediatric patients have been published. Locatelli et al. reported a trial enrolling 108 participants between 28 days and 18 years old. Patients received induction chemotherapy and two cycles of consolidation chemotherapy, after which they were randomized. The patients had morphologic CR with M1(<5% blasts) or M2 (between \u22655% and <25% blasts) bone marrow at the time of randomization. Blinatumomab was compared to conventional chemotherapy. Patients were divided into equal groups that received either one cycle of blinatumomab or three cycles of consolidation chemotherapy. Beneficial effects of blinatumomab were observed, with a favorable safety profile (adverse events rate 31% vs. 57%), more often MRD remission (90% vs. 54%), and lower mortality (14.8% vs. 29.6%). The OS hazard ratio after a median follow-up time of 19.5 months was 0.43  in the blinatumomab group, whereas in the patients who received chemotherapy, the OS hazard ratio was 0.35 . Furthermore, more blinatumomab-treated patients were eligible to proceed with HSCT (88.9% vs. 70.4%) . A trialSAR3419 (coltuximab ravtansine), an antibody-drug conjugate of maytansinoid DM4 and anti-CD19 antibody, has proven its efficacy preclinically in B-ALL and infant mixed-lineage leukemia (MLL) immune-deficient (NOD/SCID) mice xenografts. Coltuximab ravtansine has been demonstrated to significantly delay the disease progression in all xenografts and induce an objective response in six out of seven xenografts. SAR3419 also prevented relapse in hematolymphoid tissue and other organs (with the exception of the CNS system). Therefore, it was suggested that SAR3419 may improve the outcomes in pediatric CD19+ B-ALL .Denintuzumab mafodotin (SGN-CD19A) is also an interesting antibody-drug conjugate targeting CD19. It is comprised of a humanized monoclonal anti-CD19 antibody with monomethyl auristatin F (an anti-mitotic agent). Jones et al. conducted a study in which B-lineage patient-derived xenografts were established in NOD/SCID mice. The animals were given denintuzumab mafodotin orally for 3 weeks. In all of the animals, CR was achieved, proving that denintuzumab mafodotin may be a suitable agent in treating B-lineage ALL . DenintuCD20 is expressed on the surface of all mature B-cells. It is encoded by the MS4A1 gene, and it has an essential role in the development and maturation of B-cells, along with providing the optimal function of B-cells. This particular B-specific antigen currently constitutes a second-line target for B-ALL therapies; approximately 25% of all patients qualify for anti-CD20 immunotherapy ,75.Rituximab is a chimeric monoclonal antibody comprising the human and murine compounds directed against CD20. The mechanism of action characteristic of rituximab is the depletion of leukemic B-lineage cells via immune-mediated cytotoxicity followed by the induction of apoptosis. Despite the targeted character of rituximab therapy, it is associated with certain risks and secondary adverse events, as rituximab suppresses the physiological B-cell count and reduces the number of circulating antibodies. To date, the efficiency of rituximab has not been comprehensively assessed in pediatric cohorts. Fortunately, the beneficial effect of rituximab in combination with chemotherapy has been proven in young adults with B-ALL . Preclinn = 54), while the second (B2) received epratuzumab twice a week (n = 60). The OS and the 2-year survival rate were evaluated for both groups. For group B1 the OS ratio was 34.2 \u00b1 6.9%, while for group B2 it was 49.3 \u00b1 8.1%. For groups B1 and B2, the 2-year EFS was 25.9 \u00b1 6.4% and 39.9 \u00b1 8.0%, respectively. There was no significant improvement in achieving second CR as compared to the historical control group (COG AALL01P2), in which chemotherapy alone was used. Nevertheless, in the early relapse patients (18\u201336 months after the diagnosis), the addition of epratuzumab to the classical chemotherapy improved MRD-negative CR in the B2 group . Unfortunately, due to the small sample size, this beneficial effect was statistically insignificant (p = 0.1215) [As CD22 antigens are presented by around 80% to 90% of B-ALL cells, they have become another target for immunotherapy. Antibodies targeting this antigen are epratuzumab and moxetumomab pasudotox. A phase II clinical trial was conducted to evaluate the efficacy of moxetumomab pasudotox in children with B-ALL. Unfortunately, the study was terminated ahead of schedule as the first 32 subjects enrolled in the study did not achieve the required efficacy (NCT02227108). Epratuzumab has been tested for its effects in combination with reinduction chemotherapy in 114 patients from 2 to 30 years old. Patients received three reinduction blocks according to the AALL01P2 regimen. The participants were divided into two groups who were given epratuzumab with the first block of reinduction chemotherapy: the first group (B1) received one dose of epratuzumab per week ( 0.1215) . Currentn = 20) [Another agent targeting the CD22 antigen is inotuzumab ozogamicin. It is a humanized antibody-drug conjugate consisting of calicheamicin cytotoxin and kappa immunoglobulin G4 ,80. In 2n = 20) . A similn = 20) ,83.Chimeric antigen receptor T (CAR-T) cells are patient-derived, genetically engineered T-cells, which, after transformation, are applied back to the patient. During modification, lymphocytes gain extracellular domains, which bind to the antigens on tumor cells, triggering a T-cell response . Figure The most common CAR-T target is CD-19, which is expressed on almost all lymphoblasts . In 2017In 2015, the results of a phase I trial, which involved 21 patients aged 1 to 30 years, including 20 patients with relapsing/recurring B-ALL, were published. Prior to a single CAR-T infusion, all patients received cyclophosphamide and fludarabine. The dose-escalation part of the study has been designed according to the standard 3 + 3 design. Patients received either 1 \u00d7 10 \u00d7 6 CAR-T-cells per kg or 3 \u00d7 10 \u00d7 6 CAR-T-cells per kg. The entire dose of produced lymphocytes was administered in case a sufficient number of CAR-T-cells had not been generated. Nevertheless, such patients have not been involved in dose escalation; however, they were assessed for toxicity and for other parts of the study. The maximum tolerated dose of 1 \u00d7 10 \u00d7 6 cells per kg was established, given the dose-limiting toxicities in two out of four patients who received 3 \u00d7 10 \u00d7 6 CAR-T-cells/kg. Such toxicities have not been observed in the patients who received lower doses. Therefore, the dose of 1 \u00d7 10 \u00d7 6 CAR-T-cells per kg was used in the expansion of the study (patients 11\u201321). Overall, 28.6% (6/21) of patients experienced grade 3/4 cytokine release syndrome (CRS), which is a serious complication related to CAR-T therapy, which can potentially lead to multiorgan failure and death. A total of 14 (70%) patients with relapsing/recurring B-ALL achieved a complete response (CR), out of which 12 achieved MRD-negative status. Further, 10 of them were qualified for allo-HSCT transplants. All of these patients remain disease-free. In contrast, the remaining 2 of the patients with MRD-negative status who did not qualify for allo-HSCT relapsed with CD19-negative leukemia at 3 and 5 months after the therapy. Generally, with a median follow-up of 10 months, OS was 51.6%. Relapsed or residual B-ALL was identified in 3 patients who then received a second infusion of CAR-T-cells approximately 2\u20135\u00b75 months after the first dose of CAR-T-cells. Unfortunately, they also did not respond to the second administration. The obtained results showed the promising potential of CAR-T-cells therapy in the treatment of relapsing/recurrent B-ALL CAR-T-cells therapy could be especially effective if CR and MRD-negative status are followed by allo-HSCT .In 2017, Gardner et al. published the results of a phase I trial in which 43 children and young adults (between 1 and 27 years old) suffering from relapsing/remitting B-ALL were treated with a CAR-T-cell product, which had a defined composition of 1:1 CD4+/CD8+ CAR-T-cells (targeting CD19). MRD-negative CR was achieved in 41 (93%) patients. In 14 patients, the CAR-T administration was preceded by fludarabine and cyclophosphamide lymphodepletion. In these patients, the overall MRD-negative CR rate was 100%, while in the remaining patients who received cyclophosphamide-only lymphodepletion, it was 89%. Generally, the 12-month OS was 69.5%. In patients treated with fludarabine and cyclophosphamide lymphodepletion, the overall MRD-negative remission rate was 100%, while in the remaining patients, it was 89%. Overall, 45% of patients who achieved MRD-negative CR experienced relapse, with the CD-19-negative escape variant being accountable for 39% of relapses. Thus, it is expected that developing bispecific (against CD19 and CD22) CAR-T-cells could potentially reduce relapse rates and improve outcomes. At the dose of 1 \u00d7 10 \u00d7 6 CAR-T-cells per kg, dose-limiting toxicities occurred in 1 of the total 17 (9%) patients who received CAR-T therapy. It is worth noting that this patient underwent fludarabine/cytarabine lymphodepletion; thus, dose-limiting toxicities occurred in 1/6 (17%) of participants who received 2-agent lymphodepletion. CRS occurred in 40 of 43 (93%), and the rate of severe CRS  was 23% (10 out of 43). However, the authors of the study emphasize that the adapted definition of CRS was stricter and when adapting criteria for severe CRS from other studies, grade 4 CRS has not been found in any patient. Therefore, this study demonstrated that CAR-T product with a fixed ratio of 1:1 of CD4+/CD8+ expressing cells is well tolerated and shows potential in treating relapsing/remitting B-ALL .The effectiveness of tisagenlecleucel was tested during a phase II multicenter study by the Children\u2019s Hospital of Philadelphia and the University of Pennsylvania. The study involved a group of 75 patients, aged 1 to 25 years, diagnosed with relapsed/refractory B-ALL, of which 46 underwent previous HSCT. Among 75 participants, 72 (96%) were given lymphodepleting chemotherapy (fludarabine and cyclophosphamide or cytarabine and etoposide). Generally, 55 of 75 experienced grade 3/4 adverse effects related to tisagenlecleucel, with CRS being the most frequent factor causing grade 3/4 toxicity in 35 (46.7%) patients. It is worth noting that the median time from CRS onset to the grade 3/4 levels was 3 days. Interestingly, after receiving the CAR-T infusion, tisagenlecleucel remained in the blood for up to 20 months. The MRD-negative CR was achieved in 81% of participants. OS and EFS were assessed at two time points after the administration of tisagenlecleucel. After 6 months from the infusion, OS and event-free survival (EFS) were 90% and 73%, respectively, while after one year, OS was 76% and EFS was 50%. The results of this first multicenter study of anti-CD19 CAR-T-cell-based therapies in relapsed/remitting B-ALL were consistent with previous single-center studies. Administration of tisagenlecleucel causes high rates of remission, which can be sustained in most of the cases. Further, CRS appears to be the most dangerous complication of the CAR-T treatment .Ghorashian et al. generated a new variant of CAR-T-cells with a lower affinity binding for CD19 than a strong FMC63 binder, which was used in most of the previous studies . IncreasDue to the poor prognosis in relapses following the use of CD19 CAR-T-cells, a study was conducted to assess the effects of anti-CD22 CAR-T-cells. A total of 34 pediatric and adult patients, among whom 31 had failed previous anti-CD19 cell therapy, received an infusion from a relatively low dose of anti-CD22 CAR-T-cells. On the 30th day after the infusion, 24 (80%) of the 30 evaluated participants achieved CR or CR with incomplete count recovery, out of which 23 attained MRD-negativity. Four patients died during the treatment, and one of them developed grade 5 CRS. Nevertheless, in the remaining patients, the toxicity associated with CD22 CAR-T was low as no grade 3/4 events occurred. Among seven patients who did not receive any additional therapy, four had a relapse, as observed during the long-term follow-up. Nevertheless, 11 patients underwent HSCT, after which only 1 experienced relapse. The authors concluded that the anti-CD22 CAR-T lymphocytes are highly helpful in achieving a positive remission status in relapsed B-ALL patients, even in those who have previously received anti-CD19 CAR-T therapy .n = 12) were given CAR-T products from their donors (previous donor-derived\u2014PDD patients), whereas participants who never underwent HSCT (n = 8) received CAR-T products from donors whose stem cells would be used for future HSCT (new donor-derived\u2014NDD patients). The treatment was well tolerated as none of the participants experienced dose-limiting toxicities. Grade 3/4 CRS was observed in 2 patients. Overall, of the 20 patients, 19 responded to the treatment, and 18 participants achieved CR, out of which 17 were MRD-negative by day 15. The one patient who did not respond to the therapy (NDD group) lost CD7 expression. Other NDD patients proceed to the HSCT. The median follow-up time was 6.3 months, after which 15 patients remained in CR. The obtained results are promising and indicate that CAR-T treatment can be successfully implemented in T-ALL patients. The authors presented a novel strategy that relies on donor-derived CAR-T-cells. This approach was demonstrated to be highly effective, thus the need to further investigate the use of donor-derived CAR-T-cells in treatment not only in T-ALL but also in other hematological malignances [Despite the efficiency of CAR-T treatment in B-ALL, applying this form of treatment in T-ALL patients still poses a significant challenge. Recently, in the results of a phase I study, 20 children and adults (aged 2\u201343 years) with relapsed/remitting T-ALL were given allogeneic donor-derived anti-CD7 CAR-T-cells. Importantly, patients who previously underwent HSCT  gene, leading to disruption of glucocorticoid signaling. Disruption of proapoptotic/antiapoptotic signaling ratio in favor of the latter, related to alterations in B-cell lymphoma 2 (Bcl-2) protein family members expression, also contributes to the development of resistance to glucocorticoid treatment. Another cause of resistance to steroid treatment involves IKZF1 mutations in Ph-like ALL and signaling pathways overactivation, such as the interleukin-7 receptor (IL-7R) pathway and rat sarcoma virus (Ras) pathway in precursor B-cell ALL. Recently, the important role of the mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK-ERK) pathway was described, and its inhibitors were demonstrated to be effective in overcoming resistance to glucocorticoid treatment during the preclinical studies [The relapse rate of ALL patients is around 20%, and the remaining 10% of patients are still refractory to conventional therapy. Patients that have relapsed have an extremely poor prognosis; the 5-years OS is about 5\u201310% . The pro studies .NT5C2, and loss of the MSH6 gene. Various genetic aberrations such as chromosome translocations or gene rearrangements lead to the activation of additional metabolic pathways. In some of these cases, conventional chemotherapy can be combined with targeted therapy in order to improve the results of the treatment. However, the cancer cell is still able to develop a resistance mechanism that counters the action of those drugs [Purine metabolism significantly affects survival outcomes, as 6-Mercaptopurine is the basis of maintenance treatment. A number of gene mutations that lead to resistance to purines have been described. Examples include mutations in the PRPS1 gene, gain-of-function mutations in se drugs . Table 3Both children with relapse and a high risk of relapse are candidates for allogeneic HSCT . CurrentWith the advance of CART-cell therapy, studies began to investigate the efficacy of this therapy in patients with relapsed ALL compared to HSCT. In 2020, the results of a study on bone marrow transplantation after CART-cell therapy (post-HSCT) were published. The study by Zhang et al. included 120 patients with a median age of 12 years. The 1-year OS for patients with post-HSCT was 79.1%, and for patients without post-HSCT only 32.0% . In anotCurrently, in oncological centers in Europe, a study by an Italian AIEOP group in collaboration with the German BFM group (NCT03643276) is underway to develop a new treatment protocol for children and adults with ALL. The study is being conducted in response to studies that have shown that chemotherapy today has become unacceptably toxic. This is especially true of patients who received intensified therapy due to the high risk of ALL recurrence. Its aim is the qualitative improvement of patients\u2019 therapy, increasing OS, and the adjustment of risk stratification to the latest diagnostic markers with the use of available diagnostic methods. Expected changes to treatment protocols include the addition of blinatumomab as an alternative to conventional chemotherapy in patients with pre-B-ALL. In patients at high or intermediate risk of relapse, the use of intensive chemotherapy may lead to toxic effects. Therefore, AIEOP-BFM ALL-2017 aims to introduce blinatumomab as an adjunct to chemotherapy, especially for patients who respond poorly to its effects (NCT03643276) . Polish Over the years, the treatment regimens of pediatric patients with ALL have undergone many changes. Despite the development of innovative techniques and the emergence of new pharmaceuticals, classic treatment methods such as chemotherapy or HSCT are still the basis of ALL treatment. Developing innovative methods of treatment and implementing them into protocols contribute to reducing the side effects of the therapy and OS. Nevertheless, targeted treatment can be applied only to a subset of patients. Therefore, the need for developing new treatments that will be effective in the widest possible group of ALL patients."}
+{"text": "Long-term disease control is achieved in 80\u201390% of patients with acute lymphoblastic leukemia of B origin (B-ALL). About half of adult and 10% of pediatric patients develop refractory or relapsed disease, whereas survival after relapse accounts about 10% in adults and 30\u201350% in children. Allogeneic bone marrow transplantation offers remarkable benefit in cases with unfavorable outcome. Nevertheless, novel immunotherapeutic options have been approved for patients with adverse prognosis. Immunotherapeutic agents, nowadays, are preferred over standard chemotherapy for patients with relapsed or refractory B-ALL The mode of action, efficacy and safety data of immunotherapeutic agents released, indications and sequence of those therapies over the course of treatment, are herein reviewed. Acute lymphoblastic leukemia of B origin (B-ALL) is equally aggressive in adults and children. Long-term disease control with further consolidation and maintenance is achieved in 80\u201390% of patients; nevertheless, about half of adult and 10% of pediatric patients develop refractory or relapsed (r/r) disease. Survival after relapse  is dismal at about 10% in adults and 30\u201350% in children. Allogeneic bone marrow transplantation offers remarkable benefit in patients with r/r B-ALL , 5.Relapses mainly occur because leukemic cells still remain in the body, even after complete hematologic response has been achieved. The term MRD is used to describe the low-level disease which is not detectable by conventional cytomorphology , 7. MRD Overt hematologic relapse and MRD are the target of novel immunotherapeutic agents and monoclonal antibodies, such as blinatumomab and inotuzumab ozogamicin, but also of cellular therapies like chimeric antigen receptor T cells (CAR T cells) , 5. More2/24\u00a0h in 21 patients with MRD persistence (\u2265\u200910\u20134 threshold) after consolidation. In patients with an allogeneic donor, an HSCT was offered at any time after the first cycle of treatment with blinatumomab. Responders were permitted to receive three additional consolidation cycles of treatment with blinatumomab. Molecular remission was achieved in 80% of patients who were not MRD negative at any time before blinatumomab initiation. According to a more recent analysis of the trial with a median follow up of 51\u00a0months after blinatumumab, half of the patients remained in remission (10/20), whereas almost 50% of them, had not been transplanted. So, it seems that there may be a possibility of long-term complete remission\u00a0(CR) in patients with chemo-refractory disease after therapy with blinatumomab, even without HSCT [Blinatumomab is a recombinant murine monoclonal bi-specific antibody that is CD19 directed with CD3 T-cell engagement, promoting immune-mediated elimination of B-cell lymphoblasts by cytotoxic T cells. In a phase II clinical trial which was conducted by GMALL group, blinatumomab was administered as a 4-week continuous intravenous infusion at a dose of 15\u00a0\u03bcg/mout HSCT , 17.n\u2009=\u200988) achieved MRD negativity after one cycle of therapy, and 67% of them proceeded to HCT. The relapse-free survival (RFS) and overall survival (OS) were significantly prolonged in MRD responders . Complete MRD response rates were similar between patients with MRD\u2009\u2265\u200910\u20132 and those with MRD\u2009<\u200910\u20132 at baseline, and also between patients with first and those with later remission at baseline. In a median follow-up period of 30\u00a0months, median RFS and OS were found to be 18.9\u00a0months (95% CI range 12.3\u201335.2) and 36.5\u00a0months (95% CI range 19.8\u2013not estimable), respectively. MRD response after the first cycle resulted in better OS and RFS. Seventy-four (67%) of 110 patients underwent HSCT while being in continuous remission after blinatumomab. Nine (25%) of 36 patients without HSCT or chemotherapy after blinatumomab remained in continuous CR, in a median follow-up of 24.0 (range 2.8\u201341.6) months, whereas 36 (49%) of 74 with HSCT remained in remission. So, patients with a complete MRD response who remained in long-term remission without subsequent HSCT were identified, confirming the results of the pilot study indicating long-term survivors without subsequent HSCT. Transplantation offers an advantage in patients transplanted beyond a second remission [In the BLAST clinical trial (NCT01207388), blinatumomab was investigated in patients with B-ALL in first or second CR having MRD\u2009\u2265\u20090.1% Among the 113 patients included, 78% (N\u2009=\u200974) remain in CR, whereas 19% of those not transplanted (N\u2009=\u200936), also remain in CR without subsequent HSCT. In addition, among patients with complete MRD response, 46% of patients being transplanted and 30% of those not transplanted remain alive in CR. So, 30% of patients without detectable MRD after blinatumomab administration who do not proceed to transplant, can achieve long term remission [In summary, according to the BLAST trial results, among patients with chemotherapy-resistant MRD, targeted immunotherapy with blinatumomab resulted in a substantial molecular response rate and improved long-term outcomes among responders compared with non-responders. Targeted treatment in early stages of MRD is considered a viable therapeutic strategy for patients with B-cell precursor ALL. The role of HSCT after blinatumomab therapy has not yet been clearly determined, since patients with MRD response after blinatumomab may achieve long term disease control even without allogeneic HSCT. Specifically, according to the updated results of the BLAST trial with a median follow up of 5 years, 40% of the patients being transplanted (emission \u201320.p\u2009<\u20090.001), longer median duration of remission (7.3\u00a0months versus 4.6\u00a0months) and OS  compared with the conventional chemotherapy group. Patients with\u2009<\u200950% blasts in the bone marrow compared to those with\u2009\u2265\u200950% had a twofold probability of achieving CR. This trial confirmed the results of the multicenter phase II study MT103-211 in adult patients with r/r B-ALL which resulted in the Food and Drug Administration (FDA) granting accelerated approval for blinatumomab in December 2014 [A multi-institutional phase-3 trial, assigned adults with heavily pre-treated relapsed or refractory B-cell precursor ALL to receive either blinatumomab or standard-of-care chemotherapy. Blinatumomab was associated with significantly higher remission rates (both CR and CR with incomplete hematologic recovery-CRi)  and neurotoxicity. Severe CRS is quoted at about 2\u20135% and\u2009\u2265\u2009grade III neurotoxicity about 7\u201313%. Treatment strategies include corticosteroids or temporary discontinuation of infusions. Permanent discontinuation is considered in higher grade CRS or neurotoxicity with life-threatening complications , 21, 27.p\u2009\u2264\u20090.001). Among the patients who achieved CR, a higher percentage in the inotuzumab ozogamicin group compared to the standard therapy had results below the threshold for MRD (0.01% marrow blasts) , respectively. In addition, the rates of CR or CRi associated with inotuzumab ozogamicin were similar among patients with high (>\u200950% blasts) and those with low disease burden, as assessed by the percentage of bone marrow blasts at baseline [Inotuzumab ozogamicin is a CD22 directed antibody bound to the cytotoxic antitumor antibiotic calicheamicin. In August 2017, the FDA approved inotuzumab ozogamicin for the treatment of adult patients with r/r B-ALL. The approval was based on data from the INO-VATE trial \u201330. In tbaseline \u201332.p\u2009=\u20090.003), and the 3-year OS rates was 34% and 63%, respectively (p\u2009=\u20090.004) [Inotuzumab ozogamicin in combination with low intensity chemotherapy (mini-HCVD) with or without blinatumomab has been used as frontline therapy for older patients with Philadelphia chromosome-negative ALL. The 3-year event-free survival rate for patients who received HCVAD and those who received the combination of inotuzumab ozogamicin plus mini-HCVD with or without blinatumomab was 34% and 64%, respectively (=\u20090.004) .The above combination has been also used as salvage therapy in r/r Philadelphia chromosome-negative ALL. Overall, 80% of patients responded, whereas 57% achieved CR. The overall MRD negativity rate among responders was 83% .Subsequent remission consolidation with allogeneic HSCT after achieving CR in the inotuzumab group was one of the predictors of better OS. Factors associated with improved OS in the inotuzumab arm were: best MRD status, baseline platelet count and hemoglobin level, duration of first remission, achievement of CR/CRi, as well and whether a patient underwent HSCT during follow\u2010up. Inotuzumab ozogamicin is effective in extramedullary disease and is related to veno-occlusive (VOD) disease in patients receiving HSCT, especially in those receiving multiple alkylating agents , 28\u201333.Currently, combination of inotuzumab with BCL-2 inhibitors is under investigation in r/r B-ALL .Hepatotoxicity in the form of hyperbilirubinemia, transaminitis, and sinusoidal obstruction syndrome  has been seen consistently with inotuzumab. In the INO-VATE trial, 22% of patients undergoing HSCT and 8% not undergoing HSCT presented with SOS. The mechanism of hepatotoxicity with inotuzumab is likely a result of the calicheamicin component of the drug. Preventive strategies should be considered, such as avoiding double alkylators with HSCT following inotuzumab or avoiding more than two cycles of inotuzumab if HSCT is planned , 29\u201332.n\u2009=\u200975) included in the study represented a very high-risk population. They all had chemorefractory disease with extensive bone marrow infiltration and 61% of them had undergone allo-HSCT. The CR rate at 3\u00a0months was 82% among infused patients, with negative MRD in 98%. The OS at 24\u00a0months reached 66%. Durable remission was observed in 62% of responders at 24\u00a0months from infusion [p\u2009=\u20090.006), whereas CD19\u2009+\u2009relapse correlated with loss of B-cell aplasia (BCA)  [Tisagenlecleucel (tisa-cel) was approved by the FDA in August 2017 as the first CAR T cell agent for pediatric and young adult patients (up to 25\u00a0years of age) with r/r B-ALL, based on the results of the ELIANA study NCT 02435849). Patients  .6 cells per kg was selected for the subsequent phase 2 study based on efficacy and safety. The Phase 2 ZUMA-3 study enrolled 71 patients, older than 18\u00a0years, with morphological disease in the bone marrow (blasts\u2009>\u20095%) at study entry. The ZUMA-3 study represents the largest adult-only population treated for R/R B-ALL to date [Brexucabtagene autoleucel (KTE-X19) was recently approved by the FDA for adult patients with r/r ALL based on the results of the ZUMA-3 trial. The Phase 1 part of the study examined three dose levels, and the dose of 1\u2009\u00d7\u200910 to date .At a median follow-up of 16.4\u00a0months, 71% of treated patients achieved CR or CRi, with 56% of reaching CR and 97% of responders having MRD negativity. The median DOR was 12.8\u00a0months regardless of censoring patients at subsequent allo-HSCT.At data cutoff, 12 (31%) of the 39 patients with CR or CRi were in ongoing remission without subsequent allo-HSCT. Median RFS\u00a0was 11.6\u00a0months in all treated patients and 14.2\u00a0months\u00a0in responders.\u00a0Median OS was 18\u00b72\u00a0months in all treated patients and was not reached in responders .p\u2009=\u20090.014) [In another trial in adult patients, clearance of the leukemic clone by High-Throughput Sequence (HTS) after CD19 CAR T cells was associated with better DFS and OS. Also, in univariable analysis, allogeneic HSCT after CART-cell therapy was associated with longer event free survival (EFS) compared with no allogeneic HSCT  . An addi=\u20090.014) . Ongoing=\u20090.014) , 44.While CAR T-cells are rationally designed targeted therapies, nevertheless they frequently induce life-threatening toxicities. The most common are CRS and immune effector cell-associated neurotoxicity syndrome (ICANS), while other adverse events such as cytopenias, hypogammaglobulinemia, tumor lysis syndrome or infusion reactions may occur after CAR T cell infusion and need to be taken into account in clinical practice. Grade III\u2013IV adverse events occur more frequently with CAR T cell therapy than blinatumomab , 45\u201347.Differences in the study population between the pivotal trials leading to approval of the above-mentioned immunotherapeutic agents are depicted in Table Two distinct types of relapse are recognized: antigen positive versus antigen negative (including lineage switch). Lack of persistence of circulating CAR T cells, often coupled with the loss of BCA, is associated with antigen-positive relapses.Factors influencing the persistence of CAR T cells include the quality of T cells collected during leukapheresis, CAR design CD28\u2009<\u20094-1BB), and the tumor or antigen burden. In fact, loss of BCA is a surrogate marker of CAR-T cell persistence. Early loss of BCA (<\u20096\u00a0months from infusion) correlates with relapse. Patients with CAR T cell persistence are in risk of CD19-negative relapses. The mechanism of relapse is considered to be the downregulation or loss of target epitope, commonly referred to as antigen escape. The underlying mechanism is the selection for pre-existing alternatively spliced CD19 isoforms. The ELIANA trial reported that 15 of 22 relapsed patients experienced a CD19-negative relapse BB, and t, 49, 51.The major risk factor for CD19-relapse is high tumor burden, which can result in larger clonal heterogeneity due to the emergence of antigen-negative clones after therapy.Lineage switch from a lymphoid to myeloid origin, with loss of CD19 epitope is another form of antigen escape, often seen in patients with MLL gene rearrangement , 51\u201353.Prior therapy with blinatumomab poses a potential risk for antigen escape after CD19-specific CAR T cell therapy. Strategies to improve outcome and prevent relapses after CD19 CAR T cell therapy include the use of bivalent or bitransduced CD19\u2009+\u2009/CD22\u2009+\u2009CAR T cells, the use of humanized CAR T cells to prevent immune rejection and the combination with immune check point inhibitors (f.ex tisa-cel with pembrolizumab or nivolumab). Recently, \u201carmored\u201d CAR T cells that express CD40 ligand, secretable cytokine IL-18, or secretable PD-1 blocking single-chain variable fragment (scFvs) can augment the efficacy of the modified cells , 44, 46.p\u2009=\u20090.014) in patients with high-risk features such as those with high pre lymphodepletion lactate dehydrogenase concentration (HR 1.38 per 100 U/L increment increase), higher pre lymphodepletion platelet count (HR 0.74 per 50 000/mL increment increase) and those who did not have fludarabine incorporated into the lymphodepletion regimen [Whether allogeneic transplantation should be initiated in patients after CAR T cell therapy is still a matter of debate , 20, 44. regimen , 49.The rate of graft versus host disease (GVHD) does not seem to increase in patients who receive HSCT after CAR T cell infusion , 48, 49.According to the pre-mentioned data regarding efficacy and limitations of each immunotherapy it could be suggested that inotuzumab and blinatumomab may act as a bridge to transplant, although both can be used as single agents in patients unsuitable for transplant. Blinatumumab can be offered as a definite treatment for long term disease control, while inotuzumab may be limited to two cycles in transplant-eligible patients. Blinatumumab can also be used in patients who achieve MRD-positive disease after inotuzumab. Inotuzumab is effective regardless of age, but adverse effects above grade III are less tolerated in patients over 55\u00a0years old. Blinatumumab can also induce good responses in older patients or those with multiple comorbidities, but adverse events may be less tolerated in older patients. Patients with high disease burden may get a higher benefit with inotuzumab. On the contrary, blinatumomab is preferred in low tumor burden disease, with excellent responses in MRD-positive cases. Patients with\u2009<\u200950% blasts in the bone marrow have better CR/CRi rates compared to those with\u2009>\u200950% of blasts , 30, 45.CAR T cells are effective regardless of disease burden . HoweverThe group of transplant ineligible patients may include older adults, those with multiple comorbidities, or decreased performance status. Inotuzumab may be an effective option in these patients. With a lower risk of VOD without HSCT, inotuzumab may be used for a total of six cycles. Because it can be used in an outpatient setting, it may be especially attractive in transplant ineligible patients who desire to avoid hospitalization. Blinatumumab is also effective in this group of patients, but only a small proportion of may achieve long-term disease control without HSCT , 45, 47.MRD-negative status, T-cell expansion and B cell depletion are associated with longer survival in patients receiving CAR T cell therapy. This may be considered a definite treatment without subsequent transplant in patients who achieve MRD negative CR and persistent B-cell aplasia. HSCT can be used as a consolidation