diff --git "a/deduped/dedup_0226.jsonl" "b/deduped/dedup_0226.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0226.jsonl"
@@ -0,0 +1,78 @@
+{"text": "CBF1/RBP-J\u03ba/Suppressor of Hairless/LAG-1) transcription factor family members are well-known components of the transmembrane receptor Notch signaling pathway, which plays a critical role in metazoan development. They function as context-dependent activators or repressors of transcription of their responsive genes, the promoters of which harbor the GTG(G/A)GAA consensus elements. Recently, several studies described Notch-independent activities of the CSL proteins.The CSL (We have identified putative CSL genes in several fungal species, showing that this family is not confined to metazoans. We have analyzed their sequence conservation and identified the presence of well-defined domains typical of genuine CSL proteins. Furthermore, we have shown that the candidate fungal protein sequences contain highly conserved regions known to be required for sequence-specific DNA binding in their metazoan counterparts. The phylogenetic analysis of the newly identified fungal CSL proteins revealed the existence of two distinct classes, both of which are present in all the species studied.Our findings support the evolutionary origin of the CSL transcription factor family in the last common ancestor of fungi and metazoans. We hypothesize that the ancestral CSL function involved DNA binding and Notch-independent regulation of transcription and that this function may still be shared, to a certain degree, by the present CSL family members from both fungi and metazoans. CBF1/RBP-J\u03ba/Suppressor of Hairless/LAG-1) proteins compose a family of transcription factors essential for metazoan development  as a query. Candidate hits containing at least one of the conserved CSL motifs (see Results) were considered and used for further analyses. The BLAST searches were then repeated with all the newly identified CSL sequences as queries until no more new hits were found. In cases where two or more nearly-identical candidate sequences, coming from independent sources and obviously representing a single gene, were found, the sequence showing the highest degree of similarity to the fungal CSL consensus was chosen. The final searches were performed between November 24, 2006 and November 30, 2006.We have searched multiple publicly available fungal genome and protein databases  using tein, see  with 200MP designed the study, carried out database searches and phylogenetic analyses and drafted the manuscript. FP participated in the study design and final manuscript preparation. PF participated in the final manuscript preparation. All authors read and approved the final manuscript.New and corrected fungal CSL gene prediction modelsClick here for fileNew and corrected fungal CSL protein prediction modelsClick here for fileCSL proteins sequence alignment used for the phylogenetic analysesClick here for file"}
+{"text": "To assess the GH response to GHRH-arginine in apparently healthy adults in relation to cardiovascular risk factors.Cross-sectional.Eighty-six male and female volunteers aged 50\u201390.GH peak response to GHRH-arginine and cardiovascular risk factors, including obesity, insulin resistance, low levels of high density lipoprotein (HDL) cholesterol, elevated triglycerides, and hypertension. The primary outcome measurement was GH response to GHRH-arginine. The relationship between GH peak responses and cardiovascular risk factors was determined after data collection.P < 0\u00b70001). By univariate analysis, fasting glucose, insulin, body mass index (BMI), HDL cholesterol and triglycerides were significantly associated with GH peak . Multiple regression analysis revealed that fasting glucose, fasting insulin, BMI, triglycerides and sex accounted for 54% of GH peak variability. The role of abdominal fat as it relates to GH peak was explored in a subset of 45 subjects. Trunk fat and abdominal subregion fat measured by dual energy X-ray absorptiometry (DXA) were inversely related to GH peak . Analysis of this subgroup by multiple regression revealed that subregion abdominal fat became the significant obesity-related determinant of GH peak, but still lagged behind fasting insulin and glucose.GH peaks were highly variable, ranging from 2\u00b73 to 185 \u00b5g/l (14% with GH peaks < 9 \u00b5g/l). An increasing number of cardiovascular risk factors were associated with a lower mean GH peak (GH response to secretagogues was highly variable in apparently healthy adults aged 50\u201390 years. Peak GH was significantly related to fasting glucose, insulin, BMI, HDL cholesterol, triglycerides, trunk fat and abdominal subregion fat, with fasting glucose ranking first by multiple regression analysis. There was a strong relationship between cardiovascular risk factors and low GH, with individual risk factors being additive. Although these data do not differentiate between low GH being a cause or an effect of these cardiovascular risk factors, they indicate that the relationship between low GH and increased cardiovascular risk may be physiologically important in the absence of pituitary disease. Cardiovascular risk factors such as obesity, insulin resistance and dyslipidaemia cause major morbidity and mortality in the adult population.Over the years, investigators have sought to establish the determinants of GH secretion in normal adults. Many relationships have been consistently demonstrated: lower 24 h GH secretion is associated with advancing age,23While other studies have demonstrated relationships between GH dynamics and various cardiovascular risk factors in normal adults, GH response to secretagogues has not been assessed in a self-selected adult population of active, relatively healthy older individuals, nor has a relationship between GH peak and a clustering of cardiovascular risk factors been demonstrated. To determine normative data on GH response to GHRH-arginine, we studied a group of 86 apparently healthy adult male and female volunteers between the ages of 50 and 90. These responses were later analysed in relation to the presence or absence of cardiovascular risk factors.To assess the variability of GH responses to GH secretagogues, we recruited a group of 86 normal volunteers between the ages of 50 and 90. This was initially done in collaboration with the Aging and Dementia Center at NYU and subsequently through town meetings, local advertisements and word of mouth. Volunteers were excluded from participating if they were nonambulatory, had a history of nonbasal cell malignancy, chronic renal or liver disease, cognitive or psychological dysfunction, were taking antipsychotic medications, or if they had been treated with GH during the 6 months prior to participation. None of the subjects, including those with BMI < 25, had undergone any recent significant weight changes. All subjects were screened for the presence of pituitary dysfunction by hormonal analysis. Subjects with pituitary abnormalities were excluded from the study.The NYU Institutional Board of Research Associates approved the protocol. After informed consent, each participant had a complete history and physical examination, electrocardiogram, fasting screening laboratory analysis, and endocrine function testing.Two weeks after the initial visit, subjects underwent a repeat fasting measurement of IGF-I and GH stimulation testing with the combination of GHRH (1 \u00b5g/kg) and arginine (30 g in 300 ml over 30 min) infused intravenously. Samples were drawn through an indwelling catheter every 30 min from \u221230 min to 120 min, with subjects supine.Cardiovascular risk factors were assessed in each individual and subjects were identified as having or not having abnormalities of five different categories of cardiovascular risk: increased BMI (\u2265 27\u00b75), low HDL [< 1\u00b70 mmol/l (< 40 mg/dl) for males and < 1\u00b73 mmol/l (< 50 mg/dl) for females], elevated triglycerides [\u2265 1\u00b77 mmol/l (\u2265 150 mg/dl) or use of nonstatin lipid therapy], hypertension (history of hypertension or blood pressure \u2265 130/85 mmHg), and insulin resistance [history of type 2 diabetes mellitus or fasting glucose > 6\u00b71 mmol/l (> 110 mg/dl)]. After identifying abnormalities of individual cardiovascular risk, the subjects were divided into two groups: those with two or fewer abnormal cardiovascular risk categories (group A) and those with three or more cardiovascular risk categories (group B).All tests and measurements were carried out on the 86 volunteers except dual energy X-ray absorptiometry (DXA) scans, which were performed on a subset of 45 of the initial 86 volunteers. All subjects available and willing to undergo DXA scanning were included.Screening laboratory tests including complete blood count, hepatic panel, basic metabolic panel, serum cortisol, lipid profile and urinalysis were undertaken by standard techniques at the Bellevue Hospital Center Laboratory. Endocrine function testing, including TSH, free thyroxine, FSH, LH, oestradiol, PRL and total testosterone, was undertaken by Quest Diagnostics  using standard techniques.GH and IGF-I were measured by Quest Diagnostics Nichols Institute  using the Nichols Advantage\u00ae HGH and IGF-I assays. The GH assay is a two-site chemiluminescence immunoassay with a sensitivity of 0\u00b71 \u00b5g/l. The intra-assay coefficients of variation (CVs) were 4\u00b72%, 4\u00b78% and 8% for detected GH levels at 0\u00b78 \u00b5g/l, 2\u00b742 \u00b5g/l and 23\u00b76 \u00b5g/l, respectively. The interassay CVs were 4\u00b71%, 5\u00b78% and 12\u00b71% with corresponding GH levels of 0\u00b792 \u00b5g/l, 2\u00b740 \u00b5g/l and 23\u00b77 \u00b5g/l. Methods for the chemiluminescent assay for IGF-I have been reported previously.The homeostatic model assessment of insulin resistance (HOMA-IR) was calculated using fasting insulin levels (mU/l) and simultaneous fasting serum glucose (mmol/l) using the following equation: HOMA-IR = (fasting insulin \u00d7 fasting glucose)/22\u00b75.36r = 0\u00b7973, P < 0\u00b70001). We analysed the QDR-1000/W results for the whole body as well as for regions of interest, including the trunk, arms and legs. During a separate analysis, a manually defined abdominal subregion was examined by DXA.41Forty-five subjects completed DXA scanning. Whole-body DXA measurements were obtained using the Hologic QDR-1000/W  with standard protocol. The same experienced technician performed all of the scans. Although scans were obtained 2 years after the initial workup, the weights obtained at the time of DXA scanning were highly correlated with those obtained at baseline  were entered into the regression model. Multiple regression analysis using a backward elimination method was applied to the data with P < 0\u00b710 being the criterion for a variable to remain in the model. BMI was used as the preferred method over weight as a measure of obesity in the regression model. A second multiple regression analysis was performed on the subset of 45 subjects who returned for whole-body DXA scan. Methods for this multiple regression model were identical to those described above. Those variables with correlations significant at P < 0\u00b705  were entered into this regression model. The percentage of contribution to the variance in GH peak for each individual parameter was determined by using the square of the Pearson correlation coefficient (R2). Standardized regression coefficients were used to rank the variables that remained in the final regression models. Comparison of means was performed using Student's t-test, unless noted otherwise. One-way analysis of variance (anova) was used to compare mean log GH peak values according to the number of cardiovascular risk parameters within subjects. Analyses were performed using SAS version 9\u00b71 . All analyses involving GH peak were performed on base 10 log transformed GH peak responses to GHRH-arginine secretagogue testing because the log transform yielded nearly gaussian residuals in the regression model. However, for simplicity of presentation, descriptive statistics regarding GH peak are presented in original untransformed units, and have been plotted using a logarithmic scale.The first objective of the statistical analysis was to determine which variables, alone or in combination, were associated with GH peak. Prior to performing a multiple regression analysis, candidate predictor variables were identified by using simple correlation analysis for each predictor variable with the log GH peak. Those variables with correlations significant at Demographic data are presented in 35et al. for normal subjects.43GH peak varied from 2\u00b73 to 185 \u00b5g/l  in five volunteers. All were female and none had elevated IGF-I levels or clinical features suggestive of acromegaly. All were postmenopausal and four of the five were taking hormone replacement therapy. One subject was taking a daily oral conjugated oestrogen\u2013progesterone combination tablet, one a weekly oestradiol patch, one a biweekly combination oestradiol\u2013norethindrone acetate patch, and one was taking oral medroxyprogesterone and using topical oestrogen cream. Mean BMI was 21\u00b72 \u00b1 1\u00b78  and mean height was 155 \u00b1 6\u00b73 cm (range 148\u2013160 cm). We did not consider them GH resistant because nonstimulated GH levels were not elevated .One female subject had a GH peak of 3\u00b75 \u00b5g/l and a confirmed, elevated IGF-I of 351 \u00b5g/l. She was fully evaluated and found to have a normal pituitary magnetic resonance imaging (MRI), normal GH suppression in response to oral glucose and no physical signs or symptoms consistent with acromegaly. No explanation for this disparity between GH results and IGF-I was found. Despite her abnormal results, she met inclusion and exclusion criteria and was therefore included in the analyses.vs. 21\u00b72 \u00b1 14\u00b78 \u00b5g/l, respectively; P < 0\u00b701). This difference was not attributable to BMI, which was not significantly different between men and women. Three female subjects were not postmenopausal and 13 postmenopausal women were taking exogenous oestrogen. When the mean of log GH peak of postmenopausal women not on oestrogen (n = 41) was compared to that of men (n = 29), the difference was still significant (P < 0\u00b7002). For male subjects, there was a significant direct relationship between log GH peak and testosterone levels . For male or female subjects, the correlation between log GH peak and oestrogen levels was not significant.The relationship between GH peak responses to GHRH-arginine and age was not significant. As reported previously,There were significant correlations between log transformed GH peak and BMI, HDL, triglycerides, cholesterol/HDL ratio, fasting glucose, fasting insulin, and HOMA-IR .P < 0\u00b70001; anova of mean log GH peaks according to the number of cardiovascular risk categories  revealed a significant difference between groups. An increasing number of risk factor categories was associated with lower GH peaks  and group B . Nineteen of the 86 subjects (22%) were in group B and 67 of 86 (78%) were in group A. Mean log GH peak was significantly lower in subjects in group B than in those in group A (R2 = 0\u00b75379) of the variation in GH peak , the relationship between BMI and GH peak was maintained in the lower BMI group but not in subjects with BMI \u2265 27\u00b75 . By contn = 18) was lower than for those in group A  (P < 0\u00b7004). There was no statistically significant difference in BMI between subjects in group B vs. group A .In the subgroup of subjects with BMI \u2265 27\u00b75, variability in GH peak was still present. Mean log GH peak for subjects in group B . Total body fat was significantly correlated with both trunk fat  and abdominal subregion fat . Total body fat was not significantly related to GH peak. However, corrected trunk fat  and corrected abdominal subregion fat  were associated with the log of GH peak. In each case, total body fat, trunk and abdominal subregion fat correlated with BMI (P < 0\u00b70001).We measured total, trunk and abdominal subregion fat using whole-body DXA in a subset of 45 of the 86 original subjects. Measurements of abdominal subregion fat are highly correlated with measures of visceral adiposity by CT scan.R2 = 0\u00b769) of the variation in GH peak. Based on the standardized regression coefficients, the relative importance of the predictor variables from highest to lowest was: fasting insulin, fasting glucose, HDL cholesterol and corrected subregion fat. Low GH peak was associated with high fasting insulin levels, high fasting glucose, low HDL and a high ratio of abdominal subregion fat to total body fat.Multiple regression analysis was performed on the subgroup of 45 subjects who had body composition analysis by DXA. Candidate predictor variables were again determined based on the significance of factors related to the GH peak determined by univariate analysis as shown in This paper presents the results of GH responses to GHRH-arginine in a group of 86 normal volunteers between the ages of 50 and 90. The study subjects were self-selected and were included on the basis of age, apparent health, and absence of pituitary disease. Their demographic profile with regard to obesityWe noted a wide variation in the peak GH responses, which ranged from 2\u00b73 to 185 \u00b5g/l. We found that 14% of the sample had GH peaks of 8\u00b72 \u00b5g/l or below and 6% had values that were greater than 2 SD above the mean.r = \u20130\u00b7181, P < 0\u00b7253). The relationship between GH peak and BMI was maintained and strongly correlated in subjects with BMI below 27\u00b75  or total cholesterol, as well as no correlation between GH and measures of blood pressure. It should be noted that these parameters were evaluated in the presence of LDL targeted lipid therapy and hypertension therapy in many subjects, making the interpretation of direct correlations between GH and blood pressure, LDL or total cholesterol less reliable.Although there are many common features between subjects with GHD due to pituitary disease and subjects with a clustering of cardiovascular risk factors in the absence of pituitary disease, it is not clear whether the low GH associated with these cardiovascular risk factors is cause or effect. Low GH in the setting of obesity has been shown to be reversed with weight reduction, implying that it is obesity that causes the low GH.While previous studies have demonstrated a relationship between GH and individual cardiovascular risk factors in otherwise normal adults, our study is the first to show that peak GH is inversely proportional to the number of major cardiovascular risk categories. By studying a cohort of individuals largely representative of middle-class Caucasian New Yorkers, and assessing cardiovascular risk factors as part of the study rather than as inclusion criteria, we were able to examine differences between GH dynamics in those with cardiovascular risk factors compared to those without. The striking correlation of low GH to individual cardiovascular risk factors suggests an important role for GH in the clustering of these risk factors, whether or not the relationship is a causative one. Analogous to the gradual acceptance of a wide variety of what are now considered traditional cardiovascular risk factors, perhaps it is time to consider low GH as an independent marker for cardiovascular disease."}
+{"text": "To understand why treatment referral rates for ESRF are lower in Ireland than in other European countries, an investigation of factors influencing general practitioner referral of patients developing ESRF was conducted.Randomly selected general practitioners (N = 51) were interviewed using 32 standardised written patient scenarios to elicit referral strategies. Main outcome measures: General practitioner referral levels and thresholds for patients developing end-stage renal disease; referral routes (nephrologist vs other physicians); influence of patient age, marital status and co-morbidity on referral.Referral levels varied widely with the full range of cases  referred by different doctors after consideration of first laboratory results. Less than half (44%) of cases were referred to a nephrologist. Patient age (40 vs 70 years), marital status, co-morbidity (none vs rheumatoid arthritis) and general practitioner prior specialist renal training (yes or no) did not influence referral rates. Many patients were not referred to a specialist at creatinine levels of 129 \u03bcmol/l (47% not referred) or 250 \u03bcmol/l (45%). While all patients were referred at higher levels (350 and 480 \u03bcmol/l), referral to a nephrologist decreased in likelihood as scenarios became more complex; 28% at 129 \u03bcmol/l creatinine; 28% at 250 \u03bcmol/l; 18% at 350 \u03bcmol/l and 14% at 480 \u03bcmol/l. Referral levels and routes were not influenced by general practitioner age, sex or practice location. Most general practitioners had little current contact with chronic renal patients .The very divergent management patterns identified highlight the need for guidance to general practitioners on appropriate management of this serious condition. Historically, the provision of renal replacement therapy for end-stage renal disease in Ireland (57.8 new cases per million population in 1994) . MoreoveUnder-referral or late referral has important healthcare management implications. Ultimately, the consequences of late referral of patients includes increased mortality and morbidity , increasThe aim of this study was to examine decision-making strategies of general practitioners regarding referral for renal replacement therapy in order to provide information on clinical, demographic and service-related factors influencing levels and patterns of referral. Since episodes of patients developing renal failure presenting in general practice are relatively rare, standardised case analysis was used as the method of examining what is likely to happen in actual general practice. Provided that realistic cases are constructed, such written simulations are regarded as suitable for measuring clinical judgements and elucidating the decision making process ,17. For General practitioners were randomly selected from an urban and a rural setting. The rural setting was selected to represent typical general practice distances from a major renal centre. Members of the Irish College of General Practitioners were invited by letter and follow-up telephone call to take part in an interview study. Following this, each participating GP was visited by the first author who conducted a structured interview using the standardized case developed by the researchers.A total of 79 general practitioners were randomly identified from area listings. Eight general practitioners were unable to take part as they were on holiday during the research period. A further 6 general practitioners could not be contacted by phone. Of 31 urban general practitioners contacted 25 participated in the study (81% response rate), while 26 of the 27 rural general practitioners participated (96% response rate).a) Case scenarios depicting patients in varying stages of renal failure presenting in general practice. Cases were developed by a general practitioner and nephrologist. They comprised clinical information representing a 'moderate' and 'severe' renal failure profile. Cases were developed as a series of successive general practitioner consultations with laboratory investigation outcomes available where requested. Moderate cases comprised of a patient presenting with symptoms which are associated with relatively low initial creatinine level; 129 \u03bcmol/l increasing to 350 \u03bcmol/l after a second visit. Equivalent levels in the severe scenarios were 250 \u03bcmol/l and 480 \u03bcmol/l. Cases also differed in demographic and co-morbidity criteria \u2013 age of patient (40 vs 70 years), marital status (single vs married) and co-morbidity (inactive rheumatoid arthritis vs no co-morbidity). This design provided 32 case combinations  Questions on general practitioner demographic profile and training and current experience with renal disease.General practitioners (43 men/8 women) averaged 50 years old (s.d. = 9) with a mean practice size of 2.3 (s.d. = 2.3) partners. Practices were located a median of 15 miles (range = 1\u201365) from the nearest dialysis centre. General practitioners reported little current contact with renal patients; 90% of general practitioners had \u2264 1 hemodialysis, 96% had \u2264 1 continuous ambulatory peritoneal dialysis and 79% had \u2264 1 transplant patients in their practice.Figure The majority of patients (99%) were referred to a specialist at some point; 46% were referred after the first set of laboratory test results were available. Most were referred to either a nephrologist or a general physician table .There was no age difference in referral patters with older patients referred as often to a nephrologist as younger patients (chi-square = 0.73), similarly there were no referral rate difference between severe cases and moderate cases (chi-square = 1.30).Referral levels varied widely with the full range of cases  referred by different general practitioners after first laboratory results were available. Referral rates did not differ by general practitioner according to sex, practice size or current experience with renal patients. One-way analysis of variance indicated a significant interaction between general practitioner training experiences and referral rates; (a) general practitioners who had trained on a renal team , (b) general practitioners who had no specific renal experience in training (60%) and (c) general practitioners who, while not training on a renal team, had some hospital experience with renal patients (26%). Scheffe post hoc comparisons indicated no significant differences between GPs with differing experiences.Previous studies have examined reported referral levels to consultants ,9, but hThe practical implications of this study can be best understood with regard to, firstly, referral to any specialist and secondly, referral to a nephrologist. The first key issue is whether GPs referred for further investigation. Study findings indicate under-referral of cases for specialist attention by general practitioners in the light of significant renal impairment. Neither general practitioner nor patient characteristics influenced referral. The lack of influence of patient factors is encouraging given evidence that older age and co-morbidity have been inappropriately associated with lower rates of referral . HoweverThe second point of interest concerns whether GPs referred to a nephrologist. Referral to a nephrologist decreased in likelihood as the scenarios became more complex. The imperative to tackle late referral is underlined by estimates that suggest that 25% to 50% of patients worldwide who commence renal replacement therapy are referred late to a nephrology service . Early rIt is worth noting that active management of renal failure by dialysis is a medical innovation of the latter half of the twentieth century. Many of the GPs studied may not have experienced an active approach to dialysis in training. Low numbers of nephrologists available (10 in 1996 in Ireland) may also have influenced referral strategies.Accepting the limitations of research using 'paper-case' scenarios and reported behaviours, the study did find a pattern of under-referral and/or late-referral for advanced renal failure. This reported practice is consistent with a reported patient referral rate in Ireland. While published guidelines advocate early diagnosis and prompt treatment of renal disease , it is nThe author(s) declare that they have no competing interests.AM contributed to the design of the study, collected the data and drafted the manuscriptHMcG designed the study and contributed to the writing of the studyWS and JD developed the standardized case scenarios, and contributed to the writing of the studyIrish Kidney AssociationThe pre-publication history for this paper can be accessed here:"}
+{"text": "Recombinant human growth hormone (GH) and pioglitazone (PIO) in abdominally obese adults with impaired glucose tolerance were evaluated under the hypothesis that the combination attenuates GH-induced increases in glucose concentrations, reduces visceral adipose tissue (VAT), and improves insulin sensitivity over time.Randomized, double-blind, placebo-controlled, 2 \u00d7 2 factorial design.Veterans Affairs Palo Alto Health Care System, Palo Alto, California, United States.62 abdominally obese adults aged 40\u201375 with impaired glucose tolerance.GH  and pioglitazone  for 40 wk.Baseline and after 40 wk of treatment, VAT content was quantified by CT scan, glucose tolerance was assessed using a 75-g oral glucose tolerance test, and insulin sensitivity was measured using steady-state plasma glucose levels obtained during insulin suppression test.2 in GH group, mean difference from placebo: \u221228.1 cm2 . Insulin resistance declined 52 \u00b1 11.8 mg/dl with PIO, mean difference from placebo of \u221258.8 mg/dl . VAT and SSPG declined with GH and PIO combined, mean differences from placebo of \u221231.4 cm2  and \u221255.3 mg/dl , respectively. Fasting plasma glucose increased transiently in GH group. No significant changes in BMI were observed.Baseline: body mass index (BMI), plasma glucose, and visceral fat content were similar. 40 wk: visceral fat area declined 23.9 \u00b1 7.4 cmAddition of PIO to GH attenuated the short-term diabetogenic effect of GH; the drug combination reduced VAT and insulin resistance over time. GH plus PIO may have added benefit on body composition and insulin sensitivity in the metabolic syndrome. Background: People who are overweight are at higher risk of developing type 2 diabetes, particularly if they have impaired glucose tolerance (IGT). When an individual has IGT, their cells are not able to respond properly to insulin in the blood, which means that blood sugar levels can remain high, and fat cells do not take up fatty acids from blood at the rate they should. The term prediabetes is often used to refer to these linked characteristics. However, if such individuals are able to lose weight they can reduce their chances of becoming diabetic in the future. In particular, loss of a particular type of fat, the visceral fat , is thought to be beneficial for people at risk of developing type 2 diabetes. Some researchers have suggested that giving human growth hormone (GH) to people who are overweight might help reduce their levels of visceral fat. At the same time, drugs known as thiazolidinediones are currently used, in combination with other drugs, diet, and exercise, as a treatment for type 2 diabetes. The researchers carrying out this study wanted to find out whether combining treatment with human GH and a thiazolidinedione, pioglitazone (PIO), would reduce levels of visceral fat and improve glucose metabolism in overweight adults with IGT. The researchers specifically planned to compare the changes in these primary outcomes amongst people receiving both human GH and PIO for 40 weeks with the changes in individuals receiving placebo only; additional comparisons were also done for individuals receiving either drug alone, as compared to placebo.What this trial shows: A total of 76 participants were randomized and received the treatment allocated to them, but only 62 participants were included in the final analyses due to losses to follow-up. The primary outcomes being compared at baseline and after 40 weeks of treatment were the change in visceral fat levels and change in individuals' sensitivity to insulin. Individuals receiving GH experienced a drop in visceral fat area over the 40 weeks of the trial, as compared to placebo, whilst PIO alone did not seem to have an effect on visceral fat area. Individuals receiving both GH and PIO, however, also showed a decrease in visceral fat area. When examining the effect on insulin resistance, GH alone did not seem to have an effect on the ability to respond to insulin. However, administration of PIO alone did bring about a decrease in insulin resistance levels, as compared to placebo, and individuals receiving both GH and PIO together also experienced a drop in insulin resistance. The trial was not designed to detect statistically significant differences in side effects between the groups studied, but some side effects, such as build-up of fluid in the limbs and joint stiffness, seemed to be more common in the groups receiving drug treatment than in the placebo group.Strengths and limitations: Although the trial was small, enough participants were recruited to detect statistically significant changes in the primary outcomes. Strengths of the trial include the use of appropriate techniques to conceal the randomization sequence from investigators recruiting participants into the trial and blinding of both participants and investigators to the treatments that an individual would receive. However, one limitation includes the fact that the likelihood of developing diabetes was not directly measured as an outcome in this trial, and it is therefore not possible to conclude from these results that administration of GH, PIO, or both combined, will help prevent diabetes amongst overweight people with IGT. Finally, this trial compared the drug interventions directly with placebo and not with behavioral interventions such as diet and exercise, which are normally recommended for the prevention of diabetes amongst overweight people. It would be important to further investigate the efficacy, harms, and costs of these drugs directly against nondrug interventions before making any recommendations about their clinical use.Contribution to the evidence: Other studies have shown that PIO administration has beneficial effects on insulin sensitivity in people with type 2 diabetes. This study adds evidence confirming that PIO is likely to have similar effects in people who are not diabetic but who are overweight and who have IGT. The study also adds data regarding the effect of PIO and GH combined in such populations; giving both drugs together seemed to have beneficial effects on visceral fat area and insulin sensitivity, as compared to placebo. Overweight adults with impaired glucose tolerance (IGT) have a 5%\u201310% risk of developing diabetes per year, and insulin resistance in the context of inadequate beta cell compensation is an important cause of progression to diabetes \u20135. AccorRecombinant human growth hormone (GH) is a lipolytic drug that reduces total body, abdominal, and visceral fat in GH-deficient adults \u201313. SeveIn obese type 2 diabetics, insulin-sensitizing drugs known as thiazolidinediones (TZDs) also have been reported to reduce visceral fat and improve insulin sensitivity . The comThe purpose of this study was to determine the effects of GH and the TZD pioglitazone (PIO) alone and in combination on glucose metabolism, visceral adiposity, and insulin sensitivity in abdominally obese adults with IGT. We hypothesized that (1) compared to GH alone, treatment with GH plus PIO would result in better short-term glucose metabolism; and (2) compared to placebo, treatment with GH plus PIO would lead to greater reductions in both VAT and insulin resistance over time.2, and WC > 100 cm for men and > 88 cm for women. As part of the screening visit, a 75-g oral glucose tolerance test (OGTT) was performed following a ten- to 12-h overnight fast. Participants with IGT  were enrolled. Respondents were not eligible to participate if diabetes was known to exist or a screening OGTT revealed either a FPG \u2265 126 mg/dl or 2-h postprandial glucose (PPG) \u2265 200 mg/dl that was repeated and confirmed on separate day. Other exclusion criteria included the following: known history of malignancy or congestive heart failure; recent treatment with weight-reducing medications or corticosteroids in doses exceeding standard replacement; or being of child-bearing potential and either breastfeeding or declining contraception throughout the treatment period. In addition, respondents with a history of acromegaly or clinically significant cardiac, pulmonary, hepatic, or renal disease, serum alanine aminotransferase (ALT) more than three times above the upper normal limit, or uncontrolled hypertension were excluded.A total of 81 overweight adult men and women were enrolled in the study. They were recruited between March 2003 and March 2004 using fliers posted at medical centers and other facilities throughout the San Francisco Bay Area. Specific criteria for inclusion were age between 40 and 75 years, BMI \u2265 27 kg/mhttp://www.tpna.com) or its placebo and recombinant human GH  or its placebo. Enrolled participants were randomly assigned by a third-party investigator to receive one of the following treatment combinations: GH + PIO, GH + PIO placebo, GH placebo + PIO, or GH placebo + PIO placebo , and estrogen repletion status of women were used.The randomization list generated in the office of the third-party investigator was forwarded to an investigational pharmacist, who dispensed medications. All randomization assignments were sequentially numbered and placed in sealed opaque envelopes. Assignment codes were fully concealed until after all recruitment, testing, and data analyses were complete.After being evaluated for eligibility at screening, participants who met criteria for inclusion into the study were assigned a code comprising a number and three letters. The number corresponded to the order of each participant's enrollment into the study. This code was forwarded along with relevant information for stratification to the third-party investigator. The structure of the sequence of randomization was unknown to the researchers involved with the study. Randomization assignment for each participant was forwarded only to the investigational pharmacist, who dispensed all medications.Given the double-blind, placebo-controlled nature of the study, all participants and investigators were blinded to group assignment until after the study was completed and data were analyzed. The manufacturers of recombinant human GH and PIO provided matching placebos that were indistinguishable from the active medications. Medication seals, labels, and containers were utilized in a uniform fashion to preserve the study blind.Sample size was determined using data from Johannsson et al. , in whicThe primary outcome measures were change in visceral fat content and change in insulin sensitivity. At baseline (wk 0) and after 40 wk of total treatment, computed tomography (CT)-scan measurements were performed to quantify visceral fat area. Baseline versus post-treatment insulin sensitivity was assessed using a 3-h insulin suppression test.Secondary outcome measures included assessments of short- and long-term glucose metabolism, BMI, and anthropometric measurements. FPG was measured monthly, and baseline versus post-treatment glucose tolerance was measured using a 3-h OGTT. Glycohemoglobin was measured at baseline and every three months thereafter at the clinical laboratory of the Veterans Affairs Palo Alto Health Care System. Body weight was measured monthly, and measurements of WC and waist-to-hip ratio (WHR) were performed at baseline and again at week 40.Post-treatment OGTT and insulin suppression testing were performed on separate days following a 3- to 4-wk washout of study drugs. A drug washout was used to facilitate a direct assessment of the relationship between change in body composition and change in glucose disposal over time without the potential confound of direct drug effects on these measurements.Lipids were measured using available stored serum samples from baseline and post-treatment visits. This was the only analysis performed that was not prespecified in the protocol. Samples from participants who began treatment with lipid-lowering medications anytime during or shortly before their participation in the study were not assessed for lipid measurements. Triglycerides, HDL cholesterol, and total cholesterol were measured directly, and LDL cholesterol was calculated based on the method described by Friedewald et al. . Measurehttp://www.labcorp.com) was used to measure serum IGF-1. ALT levels were obtained at baseline and every 2 mo thereafter.Participants were followed monthly as outpatients and had a complete physical examination at each visit. Each participant was examined for treatment-related side effects, including peripheral edema or other fluid retention symptoms. Serum insulin-like growth factor 1 (IGF-1) levels were obtained at baseline and every two months after starting injections until the end of the treatment period (week 40). An immunochemiluminometric assay in a reference laboratory . A standard tape measure was used to quantify waist and hip circumferences as well as the WHR ratio. WC was obtained while the participant was supine and with the tape measure placed at the level of the umbilicus. Hip circumference was obtained while the participant was standing and with the tape measure placed at the level of greatest gluteal protrusion observed from the side of the participant.Weight was measured to the nearest 0.1 kg on a standard scale, and height was measured in centimeters using a wall-mounted stadiometer. BMI was calculated as the body weight (kg) divided by the height (mhttp://rsb.info.nih.gov/ij) and are recorded in centimeters squared. A single General Electric LightSpeed Scanner (http://www.ge.com) at the Veterans Affairs Palo Alto Health Care System was used to perform all baseline and week-40 CT scans.A noncontrast CT scan was performed to quantify abdominal subcutaneous and visceral fat area. This imaging technique is among the most reliable for measuring visceral fat . With thhttp://www.analox.com). Specimens were centrifuged immediately, and the on-site analyzer was calibrated daily. The five OGTT glucose measurements were used to calculate the glucose area under the curve (AUC) by the trapezoidal method.After an overnight fast lasting ten to 12 hours, participants arrived at the Clinical Studies Unit and had an FPG measurement. Participants then ingested a 75-g oral glucose beverage and had additional plasma glucose measurements 30 min, 60 min, 120 min, and 180 min after beverage ingestion. All glucose measurements were performed using an on-site glucose analyzer  was used to suppress endogenous secretion of insulin and was infused at 0.27 \u03bcg/m2/min. Insulin was infused at 32 mU/m2/min, and 20% dextrose was infused at 267 mg/m2/min. Plasma glucose was measured every 30 minutes for the first 150 min and then every 10 min during the last half hour of the test. The last four serum glucose measurements were then averaged and constituted the individual's SSPG. The SSPG provides a direct measure of insulin-mediated glucose uptake and can be used to describe each individual's insulin sensitivity [Insulin sensitivity was measured using a three-hour insulin suppression test \u201331. Aftesitivity \u201331.http://www.gbstat.com/macintosh/index1.htm). Data for primary and secondary analyses are expressed as the mean \u00b1 standard error of the mean (SEM). One-way ANOVA was used to compare baseline values of the participant groups. For measurements pertaining to visceral fat, anthropometrics, insulin sensitivity, glucose and lipoprotein metabolism, ANOVAs for repeated measures were used to analyze differences between data obtained at all time points. Pearson's correlation coefficient was used to determine the relationship between change in VAT and change in insulin sensitivity. Results are considered statistically significant at p < 0.05.Using all available data from all participants who had a follow-up measurement of visceral fat area and insulin sensitivity, regardless of adherence to treatment, a modified intention-to-treat analysis was used to evaluate data. The last available postrandomization value obtained prior to a missing measurement was carried forward for the missing data. Data were analyzed using GB-Stat statistical software for Macintosh  . The corresponding percentage declines in visceral fat in the GH and GH + PIO groups were 13.1% and 16.6%, respectively, indicating the lipolytic effect of GH on this adipose tissue depot. In contrast, VAT area did not decline significantly in the PIO group (6.4%).As shown in  = 0.02) . A similp = 0.01) (p = 0.02). The corresponding percentage reductions for SSPG in the PIO and GH + PIO groups were similar: 21.4% in the PIO group and 19.6% in the GH + PIO group. This indicates an important role for PIO in ameliorating insulin resistance. Despite a reduction in visceral fat content, SSPG did not decline significantly following prolonged GH treatment (8.8%).Treatment with PIO improved endogenous insulin sensitivity in abdominally obese, insulin-resistant individuals with IGT, as seen in  = 0.01) . SimilarAt baseline, serum IGF-1 levels were similar between treatment groups . After nThe effects of treatments on body composition are summarized in p < 0.01) (The effects of treatments on short- and long-term glucose concentrations are summarized in  < 0.01) . HoweverAlthough lipid testing was not prespecified in the protocol, measurement of lipids was performed using available stored serum samples. No significant differences in baseline versus post-treatment triglycerides, HDL cholesterol, LDL cholesterol, or total cholesterol were seen between the four treatment groups .r = 0.425, p < 0.001). There were no other significant correlations between SSPG and subcutaneous fat, BMI, anthropometric measurements, or measurements of glucose and lipoprotein metabolism.When participants from all four treatment groups were combined, change in SSPG was most directly related to change in VAT  and IRS-2 proteins ,39, a loWe found that 40 weeks of PIO improved insulin sensitivity in individuals with IGT. As with patients with type 2 diabetes , the insIn vitro and in vivo studies have indicated that activation of peroxisome proliferator-activated receptors gamma with TZDs improves insulin sensitivity by modulating the expression of various genes in the insulin-signaling pathway and increasing the production of glucose transporter proteins \u201347. MiyaOur sample size was likely not large enough or adequately powered to detect significant changes in glucose concentrations during PIO treatment . Similar2) was similar to the reduction that occurred with GH alone (24 \u00b1 7 cm2). Only cotreatment with PIO resulted in improved insulin sensitivity, while GH alone did not. These findings suggest an important role for TZDs in improving insulin sensitivity [In the GH plus PIO group, mean FPG remained stable, and both visceral fat and insulin resistance declined over time. PIO attenuated the diabetogenic effect of GH shortly after GH injections began and before any change in body composition would have been expected. Further, the reduction in visceral fat area that occurred after 40 weeks of GH plus PIO treatment  was not combined with lifestyle modification. Randomized controlled trials performed in a community setting were identified. Our search (up to 1 February 2007) revealed eight publications that involved four GH-treated cohorts and three TZD-treated cohorts.In the GH trials ,43,52,53In the TZD trials \u201356, treaIn the current study, combined treatment with GH and PIO resulted in estimated effect sizes for \u0394VAT and \u0394SSPG that were similar to GH and PIO, respectively. We considered whether the effect sizes seen in this trial might be an artifact of multiple testing for statistical significance, but this was not thought to be important because (1) sample size and power calculations were determined to see true differences in primary outcome measures; and (2) the reduction in visceral fat seen with GH (13.1%) and the decline in insulin resistance with PIO (21.4%) are comparable with the results of others and have been consistently well-documented in various studies , 52\u201356. Moderate weight loss (2.3\u20134.5 kg) induced by diet and/or exercise has been associated with reductions in insulin resistance and VAT of as much as 15%\u201320% or more, similar to that seen with GH + PIO in the present study . VAT redGiven the rising costs and growing burden of diabetes on the health-care system , strategCONSORT Checklist(49 KB DOC)Click here for additional data file.Trial Protocol(287 KB DOC)Click here for additional data file."}