therapy in some patients, particularly those not achieving MRD negative CR after CAR T cell therapy. The rate of relapse in ALL after HSCT is reported to be 26\u201364% , 20, 40.Blinatumomab is currently being studied as post-transplant maintenance in a phase II trial (NCT02807883) and is the only agent currently approved for MRD\u2009+\u2009disease. However, the type of patients who may not need HSCT and may achieve long term disease control with blinatumomab alone is unknown. Nonetheless, if there is a high possibility to undergo CAR T-cell therapy in the future, there is a small risk of loss of CD19 expression with blinatumomab , 44, 49.Blinatumumab overcomes T315I mutation-induced resistance and, as a single agent, is effective in patients who have failed ponatinib. It is often combined with tyrosine kinase inhibitor (TKI) in r/r Ph\u2009+\u2009ALL. Also, out of 38 Ph\u2009+\u2009patients from the INO-VATE trial and a phase I/II trial who failed prior TKI\u2009\u00b1\u2009HSCT, 66% achieved complete remission, and 63% had MRD negativity. An ongoing phase I/II trial is studying the combination of inotuzumab with bosutinib for patients with R/R Ph\u2009+\u2009ALL NCT02311998) , 23.11998 , 2Several other trials regarding novel immunotherapies are in progress, such as a phase I study with blinatumomab in combination with checkpoint blockade with nivolumab and ipilimumab , a phase III study investigating the role of blinatumomab combined with chemotherapy in patients with standard-risk B-ALL, a single-arm phase I/II study (ZUMA-4) which evaluates the safety and efficacy of brexucabtagene autoleucel in pediatric patients with B-ALL that is refractory, relapsed after at least one salvage therapy, or relapsed after HSCT . Additionally, a phase 3 study will be investigating the role of inotuzumab ozogamicin combined with chemotherapy in patients with newly diagnosed high-risk B-ALL, and an ongoing clinical study (NCT03628053) is comparing tisagenlecleucel versus blinatumomab or inotuzumab in r/r ALL , 48\u201351.Despite the success with improved outcomes in patients with B-ALL over recent decades, risk factors in a subset of cases continue to suggest poor prognosis. Review of risk stratification has led to the practice of augmenting treatment intensity for patients who are at high risk of failure or relapse. The current approach for patients with de novo high-risk ALL is to augment the intensity of chemotherapy. Certain high-risk subgroups, such as those with Ph+\u00a0ALL, may benefit from additional drugs . HSCT after induction of remission in certain very high-risk subgroups is an option, especially if a suitable matched related donor is available. Although augmented chemotherapy and HSCT may lead to long-term cure in some of these patients, many relapse or have disease progression. Currently, immunotherapeutic options are better than chemotherapy for achievement of MRD-negative disease in r/r B ALL patients, while there is lack of safety data from head to head comparison between these options , 53, 54.Choice between these therapies depends on several factors, such as donor availability, the presence of CD19\u2009+\u2009or CD22\u2009+\u2009on blast cells, tumor burden, toxicity, previous therapies. Combination and sequence of these therapies remain a challenge. Specifically, patients who remain MRD positive after inotuzumab, can be rescued by blinatumomab administration and vice versa. CAR T cell therapy can augment duration of remission in patients who have received inotuzumab or blinatumumab or a combination of both. Allogeneic HSCT may serve as consolidation after CAR T infusion. On the other hand, CAR T cell therapy can be used as a bridge to transplant. Second transplantation in patients who reach long term remission after CAR T cell infusion may lead to more toxicity than efficacy. It still remains a topic of discussion whether CAR T cells can be the final answer for r/r B ALL. Furthermore, cellular therapy may be an alternative in patients with Down or Li-Fraumeni syndromes who suffer from notable toxicity from chemotherapy and conditioning regimens , 53, 54.In addition, treatment of r/r ALL is a challenge in patients with central nervous system (CNS) infiltration for which there is no unified treatment regimen. Combination of intrathecal and conventional chemotherapy is mainly used to achieve CR. CD-19 CAR-T cells have a beneficial effect on patients with active CNS disease, as they cross the blood\u2013brain\u2013barrier (BBB). Inotuzumab ozogamicin also has a positive effect on r/r B-ALL with CNS involvement , 53\u201355.A limitation of CAR T cell therapy is the cost. It is an expensive treatment option and presents a challenge for insurers and health care systems. The price list for tisagenlecleucel is 475,000 USD for a single infusion and that amount does not take into account the costs of supportive care, tocilizumab for patients who develop CRS, or other treatments which may be necessary to maintain a durable remission  , 56. RecChoice of immunotherapy is summarized in Tables Immunotherapeutic agents are preferred over standard chemotherapy for patients with relapsed or refractory B-ALL. Nevertheless, there are no efficacy or safety head-to-head studies comparing these agents. The combination or sequence of these different immunotherapy options over the course of treatment remain a great challenge. Future studies may uncover biomarkers that could drive a more individualized approach to address effectiveness and prevent mechanisms of resistance."}
+{"text": "CAR T-cell therapies represent a major advance in the treatment of relapsed B-cell non-Hodgkin lymphomas. Nevertheless, a significant proportion of these patients will experience disease progression following CAR T treatment. For these patients, no standard therapeutic procedure is established so far. The novel bispecific antibody glofitamab has shown promising activity in the treatment of refractory or relapsed B-cell non-Hodgkin lymphomas. In this study, we provide evidence for good tolerance and promising efficacy of glofitamab administration in patients relapsing after CAR T-cell therapy.Chimeric antigen receptor T-cells (CAR T) treatment has become a standard option for patients with diffuse large B-cell lymphomas (DLBCL), which are refractory or relapse after two prior lines of therapy. However, little evidence exists for treatment recommendations in patients who relapse after CAR T-cell treatment and the outcome for such patients is poor. In this study, we evaluated the safety and efficacy of a monotherapy with the bispecific CD20xCD3 antibody glofitamab in patients who progressed after CAR T treatment. We report nine consecutive patients with progressive DLBCL after preceding CAR T-cell therapy. The patients received a maximum of 12 cycles of glofitamab after a single obinutuzumab pre-treatment at an academic institution. CRS was observed in two patients (grade 2 in both patients). We observed an overall response rate of 67%, with four patients achieving a complete response and a partial remission in two patients. Interestingly, we identified increased persistence of circulating CAR T-cells in peripheral blood in three of the five patients with measurable CAR T-cells. Our data suggest that glofitamab treatment is well tolerated and effective in patients with DLBCL relapsing after CAR T-cell therapy and can enhance residual CAR T-cell activity. The most common type of aggressive non-Hodgkin Lymphomas is diffuse large B-cell lymphoma (DLBCL) . WhereasHowever, along with the increased use of this innovative therapy, the number of patients relapsing after CAR T-cell treatment is emerging as a novel challenge. Various approaches are being explored for patients with relapses following established CD19 targeted CAR T-cell therapy, e.g., CD19-specific CAR T-cells that express a PD-1/CD28 chimeric switch receptor . So far,In the first in-human phase I dose-escalation study NP30179 (NCT03075696), the recommended phase II dose (RP2D) of increasingly applied 2.5 mg/10 mg/30 mg dose steps was established. The study reported an ORR of 65.7% and a CR rate of 57.1%, while toxicities were manageable. The most common adverse event was cytokine release syndrome (CRS), occurring in 50.3% of the patients . CRS is Apart from the promising results in phase I studies with glofitamab, its availability off the shelf makes it an attractive option as a rescue treatment after CAR T failure. In addition, due to its targeted mode of action, it has the potential to avoid toxic effects on residual circulating CAR T-cells\u2019 possible enabling synergistic effects. In this retrospective study, we analyzed the safety and efficacy of administering monotherapy with glofitamab in DLBCL patients relapsing after CAR T treatment, and we specifically investigated the effects of glofitamab treatment on the remaining CAR T-cells in the peripheral blood.In this single-center study, we retrospectively analyzed real-world experiences of consecutive DLBCL patients receiving glofitamab monotherapy after CAR T treatment at the Inselspital, University Hospital in Bern, Switzerland. Glofitamab was provided free as part of the standardized pre-approval access program (PAA) of the manufacturing company (Roche Pharma), as the compound is not yet approved in Switzerland. We included the data of all consecutive patients with relapsed or refractory DLBCL after CAR T treatment, who received at least one dose of glofitamab monotherapy as the next line after CAR T treatment at our institution between September 2020 and March 2022. All patients gave written informed consent, and the study was approved by a decision of the local ethics committee of Bern, Switzerland.\u00ae) 1000 mg in cycle 1 on day 1 (C1D1), thereby depleting B-cells in the peripheral blood and lymphoid organs resulting in reduced T-cell activation and cytokine release [The treatment comprised pretreatment with a single dose of obinutuzumab . Tissue biopsies served to assess tumor antigens such as CD20 positivity using routine immunohistochemistry (IHC) and to verify lymphoma histology. Bone marrow infiltration was assessed by standard aspiration and biopsy. Lymphomas that occupied at least one-third of the chest width or that had a diameter larger than 7 cm were assessed as bulky diseases.We measured the occurrence of CAR T-cell-specific DNA in the peripheral blood by digital-droplet PCR (ddPCR) technology ,33. Peak\u00ae Version 8. Progression-free survival (PFS) was defined as the time between C1D1 and death, progression, or last follow-up, whichever occurred first. Overall survival (OS) was defined as the time between C1D1 and death from any cause or last follow-up. Survival curves were estimated using the Kaplan\u2013Meier method and differences were evaluated by the log-rank test. Patients being alive and progression free were censored at the time of the last follow-up.All statistical analyses were performed using GraphPad PrismBetween September 2020 and March 2022, nine patients with CAR T failure were treated with a monotherapy of glofitamab at our institution. All of them had DLBCL, relapsing after previous CAR T treatment. DLBCL was transformed in five cases  from follicular lymphoma (FL) and in one patient from marginal zone lymphoma (MZL). At first diagnosis, four patients had stage IV disease, three patients had stage III, and two patients had stage II disease. All lymphomas were high-intermediate risk or high risk. Detailed patient characteristics at diagnosis are summarized in All nine patients completed at least one cycle of glofitamab treatment. Two patients had ongoing progression and ultimately died after the first cycle due to lymphoma progression. Lymphoma progression led to cessation of glofitamab treatment in one patient each after cycles 3, 9, and 10. Four (44%) patients completed the planned 12 cycles. Treatment characteristics are listed in Glofitamab was generally well tolerated, and there were no discontinuations or dose reductions due to treatment-related adverse events (AEs). All AEs that occurred during the treatment period are summarized in CRS was observed in two patients during cycle 1, both being grade II. One patient was treated with tocilizumab and dexamethasone. Biomarkers for CRS, such as IL-6 and CRP, were elevated in cycle 1, with median peak levels of 43 pg/mL and 131 mg/L. Peak IL-6 values during all cycles are shown in One patient experienced symptoms of tumor lysis syndrome after the first administration of obinutuzumab, with emesis, diarrhea, and abdominal pain for 2 days. Transient neutropenia occurred in three patients (grade 1 in one patient and grade 3 in two patients). One patient each experienced anemia (grade 1) and thrombocytopenia (grade 1), conditions that were not previously known. Other AEs included obstipation (grade 1) in four patients, diarrhea in three patients (grade 1 in two patients and grade 2 in one patient), nausea (grade 2) in four patients, emesis (grade 1) in one patient, dyspnea in two patients (grade 1 in one patient and grade 2 in one patient), and cough (grade 1) in two patients.Infections with at least one febrile episode of \u226538 \u00b0C were detected in six patients, while the median number of days with fever was only one day. Infections, with at least one identified germ, were seen in four patients, three of which were viral (Enterovirus (two patients), Varicella Zoster Virus (one patient)). One infection was bacterial (Staphylococcus), detected by blood culture.All patients were evaluable for response, and response rates are summarized in During the study period, four deaths occurred. All patients died due to lymphoma progression, and two of them received only one cycle of treatment. The median time from treatment beginning until death was 70 days. A summary of treatment outcomes is depicted in The median time until the last follow-up was 246 days. Response at the last follow-up was CR in four patients and PD in five patients. Progression-free survival (PFS) was 44%, and 5/9 (56%) of the patients were alive at the last follow-up. The median PFS was 161 days, and median OS was not reached. PFS and OS are presented in All nine patients had previously received CAR T-cell therapy. The kinetics of CAR T-cell-specific DNA in peripheral blood was assessed before, during, and after glofitamab treatment. One patient died before the measurement of CAR T-cells in the peripheral blood during cycle 1. In the three patients without detectable CAR T-cells before the therapy, CAR T-cells in the peripheral blood remained undetectable during glofitamab therapy. The decrease in CAR T-cells after CAR T-cell therapy continued following glofitamab in two patients. However, three patients experienced a re-expansion of CAR T-cells in the peripheral blood after glofitamab infusions. Peak CAR T-cell expansion by digital-droplet PCR (ddPCR) occurred after a median of 35 days from the start of glofitamab treatment. Later, during glofitamab treatment, the initially enhanced cell expansion decreased again; however, it did not fall below the levels seen before the start of glofitamab therapy.The median peak CAR T-cell expansion of all evaluable patients during glofitamab treatment was 66 copies/\u03bcg DNA. No association between CAR T-cell expansion and response to glofitamab could be observed, as three patients with CR did not have any detectable CAR T-cells before and after treatment. Only one patient with CR experienced a CAR T-cell expansion during glofitamab therapy. CAR T-cell expansion after glofitamab is illustrated in In this study, we investigated patients with refractory or relapsed DLBCL, who received glofitamab as the next line of treatment, after relapse following CAR T treatment, at a single academic institution. All patients were heavily pre-treated and had exhausted the available options. Our study intended to provide information on the safety of glofitamab after CAR T-cell infusion, preliminary evidence of efficacy, and the ability of glofitamab to eventually enhance the declining activity of residual CAR T-cells.In our study cohort, glofitamab application turned out to be safe and was generally well tolerated. We did not record unexpected new adverse events during glofitamab therapy. In particular, the incidence of infections and the observed germs, as well as the rate of glofitamab-related neutropenia and thrombocytopenia, were comparable to the phase I dose-escalation study. In contrast, the occurrence of CRS was significantly lower in our cohort with 22%, as compared to 71% in the phase 1 study . CRS aftOur data suggest that glofitamab therapy resulted in significant clinical response in a subset of patients with DLBCL relapsing after CAR T treatment. This supports earlier reports of the efficacy of BsAbs . FurtherTo our knowledge, no information on the efficacy of glofitamab administration in DLBCL patients relapsing after CAR T-cell therapy is yet available. The ORR and CR rates in our cohort after glofitamab treatment were similar to those observed in the phase I dose-escalation trial of glofitamab, in which patients achieved an ORR of 65.7% with a CR rate of 57.1% when treated with the RP2D ; howeverThe median OS in DLBCL patients progressing after CAR-T treatment is poor. Two studies reported overall survival of 161 and 180 days only ,21. Our Finally, we found evidence that Glofitamab administration may enhance circulating CAR T-cells in the peripheral blood assessed by ddPCR. This effect was similarly observed following mosunetuzumab treatment , but hasIn conclusion, treatment with glofitamab in patients with refractory or relapsed DLBCL after CAR T-cell therapy seems to be safe and effective. Additionally, our data suggest that the administration of glofitamab can lead to an expansion of residual CAR T-cells. However, larger studies are needed to assess whether this effect contributes to the responses observed and in order to propose an improved management of patients after CAR T-cell failure."}
+{"text": "Mycobacterium leprae bacilli in samples from the United States, Bolivia, and Paraguay; prevalence was 14.8% in nine-banded armadillos. US isolates belonged to subtype 3I-2, suggesting long-term circulation of this genotype.We examined armadillos from museum collections in the United States using molecular assays to detect leprosy-causing bacilli. We found  Mycobacterium leprae and M. lepromatosis  is its main wildlife reservoir in the southern United States , in the six-banded armadillo (Euphractus sexcinctus), and in nonhuman primates including chimpanzees, macaques, and sooty mangabeys (M. leprae and M. lepromatosis have been reported in red squirrels (Sciurus vulgaris) in the British Isles (Hansen disease (leprosy) is an ancient pathology caused by 2 slow-growing intracellular bacilli, M. leprae and M. lepromatosis across space and time. We report presence of M. leprae in armadillo tissue samples from endemic and nonendemic areas of the Americas, suggesting that public health policy should contemplate zoonotic leprosy transmission routes carefully.Natural history collections represent a neglected resource for biomedical research despite their known utility  and Arctos (https://arctos.database.museum/home.cfm), queried during December 2018\u2013April 2019. Ten US museums included armadillo samples in their datasets. The samples were collected during 1974\u20132017 . Most samples were liver tissues (n = 66 [41.5%]), followed by muscle (n = 37 [23.3%]) and spleen (n = 31 [19.5%])  . The spe[19.5%]) . M. leprae and M. lepromatosis  <26 as a threshold for whole-genome sequencing. We multiplexed and sequenced libraries on an Illumina NextSeq 500 instrument (https://www.illumina.com) (We processed tissues using an in-house DNA extraction method based on magnetic beads . We applina.com) .M. leprae in 18/159 (11.3%) samples. All positives were in D. novemcinctus armadillos, for prevalence in that species of 14.8% (n = 18/122). We detected positive results mainly in muscle tissue (n = 13/18 [72.2%]) and in 95% ethanol\u2013preserved specimens (n = 13/18 [72.2%]) (M. lepromatosis was not detected in the tissues examined. PCR subtyping was successful in 5/18 (27.8%) positive samples; 4 belonged to subtype 3I, as expected for armadillos from Texas, USA  had coverage of 18.2\u00d7 and of BioSample SAMN31421192, 4.9\u00d7  and humans  from the United States , encoding a probable acetylornithine aminotransferase. Sequence data are available from the National Center for Biotechnology Information Sequence Read Archive under accession no. PRJNA893376.We found 72.2%]) , 2. M. l.2%) , 2.xas, USA . The remprae DNA . After R92, 4.9\u00d7 . Phyloged States . IsolateM. leprae in D. novemcinctus armadillos only; prevalence was 14.8%. Positive samples were mainly detected from muscle and from ethanol-preserved specimens (M. leprae has not been reported in other wildlife in Paraguay or Bolivia. In our study, tissues from Paraguay were collected in 1996 and from Bolivia in 1993 (D. novemcinctus and T. matacus armadillos conducted during 1999\u20132001 found 0 positive animals (M. leprae\u2013negative armadillo tissues in the United States: 1 from Florida in 1974 and 6 from Texas collected during 1982\u20131990 (M. leprae was reported in Florida before 2009 (M. leprae in armadillos before the 2000s, evidence was restricted to 1 area (M. leprae in Texas armadillos from 1996, 1999, and 2000 are novel records (We identified pecimens . Infecte in 1993 . Hansen 982\u20131990 . No evid records .M. lepromatosis has been reported in multiple countries of the Americas, including the United States, Mexico, and Colombia, but as of 2022, only in humans (Sciurus vulgaris squirrels in the British Isles, broader surveillance in rodents across Europe and Mexico identified 0 positive samples (M. lepromatosis is seldom screened as a Hansen disease\u2013causing pathogen because of lack of awareness, which has impeded understanding of its incidence. Thus, in countries endemic for Hansen disease, M. lepromatosis should be also screened systematically in humans and potential animal reservoirs.M. leprae subtypes in 4 armadillos (M. leprae are circulating in armadillo populations in the southern United States (>30 years ago, highlighting the promise of using preserved animal tissues to study epizootic dynamics of leprosy and other diseases.We were able to identify madillos  and to smadillos . Of inteM. leprae and other pathogens. We recognize that no single best way to study the diversity of pathogens exists; any approach should consider the specific nuances of each zoonotic system.Information on pathogen biodiversity in wildlife is much needed. We suggest that specimens in natural museums can play a role in infectious disease monitoring; our study relied on the global museum initiative and the large digital repositories of relevant specimen data in the United States. Protocols for using museum repositories for infectious disease research are still in development (Mycobacterium leprae in armadillos.Additional methods used in study of Mycobacterium leprae in armadillos.Details of the 159 specimens processed in study of"}
+{"text": "The mechanism underlying the association between elevated red cell distribution width (RDW) and poor prognosis in variety of diseases is unknown although many researchers consider RDW a marker of inflammation. We hypothesized that RDW directly affects intravascular hemodynamics, interactions between circulating cells and vessel wall, inducing local changes predisposing to atherothrombosis. We applied different human and animal models to verify our hypothesis. Carotid plaques harvested from patients with high RDW had increased expression of genes and proteins associated with accelerated atherosclerosis as compared to subjects with low RDW. In microfluidic channels samples of blood from high RDW subjects showed flow pattern facilitating direct interaction with vessel wall. Flow pattern was also dependent on RDW value in mouse carotid arteries analyzed with Magnetic Resonance Imaging. In different mouse models of elevated RDW accelerated development of atherosclerotic lesions in aortas was observed. Therefore, comprehensive biological, fluid physics and optics studies showed that variation of red blood cells size measured by RDW results in increased interactions between vascular wall and circulating morphotic elements which contribute to vascular pathology. High RDW value has been reported to be a strong predictor of unfavorable clinical outcomes independent of concomitant conditions and could be used for risk stratification in certain groups of patients.Modern automated hematology instruments allow for simultaneous measurement of number and size of red blood cells (RBC). Based on red cell volume distribution curve the degree of variation in RBC size (i.e. anisocytosis) can be quantitated and expressed as red blood cell distribution width (RDW) which was traditionally used to diagnose different types of anemia. However, during last decade, numerous studies showed that high RDW strongly correlates with cardiovascular and all-cause morbidity and mortality in healthy populations as well as patients with various clinical conditions. This includes cardiovascular diseases , cancer, diabetes, acute pancreatitis, liver and kidney failure, sepsis, Parkinsonism and COVID-193. Moreover, during inflammatory process, the production of neutrophils and platelets increases that may slow development of erythroid lineage. Since the volume of RBC decreases over its lifespan, changes in both production kinetics and/or clearance of erythrocytes may modify RDW value4.The specific mechanism for association of high RDW and health outcomes has not been identified. RDW may be a nonspecific marker of general illness and degree of inflammatory process. Excessive oxidative stress accelerates senescence of erythrocytes and erythrophagocytic clearance5. Previously, we have also identified mechanism linking certain proteins like VEGF with altered RBC production in experimental cancer model6. We have also found that infection with cytomegalovirus (CMV) inhibits erythropoietin production by blocking renal expression of hypoxia-inducible factor 2\u03b1 (HIF2\u03b1)7.Recently, proteomics data analysis along with RDW measurement identified potential protein pathways connecting high RDW with all-cause mortality in prospectively observed aging population9. Erythrocytes help bring platelets to the surface of an injured vessel wall by random collisions between RBCs and platelets, which allows platelets to move across flow streamlines in a form of \u201cenhanced diffusion\u201d10. Collisions with flowing RBCs potentiate the molecular motion of platelets enhancing their ability to interact with the vessel wall11. Also, the size of erythrocytes may contribute to the platelet margination effect. In some mathematical models the main factor of thrombocyte migration towards periphery of the vascular wall is the size of platelets. When the space between two RBCs is smaller than the size of thrombocytes, they cannot reside in this volume and are \u201cejected\u201d to the periphery of blood vessel12. Accordingly, high RDW may influence the motion and migration of RBCs as well as platelets since variation in shape and size of RBCs leads to a different dynamic behavior in the bulk flow. Therefore, the available volume for thrombocytes to be transported in the bulk flow, the size of the RBC-depleted region as well as the collision frequency between RBCs and thrombocytes in the near-wall region are affected and expected to lead to increased interaction with arterial wall.The majority of clinical complications associated with high RDW results from vascular pathology, mostly atherothrombotic incidents due to platelet activation. Under normal physiological conditions, in flowing blood, RBCs tend to concentrate in the axis of the vessel, while platelets are prone to increase their presence near the vessel wall due to radial migrationWe hypothesize that RDW is not only a marker of rapid progression of cardiovascular diseases, but it directly affects blood flow and interaction with the vascular wall. We assume that changes in blood flow caused by anisocytosis lead to interaction between the cellular components of blood and the vascular endothelium. This interaction causes overexpression of adhesive molecules in endothelial cells which may be an initiating factor for the development of inflammation in the vascular wall. Therefore in our study, we applied mathematical models and physical stimulation of blood flow in addition to traditional methods of molecular biology. We aimed to provide a link between increased interactions of blood cells with the vascular wall and red blood cell distribution width.The study involved patients with distinct RDW values based on detailed hematological characteristics Table . MicroarTo elucidate the effect of anisocytosis on platelet migration towards vascular wall, lattice Boltzmann simulations of RBCs, blood plasma and platelets were performed. Three different RBCs volume distributions (Gaussian) having standard deviations of 12, 16 and 20% were investigated, maintaining a bulk RBCs volume fraction of 30% for all analyzed cases. The effect of RBCs deformability was considered by applying different shear modulus of 25, 50 and 126 \u03bcN/m, corresponding to capillary numbers . An instantaneous picture of the distribution of RBCs and platelet distribution was presented as Fig.\u00a0Human blood samples drawn from patients with low RDW  and high RDW  as shown in Table To investigate the relationship between RDW and the shape of the blood flow profile in carotid arteries, blood flow was measured by 9 Tesla MRI in distinct animal models of high RDW: mice with induced anemia (n\u2009=\u20099), mice with implanted murine colon cancer CT26 cells (n\u2009=\u20098), mice treated with erythropoietin (n\u2009=\u20096) and transgenic mice thalassemic Hbb homozygotes. (n\u2009=\u20099). As a control, BALB/c mice (n\u2009=\u20095) were used. Data on blood morphology of evaluated animals were included in Table \u2212/\u2212 mice were crossed with thalasemic Hbb+/\u2212 mice, both having high RDW values. Parental generation of Hbb+/\u2212 and ApoE\u2212/\u2212 mice as well as wild type C57BL/6J strain were used as a control. To strenthen the genotype effect related to abnormal RDW and increased propensity to develop atherosclerosis, all animals from each experimental group  were additionally on a high cholesterol diet for 10\u00a0weeks. Next, aortas were isolated, stained and analysed to determine size of atherosclerotic lesions , we have demonstrated that rise of RDW value alters radial migration of the platelets and may thus facilitate their interaction with the vessel wall. Lattice Boltzmann method has become one of the most popular methods in computational fluid dynamics, it simulates blood flow in a complex microvascular network and allows to identify determinants of interactions between circulating blood elements and endothelium. It was shown previously\u2014using LBM, that changes in vessel geometry like curvatures and bifurcations result in increased fluid viscosity and elevated force from blood elements to vascular wall, inducing changes in endothelial cells that promote atherosclerosis14. Therefore, it is plausible that association between RDW and different clinical outcomes may also involve platelet-related mechanisms.Using the same in silico approach, we have demonstrated that elevated RDW value potentiates the interactions of blood components, as RBCs and thrombocytes, with the vascular wall. In recent years, there has been accumulating evidence that platelets play roles beyond thrombosis and hemostasis, e.g., in inflammatory processes, infection and cancer15. Presented data show that high RDW value led to shrinkage of space between flowing blood cells and vascular wall, in consequence promoting direct contacts between morphotic elements of blood and capillary. Samples of blood with low and normal RDW value presented similar, but greater than high RDW samples, distance between blood cells and vascular wall. These in vitro findings are in concordance with in silico analysis performed using lattice Boltzmann method. Therefore, results from our studies suggest that elevated RDW value may accelerate interaction of platelets with endothelium contributing to the development of atherosclerosis as well its clinical complications.We studied flow patterns of blood samples from subjects with different RDW values in microfluidic channel system. To study this process we have employed Doppler optical coherence tomography (DOCT), which enables simultaneous visualization of the structure and blood flow. The method can be used in animal models of different human diseases to assess flow patterns and interactions of blood morphotic elements and vascular wall16. It has been demonstrated, that leukocytes are transported toward the vessel wall likely via hydrodynamic interactions with the relatively smaller and more flexible erythrocytes. In order to initiate rolling, circulating leukocytes must marginate to contract the vessel wall. Leukocyte margination has been attributed to the ability of RBC aggregates to exclude the WBCs from the bulk solution17 and also to the interactions between individual white and red blood cells at bifurcations or postcapillary expansions18. Random and lateral displacements of RBCs (high RDW) may produce repeated collisions with lymphocytes located near the wall and consequently promote increased incidence of direct interactions of lymphocytes with vascular-wall and initiation of the inflammatory process. Adhesion modeling demonstrated, that a lymphocyte, when adhere to the vascular wall is much easier pulled off the wall by a single red blood cell than \u201ca train of erythrocytes\u201d due to downward forces of the RBC series passing the attached lymphocyte and pushing it down into the wall20. The higher variation in size of the RBCs together with lower vessel diameter seems to facilitate forming of \u201ca rope\u201d rather than equally dispersed single cells.Despite the fact, that we only show the association of high RDW with increased interactions of blood cells with the vascular wall we think that we have found a missing piece to theory about the causativity of the RDW. It is known that vascular cell mechano-transduction of flow dynamics and cell to cell interactions may trigger cytokine release and cross-talk between cell types within the artery20. The authors prepared platelet-free blood containing T-lymphocytes at 32% hematocrit and tested the flow medium effect on lymphocyte capture of the endothelial monolayer in vitro. Interestingly, the efficiency of cell capture approximately doubled at moderate shear stress with the addition of erythrocytes. The addition of RBCs also increased the fraction of rolling cells as compared to adherent cells, and rolling velocities were comparable to those measured in vivo20. Melder et al. postulated that a mechanism of the enhancement effect of RBC could rely on the outward dispersive effect of RBCs produced by cell interactions at physiological hematocrits during flow in a narrow tube. Then, random and lateral displacements of RBCs may produce repeated collisions with lymphocytes located near the wall and consequently promote increased lymphocyte-wall collisions. Moreover, RBCs aid in rapid lymphocyte recapture after detachment from the endothelium, a phenomenon of even greater significance under conditions of high arterial shear stress20.Described observation of RBC\u2019s role as a helper or reinforce stabilizer in initial arrest or solid attachment to the endothelium mediated by VCAM-1 and ICAM-1, respectively, is consistent with results obtained in another study21. Non-laminar flow causes loss of this property and brings the RBCs close to the arterial wall. The same is observed in conditions of high RDW. With time, anucleate erythrocytes progressively expose phosphatidylserine on their external membrane, as a signal of senescence recognition. Senescent RBCs are frail and more sensitive to hemolysis and their detrimental cytotoxicity on the arterial wall is mainly mediated by hemolysis and the powerful oxidative capacity of heme-ferrous iron which may initiate endothelial cell damage. For instance, the focal external application of FeCl3 is a usual model to induce experimental clotting in arteries. This model involves the inward cellular transport of FeCl3 towards the endothelium and is dependent on local hemolysis of circulating RBCs23. Formation of endothelial RBC aggregates, hemolysis, and loss of endothelium precede platelet activation and thrombus formation in this model24. Sites of the bloodstream reattachment are likely the areas of frequent RBC collisions that add more to the pre-existing physical forces also due to RBC overrepresentation in the blood as compared with other types of blood cells and change the gene expression pattern of the endothelial cells. Therefore, the specific sites of plaques formation is an effect of synergistically acting RBCs constituting dominant cell type component in the circulation system, other morphotic elements of the blood, and hemodynamic forces.Presented data show increased interaction of blood morphotic elements with the vascular wall in conditions of high RDW. We believe that this interactions are also a source of oxidative stress in the vessel and initiate endothelial damage. RBC collision with the aortic wall has recently been reported as an important source of the oxidation process in early human aortic atheroma26. In opposition to normal RBCs, sickle RBCs demonstrate polymerization of sickle hemoglobin towards the cell surface creating several sites of abnormal cytoadherence to human endothelial cells in vitro and hypoxia enhanced this adhesion26. Although in the in vivo systems, sickle RBCs attachment predominates in postcapillary venules with the low shear stress near the wall of ~ 0.1\u00a0Pa, the performed simulations by Papageorgiou indicate that RBC shape heterogeneity (and RBC deformability) facilitate contact with the vascular wall26. One of the earliest in vitro studies on the sickle cell disease also demonstrated, that sickle erythrocytes are able to induce expression of vasoconstrictor endothelin-1 (ET-1) in primary cultures of human umbilical vein endothelial cells (HUVEC), therefore regulating local vasomotor tone directly25. ET-1 has been described to play a role in fibrosis, angiogenesis, and inflammation. Moreover, ET-1 stimulates endothelial angiotensin-converting enzyme (ACE) activity and secretion of aldosterone participating in hypertension development27.A portion of key information of the increased RDW role on blood rheology and atherosclerosis development, as well as another example of RBCs contact with the vascular wall, provides studies on sickle cell disease1. Many of these conditions are potent cardiovascular risk factors, therefore relation between RDW and atherosclerosis may be incidental not causal. However, the hypothesis that high RDW may contribute to the development of vascular lesions cannot be rejected and we have provided supporting evidence in our study.We did not study the mechanism contributing to variability of RBC size. In humans, RDW variations are related to different types of anemias but there is also an association with age, gender, genetic factors, renal and liver function, blood pressure, metabolic factors and inflammationFirst, in ex vivo setting without any additional interfering factors like inflammation, high RDW promotes potentially atherogeneic interactions between the blood elements themselves and vascular wall. This has been shown in in silico experiments (lattice Boltzmann method) as well as in microfluidic channels measuring flow patterns of blood samples differing in RDW values.