+{"text": "A 52-year-old female presented to an otolaryngologist with a hoarse voice. An endocrine opinion was sought to exclude an underlying endocrinopathy. She had been investigated three years previously by a neurologist for right-sided facial pain. A magnetic resonance imaging (MRI) scan had shown a small \u201ccyst\u201d in the pituitary gland. She had been reassured that this was a coincidental finding. The patient did not volunteer any specific symptoms and had no complaints other than a hoarse voice. Her appearance is shown in The above scenario is increasingly common as a result of the advent of powerful imaging techniques such as MRI and computerised tomography scanning, which identify \u201ccoincidental\u201d pituitary abnormalities in a significant minority of the adult population. Nonetheless, when such lesions are identified they warrant further characterisation.Is there evidence of over secretion of pituitary hormone(s)?Is there evidence of deficiency of pituitary hormones?Is there evidence of pressure on structures surrounding the pituitary fossa?The clinician confronted with such a case should ask the following questions:The commonest cause of excess pituitary hormone secretion is a prolactinoma. It usually presents with galactorrhoea, oligo- or amenorrhoea, and hirsutism in premenopausal women and with hypogonadism in men. Cushing disease and acromegaly are less common and gonadotrophin-secreting adenomas and thyrotrophinomas are rare. Mild hyperprolactinaemia is commonly found in association with large pituitary tumours and is usually due to distortion of the pituitary stalk. This \u201cdisconnection\u201d syndrome must be distinguished from a true prolactin-producing adenoma, as the treatment of the latter (with dopamine agonist drugs) is radically different from that of other types of pituitary adenomas.Hypopituitarism can present with features of hypogonadism , hypothyroidism, and hypoadrenalism. The latter, in addition to symptoms of hypocortisolism  may also be associated with loss of ability to tan and generalised hypopigmentation.Expansion of a pituitary mass superiorly can compress the optic chiasm, thus giving rise to bitemporal hemianopia. Lateral extension can compress cranial nerve III, IV, or VI. Occasionally pituitary tumours can bleed or infarct to cause pituitary apoplexy . Investigations include pituitary function tests, formal visual field assessment, and in some cases further more detailed imaging.Despite the absence of spontaneous symptoms, the patient admitted to increasing hand and shoe size when specifically asked, associated with a hoarse voice of three years duration. She had also suffered from frontal headaches as well as tingling of the right index finger. Previously, she had surgery for temporomandibular joint dysfunction.On closer inspection, there was a suggestion of some broadening of the nose and prominence of the lips, rather large hands, and increased skin thickness . Visual The sensory disturbance in the distribution of the median nerve is typical of right carpal tunnel syndrome (CTS). CTS typically presents as pain in the medial three fingers radiating into the arm, worsening during the night.Thickening of tendons or synovitis in the carpal tunnel area causes CTS. The history, in this patient, is typical of CTS and is characterised by pain, tingling, and numbness in the median nerve distribution. This patient does not have hypothyroidism  or diabetes mellitus , was not pregnant or obese, and did not have a history or clinical manifestations of rheumatoid arthritis. The cause could be idiopathic, but the other features in the history and examination point towards endocrinopathy as being the underlying aetiology. The diagnosis of CTS can be confirmed by an electromyogram.Hypertension associated with problems with glucose metabolism is a common feature usually seen in people with the metabolic syndrome. Less commonly, it can be seen in endocrine diseases like Cushing syndrome and acromegaly. The reason for hypertension and hyperglycaemia in Cushing syndrome is due to the excess glucocorticoid levels whereas in acromegaly, it is due partly to the direct action of excess growth hormone (GH) on sodium retention and increased insulin resistance, respectively .The symptoms of increasing soft tissue size, CTS, hypertension, hyperglycaemia, and temporomandibular joint dysfunction make acromegaly a possible diagnosis . The durSymptoms due to direct effect of the tumourHeadacheVisual impairmentHypopituitarismHyperprolactinaemiaSymptoms due to GH excessSoft tissue enlargementHeadacheIncreased skin tagsIncreased sweatingAcanthosis nigricansCardiovascular featuresHypertensionBiventricular hypertrophyDiastolic dysfunction at rest and systolic dysfunction on effortEndothelial dysfunctionMetabolic and other endocrine featuresImpaired fasting glycaemiaImpaired glucose toleranceType 2 diabetes mellitusInsulin resistanceDyslipidaemiaMultinodular goitreHypercalciuriaHyperparathyroidismMusculoskeletal featuresJoint stiffnessArthropathy and osteoarthritisCarpal tunnel syndromeOsteopeniaRespiratory diseaseUpper airway obstruction and snoringMacroglossiaObstructive sleep apnoeaThickened vocal chords and hoarse voiceNeoplastic diseaseColorectal polyps and cancerProbable breast, prostate, and thyroid cancerBaseline GH levels are of limited value in diagnosing acromegaly since GH is normally secreted episodically, and high levels can also be seen in pregnancy, puberty, in response to pain, stress, malnutrition, and after a prolonged fast. The diagnosis can be confirmed by measuring GH levels in response to an oral glucose tolerance test (OGTT) . Insulin-like growth factor 1 (IGF 1) is a protein modulated by GH and produced in many body tissues, primarily in the liver. Serum levels of IGF 1 are fairly stable throughout the day and correlate closely with mean GH serum concentration.Fast the patient from midnight.Insert venous cannula prior to basal sample.Administer oral 75 grams glucose at time 0  and collect blood samples for GH and glucose at 30-minute intervals up to 120 minutes.Measure IGF 1 level with basal sample.Further investigation and management of patients with suspected pituitary disease should be undertaken in specialised endocrine centres, to which such patients should be referred.The patient's random GH level was 55 mu/l (0\u201320) along with an elevated IGF 1 level of 78 nmol/l . She then proceeded on to an OGTT with glucose and GH level measurements; the results are outlined in The OGTT confirms failure of GH to suppress to levels below 2 mu/l (<1 mcg/l) as well as impaired fasting glycaemia and impaired glucose tolerance. Other tests of anterior pituitary function  as well as dynamic testing of adrenal reserve in response to synthetic ACTH (short synacthen test) were normal. MRI studies of the pituitary gland revealed a pituitary micro-adenoma .This patient's case highlights the dilemma clinicians are facing today as a result of the increasing use, availability, and precision of imaging techniques. She had a MRI scan previously that detected a pituitary tumour. Pituitary tumours that are detected coincidentally  are not uncommon with reports of prevalence of up to 10% in adults. Given the limitations of diagnostic testing, biochemical screening requires sufficiently high pre-test probability to make it effective. Apart from the cost factor, an imaging-first principle in any field in medicine that relies on biochemical proof of disease leads to a cascade of tests and pursuit of false-positive results. Therefore, appropriate clinical evaluation should precede biochemical investigations, which then may need to be confirmed by imaging techniques .The pathologic effects of increased GH levels are progressive and are associated with increased morbidity and mortality. People with acromegaly have a 2- to 4-fold increase in mortality rate, mostly due to cardiovascular disease . ApproprThe underlying treatment strategy of acromegaly is to remove the pituitary tumour , normalise GH and IGF 1 levels whilst preserving normal residual pituitary function, and relieve symptoms. Medical, surgical, and radiotherapeutic means or, more commonly, some combination of the three can be used to try and achieve this. Currently five different modalities of treatment are available, although surgery remains the treatment of choice. In this patient, it was decided that it would be prudent to try and regress some of the soft tissue changes of acromegaly to minimise the risks of intubation during anaesthesia . This was achieved by a somatostatin receptor analogue therapy, given every month. This reduced GH levels to 35 mu/l and IGF 1 levels to 56 nmol/l.After four monthly injections of long-acting somatostatin receptor analogue therapy, the patient went on to have an endoscopic pituitary adenomectomy. Histology of the resected adenoma revealed a GH cell pituitary adenoma.The currently accepted criteria for cure of acromegaly is a random or mean GH level of <5 mu/l or a nadir GH level of less than 2 mu/l during an OGTT and a serum IGF 1 level within the age-adjusted normal range . The patShe was then started on somatostatin analogue therapy to achieve better GH level control. This reduced mean GH levels to 2.9 mu/l and normalised IGF 1 levels to 32 nmol/l. After discussion with the patient, it was decided not to proceed with radiotherapy since the acromegaly was well controlled with medical therapy and due to the high probability of hypopituitarism associated with radiotherapy. She remains asymptomatic and is under regular endocrine follow-up.Acromegaly is a rare condition with prevalence rates of 60 per million population. The condition can cause significant morbidity and mortality but may present with vague features; therefore a high index of clinical suspicion is warranted. The average delay in diagnosis after onset of the disease is about eight years. It can cause hypertension and disorders of glucose metabolism, which are increasing in prevalence, as well as soft tissue enlargement, which may take years to be noticed. The increasing use of imaging techniques has invented a new disorder\u2014the incidentaloma. When incidentalomas are found in the pituitary, a thorough history and examination is required with relevant biochemical tests. The biochemical diagnostic criteria for acromegaly have changed over the past decade, bringing the GH diagnostic threshold to lower levels. The advent of better and more sensitive GH assays and better imaging have helped to diagnose more subtle forms of the disease, which would not have been picked up earlier, and may therefore hopefully reduce morbidity and mortality. Furthermore, newer treatment options, whilst expanding the therapeutic armour, also pose a challenge to the treating endocrinologist in deciding what best suits the patient.Acromegaly is a rare but easily diagnosed condition that can cause significant morbidity and mortality.Increasing use of imaging has led to an increase of incidental findings\u2014the \u201cincidentaloma\u201d.Symptoms of acromegaly may persist for many years before the diagnosis is made.Newer modalities of GH assays and treatment have led to earlier diagnosis and may reduce symptoms and mortality."}
+{"text": "Objective: To audit the referral patterns of burns in an emergency department compared with national referral guidelines. Methods: A retrospective case note audit of patients attending an emergency department with a diagnosis of \u201cburn\u201d in a 1-year period. Results: Only one quarter of the patients were managed according to the suggested national referral criteria for burns. Large and full thickness burns were managed appropriately but those at important anatomical sites and in patients at the extremes of age were managed less well. Conclusion: Increased awareness of the national referral guidelines, along with further education of staff within this department, may improve management of burn injuries. It is likely that referral patterns are similar in other emergency departments and may be improved by training staff in the assessment and management of burns. Increased adherence to the guidelines is likely to improve patient outcome at the expense of increased patient numbers and workloads in regional burns units that have implications for funding and service provision. Burns are potentially devastating injuries that can have long-term physical, psychological, and economic consequences. Mortality rates from major burns are improving and increasingly efforts are focused on improving outcome from relatively minor burns.It has been traditional to refer burn injuries on the basis of total burn size area (TBSA) alone. It is now recognized that this is overly simplistic and that burns should be referred to a specialist burns service on the basis of injury complexity that may itself be suggested by several factors including patient age, anatomical location, and coexisting medical conditions. Because of the serious but potentially preventable long-tem sequelae that can result from even minor burns, it is important to recognize those injuries that require specialist input and refer these patients to the appropriate unit.The British Burns Association (BBA) by way of the National Burn Care Review has proposed guidance on recognizing a potentially complex burn injury that may require assessment and management at a specialist burns unit.There have also been similar guidelines recently published by a European working party for the management of partial thickness burns in a general hospital setting.This study aimed to audit referral patterns of patients with minor burns in a British emergency department (ED) to see how closely the guidelines were being followed and whether there are particular groups of patients who are being either over- or underreferred to burns units.We carried out a retrospective case note audit of all patients presenting to a single ED with a triage diagnosis of \u201cburn.\u201d The University Hospital Birmingham ED has 79,000 new attendances each year and the hospital is also the site of the West Midlands Regional Burns Unit. Tertiary referrals to the burns unit from other hospitals were excluded as these were felt to reflect a different clinical population.The ED case notes were reviewed to gather data including details of the burn injury, examination findings, whether referral to another specialty was made, and outcome of the patient after leaving the department. This information was then compared with the referral guidelines produced by the BBA Fig , allowinFor each patient the information available was used to determine whether the burn was complex in nature, whether a referral to the burns unit for advice or admission was warranted, and whether such a referral was made.In many cases there was insufficient information in the case notes to decide whether a decision was appropriate or not. For example, if there was no TBSA or anatomical site recorded in the case notes then it was not possible to decide whether this could be classified as a complex burn that required referral. Conversely if there was any one of the referral criteria then it was deemed that a referral should have been made, even in the absence of other details.The BBA guidance recognizes the fact that not all the referral criteria are absolute and some may be open to interpretation in the absence of other risk factors for a complex injury. For example, it states that some small injuries to the face or hands could be managed locally providing the patient is followed up in an ED clinic or similar. For the purposes of this study all patients who met any of the referral criteria were deemed to require a referral.The regional burns unit is located on the same site as the ED in this study. Any patient referred to the burns service is seen in the ED by a member of the burns team who then decides on further management including whether admission of the patient is required or not. For the purposes of this study, any patient who was discussed with, or seen by, a member of the burns team before they left the ED was considered to have been referred.Each patient was allocated into one of the following groups: \u201cAppropriately referred\u201d if they met referral criteria and were referred to the burns unit for either advice, outpatient follow-up or admission; \u201cAppropriately not referred\u201d if they had a noncomplex burn and were either discharged or followed up in the ED clinic; \u201cUnderreferred\u201d if they met referral criteria but were not referred to the burns unit; \u201cOverreferred\u201d if they were referred to the burns unit despite not meeting the criteria for a complex burn injury; or \u201cNot known\u201d if there was insufficient information in the case notes to decide whether the management was appropriate or not.A total of 785 patients presented to the ED with a triage diagnosis of \u201cburn\u201d within the 1-year study period. Tertiary referrals from other hospitals were excluded, as were those patients whose notes were missing or did not include information about their outcome from the department, leaving 561 patients in this study. Details of the epidemiology of these patients have been presented previously.3Overall, 142 patients (25%) were deemed to have had appropriate management according to the information available. This included 131 patients who required referral and were correctly referred, and further 11 who had noncomplex burn injuries and were correctly managed by the ED or general practitioner. A total of 247 patients were felt to have been underreferred in that they met referral criteria but were not referred to the burns service for an opinion, assessment, or admission. Of these patients, 107 patients were referred to other specialties or followed up in the ED clinic whereas the remaining 140 patients were discharged to the care of their general practitioner. Seventeen patients were overreferred to the burns unit despite not meeting referral criteria and the remaining 155 patients had insufficient information in the case notes. These results are summarized in Figure Of the 561 patients, 378 (67%) met at least 1 criterion for referral to the burns unit. However, of these 378, only 131 (35%) were actually referred. This means that of this sample there were potentially a further 247 patients who warranted referral to the burns unit if the referral criteria are being followed absolutely. In addition, it is likely that there were more patients who would have met the referral criteria if they had adequate information documented in the case notes. Therefore, even allowing for some flexibility in interpretation of the referral guidelines, it is clear that there are a significant number of patients presenting to this ED who may warrant referral because of complex burn injuries and are not currently being referred. The BBA guidelines highlight the need to discuss any case where there is doubt about the need for referral with the burns unit at the time of presentation.Each referral criterion was studied individually to see whether there were particular groups of patients who were being managed inappropriately because of lack of familiarity with the guidelines. This sample of patients contained only a small number (7) of patients who required referral on the basis of TBSA alone but all these patients were correctly referred. Almost all (92%) of patients with full-thickness burns were also correctly referred, even in cases of small or mixed depth burns. However, other criteria were less well adhered to, including only 44% of children younger than 5 being referred and 31% of patients with burns to the hand. Figure Some patients met more than one of the referral criteria, for example a 2-year-old child with a hand burn. The number of referral criteria for each patient ranged from 0 to 4. Of the 247 patients who were underreferred, 189 (77%) met one referral criterion, 52 (21%) of them met 2 referral criteria, and 6 patients (2%) met 3 separate referral criteria and were not referred. It is likely that many of these patients who are not referred to the burns unit are being managed entirely appropriately by the experienced clinical staff in the ED. However, while there is room for some flexibility of the referral guidelines, it is more likely that any patient who meets 2 or 3 different referral criteria should be referred to the burns unit for specialist management and a failure to do this highlights a lack of familiarity with referral guidelines by the ED staff.Burn injuries are relatively common and account for 175,000 ED attendances in the United Kingdom each yearBurns can have many long-term sequelae including hypertrophic scarring, impaired function, and psychological distress. There is increasing recognition that these problems can be seen even after small burns\u2014the so-called \u201csmall burn, big problem\u201d patient.4,It has been shown that patients with small burns of less than 1% TBSA can suffer clinically significant levels of psychological morbidity several months after the initial injury.6,9It has been highlighted in several previous papers that assessment of burns by nonspecialists is difficult and can be inaccurate.3Because of the potentially significant and long-term impact of burns, it is very important that all burn injuries are assessed, recognized, and referred correctly by the ED staff that are treating them. This may include nurse practitioners with extended roles as well as medical staff. Bezuhly and colleagues discuss the management of minor burns in EDs and call for stronger educational and clinical ties to be established between EDs and burns units.10A British Regional Burns Centre has previously reported a change in the pattern of adult burn referrals over the last 20 years. The Pinderfields Burns Centre has found that over the last 2 decades they have noted a significant increase in the number of patients admitted but found that there has been a decrease in the size and depth of burns as well as a decrease in the length of inpatient stay and mortality rate. The authors of this article feel that the increase in numbers is due to referring units strictly following the BBA referral guidelines, rather than an actual increase in the number of burn injuries in the region.11In this study, any patient who met a single referral criterion and was not referred was considered to have been inappropriately managed in terms of referral outcome. It is likely that the majority of these patients had their burn injuries well managed with no long-term complications as the referral guidelines simply act to highlight those patients who are at risk of having a complex injury rather than those who will necessarily require specialist input. It is also likely that within the group of patients with insufficient information in their medical records, the majority will have been treated well and appropriately. Although the results of this study may seem to exaggerate the problem, the aim was to highlight current referral patterns along with implications for education, funding, and burns service organization.We feel that the referral patterns demonstrated in this study are likely to be similar across the country. The ED in this study has the regional burns unit on site and it is, therefore, very simple for a member of the burns team to assess the patient in the department prior to their discharge and make a decision regarding their further management. It may be that the proportion of patients referred from other institutions without burns units are even lower because of the increased difficulty in transferring patients to another hospital for assessment. Medical staff in this department work entirely independently of the burns unit staff and are likely to have similar knowledge of burns as staff in other departments within the region or nationally.This highlights the impact that adherence to these referral criteria could have on burns services in this country. It is likely that units will continue to see greater numbers of smaller, but potentially complex, burns. These are associated with shorter inpatient stays but also with increased number of outpatient attendances and clinic sessions. An increase in the number of patients referred with hand burns may require an increase in the number of dedicated hand therapists to optimize patient outcome. The result is likely to have more burns units dealing with larger numbers of small burns, many as outpatients, with fewer units dealing with larger and more complex burns. This coincides with the recommendations of the National Burns Care Review to restructure burn care services in the United Kingdom in line with differing levels of injury complexity.This study has found that overall only one quarter of the patients presenting to this ED are referred appropriately according to information recorded in the medical records and the referral guidelines produced by the BBA. This may be partly due to lack of familiarity with the guidelines, as well as the ability to manage some minor burns in the department with the knowledge that the regional burns unit is on site in case of later complications. Full-thickness and larger burns are consistently referred appropriately but burns of important anatomical sites and those in patients at the extremes of age are not always managed correctly and this can have long-term consequences for the patient who is potentially preventable.The findings from this study are likely to be reflected nationally. We highlight the need for accurate assessment of minor burns, along with increased awareness of burns referral criteria, education of ED staff, and closer links between the burns unit and ED to obtain the best possible outcome for these patients.Increased adherence to the national referral guidelines for burn injuries is likely to improve patient outcome at the expense of increased patient numbers and workloads in regional burns units that have implications for funding and service provision nationally."}
+{"text": "The growth hormone (GH)/insulin-like growth factor 1 (IGF-1) axis regulates cardiac growth, stimulates myocardial contractility and influences the vascular system. The GH/IGF-1 axis controls intrinsic cardiac contractility by enhancing the intracellular calcium availability and regulating expression of contractile proteins; stimulates cardiac growth, by increasing protein synthesis; modifies systemic vascular resistance, by activating the nitric oxide system and regulating non-endothelial-dependent actions. The relationship between the GH/IGF-1 axis and the cardiovascular system has been extensively demonstrated in numerous experimental studies and confirmed by the cardiac derangements secondary to both GH excess and deficiency. Several years ago, a clinical non-blinded study showed, in seven patients with idiopathic dilated cardiomyopathy and chronic heart failure (CHF), a significant improvement in cardiac function and structure after three months of treatment with recombinant GH plus standard therapy for heart failure. More recent studies, including a small double-blind placebo-controlled study on GH effects on exercise tolerance and cardiopulmonary performance, have shown that GH benefits patients with CHF secondary to both ischemic and idiopathic dilated cardiomyopathy. However, conflicting results emerge from other placebo-controlled trials. These discordant findings may be explained by the degree of CHF-associated GH resistance. In conclusion, we believe that more clinical and experimental studies are necessary to exactly understand the mechanisms that determine the variable sensitivity to GH and its positive effects in the failing heart. Growth hormone (GH), a 191 amino acid single-chain peptide, is synthesized and secreted by the somatotroph cells of the anterior pituitary gland . Its sec2 agonists, hypoglycemia and daily life stresses, and inhibited by \u03b2 and \u03b11 agonists, glucocorticoids and aging [GH secretion is pulsatile, and is regulated by a number of neurologic, metabolic and hormonal influences: during most of the day, the plasma GH level of adults is 5 ng/ml, with one or two sharp spikes three to four hours after meals. The lowest circulating level is early in the morning and highest about one hour after the onset of deep sleep -14. Secrnd aging , 14-17.2+) trafficking, regulating expression of contractile and cytoskeletal proteins and modifying activation of intrinsic neurohormonal networks [The biological effects of GH are mediated by the interaction with a specific receptor (GHR), a single chain trans-membrane protein, expressed in almost all cellular types  , 18,  19networks .GH exerts its effects either directly or indirectly , 21, 22.IGF-1, a 70 amino acid single chain protein, structurally homologous to pro-insulin, is synthesized in liver and kidney, although the local production in other tissues appears to be important in mediating, by paracrine or autocrine mechanisms, GH anabolic and growth-promoting effects -33. IGF-The diminished age-related amplitude of GH pulses and the increased resistance to GH action contribute to reduce IGF-1 plasma concentration. The mechanisms underlying these age-related modifications include peripheral influences , changes in hypotalamic neuropeptides and neurotransmitters, and increase in somatostatin secrection. . AlthougGH alters body\u2019s homeostasis and its effects can generally be described as anabolic. GH directly stimulates chondrocyte division and multiplication; it increases calcium retention, thereby strengthening bone mineralization ; promote1).Besides growth promoting and metabolic effects, the GH/IGF-1 axis regulates cardiac growth, stimulates myocardial contractility and influences the vascular system  -77. MoreThe GH/IGF-1 axis can also control intrinsic cardiac contractility through different mechanisms: by enhancing myofilament calcium sensitivity , 82, 83,While IGF-1 positively affects cardiac contractility, GH physiological role, although GHRs are expressed on the heart, probably does not include acute modulation of myocardial contractility, but it needs to mediate some other functions such as protein synthesis or local IGF-1 production , 88.Moreover, GH induces myosin phenoconversion toward the low ATPase activity V3 isoform. The prevalence of V3 isoform increases the number of actin-myosin cross-bridges and their attachment time, enhances protein calcium sensitivity and calcium availability and allows the myocardium to function at lower energy cost , 77. V3 Although GH reduces energy output, it favours the conversion of metabolic energy to external work and enhances the intrinsic ability of the myofilament to develop force, resulting in an improvement of LV performance . In concThe relationship between the GH/IGF-1 axis and the cardiovascular system has been extensively demonstrated in numerous experimental studies and confirmed by the derangements of cardiac structure and function reported in patients with both GH excess  and GH deficiency (GHD).Acromegaly is a clinical condition consequent to chronic GH excess that affects the heart. Acromegalic cardiac involvement was first described by Huchard in 1895 . SubsequAcromegalic cardiomyopathy can be divided into three main stages , 89. TheThe most relevant histological abnormalities are interstitial fibrosis, reduced capillary density, increased extracellular collagen deposition, myofibrillar derangement, lymphomononuclear infiltration and myocyte death due to necrosis and apoptosis , 116.GH excess seems to exert different and potentially opposite effects on the heart: it enhances cardiac performance in early-stage acromegaly, whereas it causes cardiac dysfunction in the intermediate-late phase. This apparent discrepancy is easily clarified: a physiological GH level or short-term excess exert positive inotropic effect, whereas by causing morphological and functional adaptive changes, long-term exposure to GH excess induces cardiac dysfunction and progression to heart failure , 118.GH/IGF-1 may cause acromegalic morphological and functional changes either directly by affecting myocyte growth and contractility, or indirectly by affecting peripheral vascular resistance, modifying extracellular volume and neurohormonal activity. Subsequently, with the increase of arterial stiffness due to hypertrophy and fibrosis of the arterial muscular tunica, about 20-50% of acromegalic patients become hypertensive . ExperimThere is compelling evidence that IGF-1 is involved in the intricate cascade of events leading to cardiac hypertrophy. In fact, in response to pressure or volume overload, IGF-1 expression increases in parallel to hypertrophy , 132. MoGrowth hormone deficiency produces different clinical features depending on the time of onset and disease severity and duration , 147. GHChildhood-onset GHD is characterized by cardiac atrophy with a significant reduction in LV mass, relative wall thickness and cavity dimensions, compared with age-, sex- and height-matched controls -162. MorEvidence that cardiac alterations in GHD are strictly related to the GH deficiency comes from many GH replacement trials, which taken together show an increase in LV mass and improvement in cardiac performance, diastolic filling and systolic function after GH treatment , 169-172The beneficial cardiovascular effects of GH replacement are related not only to cardiac anabolic actions but also to its peripheral effects. Treatment with GH normalizes NO production, thereby reducing peripheral vascular resistance and modulating cardiac cytoskeletal functions by altering calcium myofilament responsiveness , 157. Moprimum movens of the vicious cycle responsible for pathologic remodelling.The rationale for GH therapy in CHF appears evident when considering the cardiovascular effects of GH and the cardiac morphological and functional features in heart failure. Patients with CHF have reduced myocardial contractility, decreased cardiac output, dilated LV cavity, increased peripheral vascular resistance and enhanced wall stress. Cardiac dilatation, which initially helps to maintain an adequate stroke volume, initiates a vicious cycle whereby dilatation leads to dilatation. GH replacement may be beneficial in all steps of heart failure. By stimulating cardiac growth, GH induces a concentric pattern of remodelling, which reduces wall stress. By decreasing peripheral vascular resistance, GH reduces afterload, attenuates pathologic cardiac remodelling and improves cardiac function. Furthermore, by inducing positive inotropic effects, GH directly counteracts the impaired contractility, which is the +/K+ ATPase activity.The pathogenesis and the progression of CHF seem to be related also to an imbalance between pro-inflammatory/anti-inflammatory factors and endothelial dysfunction. Patients with CHF have excessive plasma levels of pro-inflammatory cytokines and impaired vascular reactivity, which consists of attenuated vasodilatation in response to acetylcholine and preserved response to the direct NO donor nitroprusside. By shifting the cytokine balance toward anti-inflammatory predominance and reducing pro-apoptotic factors, GH positively acts on LV remodelling, increasing LV contractile performance and enhancing exercise capacity. In addition, GH is able to improve vascular reactivity, not only by restoring NO production, but also activating non-endothelium-mediated actions, in particular by modifying intracellular calcium concentration and regulating NaThe first study of the effects of the GH/IGF-1 system in experimental heart failure models dates back to 1992. At that time, Castagnino and colleagues evaluated the effect of GH on the connective tissue, fibroblast growth and proliferation in rats with experimental myocardial infarction, and found a significant decrease in the incidence of ventricular aneurysms . A subsein vivo, IGF-1 mediates the GH-induced cardiac hypertrophy [Cittadini and co-workers administered GH or IGF-1 or GH plus IGF-1 to adult HF rats and found a significant increase in cardiac performance and LV mass, without development of significant fibrosis, and no additional hypertrophy in rats receiving GH plus IGF-1 compared with rats treated singularly with GH or IGF-1 alone. This interesting result suggested that, ertrophy . Subsequertrophy -191.per se does not induce fibrosis, it leaves myocardial defects that are filled with interstitial fluid from myocardial edema, subsequently leading to fibrous tissue accumulation [More recently, Cittadini and colleagues demonstrated, in a rat model of post-infarction heart failure, that GH improves a broad spectrum of structural abnormalities of the extra-cellular matrix . Specifimulation . GH and mulation , 192-195mulation . They almulation . This remulation , 88. In mulation . In contmulation . All themulation , 194.+-H+ and reversed Na+-Ca2+ exchanges [Von Lewinski and colleagues were the first to study the functional effects of IGF-1 in isolated human myocardium. They demonstrated that IGF-1: 1) exerts a concentration-dependent positive inotropic effect, which is almost completely prevented by blocking its receptors or phosphoinositide 3-kinase (PI3-kinase); 2) increases L-type calcium currents; 3) activates Naxchanges . The benxchanges , 197. Alxchanges , 199. Thxchanges -202.1). The first results were limited to case reports showing that GH administration considerably improved cardiac function [Several research groups have studied the effects of GH and IGF-1 in patients with impaired cardiac function  and interleukin- 6 (IL-6), their soluble receptors, as well as apoptosis mediators, such as soluble Fas (sFas) and soluble Fas ligand (sFasL) , 216. Th2).In an attempt to gain further insight into the mechanisms by which GH may benefit CHF patients, Fazio and co-workers have recently carried out a double-blind, placebo-controlled study of the effects of GH on physical exercise capacity and cardiopulmonary performance in twenty-two patients with moderate heart failure . PatientMoreover, at transthoracic echocardiography, the GH group had an increase in LV mass index, relative wall thickness and cardiac performance. The LV ejection fraction and early-to-late mitral peak velocity ratio were significantly.The conflicting results of the clinical trials of GH treatment analyzed in this review may be related to the small number of patients enrolled, the different dose and duration of GH treatment, the different CHF etiologies, and differences in the patients' demographic, hemodymamic and clinical characteristics. This discrepancy may also reflect the heterogeneity of IGF-1 increase in response to GH. In fact, a recent meta-analysis, which analyzed all randomized controlled trials and open studies on sustained GH treatment in adults with CHF in the absence of GHD, contained in the Medline, Biosis and EMBASE databases from their inception to June 2005, confirms that there is a close relationship between change in IGF-1 concentration and GH effects . When thAlthough experimental models and preliminary human studies have demonstrated that GH administration may have beneficial cardiovascular effects in CHF, more experimental and clinical studies are necessary to clarify the mechanisms that determine the variable sensitivity to GH and its positive effects in the failing heart."}
+{"text": "Despite many medical advances, burns continue to remain a challenging problem due to the lack of infrastructure and trained professionals as well as the increased cost of treatment, all of which have an impact on the outcome. There is very little information on the pattern of outcomes among burn patients in relation to clinical aspects in India. Hence, the present study was undertaken in a burns unit to determine selected epidemiological variables, assess the clinical aspects  and first aid measures adopted and finally to analyse the outcomes in cases of burn injuries. In addition, we have sought to suggest measures to remove myths about pre-hospital burn treatment and provide recommendations to healthcare professionals. Despite many medical advances, burns continue to remain a challenging problem due to the lack of infrastructure and trained professionals as well as the increased cost of treatment, all of which have an impact on the outcome. Previous epidemiological studies from different parts of India\u20136 have rAfter obtaining Institutional Ethics Committee approval, a prospective study was carried out over a 100 day period to analyse 150 consecutive burn cases admitted to a specialist 30 bedded burns unit of a large Government Teaching hospital in South India with a total of 2200 beds. The socio-demographic, clinical and in-hospital outcomes of these burn cases along with details of treatment adopted prior to hospitalization were collected by the principal author and confirmed by the second author. The patient data was recorded for age and gender, extent of burn, etiology, method of extinguishing the flame and first aid received and finally clinical outcome in hospital. The data were entered in a Microsoft\u00ae Excel spreadsheet and analyzed using Chi Square Test.Age and gender: A total of 150 burn patients were treated during 100 days. There were 62 males (41.3%) and 88 females (58.7%). Their ages ranged from three to 59 years in males and four to 75 years in females. The mean (\u00b1SD) was 31.58 (\u00b111.64) for males and 30.18 (\u00b115.60) years for females (P > 0.05). However, men in the age group of 25 to 34 years and women aged 15 to 24 years suffered from burns significantly more than the other age groups (P < 0.05). The distribution of cases in relation to the age group and gender is depicted in P < 0.01).Etiology: The etiologies were determined by personal interview with 103 of the 150 patients who were compos mentis during their hospital stay. This could not be done for the remaining cases as they were seriously incapacitated or died soon after admission. Analysis of flame burns revealed them to be accidental in 45 , suicidal in 25 , homicidal in 8 [five acid burns and three flame burns due to personal rivalry] and incidental in 5 while trying to save other burn victims. Scalds were noticed in 15  and were due to accidental reasons. Even though another 47 victims had flame burns, their attributes could not be ascertained in view of the reasons stated above. The details in relation to 103 patients and their age groups are provided in How was the fire extinguished? The methods practised to quench the fire at home were pouring water in 55%, covering with bed sheets or gunny bag in 35%, making the victim roll on the ground in 15% and throwing sand over the victim in 4% or a combination of the above.First aid: A total of 83 (55%) patients were brought directly to the hospital within three hours. They were immediately resuscitated with ringer lactate according to the Parkland formula and given intravenous antibiotics and ranitidine. The remaining consulted their local doctors and were provided with intravenous fluids in 49% (33 patients), analgesics in 40% (27 patients) and ointments in 17% (11 patients) or a combination thereof. 19% didn't receive any treatment from the local doctor when approached for professional assistance other than referral to specialist centres. Unfortunately, three doctors advised the relatives to apply liquid ink used for fountain pens or herbal extracts.Clinical outcome: Of the 150 patients, 86 died with an overall mortality of 57.33%. It was found that none of the cases with <30% TBSA burns died while all those with >55% TBSA burns died; the outcome of patients with 30-55% TBSA burns was variable. The patients with TBSA of 81 to 100%, 61 to 80%, 41 to 60% and 31 to 40% died within two, four, six and eight days respectively. The details are provided in Understanding the epidemiological aspects and clinical details is helpful to find out the lacunae in burns' treatment and the need to improve the same. In the present study, 150 cases of burns were hospitalized over a period of 100 consecutive days in a 30 bedded burns unit of a large multispecialty teaching hospital with 2200 beds in Madurai.et al.[et al.[et al.[et al.[Eighty six out of 150 patients died and the in-hospital mortality was 57.33% which is consistent with the series of Subrahmanyam[l.[et al. (52.33%)l.[et al. (90.2%) l.[et al. (48.33%)l.[et al. (18.3%) Among women, 40.9% of the victims belonged to the age group of 15 to 24 years21213 hara12et al. (77%). This variation may be attributable to the socio-environmental factors discussed earlier.Flame burns accounted for 86.6% of all cases. Although accidental flame burns was the most common cause (57%), it was far less when compared to the series of Subrahmanyam (80%) and Bilwani Kerosene stoves contributed to 48% of accidental burns when compared to 2% due to gas stoves. As most of the kerosene stoves are of inferior quality, the occuAs burns are very frightening and catastrophic, patients go to the local practitioner for first aid. When prehospital treatment was analyzed, 83 patients were referred immediately due to the severity of burns and the rest were given substandard care. It was disappointing to note that doctors too practiced unconventional techniques  as first-aid measures to treat burn victims. As their treatment modalities reflected their suboptimal knowledge of treatment of burns, these doctors require continuing medical education. It is alThe strengths of this study were the prospective nature of the study, evaluation of individual cases by a single person (first author), confirmation by the second author and follow-up of the patients."}
+{"text": "The glycoprotein H (gH)/gL heterodimer is crucial for herpesvirus membrane fusion. Yet how it functions is not well understood. The Murid Herpesvirus-4 gH, like that of other herpesviruses, adopts its normal virion conformation by associating with gL. However, gH switched back to a gL-independent conformation after virion endocytosis. This switch coincided with a conformation switch in gB and with capsid release. Virions lacking gL constitutively expressed the down-stream form of gH, prematurely switched gB to its down-stream form, and showed premature capsid release with poor infectivity. These data argue that gL plays a key role in regulating a gH and gB functional switch from cell binding to membrane fusion. Enveloped viruses deliver their capsids to the cytoplasm by fusing with either the plasma membrane or the limiting membranes of endocytic vesicles. Many viruses use a single glycoprotein for both binding and membrane fusion. Herpesviruses, by contrast, use at least four + late endosomes We have analyzed gB and gH/gL using the MHV-68 isolate of Murid Herpesvirus-4 (MuHV-4) Both gB and gH have hydrophobic loops that could participate directly in fusion While quite a lot is known about gB, much less is known about gH/gL. Understanding gH/gL therefore presents the major obstacle to understanding herpesvirus entry. Unlike gH, gL lacks obvious fusion loops or a trans-membrane domain. Its contribution to membrane fusion is therefore likely to be indirect. So far, gL has been defined only as a chaperone for gH \u2212 MuHV-4 virions do show some attenuation relative to the wild-type. One deficit is reduced binding to BHK-21 fibroblasts gLMuHV-4 infects adherent cells via endocytosis. Capsid release is pH-dependent and occurs when virions reach the late endosomes/lysosomes marked by lysosome-associated membrane protein-1 (LAMP-1) + late endosomes; any residual gH/gL-specific staining after incubation at 37\u00b0C was confined to LAMP-1\u2212 compartments  at the cell surface to BN-1A7\u2212MG-1A12+ (post-fusion) in late endosomes  and gL+ (revertant and wild-type) viruses for their capacity to establish infection after intranasal inoculation of 1\u2013100 p.f.u. , as gL\u2212 virions fail to express gH/gL yet fuse more readily than the wild-type rather than less. It is possible that gL\u2212 virions express another, as yet unidentified, pre-fusion form of gH. However, we have found no antigenic evidence of other forms (data not shown). Our working hypothesis is therefore that gH/gL and gH-only are both pre-fusion - gH/gL being up-stream of gH-only - and that further gH conformation changes accompany fusion itself. In support of this, gH-only epitopes tended to disappear after a 4 h 37\u00b0C incubation, whereas MG-1A12-type gB epitopes were maintained (data not shown). Thus, gL dissociation from gH appears to prime gH for membrane fusion rather than being a part of the fusion reaction per se.Analogy with the Vesicular stomatitis virus glycoprotein G A pre-fusion conformation change cannot be ruled out for gB either. Heldwein et al. \u2212 mutants The influence of gL on the conformation of gB was presumably indirect. A loss of gL would change gH/gL to gH-only and would therefore disrupt the interaction \u2212 viruses were derived from a cloned MuHV-4 BAC BHK-21 fibroblasts, NIH-3T3 fibroblasts, NMuMG epithelial cells, and MCCD epithelial cells were propagated as described 4Cl or chlorpromazine was added from 2 h pre-infection to the time of fixation. Viral glycoproteins were detected with murine mAbs  plus Alexa488- or Alexa568- labeled anti-rat IgG (Invitrogen). Nuclei were counterstained with DAPI. Fluorescence was visualized on a Leica SP2 confocal microscope.Cells on glass coverslips ine mAbs  at 1\u201310 + or gL\u2212 MuHV-4 (2\u20135 p.f.u./cell), then trypsinized and either analyzed directly for viral eGFP expression  or first stained  with MuHV-4 glycoprotein-specific mAbs plus fluorescein-labeled anti-mouse IgG (Dako Cytomation) BHK-21 cells were infected with gL"}
+{"text": "Intrathymic T-cell differentiation is under the control of the thymic microenvironment, which acts on maturing thymocytes via membrane as well as soluble products. Increasing data show that this process can be modulated by classical hormones, as exemplified herein by prolactin (PRL) and growth hormone (GH), largely secreted by the pituitary gland.            in vivo the expression of high-molecular-weight cytokeratins and stimulates in vitro TEC proliferation, an effect that is shared by GH and IGF-1.Both PRL and GH stimulate the secretion of thymulin, a thymic hormone produced by thymic epithelial cells. Conversely, low levels of circulating thymulin parallel hypopituitary states. Interestingly, the enhancing effects of GH on thymulin seem to be mediated by insulinlike growth factor (IGF-1) since they can be abrogated with anti-IGF-1 or anti-IGF-l-receptor antibodies. The influence of PRL and GH on the thymic epithelium is pleiotropic: PRL enhances             In vivo inoculation of a rat pituitary cell line into old rats results in restoration of the thymus, including differentiation of CD4-CD8- thymocytes into CD4+CD8+ cells. Furthermore, PRL may regulate the maintenance of thymocyte viability during the double-positive stage of thymocyte differentiation.Differentiating T cells are also targets for the intrathymic action of PRL and GH.             Injections of GH into aging mice increase total thymocyte numbers and the percentage of CD3-bearing cells, as well as the Concanavalin-A mitogenic response and IL-6 production by thymocytes.  Interestingly, similar findings are observed in animals treated with IGF-1. Lastly, the thymic hypoplasia observed in dwarf mice can be reversed with GH treatment.            In keeping with the data summarized earlier is the detection of receptors for PRL and GH on both thymocytes and thymic epithelial cells. Importantly, recent studies indicate that both cell types can produce PRL and GH intrathymically. Similarly, production of IGF-1 and expression of a corresponding receptor has also been demonstrated.                        In conclusion, these data strongly indicate that the thymus is physiologically under control of pituitary hormones PRL and GH. In addition to the classical endocrine pathway, paracrine andautocrine circuits are probably implicated in such control."}