\u2212/\u2212 strain. Anisocytosis accelerated development of lipid plaques in aortas of ApoE deficient mice as compared to animals without thalassemic gene.Second, we applied different mouse models with high RDW induced by anemia, transplanted colon cancer cells, erythropoietin treatment or thalassemia. Some of these experimental setting may also include processes like inflammation, prothrombotic conditions that may contribute to vascular lesions and affect pattern of blood flow. However, measurement of blood flow in carotid arteries using non-invasive magnetic resonance imaging showed intermittent or turbulent blood flow. This pattern of blood flow is unequivocally associated with blood-vessel wall interactions inducing atheroma formation. We have also studied crossbreds of thalassemic high RDW mice with atherosclerosis-prone ApoE19, for example, these local hemodynamic forces induce production of antioxidant enzyme, superoxide dismutase, or upregulates the expression of nitric oxide synthase. As a consequence of nitric oxide (NO) overproduction, VCAM-1 expression decreases by inhibition of nuclear factor kappa beta (NFkB) that prevents platelet clumping and inflammation20. Our analysis of human atherosclerotic samples showed that in patients with anisocytosis, there is an increased expression of VCAM-1 that facilitates plaques formation and mediates adhesion of blood cells, including monocytes, to vascular endothelium. Once adhered, the monocytes penetrate vascular endothelium and infiltrate the intima in the process of diapedesis that requires a chemoattractant gradient such as monocyte chemoattractant protein 1 (MCP-1)28. This is one of important steps in the development of atherosclerotic plaque. Another factor is a shear stress. Shear stress-dependent elevation of platelet-derived growth factor A (PDGF-A) and B (PDGF-B) mRNA in cultured human umbilical vein endothelial cells (HUVEC) has been described, as well as increased endothelial secretion of tissue plasminogen activator (PLAT) induced by blood flow-mediated shear stress29. Similarly in our microarray study we have observed elevated expression of those genes in patients with high RDW level. It has been also documented that oscillatory shear stress limits fibroblast growth factor receptor 1 (FGFR1) expression in endothelium  and stimulates transforming growth factor \u03b2 (TGF-\u03b2) signaling. Both pathways have been proved to play crucial role in endothelial-mesenchymal transition of endothelium and atherosclerosis progression30. Hence these findings propose that the flow characteristics such as level of velocity fluctuations appearing in the flow field might induce a variety of molecular responses in ECs that result in sparing of the straight parts of the arteries and formation of lesions at the curvatures. Although mentioned genes are known to have impact on atherosclerosis development, for the first time we have found in human plaques a correlation between RDW and altered expression of genes important in pathogenesis of atherosclerosis.Third, we analyzed samples of atherosclerotic plaques removed during carotid thromboendoatherectomy in patients with significant carotid stenosis. Numerous data demonstrate that when local properties of viscosity and density of blood are altered, along with the flow pattern, local shear stress can be modified. Shear stress affects atheroprotective mechanismsWe have applied different experimental approach  to study the effect of high RDW on blood flow pattern and interactions between blood elements and vascular wall. Our results show that RDW accelerates interaction between blood elements (platelets and blood cells) which is associated with development of atherosclerosis. These data support the hypothesis that RDW may increase cardiovascular risk directly affecting mechanisms related to atherosclerosis.Lack of arterial samples of the patients with different RDW values without any concomitant medical conditions, therefore the effect of other factors cannot be definitely excluded.Lack of in vitro study with cultured endothelial cells exposed to shear stress and different components of blood of high vs. low RDW to determine the early changes in gene expression upon controlled, forced physical collisions of RBCs of different sizes.Mouse models used also include concomitant factors  that can affect studied parameters like pattern of blood flow.To the study 98 patients were recruited. From the population of 98 patients, those with lowest and highest RDW value were included in further analysis. Microarray analysis was performed on 12 carotid plaques derived from 6 patients with low and from 6 patients with abnormal parameter value\u2009>\u200916. Gene expression profiles were analyzed using an Affymetrix  at Karolinska Institute (KI). We found statistically significant (p\u2009<\u20090.05) differences in 2636 genes expressions that were up or downregulated (at least twofold change) in plaques derived from patients with high RDW as compared to genes expression pattern found in samples from normal RDW patients. Next, those genes were filtered using Panther DB to choose those, which are known to be involved in pathways associated with pathogenesis of atherosclerosis. Moreover, proteins encoded by those genes were localized in aorta using immunohistochemistry technique. Necessary ethical approval (No 2011411-311) was obtained prior to material collection from patients that were planned to have carotid endarterectomy as standard treatment for their atherosclerotic lesions.6 of murine colon cancer CT26 cells that resulted in high RDW within 2\u00a0weeks. Second group of mice (n\u2009=\u200910) received erythropoietin for 4 subsequent days intravenously and the third group of animals (n\u2009=\u200910) was on a low iron diet for 4\u00a0weeks and had 0.6\u00a0ml of blood drawn regularly  to trigger anemia and induce inflammation-independent anisocytosis. Control mice (n\u2009=\u200910) constituted healthy, untreated BALB/c mice. All animals were on normal diet except for one group fed iron-deficient chow. Next, all mice, exposed to different factors contributing to high RDW value, had anisocytosis confirmed by blood tests and MRI performed using a 9 Tesla at the Karolinska Institute to observe blood flow in the arteries and veins of the cerebellum and to compare changes in blood flow between groups. Animal studies were conducted according to the guidelines of the Declaration of Helsinki, and approved by the Institutional Review Board of the Karolinska Institute .To analyze differences in blood flow through cerebral arteries in BALB/c mice with high RDW induced under distinct conditions, several manners of anisocytosis induction were undertaken. To trigger inflammation-mediated anisocytosis, mice (n\u2009=\u200910) were injected with 3\u2009\u00d7\u2009103) was applied (maintaining a 30% bulk RBC volume fraction). Moreover, the shear modulus of the RBC was changed to consider possible variability in RBC stiffness. The platelets were considered rigid and spherical objects with a diameter of 2\u00a0\u03bcm. To initiate the simulations, a random distribution of RBCs and platelets was used, from which the motion of the cells was tracked over time. A constant volume force was applied in the flow direction corresponding to the pressure drop in a flow of solely blood plasma having a velocity of 6\u00a0cm/s. At the boundaries, a periodic inlet\u2013outlet condition was applied along with no-slip at the vessel wall and cell surfaces.Simulation of blood flow was performed using the lattice Boltzmann method (LBM), in-house solver available at KTH Mechanics. The aim of using lattice Boltzmann (LBM) was to assess how variance in RDW influences the transport of platelets within the vessel. LBM is one approach to numerically assess the transport and distribution of particles and is commonly used in fluid dynamics to study dense particle suspension flows (such as blood flow). LBM is in this study used to assess the interaction among the blood components as well as the distribution of the different components within the blood vessel. The numerical setting provides an opportunity to study the blood components individually, not possible experimentally for a flow situation as considered here. Analyzed vessel had diameter and length of 42\u00a0\u03bcm and 126\u00a0\u03bcm, respectively. The volume fraction of RBCs investigated was 30%. To capture the effect associated with RDW, a deviation in RBCs volume corresponding to 12, 16 and 20% with respect to mean RBC volume , a volume holographic diffraction grating , a telecentric f-theta lens , and a 12-bit CMOS line-scan camera . Analysis of intensity of dynamic backscattering of moving particles enables to asses velocity and structure of blood flow simultaneously32.We measured velocity profiles of blood flow in microchannels with Doppler optical coherence tomography (DOCT). Venous blood was drawn from patients and samples with high and low RDW values were studied using DOCT and microfluidic channels as previously describedMRI studies were conducted on mice from different groups to determine blood flow velocity and shear stress in the carotid veins, especially at the vessel bifurcations. Mice were anesthetized and prepared for scanning according to the adopted protocol. MRI was performed in collaboration with Peter Damberg at the Karolinska Experimental Research and Image Center (KERIC) facility using a Varian 9.4\u00a0T scanner with a 30\u00a0cm bore.33. Following primary antibodies were used: anti-VCAM-1, anti-ANGPTL1 and anti-PLAT . As secondary antibody anti-rabbit/mouse ImPRESS universal staining kit  was applied. Sites of reactions were visualized as previously described34. Intensity was calculated according to 3 points scoring system .Immunohistochemical analysis was performed using previously established methodtm1Unc/J (ApoE\u2212/\u2212) lacking apolipoprotein E and B6.129P2-Hbb-b1tm1Unc Hbb-b2tm1Unc/J (Hbb+/\u2212) with knockout of genes encoding both hemoglobin chains were purchased from Jackson Laboratory (USA). For the atherosclerosis experiments, ApoE\u2212/\u2212 mice were mated with the Hbb+/\u2212 mice. Male double transgenic mice (Hbb+/\u2212\u2009\u00d7\u2009ApoE+/\u2212) were compared to age-matched male ApoE\u2212/\u2212, Hbb+/\u2212, and control C57BL6/J mice. Genotyping was performed by PCR, using tail-tip DNA according to the protocol provided by the Jackson Laboratory. Animals were fed a standard chow for 8\u00a0weeks. At 9\u00a0weeks of age, mice from each experimental group started a high fat diet  and continued 24\u00a0weeks to induce hyperlipidemia and atherosclerosis.Transgenic mouse lines: B6.129P2-ApoeAt 32\u00a0weeks, mice were anesthetized and blood samples were drawn from the heart into EDTA-coated tubes to prevent coagulation. Then, through the left ventricle, the animal was perfused transcardially with phosphate-buffered saline until the eluent from the right auricle became clear, followed by 10% buffered formalin infusion. Finally, aortas were placed in the fixative at 4\u00a0\u00b0C overnight.\u00ae, Vienna, Austria). Second part of blood was centrifuged at 1000\u00d7g in 4\u00a0\u00b0C for 10\u00a0min, then plasma was collected and stored at\u2009\u2212\u200980\u00a0\u00b0C until further analysis.Blood was collected directly from heart of anesthetized mice to EDTA coated syringes. Each blood sample was divided in two equal parts. First part was used for complete blood count by hematology analyzer  was dissected away intact from the dorsal wall. Aortas were fixed in 4% formaldehyde, opened longitudinally, pinned onto black wax plates and stained. The aorta was then rinsed with 70% ethanol for 5\u00a0min, then incubated for 8\u00a0min in filtered Oil Red O stain solution (a fat-soluble dye that stains triglycerides and protein-bound lipids red) containing 0.5% Oil Red O , in isopropanol, then the specimen was rinsed in distilled water to clear redundant staining. Next, stained aorta was placed in PBS. The total Oil Red O-stained lesion area was quantified using ImageJ software, version 1.38\u00d7 . The final data are expressed as a percentage of positive-staining areas relative to the total aortic area.Statistical analysis was performed using Statistica 7.0. Data obtained from animal experiments were analyzed using Student\u2019s t-test. For comparing the data gathered during human studies, we performed ANOVA, followed by least significant differences (LSD) post-hoc test. We considered the results as statistically significant when p-value was lower than 0.05. All data presented on graphs are mean\u2009\u00b1\u2009standard deviation (SD).Animal studies were conducted according to relevant guidelines and regulations. Experimental protocols were approved by the Institutional Review Board of the Karolinska Institute . All the information related to animal studies follows the recommendations in the ARRIVE guidelines.Human studies were performed in accordance with the Declaration of Helsinki. Ethical approval No 2011411-311 was obtained from Commission for the Supervision of Research on People and Animals at the Central Clinical Hospital of the Ministry of Interior and Administration in Warsaw. Informed consent was obtained from all participants prior to material collection."}
+{"text": "Immunotherapy is one of the four pillars of cancer treatment that has recently emerged as a beacon of hope for cancer patients. Certain immunotherapies, for example, immune checkpoint inhibitor therapy, monoclonal antibody therapy and chimeric antigen T-cell therapy have garnered extensive interest in response to their exceptional properties that activate the immune system to respond to cancer cells, inhibiting their progression. In the era of rapid development, dostarlimab, an anti-programmed cell death protein (PD-1) monoclonal antibody has mesmerized the medical profession by showing complete (100%) cure of patients with colorectal cancer. Not only this, the results obtained from clinical trials revealed no major side effects in any of the participants in the study. Dostarlimab has also shown promising results in endometrial cancer, ovarian cancer, melanoma, head and neck cancer, and breast cancer therapy. This review focuses upon the action of immunotherapy, extensively emphasizing the miraculous therapy to activate T-cells for cancer treatment. Based on this, we discuss major ongoing clinical trials and combination immunotherapies to enlighten future clinicians and researchers about the response of dostarlimab against various cancers. Cancer remains one of the deadliest diseases that humankind has ever encountered, and despite of years of research in this field it is still a leading health problem responsible for over 10 million deaths per year ,5,6,7,8.Another brilliant insight in cancer immunotherapy was brought forth by the Nobel-prize-winning discovery of T-cell checkpoints such as CTLA-4 and PD1 by Drs. Allison and Honjo . This reAntibodies are large glycoproteins belonging to the immunoglobulin (Ig) superfamily which are found naturally in blood and are responsible for recognizing foreign antigens, neutralizing them, and evoking further immune responses. They structurally comprise two heavy and two light chains in the shape of a Y. There are five different types of immunoglobins based on the type of heavy chains. These include IgA, IgD, IgE, IgG, and IgM. The Y-shaped immunoglobins consists of different parts, while the Fab (fragment antigen-binding) portion of the antibody is located at each tip of the Y; the fragment crystallizable (Fc) region is present at the base of the Y structure. Antibodies recognize specific antigens by their Fab portion, whereas Fc receptors mediate interactions between antibodies and other components of the immune system. The most common form of immunoglobulin used for antibody-based immunotherapy is IgG, attributed to its interaction with FcR and Fc\u03b3R, which are largely found in natural killer cells, macrophages, monocytes and granulocytes such as eosinophils or basophils. They are involved in specific functions related to complement-dependent cytotoxicity (CDC) and antibody-dependent cellular cytotoxicity (ADCC). Moreover, IgGs are further subdivided based on the ability of FcR to elicit CDC or ADCC response; while IgG1 and IgG3 can successfully induce these responses, IgG2 and IgG4 cannot ,21.mABs means \u201call for just one\u201d specific type of antibody; that is, each mAB has multiple copies of just one type of antibody isotype meant for targeting a unique antigen. There are various mABs available for the treatment of cancer, and while they all act through different pathways, some of them might act by more than a single process. mAB therapy for cancer has advanced considerably after unmodified murine mAbs were first considered as anticancer agents. Several mAB-based strategies have proven to have good potential in treating cancer patients. Their action involves the use of unlabeled IgG that specifically binds to the tumor cells, or alters the active host response towards the tumor . These mIt is a time of unprecedented progress in mAb-based therapy, with new therapeutic agents and constructs being developed rapidly, with an enhanced understanding of their biological effects and growing clinical experience based on both clinical trials and the community use of FDA-approved products. Dedicated research in the translational and clinical field of mABs have brought forth miraculous results for the very first time in anticancer therapy. A trial performed for dostarlimab on 12 patients with colorectal cancer produced complete cancer recovery. Although, this trial is at the phase II stage and was conducted only on limited individuals, a proven complete cure for cancer makes the world wonder upon this drug with high hope ,25. On tDostarlimab (Jemperli\u2122) or dostarlimab-gxly is a humanized mAB which acts as an antagonist for programmed death-1 (PD-1) receptors. It is being developed by GlaxoSmithKline (GSK) under a license from AnaptysBio Inc for the treatment of several forms of cancer including endometrial cancer, colorectal cancer, ovarian cancer, cancer of the head and neck, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), squamous cell cancer (SCC), fallopian tube cancer, pancreatic cancer, and many more. According to preliminary findings from the GARNET trial, dostarlimab has recently been approved (22 April 2021) for adults with advanced or recurrent advanced mismatch repair-deficient endometrial cancer (dMMR) in the EU and USA. The dose of dostarlimab that is generally recommended is 500 mg every 3 weeks (for the first four doses), after the fourth dose, 1000 mg every 6 weeks is administered until disease progression or any unacceptable toxicity is noticed ,27,28 F.PD1 is an immune checkpoint receptor found in T-cells that suppresses cancer-specific immune responses. The humanized IgG4 mAB, dostarlimab, is derived from a Chinese hamster ovary cell and has a molecular weight of approx 144 kDa. A binding between the PD-1 ligands (PD-L1 and PD-L2) and the PD-1 receptor on T-cells inhibits cytokine and T-cell proliferation. In some tumors, PD-1 ligands are upregulated, and signaling through this pathway may contribute to the suppression of active T-cell immunity. This is where the drug dostarlimab comes into the picture. It inhibits programmed cell death receptor-1 (PD-1) and blocks the interaction of receptors with PD-L1 and PD-L2, which in turn activates T-cells and enhances overall immunity. Studies have depicted that dostarlimab binds with PD-1 receptors of both humans and cynomolgus monkeys with high affinity, as seen from the results obtained in flow cytometry and plasmon resonance. Moreover, a human CD4+ mixed lymphocyte reaction assay showed that dostarlimab worked as a functional antagonist, resulting in increased IL-2 production. This assay also showed the enhanced activity of dostarlimab when TIM3 antibodies or LAG3 antibodies were present. In the presence of antibodies, dostarlimab exhibited increased activity, but no significant cytokine release was observed from human PBMCs  .A pharmacokinetic study for dostarlimab-gxly was performed on patients with solid tumors which included 150 endometrial cancer patients. It was noted that there was a proportionate increase in mean Cmax, AUC0\u2212inf and AUC0\u2212\u03c4 over the dose range of 1.0\u201310 mg/kg. Moreover, the mean cycles of Cmax and AUC0\u2212\u03c4 after the administration of 500 mg dostarlimab once every 3 weeks was reported to be in the range of 171 \u00b5g/mL and 35,730 \u00b5g\u2219h/mL, respectively, and 309 \u00b5g/mL and 95,820 \u00b5g\u2219h/mL, respectively, at a dose of 1000 mg administered once every 6 weeks. Similarly, the study also evidenced the mean steady-state volume of the distribution of dostarlimab to be around 5.3 L, and the mean steady-state clearance to be in the range of 0.007 L/h. There were no clinically significant differences observed in the pharmacokinetics characteristics of dostarlimab based on gender, age, ethnicity, tumor type, or renal or hepatic impairment. Although, there are no studies conducted to determine whether dostarlimab-gxly is carcinogenic or genotoxic. Fertility studies have been performed for this drug on monkeys which, after repeating doses for one and three months, found no significant effects on male or female reproductive organs, although most animals in these studies were not sexually mature by the time of study [The first-in-human study, 4010-01-001, otherwise known as the GARNET trial (NCT02715284), evaluated dostarlimab pharmacokinetics (PK), pharmacodynamics (PD), tolerability, clinical activity and safety across multiple solid cancer types, which included endometrial, NSCL and cancer of the ovaries and fallopian tubes. A modified 3 + 3 design was used to evaluate three weight-based doses  administered every 2 weeks intravenously in Part 1. Part 2A used two fixed-dose regimens, 500 mg every 3 weeks intravenously, and 1000 mg every 6 weeks intravenously was administered in in Part 2B. Data from Part 1 demonstrated a maximum receptor occupancy at 2.4 g/mL dostarlimab serum concentrations. Furthermore, a PK model was constructed using the PK data from Part 1 to predict dostarlimab concentrations that would exceed those leading to maximal receptor occupancy at fixed doses. Similarly, Part 2A demonstrated dose-proportional PK and the median serum trough concentrations to be approximately 40 and 50 ng/mL after a single dose of 500 mg and 1000 mg, respectively .June 2022 saw a revolutionary discovery in the field of cancer treatment. For the very first time in science, a drug under clinical trial showed the complete eradication of a tumor with no reoccurrence. The mAB-based drug dostarlimab was evaluated for safety under efficacy against locally advanced rectal cancer .Primary locally advanced rectal cancer is also known as stage III rectal cancer and is also indicative of resectable tumors with the involvement of lymph nodes. These tumors are characterized for invading and extending close to the mesorectal fascia. These types of colorectal cancer are generally treated with aggressive chemoradiation, short course radiotherapy, and total mesorectal surgery (TME) surgery. The results from this collective therapy are positive, showing excellent survival rates and low reoccurrence. Moreover, in some cases with locally advanced tumors, a complete removal of the tumor is the most preferred and beneficial option for control and survival .18F-fluorodeoxyglucose\u2013positron-emission tomography, magnetic resonance imaging, biopsy, digital rectal examination, or endoscopic evaluation. Moreover, no adverse events of grade 3 or higher were reported. The study clearly depicted that a single agent PD1 was highly sensitive to mismatch repair-deficient, locally advanced rectal cancer and could bring about positive results; however, a longer follow-up study still needs to be performed to validate this point [As stated above, the standard method of treatment of locally advanced rectal cancer is radiation and neo-adjuvant chemotherapy followed by the surgical removal of the rectum. Additionally, it has also been noted that the cause of some rectal cancers is a lack of mismatch repair. In the context of metastatic disease, mismatch repair-deficient colorectal cancer responds to the programmed death 1 (PD-1) blockade, thus suggesting that a checkpoint blockade may be effective in mismatch repair-deficient patients. Scientists in partnership with GSK initiated a prospective phase 2 study in patients with stage II or III rectal adenocarcinomas who were mismatch repair-deficient. They were administered with single-agent anti-PD-1 mAB dostarlimab every 3 weeks for 6 months. Although this treatment is supposed to be followed with standard surgery and chemoradiotherapy, the patients who depict a clinically complete response following dostarlimab therapy would not undergo chemotherapy, radiotherapy, or surgery. This is also the primary endpoint for the study. Interim results were obtained from the study completed on a total of 12 patients that had successfully completed treatment with dostarlimab and had also undergone a minimum of 6 months\u2019 follow-up. It was evidenced that all 12 patients  had a complete clinical response and no form of existing tumor, progression and recurrence was noticed in is point ,35.Dostarlimab was evaluated in a phase 1 nonrandomized clinical trial for patients with deficient mismatch repair endometrial cancer to assess antitumor activity and safety. Part 1 of this ongoing open-label, multicenter single group study began on 7 March 2016, and enrollment for patients with deficient mismatch mutation repair endometrial cancer began on 8 May 2017. Around 104 women with deficient mismatch mutation repair endometrial cancer were enrolled and each patient received intravenous dostarlimab 500 mg every three weeks for four doses, then 1000 mg every six weeks until disease progression, treatment discontinuation or withdrawal occurred. Specifically, the objective of this study was to evaluate the antitumor activity of dostarlimab on recurrent or advanced dMMR (mismatch repair deficiency) endometrial cancer (EC) patients, using the objective response rate (ORR) which was defined by blinded independent central review (BICR) using Response Evaluation Criteria in Solid Tumors (RECIST) guidelines. A similar concept is the duration of response (DOR), defined as the time from the first documented evidence of complete or partial response to the first documented evidence of disease progression or death, whichever occurs first. Following the first dose of dostarlimab administration, radiographic evaluations were performed 12 weeks after the first dose, every 6 weeks (\u00b110 days) until month 12, and then every 12 weeks thereafter.The results obtained from this analysis on patients with recurrent or advanced dMMR EC who had progressed after platinum-based chemotherapy and dostarlimab monotherapy were associated with an ORR of 42.3%  in almost 30 patients, 29.6% in around 21 patients, and around 12.7% in 9 patients. The responses were durable, and the median DOR was not reached at 11.2 months in the follow-up period. The safety profile depicted by dostarlimab was manageable and comparable to that of other anti-PD-1 antibodies. Additionally, treatment-related adverse events (TRAEs) accounted for less than 2% of patients discontinuing treatment, and there were no treatment-related deaths. To the best of our knowledge, these results are the largest set of data to date on dMMR EC treated with a PD-1 inhibitor ,36.Although cross-trial comparisons cannot be performed, it is generally noted that the response rates with anti-PD-1 therapies appear to be more favorable, as evidenced from the ORR range offered by single-agent therapies that ranged from 13.5%  for bevacizumab to 21\u201327.3%  for paclitaxel before the introduction of anti-PD-1 therapies. Although the GARNET trial was a single-group study, the antitumor activity observed in patients with dMMR EC was promising, suggesting that dostarlimab might have a role to play in the treatment of patients with dMMR EC. Dostarlimab demonstrated high ORR and a longer duration of response, reflecting its high potential against cancer. Furthermore, one year after inclusion in the GARNET trial, 74% of patients in the dMMR EC population are still alive. In addition to these wide actions of dostarlimab, a unique characteristic of this drug is its dosing regimen. Patients and caregivers both benefit from this unique dosing schedule after 12 weeks of initial treatment with dostarlimab, which may result in less frequent clinic visits and possibly lower healthcare costs. Altogether, the data from the GARNET study has demonstrated durable anticancer action not in only patients with (MMR-proficient) MMRp and dMMR endometrial cancers, but also for non-EC dMMR solid tumors. According to the GARNET trial data, dostarlimab monotherapy was accelerated for approval in the US as a treatment for recurrent/advanced dMMR solid tumors, following the progressive results obtained from prior treatment. Additionally, it has been approved in both Europe  and the USA (accelerated) for dMMR/MSI-H and dMMR endometrial cancer, respectively, during and after platinum-based chemotherapy ,38,39. AIn the past few years, scientists have also tried exploring the potential of dostarlimab against locally advanced cervical cancer (LACC). They hypothesize that the use of dostarlimab as a consolidation therapy following chemotherapy might enhance progression-free survival rate in patients. Based on this rationale, a randomized, phase II, open-label study was set as maintenance therapy for patients with a high risk of LACC. This ongoing study is a randomized study that began in 28 June 2019, and included around 132 participants. Interim data and hence the results for this study are yet to be reported ,42.Lung cancer is another cancer that is accountable for the most cancer-related deaths worldwide. Amongst the type of lung cancer, almost 85% belong to the category of non-small cell lung cancer (NSCLC), for which the primary option for treatment is chemotherapy. In recent years, the introduction of immune checkpoint inhibitors has revolutionized the process of cancer treatment.In a recent trial, the safety and antitumor activity of dostarlimab were studied in a first-in-human, phase 1, multi-center, open-label, two-part study GARNET cohort of 67 patients with recurrent or advanced NSCLC who had previously been treated with platinum-based chemotherapy. While Part 1 of the study was a dose escalation study and involved the evaluation of pharmacodynamics and pharmacokinetic characteristics of the drug at different doses of 1,3 and 10 mg/kg, Part 2, on the other hand, was conducted in two different subparts: Part 2A evaluated the dose safety and Part 2B dealt with evaluating the clinical efficacy of the drug. Immuno-related objective response rate (irORR) and safety were used as the primary endpoint to determine dostarlimab\u2019s antitumor activity in patients with recurrent or advanced NSCLC. An irORR was defined as the proportion of patients achieving immune-related complete response (irCR) or immune-related partial response (irPR) based on the investigators\u2019 assessment per immune-related RECIST (irRECIST). Monotherapy with dostarlimab produced strong antitumor activity and durable responses across all PD-L1 Tumor Proportion Score (TPS) status subgroups. It was noted that, in NSCLC, the safety profile of dostarlimab was acceptable, with low to a manageable toxicity, and was consistent with that of the other agents that block PD-L1. In the entire study, four patients, i.e., almost 6%, discontinued the study due to treatment-related TEAEs (treatment-emergent adverse effects) (TRAEs), and two deaths were caused because of treatment-emergent adverse effects (TEAEs) which were not considered related to treatment with dostarlimab. Furthermore, dostarlimab is currently being studied as a combination regimen for the treatment of NSCLC, as well as other solid tumors, including in the first-line setting .Besides the above-stated studies performed particularly on some specific kinds of cancer, other trials meant for advanced solid tumors are also being performed for dostarlimab. It is being evaluated for safety and efficacy in the phase 1 GARNET study (NCT02715284) in patients with advanced solid tumors. Participants in Cohort F of the GARNET trial had dMMRs or DNA polymerase epsilon (POLE) mutation non-endometrial solid tumors; the majority had GI origins. The patients were administered with 500 mg of dostarlimab for Q3W for four cycles followed by 1000 mg Q6W until discontinuation. Objective response rate (ORR) and duration of response (DOR) were noted by a blinded independent central review per RECIST. The patients receiving \u22651 dose of the drug were included in the safety analysis around 144 patients), while the ones that had measurable disease at baseline were included as part of the efficacy analysis at the 6-month follow-up (106 dMMR patients). Results from the study showed that amongst 106 patients, around 99, i.e., 93.4% of them, had gastrointestinal tumors. Moreover, the confirmed ORR in dMMR patients was around 38.7% and the complete response rate was approx. 