+{"text": "Terror attacks in Southeast Asia were almost nonexistent until the 2002 Bali bomb blast, considered the deadliest attack in Indonesian history. Further attacks in 2003 (Jakarta), 2004 (Jakarta), and 2005  have turned terrorist attacks into an ever-present reality.The authors reviewed medical charts of victims evacuated to the Singapore General Hospital (SGH) Burns Centre during three suicide attacks involving Bali (2002 and 2005) and the Jakarta Marriott hotel (2003). Problems faced, lessons learnt, and costs incurred are discussed. A burns disaster plan drawing on lessons learnt from these attacks is presented.n = 15], 2003 Jakarta attack [n = 14], and 2005 Bali attack [n = 2]). For the 2002 Bali attack, median age was 29 years (range 20 to 50 years), median percentage of total burn surface area (TBSA) was 29% (range 5% to 55%), and median abbreviated burn severity index (ABSI) was 6 (range 3 to 10). Eight of 15 patients were admitted to the intensive care unit. For the 2003 Jakarta attack, median age was 35 years (range 24 to 56 years), median percentage of TBSA was 10% (range 2% to 46%), and median ABSI was 4 (range 3 to 9). A large number of patients had other injuries. Problems faced included manpower issues, lack of bed space, shortage of blood products, and lack of cadaver skin.Thirty-one patients were treated at the SGH Burns Centre in three attacks (2002 Bali attack [The changing nature of terror attacks mandates continued vigilance and disaster preparedness. The multidimensional burns patient, complicated by other injuries, is likely to become increasingly common. A burns disaster plan with emphasis on effective command, control, and communication as well as organisation of health care personnel following a 'team concept' will do much to ensure that the sudden onset of a crisis situation at an unexpected time does not overwhelm hospital manpower and resources. Urban terrorism has been called the scourge of our times . Indeed,In Southeast Asia, terrorist attacks were almost nonexistent until the 2002 bombing at Kuta Beach on the island of Bali. After this attack, considered the deadliest act of terrorism in Indonesian history, further attacks targeting the Jakarta Marriott hotel (Indonesia) in 2003 and the Australian embassy in Jakarta in 2004 and further Bali bombings in 2005 have turned terrorist attacks into an ever-present reality. Although those responsible for the attacks have been arrested and charged , the victims and relatives involved on those fateful days will forever bear the scars of terrorism.In three of these attacks, the Singapore General Hospital (SGH) Burns Centre served as a receiving facility for some of the most severely burned victims in the immediate aftermath of the blasts. SGH is a level I trauma centre, and the SGH Burns Centre, the only dedicated burn facility serving Singapore, receives 93% of total burns cases in Singapore, a city-state with a population of 4.18 million [This report describes the characteristics of patients received in the aftermath of the 2002 and 2005 Bali bombings as well as the 2003 Jakarta Marriott hotel bombing, along with problems faced, the manner of response, lessons learnt, and costs incurred. In addition, a disaster plan for management of future terrorist incidents in Southeast Asia involving large numbers of burn victims is presented, drawn up from the experience of these three devastating attacks.On 12 October 2002 at 11:05 p.m. at Kuta, a town in southern Bali, a suicide bomber triggered a device hidden in a backpack, causing an explosion to tear through Paddy's Bar. Fifteen seconds later, in front of the Sari Club, a much larger car bomb of close to 1,000 kg concealed in a white van was detonated by remote control. The blast left a one meter-deep crater, and the shock wave blew out windows throughout the town. Scores of victims were killed and many more suffered severe trauma and burns. A third bomb had been detonated in front of the American consulate in Bali shortly before, causing only slight injury to one person. When all bodies were accounted for, it was found that 202 people had lost their lives [On 5 August 2003, near the lunch hour in Jakarta, a car bomb exploded in the driveway of the Marriott hotel, killing 12 people and injuring another 150 . The forOn 1 October 2005 at 6:50 p.m. in Bali, two explosions caused by suicide bombers ripped through a Jimbaran Beach food court, and a third bomber struck at 7 p.m. in the main square of central Kuta. Unlike in previous attacks, many of the casualties sustained shrapnel injuries as well as injuries due to ball bearings, suggesting a different modus operandi for the bombers. The final death toll was 20, and another 129 were injured [The SGH Burns Centre is less than two hours by air from much of Indonesia and is located 1,050 miles from Denpasar, Bali, and 555 miles from Jakarta and therefore was ideally placed to receive casualties after these attacks. It is a 29-bed facility divided into a 4-bed intensive care unit (ICU), 6-bed high-dependency unit, and 19-bed general ward. After the 2002 Bali attack, the facility was renovated and the ICU is now able to nurse eight patients in a crisis situation as each of the cubicles is double-spaced (with patients housed as such only in a crisis with insufficient bed space). The mean annual admission to the Burns Centre is 288 patients [Data on patients were obtained from a retrospective review of medical records. Information on demographic data, injuries sustained, complications, surgeries, and outcome was obtained. Information on costs incurred in the wake of the terrorist attacks was obtained from records that were kept by the finance office of SGH and based on hospital bills incurred by individual patients. Data on cadaver skin obtained and skin-banking protocols were obtained from the skin bank at the SGH Burns Centre. Information regarding the events surrounding previous terrorist attacks was obtained from the news media.From October 2002 to October 2005, the SGH Burns Centre was involved in the management of 31 patients evacuated from three separate suicide bombing attacks in Indonesia. Table In contrast, for the 5 August 2003 Jakarta Marriott hotel bombing, patients evacuated to our centre were less severely burned (median percentage of TBSA of 10%) and only two patients were admitted to the ICU. All patients survived. Thirteen patients required surgery; 29 burn surgeries and 7 non-burn surgeries were performed. Patients were evacuated to Singapore in waves from 6 August to 9 August, and the two most severely injured requiring ICU care arrived first. This likely reflects the smaller scale of the 2003 Jakarta bombing as opposed to the three bombs detonated in the 2002 Bali bombing.Interestingly, all the patients from the 2002 Bali bombing treated at the SGH Burns Centre were non-Indonesian  and of relatively young age (median 29 years). The terrorists targeted crowded areas frequented by tourists, and this likely explains why many foreign nationals sustained severe burn injuries. At the request of patients and national authorities, six of these patients were evacuated to their home countries after a two to eight day hospitalisation in Singapore . In contrast, for the 2003 Jakarta bombing, all the patients seen were either Indonesian or Singaporean, perhaps due to lesser numbers of foreign tourists visiting Indonesia.Table A large number of the patients seen at the SGH Burns Centre had other injuries as shown in Table Throughout the three terrorist attacks, the SGH Burns Centre continued to function normally, admitting burn patients from Singapore and abroad. This was unavoidable given that we are the only regional burns centre in this part of Southeast Asia. The main problems faced were those of manpower, lack of bed space, shortage of blood products, and lack of cadaver skin. With the sudden influx of 15 patients in one day after the 2002 Bali bomb blast, the usual staff complement of the Burns Centre was insufficient to manage the situation. As a result, off-duty staff were recalled, additional critical care trained nurses were recruited from the surgical and medical ICUs, and surgical residents who had previously done a burns rotation were seconded to assist in managing patients in the week following the incident. The nine plastic surgeons in the unit with teams of surgical residents worked 12-hour shifts in the days following the attack, operating on the patients. Additional operating theatres were allocated for use in the management of victims of the Bali bomb blast. The estimated number of cancelled elective surgeries, particularly those requiring ICU care, was 20 to 30.Of the eight patients requiring ICU care after the 2002 Bali attack, four were housed in the surgical ICU, managed with the aid of additional surgical intensivists recruited during this period. Patients judged fit enough for step-down care were discharged from the surgical ICU prior to the arrival of the first patients from Bali. The 2003 Jakarta and 2005 Bali attacks did not pose such a major manpower and resource problem; this was due to a smaller number of patients requiring critical care and surgery as well as better disaster preparedness resulting from the experience of managing patients from the 2002 attack.In our burns centre, we practice early massive excision of burns and temporary coverage by skin substitutes followed by definitive wound closure with autologous skin grafts in staged surgeries. As a result, a significant problem encountered after the 2002 Bali bombing was an acute shortage of blood products following the many surgeries performed for victims of that attack. Fortunately, the National Blood Bank was able to obtain more blood at short notice through blood donation drives and recalling regular blood donors during this period. However, to conserve blood products, many elective surgeries were also cancelled in the immediate aftermath of the attack.2 of cadaver skin in our skin bank. By 18 October, only 5,450 cm2 was left. Fortunately, a prior request for substitute skin had been made to the University of Texas Southwestern Medical Center at Galveston , which responded by sending 22,968 cm2 of skin to Singapore. The shipment arrived on 18 October 2002, forestalling the anticipated shortage of cadaver skin. Better prepared for the 2003 Jakarta and 2005 Bali attacks, the SGH Burns Centre did not face any further shortages of skin substitutes.The lack of cadaver skin was another major issue after the 2002 Bali bomb blast. Prior to this attack, no contingency had ever called for the massive amounts of cadaver skin required. On 14 October 2002, when the patients arrived from Bali, there was 9,100 cmThe cost of these consecutive suicide bombing attacks, at regular intervals in Indonesia, to the victims and families involved cannot be quantified. Numerous people lost their lives, and many more were injured. In addition, the previous absence of terror attacks was replaced by an almost annual bomb blast in Indonesia, changing the region forever. The psychological effect has been no less, with a pervading sense of danger among the local populace and marked decrease in tourism to the region seen after these attacks.In terms of costs incurred by patients during their stay, the 2002 Bali bombing cost SGD $765,702 . The 2003 Jakarta bombing cost SGD $603,008 , and the cost of the 2005 Bali bombing was SGD $38,535 .The number of patients suffering burns as a result of the 2002 Bali bombing was extremely high; 15 patients were treated at the SGH Burns Centre, and a further 48 were evacuated from the Royal Darwin Hospital  to Australian burns centres . We willBurns centres are never the first responders in terrorist attacks. However, they almost invariably play a pivotal role in the subsequent management of burn patients. A formalised protocol for MCIs and limited MCIs is therefore essential to ensure proper workflow during a crisis situation as well as the ability to cope with a massive surge in patients transferred at short notice. The experience of previous terrorist attacks would suggest that the number of burn patients to be expected is significant. In Israel, of patients hospitalised after injury by terror-related explosions, 15% suffered burns . After 9Due to Singapore's location at the crossroads of air and sea traffic, as well as the presence of a petrochemical industry and high-density urban sprawl, burns preparedness has always been a priority. The SGH Burns Centre Burns Disaster Plan was conceptualised and designed in light of lessons learnt after the recent terror attacks in Indonesia. It emphasises effective command, control, and communication as well as a 'team concept' in which medical and nursing personnel are organised into teams for better management of burns patients. Yearly drills ensure that staff are kept up to date on processes and procedures. Future validation of the disaster plan is planned. The major problems faced during the Indonesian terror attacks \u2013 such as manpower issues, lack of bed space, and resource shortage \u2013 were analysed and solutions proposed. Cross-training of personnel to provide additional manpower in a crisis situation and provision for opening of additional ICUs and wards were instituted. In addition, a directive from the Ministry of Health, Singapore, stipulated requirements for a minimum supply of cadaver skin to be banked at the Burns Centre at all times.In a crisis situation, a Burns Disaster Command is formed with the director of the Burns Centre serving as the director of operations. He is assisted by a team comprised of senior nursing staff and administrative and communications officers. The Burns Disaster Command is housed in a specialised room serving as an operations centre and provides command and control of all Burns Centre personnel Figure . MedicalContingency plans also allow for the opening of additional temporary ICUs during an MCI in areas such as the operating theatre recovery rooms, endoscopy suite, and day surgery suite. Intensivists are organised into teams comprised of four attending physicians and four residents, with one team covering each ICU.A dedicated briefing and communications room for press conferences and communication with family members is manned by a communications officer, who has easy access to social workers, psychologists, nurses, and doctors. To ensure that effective channels of communication are maintained, dedicated phone lines are maintained between the operations centre, communications room, ED, disaster site command, and the rest of the hospital. The operations centre serves as the nerve centre of the communications network. A plan for activation and recall of medical and nursing staff is in place with varying levels of activation, and the level of activation of personnel is decided by the director of the Burns Centre. The role of local authorities in a mass casualty situation is also vital for preserving lines of communication and transport. Civil defence and emergency services contingency plans are in place to prepare for such a situation.Unidirectional flow of casualties is a priority and is formalised into a protocol for reference of medical and nursing personnel Figure . In addiDespite all possible preparative measures and a formalised burns disaster plan to forestall chaos, in a true mass casualty scenario, manpower and hospital resources may still be insufficient to cope with the situation. The concept of 'minimal acceptable care' in terror attacks, in which effort is concentrated on a maximal number of salvageable patients ,14,15, hThere appears to be a clear difference between normal burn patients and victims of terror attacks requiring admission to a burns centre. In our experience, a large proportion of victims of terror attacks have had multidimensional injury with other injuries besides burns. Similarly, in the Israeli experience, 68% of patients with burn injuries had penetrating and blunt injuries [For patients with burn injuries sustained in bomb blasts, it must be appreciated that the blast wave caused by heavy explosives results in an additional element of soft tissue destruction. This is especially true for those victims closest to the blasts. These wounds cannot be treated primarily as burn wounds but require repeated reassessment in the subsequent 48 hours for progression to deeper tissue destruction. Therein lies the problem for MCIs in which facilities and staff are overwhelmed and the resultant level of care is therefore suboptimal.The changing nature of terror attacks mandates continuing vigilance and disaster preparedness. The multidimensional burns patient, complicated by other injuries, is a particular challenge to manage but is likely to become increasingly common. A structured burns disaster plan with emphasis on control, command, and communication will do much to ensure that the sudden onset of a crisis situation at an unexpected time does not overwhelm hospital manpower and resources. In extreme circumstances, 'minimal acceptable care' with the selective treatment of burn patients to conserve hospital resources and maximise manpower may offer an alternative to an overwhelmed health care system.\u2022 A burns disaster plan with emphasis on effective command, control, and communication as well as organisation of health care personnel following a 'team concept' will do much to ensure that the sudden onset of a crisis situation at an unexpected time does not overwhelm hospital manpower and resources.\u2022 The changing nature of terror attacks mandates continued vigilance and disaster preparedness.\u2022 In a mass casualty situation after a terrorist attack, 'minimal acceptable care' with the selective treatment of burn patients to conserve hospital resources and maximise manpower may offer an alternative to an overwhelmed health care system.\u2022 After a terror attack, the multidimensional burns patient, complicated by other injuries, is likely to become increasingly common, and hospitals should prepare to treat this kind of patient.ED = emergency department; ICU = intensive care unit; MCI = mass casualty incident; SGH = Singapore General Hospital; TBSA = total burn surface area.The authors declare that they have no competing interests.HC conceived the study, carried out the research, and wrote the manuscript. WSY and CS participated in care of patients and helped to draft the manuscript. All authors read and approved the final manuscript."}
+{"text": "We thank Kumar for his letter about our article . We hope2.5) based on the data available. More sophisticated approaches will hopefully reduce the discrepancy between PM2.5 and AOD, but this does not change the need for rigorous assessment of the use of AOD as a proxy for PM2.5. An important test\u2014which we explored\u2014is the ability of AOD to help improve PM2.5 predictions, beyond reporting correlations between AOD and PM2.5. Furthermore, even with improved approaches in which systematic discrepancy may be alleviated, systematic discrepancy seems unlikely to disappear, and we believe serious consideration of AOD as a proxy for PM2.5 in the future will need to consider the nature of this discrepancy and its implications for the contexts in which AOD is used as a proxy for PM2.5.We agree that in our article  we used 2.5, we agree with Kumar that it would be ideal to control for such sources. We used the standard MODIS (moderate resolution imaging spectroradiometer) AOD product because this product would be available to general users; however, it would be appealing if a more tailored AOD retrieval algorithm could be applied over the spatial and temporal domain of interest for a given application. From reading the article by To the extent that natural sources of AOD do not correlate with concentrations of ground-level PM2.5, the average of all monitoring data available at a regular interval should be an unbiased estimate of true PM2.5 at the location, which is the quantity one would like to have everywhere in space. Estimated associations based on matched data therefore are an overly optimistic assessment of AOD as a proxy for true long-term PM2.5. Of course for shorter intervals, the variability in estimates of true PM2.5 that are based on small numbers of daily samples will contribute to reduced AOD\u2014PM2.5 association, so there are tradeoffs in deciding whether to match. One also needs to consider whether using matching introduces bias because missing AOD is associated with particular meteorologic conditions that also likely correlate with PM2.5 levels  for which AOD is available or for which AOD is thought to be a more reliable proxy.As noted by Kumar, averaging all data\u2014rather than matching in time before averaging\u2014reduces associations. However, when interest lies in developing a proxy for long-term average PM5 levels . Finally5 levels . The ref2.5, and of course one cannot expect AOD to provide information below its nominal resolution. Given this, in our statistical modeling we did our best to account for local sources of variation in PM2.5, namely distance to roads and to point sources, that cause the point-level observations to necessarily differ from the pixel-scale AOD. One would hope that the AOD pixel value represents variation in AOD at the scale of pixels or at somewhat larger resolution  that differentiates urban, suburban, and rural areas. We would like variation at this scale to provide information on PM2.5 variation at the same scale that would improve prediction of PM2.5, but our results unfortunately did not provide evidence for such improvement. It is not completely clear what Kumar is suggesting as an alternative to using the value of AOD assigned to a pixel as representative of the entire pixel area, but it seems to be an approach that uses subpixel-scale information not available in the current MODIS AOD product. This seems promising, and we welcome work on providing AOD at higher resolution and evaluating whether more highly resolved AOD improves predictions of PM2.5. A key issue from this perspective is not the nominal resolution at which AOD is provided but the resolutions at which it is associated with spatial variations in PM2.5.Given the pixel-scale AOD retrievals (and the changing MODIS pixels from day to day), to spatially align our various data sources we took the ad hoc approach of assigning to each 4-km grid cell the value of the nearest MODIS AOD pixel overlapping the grid cell, requiring the distance between the cell and pixel centroids to be no greater than the nominal distance between AOD pixel centroids. This does not fundamentally change the AOD spatial pattern but does somewhat blur the original AOD values at the pixel boundaries. We recognize that it is difficult to compare a pixel-wide AOD value to a point observation of PM2.5 that might mask smaller-scale correspondence, we used AOD and PM2.5 data to estimate and adjust  for large-scale spatial discrepancy that persists over time but found that this did not improve matters, suggesting that small-scale discrepancy between PM2.5 and AOD is a major concern.It was not entirely clear what Kumar is suggesting in terms of how to control for natural-source AOD and its spatio-temporal structure. With regard to large-scale discrepancy between AOD and PM"}
+{"text": "Defects of the primary cilium and its anchoring structure, the basal body, cause a number of human genetic disorders, collectively termed ciliopathies: primary ciliary dyskinesia, Bardet-Biedl syndrome, polycystic kidney and liver disease, nephronophthisis, Alstr\u00f6m syndrome, Meckel-Gruber syndrome and some forms of retinal degeneration.Alstr\u00f6m syndrome is an extremely rare, autosomal recessive genetic disorder characterized by a group of signs and symptoms including infantile onset dilated cardiomyopathy, blindness, hearing impairment/loss, obesity, diabetes, hepatic and renal dysfunction.Because adult growth hormone deficiency and Alstr\u00f6m Syndrome share some clinical and metabolic features, we studied the GH-IGF1 axis, using MRI techniques and dynamic tests in 3 unrelated patients with Alstr\u00f6m syndrome.The patients were hospitalized and the growth hormone stimulatory tests were made, as well as brain MRI. Insulin provocative test revealed a severe GH deficiency in these patients, defined by a peak response to insulin-induced hypoglycemia less than 3 ng/dl and IGF1 concentrations less than \u2013 2SDS.We didn't find multiple pituitary hormone deficiency and we noticed only a severe GH deficiency in all three patients. The MRI study of the diencephalic and pituitary region was suggestive for the diagnosis of empty sella in one patient.One patient received Recombinant-GH replacement for one year with very good results, one underwent a gastric sleeve with a satisfactory outcome, one patient died due to the progression of the cardiac myopathy.Future studies are needed to assses if the substitution therapy with Recombinant Growth hormone is cost-effective and without risk in such patients with Alstr\u00f6m Syndrome and severe insulin resistance, despite our good results in one patient. Also, careful clinical and genetic studies can contribute to a better understanding of the evolution after different therapeutical attempt in the complex disorders such as Alstr\u00f6m Syndrome. Alstr\u00f6m syndrome is a rare autosomal recessive disorder , caused Central features of Alstr\u00f6m syndrome include obesity, insulin resistance, and type 2 diabetes, and therefore investigating such patients could offer new insights into the pathogenesis of these common conditions [Primary cilia are ubiquitous cellular appendages that provide important yet not well understood sensory and signaling functions. Until recently, cilia were thought to be simple external cellular organelles, but now they are thought to play important roles in cell signaling, in sensing chemical and physical activity, in intracellular communication, and as photoreceptors. The significance of primary cilia is exemplified by the fact that defects in cilia formation or function cause renal cystic disease, retinal degeneration, liver fibrosis, anosmia, ataxia, cardiac defects, and situs inversus ,4.Although all ciliopathies arise from defective cilia, the range of symptoms can vary significantly , and onlThere is growing evidence that cilia are connected with the cellular signaling involved in modern illnesses such as obesity and diabetes, e.g. an increasing number of genetic diseases being associated with defects in ciliogenesis or ciliary function -20, inclThe complex links in the central nervous system between neuronal cilary dysfunction in the brain areas such as the hypothalamus, involved in appetite control, and obesity may be explained by the mechanisms of ciliary maintenance and lead to hyperphagia, a low metabolic rate, autonomic imbalance, growth hormone (GH) deficiency and various other problems that contribute to weight gain -24.It is important to identify those at high risk of hypothalamic obesity so that weight gain prevention approaches can be offered. In those who are already obese, the principal causal mechanism should be considered as a basis for guiding clinical management -27.Also, by studying such rare disorders we could understand the complex mechanisms of obesity and diabetes, were, dietary habits and exercise could be sometimes accompanied by genes linked to cilia and basal bodies, making some people more susceptible to obesity than others.Considering that hypothalamic ciliary neuronal dysfunction is implicated in the etiology of obesity in Alstr\u00f6m syndrome patients, we studied the presence of GH deficiency in our patients, because we assume that an early preventive intervention in such patients is GH replacement.We evaluated hypothalamic-pituitary-GH axis, by studying the GH-IGF1 axis, using MRI techniques and dynamic tests in 3 unrelated patients with Alstrom syndrome.To characterize the GH-IGF1 system in Alstr\u00f6m syndrome, we evaluated our 3 patients with Alstr\u00f6m syndrome for hepatic, renal and thyroid function. Glycaemic and hormone measurements such as insulin, GH, FSH, LH, testosterone and 17-beta-oestradiol were assessed. A significantly lower height was observed in our patients compared to age-matched controls. Also, all patients were clinically obese (by weight and body mass index (BMI) standards). Only 2 patients presented with fasting hyperglycaemia, but all 3 were hyperinsulinaemic. TSH was normal. Baseline FSH and LH in the 2 females (Patient 2 and Patient 3) were within the normal range, while the male (Patient 1) had an abnormally low testosterone value. Free IGF1, IGFBP-1 were significantly reduced and IGFBP-2 was markedly increased in all 3 patients compared to age-matched controls, which points to a growth hormone deficiency (GHD) condition in Alstrom syndrome.All 3 subjects had anthropometric and laboratory parameters checked at baseline. After a 12-hour overnight fast, blood specimens were obtained for plasma glucose, triglycerides, glycosylated hemoglobin (HbA1c), and serum total, low-density lipoprotein (LDL), and high-density lipoprotein (HDL) cholesterol. Patients who were using insulin (patient 1 and patient 2) had their treatment stopped the day before the test, but were closely monitored for the glycemic status.2 of body surface) was performed in each patient.An insulin tolerance test (ITT), consisting of a bolus of regular human insulin  and photophobia at 12 months), reduced visual acuity. Sensorineural hearing impairment was noted at 15 years of age and type 2 diabetes mellitus was diagnosed at 16 years of age . The MRI study of the diencephalic and pituitary region was suggestive for the diagnosis of empty sella Figure . We foun2 \u2013 0,49 ng/mL , IGF-1 \u2013 49 ng/ml (N:116\u2013356 ng/ml). Because of the insulin resistance, the needed dose of insulin in order to achive the hypoglycemia, was 4 times greater than usual.The values were: GH1 \u2013 0,18 ng/mL, GHMultiple pituitary hormone deficiency (MPHD) wasn't found and we noticed only severe GH deficiency and an abnormally low testosterone value. The presence of empty sella seems to be a rare morphologic finding in Alstr\u00f6m syndrome though it was described in patients with Bardet-Biedl syndrome .Decreased serum levels of GH, which acts on cardiac myocytes primarily through IGF-1, are associated with impaired myocardial growth and function, which can be improved with restoration of GH/IGF-1 homeostasis . This efAlso, due to the severity of the cadiomyopathy, we were reluctant to consider the Re-GH administration in this case.The patient was included in a study of linkage mapping . Interestingly, so far, the Alstr\u00f6m patient doesn't have any of the known ALMS1 mutations and he did not have any of the known BBS mutations either. He had one heterozygous SNP in BBS5 (BBS5_N184S het) that is not disease-causing. Despite the fact that this case was analyzed for years without the identification of a known mutation, efforts are still made using the Asper Biotech Gene Chip, in order to identify a possible new unknown mutation(s) that may explain the phenotypic diagnosis.The second patient is a girl, 14-y-o, diagnosed with Alstr\u00f6m syndrome clinically and genetically . The genetic testing performed at Jackson Laboratory, Bar Harbor, Maine revealed in exon 16, in the ALMS1 gene in patient's DNA, 2 different mutations: 10753 C > T Ter and 10780 C > T Ter.2) but, normal intelligence, normal extremities, normal secondary sexual characteristics were noted during the evolution.The first sign, nystagmus, was noted at 4 months of age, then she developed progressive retinal distrophy and blindness by 10 years of age. Infantile obesity progressive with age, sensorineural hearing impairment, type 2 diabetes mellitus, abnormal liver function tests, reccurent urinary tract infections, urinary incontinence, scoliosis, kyphosis, acanthosis nigricans, obesity .We found a severe GH deficiency, defined by a peak response to insulin-induced hypoglycemia less than 3 ng/dL and IGF1 concentrations less than -2SDS.The values were: GH1 \u2013 0,18 ng/mL, GH2 \u2013 0,17 ng/mL , IGF-1 (somatomedin c) \u2013 67 ng/mL (116\u2013356).Because of the insulin resistance, the needed dose of insulin in order to achive the hypoglycemia, was 2 times greater than usual.The MRI study of the diencephalic and pituitary region was normal Figure .We found normal TSH (Thyroid Stimulating Hormone), fT3 (free triiodothyronine), fT4 (free thyroxine), and negative results for anti-thyroid auto-antibodies. Multiple pituitary hormone deficiency (MPHD) wasn't found and we noticed only severe GH deficiency.We used Re-GH in this patient for 12 consecutive months, in a dose of 0,25 mg/day, with very good results: the total body fat mass decreased after one year, most significant in visceral trunk location as revealed by DEXA body composition, the bone density increased with 5% after 6 months Figure . EchocarThe third patient is a 13-y-o girl with severe obesity Figure  who was The past medical history revealed the presence of nystagmus from 4 months of age and progressive obesity during her infancy and childhood. The patient has normal extremities and normal inteligence, no sensorineural hearing impairment was noted yet, nor type 2 diabetes mellitus, and thyroid disorders. Differential diagnostics included lysosomal storage diseases and aminoacidopathies, but these disorders were excluded. Several laboratory tests showed normo-glycemia, mild hypertriglyceridemia, and hypercholesterolemia and normal liver transaminases and renal function tests. Mild to moderate insulin-resistance was noted, as revealed by glucose-to-insulin ratio (GIR) = 4.3 Obese patients with a fasting GIR of 4.5 or more have insulin sensitivity, while a GIR of less than 4.5 means insulin resistantance. Fasting Insulinemia: 18.5 uU/mL . We studied the GH-IGF1 axis, using MRI techniques and dynamic tests (insulin tolerance test): GH 1- 0.32 ng/mL, GH 2- 0.24 ng/mL , IGF-1 162 ng/mL .Insulin resistance as well as growth hormone deficiency was diagnosed in this patient; her DNA was sent to Jackson Laboratory, Maine, USA for the genetic testing and we are pending for the results.Despite the gastric sleeve and considerable weight loss (about 45 kg in 9 months), this patient was diagnosed with GH deficiency unrelated to obesity, and we are considering the Re-GH administration in her case.We noticed an important clinical variability among these patients, characteristic for the ciliopathies, given the multiple roles of cilia in development and physiology.The first sign noticed in all these 3 affected patients was the presence of nystagmus and light sensitivity in infancy.Congestive heart failure resulting from dilated cardiomyopathy was diagnosed in patient 1 in adolescence, leading to his death, by the age of 28. Also, the cardiomyopathy was diagnosed in patient 2, but some improvements were noted after the treatment with Re-GH.As infants and toddlers all 3 patients were overweight. Hearing impairment was diagnosed in patients 1 and 2, and all 3 became insulin resistant as adolescents. Patient 1 and patient 2 were diagnosed with type 2 diabetes mellitus in the 2-nd decade of life.Other findings observed in our Alstr\u00f6m Syndrome patients: acanthosis nigricans, short stature, abnormal liver and kidney tests in patients 1 and 2, and normal intelligence, normal extremities, normal secondary sexual characteristics in all 3 patients, making possible the differential diagnosis with Bardet-Biedl syndrome.Patient 1 was diagnosed with empty sella, based on the brain MRI exam, this finding being unusual so far in Alstr\u00f6m Syndrome patients.Studying the medical literature, we noticed that considerable variability exists in the expression of the clinical signs of Alstr\u00f6m Syndrome, even among siblings, and not all people who have Alstr\u00f6m Syndrome will experience all of the characteristic features .All 3 patients in our series were diagnosed with GH deficiency, based on the results of the provocative tests using insulin, one problem of great concern being the obesity.The somatotropic response to all provocative stimuli is negatively correlated to BMI and the GH response in obese subjects is sometimes as impaired as that in hypopituitary patients with severe GHD -35. The We used the ITT and the classical cut off level of 3 ng/dl when we assessed the impairment of GH secretion in our patients.It is supposed that the genetic alteration leads to dysfunction of several hypothalamic centres and growth hormone (GH) deficiency (GHD) in Alstr\u00f6m syndrome.In our case series, at baseline the activity of the GH-insulin-like growth factor-1 (IGF-1) system was impaired with low GH values, low total IGF-1 and in relation to the obesity low levels of free IGF-1 and non-suppressed IGF-binding-protein-1 (IGFBP-1). Bone mineral density (BMD) assesed in one patient was low. Two patients had diabetes mellitus, and all three had a glucose-to-insulin ratio (GIR) less than 4.5 indicating insulin resistance. One patient subsequently completed a 12 months GH treatment trial, and GH had beneficial effects on body composition without significant adverse effects. More, the echocardiography performed in this patient has shown that left ventricular mass index, fractional shortening and fiber shortening velocity improved after 12 month of low-dose therapy. No lipid metabolism improvement was noted, but a psychological well being was observed. Insulin sensitivity and acanthosis nigricans improved. Glucose-to-insulin ratio increased from 3.45 to 4.52 after one year.Demonstrating GHD in an Alstr\u00f6m syndrome patient, Tai TS, Lin SY, Sheu WH assessed the metabolic effects of growth hormone therapy concluding that Re-GH therapy might have beneficial effects on body composition, liver fat content, lipid profiles, and insulin resistance in Alstr\u00f6m syndrome patients, with improvement of the glucose homeostasis .Also, Maffei et al. found a reduction of ALS (acid labile subunit) and the increase of IGFBP-2 as expression of growth hormone deficiency (GHD) condition in 15 young adults with Alstr\u00f6m syndrome .z score, and LV end systolic stress z score 6 months after discontinuation of GH treatment  [Considering Recombinant-GH as treatment in to 8 pediatric patients with stable chronic heart failure secondary to dilated cardiomyopathy (DCM), McElhinney and the other authors determined several notable cardiovascular effects, including a trend toward improved LV ejection fraction during the course of GH treatment and significantly improved LV SF, SF  values) . Re-GH wConcerning the gastric sleeve, we consider that this procedure should be addressed to extremely obese patients with Alstrom syndrome, , who have reached their adult height , and have serious weight-related health problems, such as type 2 diabetes, sleep apnea, heart disease, or significant functional or psychosocial impairment. In addition, potential patients and their parents should be evaluated to see how emotionally prepared they are for the operation and the lifestyle changes they will need to make.This case series showed that adolescents and adults with Alstr\u00f6m syndrome have GH deficiency, and recombinant GH therapy might have beneficial effects on body composition, and insulin resistance, with improvement of the glucose homeostasis and cardiac function. Larger and longer term studies on the effect of GH replacement in Alstr\u00f6m syndrome patients are encouraged, to assess if the substitution therapy with Recombinant Growth hormone is cost-effective and without risk in such patients with Alstr\u00f6m Syndrome and severe insulin resistance, knowing that the state of GH deficiency seen in Alstr\u00f6m syndrome renders these patients exposed to a lifelong risk of metabolic disturbances.Further careful clinical and genetic studies of such patients can contribute to a better understanding of the evolution after different therapeutical attempts in the complex disorders such as Alstr\u00f6m Syndrome.GH: growth hormone; IGF-1: insulin-like growth hormone 1; GHD: growth hormone deficiency; MRI: magnetic resonance imaging; SDS: standard deviation; MPHD: multiple pituitary hormone deficiency; ALMS1-Alstr\u00f6m syndrome 1(the gene responsible for Alstr\u00f6m Syndrome); DKA: diabetic keto-acidosis; TSH: Thyroid Stimulating Hormone; fT3: free triiodothyronine; fT4: free thyroxine; DEXA: Dual energy X-ray absorptiometry; BMI: body mass index; BMD: bone mineral density; ITT: insulin tolerance test; SNP: single nucleotide polymorphism; BBS5: Bardet-Biedl Syndrome 5 (a human gene); GIR: glucose-to-insulin ratio; Re-GH: recombinant growth hormone; ALS: acid labile subunit; DCM-dilated cardiomyopathy.Written informed consent was obtained from the patients's parents for publication of this article and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.RMS and HA were responsible for analyses of blood samples and initial drafting of the manuscript. TNP was responsible for design, planning, execution and drafting of the manuscript. CMM and DC were involved in drafting the manuscript and revising it critically for intellectual content. MT was responsible for the cardiac echography."}
+{"text": "Trypanosoma cruzi has been the primary cause of recent outbreaks of acute Chagas' diseases. This route of infection may involve selective binding of the metacyclic trypomastigote surface molecule gp82 to gastric mucin as a first step towards invasion of the gastric mucosal epithelium and subsequent systemic infection. Here we addressed that question by performing in vitro and in vivo experiments. A recombinant protein containing the complete gp82 sequence (J18), a construct lacking the gp82 central domain (J18*), and 20-mer synthetic peptides based on the gp82 central domain, were used for gastric mucin binding and HeLa cell invasion assays, or for in vivo experiments. Metacyclic trypomastigotes and J18 bound to gastric mucin whereas J18* failed to bind. Parasite or J18 binding to submaxillary mucin was negligible. HeLa cell invasion by metacyclic forms was not affected by gastric mucin but was inhibited in the presence of submaxillary mucin. Of peptides tested for inhibition of J18 binding to gastric mucin, the inhibitory peptide p7 markedly reduced parasite invasion of HeLa cells in the presence of gastric mucin. Peptide p7*, with the same composition as p7 but with a scrambled sequence, had no effect. Mice fed with peptide p7 before oral infection with metacyclic forms developed lower parasitemias than mice fed with peptide p7*. Our results indicate that selective binding of gp82 to gastric mucin may direct T. cruzi metacyclic trypomastigotes to stomach mucosal epithelium in oral infection.Oral infection by  T. cruzi, characterized by high mortality, have been reported in recent years. In Brazil, oral infection is currently the most important mechanism of T. cruzi transmission. Studies on oral T. cruzi infection in mice have shown that insect-stage metacyclic trypomastigotes invade only the gastric mucosal epithelium and not other areas of mucosal epithelia prior to establishing systemic infection. Here we have shown that metacyclic trypomastigotes bind selectively to gastric mucin, a property also displayed by gp82, a metacyclic stage-specific surface protein implicated in cell adhesion/invasion process. It is also shown that the gastric mucin-binding property of gp82 resides in the central domain of the molecule and that the synthetic peptide p7, based on a gastric mucin-binding sequence of gp82, markedly reduces parasite invasion of cultured human epithelial cells in the presence of gastric mucin. These results, plus the finding that mice that received peptide p7 before oral infection with metacyclic trypomastigotes had fewer parasites replicating in the gastric mucosa and developed lower parasitemias than control mice, lead us to suggest that gp82-mediated interaction with gastric mucin may direct T. cruzi to stomach mucosal epithelium in oral infection.Frequent outbreaks of acute Chagas' disease by food contamination with  Trypanosoma cruzi has been responsible for frequent outbreaks of acute cases of Chagas' disease in recent years Triatoma infestans in many endemic areas, and the control of the blood bank transmission, T. cruzi infection by the oral route constitutes the most important transmission mechanism T. infestans, has been reported in different geographical regions. The incidence is higher in the Brazilian Amazon Orally transmitted infection by the protozoan parasite T. cruzi infection in the mouse model have shown that the insect stage metacyclic trypomastigotes invade the gastric mucosal epithelium and, following intracellular replication as amastigotes, differentiate into trypomastigotes that are subsequently released into circulation T. cruzi infection, with parasites being undetectable elsewhere within the mucosa of the oropharynx or esophagus T. cruzi infection by the oral route 2+ mobilization in both cells T. cruzi strains deficient in gp82 expression are poorly infective when administered orally into mice, although they efficiently invade host cells in vitro by engaging gp30, a Ca2+ signal-inducing surface molecule related to gp82 but devoid of gastric mucin-binding property Shigella dysenteriae, for instance, whose pathogenic potential correlates with its capacity to invade and multiply within cells of the colonic epithelium, adheres preferentially to colonic mucin T. cruzi metacyclic forms bind selectively to gastric mucin in gp82-dependent manner. Here we aimed at addressing that question, at identifying the gp82 sequences involved in gastric mucin-binding, and at investigating the effect of gp82-based synthetic peptides on metacyclic trypomastigote infection in vitro and on oral infection in mice.Studies on oral T. cruzi strain CL 2 atmosphere. Cell invasion assays were carried out as detailed elsewhere 5 HeLa cells. After 1 h incubation with parasites, at multiplicity of infection 10\u22361, the duplicate or triplicate coverslips were fixed in Bouin solution, stained with Giemsa, and sequentially dehydrated in acetone, a graded series of acetone\u2236xylol  and xylol. Cell invasion assays in the presence of gastric mucin were performed with mucin suspended in culture medium.T. cruzi gp82 (GenBank accession number L14824) in frame with gluthatione S-transferase (GST), was produced in E. coli DH5-\u03b1 by transforming the bacteria with a pGEX-3 construct comprising the gp82 gene The recombinant protein J18, containing the full-length o-phenilenediamine and the absorbance at 492 nm read in a Multiscan MS ELISA reader. To check the effective coating with mucin, the mucin-coated microtiter plates (10 \u00b5g/well) were blocked with PBS/BSA and incubated at 37\u00b0C for 1 h with anti-gastric mucin or anti-submaxillary mucin antisera diluted 1\u2236100 in PBS/BSA. Reaction proceeded with peroxidase-conjugated anti-mouse IgG, as described above. For coating with gastric mucin preparation at pH 2.5 citrate buffer was used.Microtiter plates (96 wells) were coated with mucin from porcine stomach  or from bovine submaxillary glands  in PBS (10 \u00b5g/well). After blocking with PBS containing 2 mg/ml bovine serum albumin (PBS/BSA) for 1 h at 37\u00b0C, the plates were sequentially incubated at 37\u00b0C for 1 h with the recombinant protein J18, J18* or C03, with polyclonal monospecific antibody directed to J18, C03 or GST, and with peroxidase-conjugated anti-mouse IgG, all diluted in PBS/BSA. The final reaction was revealed by o-phenilenediamine.Wells of microtiter plates were coated with gastric mucin (10 \u00b5g/well). After blocking with PBS/BSA, the plates were incubated for 1 h at 37\u00b0C with J18 (10 \u00b5g/ml) in absence or in the presence of individual synthetic peptides (200 \u00b5g/ml) corresponding to the gp82 sequence spanning residues 224\u2013333, synthesized as described 7/ml) was added to each well and incubation proceeded for 1 h at 37\u00b0C. Following washes with PBS, the coverslips were fixed in methanol and Giemsa-stained for microscopic visualization of parasites. ELISA assay for metacyclic trypomastigote binding to mammalian mucin was performed as follows: 96-well microtiter plates coated with gastric mucin or submaxillary mucin, at varying concentrations in PBS, were washed in PBS and then 50 \u00b5l of parasite suspension in cell culture medium (5\u00d7107/ml) were added. Following 1 h incubation at 37\u00b0C and washings in PBS, the parasites were fixed with 3.5% formaldehyde for 20 min at room temperature. After washings in PBS, the parasites were sequentially incubated with a monoclonal antibody to T. cruzi surface glycoprotein gp35/50, and peroxidase-conjugated anti-mouse IgG, all of them diluted in PBS/BSA. The final reaction was revealed by o-phenilenediamine. The same protocol was used for inhibition of parasite binding to gastric mucin, in which microtiter plates coated with gastric mucin (10 \u00b5g/well) were incubated with metacyclic forms in absence or in the presence of varying concentrations of the recombinant protein J18 or GST.Twenty four- well plates, containing 13 mm round glass coverslips, were incubated overnight at 37\u00b0C with 100 \u00b5l of gastric mucin or submaxillary mucin, at 400 \u00b5g/ml in PBS. After washings in PBS, a metacyclic trypomastigote suspension in cell culture medium  and incubated for 1 h at 37\u00b0C. Thereafter, the mucin-coated transwell filters were placed onto parasite-containing wells, and 100 \u00b5l PBS were added to the filter chamber. At different time points of incubation at 37\u00b0C, 10 \u00b5l were collected from the filter chamber for determination of parasite number and the volume in this chamber was corrected by adding 10 \u00b5l PBS.Polycarbonate transwell filters  were coated with 50 \u00b5l of a preparation containing 10 mg/ml gastric mucin or submaxillary mucin in water. T. cruzi metacyclic forms by oral route (4\u00d7105 parasites per mouse), using a plastic tube adapted to a 1 ml syringe. Starting on day 10 post-inoculation, parasitemia was monitored twice a week by examining 5 \u00b5l blood samples collected from the tail, at the phase contrast microscope. For detection of parasites in the gastric mucosal epithelium, the stomach of mice inoculated orally with metacyclic forms was collected, fixed with 10% neutral formaldehyde for 24 h. After processing by gradual dehydration in a graded series of ethanol solution, followed by xylene immersion and embedding in parafilm, serial 5 \u00b5m tissue sections were cut and stained with hematoxylin and eosin.Four to five week-old female Balb/c mice, bred in the animal facility at Universidade Federal de S\u00e3o Paulo, were used. All procedures and experiments conformed with the regulation of the institutional Ethical Committee for animal experimentation, and the study was approved by the Committee. Mice were infected with 3 (0.5 mg/mouse) and after two weeks received three additional doses of the antigen plus the same adjuvant at one week interval. Ten days after the last immunizing dose, the mice were bled by heart puncture and the serum collected.Six to eight week-old Balb/c mice were used for immunization with J18, C03, GST, gastric mucin or submaxillary mucin to generate specific antibodies. Mice received the first dose of antigen (10 \u00b5g/mouse) adsorbed in Al(OH)t test, the program GraphPad InStat was used.To determine significance of data by Student's T. cruzi metacyclic forms invade the gastric mucosa but not the mucosa of the oropharynx T. cruzi surface glycoprotein gp35/50 revealed that metacyclic trypomastigotes bound to gastric mucin in a dose-dependent manner whereas binding to submaxillary mucin was negligible at all concentrations tested  in absence or in the presence of each of the 20-mer peptides with 10 overlapping residues, spanning amino acids 224\u2013333 , and theWe tested whether the synthetic peptides p7 and p10, which displayed the highest inhibitory effect on J18 binding to gastric mucin  could in5 parasites/mouse), and the parasitemia levels were monitored. Mice that received peptide p7 developed significantly lower parasitemias than those that received the control peptide p7*  15 min before oral infection with metacyclic forms  affected parasite entry into target cells to a lesser degree than p7. One interesting possibility is that metacyclic trypomastigote binding to gastric mucin through the p7 defined region of gp82 facilitates host cell adhesion, but that adhesion is also dependent upon co-operation from other regions of gp82. The main cell adhesion site of gp82 is the sequence LARLTEELKTIKSVLSTWSK represented by peptide p4 It should be pointed out that the central domain of metacyclic trypomastigote gp82, where the p7 sequence resides, shares considerable sequence similarity with other glycoproteins of gp85 family and trans-sialidase, which are all members of the same superfamily. Analysis using BLASTP to search for sequences homologous to peptide p7 revealed proteins of gp85/trans-sialidase superfamily; therefore, it is possible that a motif similar to that represented by p7 may also be implicated in gastric mucin-binding and be responsible for the low proportion of cases in which cell invasion of metacyclic forms is not inhibited by p7 in the presence of gastric mucin . AnotherT. cruzi infection by the oral route was tested in the mouse model. Mice administered orally with peptide p7 prior to metacyclic trypomastigotes developed low parasitemia levels, in contrast to animals that received the control peptide p7*, with the same composition as p7 but with a scrambled sequence, which developed high parasitemias. The presence of much fewer nests of amastigotes replicating in the stomach epithelium in mice that were given p7, as compared to the number of amastigote nests in mice that received p7*, is an indication that fewer parasites invaded the gastric mucosal epithelium. What possibly occurs is that the presence of p7 interferes with gp82-binding to gastric mucin, precluding the parasite traversal of the mucus layer towards the target cells. Therefore, the gastric mucin-binding property of gp82 may be as critical for T. cruzi infection by the oral route as its cell-binding capacity.The importance of gp82-mediated binding to gastric mucin through the p7 sequence in the establishment of"}