7.5%. The median duration of follow-up was 12.4 months while median DOR was not achieved. In addition, treatment-related adverse events (TRAEs) were also noted in 68.8% of patients, amongst which almost 8.3% of patients were evidenced to experience at least one grade \u22653 TRAE, the most common of which was an increase in lipase in around 1.4% (two patients). Additionally, no deaths were caused as a result of drug administration and only two patients discontinued drug administration because of TRAE. These results obtained from the study show evidence of the potential antitumor activity of dostarlimab against solid tumors. Lastly, the safety profile was also observed for other cohorts in GARNET and the results obtained were very consistent with low to no immune-related TRAEs  patients,46.A sarcoma is a malignant solid tumor with high heterogeneity accounting for over 100 subtypes classified so far. Over the years, chemotherapy combined with surgery has proven to be an effective treatment procedure that has resulted in a comparative increase in overall survival rate. Dostarlimab is also being employed to study its activity against sarcomas. A phase II, single-arm, not-randomized, European multicentric study was designed to evaluate the action of TSR-042 (dostarlimab), in patients diagnosed with advanced/metastatic clear cell sarcoma. The study was initiated on February 19, 2021, and around 16 patients were enrolled for the study . The majThere are several other immune check point inhibitors such as nivolumab, pembrolizumab, atezolizumab, durvalumab, and avelumab that are utilized for cancer treatment . Since dDostarlimab is also being studied for its activity with one or more chemotherapeutic drugs, including niraparib, pembrolizumab, bevacizumab, cobolimab, and many more. Most of these studies conducted for different cancer types are still under trial. The data below covers some of such ongoing studies.A combination study investigated the PARPi drug niraparib and anti-PD-1 mAB dostarlimab administered in patients with advanced head and neck squamous cell carcinoma (HNSCC). Niraparib is a type of targeted therapy that inhibits poly adenosine diphosphate-ribose polymerase (PARP), which is an enzyme that repairs DNA in times when it gets damaged. Blocking these PARP might prevent DNA repair in cancerous cells, causing them to die. This phase II trial involving 49 patients was initiated on February 8, 2021 . ResearcIn addition to these, other combinations such as cobolimab, docetaxel, and dostarlimab ; dostarlDriving the patient\u2019s own immune system to act against the deadly disease of cancer could potentiate the fast remission of neoplastic cells. Generally, any invasion of pathogens or the non-responsiveness of certain stimuli in the human body turns the T-cell \u201con\u201d, causing the immune-defense system of the body to respond against them. These T-cells have proteins on their surface called immune checkpoint proteins. Most cancer cells over-express certain proteins that inactivate T-cells, which should be in the field to attack cancer cells in response to their growth and proliferation. Thus, cancer cells switch \u201coff\u201d the immune-response button of T-cells so that they can no longer detect and suppress the cancer cells. Immunotherapy, therefore, acts on tumors, disabling their function to act on T-cells. This, in turn, pushes T-cells to immediately act against them. Dostarlimab is one the immune checkpoint inhibitors that blocks the binding of PD-1 protein on T-cells to the ligand PD-L1/2. It is under trial for different cancer therapies, but, recently, it has shown positive results and complete remission for the very first time in history, and has therefore attracted the interest of clinicians, oncologists, researchers, and even industrialists. The clinical trial was performed on a subset of 12 patients with colorectal cancer with mismatch repair deficiency (MMRd). Such tumors are, however, non-responsive towards radiation or chemotherapy. Nonetheless, in the above trial, all of the 12 patients were completely cured, suggesting that immunotherapy could turn out to be a major milestone in the history of cancer therapy. It is essential to note that all the patients were at same stage of cancer and were given no previous chemotherapy or surgical treatment. The treatment appeared to be effective within this group; however, it is still difficult to suggest that the same response will be reported in large groups of individuals. A phase 3 clinical trial should be carried out covering heterogeneous samples to accurately determine the strength of dostarlimab. Furthermore, studies could be carried out at various locations for different types of cancers as well. As of now, immunotherapy has not reached the wider clinical market and, in this context, the concept of nanotechnology could mark a new beginning in oncotherapy. Overall, it cannot be overlooked that the immunotherapeutic agent dostarlimab is a star compound against colorectal cancer."}
+{"text": "Dostarlimab (JEMPERLI) is a PD-1 monoclonal antibody for the treatment of adult patients, with mismatch repair deficient (dMMR), recurrent or advanced endometrial cancer that has progressed on or following prior therapy with a platinum-containing regimen. As determined by an FDA-approved test this indication was granted rapid approval based on the rate of tumor response and the duration of the response. Continued approval for this indication is conditioned on further confirmatory trials demonstrating and documenting clinical benefit. In June 2022, the clinical trial NCT04165772 reported a 100% remission rate for rectal cancer. This clinical trial brought proof that we can match a tumor and the genetics of what is driving it, with therapy. This clinical trial continues to enroll patient and is currently enrolling patients with gastric, prostate, and pancreatic cancers. Dostarlamib is being recommended for rectal cancer. The focus of this review is to summarize the existing knowledge regarding Dostarlimab and explore the possibilities of mono- and combination therapies. In 1986, the first immunotherapy agent, an antitumor cytokine designated interferon-alpha 2 was approved by the US Food and Drug Administration (FDA). IFN-a2 was first approved for the treatment of hairy cell leukemia (HCL) after studies showed that it had a high response rate in patients with advanced HCL. In 1995, the FDA approved IFN-a2 for use as adjuvant therapy for stage IIB/III melanoma. When it was licensed for the treatment of metastatic melanoma and renal cell carcinoma in 1998, interleukin-2 (IL-2), a T-cell growth factor that aids in immunological modulation and T-cell proliferation, became the second anticancer cytokine approved by the FDA. Since the development of immunotherapies a promise of revolutionizing the standard care in cancer treatment has existed and, in recent years, a novel class of immunotherapeutics known as checkpoint inhibitors has emerged as a cornerstone in cancer treatment [Notably, a record number of antibody therapeutics have been granted approval in either the European Union (EU) or the United States (US). In diseases such as cancer, immunotherapies have drastically changed the game for patients, since immunotherapies get the immune system properly engaged to eradicate cancer cells. For example, the use of programmed cell death protein-1 (PD-1) and the cytotoxic T-lymphocyte-associated protein-4 (CTLA-4) has been demonstrating increased median overall survival and durable responses in patients across multiple tumors. Thousands of people have benefited from immune checkpoint inhibitors (ICPIs); however, despite long-lasting responses in a variety of tumor types, most patients either do not respond at all or develop resistance to the ICPI. Additionally, ICPI treatment has the potential to cause major side effects, and therefore identification of patient populations that will benefit from ICPI as single medicines and in combination is urgently needed .Regarding activated T cells, PD-1 is an inhibitory immunological checkpoint receptor. PD-1 reduces activated effector T-cell capabilities such as proliferation, cytokine generation, and cytotoxic activity by interacting with its ligands, programmed cell death ligands 1 and 2 (PD-L1 and PD-L2). One of the strategies through which tumor cells elude the immune system and interfere with cancer-specific immune responses is the upregulation of PD-L1. Preclinical and clinical investigations have shown that treatments that bind to either the PD-1 receptor or ligand and effectively disrupt the receptor\u2013ligand interaction can boost antitumor immunity and improve patient survival in a range of malignancies . So far,On 17 August 2021, the FDA granted accelerated approval to Dostarlimab, a monoclonal antibody, for adults with dMMR recurrent or advanced endometrial cancer that has progressed despite ongoing or prior treatment with the platinum-containing chemotherapy regimen, Dostarlimab  is a humanized mAb of the IgG4 isotype, produced by recombinant DNA technology in mammalian Chinese hamster ovary (CHO) cells that binds PD-1 on T cells and blocks interactions with its ligands PD-L1 and PD-L2, activating immune responses. Dostarlimab is an immunotherapy that aids the body\u2019s natural anti-tumor immune response during cancer treatment. It is given via intravenous infusion for over 30 min every three to six weeks, depending on the cycle.TM final product is a concentrate for infusion solution containing 500 mg of dostarlimab as the active ingredient. Trisodium citrate dihydrate, citric acid monohydrate, L-arginine hydrochloride, sodium chloride, polysorbate 80, and water for injection are among the other constituents. To prevent the formation of half-antibodies, each heavy chain of the antibody has a serine to proline substitution (S228P) to promote the stabilization of disulfide bonds between the two heavy chains. Dostarlimab was humanized by grafting the heavy- and light-chain complementarity-determining regions on the germline variable region frameworks of their nearest CONTACT human species orthologs, followed by affinity maturation via mammalian cell display and somatic hypermutation, using the AnaptysBio SHM-XEL system. The company Anaptysbio developed the drug Dostarlimab, also in collaboration with Tesaro, and was bought by GlaxoSmithKline in 2019 ,6. The J\u22121s\u22121) and a dissociation rate of 1.7 104 (s\u22121), indicating fast target association and delayed dissociation [Although the heavy chain of Dostarlimab is involved in the interaction between PD-1 and Dostarlimab, the light chain is predominantly responsible for steric blockage of PD-L1 binding. To attain high affinity, Dostarlimab causes conformational rearrangements in the BC, C\u2019D, and FG loops of PD-1. By occupying the concave surface on the heavy chain via numerous interactions, the residue R86 within the C\u2019D loop of PD-1 plays a vital role in Dostarlimab binding. This high-resolution structure could be useful in developing better anti-PD-1 biologics or effective cancer immunotherapy combination methods . Dostarlociation . Since IThe structural basis is still unrevealed, but it is known that an epitope within a target molecule might be a critical component of a therapeutic antibody since antibodies that recognize different epitopes have varying therapeutic efficacy. Even though that antibodies against PD-1 and PD-L1 have a similar blocking function, they identify different antigenic epitopes. Because of their high specificity and affinity for their targets, monoclonal antibodies have been a key therapeutic method for decades. The high-resolution structure revealed that Dostarlimab binds to the flexible loops of PD-1, including the BC, C\u2019D, and FG loops, differently than Pembrolizumab or Nivolumab .Moreover, Dostarlimab was characterized by a variety of in vitro and in vivo experiments, as well as preclinical actions that enabled it to become an investigational new drug. Dostarlimab has no cross-reactivity with the mouse orthologue, and it does not cause considerable cytokine stimulation when used alone . It was Dostarlimab has an anti-drug antibodies (ADA) rate of 2.5%, which, again, is comparable to other anti-PD-L1 medicines, and it only induces a modest immune response in a limited fraction of cancer patients after one or more treatment cycles. Dostarlimab\u2019s high product purity and mode of administration reduces the danger of inducing immunological reactions. Furthermore, there is currently no evidence that pre-existing ADAs or the generation of ADAs has any effect on any safety or efficacy measurements. These findings suggest that Dostarlimab is a novel and effective anti-PD-1 monoclonal antibody with a low risk of eliciting immunogenic reactions . Data frDostarlimab was found to improve T-cell activation in a variety of in vitro functional test methods using primary human T cells. While Dostarlimab improved T-cell activation in antigen-dependent systems, it had no direct (nonspecific) effects on T-cell responses, as seen by the lack of cytokine production in the absence of antigen. Dostarlimab was found to have effective anticancer action in humanized mice tumor models, as well as a consistent pharmacokinetic and pharmacodynamic profile with negligible off-target effects. Its anticancer effectiveness was linked to a decrease in tumor-associated regulatory T cells and an increase in tumor-infiltrating CD8+ T cells . For exaDostarlimab\u2019s anti-PD-1 antibody profile was shown to be good in preclinical testing, with effective binding to PD-1 and antagonizing interactions with PD-L1 and PD-L2. Dostarlimab binds to the human PD-1 receptor with a high affinity, with a binding affinity (KD) of 300 pM. Preclinical findings for the previous approved PD-1 treatments such as Nivolumab, Pembrolizumab, and Cemiplimab have a similar binding profile. Dostarlimab was chosen for its IgG4 isotype to generate the most dependable and efficacious therapy. Other anti-PD-1 antibodies  are all IgG4 modalities, but anti-PD-L1 antibodies  are all IgG1 modalities . According to surface plasmon resonance, flow cytometry employing cell lines overexpressing recombinant PD-1, or binding to the native protein on peripheral blood mononuclear cells, Dostarlimab bound to both human and cynomolgus monkey PD-1 with great affinity . The antInterfering with the PD-1/PD-L1 pathway removes an essential immune system inhibitory response, which can lead to severe or fatal immune-mediated adverse effects. These reactions can occur in any organ system and at any time after starting therapy; while they are most common during therapy, they can also occur after the causative substance is stopped. Patients on Dostarlimab should be closely monitored for signs of an underlying immune-mediated reaction, and if one is suspected, they should be assessed and treated immediately. It is important to remember that anti-PD-L1 therapies are associated with a multitude of side effects, including pneumonitis, hypothyroidism, colitis, and infusion-site responses. Although enhancing the immune system\u2019s activation state is an effective anticancer strategy these events are most likely connected to the target\u2019s binding and associated pharmacodynamic consequences, such as anti-PD-L1 treatments\u2019 immune-related side events. The cytotoxicity caused by the antibody\u2019s binding to complement, or FC receptors is another important factor in predicting the safety profile of a new anti-PD-(L)1 treatment. Dostarlimab demonstrated little to no binding to Fc or a complement protein C1q, receptors that induce ADCC, and CDC, respectively, and so is unlikely to result in the depletion of antitumor effector T cells, which is consistent with its IgG4 framework.The preclinical data supported Dostarlimab first-in-human dose selection and showed that the drug had a sufficient safety margin to be examined further in the Phase 1 GARNET trial\u2019s human dose-finding sections 1 and 2A. Dostarlimab has shown significant and sustained responses in ongoing clinical studies, as well as a manageable safety profile with side effects like those seen with other anti-PD-1 treatments. No dose-limiting toxicity was observed. Dostarlimab has shown potential as an anti-PD-1 therapy in different clinical studies, including RUBY (NCT03981796), FIRST (NCT03602859), IOLite (NCT03307785), and MOONSTONE (NCT03307785), and several more, where it is being tested either as a monotherapy and in combination for a variety of tumor types (NCT03955471) .A population PK (PopPk) profile of Dostarlimab was well described by a 2-compartment model with time-dependent linear elimination. At clinically relevant doses, the PopPK model revealed that Dostarlimab exposure is approximately dose-proportional. The PK profile of Dostarlimab is generally consistent with that of other approved PD-1 inhibitors, Pembrolizumab, Nivolumab, and Cemiplimab because PK parameters were similar, and both time-varying CL and a linear elimination pattern were previously observed for these agents within their therapeutic dose range. While Dostarlimab\u2019s time-varying CL is similar to other PD-1 inhibitor observations, the typical maximum drop in CL over time was calculated at 14.9%, which is lower than that reported for Pembrolizumab (20\u201330%), Nivolumab (25%), or Cemiplimab (35.9%). Interestingly, in stepwise covariate modeling, tumor type (EC (dMMR/MSI-H), NSCLC or MSI-H, etc.) was not determined to be a statistically significant covariate and did not affect Dostarlimab PK characteristics. Body weight and time-varying albumin were observed to influence Dostarlimab PK, as previously reported for other PD-1 inhibitors. The impact of body weight on exposure was considered not clinically relevant. For short, patient covariates/disease characteristics had limited clinically relevant effects on exposure.Dostarlimab has a pharmacokinetics (PK) profile that permits the dosing interval to be increased from three to six weeks. The pharmacodynamic activity of Dostarlimab was conducted in both in vitro and in vivo experimental systems. Throughout the first cycle 500 mg was administered intravenously every 3 weeks, and the absorption was described by: the mean Cmax and AUC0-tau of dostarlimab as 171 mcg/mL and 35,730 mcg.h/mL, respectively. When administered at 1000 mg every 6 weeks, the mean Cmax and AUC0-tau are 309 mcg/mL and 95,820 mcg.h/mL, respectively. At steady state, the mean volume of distribution of Dostarlimab is 5.3 L. The metabolism of Dostarlimab has yet to be characterized, but for now it is estimated to be degraded via catabolic pathways into smaller peptides and amino acids . The meaOther authorized PD-1 inhibitors have the following PK characteristics: long half-life, limited extravascular diffusion, and minimal impact of hepatic or renal function impairment on PK . The antNoticeable, there is a correlation between tumor mutational burden status (TMBST) and dMMR/MSI status in some tumor types, including EC and colorectal cancer, and multivariate logistic regression analysis revealed that the impact of TMBST on overall response rate (ORR) was significant for the entire dataset and the EC subgroup. A similar correlation between TMBST and ORR has previously been reported for immune-checkpoint inhibitors . There aT cells, B cells, natural killer cells, and other tumor-infiltrating lymphocytes express PD-1, a transmembrane receptor. Antigen-presenting cells (APCs) and certain nonimmune cells, particularly tumor cells, express PD-L1 and PD-L2. The immunological inhibitory checkpoint PD-1 and its ligands are involved in T-cell activation and tolerance . The bin\u00ae) and Pembrolizumab (KEYTRUDA\u00ae) were approved by the US FDA in 2014 for the treatment of melanoma and nonsmall cell lung cancer. Since then, the antibodies\u2019 indications have been expanded to include renal cell carcinoma, classical Hodgkin lymphoma, squamous cell carcinoma of the head and neck, urothelial carcinoma, esophageal carcinoma, endometrial cancer, squamous cell carcinoma, hepatocellular carcinoma, and breast cancer, either as monotherapy or in combination with other drugs, Pembrolizumab, Nivolumab, Cemiplimab, Atezolizumab, Avelumab, and Durvalumab are mAbs that disrupt the interaction of PD-1/PD-L1 and thereby eliminate cancers\u2019 ability to evade the immune system . NivolumIn 2019, GSK anticipated potential regulatory submissions for Dostarlimab, after the results of Phase I dose-escalation and cohort expansion study . This study evaluated the safety and efficacy of Dostarlimab monotherapy for patients with advanced solid tumors, including women with recurrent or advanced endometrial cancer who progressed on or after a platinum-based regimen. Patients were administered 500 mg every 3 weeks for the first 4 cycles, and 1000 mg every 6 weeks. Of the 25 patients with microsatellite instability in endometrial cancer, one had a complete response and 12 had partial responses. The objective response rate was 43.5% in this group of 108 patients, according to RECIST v1.1 , with 10.2% complete responses (CRs) (11/108) and 33% partial responses (36/108). Furthermore, 89.4% of respondents had an active answer at the time of data cut-off .Early-stage clinical studies, as well as two Phase 3 studies, RUBY and FIRST, are evaluating Dostarlimab as a treatment for several forms of cancer. The Phase 3 RUBY study NCT03981796) is a 2-part study. Part 1 is to evaluate the efficacy and safety of Dostarlimab plus carboplatin-paclitaxel followed by Dostarlimab versus placebo plus Carboplatin-Paclitaxel followed by placebo. Part 2 is to evaluate the efficacy and safety of Dostarlimab plus Carboplatin-Paclitaxel followed by Dostarlimab plus Niraparib versus placebo plus Carboplatin-Paclitaxel followed by placebo in participants with recurrent or primary advanced (Stage III or IV) endometrial cancer. TSR-042 is also being tested in a Phase 3 FIRST trial (NCT03602859), which compares platinum-based therapy with TSR-042 and Niraparib to the standard of care platinum-based therapy as first-line treatment of Stage III or IV non-mucinous epithelial ovarian cancer [1796 is aThe EMA approved the conditional marketing authorization since Jemperli answers an unmet medical need and the benefit of immediate availability outweighed the risk of less comprehensive data than is generally necessary. In 2021, either the US or the EU granted accelerated approvals to 11 antibody therapeutics. The FDA granted accelerated approval to five of the seven products, Dostarlimab, Loncastuximab Tesirine, Amivantamab, Aducanumab, and Tisotumab vedotin. Jemperli received an additional accelerated approval from the FDA on 17 August 2021, for the treatment of adult patients with dMMR recurrent or advanced solid tumors, as determined by an FDA-approved test, that have progressed on or following prior treatment and who have no satisfactory alternative treatment options. This approval was based on the tumor response rate and the response\u2019s duration. The increased number and variety of antibody therapies that may be approved soon will almost certainly have a significant impact on patient care. This is particularly true for cancer patients, who may soon have access to a significantly higher number of antibody immune checkpoint modulators and antibody\u2013drug conjugates.Cancer immuno-therapy has seen significant clinical success driven by ICBs that restore T-cell activation. ICBs act in multiple ways to alter T-cell function, including the downregulation of inhibitory signaling . One tarAnti\u2013PD-(L)1 pathway-targeted treatments have been demonstrated to be well tolerated and have consistent safety profiles as a pharmacological class, and when used to treat dMMR-MSI-H, PD-1/PD-L1 inhibitors showed favorable clinical results, including a higher response rate. However, not all drugs entitled of PD-1/PD-L1 inhibitors have the same success rate in treating tumors with dMMR. In Sclafani\u2019s review, it is highlighted that the administration of Pembrolizumab to patients with dMMR metastatic colorectal cancer was correlated with a poor prognosis. Numerous studies have demonstrated the wide range of immunotherapy, prognosis, and chemotherapy sensitivity in individuals with dMMR/MSI malignancies, and the detection limitation contributes to the difficulty of treatment. Moreover, it is necessary to quantify the frequency of missmatch repairs. A lower or higher frequency will require a different treatment. However, it remains unclear how the same PD-1/PD-L1 inhibitors (or even different ones) cause variable therapeutic responses in patients with a different frequency of mismatch repairs . At lastBased on the enormous success of antibodies targeting PD-1 or its ligand PD-L1, the low response rate of -PD-1/PD-L1 therapy must be addressed. For most cancer patients, the PD-1/PD-L1 pathway is not the only mechanism limiting antitumor immunity and inhibiting the PD-1/PD-L1 axis is insufficient to generate an effective antitumor immune response. Some combination therapies, such as PD-1/PD-L1 plus chemotherapy, radiation, angiogenesis inhibitors, targeted therapy, additional immune checkpoint inhibitors, co-stimulatory molecule agonists, interferon gene stimulator agonists, fecal microbiota transplantation, epigenetic modulators, or metabolic modulators exhibit better response rates and superior anticancer efficacies , see TabFor example, Belamaf (Belantamab mafodotin) is a B-cell maturation antigen (BCMA)-targeted antibody\u2013drug combo that was recently licensed as monotherapy for people with relapsed/refractory multiple myeloma. For patients with relapsed/refractory multiple myeloma, a phase I/II platform research comparing the safety and efficacy of belamaf combination with Dostarlimab (a PD-1 blocker) to belamaf monotherapy is underway . BCMA isCombination techniques have been developed to generate synergistic effects or to diminish primary or secondary resistance to PD-L1 inhibitors due to the complexity of immune response activation and the multiple mechanisms leading to resistance to PD-(L)1 inhibitors. Combinations with CTLA-4, TIGIT, IDO, and PVRIG are being evaluated in early clinical trials to block other immune checkpoints  , and futPembrolizumab and Dostarlimab have shown impressive results in MMR-deficient cases, and the association of Pembrolizumab and Lenvatinib is becoming a standard of care for pretreated recurrent MMR-proficient EC. However, further advances are needed to understand primary and secondary mechanisms of resistance to immunotherapy and to implement ICI in the first-line metastatic setting and early-stage tumors.Patients with platinum-resistant ovarian cancer have a poor prognosis and few therapy alternatives. In this group of patients, preclinical and clinical studies showed that combining poly-ADP ribose polymerase inhibitors with immune checkpoint drugs could have a synergistic anticancer effect (NCT04679064) . MoreoveFor advanced solid tumors, IOLite is a dose-finding trial of Dostarlimab in combination with the PARP inhibitor Niraparib or platinum-based chemotherapy Bevacizumab. It has four arms, each of which is adorned with Dostarlimab. Patients were assigned to either arm based on the histology of their tumors, their prior treatment history, and their physician\u2019s recommendation. In diverse forms of cancer , there was one complete response with the combination of Dostarlimab plus chemotherapy, and there were partial responses in any of the four arms. There were no pharmacokinetic interactions between Dostarlimab and Niraparib and the combination. As a result, the combination of the two medications appears to be successful, with responses in a variety of histologies and a favorable safety profile .The majority of trials look at Dostarlimab in combination with PARP inhibitors, antiangiogenic medicines, chemotherapy, or other immunotherapies such as TSR-022 (anti-TIM-3) or TSR-033 (anti-LAG-3). There have been no efficacy results released yet; however, a preliminary safety profile report from the AMBER phase I trial  has been released.Studies show that the doublet and triplet combination of Dostarlimab with Niraparib or Carboplatin-Paclitaxel, with or without Bevacizumab, was safe and tolerable with promising evidence of antitumor activity in patients with advanced solid tumors. The co-administration of Niraparib, Carboplatin-Paclitaxel, or Bevacizumab did not affect the PK of Dostarlimab. To prevent the potential impact of prior medications on the efficacy of the combinations, we tested them in PARP inhibitor-naive and PD-1/L1 inhibitor-naive patients . CombiniMSI-H/dMMR is found in 13\u201330% of recurrent endometrial malignancies. The mutations that cause dMMR endometrial malignancies are mostly somatic (90%) in nature, with 5\u201310% of cases involving germline alterations . CancersThe mismatch repair mechanism is a crucial step in the preservation of genomic integrity. It is involved in processes including mitotic and meiotic recombination, immunoglobulin gene rearrangement, apoptosis, and more. Testing for d-MMR or MSI-H helps to identify patients who are likely to respond to PD-1 inhibitors ,29. EndoEndometrial cancer is the 6th most occurring cancer in women. In 2021, there were more than 400,000 new cases. Patients with advanced and recurrent disease have a dismal prognosis with an expected 5-year survival of less than 20% and limited treatment options. Patients with metastatic disease are eligible for platinum-based chemotherapy. The expected median progression-free survival (PFS) is of 13 months . EC has Dostarlimab binds with high affinity to the PD-1 receptor and effectively blocks the interaction with PD-L1 and PD-L2 . The GARn = 12), with anemia being the most frequently reported TRAE at 2.9% (n = 3). At least one significant TRAE was experienced by 10 patients (9.6%). Colitis was the most frequently reported serious TRAE (2 (1.9%)). Two individuals (1.9%) dropped out of the research due to a TRAE (increased transaminase levels); one of these two patients also exhibited elevated glutamyl transferase levels. There have been no TRAE-related deaths documented. Pneumonitis was detected in one patient, but no grade 3 or higher infections were found.Most treatment-related adverse events (TRAEs) in the 104 patients included in the safety analysis were grade 1 or 2. Asthenia, diarrhea, tiredness, and nausea were the most reported TRAEs of any grade (10%). TRAEs of grade 3 or above were recorded in 11.5% of cases  and Dostarlimab are now indicated for patients with dMMR/MSI-H chemoresistant metastatic colorectal cancer (in patients who have not previously received an ICI). Focusing on the premise of targeting immune-mediated interaction in the dMMR/MSI-H intestinal milieu.Targeting molecular abnormalities seen across diverse tumor histology is becoming increasingly important in cancer treatment. While some oncogenic drivers, such as microsatellite instability (MSI) and NTRK fusions, can be treated the same way regardless of tumor type (\u201chistology-agnostic\u201d), others require histology-specific therapeutic adjustments (\u201chistology-tuned\u201d), which can be accomplished by using specific inhibitors and ad hoc combinations.Pembrolizumab or Dostarlimab, among histology-agnostic medicines, showed equivalent action in MSI metastatic colorectal cancer (mCRC) as in other MSI tumors, while Entrectinib or Larotrectinib were successful in NTRK rearranged mCRC, albeit less significantly than in the general population. BRAFV600E mutations and ERBB2 amplification are targeted by histology-tuned methods in mCRC, underscoring the need for simultaneous anti-EGFR inhibition or cautious selection of companion medicines in this tumor type. Anti-RET and anti-ALK medicines have emerged as possible histology-agnostic treatments, whereas anti-KRASG12C methods could become histology-tuned therapies in the future. The effects of targeting ERBB2 mutations and NRG1 fusions were mixed. To summarize, agnostic targets such as MSI and NTRK fusions have previously been exploited in mCRC, whereas the multitude of developing histology-tuned targets represent a challenging potential that will necessitate the evolution of molecular diagnostic tools at the same time .In MMR-deficient instances, Dostarlimab has demonstrated promising benefits, and the combination of Pembrolizumab and Lenvatinib is quickly becoming the standard of therapy for pre-treated recurrent MMR-proficient EC. However, further research is needed to understand the primary and secondary mechanisms of immunotherapy resistance, as well as to use ICI in the first-line metastatic context and early-stage malignancies. The same applies to rectal cancer. Future clinical trials should go through safety studies to identify higher-risk categories.Treatments such as Dostarlimab should become widely available, as well as access to a medical team who will help monitor patients like in the trial NCT04165772 and intervene if the tumor comes back. We believe that the future of cancer treatment is an approach based on cancer type and subtype, and such a dramatic response as seen with Dostarlimab in patients with rectal cancer gives hope that we are on the right track to find a dramatic match for the remaining cancers."}