+{"text": "Several lines of evidence point to a particularly important role of the left atrium (LA) in initiating and maintaining atrial fibrillation (AF). This role may be related to the location of pulmonary veins (PVs) in the LA. The aim of the present study was to investigate the action potential (AP) and ionic currents in LA-PV cardiomyocytes isolated from Bio14.6 myopathic Syrian hamsters (36-57 week-old) versus age-matched F1B healthy control hamsters.2 analysis). Myopathic myocytes have shorter AP duration (APD) with smaller ICa,L and INCX than the healthy control. The currents ITO, IK, IK1 and ICa,T are not significantly different in myopathic versus healthy cells.Whole-cell patch-clamp techniques were used to record AP in current-clamp mode and ionic currents in voltage-clamp mode. The results obtained show that in both healthy and myopathic LA-PV tissue spontaneously discharging cardiomyocytes can be found, but they are more numerous in myopathic (9/29) than in healthy hamsters (4/42, p < 0.05 by \u03c72+ channels and may account for contractile dysfunction.Our results indicate that in myopathic Syrian hamsters LA-PV cardiomyocytes are more prone to automatic rhythms. Also, they show altered electrophysiologic properties, which may be due to abnormal Ca On tchannels  thus resHano et al.  reportedCold-immobilization of Bio14.6 myopathic hamsters for 2 hr had a lethal effect . There wmXin\u03b1 gene deletion as detected by a MED64 multi-electrode array system [We have recently reported a study on the mechanisms of arrhythmias in the LA-PV myocardium of mXin-deficient mice induced by brief high frequency electrical drive (30 Hz for 3 sec)  in the ay system . The indy system . However+-Ca2+ exchanger have been considered [+-Ca2+ exchange current was reduced in the LA-PV cardiomyocytes of myopathic hamsters , grant support for the experimental study. JW: general discussion on the experimental works and grant support for the study. CIL: principal investigator of the study, research grant applications to NSC, design of the electrophysiological study, data analysis and interpretation and writing up of the manuscript.YXL: performed most of the experimental works"}
+{"text": "Acromegaly is an acquired disorder related to excessive production of growth hormone (GH) and characterized by progressive somatic disfigurement (mainly involving the face and extremities) and systemic manifestations. The prevalence is estimated at 1:140,000\u2013250,000. It is most often diagnosed in middle-aged adults . Due to insidious onset and slow progression, acromegaly is often diagnosed four to more than ten years after its onset. The main clinical features are broadened extremities (hands and feet), widened thickened and stubby fingers, and thickened soft tissue. The facial aspect is characteristic and includes a widened and thickened nose, prominent cheekbones, forehead bulges, thick lips and marked facial lines. The forehead and overlying skin is thickened, sometimes leading to frontal bossing. There is a tendency towards mandibular overgrowth with prognathism, maxillary widening, tooth separation and jaw malocclusion. The disease also has rheumatologic, cardiovascular, respiratory and metabolic consequences which determine its prognosis. In the majority of cases, acromegaly is related to a pituitary adenoma, either purely GH-secreting (60%) or mixed. In very rare cases, acromegaly is due to ectopic secretion of growth-hormone-releasing hormone (GHRH) responsible for pituitary hyperplasia. The clinical diagnosis is confirmed biochemically by an increased serum GH concentration following an oral glucose tolerance test (OGTT) and by detection of increased levels of insulin-like growth factor-I (IGF-I). Assessment of tumor volume and extension is based on imaging studies. Echocardiography and sleep apnea testing are used to determine the clinical impact of acromegaly. Treatment is aimed at correcting (or preventing) tumor compression by excising the disease-causing lesion, and at reducing GH and IGF-I levels to normal values. Transsphenoidal surgery is often the first-line treatment. When surgery fails to correct GH/IGF-I hypersecretion, medical treatment with somatostatin analogs and/or radiotherapy can be used. The GH antagonist (pegvisomant) is used in patients that are resistant to somatostatin analogs. Adequate hormonal disease control is achieved in most cases, allowing a life expectancy similar to that of the general population. However, even if patients are cured or well-controlled, sequelae  often remain. Acromegaly . This term was proposed by Pierre Marie, a famous French neurologist working in La Salpetri\u00e8re Hospital, in Paris, who published the first description of the disease and its pathology in 1886. It is used when the disease begins in adulthood.Gigantism: when the disease begins during childhood.Prosopectasia : used by Verga, an Italian anatomist, in 1864.Acromegaly is characterized by an acquired progressive somatic disfigurement, mainly involving the face and extremities, but also many other organs, that is associated with systemic manifestations. The disease is related to the excessive production of growth hormone (GH). This GH hypersecretion originates from a monoclonal benign pituitary tumor (adenoma) in more than 90% of cases.Acromegaly is a rare disease, with a prevalence of 40 to 70 cases per million inhabitants and an annual incidence of 3 to 4 new cases per million inhabitants . Howeverpunchinello\" aspect, especially when GH hypersecretion begins prior to closure of the epiphyses.The extremities (hands and feet) are broadened, the fingers are widened, thickened and stubby, and the soft tissue is thickened Figure . The patAcromegaly can cause a variety of symptoms, such as malodorous sweating ; headache ; acroparesthesia ; and joint pain. A progressive deepening of the voice is also observed.Nearly 70% of patients have sweaty, oily skin. Skin thickening is due to glycosaminoglycan deposition and to increased collagen production by connective tissue. Skin tags are frequent and may be a marker of colonic polyps. Raynaud's disease is present in one-third of cases.In response to both GH and IGF-I, periosteal new bone formation leads to an increase in skeletal growth, especially at the level of the mandible (prognathism); jaw thickening, teeth separation, frontal bossing, malocclusion, and nasal bone hypertrophy are the usual facial bony deformities seen in acromegaly Figure .Radiography shows a thickening of the cranial vault and protuberances, frontal internal hyperostosis, condensation of the walls of the sella turcica with clinoid hypertrophy. Hypertrophy of the sinuses, especially the frontal sinuses, is also clearly visible. This, along with laryngeal hypertrophy, explains why the voice in acromegaly tends to become deeper and has a sonorous resonance.These changes are not only due to soft tissue hypertrophy and excess growth of bone and cartilage but also to bone deformation. Indeed, radiography is abnormal in half of the cases, showing distal tufting of the phalanges, widening of the base of phalanges with osteophyte formation, enthesopathy , widening of diaphysis in cortical bone, and widening of joint spaces due to cartilage hypertrophy .Bony deformation also affects the spine, with upper dorsal kyphosis and compensatory lumbar hyperlordosis. Vertebral enlargement, widened intervertebral spaces and osteophyte formation also being observed. The thorax is deformed due to protuberance of the lower portion of the sternum, and by elongation and divergence of the ribs  Figure .Imaging studies show diaphyseal cortical thickening of the long bones and widened joint spaces, sometimes with osteophytes.Bone remodeling is stimulated in acromegaly. Cortical bone thickens  and its porosity is diminished. The trabecular bone mass may be decreased, normal or increased. Measurement of spinal bone mass can give contradictory results, probably because acromegaly is often associated with other endocrine disorders that interfere with bone mass. In general, bone mass is normal in the lumbar spine in patients with isolated acromegaly, but is decreased in patients with associated hypogonadism , as it iPeripheral joint symptoms are very frequent ,14. ArthPhysical examination of joints often provides little information. The abnormalities are generally minor as compared to the subjective functional discomfort. The shoulders and hips may show a loss of mobility and function. In contrast, some patients have joint hyperlaxity. There is no correlation between the presence (or severity) of arthropathy and the age of onset of acromegaly, or the mean GH or IGF-I concentration at baseline or during follow-up. Arthropathy appears to be more frequent after age of 45 years.Radiological studies show a widening of the joint spaces, reflecting hypertrophy of the hyaline cartilage, the presence of osteophytes, bone proliferation at the attachment sites of tendons and ligaments, periarticular calcium deposit and exostosis of the bone surface. The joint space subsequently diminishes due to destructive arthropathy. Sonography shows a thickening of the cartilage in the shoulder, wrist and knee joints, which improves during treatment for acromegaly .The arthropathy progresses inexorably in advanced stages and unpredictably in minor forms. It is not influenced by successful treatment of acromegaly, with the exception of diffuse articular symptoms and some sites of pain.The estimated prevalence of spinal involvement is about 40% to 50%. Backache is more frequent at the level of the lumbar spine than cervical or dorsal spine. The pain is mainly mechanical in nature, but inflammatory features can occur (16%). Spinal involvement may be accompanied by nerve compression. Occasionally, bilateral intermittent claudication reveals lumbar spinal stenosisRadiological examination shows typical features: ossification of the anterior and lateral surface of the vertebral bodies contributing to enlarging their anteroposterior diameter; a biconcave vertebral appearance and scalloping of the vertebral bodies . The mechanism is poorly understood, and may involve hypertrophy of the intraspinal soft tissues  or of the bone. In more severe cases, the process of ossification of the anterior surface of the vertebral bodies can bridge the disc space and give the aspect of diffuse idiopathic skeletal hyperostosis.Symptomatic carpal tunnel syndrome is frequent . Nerve conduction studies have documented that the vast majority of acromegalic patients have subclinical abnormalities of nerve conduction. Magnetic resonace imaging (MRI) shows an increase in the amplitude and intensity of the median nerve signal in the patients with symptomatic carpal tunnel syndrome compared to asymptomatic patients . The mecHypertension occurs in 20% to 50% of patients. Its prevalence increases with time after the onset of acromegaly, the GH level, and age. It is at least partly due to chronic hypervolemia  ,18. HypeCardiac involvement is a consistent feature of acromegaly. Many lines of evidence, especially from experimental studies, point to the existence of specific cardiac disorders in acromegaly, independently of coronary involvement (found in a minority of patients nowadays) and valve disorders ,22,23.Initially, the cardiac involvement is asymptomatic (at least at rest), and consists mainly of myocardial hypertrophy , as assessed by echocardiography, but the dimensions of the left ventricle are normal (concentric hypertrophy). It can occur in the absence of hypertension, and even in young patients (< 30 years), reflecting the role of GH itself on the myocardium. Hypertension further aggravates cardiac hypertrophy. Echocardiography and isotope studies show altered diastolic function  related to abnormal relaxation . Clinical symptoms such as dyspnea during exercise may be observed while the patient is asymptomatic at rest. Systolic function is normal at this stage , thanks to increased myocardial contractility. A hyperkinetic syndrome (increased cardiac index) is always present. Systolic function is altered during exercise, however. Even at this early stage, arrhythmias and/or conduction disorders may occur. Their prevalence in acromegaly was underestimated for many years. In fact, ventricular premature complexes occur in about 40% of patients with acromegaly, and, in one study, systematic 24 h Holter electrocardiogram (ECG) recordings showed complex ventricular arrhythmias in 48% of patients (compared to only 12% of controls). Most of these arrhythmias are subclinical and persist despite successful treatment of acromegaly. Myocardial remodeling, hypertrophy and fibrosis all are likely to play a role in their onset.Congestive heart failure can occur if the cardiac disorders progress ; functional signs appear on effort at first, before becoming permanent. At this stage, echocardiography shows variable degrees of cavity dilation. Fortunately, these severe forms are now far less frequent  .A number of cardiovascular parameters improve during effective treatment of acromegaly, even if some lesions may appear to be irreversible in certain patients. In general, younger patients and patients with a relatively short history of acromegaly show better \"recovery\" . In contrast, when dilated congestive heart failure occurs, cardiac function  may show a short-term improvement, allowing some patients to survive or to avoid heart transplantation, but the longer-term prognosis is worse than that of patients with heart failure due to other causes .The increased prevalence of valve disorders can also contribute to the onset or aggravation of the heart disease in patients with acromegaly . The risPhysiologically, GH increases blood glucose levels, exerts a lipolytic effect, and promotes triglyceride hydrolysis into free fatty acids and glycerol.\u03b2 cells counterbalances the reduction in insulin sensitivity, glucose tolerance remains normal. Impaired glucose tolerance occurs when insulin secretion is altered, and is followed by diabetes. There is a link between glucose tolerance, hypertension and acromegalic cardiomyopathy [GH excess leads to insulin resistance at the level of the liver or in the periphery that leads to hyperinsulinemia. The prevalence of diabetes in acromegalic patients ranges from 20% to 56%, and that of glucose intolerance ranges from 16% to 46%, depending on the series . As longAcromegaly is associated with decrease in fat mass and increase in lean body mass .Sleep apnea affects 60%\u201380% of all patients with acromegaly (more often men) and 93% of patients with signs of this disorder. Sleep apnea is more likely to be sought in patients who snore  and those with daytime sleepiness (51%), or morning fatigue and morning headache (16%). Sleep apnea may be a contributory factor in hypertension and cardiovascular disease. In most cases the apnea is obstructive, but one-third of patients have central apnea. Obstructive apnea is linked to anatomical changes due to mandibular and maxillary growth, soft-tissue thickening  and changes in the angles of the different bone segments, leading to hypercollapsibility of the posterior and lateral hypopharyngeal walls. Hypertrophy of the tongue also plays a role , as doesChanges in respiratory function are frequent but less well documented. Anatomical modifications of thoracic bones and cartilage (leading to profound changes in the geometry of the rib cage) and mechanical changes in thoracic elasticity and inspiratory muscles can lead to ventilatory disorders. Respiratory muscle strength is also abnormal. The inspiratory time is shorter and the breathing frequency may increase.Patients with acromegaly often have an increase in their total lung capacity (81% of men and 56% of women), owing to an increase in alveolar volume. An obstruction is found in 20% to 30% of patients . Subclinical hypoxemia may be present. No ventilation-perfusion mismatching has been demonstrated.The apnea-hypopnea index improves during effective treatment of acromegaly, along with the obstructive apnea index and oximetry values ,29. HoweThe issue of colon cancer risk in acromegaly is controversial . The relGoiter is found in 25% to 90% of patients with acromegaly. The risk of developing thyroid nodules increases with the time since the onset of acromegaly. Multinodular goiter is autonomous in 10% to 20% of patients, sometimes causing patent thyrotoxicosis. Thyroid nodules are generally harmless, and the risk of thyroid cancer does not seem to be higher than in the general population.Other cancers  are not over-represented in patients with acromegaly [romegaly .More than 95% of patients with acromegaly have a benign monoclonal pituitary adenoma which develops from the somatotrope cells that normally produce GH in the pituitary. Thus, these adenomas are termed somatotrope adenoma.Somatotrope pituitary adenomas may be pure or mixed. Pure somatotrope pituitary adenomas (60%) contain either cells rich in secretory granules that show diffuse immunostaining (such densely granulated somatotrope adenoma are observed in older patients with slow disease progression) or cells poor in secretory granules with scattered immunolabelling (sparsely granulated somatotrope adenomas are seen in younger patients with a more rapidly progressing disease) . Some ofSome adenomas are mixed. Mixed GH- and prolactin (PRL)-secreting adenomas are frequent (25%). Some adenomas contain both cell types, while other develop from a mammosomatotropic stem cell and consist of more mature monomorphic cells that express both GH and PRL . Rare adIn the large majority of cases adenomas are benign. Exceptional pituitary carcinomas (less than 20 cases published) may be observed and the presence of distant metastases is generally required to support the diagnosis of malignancy .Some somatotrope adenomas are not associated with systemic GH hypersecretion or GH hypersecretion is very mild. In such cases, clinical acromegaly is not observed, but GH immunolabeling of the excised tumor  is positive . However\u03b1 protein has been identified in up to 40% of somatotrope adenomas. Mutations at two critical sites (gsp mutations) inhibit GTPase activity and lead to constitutive adenyl-cyclase activation [PTTG, pituitary tumor transforming gene), also play a role. This latter gene (a securin homolog) is over-expressed in functional pituitary tumors, which could lead to aneuploidy [The pituitary/hypothalamic origin of these adenomas is controversial . Some litivation . In the euploidy ; the degFinally, even if it is clear that somatotropes cells are altered in somatotrope adenomas, the sequence of events leading to their clonal expansion seems to be multifactorial. An activated oncogene may be necessary to initiate tumorigenesis, while promotion of cell growth may require GHRH or other growth factors, such as bFGF (basic fibroblast growth factor) ,47.caf\u00e9-au-lait spots, can be accompanied by acromegaly. This syndrome is related to a somatic mutation that activates the alpha subunit of Gs protein [McCune-Albright syndrome, which is associated with multiple fibrous bone dysplasia, precocious puberty and  protein .e.g. gastrinoma, insulinoma or a non-functional pancreatic tumor), adrenal and other endocrine and non-endocrine tumors in patients with multiple endocrine neoplasia type 1 (MEN1), which is related to a germline mutation of the menin gene in many cases [Acromegaly can also be associated with hyperparathyroidism, neuroendocrine tumors  [When acromegaly is associated with bilateral pigmented micronodular adrenal hyperplasia (causing ACTH-independent hypercorticism) and with cutaneous lesions or cardiac myxomas, the patient should be screened for the Carney complex, which is often related to a germline mutation of the regulatory 1-PRKAR1A) ,52.AIP (aryl hydrocarbon receptor interacting protein) gene have been described [Very recently, familial acromegaly related to germline mutations of the escribed . These mescribed -56.etc.) or, more often, to ectopic, peripheral GHRH hypersecretion  that stimulate the normal somatotropes to become hyperplastic and to hypersecrete GH. The diagnosis is based on plasma GHRH assay  and on identification of the GHRH-secreting endocrine tumor [GH hypersecretion does not always have a pituitary origin. Acromegaly can be due to eutopic hypothalamic GHRH hypersecretion  or, in exceptional cases, by a peripheral tumor (pancreatic islet tumor or lymphoma) ,59.The diagnosis of acromegaly is clinical and needs to be confirmed biochemically. Clinical diagnosis is suggested by the typical disfigurement of the patient related to progressive acral enlargement and modification of facial appearance, as assessed by serial photographs. Diagnosis is made biochemically by the findings of increased serum GH concentrations that are not suppressed following an oral glucose load . An increase  in the serum concentration of IGF-I), the main GH-dependent growth factor, confirms the diagnosis.The first GH assays, which began to be used 35 years ago, were polyclonal competitive radio-immunoassays (RIAs); their sensitivity was poor. Thereafter, over the last 25 years, non-competitive two-site antibody radioimmunometric assays (IRMAs) have been introduced allowing for enhanced sensitivity. Fifteen years ago, non-isotopic two-site antibody assays began to become available, with the major practical advantage being that some were automated . This la\u03bcg/l of IS 98/574 (1 \u03bcg corresponding to 3 IU somatropin)\".Many standard GH preparations were used previously to calibrate GH. Manufacturers were recently advised to calibrate their GH assay kits with the international standard (IS) 98/574, which was established with recombinant GH. According to a recent European consensus statement on the standardization of GH assays , \"the av\u03bcg/l (90 mIU/l)  plus a normal IGF-I level rules out acromegaly. If the GH is above 0.4 \u03bcg/l (1.2 mIU/l) and/or if the IGF-I is elevated , an oral 75 g glucose load  must be performed. If the lowest GH value (nadir) during OGGT is below 1 \u03bcg/l (3 mIU/l), acromegaly can be ruled out. If it remains above 1 \u03bcg/l (3 mIU/l), acromegaly is confirmed. As detailed below, with the generalized use of very sensitive assays nowadays, it has recently been considered that this cutoff should be decreased to 0.3 \u03bcg/l (0.9 mIU/l). Paradoxically, the OGTT can stimulate GH secretion in about 10% of patients with acromegaly.The basal plasma GH level  is elevated in acromegaly. However, high GH concentrations can also be found in healthy subjects, owing to the episodic nature of GH secretion, that can fluctuate between undetectable levels (most of the time) and peaks of up to 30 ) Figure . AccordiThe IGF-I level increases in parallel to the log of the GH concentration. It must be determined using age-adjusted norms . Pregnancy, puberty and the post-pubertal period are accompanied by high IGF-I concentrations. The concentration of IGFBP3, the main IGF carrier protein, is usually increased in patients with acromegaly, but this marker offers little further diagnostic information.Some patients (up to 50%) have an increase in their GH concentration after thyrotropin-releasing hormone (TRH) and/or gonadotropin-releasing hormone (GnRH) stimulation. These tests have no diagnostic value, however, nor does the response to GHRH.\u03bcg/l (3 mIU/l) during OGTT [\u03bcg/l, i.e. 0.3 to 0.9 mIU/l), the OGTT positivity cutoff should not be 1 \u03bcg/l (3 mIU/l) but rather 0.30 \u03bcg/l (1 mIU/l) [\u03bcg/l cutoff (1 mIU/l) when using very sensitive GH assays.A few patients with clear clinical signs of acromegaly and a high IGF-I level have a GH nadir of <1 ing OGTT . Thus, s1 mIU/l) . ForthcoOther difficult problems include a typical clinical picture of acromegaly in a patient with normal IGF-I and GH concentrations. This situation probably corresponds to cases in which acromegaly has resolved spontaneously, probably through necrosis of a pituitary adenoma.In some conditions such as diabetes mellitus, chronic renal failure, pregnancy or at the time of puberty, GH and/or IGF-I measurement cannot be used neither for the diagnosis nor for the assessment of treatment efficacy.Lastly, some patients have acromegaloid features with normal GH and IGF-I levels ; in some cases, severe insulin resistance is the proposed mechanism.Once the diagnosis has been established, and before initiating treatment for acromegaly, patients must undergo a dual work-up focusing on both the tumor and pituitary function.Headache is very frequent, and is typically retroorbital or frontal. It is linked to the adenoma and also to GH hypersecretion itself.When the adenoma grows upwards it can compress the optic chiasm, leading to visual field disturbances, which begin in the mid-periphery of the superior temporal sectors, then progress to bitemporal hemianopsia Figure . PersistIn the case of a huge tumor with suprasellar extension into the third ventricle obstructing the foramen of Munro, hydrocephaly can occur. Infrasellar extension can lead to sellar floor lysis and invasion of the sphenoid sinus, with the risk of cerebrospinal fluid rhinorrhea. Lateral extension of the adenoma into the cavernous sinus, which is far more frequent, can compress the III, IV, V, or VI cranial nerves, or even the temporal lobe .Frontal and profile radiography of the sella turcica should nowdays be abandoned. When formerly performed, they showed an increase in the size of the sella, demineralization of its walls, or local erosion; in patients with very large tumors, the contour of the sella turcica can disappear completely; asymmetrically growing tumors produce a double countour  or obliquity of the sellar floor .MRI is tending to replace computed tomography for imaging in this setting. It is currently the neuroradiological examination of choice for all patients with pituitary adenomas, and especially for acromegalic patients.Microadenomas (< 10 mm diameter) appear as rounded, well-circumscribed, homogeneous and discreetly hypointense abnormalities on T1-weighted images ; sometimes the adenoma is iso-intense in T1-weighted images and thus difficult to distinguish from normal pituitary before contrast injection. It can be hypo-, iso- or hyperintense on T2-weighted images. After gadolinium injection, microadenomas appear hypointense relative to the rest of the brain parenchyma Figure  and espeMacroadenomas (> 10 mm diameter) are generally iso-intense as compared with the rest of the white matter of brain parenchyma on unenhanced T1-weighted images. Gadolinium contrast medium is intensely taken up by these lesions, which appear hyperintense in comparison with the rest of the white matter of brain parenchyma Figure .MRI can be used to study possible suprasellar expansion, upwards towards the suprasellar cisterna and the chiasma, which may be compressed, pushed back, or laminated. Extension downwards towards the sphenoid sinus and laterally to the cavernous sinus should also be evaluated. Invasion of the cavernous sinus is difficult to diagnose, as the adenoma may appear to invade the cavernous sinus when it simply abuts the lateral wall. The only indisputable sign of cavernous sinus invasion is when the internal carotid artery appears completely surrounded by the adenoma.The lack of clear signs of an adenoma on MRI, or an appearance showing a bulging, hyperplastic pituitary Figure , suggestBy developing in the sellar fossa, the adenoma compresses the healthy pituitary  and can alter physiological pituitary secretion. A gonadotrope deficiency will cause sexual dysfunction and decreased plasma testosterone levels in men, and menstrual disorders in women (amenorrhea in some cases) together with a decline in estradiol levels (without rise in gonadotrophin levels). Thyrotrope deficiency is diagnosed by a decrease in T4 levels, while the TSH level is in the normal range. Corticotrope deficiency can be evaluated by measuring morning plasma cortisol levels and/or testing with metyrapone, corticotropin-releasing hormone (CRH) or ACTH, according to each center habits.Prolactin (PRL) hypersecretion is present in 30% of cases, either functional , or due to a mixed adenoma secreting both PRL and GH. Free alpha-subunit is hypersecreted in 20% to 40% of cases of acromegaly. Hypersecretion can also affect TSH, both PRL and TSH or, in very rare cases, gonadotrophins or ACTH.