+{"text": "The COVID-19 pandemic proved the resilience of health systems in managing a health crisis worldwide. In this sense, implementing large-scale vaccination programs was proposed as a fundamental strategy to restrict infections and deaths caused by SARS-CoV-2 infections.Mexico implemented a comprehensive vaccination policy encompassing up to 15 vaccines to cover almost 160 million inhabitants.The Lancet Regional Health\u2014Americas, Hernandez-Avila and Ortiz-Brizuela et\u00a0al. performed a nationwide nested test-negative design to evaluate the effectiveness of five SARS-CoV-2 vaccines  in Mexican pensioners covered by the Mexican Institute of Social Security.In this issue of The results from this study fill an important gap in Mexico, as they contribute to understanding the real-world effectiveness of a multi-vaccine program for pensioners. This subset of the population has not only been proven to face a higher risk of adverse outcomes due to increased age and comorbid conditions but also endures social disadvantages and economic vulnerability, increasing the risk of severe forms of COVID-19.While more research is still needed to gauge the effectiveness of COVID-19 vaccines, the results from this study show that successful public health policies, such as Mexico's vaccination program, are effective strategies to mitigate the impact of the emerging pandemic. However, they also show that policies still need strengthening to address context-specific challenges that perpetuate the influence of sociodemographic inequalities on the effectiveness of these interventions in one of Latin America's hardest-hit regions.Each author contributed important intellectual content during manuscript drafting or revision and accepted accountability for the overall work by ensuring that questions pertaining to the accuracy or integrity of any portion of the work are appropriately investigated and resolved.Nothing to disclose."}
+{"text": "This article reviews the current knowledge state on pragmatic and structural language abilities in autism and their potential relation to extralinguistic abilities and autistic traits. The focus is on questions regarding autism language profiles with varying degrees of (selective) impairment and with respect to potential comorbidity of autism and language impairment: Is language impairment in autism the co-occurrence of two distinct conditions (comorbidity), a consequence of autism itself (no comorbidity), or one possible combination from a series of neurodevelopmental properties ? As for language profiles in autism, three main groups are identified, namely, (i) verbal autistic individuals without structural language impairment, (ii) verbal autistic individuals with structural language impairment, and (iii) minimally verbal autistic individuals. However, this tripartite distinction hides enormous linguistic heterogeneity. Regarding the nature of language impairment in autism, there is currently no model of how language difficulties may interact with autism characteristics and with various extralinguistic cognitive abilities. Building such a model requires carefully designed explorations that address specific aspects of language and extralinguistic cognition. This should lead to a fundamental increase in our understanding of language impairment in autism, thereby paving the way for a substantial contribution to the question of how to best characterize neurodevelopmental disorders. Autism spectrum disorder (ASD) is a neurodevelopmental conditionIn current versions of the two principal nosographic systems, the DSM-5 APA  and the The implementation of these recommendations, in research or clinical settings, is far from obvious, given current understanding of language impairment in ASD. Some researchers have argued that ASD and DLD constitute points on a continuum of the same disorder instead of separate conditions, on the basis of evidenced overlaps in the patterns of language impairment in the two populations  autistic individuals\u2019 language difficulties to the first dimension of ASD , the second dimension  is rarely mentioned as a potential underlying cause of ASD language difficulties. This warrants further research. In summary, the nature and directionality of the interactions between linguistic skills, extralinguistic abilities and ASD characteristics is the subject of current debate.The aim of this review is to discuss the key role of language in understanding the challenges in general functioning of individuals with ASD. In doing so, we highlight the heterogeneity of linguistic profiles in autistic individuals, in terms of which language components may be impaired and how, and we point to areas of extralinguistic cognition which may be sources of difficulty or, conversely, which may provide extraordinary language-building resources to these people. These considerations, intimately tied to how these skills can be adequately assessed in ASD, across the range of profiles, are the necessary building blocks for meaningful progress regarding the veritable nature of language difficulties in ASD: a comorbid condition, a likely consequence of ASD, or indeed, in a dimensional approach to neurodevelopmental disorders, just one of a host of separate properties which can combine in individuals in different constellations.Language is a key ability that supports and expresses human thought and enables us to communicate, a resource we use to share our thoughts, emotions, and desires, to participate in social processes, and to learn. Language is a system, with a specific architecture and organization; it also encompasses how this system is used for communication. Over the last 65\u00a0years (since Chomsky (i)Lexicon (vocabulary): storage of words and their properties (ii)Structural language:a, o, i; consonants (C), e.g., s, t, r), syllables (ba-by: CV-CV), and prosodic units Phonology: organization of the sound system via segmental units , e.g., rd person singular: walk-s)Morphology: organization of meaningful elements to form words Syntax: organization of words into sentences  vs. Kim washed her (her cannot refer to Kim))Compositional Semantics: derivation of meaning from the structure of words, sentences, and larger units Pragmatics: use of language in context, integrating aspects of the linguistic and non-linguistic contexts, often rendering implicit meaning A fundamental outcome of the scientific study of language is that language is a complex and multidimensional system that consists of several distinct domains and subdomains:Each of these domains is complex and entails in each language a large number of abstract rules and patterns that also result from the interaction between these domains and that describe the complex system of language at a high degree of granularity.There is abundant evidence from studying children and adults who have impaired language  that domains of language can be affected differently. Cases of selective impairment, where deficits in one language area occur in a context of other language domains which are intact, provide unequivocal evidence that the system of language comprises distinct domains or subsystems Curtiss .Arriving at informative and reliable language profiles for autistic individuals entails study of the different domains of language. No single language score can accurately profile language in autistic individuals. Exclusive recourse to a vocabulary measure to stand for \"language,\" a common practice in studies on ASD, is particularly risky. Lexical knowledge is part of language, but language is not lexical knowledge. To increase our understanding of issues such as the frequency of co-occurrence with language impairment in ASD, and indeed what it means to speak of comorbid language impairment, it is essential to target specific language domains at a high degree of granularity through appropriate tools.(i)ASD-LN(ii)ASD-LI ('language impairment'): Impairment in structural language skills, i.e., phonology and/or morphosyntax(iii)MV: Minimal verbal abilities: expression limited to a very restricted set of words and short phrases or absence of spoken language.There is consensus in the literature that virtually all autistic people exhibit pragmatic abilities that diverge from those of neurotypicals, although this does not apply to all aspects of pragmatics, nor does it concern the same pragmatic abilities in each individual with ASD  meanings of utterances from their literal meaning. Some researchers refer to this part of pragmatics as \u2018Linguistic Pragmatics\u2019 (Andr\u00e9s-Roqueta and Katsos kick the bucket \u2018die\u2019) and proverbs  (Morsanyi and Stamenkovic the crown to refer to a monarch)  is difficult for autistic individuals with good structural language skills. Since the seminal work of Happ\u00e9 , severalAlthough difficulties with pragmatics may relate to impairments in structural language  emerge as impaired in ASD, showing both receptive and expressive difficulties. When linguistic competence is sufficient for re-interpreting words, statements and discourse (Linguistic Pragmatics), autistic people without structural language impairment may show typical performance and abilities, at least on the surface.As mentioned in Section\u00a0\"While structural language impairment is clearly not universal in autism, there is no accepted prevalence estimate that emerges from current research. Studies such as Loucas et al.  or Kjelghttps://laca.humanities.uva.nl/wp/), which recommends a specific type of production task, repetition, for baseline measures of structural aspects of language. Repetition tasks involve very limited task demands: instructions are maximally simple, they do not involve inferencing from pictures or previous linguistic material, and memory load and the influence of lexical knowledge can be minimized. Moreover, there is ample evidence that nonword repetition (NWR), for phonology, and sentence repetition (SR), for morphosyntax, are (the most) reliable way to screen for structural language impairment, including independently of autism  have a phonological deficit Boucher , others strict). These atypicalities were observed in very young children with ASD , paralinguistic because it conveys emotion, and linguistic in that it signals pragmatic aspects such as the communication situation and the speaker's state of mind , but also structural language aspects: prosody participates in the realization and structuration of the different linguistic levels   regardless of their NVIQ scores  have been observed in children with autism  in autistic children has brought forth evidence showing that some children show intact performance on par with their neurotypical peers, while other autistic children present difficulties comprehending and producing a variety of morphosyntactic structures  and/or entails an embedded clause (e.g. We know the child [that the mother hugged]).A bulk of work investigating morphosyntax , the question arises as to the nature of the linguistic competence of MV children. Are there different (receptive) language profiles in MV children? Are they entirely without a structural language system, or do they have some receptive language abilities, and if so, do these abilities differ from those of neurotypical children and those of verbal autistic children? Another question concerns intellectual development in MV children. Do these children tend to have intellectual deficiency, or can they develop typical intellectual functioning? Also, do MV children tend to have more severe autism symptoms than verbal children? It is striking that although the prevalence of MV children is far from being non-negligible, they nonetheless remain an under-researched population. Yet, families and clinicians are in crucial need of answers concerning language prognosis for these children and how to better communicate with them.Assessing language abilities of MV children through standardized tests commonly used in speech-language therapy, including receptive language tasks, can be very challenging, as these tasks often contain complex instructions and require active participant responses. Results may thus not reflect these children\u2019s real language capacities. Instead, it is recommended that language skills of MV children be investigated via tools generating automatic, passive responses, notably eye-tracking and EEG , compared to a mismatching video  are found at around 12\u00a0months and 24\u00a0months respectively, in autism these milestones can come significantly later. In a retrospective study of early development in 162 autistic children, 70% did not have phrases at age 33\u00a0months , which autistic individuals are often argued to have as a possible instantiation of a second dimension characteristic: sensory hyper-sensitivity  acquire fluent language Kissine . This isA meta-analysis by Obeid et al.  suggestsA minority of recent studies also found differences in statistical learning outcomes, in the form of an advantage for  statistical learning in autistic learners , and its prevalence is about 25%, which may be higher depending on how the population has been sampled  cognitive functions, such as ToM, Executive Function or intelligence (expressed by IQ). As autistic people\u2019s extralinguistic abilities are often reported to diverge from neurotypicals\u2019, it is important to discuss them in more detail and to consider including them in a broad assessment battery testing linguistic skills. This is exactly what the LACA network attempts to do in the LACA Baseline Battery, which proposes tasks for evaluation of both linguistic skills and nonlinguistic cognitive skills. The current section discusses in more detail ToM, EF and IQ in ASD.As noted in Section\u00a0\"Besides the relation between ToM and pragmatics  it contains is false (since Santa Clause does not exist). As such, this structure captures an essential property of (subjective) beliefs, namely that they can be in contradiction with (objective) reality. However, another crucial characteristic of complements is that they allow meta-representation, namely the capacity to represent another representation, or hold in mind the content of another mind. Given their specific deficit in ToM, autistic children would be \u201cespecially dependent on language, particularly knowledge of sentential complements, to bootstrap their meta-representational capacity\u201d  by preschool neurotypical children also relates to false-belief task performance, although these do not allow misrepresentation. Still, as training on relative clauses in neurotypical children has been reported to fail at boosting false belief task success, in contrast to training on complements  refer to higher-order cognitive processes involved in goal-directed behavior, such as inhibition, shifting, planning or updating in working memory. Working memory refers to the ability to store verbal or nonverbal information while performing a cognitive task. Quantitative and/or qualitative impairment in EF, which may persist even when general intelligence is controlled for, has been reported in individuals with ASD ) and individual data and including individuals with autism on the entire spectrum, with or without language impairment and with variable cognitive abilities and age ranges, may be necessary to better catch the link between language and EF variability. Finally, longitudinal studies may be useful to elucidate the directionality of the relationship between language and EF, knowing that better understanding of this relationship in individuals with ASD may have direct clinical implications. Although the nature of the relationship between language and EF/working memory in individuals with ASD is still unclear, the assessment of individuals with ASD must include indices of EF and working memory, in addition to language measures, to obtain a full picture of one\u2019s strengths and weaknesses and to develop a tailor-made intervention for each individual with ASD.In sum, to date, research does not give a clear picture about EF deficits and the nature of their relationship to language in individuals with ASD. Most of these studies are cross-sectional, limited to group analyses and involve autistic individuals without ID. Further studies exploring group, subgroup  Intelligence can be measured through language-based reasoning or via nonlinguistic means. If we want to investigate the relationship between language and intelligence, and if language can be impaired in ASD, it seems only logical to use measures of IQ that do not rely on using language in autistic individuals (to be elaborated on at the end of this section). Of all autistic people, two-thirds have neurotypical intelligence; this leaves one-third of autistic individuals with ID  impairment and questions with respect to potential comorbidity of autism and language impairment. Three broad ASD language profiles were identified, namely, (i) minimally verbal autistic individuals, (ii) verbal autistic individuals without structural language impairment, and (iii) verbal autistic individuals with structural language impairment. Each of these three groups includes various sub-profiles.Irrespective of the tripartite distinction sketched above, one consensus in the field is that all autistic individuals have difficulty with pragmatics, although selective impairment within pragmatics seems to occur as well. As discussed in Section\u00a0\"In addition to pragmatic difficulties, a sizeable proportion of autistic individuals have difficulties with structural language , as noted above under (iii). Striking similarities with the structural language profile found in DLD have been reported for many verbal autistic individuals, in particular, children. At the same time, quantitative and qualitative structural language differences from DLD have also been observed. One subdomain of structural language is underinvestigated, namely, compositional semantics (the derivation of meaning from morphosyntactic structure), warranting future research.Some other areas of language require more research to establish their relative strengths or weaknesses in ASD. Prosody, a domain which is often reported to be unusual or deviant in people with ASD, is mostly known for emotional prosody, whereas the few studies on structural linguistic prosody and pragmatic prosody provide mixed results. Furthermore, although a few studies report lexical skills to be strong in some autistic individuals, more studies are needed in this area.Regarding language assessment in ASD, the following observations were spotlighted. Many language tasks included in routinely used standardized language batteries involve complex verbal instructions and rely on multiple extralinguistic cognitive abilities, including reasoning and inferencing skills, working memory, ability to integrate details from pictures into a coherent mental construction, etc. Many of these extralinguistic cognitive skills are areas of known weakness for many/most autistic individuals. As a result, if individuals show low performance in language tasks, it is unclear whether this reflects deficits in specific language domains or whether it results from deficits in extralinguistic cognitive abilities. In turn, extralinguistic cognition  is often tested through verbal tasks, making it difficult to disentangle it from language abilities. If autistic individuals score poorly on tests that assess extralinguistic abilities through language, it is the question whether this low performance stems from weakness in extralinguistic cognition or from language difficulty. Furthermore, characteristics related to the second dimension of ASD , such as perseverance, inflexibility, sensorial sensitivity and systemizing may negatively or positively affect language development and language processing, and therefore language task performance. Finally, appropriate and adequate baseline tools to assess certain areas of language in ASD, such as pragmatic, prosodic and compositional semantic abilities, are virtually non-existent. The same applies to tools assessing the linguistic skills of minimally verbal autistic individuals.The way forward to disentangling language profiles in autism requires carefully designed studies, taking into account (a) the respective language domains, (b) the relevant aspects of extralinguistic cognition and autism severity, and c) the influence of linguistic difficulties on extralinguistic cognitive performance. Each test in a language assessment battery should be as \u2018pure\u2019 and specific as possible. For example, structural language assessments must control for pragmatics and other linguistic  and extralinguistic  cognitive domains which can influence structural language performance in autistic individuals. Pragmatic assessment should focus on pragmatic phenomena that seem particularly vulnerable in ASD, namely, the ones that require mindreading or perspective-taking, and that cannot be tackled by structural language or lexical skills alone. Prosody assessment must distinguish between emotional, pragmatic and structural language prosody. Furthermore, language assessment batteries need to include tests on extralinguistic cognition such as ToM, EF, IQ, central coherence, statistical learning, and on autism severity, including second dimension characteristics, such as perseverance, inflexibility, sensorial sensitivity, systemizing. Moreover, such skills should be assessed non-verbally, so that they are not obscured by impaired language. Finally, strong efforts should be made to assess the language skills of minimally verbal autistic individuals, for example, by developing special tools testing language comprehension without requiring active responses.A start toward this fundamental, methodological goal has been made by the LACA network, which is developing the so-called \u201cLACA Baseline Battery\u201d. The aim is to have screening tools for all linguistic and relevant extralinguistic domains, including autism severity. Good progress has been made for the structural language area, in particular, for morphosyntax and phonology. Ideas for adequate and appropriate ToM and pragmatics tests are currently being developed. A challenge to be overcome in the LACA Baseline Battery is the goal to have appropriate assessment tools across the life-span, so for toddlers, school-age children, adolescents, adults and the elderly.Turning now to the issue of comorbidity, a lively, ongoing debate has emerged about whether ASD can be comorbid with DLD. Some studies treat the structural language difficulty condition as a co-occurring condition, e.g., in the ASD-LI profile. The few studies that exist on this topic usually compare ASD-LI groups to ASD-LN groups on the one hand, and to DLD groups on the other, to understand what might be specific about LI in ASD. However, such studies often do not simultaneously compare properties related to ASD in the two ASD groups and their link (or lack thereof) with structural language impairment in each group. There is no model of how structural language difficulties may interact with ASD characteristics and with various extralinguistic cognitive abilities. This currently prevents us from taking a firm position in the debate as to whether DLD can be comorbid with ASD or regarding the question as to whether ASD and co-occurring language difficulty would be better approached from a dimensional view to neurodevelopmental disorders. As discussed in Section\u00a0\"The questions raised by the considerations and observations in the paragraph above are: \u201cAre particular structural language difficulties in ASD direct consequences of certain ASD characteristics (including the second dimension)? Or do (certain) ASD-characteristics and co-occurring structural language difficulties follow from a third underlying cause?\u201d It is these questions that we recommend investigating in future research, in parallel to describing the various autistic language profiles in detail. This can be achieved only if the various linguistic and relevant extralinguistic skills are assessed by means of tests that are as \u2018pure\u2019 and specific to the relevant area as possible. This will allow us to uncover fine-grained potential associations between various linguistic abilities, extralinguistic cognitive abilities and autistic traits. Moreover, it will further enable us to provide scientific input to the development of urgently needed, more appropriate, precise and individualized support and training for both autistic individuals and their non-autistic communication partners.Concluding, there is little research on how characteristics usually associated with ASD interact with co-occurring language difficulties. The current tripartite distinction between minimally verbal autism, ASD-LI and ASD-LN hides an enormous linguistic heterogeneity. A good part of this heterogeneity may be explained if more attention is paid to the way linguistic and extralinguistic cognitive abilities and autistic traits are assessed. Only when more detailed language profiles in ASD have been described can we start answering questions regarding potential comorbidity of ASD and DLD or whether co-occurring language impairment needs to be approached from a dimensional view to neurodevelopmental disorders."}
+{"text": "H. sapiens) utilizing it, and the emergence of new situational adaptations, as well as new forms and types of human language, demonstrates that language includes an act driven by a communicative goal. This article serves as an overview of the current state of psycholinguistic research on the topic of language evolution.With the present paper, we sought to use research findings to illustrate the following thesis: the evolution of language follows the principles of human evolution. We argued that language does not exist for its own sake, it is one of a multitude of skills that developed to achieve a shared communicative goal, and all its features are reflective of this. Ongoing emerging language adaptations strive to better fit the present state of the human species. Theories of language have evolved from a single-modality to multimodal, from human-specific to usage-based and goal-driven. We proposed that language should be viewed as a multitude of communication techniques that have developed and are developing in response to selective pressure. The precise nature of language is shaped by the needs of the species (arguably, uniquely  Research on language origin and evolution may be viewed as two of the most prominent research directions of the past few years. While these questions have been at the forefront of language science since its inception, only recently have we seen methodologies and techniques being developed that can provide answers backed with sufficient empirical evidence. The landscape of theoretical frameworks of language origin, the form in which it originated, and its worldwide dispersal has also been shifting in response to newly obtained evidence. The field of language evolution research can be described as currently coming of age while already equipped with a rich toolkit of methods for pursuits such as comparative research, investigating commonalities and differences between human language and animal communication systems, and studying cumulative cultural evolution of communication systems in experimental settings .The aim of this article was to give a brief overview of the evolution of language, as well as to demonstrate how theoretical frameworks of language origin and evolution evolved with it. We sought to utilize the latest findings to argue that evolution is one of the central driving forces of the existence and development of human language. Language is a human skill, the nature and features of which are shaped in accordance with the needs of the species through continuous usage and adherence to communicative goals . That naTo illustrate that language is a skill that constantly undergoes changes due to various selective pressures, we aimed to explore three groups of factors that seem to transform language in the most significant ways: factors of the physical environment , socio-demographic factors , and technological advances . The latter group of factors is of most interest to us due to the changes that online communication is bringing about at a rate that has never been witnessed before. We propose that the evolution of language follows a similar pattern to the one outlined by recent research into general intelligence, promoting a more context-dependent and dynamic view of intelligence that is focused more radically than ever before on niche construction as a result of the cultural evolution . The facWhile the argumentation provided in the present article is split into two main sections, covering the theories of origin and the evidence of evolution, all of it follows the main thesis of language emerging and evolving through usage; we deem this thesis to be the most prominent new direction in language research.There are more than 7000 living languages across the globe today . To apprAn important philosophical distinction collects two separate topics under the label \u201corigin of language\u201d: the origin of language faculty and the origin of languages . The latThe theories relating to the emergence of language have been extensively debated for centuries, once leading to the infamous ban of the germane discussions by the Soci\u00e9t\u00e9 de Linguistique de Paris in 1861. However, the field has seen a surge in this theorizing since the late 20th century and its considerable evolution over the past two decades . The focIn these controversies, one of the most contested topics is the question of causality, which is influenced by several factors: the problem of spurious correlation , the uniTo summarize, the current general trend for the linguistic field seems to move further and further away from notions of language innateness, although significant support for these viewpoints remains. In the scope of language evolution, usage-based frameworks allow for significantly more detailed and insightful investigations into the emergence of language. The same appears to be true for research into the modality of origin: this landscape of theories is also changing.The debate on the modality of origin, which is the initial main channel carrying verbal information, also has a few contesting theories: according to the \u201cgesture-first\u201d view, \u201clanguage evolved initially from manual gestures with vocal elements gradually added\u201d . The \u201cspOne of the novel multimodal hypotheses is the mirror system hypothesis developed by Importantly, the origin theories based on the writing modality are characteristically absent, which is understandable given its (mostly) secondary nature to spoken language. This, however, is all too indicative of the attitudes to writing in language research prior to modern studies. The linguistic views on the emergence of writing were varied and controversial, echoing many general issues of the evolution of spoken language. The traditional outlook on writing systems since Aristotle was superficial, ostensibly viewing these systems as an optional, supplemental representation of spoken language. Moreover, writing was deemed a \u201cwandering outcast of linguistics\u201d , leadingViews that contested that bias started emerging in the mid-20th century from the historical  and anthThus, while the dominating role of the vocal\u2013auditory modality remains indisputable, progress in the field was made toward developing multimodal theories of language origin, which aid in unifying disparate evidence in support of different single-modality theories under a single governing principle.The second question out of the pair laid out at the beginning of the section, namely, regarding \u201cthe origin of languages,\u201d was mostly inquired upon in neighboring fields of inquiry and tied to the spread of human populations. A link between the human genome and the spread of languages has been debated ever since Darwin proposed that \u201ca perfect pedigree of mankind\u2026 would afford the best classification of the various languages now spoken throughout the world\u201d . While s2 <= 0.05), as well as with genetic distance and geographic proximity, in contrast to the much stronger relationships found between genes and geography: the results suggest that genes and culture are surprisingly decoupled  process playing an important role in shaping global patterns of neutral genetic diversity is currently forming. This process entails a series of population splits, movements into an unoccupied territory, and subsequent isolation: beginning in Africa and proceeding through Eurasia into the Americas and Oceania. At the within-population level, it led to a steady decay in genetic diversity with increasing geographic distance from East Africa; at the between-population level, it led to a steady increase in genetic distance with increasing geographic distance . The debecoupled . For theecoupled  used Bayecoupled . While bTo summarize, new technological and methodological advances have led to the most drastic changes in language evolution research. Large-scale investigations do require substantial resources, and interdisciplinary collaboration poses a challenge, but the results obtained contribute to significant advancements in the linguistic and neighboring fields in regard to the origin of language dispersal.The final important aspect of language origin studies, tangential to linguistics but central to psycholinguistics, is of utmost importance for the present essay: neural correlates of language. Evidence obtained from numerous previous studies that attempted to localize language within the brain is well established: the clinical studies of Broca  in the 1Modern models of language include numerous areas of the brain organized in multiple circuits within clusters of activation . One sucThus, despite initial findings that focused on the narrow specificity of function, the field has evolved to include numerous areas of the brain organized in multiple circuits within clusters of activation, in addition to the emerging evidence of neural multifunctionality for language networks.Just like birds develop different beaks adapting to different environments, languages and cultures might be undergoing similar changes . CharlesSimilar to the communication systems of other species, language may be affected by ecological factors. Physiologically based predictions demonstrate that languages with complex tonality have generally not developed in very cold or otherwise desiccated climates, as air dryness decreases the control of the vocal folds and pitch production, and this, in turn, results in the absence of a (complex) tone system. The geographic\u2013linguistic association operates within continents, major language families, and across language isolates . HoweverEnvironments in which higher sound frequencies are less faithfully transmitted due to denser vegetation or higher ambient temperatures seem to be related to the greater use of sounds of lower frequencies (\u201cmore sonorous\u201d languages). The results of Another striking example is the observed partial correlation between latitude and the absence or presence of the word for the color blue  due to tA common criticism of the abovementioned studies is that they are correlational in nature, thus, do not contribute to the understanding of possible mechanisms that underlie linguistic evolutionary processes. In order to improve the methodological robustness of the studies, additional approaches, such as iterated learning, a historical case study, corpus studies, and studying individual speech, was suggested . For thiOne of the most striking examples of linguistic adaptation to the environment is whistled languages. The main purpose of whistled languages is to facilitate spoken communication at great distances, but it is also used in other circumstances, such as secrecy, courtship, singing, and communication in noisy environments. Although they are always referred to as languages, they are considered a mode of speech because whistled languages are always based on a spoken language .Several hypotheses were put forward to explain the current existence of whistled languages. One of them posits that whistled languages are simply the vestigial remains of a widespread ancient phenomenon. This mode of speech could have been used by prehistoric hunter-gatherers for hunting in groups or signaling a danger in any type of environment . AnotherIt is estimated that approximately 70\u201380 languages actively use their whistled mode of speech, but the number is rapidly declining due to modern technologies of communication, and most of them are endangered . EvidentThe principle of whistled speech is straightforward: people articulate words while whistling, which involves acoustic reduction at the produced frequency level and selection of key salient phonetic cues for the corresponding spoken utterances. The resulting signal\u2019s linguistic structure is identical to standard speech. Interestingly, even though the acoustic channel is reduced, whistled sentences remain highly intelligible to trained speakers .It was suggested that human whistled languages can serve as a model for understanding the coding of information in dolphin whistle communication. Comparing human and dolphin whistles could become a complementary test bench for the development of new methodologies for decoding whistled communication signals by providing new perspectives on structural and organizational aspects of encoding information .Overall, exploring the connection between the structure of languages and the environment in which they are utilized is complicated by several issues. If the ecology of the area was able to influence the language at the stage of its emergence, the amount of information needed to make a conclusive statement about it is scarce. Additionally, most of the studies that focus on the link between environment and language are correlational in nature. Although the overall structural diversity of languages has not been linked with other types of diversity, some aspects, such as morphosyntactic complexity or consonant/vowel inventory, may be affected.linguistic niche hypothesis, which describes the esoteric and exoteric niches for languages. The exoteric linguistic niche includes languages with large numbers of speakers , which forces these languages to serve as a means of communication between strangers. Speakers of languages in the exoteric niche, compared with the esoteric niche, are more likely to be non-native speakers or have learned the language from non-native speakers and use the language to speak to individuals from different ethnic and/or linguistic backgrounds. The esoteric niche includes languages like Tatar, Elfdalian, and Algonquin  is a graphic symbol that represents a wide variety of different things, ranging from complex facial expressions to concepts and ideas. It is thought to have developed from emoticons, i.e., representations of facial expressions usually comprised of various combinations of keyboard characters (\u201c:)\u201d). These symbols usually augment a message with non-verbal elements .Due to their growing popularity, emojis are used not only in online communications but are becoming integrated into an increasingly wider variety of contexts. Specifically, research is conducted to understand how emoji-enriched interfaces affect performance in the classroom , marketiEmojis (or \u201csmileys\u201d) are a unique phenomenon in terms of their nature and diverse functions in communication. On the one hand, emojis produce effects that are functionally similar to the response observed for facial expressions of emotion in face-to-face communication. They seem to affect the perceived emotional intensity of a message and accentuate its perceived valence by acting as nonverbal cues in digital communication . On the Lupyan and Dale argued that the divergence between conventional written languages (as well as online written communication) differs in many ways from the divergence between conventional spoken languages, for example, Dutch and Afrikaans. Both of these phenomena represent how languages (or language registers) adapt to the environments in which they are being used . SimilarShortcuts are one of the most prevalent features of the new \u201cnetspeak\u201d . Common One of the explanations of this process posits that users intuitively ignore uneconomical language rules and strive for cost-effectiveness, increasing the efficiency of the language orthography  and enriPragmaticalized units may partially or completely lose their semantic meaning and move into a new pragmatic domain of function and meaning. In this sense, online communication is not only enriched by the spoken form of language with its abundance of discourse (or pragmatic) markers but gives rise to new netspeak-specific pragmatic features that slowly pave their way back into spoken language, making this interaction bidirectional and mutually enriching. This is only one of many aspects that is indicative of the emergence of a unique new hybrid register that fuses the full range of variants from the language use, namely, written, spoken, formal, informal, and vernacular variants .One particular field able to inform the shortcut trend is quantitative linguistics, one of the aims of which is the development of statistical laws about language usage. Such laws can tell us a lot about speech and language efficiency principles, the most established among them being Zipf\u2019s law of word frequency, which quantifies the frequency of occurrence of words, demonstrating that there is no unarbitrary way to distinguish between rare and common words . This laHence, technology has had a significant impact on language in recent years, giving rise to new forms of communication and new ways of using language. One of the most notable changes brought about by technology is the emergence of \u201ctext-speak,\u201d which is a form of language that is characterized by the use of shorthand, abbreviations, and symbols in text-based communication. In this way, digital communication can be seen as a distinct form of language with unique features and conventions that are specific to the digital environment. It is not a replacement for spoken or written language, but rather, it is an additional way of communicating and conveying meaning, which is a skill that emerged in humans as a response to a new and all-encompassing technological environment with its constraints and possibilities.The questions of the origin and evolution of language, apart from gaining new evidence for their resolution through the use of novel linguistic and psycholinguistic methods and interdisciplinary inquiries, also changed in their nature. Modern language research strays away from portraying human language as a unique anthropoid phenomenon, the expression of which has not been modified by selection pressure, instead viewing it through the lens of ongoing human evolution and strict adherence to communicative goals. In this light, language can be viewed as a toolbox, the contents of which change in accordance with the needs of the human species, which is the statement that we attempted to demonstrate through the review of the literature on language evolution and adaptation.Manifold examples of languages adapting to and reflecting different aspects of the environment illustrate that linguistic diversification is not simply an accumulation of random changes over time. The most recent example of strong selective pressure affecting languages all over the world is the integration of instant communication technologies. This new phenomenon allows us to witness language modification in real time and better understand the underlying processes. It can already be confidently stated that human language is undergoing one of its most massive changes at this very moment while following the essential principles that governed its existence and development before the onset of the digital age.Multimodal and usage-based emergence theories, in addition to more robust correlation and causation links, provide a framework that is apt to incorporate the majority of scientific knowledge about language. Modern neural correlate models of language processing further serve to illustrate the interconnectedness of language to other domains of cognition. Further steps in that direction of inquiry may only serve to elucidate how thoroughly integrated language is with all other types of human behavior.We propose that the study of languages should not be confined to properties of particular languages and language in general but should incorporate a wider array of contributing factors that inevitably shape the way different species, including humans, communicate. This all-encompassing approach will provide more insights into the nature, structure, and functions of language in diverse environments and demographic contexts, as well as help to explain the way human communication adapts to and transforms in response to the pressures put forward by technological breakthroughs and societal transformations, along with the alterations in our species\u2019 ecological niche in the Anthropocene era."}
+{"text": "Bilinguals have distinct linguistic experiences relative to monolinguals, stemming from interactions with the environment and the individuals therein. Theories of language control hypothesize that these experiences play a role in adapting the neurocognitive systems responsible for control. Here we posit a potential mechanism for these adaptations, namely that bilinguals face additional language-related uncertainties on top of other ambiguities that regularly occur in language, such as lexical and syntactic competition. When faced with uncertainty in the environment, people adapt internal representations to lessen these uncertainties, which can aid in executive control and decision-making. We overview a cognitive framework on uncertainty, which we extend to language and bilingualism. We then review two \u201ccase studies,\u201d assessing language-related uncertainty for bilingual contexts using language entropy and network scientific approaches. Overall, we find that there is substantial individual variability in the extent to which people experience language-related uncertainties in their environments, but also regularity across some contexts. This information, in turn, predicts cognitive adaptations associated with language fluency and engagement in proactive cognitive control strategies. These findings suggest that bilinguals adapt to the cumulative language-related uncertainties in the environment. We conclude by suggesting avenues for future research and links with other research domains. Ultimately, a focus on uncertainty will help bridge traditionally separate scientific domains, such as language processing, bilingualism, and decision-making. Bilinguals, people who know and use more than one language, have different linguistic experiences relative to monolinguals, who know only one language. These experiences stem from different interactions with their environments and the individuals therein. Whether someone is trying to decipher multilingual signs at high speeds on the highway, order coffee in a bilingual city, or communicate academic research to multilingual peers, the people involved in these interactions bring to the table their individual levels of language knowledge, language fluency, language preferences, overt goals, and covert intentions. Bilingual environments thus have fluctuating language demands , which cFundamentally, bilinguals make choices about which languages to speak when and with whom, and they must appropriately engage their language systems to realize these choices. Even after an intended language has been chosen, bilinguals continue to experience lasting cross-language activation and competition within their linguistic subsystems that can help or hinder comprehension and production . To prodCognitive control is an umbrella term that refers to a set of latent cognitive functions that may be differentially recruited by cognitive tasks . They also carry consequences of varying magnitudes: What will I cook for dinner; can I afford to cook dinner? Should I speak in English or French to this new person? When will a vaccine be universally available to curb a global pandemic? Some uncertainties may be unexpected, such as the onset of the COVID-19 global pandemic. Other uncertainties may be expected, for example, in the case that money is routinely tight at the end of the month, or the possibility of using either language that you know within a highly bilingual environment. Individuals must adapt their decision-making processes and underlying neurocognitive mechanisms to cope with such uncertainties. Language provides an optimal domain in which to study the impact of uncertainty because linguistic environments are rife with uncertainties at multiple levels of representation. Crucially, people who are bilingual experience all the typical uncertainties associated with language, as well as the added uncertainty of choosing a particular language according to the demands of particular moments.Uncertainty can be measured with a quantity known as Uncertainty and entropy have been used in psychological and neurocognitive theories such as the psychological entropy framework  and the People are sensitive to the statistical regularities that occur in their environments, and they build expectations or heuristics that allow them to make inferences about upcoming information or rewards. In contexts where a particular outcome is certain, heuristics can aid decision-making. However, in novel contexts or when outcomes become otherwise uncertain or ambiguous, such heuristics could fail, requiring reanalysis. To prevent this, in cases of uncertainty, people become less sensitive to prior top-down heuristics: They suppress the use of previously informative cues and expend cognitive effort to reduce uncertainty. In other words, when people encounter uncertainty, they should lower the anticipation of an expected reward. Task performance may become more variable as people try new strategies to learn more about the context and seek out further information that could be used to make inferences .ambiguous choices), to situations with expected uncertainties, where risk is known beforehand , there is differential activation of frontal  vs. striatal  areas. Expected uncertainties appear to activate striatal systems, whereas unexpected uncertainties down-regulate the striatal system and up-regulate orbitofrontal cortex  can either attach to the first noun phrase (the man) or the second noun phrase (the student) leading to interpretations where either the man or the student is carrying the knife.In the traditionally separate domain of language, the notion of uncertainty has also been a central concept by way of ambiguity. Ambiguities can occur within a language at many levels of linguistic representation. For example, we encounter ambiguous words with multiple meanings, such as the word woman pushes brown bear as it climbs over fence to save her dogs, many readers may have been left wondering what the woman did to her dog that prompted a bear to intervene. A key focus in psycholinguistics has been to investigate how people resolve these types of ambiguities and misinterpretations in the moment during comprehension and production. Do comprehenders simply rely on a strict set of processing heuristics to reduce memory burden and interpret a sentence ? In some cases, the answer to these questions is that both languages are acceptable, and people will flexibly engage the entirety of their linguistic repertoires, as in the case of code-switching  or transLanguage-related uncertainties start early and can be pervasive throughout the lifespan. Even young children are aware of the social consequences of choosing a particular language or dialect, as when To begin to measure language-related uncertainties at a global level, we have developed a methodological approach based on information theory . SpecifiBilingualism: Language and Cognition [In our view, a focus on uncertainty has the potential to mutually benefit and more closely integrate multiple subdomains of cognitive science, including decision-making, language science, and bilingualism. Attention and decision-making literature emphasize the role of uncertainty in behavioral contexts, and bilingualism can provide researchers with new ways of assessing contextual uncertainties through language. ognition ). UltimaThe notion of behavioral context is central to many usage-based theories about language and bilingualism, because people perceive and produce the various languages that they know with interlocutors in their environments (such as at home or in the workplace). This rich contextualization of language has wide-ranging consequences for language fluency, processing, representation, and control, and it may also carry consequences for domain general cognitive control and underlying brain mechanisms . To giveSocieties and communities may differ in aggregate along the lines of interactional context in ways that impact language and cognitive control. For example, Beatty-Martinez and colleagues have shown that otherwise comparable populations of highly proficient Spanish-English bilinguals differ in how they engage their languages. Participants living in Southern Spain tend to engage in single language contexts, while participants in Puerto Rico and mainland USA tend to exhibit behaviors associated with dual language or dense code-switching contexts . They fuWe posit that contexts such as these differ with respect to language-related uncertainty, with dual language and dense code-switching contexts having higher uncertainty relative to single language contexts. The level of language-related uncertainty can be estimated, at a basic level, using entropy measures , either Thus, researchers interested in uncertainty from a cognitive, attention, or decision-making perspective can exploit background language characteristics of participants as a sort of natural experiment. For example, the long-term role of behavioral context in cognitive adaptation can be investigated, between participants, by recruiting and contrasting participants who systematically vary in their language background in terms of interactional context , providiThe neurocognitive study of uncertainty also has something to offer researchers interested in language and bilingualism. Namely, this perspective allows for an integration with computational, neurobiologically plausible models of cognition and control . For exaIn sum, by merging these perspectives within the general framework of uncertainty, we can more tightly contrast uncertainty at two levels: local, in the moment uncertainty and global uncertainty in the environment. Thus, the demands and processes involved in resolving local uncertainty must take into account the properties of the global or historical context. This is an essential link between general cognitive studies and linguistic approaches that examine how the sociolinguistic demands impact local psycholinguistic processes. Next, we provide an example of how uncertainty can be applied to the neurocognitive study of bilingualism by reviewing two \u201ccase studies\u201d in this domain.H = \u2212Pilog2(Pi). Here, entropy (H) is computed over the proportion of usage for a particular language (Pi) in a set of languages . The process can be repeated for any number of communicative contexts. Proportional usage is derived from self-report questionnaire data commonly collected in the field, such as language use in the home versus language use at work  when one language in a set is used all the time in that context  and the other languages never occur. A person with minimum language entropy in a context can be quite certain that a particular language will be used, and they should experience low levels of language-related uncertainty in this situation. The occurrence of the predictable language would also carry little information, as it reflects business as usual. However, the spontaneous use of another language would be highly unusual and convey information of some form.Language entropy can be thought of as providing a continuous index of language diversity or language-related uncertainty for a particular communicative context , with a range from 0 to some maximum value. Language entropy is at its minimum . A person with maximum language entropy in a particular communicative context should experience high levels of language-related uncertainty in this situation because either language is equipotent. Language entropy is at its maximum when the percentage of usage for two or more languages is equal within a communicative context ), illustrated in Mathematically, language entropy carries some interesting properties. The maximum possible language entropy for a context or individual increases as a function of the number of equally used languages  for high entropy bilinguals might go against the predictions of decision-making theories based on uncertainty, namely, that highly uncertain or ambiguous situations should down-regulate predictive mechanisms. However, these results can be explained under an adaptive mechanism in which participants who routinely experience high entropy environments may be better able to reduce internal uncertainty. We have speculated that bilinguals might adapt to contexts with language-related uncertainty by attending to other cues that are present in the environment. For example, phonetic or lexical cues encoded in the linguistic signal can preempt code switches; or particular interlocutors may have a tendency to use a particular language. These cues may be important for high entropy bilinguals who need to identify rapidly what language will come next to resolve language-related uncertainty in the environments at multiple levels.There is also a possibility given our reading of the uncertainty literature, that high entropy bilinguals adapt to linguistically uncertain environments by creating a set of internal bilingual attractor states. For example, perhaps a new set of states is created that is related to a dual language  or a bilWhile network models of multilingual language usage have been constructed from online sources, such as Twitter e.g., , they haIn the context networks, we found that the various communicative contexts evidenced distinct configurations in terms of the topics that were discussed within those contexts see . In partWe are now expanding the level of analysis to individuals\u2019 language-tagged social networks  with theTo sum up, we have brought together recent work showing how language-related uncertainty can be measured or estimated using language entropy and network science, and we have shown some of the interactions with other aspects of neurocognition, including language proficiency, brain organization, and proactive executive control abilities . This woMeasures like entropy and those computed from network analysis provide estimates of language-related uncertainty that are derived from self-report questionnaires. Future work should attempt to more closely approximate naturalistic language-related uncertainties through the use of objective measures such as corpus/dialogue analysis or the observation of naturalistic productions among bilinguals and multilinguals. Doing so will allow for further measurement validation and expansion of language-related uncertainty. For example, participants could complete language history or language-tagged social network questionnaires and then consent to having portions of their daily conversations recorded through a smartphone app. Or, they might respond to intermittent text message probes that inquire about language usage in the moment. Language entropy and usage patterns could be computed from the data elicited by these instruments. An advantage of a smartphone app or text message probes is that research could reach a broader and more diverse portion of the population than is typically sampled in experimental psychology.Moreover, data from other geographic locations will be crucial in assessing the generalizability of these measures, methods, and theoretical perspectives. At the moment, only a few studies have assessed language entropy, most in the highly multilingual Montr\u00e9al context . HoweverIn terms of linking linguistic and cognitive perspectives , going fCode-switching is the practice of flexibly mixing languages , spaced study sessions (as opposed to mass study sessions), and interleaved practice (as opposed to blocked practice). Desirable difficulties have been applied to language learning through the observation that bilingualism often results in observable costs during language processing (thought to be the result of cross-language activation or competition) but other benefits in certain aspects of novel language learning  language . Thus, iBilingual environments have been associated with language-related stress and anxiety for individuals who do not adapt to an immersion environment. This is shown primarily through social network analysis. The structural properties of individuals\u2019 networks have implications for language proficiency, educational outcomes, and overall well-being. For example, when considering people who move to a new linguistic environment , social network structure  is positively associated with proficiency gains during language learning and educational outcomes  as well Casting bilingualism as an exercise in managing language-related uncertainty has several benefits that can drive future research in various subdomains. As reviewed above, a focus on uncertainty allows for tighter integration between linguistic and computational cognitive theories that are neurally plausible. Such computational perspectives provide various metrics and measures that can be leveraged, including entropy. This integration will help in achieving common goals, such as investigating the impacts of behavioral context  on behaviors and brain organization. Ultimately, developing proficiency in a second language may be an exercise in reducing or adapting to uncertainty, allowing for efficient comprehension and production according to the behavioral or interactional context.Debra Titone, Natural Sciences and Engineering Research Council of Canada, individual Discovery Grant, Award ID: 264146. Jason W. Gullifer and Debra Titone, the Social Sciences and Humanities Research Council of Canada, Insight Development Grant, Award ID: 00935.Jason W. Gullifer: Conceptualization: Lead; Funding acquisition: Equal; Investigation: Lead; Project administration: Supporting; Writing \u2013 original draft: Lead; Writing \u2013 review & editing: Equal. Debra Titone: Conceptualization: Supporting; Funding acquisition: Equal; Project administration: Lead; Resources: Lead; Supervision: Lead; Writing \u2013 review & editing: Equal."}
+{"text": "EFs were assessed through tasks that explored three predictor variables: inhibitory control, working memory, and cognitive flexibility. The language outcomes included receptive and expressive language. After controlling for age, gender, and nonverbal intelligence, findings showed that working memory and cognitive flexibility, respectively, explained an additional 16% and 19% of the variance. Inhibition skills did not increase the amount of explained variance in language outcomes. These results highlight the potential added importance of assessing working memory and cognitive flexibility in the prediction of language skills in preschool children.The development of language skills requires a range of linguistic abilities and cognitive processes, such as executive functions . Despite progress in understanding the link between language and EFs, the need for more research on the extent and directionality of this link is undeniable. This study examined whether specific components of EFs account for a significant amount of variance in language abilities above and beyond gender, age, and nonverbal intelligence. The sample comprised 79 typically developing children attending the last year of preschool ( Developing language skills is critical for meeting the demands and challenges of contemporary societies. Unfortunately, many children do not master language skills as expected, and language impairments during childhood tend to persist throughout development, with lifelong implications for academic, social-emotional, and behavioral functioning . LanguagEFs are a set of cognitive skills involved in goal-directed activities, which are crucial for regulating thoughts and actions . The sevIt has been reported that EFs gradually differ in structure throughout schooling . There iConsidering the relevance of EFs to language abilities, previous work has examined the relationship between EFs and language skills in clinical populations. This topic has been of long-standing interest in the field of language sciences and clinical linguistics , we , we 45])SD = 3.47; age range = 50 to 72 months). The children were enrolled in their last year of preschool . Based on the information provided by the nursery teacher, there were no reports of medical conditions or uncorrected visual/hearing problems.Seventy-nine typically developing European Portuguese children participated in this study .Inhibitory control. To assess inhibitory skills, we used the Inhibition subtest of the NEPSY-II, a development neuropsychological assessment )The present findings provided insight into the unique contribution of short-term/working memory and cognitive flexibility to language outcomes, above and beyond gender, age, and nonverbal intelligence, in preschool children. By analyzing the relationship between these variables, the current study supports the importance of considering not only short-term/working memory, but also cognitive flexibility, when exploring the relationship between EF components and language outcomes during the preschool period. Thus, our results provide a foundation for further research on EF components associated with the development of language skills. Furthermore, although executive deficits are commonly seen in children with language impairments, our findings suggest that each EF dimension may have a distinct contribution to language development. In the particular case of clinical settings, the present findings support the added importance of assessing specific features of EFs when evaluating children\u2019s language development."}
+{"text": "Moreover, comparing the language profiles between Ms and Fs with a receptive disorder, Fs had significantly worse grammatical comprehension and better grammatical production than Ms. Even among children without a receptive disorder, Fs had significantly higher grammatical production scores. The S/G differences in language profile, particularly better expressive language in Fs than Ms, can partially contribute to the delayed ASD diagnosis or underdiagnosis of Fs without intellectual disability. Finally, the results document the importance of accurately investigating both expressive and receptive abilities in children with ASD.Sex/gender (S/G) differences in ASD language profiles have been poorly investigated. The present study aims to explore whether male (M) and female (F) children with ASD and with normal non-verbal cognitive abilities differ in their linguistic profiles. A sample of 76 Italian children with ASD (range: 4.9\u20138 years), including 50 Ms and 26 Fs, was retrospectively recruited. Language profiles were analyzed using standardized tests for the evaluation of receptive and expressive vocabulary as well as grammar. Grammatical comprehension was the most impaired domain compared to the other language measures in both M and F children. Comparing language profiles between S/G, Fs showed significantly better scores than Ms in grammatical production ( Autism spectrum disorder (ASD) is a neurodevelopmental disorder characterized by persistent deficits in reciprocal social interaction, communication and the presence of restricted, repetitive behaviors and interests . PrevaleIn the field of typical development, extensive literature reported that Ms and Fs differ in the rates of communication and language development. In particular, Fs demonstrate an earlier acquisition of first words , a betteAccording to the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders , languagThe over-representation of boys with respect to girls is one of the most replicated findings in the ASD literature ,14,15. ITo note, given the difficulties in disentangling the effects of sex and gender on ASD features, the term \u201csex/gender\u201d (S/G) will be used throughout this article to acknowledge the overlap between these two concepts .In toddlerhood, language delay is a major cause for concern among parents of infants who go on to receive an ASD diagnosis , and thiControversial findings regarding S/G differences in language and communication domains were reported. Some studies did not find any statistically significant differences in basic vocabulary, grammar skills, and on narrative abilities between Fs and Ms ,29, wherMoreover, ASD Fs performed better than ASD Ms on narrative skills   and on cThe abovementioned studies focused more on social and pragmatic domains rather than on basic structural language and identified pragmatic and associated higher-level structural language skills as areas of difference between the M and F phenotypes of ASD ,30,33. ITo address the abovementioned knowledge gap, the present study aimed to investigate S/G differences in basic structural language profiles in a cohort of children with ASD. Specifically, it directly compared expressive and receptive language abilities between M and F Italian children with ASD, using both naturalistic and standardized assessments performed by speech\u2013language therapists with expertise in communication disorders. Since a significant association between non-verbal IQ and language abilities was previously detected ,39, it wBased on this previous evidence, we formulated three hypotheses: Hypothesis 1: We expected to find significant phenotypic differences related to S/G language profile; Hypothesis 2: We expected to find differences between ASD Ms versus ASD Fs with receptive language disorder; and Hypothesis 3: We expected to find differences between ASD Ms versus ASD Fs without receptive language disorder.The study was conducted on a sample of 76 children with ASD  aged 4.9\u20138 years  retrospectively recruited in a tertiary care University hospital from February 2009 to November 2020.Inclusion criteria were as follows: 1) Diagnosis of either autistic disorder according to DSM-IV-TR criteria  or autis DiagnosiInformed written consent was obtained from the parents of all participants. This study was approved by the Pediatric Ethical Committee of the Tuscany Region  and was conducted according to the Helsinki Declaration.Grammatical Comprehension Test for Children (TCGB)  is standPeabody Picture Vocabulary Test-Revised (PPVT-R)  is a mulOne-Word Picture Vocabulary Test  is an exThe \u2018Grid of Analysis of Spontaneous speech\u2019 (GASS) ,45 is a The language profile was evaluated by the following measures:For all language tests (with the exception of the GASS), z scores below \u22121.5 SD of the mean were considered clinically significant. For a detailed description of TCGB and GASS, see WPPSI-III  performaADOS-G  or ADOS-Skewness and Kurtosis statistics did not demonstrate a normal distribution for language-related variables. Thus, non-parametric tests were used.between S/G (50 ASD M and 26 ASD F);between ASD M and ASD F with receptive disorder (31 ASD M and 17 ASD F);between ASD M and ASD F without receptive disorder (19 ASD M and 9 ASD F).The Mann\u2013Whitney U test was used to compare age, language scores , non-verbal, verbal and total cognitive scores, and ADOS severity scores:Statistical analyses were performed using SPSS 21 software .Considering the mean z scores of the whole sample see , grammatThe analysis of the number of children who presented deficient expressive grammatical abilities (GASS) showed that there was a higher percentage of Ms (15%) than Fs (4%) with impaired performance. Moreover, receptive vocabulary and grammar were the most deficient areas in a high percentage of children in both the M and the F groups .p = 0.002), whereas Ms had better active negative sentence comprehension (p = 0.035). Moreover, Ms showed a better grammatical comprehension total score than Fs, though this finding did not reach statistical significance.Statistical analysis with the Mann\u2013Whitney U test did not show any significant differences in age, cognitive abilities, and severity of autistic symptoms between Ms and Fs . Insteadp = 0.014) and expressive (p = 0.019) grammatical abilities differed significantly between Ms and Fs in children with receptive deficits. In particular, Fs had significantly worse grammatical comprehension but significantly better grammatical production than Ms.Given the importance of receptive difficulties, Mann\u2013Whitney U tests have been conducted to compare the functional profiles of Ms and Fs with and without receptive disorder. Both analyses (comparisons between Ms and Fs with and without receptive disorder) did not show any significant differences in non-verbal cognitive scores and severity of autistic symptoms between the groups . Both rep = 0.028) than Ms.Statistical comparison between Ms and Fs without receptive disorders also confirmed in this group that Fs had significantly better expressive grammatical abilities , can partially contribute to the undiagnosed or late-diagnosed ASD in Fs. Moreover, the specific linguistic profile of high-functioning Fs with ASD has been related to the \u201ccamouflage\u201d abilities of these individuals . IndeedThe results of the present study suggest the presence of distinct linguistic profiles in ASD Ms and Fs with IQ \u2265 70. They also provide evidence of the importance of accurately investigating both expressive and receptive language abilities for the choice of effective and personalized interventions aimed at promoting language development on the basis of the specific language profile.Moreover, enhancing pediatricians\u2019 understanding of language disorders in ASD is crucial as it could play a pivotal role in achieving early detection and diagnosis. Providing comprehensive information and training to pediatricians could help them to recognize the subtle signs and challenges associated with language impairments in ASD. This, in turn, facilitates timely identification and referral to specialists for further evaluation and intervention. Investing in pediatricians\u2019 knowledge and expertise in this area not only enables early intervention but also improves outcomes for children with ASD, ensuring they receive the necessary support and tailored interventions from an early age.The present study has certain limitations that must be acknowledged. First, the rather low sample size, the lack of power analysis, and the retrospective nature of this single-center investigation make the study susceptible to bias: therefore, the results obtained need to be further validated on a larger sample of ASD children.Second, only ASD subjects without an intellectual disability were included. This selection criterion was justified by the need to homogenize the sample of children with ASD, but it does not allow to generalize results to the rest of the ASD population. In order to overcome, at least in part, the above limitation, in future studies, it might be very interesting to compare the Verbal Intelligent quotient to the receptive and expressive verbal skills in M and F groups. In this way, more information about the differences between Ms and Fs with ASD might be collected, thus improving the ability to describe phenotypic variability.Third, the lack of a matched control group of typically developing children was a limitation of the study but was mitigated by the use of standardized tests.Fourth, the alpha value of the One-Word Picture Vocabulary Test was not reported.Future studies should integrate clinical assessments performed by trained professionals with parent-report measures of communication abilities in order to obtain a more comprehensive picture of S/G ASD differences in the use of language in daily living situations.The study may have implications in both clinical and research settings.The clinical implications could concern the following points: (1) Improved Diagnosis: the findings of this study suggested that considering S/G differences in language profiles can contribute to more accurate and timely diagnoses of ASD, especially in females without an intellectual disability. Clinicians can incorporate this knowledge into their assessment process to ensure a comprehensive evaluation of language abilities in both male and female individuals with ASD; (2) Tailored Interventions: Understanding the specific language difficulties experienced by males and females with ASD can inform the development of targeted intervention strategies. Clinicians can design interventions that address the unique language profiles of each S/G, focusing on areas such as grammatical comprehension or production where individuals may struggle the most; (3) Enhanced Support: By recognizing the S/G differences in language profiles, clinicians can provide more effective support to individuals with ASD. Tailored therapy approaches can be implemented to enhance both expressive and receptive language skills, considering the strengths and challenges associated with each S/G.Intervention and Outcomes: Building on the study\u2019s findings, further research could explore the effectiveness of S/G-specific interventions in improving language skills and overall outcomes for individuals with ASD. Comparative studies could assess the impact of tailored interventions on language development, social communication, and quality of life in males and females with ASD. In summary, the study has implications for clinical practice by influencing diagnostic approaches, intervention strategies, and support provided to individuals with ASD. Moreover, it highlights areas for further research, including investigating underlying mechanisms and exploring S/G-specific interventions and outcomes. These implications contribute to advancing our understanding of ASD and ultimately improving the lives of affected individuals.The research implications could cover the following points: (a) Further Exploration of S/G Differences: The study pointed out the need for more research on S/G differences in language profiles among individuals with ASD. Future studies should investigate larger and more diverse samples to validate and expand upon the findings. Longitudinal studies should also examine how language abilities evolve over time and whether these differences persist into adulthood. Moreover, the study of S/G differences in language profiles would benefit from the inclusion of siblings at high familial risk for ASD in which decreased early language ability has been detected ; (b) Und"}
+{"text": "The results indicate that the DASH diet improves all the markers of hypertension in the test group with significant decreases in BMI, SBP, DBP, LDL-c and total-cholesterol. Patients of the control group had fourteen and seven times more risk of having increased systolic and diastolic pressures, respectively, and are thus exposed to hypertension complications. The DASH diet established in this study is therefore effective for the management of hypertension.Hypertension remains a public health issue in Cameroon, though lifestyle and dietetic measures are the main approaches for the prevention and management of hypertension. The present study aimed at evaluating the impact of a Dietary Approaches to Stop Hypertension (DASH) diet using local foodstuffs on the status of hypertensive patients at the Ngaoundere Regional Hospital. A case\u2013control study was carried out with 160 hypertensive patients divided into two groups, a test and a control group. A food questionnaire was used to evaluate the food habits of patients and design the sheet of the DASH diet to provide a maximum of 2000 kcal/d. The DASH diet was administered to the test group (eighty-eight patients), while the control group (seventy-two patients) consumed their normal diet. Both groups were followed up for 8 weeks. The systolic and diastolic blood pressures , body mass index (BMI), triglycerides, HDL This high pressure can damage the walls of the blood vessels in the long term. The risk factors of hypertension are mainly associated with food practices and lifestyle, particularly diets rich in salt and fats, alcoholism, tobacco and low or absence of physical exercises, low consumption of fruit and vegetables, aging, family history and overweight.Hypertension is a pathologic state characterised by permanent high blood pressure on the walls of vessels, higher than 140\u00a0mmHg for systolic blood pressure (SBP) and/or higher than 90\u00a0mmHg for diastolic blood pressure (DBP). Women are more affected (37\u00a0%) than men (30\u22c52\u00a0%), and the prevalence increases with age, affecting 19\u22c52\u00a0% population from 20 to 34 years old, 53\u22c58\u00a0% of 40\u201360 years and 72\u22c52\u00a0% of the population group from 65 years. Hypertensive patients are exposed to associated pathologies, notably renal and cardiac failures, arterial aneurism, aortic dissection, arrhythmia and cognitive and mental disorder. However, a slight reduction in blood pressure could considerably decrease morbidity and mortality related to these related diseases and complications, for example, a decrease of 2\u00a0mmHg in the DBP have been reported to reduce by 17\u00a0% the prevalence of hypertension, by 6\u00a0% the risks of coronary diseases and by 15\u00a0% the risks of cerebrovascular accidents.Hypertension affects about a billion people around the world and causes more than 10 million deaths each year, with a prevalence that does not significantly vary between urban (32\u22c56\u00a0%) and rural (34\u22c53\u00a0%) areas. Accordingly, the Dietary Approaches to Stop Hypertension (DASH) diet developed in the 1990s in the United States to fight against hypertension, recommends a diet rich in fruits and vegetables, whole cereals, skimmed dairy products, legumes/grains and low in fat, sodium (Na+) and refined sugars, accompanied with regular physical activity. Several studies have shown the effectiveness of this diet in the management of hypertension, with a significant decrease of the SBP and DBP, weight, waist circumference and serum level of total- and LDL-cholesterol\u201311, cardiovascular and renal diseases, metabolic syndrome, gestational diabetes and colorectal cancer.The management of hypertension by medical prescription of antihypertensive treatment and/or by lifestyle-dietetic measures  aimed at decreasing blood pressure and other risk factors of hypertension like overweight and hyperlipidaemia, and the hypertension management is challenging because of the lack of financial resources, customs, beliefs and the negative perception of the disease as well as lack of information/education on the hypertension prevention and management. Some of these constraints can however be circumvented by a DASH diet based on available local resources and taking in account the food habits and practices of the patients. The general objective of the present study was to evaluate the effectiveness of a DASH diet with local foodstuffs in nutritional management of hypertension among patients attending the Ngaoundere Regional Hospital (NRH).In Cameroun, more than 25\u00a0% of the general population are hypertensiveN) was calculated using the formula of Lorenz ; p is the prevalence of hypertension (0\u22c525) and m is the margin of error (0\u22c505).The intervention was a case\u2013control prospective experimental study carried out for eight weeks from December 2021 to February 2022 on hypertensive patients attending the cardiology unit of the NRH. The minimal sample size , and daily frequency and quantity of water consumed. Concerning lifestyle, information on alcohol consumption, smoking tobacco and the practice of physical activity (type and frequency) were investigated.The patients then received nutritional advice, with those of the test group additionally receiving a 7-d diet plan, established based on the season's foodstuffs available, and partitioned into breakfast (7\u20139 a.m.), lunch (12\u20132 p.m.) and dinner (5\u20137 p.m.). An appointment for follow-up was set at 2 weeks\u2019 interval, but also aiming to evaluate the diet prescribed and make some adjustments where necessary.The intervention consisted in administering to the test group, for 8 weeks, a DASH diet (Appendix 1) built up using the results of survey on their food habits and to be followed-up at home, coupled with the practice of a moderate physical activities  at least 30\u00a0min per day at least three times per week. This DASH diet was rich in fruits, vegetables, skimmed or partially skimmed dairy products, dietary fibres, potassium, calcium and magnesium, moderate in fish, lean meat and poultry, leguminous plants, seeds and dry fruits with hulls, and low in total fat, saturated fatty acids and cholesterol.The daily total energy intake (DTEI) was estimated based on recommendations of a DASH diet, 2000\u00a0kcal divided in three meals and two snacks between the meals. The portions of meals were estimated using food composition tables. Lipid intake accounted for 27\u00a0% of the DTEI, cooking oil recommended was soybean oil. Carbohydrate and protein intake were respectively 55 and 18\u00a0% of the DTEI. It was recommended to the patients to consume about 2\u22c53\u00a0g (a teaspoon) of salt (sodium chloride) per day, avoiding monosodium glutamate in their meals, to use not more than six tablespoons of oil in the meals, which should be added at the end of cooking, avoid adding salt to already cooked dishes and to use flavour alternatives like aromatic herbs and spices, and also to consume 2\u22c55 to 3\u00a0l of water per day. Alcohol intake was limited to a half glass of red wine per day.Moringa oleifera), zom/njapche/koumbi leaves (Solanum nigrum), kenen kenen leaves (Corchorus olitorus), water melon, orange, apple, banana, tangerine, carrot, French beans, cucumbers, okra, etc.). Since the dietary intakes of the patients of the control group were not followed-up and assessed, their energy intake was not estimated.Concerning the qualitative aspect, this diet considered the geographic context by preferring foodstuffs resulting from local agriculture. The consumption of fruits and vegetables locally available during the season was strongly recommended (moringa leaves (2)  kg/m (Eq. 2),2) was ranged as follows: <18\u22c55: Underweight; 18\u22c55\u201324\u22c59: Normal; 25\u201329\u22c59: Overweight; 30\u201334\u22c59: Primary obesity; 35\u201339\u22c59: Secondary obesity; \u226540: Tertiary Obesity (morbid).Nutritional status corresponding to BMI values (kg/mSBP and DBP (mmHg) were measured using an electronic blood pressure monitor (OMRON M6 Confort [HEM-7321-E]). The measurements were done three times with an interval of 1\u00a0min between two measurements on sitting patients, at rest and not stressed, the armband of the monitor being placed at the level of the non-dominant arm (left arm for the right-handed and right arm for the left-handed persons). Concerning lipid parameters, blood sample was collected by a nurse, labelled and conveyed to the laboratory of Biomedical Analysis of the NRH for the analysis of serum triglycerides, total, HDL-c and LDL-c levels.\u03b1\u00a0=\u00a00\u22c505.The survey sheet was designed using the software Sphinx Plus\u00b2 \u2013 Edition Lexica-V5, and the data analysed using SPSS-v20 software. The qualitative variables were expressed in absolute and relative frequency while the quantitative variables were expressed as mean\u00a0\u00b1\u00a0standard deviation for the data with a normal distribution, or as medians with the interquartile intervals for the data not having a normal distribution. The impact of the intervention was evaluated by the test Chi-square test of Mann\u2013Whitney on two series of paired qualitative data. The threshold of signification was fixed at This study was conducted according to the guidelines laid down in the Declaration of Helsinki and all procedures involving human subjects were approved by the Direction of Regional Hospital of Ngaoundere by delivering an authorisation of research. Appropriate protocols for protecting the rights and privacy of all the participants were applied during the nutritional intervention. Verbal informed consent was obtained from all subjects. Verbal consent was controlled and formally recorded. The agreement clearly stated that participation is not compulsory, participants are free to withdraw from the study at any time or step, and full disclosure of study requirements and risks of the study. The anonymity of the participants was guaranteed, as well as the confidentiality of data collected. In addition, this study did not harm the physical integrity of the patients and did not interfere with their clinical follow-up.. A study carried out in the town of Ngaoundere in 2020 also revealed a high predominance of men (63\u22c58\u00a0%) among the hypertensive patients.The socio-demographic characteristics of the patients are presented in . Indeed, contrary to patients 60 years old who are pensioners for the majority, those aged 40\u201359 years are still active, and thus undergo the pressure and the stress related to the long working days. A study carried out in the Garoua town in Cameroon established that the age group of 46\u201365 years were the majority in population of hypertensive patients. From The patients were mainly married (70\u22c56\u00a0%) , which i. In fact, the higher the level education, the lower is the prevalence of malnutrition among women and their families.Concerning the level of education, 32\u00a0% of the patients had never gone to formal school or follow certifying education and 313\u00a0% have primary school level. Level of education is a significant factor in the development of nutritional intervention programs. Because of their low level of education, about two-third of participants can neither speak, read nor write English and/or French, the two official languages in Cameroon. They are consequently unable to understand the messages and sensitising in the media on hypertension. Moreover, they do not measure the importance of nutrition in their lifestyle. In fact, it was shown that people who received a minimum of education are generally more advised than those who did not, and lack of education can negatively affect the decisions about food choices,21. Moreover, 61\u22c53\u00a0% of patients had family history of hypertension  were diagnosed less than one year back, while 34\u22c54\u00a0% of patients were diagnosed more than 5 years back showing that hypertension is diagnosed late in the town of Ngaoundere, which can be related to the lack of information of the patients on the symptoms of the disease, their low level of education, but especially the low rate of hospitals visits by the population.The type, frequency and duration of physical activity by the participants, as well as the history of their hypertension are presented in rtension , one of . Indeed, it is recommended to hypertensive patients to significantly reduce their intake of table salt, as there is a high correlation between a diet rich in Na+ and the occurrence of hypertension. Moreover, with their high content in vitamins, minerals, antioxidants and others bioactive compounds, fruits and vegetables are strongly recommended in the management of hypertension, and it is the same for olive oil with its wealth in polyunsaturated fatty acids.Results on food practices and lifestyle of the patients  indicate.Cattle breeding is the major activity in the study area, then beef meat is available in the local markets, which explains why 71\u22c52\u00a0% of the patients consume meat at least three times per week, contrary to fish which is a little bit scarce, and thus less consumed with only 32\u22c55\u00a0% of participants who eat fish at least three times per week. This result suggests that the feeding habits of the patients are likely to expose them to complications, because red meats must be reduced in the diets for chronic diseases in general and DASH diet. Moreover, fish, in addition, is also a source of unsaturated fatty acids which have properties proven in the management of hypertensionAmong the patients, 42\u22c55\u00a0% consumed whole cereals. Cereals are famous for their high content in dietary fibres which are implicated through several mechanisms in the reduction of blood cholesterol and sugar in the body.,27, they present a low risk for the patients attending NRH nutrition unit.Concerning the lifestyle, 70\u22c56\u00a0% of patients did not consume alcohol and 93\u22c57\u00a0% of patients did not consume tobacco. However, 13\u22c57\u00a0% of the patients frequently consumed alcohol and 5\u00a0% consumed tobacco. Even though smoking and consumption of alcohol are high risk factors of hypertension, and also rich in whole cereals containing dietary fibres implicated in the reduction of blood glucose and lipid levels, thus limiting their storage in the form of energy. This diet combined with the practice of physical activity, largely contributed to the reduction of body weight of the patients, as reported in a similar study carried out in Algeria.BMI of patients at the beginning and at the end of the intervention were calculated and the results compiled in P\u00a0<\u00a00\u22c505) in the SBP and DBP in both test and control groups. This reduction is of about 28 and 18\u00a0mmHg, respectively, for SBP and DBP in the test group, 27 and 15\u00a0mmHg in the control group and can be explained by the fact that all the patients in the test and control groups, were under antihypertensive treatment during the period of the study, which would have contributed to this significant decrease in blood pressure. However, a comparison of the average values of the variations of DBP (P\u00a0<\u00a00\u22c505) compare to the control group. This could be justified by the benefits of the experimental diet, in particular the reduction of Na+ intake and the consumption of fruits, vegetables and fish. The regular consumption of fish which is rich in \u03c9-3 polyunsaturated fatty acids (3 times per week) and vegetable oils rich in unsaturated fatty acids leads to the decrease in the blood pressure, and can be recommended among hypertensive patients.SBP and DBP of the patients before and after the intervention are presented in s of DBP  shows a P\u00a0<\u00a00\u22c505) in the test group, with the prevalence of the patients at the advanced stages  passing from 88\u22c57\u00a0% at the beginning of the study to 4\u22c55\u00a0%, with no patient at the grades 2 and 3 at the end of the study. The same trend was observed for the DBP with the proportion of patients with advanced stage of the disease passing from 84 to 9\u00a0%, without patient in grade 3 at the end of the study. These results confirm once more the effectiveness of this DASH diet in the management of hypertension.The impact of the DASH diet on the evolution of the severity of hypertension is presented in 2+), magnesium (Mg2+) and potassium (K+) which are vasodilator minerals. Indeed, the movement of Ca2+ on both sides of the cellular membrane is accompanied by a reduction of the blood pressure and a decrease in the intracellular concentration of Ca2+, causing a relaxation of vascular fibres and thus a vasodilatation. Mg2+, on the other hand, acts on vascular tonicity through mediators like nitric oxide (NO), endotheline-1 and the derivatives of prostaglandins released by the endothelium and lowers the blood pressure. For the case of K+, it reduces the blood pressure by acting on the urinary elimination of Na+ and water. K+ would have also the capacity to recover noradrenalin at the level of nervous terminations and consequently is effective as a vasodilator leading to a reduction of the blood pressure.The decrease in blood pressure observed in this study may also be due to the richness of the elaborated DASH diet in calcium (CaP\u00a0<\u00a00\u22c505) on the lipid parameters. Total-cholesterol and LDL-c levels decrease for the patients of the test group based on average by 10\u22c586 and 9\u22c556\u00a0mg/dl, respectively, while their HDL-c level increased by 4\u22c534\u00a0mg/dl. Total-cholesterol level significantly (P\u00a0<\u00a00\u22c505) decreases in the test group than the control group (Lipid profile of the patients before and after the study is presented in ol group . These r.Level of risk of exposure to hypertension (increasing in SBP and DBP) according to the observance of DASH diet among patients is presented in The good application of a DASH diet established from available food resources in the town of Ngaoundere contributes effectively to the management of hypertension, by improving the physiological (SBP and DBP), anthropometric (BMI) and lipid  parameters of the hypertensive patients. The application of DASH diet proposed reduces the risk of complications mainly by fourteen times the risk links to an increasing of the SBP and by seven times the risk links to an increasing of the DBP."}
+{"text": "This paper offers a multidimensional theoretical scheme to analyze professional ethics in the field of political public relations. We suggest investigating the decisions of these professionals using moral foundations theory because human ethical reasoning is contextual, and the examination of ethics in a one-dimensional manner as previous researchers have done overlooks the complexity of the moral choices that such professionals make. The prospects of the proposed theoretical approach are demonstrated on 16 interviews with post-soviet Russian political PR industry leaders that were conducted from March 2018 to April 2020. Our empirical findings show that Russian political PR specialists employ all moral foundations, however, in their narratives the \u201ccare/harm\u201d and \u201cauthority/respect\u201d foundations were not mentioned very often. Overall, this paper makes a critical contribution to research on professional ethics in political public relations, and it provides important insight into the specifics of moral reasoning in the Russian political PR industry that is insufficiently described in the current literature. The moral reasoning of public relations (PR) professionals is a significant focus of research for practitioners and researchers worldwide \u20133. AlthoOur paper addresses these two problems. In particular, we use the scheme for moral foundations developed by Haidt and his colleagues  to invesThe article starts with a historical overview of the formation and transformation of the Russian political PR industry. It continues with an analysis of the literature on the ethics of political PR professionals. After that, the current study is introduced. Then the results are presented and discussed, and directions for future research are proposed.The contemporary Russian PR industry began as a professional field and a market segment during the political and economic transition from socialism to capitalism in Russia and other socialist countries in 1980\u20131990 \u201316. Its During 1990\u20132000 different actors in the PR industry tried to formalize ethical principles in the form of codes, declarations, and agreements [reements , 23. On reements , 25. Apareements \u201330.During the early 2000s, the Russian political PR segment finally established itself as a professional community and market segment, despite the economic collapse and economic crisis of 1998, and agencies in the capital cities (Moscow and Saint-Petersburg) continued to dominate the market [Generation P [e market . In addie market . These wration P . Despiteration P . First, ration P . This hiDuring 2010\u20132020, in the Russian PR industry, there were two controversial processes. On the one hand, there was a massive extension of governmental involvement in the economy, including the political PR sector, and a massive restriction of political freedoms [freedoms . Therefofreedoms \u201337. Bothfreedoms . Many offreedoms , when evfreedoms . In thesfreedoms \u201344. Gradfreedoms \u201348. ThesGenerally speaking, contemporary Russian political consulting and PR have developed a fully functional institutional infrastructure . It inclThe ethics of PR specialists is one of the most important topics to be investigated by social science and media scholars and practitioners because moral norms determine the internal integrity of this profession and the public trust in services and products it presents to them \u20133. Even PR professionals must make various ethical choices at work, and these choices tend to change over time . Neill, Moreover, PR specialists are prone to be morally disengaged because their position in the chain of the political process is an intermediary one. Studies in various countries show that these specialists evaluate their accountability differently, based on the ethical character of their clients. Some practitioners suppose that it is up to the client to draw the line between moral and immoral political actions \u201360. HoweAt the same time, some scholars treat PR specialists as supporters of ethical leadership, and they research the practice of PR specialists from that perspective . They clApart from their professional lives, many political PR specialists have other spheres, where they make ethical decisions . Measuring the moral choices that these practitioners make in non-professional contexts could reveal the tacit ethical principles on which they rely in work-related situations that are not regulated by professional ethical codes for various reasons. Moreover, the literature on PR professionals in general and on political PR per se shows that even when formal ethical codes are applicable these people tend to employ their moral compass instead of established ethical codes , 64\u201366.The moral characteristics of PR specialists in non-work-related contexts were investigated mainly by moral development researchers. Moral development is the concept introduced and developed by Piaget, Kohlberg, Gilligan and their followers . Their rThe moral decisions of PR political professionals could depend on organizational and cultural values. The cultural influence at the country level is visible, first, from comparisons to global ethical codes. For instance,  showed tOverall, from the research on the ethics of political PR professionals and PR professionals in general, it is apparent that the moral decision-making of these specialists has been extensively investigated in the separate areas of their lives, but the interrelation between those areas is not yet fully understood. Instead, we suggest using the moral foundations theory  to theorTo discover the moral foundations of the political PR professionals, semi-structured qualitative interviews with these specialists were conducted from March 2018 to April 2020. The interviews were taken during the aforementioned time period because in 2018 almost 30 years passed since the beginning of PR industry professionalization in Russia \u201316 and sAs our study was focused on the ethics of post-soviet Russian political PR professionals that have worked in Russia in this field since its establishment, we searched for the leading Russian political PR market specialists that have been working in this market since 1990 and were engaged in PR specialists\u2019 professional associations. Two sources of information about the market structure were triangulated: the Internet and books about leaders in the field. For the first, we contacted the most active members of the related professional associations. For the second, we examined books that provided overviews of key market figures like \u201cWho\u2019s who in PR?\u201d .The aim During the interview, informants were asked about their professional biography and the characteristics of the Russian political PR industry in 1990\u20132000 and its further transformation. In addition, they were questioned about professional ethics, the role of professional organizations, social media, and Internet technologies in this industry. At the end of the interview, they were asked their opinion of the current state of political PR and consulting in Russia. The interviews lasted between 35 and 90 minutes.Interview data were analyzed using qualitative thematic analysis by two researchers . We emplThe findings address five moral foundations. Three of them, \u201cfairness/reciprocity,\u201d \u201cin-group/loyalty\u201d and \u201cpurity/sanctity\u201d were referenced more frequently during the interviews. The other foundations, \u201ccare/harm\u201d and \u201cauthority/respect,\u201d were mentioned less often. The themes and subthemes in the narratives are elaborated below.The participants expressed the importance of care/harm toward society, clients, and other political PR professionals, but they did not mention others that could be harmed/cared for because of their actions: individuals other than clients and non-humans. Examples and quotes in support of this theme and its subthemes are in Four participants emphasized that in their practice they care about other PR professionals\u2019 wellbeing. They said that they work against politicians, not against other PR specialists. This position of the interviewees could have pragmatic reasons behind it. As one participant stated, the PR specialists frequently work in teams with each other, therefore it is important to be polite to the colleagues.Three participants claimed that they consider the public good in their professional decisions. It is important for these political PR specialists to consider how their actions will affect ordinary people, and these professionals bear in mind what is considered bad by the public. The interviewees also argued that professional ethics is grounded in universal assumptions about evil and good that are internalized during socialization. All the mentioned political PR specialists said that they try not to harm the public with their decisions.Two interviewees stated that they care about the effects of their deeds on their client\u2019s state of affairs. One of them indicated that the worse the state of the client the more profit will come from handling the case. He also compared PR professionals to doctors and advocates because, to his mind, all these professionals could get more money for their services the worse the condition of the client is. Also, it was claimed that it is common that the borders between professional and personal relations blur, and therefore sometimes political PR professionals could care more about the state of their client when it is required formally. A second interviewee claimed that the good of the client is one of the goods that he tries to fulfill when he does his work, along with the public good and norms of behavior established between colleagues in his professional community.Participants applied the notions of fairness and reciprocity to the same subjects about which they applied the concepts of care and harm . However, while talking about PR specialists, our interviewees tended to conceptualize their relations with colleagues as reciprocal. They mostly did not speak about honesty. Conversely, when they discussed the same topic concerning clients and society, they did speak about honesty/dishonesty. We think this relates to the backside logic that they use while thinking about these different types of relations. Namely, PR specialists are in economic relationships with them, clients have borderline relations and society is in non-professional relations with these people.  that must be respected when they make certain decisions. These participants claimed that they consider the authorities\u2019 interests during their work.One person emphasized the hierarchy needed between him and clients in ethical professional relations because sometimes borders between professional and personal relations tend to blur.Hierarchy exists in the political PR community, and it is indirectly visible through the need to sign ethical codes. This was mentioned by only one interviewee. This participant argued that those who signed codes want to show to the other market players that they are privileged and others who do not sign are \u201coutside the system.\u201dThe purity/sanctity foundation involved reflections about the existence or absence of black (dirty) PR compared to white (honest) PR. Almost no religious or spiritual language or religious connotations were used to conceptualize the boundary. Only one person cited the Ten Commandments to illustrate his point. Others tended to employ a narrow variety of words, mainly \u201cdirt\u201d or \u201cblack\u201d when they addressed the topic see .Eight interviewees mentioned the notion of black or dirty PR and contrasted it with white. Three of them said that for them there is no black PR because the most important thing is what is effective and what is not and lying and distorting information is an inevitable part of their profession. Also, one participant claimed that there is no black or white PR because the ethics of PR reflects the clients\u2019 values, not the PR specialist\u2019s ones. Others argued that the indicators that define what is black PR are disobeying judicial codes and internal universal ethical principles. Also, two interviewees said that black PR is not in fashion now in Russia. Besides this, it was claimed that using black PR is has become risky for one\u2019s reputation in the field. It could discredit you in the eyes of colleagues.In this paper, we offer a multidimensional scheme to measure the ethics of political PR specialists, since one-dimensional frameworks used in previous research did not account for the contextual variety of human moral reasoning or apply it to the investigation of the moral reasoning of the members of the Russian political PR industry. In particular, we examine the ethical principles of 16 leading \u201cplayers\u201d in the market.Our first finding was contrary to the research of . They shSecond, regarding the nature of moral reasoning, we show that the ethics of political PR professionals depend on the perception of whom their actions could affect. These include clients, other professionals, their professional organizations, the public, governmental structures, and other politicians. Moreover, we discovered all five moral foundations from the range suggested by Haidt in the narratives of our informants. However, three foundations, \u201cfairness/reciprocity,\u201d \u201cin-group/loyalty\u201d and \u201cpurity/sanctity,\u201d were referred to more than the other two (\u201ccare/harm\u201d and \u201cauthority/respect\u201d). Such results are in line with previous papers that show that Russian PR specialists are less likely than US ones to think about how their actions affect the public good . We suppThird, like , 77, 82,Finally, we found that attitudes toward the subjects to whom political PR specialists apply ethical principles depend on each other. For instance, being polite to other professionals could also presuppose being brutal to the political figures that these other professionals represent. This observation leads us to the idea of the networked structure of ethical orientations that the political PR professionals may have developed in their professional practice. Furthermore, our research was not targeted on the analysis of moral agency prescription by these professionals, but this topic should be investigated further because understanding whom PR professionals consider moral agents could explain why some moral foundations are more involved in their moral reasoning than others. For example, if these professionals do not think that the public is a collective agent  that couOur study is not without limitations. First, the sample includes mainly male political PR professionals. This reflects the male-domination of the Russian political PR industry . Moreove"}
+{"text": "It is scarce in natural systems, and deficiency can lead to reproductive failure, neurological issues, and death. One major cause of thiamine deficiency is an overreliance on diet items containing the enzyme thiaminase. Thiaminase activity has been noted in many prey fishes and linked to cohort failure in salmonid predators that eat prey fish with thiaminase activity, yet it is generally unknown whether evolutionary history, fish traits, and/or environmental conditions lead to production of thiaminase. We conducted literature and GenBank BLAST sequence searches to collect thiaminase activity data and sequence homology data in expressed protein sequences for 300 freshwater and marine fishes. We then tested whether presence or absence of thiaminase could be predicted by evolutionary relationships, trophic level, omega-3 fatty acid concentrations, habitat, climate, invasive potential, and body size. There was no evolutionary relationship with thiaminase activity. It first appears in Class Actinoptergyii (bony ray-finned fishes) and is present across the entire Actinoptergyii phylogeny in both primitive and derived fish orders. Instead, ecological factors explained the most variation in thiaminase: fishes were more likely to express thiaminase if they fed closer to the base of the food web, were high in polyunsaturated fatty acids, lived in freshwater, and were from tropical climates. These data provide a foundation for understanding sources of thiaminase leading to thiamine deficiency in fisheries and other organisms, including humans that eat uncooked fish.Thiamine (vitamin B Yet despite being necessary for all life, animals cannot synthesize thiamine de novo, and so the majority must obtain it through diet or direct uptake in the case of fry5. Biological thiamine synthesis is energetically expensive and complicated7. Thiamine in aquatic systems is present at extremely low (picomolar) concentrations; spatially heterogenous; degrades rapidly in the presence of UV8, alkaline conditions9, and high temperatures10; and tends to be rapidly taken up after synthesis13. Furthermore, having too little thiamine leads to a suite of cardiovascular and neurological issues in humans3, foxes14, fishes15, and other wildlife16. Although some effects of thiamine deficiency are reversible, early life deficiency can cause death17, and permanent brain damage has been documented in humans18. The long-term effects of temporary or intermittent thiamine deficiency in fishes17 and the reasons thiamine deficiency complex is showing up more in wild populations19 remain poorly understood, in part because thiamine supplementation is inexpensive and easily applied in managed populations.Thiamine  or through eating something that destroys thiamine before it can be absorbed21. Previous research has hypothesized that a diet of lipid-rich prey can lead to thiamine deficiency in fish predators, but these correlative studies have not considered if lipid-rich forage fish also contain thiaminase22. Early life stage mortality and sublethal effects in salmonids is linked with low egg thiamine concentrations caused by elevated thiaminolytic enzymes  present in the maternal diet24. Fishes differ drastically in their thiaminase activity27, but the sources and reasons for thiaminase production are relatively unknown. Bacteria can use thiaminase as a salvage pathway for thiamine biosynthesis28, and originally thiaminase activity in forage fishes was thought to be linked to thiaminase-producing bacteria such as Paenibacillus thiaminolyticus that had been isolated from Alewife (Alosa pseudoharengus)29. However, later research revealed no relationship between thiaminase activity and either the amount of P. thiaminolyticus thiaminase I protein or the abundance of P. thiaminolyticus cells30. More recently, Richter et al.31 provided evidence for de novo production of thiaminase I by fish  and identified the genetic basis for thiaminase production in fishes.There are two demonstrated mechanisms for aquatic animals to become thiamine deficient: through a diet that lacks enough thiaminewhy fishes produce thiaminase if it destroys an essential nutrient that fish cannot synthesize? It is highly unlikely that thiaminase production is a prey response to limit predators for two reasons: (1) predators develop TDC when a large portion of their diet has thiaminase, but it can take years21; and (2) this feedback loop is too slow to benefit prey producing thiaminase who might have two or three generations until predator populations begin to experience reproductive failure. One possible explanation of thiaminase production is the result of strong selective pressure as a method to partially resynthesize thiamine6. Fish that express thiaminase activity are not themselves deficient in thiamine26, suggesting that mechanisms exist to partition thiaminase activity from thiamine within the tissues of fish that express thiaminase. However, the mechanisms, efficiency, and energetic requirements of thiaminase partitioning have not been elucidated. Thiaminase activity has been found to increase with disease challenges32 and with diet quality and stress33. However, not all fishes produce thiaminase, and thiaminase activity levels are highly variable34. The evolutionary history of thiaminase production in fishes is also unknown. Thiaminase may be more common in primitive than derived North American freshwater fishes35, but these studies did not consider marine species.The question remains 35; and (2) if ecological or physiological characteristics of trophic level, habitat use during foraging, salinity tolerance, or lipid content predicted thiaminase presence or activity in fishes. Associations of thiaminase with these ecological or physiological factors would aid in evaluation of risk for thiaminase-induced TDC in piscivorous fishes, wildlife, and humans.We sought to explore whether evolutionary and ecological characteristics could explain thiaminase presence in fishes. Specifically, we evaluated: (1) if phylogenetic relationships would predict thiaminase presence or activity, consistent with previous work on North American freshwater fishes55 and a GenBank search for protein sequences coded by expressed transcripts with significant homology to Zebrafish (Danio rerio) thiaminase I . The thiaminase I enzyme of Zebrafish is homologous to a candidate thiaminase gene identified in Alewife. The empirically derived mass and isoelectric point of the thiaminase I activity extracted from Alewife tissues exactly matched that predicted for the candidate Alewife thiaminase I gene31. We limited the search to fish species with at least 10,000 predicted protein sequences in GenBank. We conducted a protein BLAST sequence search for each of the species against the Zebrafish thiaminase predicted protein sequence31. Fishes were scored thiaminase positive if they had an expressed predicted protein sequence with at least 35% sequence identity56 to Zebrafish thiaminase and contained the predicted active site cysteine (C153 in NP_001314821.1).Data on thiaminase I activity of 300 fishes were compiled from existing literaturePetromyzon marinus) were categorized as thiaminase positive in the literature36 but negative in BLAST. Since Boggs et al. (2019) suggested little to no thiaminase activity for another lamprey species\u00a0and the BLAST data are more comprehensive, we categorized them as negative. Ninespine Stickleback (Pungitius pungitius) was listed as thiaminase positive in Riley and Evans35 based on activity of 85\u2009\u00b1\u200960\u00a0pmol/g/min26. However, the BLAST data indicated it was thiaminase negative and the high standard deviation in measurements suggested many low values. Furthermore, a more recent study showed very little thiaminase activity57. Thus, we categorized the Ninespine Stickleback as thiaminase negative. Lake Whitefish (Coregonus clupeaformis) was categorized as thiaminase positive based on Deutsch and Hasler58 but was BLAST negative. Since we have lower confidence in the sole literature value, we categorized Lake Whitefish as negative. Bowfin  was positive in two studies46 but also listed as both positive and negative36. Thiaminase analysis in these studies was conducted on whole-body Bowfin homogenates, and it is possible that positive results may have resulted from analyzing Bowfin that contained thiaminase-rich prey in their guts, so they were eliminated from analysis. European Perch (Perca fluviatilis) was positive in one study48 but negative in BLAST. We put higher trust in the BLAST data since published work48 only reports positive or negative activity and did not report a range of measured values. All entries were checked closely by two separate people for completeness and accuracy.The BLAST search and literature agreed for 23 fishes where both genetic and literature thiaminase data were available. There were few disagreements. Sea Lamprey , trophic level estimate, and median Omega-3 concentration were treated as continuous variables. A species\u2019 invasive ability , climate range , habitat , and whether a fish spends the majority of its life in marine or freshwater environments were treated as categorical variables.We obtained family, order, and ecological data from fishbase.org60. We tested for phylogenetic relationships among fish families and presence/absence of thiaminase using a published fish phylogeny including the Classes Sarcopterygii, Chondrichthyes, and Actinopterygii61, and among orders using a phylogeny of ray-finned fishes of Class Actinopterygii only62. We used the R package ape63 to prune the tree to fish orders/families where we had data using the \u2018drop.tip\u2019 function. We then used \u2018make.simmap\u2019 in the phytools package64 to fit continuous-time reversible Markov models to estimate the evolution of thiaminase at each node for 500 simulations. The models assumed equal (0.5/0.5) root node prior probabilities of presence or absence of thiaminase conditioned on the published fish phylogenies. We used these simulations to estimate the probability that an ancestral state/root node had thiaminase, represented as pie charts at each node.We analyzed all data in R v4.1.2rstanarm65 R package. We used weakly informative priors with a mean of zero and standard deviation of 2.5. We ran each Bayesian model for 10,000 iterations and discarded the first half as a warm-up to obtain 20,000 simulations for analysis. We confirmed convergence using Gelman\u2013Rubin statistic (R\u0302\u2009<\u20091.01)66 and by examining trace plots. None of the models had influential outliers as assessed by leave-one-out cross-validation (\u201cloo\u201d) in the rstan package67. We report the coefficients as the mean and the 95% credible interval (95% CRI), which is the range of values for posterior samples. We computed Bayesian R2 for the regression models  to explore the proportion of variance explained by the models68.To explore the ecological determinants of thiaminase activity we used Bayesian binomial models with a logit-link function in the 2\u2009=\u20090.36, Fig.\u00a0TL\u2009=\u2009\u2212\u20090.88, 95% CRI ; Supplementary Table marine\u2009=\u2009\u2212\u20092.01, 95% CRI ) were negatively related to thiaminase presence in fishes  had thiaminase. These species represent a broad range of sizes, climates, and habitats  were positively related to thiaminase in fishes  all lack the genes to produce the thiaminase protein. For both family- and order-level analyses, there was no phylogenetic relationship of thiaminase presence/absence. The trait first appears in the Class Actinopterygii (ray-finned fishes) Order Polyteriformes , which evolved 368 million years ago61, but the presence/absence of thiaminase has no discernable patterns within Class Actinopterygii. Previous work has reported thiaminase activity and presence were generally higher in basal teleosts  than in more derived neoteleosts 35. However, with a tenfold larger data set we were unable to discern any phylogenetic patterns. Certain orders have more members with thiaminase (Clupeiformes and Cypriniformes), suggesting there must be some evolutionary reason for its presence. While other species can and do produce thiaminase, clupeids in particular are well known to cause thiamine deficiency if they are a large portion of predator diets75. A better understanding of how thiaminase in Clupeiformes such as alewife differs from that in Cypriniformes such as carps and other fishes is needed.Thiaminase is not present in ancient fishes. Lampreys, cartilaginous fishes, and the Coelacanth  were thiaminase positive. The reasons for fishes producing thiaminase remain unclear. Lower trophic food items like seston and zooplankton are highly variable in thiamine concentrations1, 154\u2009=\u20090.203, p\u2009=\u20090.653). Thiamine-deficiency complex in North American fisheries is thought to be the result of thiaminase in prey fishes destroying thiamine in predators gut contents as they pass through the gut26. In contrast, thiamine deficiency  in Atlantic Salmon  from the Baltic Sea has been correlated with consumption of Sprat (Sprattus sprattus) and Atlantic Herring (Clupea harengus)50. In the Baltic, thiamine deficiency is presently thought to be caused by high lipid density leading to low thiamine concentrations per unit energy83. However, there has been no reported evidence that oxidative stress from highly unsaturated omega-3 fatty acids results in thiamine deficiency in consumers eating diets without thiaminase. Diets containing both high concentrations of omega-3 fatty acids and thiaminase confound attempts to uncover drivers of thiamine deficiency observed in M74-affected fish. It is also possible forage fish with high lipids22 and thiaminase presence such as in Sprat27 have additive negative effects on thiamine concentrations in predators. More efforts to disentangle whether thiaminase, high lipids (such as omega-3), or both cause thiamine deficiency are needed to understand threats to fisheries.One of the more interesting results was the strong positive relationship between omega-3 concentration and thiaminase presence, independent from trophic level  of thiaminases in fish. Why fishes produce thiaminase remains unknown, but the discussions may have been hindered because of the tendency to focus on thiaminase\u2019s thiamine-degrading properties (and aforementioned impact on predators) rather than its function as a benefit to organisms. In bacteria, thiaminase II hydrolyzes the thiamine break-down product of formylaminopyrimidine (N-formyl-4-amino-5-aminomethyl-2-methylpyrimidine) to 4-amino-5-hydroxymehtyl-2-mehtylpyrimidine (HMP) which is then recycled in a thiamine biosynthetic pathway85 due to an oxidative side-reaction that readily damages the thiazole moiety86. Thiamine is also degraded in the presence of UV, sulfites, or high pHs, exacerbating its scarcity in natural environments and offering an advantage to organisms with microbiomes containing the ability to resynthesize thiamine from its breakdown products or precursors2. It is interesting that thiaminase production is most common in lower trophic levels, meaning that forage fishes are most likely to produce it. Thiaminase I as a thiamine salvage pathway in their microbiome would offer a strong advantage to fishes in environments with low and unstable thiamine supplies. However, it is unlikely that thiaminase I in forage species serves as a selective force to control reproduction and subsequently population size in salmonine predators. Laboratory experiments demonstrated that it took at least two years to induce TDC in eggs and fry of Lake Trout fed a thiaminase-rich diet21, a timeline too long for the feedback loop to benefit prey producing thiaminase.Thiaminase I most certainly offers a selective advantage in fishes that possess this gene. Some possible advantages offered by thiaminase production include: (1) aide in thiamine production of commensal bacteria of the microbiome; (2) ecological advantages through population control of predatory species that forage on thiaminase-producing fishes; and (3) enhanced health of thiaminase-producing species of fish through greater immune function. Thiamine is the least metabolically stable B vitamin47. Additionally, thiaminase activity increased in carp injected with a pathogenic bacterium , suggesting a relationship between thiaminase expression in fish and immune status32. Thiaminase I in fishes may have antimicrobial activity, which would be a significant health benefit for survival. The subcellular localization of thiaminase in lysosomes87 is consistent with such an antimicrobial activity.Last, there is evidence that thiaminase I in fishes may be associated with immune function. Thiaminase activity within fishes is found to be greatest in tissues known to have immune function, such as head, kidney, gill, and spleenThe physiological function of thiaminase I in fishes remains in question at this point. Better understanding of these functions will ultimately help our predictions of ecological determinants for thiaminase production in fishes, as well as evolutionary significance of this fascinating enzyme.The present work shows that de novo thiaminase production in fishes is widespread. We found no evolutionary relationship with thiaminase activity. Thiaminase appears in Class Actinoptergyii and is present across the entire phylogeny in both primitive and derived fish orders within this Class. Computer simulation resulted in the probability of all families in the Actinoptergyii Class having thiaminase, suggesting the genes have been widely retained. Ecological factors explained the most (40%) variation in thiaminase; fishes were more likely to express thiaminase if they feed closer to the base of the food web, were high in polyunsaturated fatty acids, lived in freshwater, and were from tropical climates.19. As the climate changes, certain fish communities are shifting their ranges. Species like Northern Anchovy  have reached record abundances in the Pacific Ocean along the southern portion of the United States88, causing thiamine deficiency in Pacific Salmon74. Understanding which prey species produce thiaminase, why they produce it, and how prey range and population sizes may change with climate is a necessary foundation for predicting and managing thiamine deficiency in fisheries.Determining sources of thiaminase can help predict spatial and temporal patterns of the risks of thiamine deficiency globally. Thiamine deficiency is considered one of the top emerging issues for wildlifeSupplementary Information."}
+{"text": "Central adrenal insufficiency (CAI) is a life-threatening disorder. This occurs when ACTH production is insufficient, leading to low cortisol levels. Since corticosteroids are crucial to many metabolic responses under organic stress and inflammatory conditions, CAI recognition and prompt treatment are vital. However, the diagnosis of CAI is challenging. This is not only because its clinical presentation is usually oligosymptomatic, but also because the CAI laboratory investigation presents many pitfalls. Thus, the clarification of when to use each test could be helpful in many contexts. The CAI challenge is also involved in treatment: Several formulations of synthetic steroids exist, followed by the lack of a biomarker for glucocorticoid replacement. This review aims to access all available literature to synthesize important topics about who should investigate CAI, when it should be suspected, and how CAI must be treated. Central adrenal insufficiency (CAI) occurs when corticotropin-releasing hormone (CRH) or adrenocorticotropic hormone (ACTH) signaling cannot guarantee the proper quantity of adrenal androgens and glucocorticoids   . MineraThe hypothalamic-pituitary-adrenal (HPA) axis controls cortisol production in response to light, stress, and many other inputs, including communication with the autonomic nervous system   , 3 . ThEvaluation of functional CAI is extremely important in various clinical and intensive care contexts, as an inadequate response of the axis interferes with the recovery from many diseases   . CAI isAnother relevant factor is the peripheral activity of corticosteroids in different tissues and their genomic and non-genomic effects. Some polymorphisms of glucocorticoid receptors have been described to be related to glucocorticoid syndromes of resistance or hypersensitivity   , 14 . WCAI is classified as secondary or tertiary. The secondary causes are pituitary conditions, whereas the tertiary causes are hypothalamic disorders as well as CRH dysfunction. The annual incidence of CAI is 14-28 per 100,000 individuals   , 17 . HOverall, up to one-third of individuals with pituitary disease develop subsequent CAIs   , 28 . EThe basal cortisol level cannot predict the response to ACTH   . Thus, A cut-off level of basal cortisol that can differentiate between CAI or a normal corticotrophic axis would be beneficial to guide corticosteroid replacement. However, the literature on this topic is inconclusive. A meta-analysis including 13 studies suggested different cut-offs; cortisol <138 nmol/L (5 \u03bcg/dL) translates to >92% probability of CAI (95% CI: 75%-99%), whereas cortisol >359 nmol/l (13 \u00b5g/dL) translates to <9% probability of CAI (95% CI: 3%-18%)   . A receWhen the measurement of basal cortisol is insufficient, a pituitary stimulation test is necessary   , 34 . UOnce the laboratory diagnosis of CAI is confirmed, an imaging evaluation of the pituitary is necessary (except in cases induced by opioids and glucocorticoids) to detect the presence of a tumor or other infiltrative processes   . In addITT is the gold standard test. However, it is contraindicated in patients with high cardiovascular risk, seizures, pregnancy, cerebrovascular disease, and in those over 60 years of age. Samples were collected at 0, 30,60,90, and 120 min after the stimulus with intravenous insulin administration (0.05 0.15 U/kg). For adequate stimulation, a glucose level of <40 mg/dL is mandatory at any point after insulin administration   . Potent\u00ae or Cortrosyn\u00ae) as a stimulus. However, this test works better after adrenal atrophy is established, which usually occurs approximately six months after pituitary injury. Thus, this test cannot be used for diagnosing acute CAI  has a possible bias owing to the difficulty of preparing a meager ACTH amount, which runs the risk of administering inaccurate doses  to cortisol, thereby decreasing the negative cortisol feedback on ACTH   . DespitThis topic will discuss other laboratory approaches and tests that deserve attention, and current research focuses on improving CAI diagnosis.Cortisol binding globulin (CBG) binds cortisol with high affinity and low capacity   . BesideTaking all this into account, free cortisol measurement, either directly in serum or saliva or indirectly using calculated values, is helpful in situations where the total cortisol value is incongruent with clinical presentation.in vitro study, supporting that CAI is extremely unlikely if the DHEAS level is normal ( Dehydroepiandrosterone sulfate (DHEAS) is exclusively produced in the adrenal reticularis zone by ACTH stimulus   , 2 . So normal   , 48 .DHEAS has a longer half-life (about 20 h) and lesser diurnal variation than cortisol   , which Glucocorticoid replacement in CAI is challenging in many ways. First, it is difficult to mimic the circadian rhythm of cortisol secretion. Second, there are several options for oral glucocorticoid replacement, and third, there are no reliable biomarkers to guarantee appropriate doses.The daily physiological secretion of cortisol by the adrenal gland is estimated to be between 5 and 10 mg of cortisol per m\u00b2 surface area   . Based There are several options for oral glucocorticoid compounds     1 , 22 . The gHydrocortisone and cortisone acetate are not widely available in some countries, such as Brazil. Consequently, many patients need to use intermediately acting glucocorticoids (prednisolone or prednisone). Even under physiological doses, this kind of glucocorticoid can induce unfavorable metabolic effects, as it impacts the circadian level of cortisol production   .In addition to drug choice, corticoid doses matter   , 55 . TDeficiencies of other pituitary axes are common among individuals with CAI. They can modify corticosteroid bioavailability and impact the corticosteroid dosage. Patients with hypopituitarism undergoing growth hormone and/or estrogen replacement require higher glucocorticoid doses than those without these deficiencies   , 32 . GSome drugs can affect CYP3A4, the major enzyme in cytochrome P450, which metabolizes medications that affect the metabolism of synthetic corticosteroids. Therefore, glucocorticoid intake should be reduced with concomitant use of CYP3A4 inhibitors ; it should be increased with the use of drugs that activate CYP3A4    .Alternative corticosteroid formulations have recently been studied, with promising results (see future perspectives).Nevertheless, more research is needed to identify biomarkers that enable personalized and physiological glucocorticoid replacement (see Future Perspectives). Without this kind of laboratory assessment, we can only reduce medication doses in the presence of signs of hypercortisolism without accounting for to subclinical adverse outcomes.CAI occurs mainly in combination with multiple pituitary deficits. In hypopituitarism, mortality is associated with untreated growth hormone deficiency, untreated hypogonadism, and over-treated hypocortisolism   , 57 . IIn a meta-analysis of 12 studies, Jasim and cols. showed that the main mortality determinants in hypopituitarism were female sex, young age at diagnosis, transcranial surgery, radiotherapy, craniopharyngioma, and diabetes insipidus   . This sOver-replacement and subclinical hypercortisolism may be responsible for the high morbidity and mortality rates in patients with CAI and hypopituitarism   . ConverTherapeutic patient education in CAI, as in many other chronic conditions, is a crucial issue. It is beyond simply transmitting information. Patients with CAI should be encouraged to acquire and maintain competencies that help them become more independent, to improve their quality of life (QoL), and to protect themselves from potentially life-threatening risks linked to their condition. Patients  must be trained to maintain proper use of medications, port an emergency card, recognize situations that trigger an adrenal crisis, and act appropriately in case of adrenal crisis   .Androgenic deficiency in women with CAI has been associated with lower quality of life (QoL)   . This pin vitro studies  is a clinical concept that describes the impairment of the hypothalamic-pituitary axis during organic stress in the intensivist context   . The raAnother exciting topic is HPA recovery. This recovery can occur, but it cannot be predicted after neurosurgery or prolonged exposure to synthetic corticosteroids.\u00ae test  had a sensitivity of 70% and specificity of 93% in predicting adequate response to the short Synacthen\u00ae test   . Anothe\u00ae test   .The CRH test after pituitary surgery, although safe, does not demonstrate adequate accuracy in predicting long-term corticotroph function   . Basal \u00ae) and dual release (Plenadren\u00ae) of hydrocortisone have been studied. Their pharmacokinetics promote corticoid bioavailability closer to that of circadian production ( \u00ae is licensed in Europe. It is administered once a day to improve patient adherence. Besides comfortable posology, this drug has demonstrated benefits regarding body composition, metabolic profile, and bone safety ( \u00ae has 20% less bioavailability than oral hydrocortisone, and dose adjustment is necessary ( Medications with a modified release (Chonocortduction   , 60 . P safety   , 78 . Hcessary   . AlthouBesides having a broad analogy with human DNA, zebrafish is a well-established animal model for the study of adrenal diseases due to its diurnal habit. Animal studies with zebrafish, metabolomics, and transcriptomics provide exciting insights into the transcription of gene cycles and metabolomic profiles in models of primary and secondary adrenal insufficiency   , 80 . WIn conclusion, CAI is a life-threatening condition in which diagnosis and management are still challenging. A basal cortisol dosage is able to diagnose CAI, but it relies on a straight cut off. Therefore, several patients presented with a gray zone demanding stimulus tests. CAI treatment is based on glucocorticoid replacement, but many questions remain about its optimal posology. In the absence of a clinical biomarker of glucocorticoid replacement adequacy, there is a risk of under-or over-glucocorticoid replacement. It is urgent to determine how to diagnose CAI, differentiate partial from complete adrenal insufficiency, and clarify the role of new glucocorticoid replacement options in CAI management."
\ No newline at end of file