\u03bcg/l or 6 mIU/l (or even 1 \u03bcg/l or 3 mIU/l) and the IGF-I level must return to normal [The clinical aims are to relieve symptoms, to reduce the volume of the pituitary tumor, to avoid tumor relapse, and to improve long-term morbidity and mortality. Recent epidemiological studies helped to refine the definitions of \"cure\" and good disease control, which are now far more precise: the GH concentration  must return to less than 2 o normal . A stepwi.e. <10 \u03bcg/l or 30 mIU/l), and the surgeon's experience. Endoscopic techniques are now currently used in the majority of expert centers [Tumor excision, usually by the trans-sphenoidal route, is the most rapid way of reducing GH and IGF-I concentrations in patients with acromegaly. Nevertheless, these levels normalize in only 40% to 70% of cases -69, depe centers .Surgical outcome is carefully assessed at three months. When surgery fails to achieve good disease control, or when surgery is impossible or contraindicated, patients are offered radiotherapy and/or pharmacological treatments.\u03bcg/l (6 mIU/l) and normal IGF-I levels in 5% to 60% of patients, depending on the series, after a median follow-up of about 7 years [Radiotherapy in this setting is generally external and centered on the tumor; an average total dose of 50 Gy is delivered in about twenty five daily sessions. Highly focused irradiation  is now available in some centers, and causes less damage to neighboring tissues. Fractioned irradiation yields GH concentrations below 2  7 years -75. In sRadiotherapy leads to variable degrees of anterior pituitary insufficiency in 80% to 100% of patients after 10\u201315 years. Complications such as radionecrosis and optic neuropathy are now very rare. In contrast, the risk of stroke may be increased, sometimes many years after irradiation .e.g. with a gamma-knife) is becoming clearer [\u03bcg/l (<6 mIU/l). In any event, this \"radiosurgery\" is reserved for patients with small lesions located at least 5 mm from the optic chiasma.The precise role of stereotactic irradiation in this setting , on somatotrope adenoma cells. These drugs exert their antisecretory and antitumoral effects by acting on SST 2 and 5.\u00ae) can be injected subcutaneously (SC), generally by the patient him/herself, at a dose of 100 to 200 \u03bcg two or three times a day. This was the first such analog to be marketed, in the 1980s, and represented a real therapeutic advance [\u00ae LP 30 mg) was the first slow-release preparation to be marketed. It was injected intramuscularly every 10 to 14 days (the frequency of injections depends on the impact on the GH concentration). Lanreotide is now available for deep SC injection every 28 days, at doses of 60, 90 and 120 mg . Octreotide LAR (Sandostatin\u00ae LAR 10\u201320 or 30 mg) is the sustained-release version of octreotide, and is administered intramuscularly, once a month. Treatment is usually started at the median dose, and is then adjusted (decreased or increased) according to the GH concentration. Alternatively, it is possible to increase or decrease the frequency of injections.\u2022 Available preparations. Octreotide (Sandostatin advance . Sustain\u03bcg/l (5 mIU/l) in 60% to 70% of patients, and normalize IGF-1 levels in 50% to 80% of patients [\u2022 These drugs achieve GH concentrations below 2 patients -90. Besipatients ,91. The patients .\u2022 In selected cases , life expectancy merges with that of the matched general population [Acromegaly is associated with increased mortality . Accordipulation ,101. Higpulation . Qualitypulation . Finallypulation . HoweverACTH: corticotrophin; AIP: aryl hydrocarbon receptor interacting protein; CG: chorionic gonadotropin hormone; CRH: corticotropin-releasing hormone; ECG: electrocardiography; ELISA: enzyme-linked immunoabsorbent assay; FSH: follicle-stimulating hormone; GH: growth hormone; GH-BP: GH-binding protein; GHRH: growth hormone-releasing hormone; GnRH: gonadotropin-releasing hormone; ICMA: immunochemiluminescent assay; IGF-I: insulin-like growth factor I; IRMA: immunoradioimmunometric assay; IS: International Standard; LH: luteinizing hormone; MEN1: multiple endocrine neoplasia type 1; MRI: magnetic resonace imaging; OGTT: oral glucose tolerance test; PRL: prolactin; PRKAR1A: 1-a subunit of protein kinase A; PTTG: pituitary tumor transforming gene; RIA: radio-immunoassay; TRH: thyrotropin releasing hormone; TSH: thyroid-stimulating hormone; SST: somatostatin receptor subtypesThe Service d'Endocrinologie et des Maladies de la Reproduction, Universit\u00e9 Paris-Sud 11, receives unrestricted educational and research grants from Novartis, Ipsen and Pfizer. PC received consulting and lecture fees from Novartis, Ipsen and Pfizer. SS has nothing to declare.The two authors equally contributed to this review article. They read and approved the final version of the manuscript.Written consent for publication of photographs was obtained from the patients."}
+{"text": "Objective: This study aims to contextualize an unintended intraoperative electrocautery burn that occurred on our service within the spectrum of all intraoperative electrocautery burns. Methods: A case report of the incident was drafted, and the relevant literature present in PubMed and industry publications was reviewed. Results: Intraoperative electrocautery burns can be divided into 4 categories: (1) direct contact burns resulting from inappropriate operator use of the active electrode, (2) burns at the grounding electrode site due to improper attachment or placement, (3) burns resulting from electrode heating of pooled solutions, and (4) burns occurring outside the operative field as a result of circuits generated between the active electrode and an alternate grounding source. We herein report an unintended intraoperative electrocautery burn of the fourth category. An aberrant intraoperative circuit utilized previously placed in-dwelling titanium plating in the patient's right brow as the grounding electrode, resulting in 3 \u00d7 3-cm full-thickness skin necrosis overlying the site of hardware implantation. Conclusions: Literature recommendations to reduce this type of electrocautery burn suggest avoiding grounding pad placement on the forearm and lateral thigh, although further investigation is needed to determine optimal grounding electrode placement with respect to known indwelling hardware. The patient is 14-year-old girl with a complex medical and surgical history notable for Chiari malformation, sagittal sinus thrombosis, hydrocephalus, secondary craniosynostosis, and seizure disorder. Of note, several titanium plates remained in her left and right frontal, temporal, and parietal regions following full cranial expansion in June 1993 with subsequent plate and screw revision in June 1994. She had multiple ventriculoperitoneal and lumbarperitoneal shunt revisions beginning in 1995, and underwent cervicomeduallry decompressions in August 1998 and January 2004. In March 2005, she presented with recurrent symptoms of severe headache and vomiting. Magnetic resonance imaging revealed a collection of scar tissue at the cervicomedullary junction. Accordingly, she underwent cervicomedullary exploration and decompression for her Chiari malformation from an occipital approach. She was placed in the prone position with her head resting on a well-padded Mayfield horseshoe. One grounding pad was applied on the left thigh. Her surgery proceeded without incident. Total operating time was 1.5 hours. When she was turned over at the conclusion of surgery, one area of erythema was noted on the right side of her forehead. Plastic surgery was considered. A swollen 3 \u00d7 3-cm triangular area of brown dermis with visibly coagulated veins was noted above her right brow  direct contact burns in the operative field resulting from inappropriate operator use of the active electrode, (2) burns at the grounding electrode site due to improper indifferent electrode attachment or placement, (3) burns resulting from either the active or indifferent electrode heating pooled solutions, and (4) burns occurring outside the operative field as a result of aberrant intraoperative circuits generated between the active electrode and an alternate grounding source . We herein report an unintended intraoperative electrocautery burn of the fourth category, in which an aberrant circuit utilized previously placed indwelling titanium plating in the patient's right brow as the grounding electrode. This circuit resulted in 3 \u00d7 3-cm full-thickness skin necrosis overlying the site of hardware implantation. To our knowledge, this is the first report of its kind in the English language literature. Such alternate-site burns result from highly variable and currently unpredictable intraoperative circumstances. Literature recommendations to reduce intraoperative electrocautery burns suggest avoiding grounding pad placement on the forearm and lateral thigh. Considering alternate-site burns, further investigation is needed to determine optimal grounding electrode placement with respect to both operative site and known indwelling hardware."}
+{"text": "In 1996 the guideline 'The Red Eye' was first published by the Dutch College of General Practitioners. The extent to which general practitioners adhere to this guideline is unclear. Recently, data on the management of infectious conjunctivitis by general practitioners became available from the Second Dutch National Survey of General Practice. We measured the age-specific incidence of infectious conjunctivitis, described its management by Dutch general practitioners, and then compared these findings with the recommendations made in the guideline.In 2001, over a 12-month period, data from all patient contacts with 195 general practitioners were taken from electronic medical records. Registration was episode-oriented; all consultations dealing with the same health problem were grouped into disease episodes. Data concerning all episodes of infectious conjunctivitis (ICPC-code F70 and sub codes) were analysed.Over one year, 5,213 new and recurrent episodes of infectious conjunctivitis were presented to general practitioners from a population of N = 375,899, resulting in an overall incidence rate of 13.9 per 1000 person-years, varying from more than 80/1000 py in children up to one-year old, to less than 12/1000 py in children over the age of 4. Topical ophthalmic ointments were prescribed in 87% of the episodes, of which 80% was antibiotic treatment. Fusidic acid gel was most frequently prescribed (69%). In most episodes general practitioners did not adhere to the guideline.In 2001, the management of infectious conjunctivitis by Dutch general practitioners was not in accordance with the recommendations of the consensus-based guideline published five years previously, despite its wide distribution. In 2006 this guideline was revised. Its successful implementation requires more than distribution alone. Probably the most effective way to achieve this is by following a model for systemic implementation. The guideline entitled 'The Red Eye' was first published by the Dutch College of General Practitioners in 1996 . Data onThe study took place within the framework of the Second Dutch National Survey of General Practice, which was carried out in 2001 by the Netherlands Institute for Health Services Research (NIVEL) in collaboration with the National Information Network of General Practice (LINH). It included 61 general practices participating in the LINH network, and 43 additional general practices especially recruited for this survey. Thus, 104 general practices participated, with a total of 195 (164.75 FTE) general practitioners, and about 390,000 patients. This sample constitutes a representative group of Dutch primary care physicians , with a slight under-representation of single-handed general practitioners. All participating practices were computerised, had electronic patient files, and an electronic prescription system used for diagnosis-related prescribing. Data were extracted from all electronic medical records from each participating practice over a period of one year . Study design and methods of the survey have been published in more detail elsewhere[Data about all patient contacts included information on diagnosis, referrals, and prescriptions. Diagnoses were coded according to the International Classification of Primary Care (ICPC). A contact was defined as a face-to-face consultation of the patient with a general practitioner; contacts by telephone and contacts between patients and the medical receptionist were registered as a contact only if they led to a prescription or a referral. The registration was episode-oriented; all consultations dealing with the same health problem were grouped into disease episodes. The participating general practitioner decided whether a contact belonged to an existing disease episode or was the beginning of a new episode. A disease episode was coded by the diagnosis made at the most recent contact of that episode. Data on all episodes of infectious conjunctivitis (ICPC-code F70 and sub codes), age and sex of the patient, season, number of contacts with the general practitioner, prescriptions and referrals, were extracted.The incidence of infectious conjunctivitis is represented as an incidence rate (per 1000 person-years). The numerator concerns new and recurrent episodes. A recurrent episode is a second (or even third or more) isolated episode of infectious conjunctivitis in the same patient within the one-year registration period. The denominator concerns the mid-time population size based upon the size and composition of the population at the start and at the end of the one-year registration period. The sex-specific incidence rate differences in age groups  were calculated to investigate any difference between incidence rates in men and women in each age group. The season-specific incidence rate difference, spring and summer (from April to September) versus autumn and winter (from October to March), was also calculated.The Poisson distribution was used to calculate the 95% confidence intervals of the incidence rates. Statistical analyses were performed using SPSS (version 11.5.2). We used Stata (version 9.1) to calculate the incidence rates and rate differences and their 95% confidence intervals.In a one-year period, 5,213 new and recurrent episodes of infectious conjunctivitis were registered in a mid-time population of N = 375,899. The patients were representative of the general population in terms of age, sex and type of health care insurance (public/private). The incidence rate of infectious conjunctivitis was 13.9 episodes per 1000 person-years (95% CI: 12.5 to 15.3). The majority of the patients (96.1%) had one episode, 3.6% had two episodes, and 0.3% had three or more episodes of infectious conjunctivitis within one year. Table Figure Sixty-eight percent of the first contacts in an episode were registered as \"infectious conjunctivitis\", 26% as bacterial conjunctivitis and 6% as viral conjunctivitis. Most episodes (87%) consisted of one registered contact between patient and general practitioner.General practitioners prescribed a topical ophthalmic ointment to almost 87% of the patients with infectious conjunctivitis, 80% of which was antibiotic treatment Figure . FusidicOf all patients with one or more episodes of infectious conjunctivitis, 1.9% (n = 121) were referred to secondary care with a referral diagnosis 'infectious conjunctivitis'. Of these patients, 85% were referred to an ophthalmologist. There was no difference in referral rate per 1000 episodes in women compared to men, referral rate difference: 3.4 (95%CI: -5.1 to 11.8). Most referrals took place in the 25\u201344 year and 45\u201364 year age groups, 29% and 29% respectively.These results show that in most episodes of infectious conjunctivitis general practitioners do not adhere to the guideline. In 21% of episodes, general practitioners registered bacterial conjunctivitis in the electronic medical record. However, in more than two-thirds of all episodes general practitioners prescribed a topical antibiotic. Furthermore, fusidic acid was by far the most frequently prescribed antibiotic, which differs from the first choice antibiotic in the guideline.The results show that, in 2001, five years after the publication of the guideline, the management of infectious conjunctivitis by general practitioners was predominantly not according to the guideline. Patients with infectious conjunctivitis received antibiotic treatment in almost 70% of episodes making the total number of prescriptions for antibiotics by general practitioners remarkably high. It is in contrast with the guideline's recommendations to limit the prescription of antibiotics to those patients with suspected bacterial involvement [The contrast between the guideline and daily practice may be explained as follows. The advice on treatment in the guideline was not based on randomised trials in patients typical of those seen in primary care, and therefore publications on this subject might not have caught the attention of general practitioners. Assumptions made in the guideline on the symptoms indicative of a diagnosis of infectious conjunctivitis, bacterial conjunctivitis in particular, were based on consensus. In a literature search we found no evidence to back up these assumptions . FurtherSurprisingly, 5% of all prescribed treatments contained corticosteroids, with or without antibiotics. It should be emphasised that this treatment for infective conjunctivitis is not recommended by our guidelines, and the general opinion is that corticosteroid prescriptions should only be initiated by ophthalmologists, after careful evaluation. The reasons for general practitioners to prescribe corticosteroids cannot be evaluated within our data. Possibly these prescriptions were repeat prescriptions first issued by ophthalmologists.The strength of this study is that the results can be extrapolated to the general Dutch population and Dutch general practitioners and probably also to other Western European countries. The population and general practices studied are representative of the Dutch situation. Furthermore, a Dutch study has shown that no differences exist in working style between those general practitioners who participated in a registration network and those who did not. This also holds for general practitioners working in computerised or non-computerised practices . HoweverAnother limitation might be the fact that only face-to-face consultations were registered. Contacts by telephone and with the receptionist that did not lead to a well-defined action were not registered. For example, a question from a patient about a red eye which did not lead to any action by the general practitioner or receptionist would have been missed. Therefore, there might be some under-representation of cases of infectious conjunctivitis in which no treatment was given. However, this proportion of patients will be small. First, only 15% of all contacts were telephone contacts . Second,Over two-thirds of the episodes of infectious conjunctivitis were treated with topical antibiotics, almost seventy percent of those with fusidic acid. Although not comparable to the Second Dutch National Survey of General Practice, an English study performed in January 2001 indicates that the total number of prescriptions by English general practitioners might even be higher. In this postal questionnaire survey on the management of acute infectious conjunctivitis among of 303 general practitioners in Southern England, 95% of the 234 responding general practitioners indicated they usually prescribed topical antibiotics for acute infectious conjunctivitis . In factIn 2003 in the United Kingdom, chloramphenicol and fusidic acid gel were the first and the second most prescribed topical ocular antibiotics. About 25% of all topical ocular antibiotic prescriptions were for fusidic acid . This isThe prescription policy of Dutch general practitioners may be explained by the fact that fusidic acid gel needs to be administered less frequently than chloramphenicol eye drops, and also, it appears to have no serious adverse effects .Staphylococcus aureus, accounting for 13 of the 58 isolates [After the guideline appeared, the results of two trials, conducted in primary care were published, ,22. Thesisolates . Rose etThe question is whether general practitioners should prescribe antibiotics at all to patients with infectious conjunctivitis. The prevalence of bacterial origin in our trial was 32% . In a siIn 2006 the 'The Red Eye' guideline was revisited . An majoIn conclusion, over two-thirds of episodes of infectious conjunctivitis are treated with topical antibiotics, almost seventy percent of these with fusidic acid. This is at odds with the recommendations of the Red Eye guideline and recently published evidence on this subject. If the patient specifically wants antibiotics then they should only be prescribed if there is a high probability of a bacterial origin.The author(s) declare that they have no competing interests.RPR and GtR analyzed the data and RPR wrote the first draft of the manuscript. All other authors gave comments on the first to the last versions of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:"}
+{"text": "The Gene Ontology is the most commonly used controlled vocabulary for annotating proteins. The concepts in the ontology are organized as a directed acyclic graph, in which a node corresponds to a biological concept and a directed edge denotes the parent-child semantic relationship between a pair of terms. A large number of protein annotations further create links between proteins and their functional annotations, reflecting the contemporary knowledge about proteins and their functional relationships. This leads to a complex graph consisting of interleaved biological concepts and their associated proteins. What is needed is a simple, open source library that provides tools to not only create and view the Gene Ontology graph, but to analyze and manipulate it as well. Here we describe the development and use of GOGrapher, a Python library that can be used for the creation, analysis, manipulation, and visualization of Gene Ontology related graphs.An object-oriented approach was adopted to organize the hierarchy of the graphs types and associated classes. An Application Programming Interface is provided through which different types of graphs can be pragmatically created, manipulated, and visualized. GOGrapher has been successfully utilized in multiple research projects, e.g., a graph-based multi-label text classifier for protein annotation.The GOGrapher project provides a reusable programming library designed for the manipulation and analysis of Gene Ontology graphs. The library is freely available for the scientific community to use and improve. Network graphs based on the Gene Ontology (GO) database are now widely used in projects that analyze biological concepts , and a protein node class (GOProteinNode). The second group is made up of the four basic graph type classes (cyan borders) which are categorized based on weighting and directionality. The third group consists of classes that handle serialization and storage of various graph instances (shown with brown borders). Finally, a weighting interface has been created; classes that implement the interface can produce a weighted version of a graph using the weighting functions provided by users. Two example weighters are given (green borders).The object-oriented hierarchy of the library's classes is shown in Figure Graphs are represented by collections of vertices and edges. The vertices . Other GO related graphs can be created by transforming an instance of the GODiGraph object into the desired type. For example, an instance of GODiGraph can be converted to an undirected graph, or, if given weighting information, it can be converted to a weighted graph (either directed or undirected). Since many GO terms are species specific, we allow users to specify whether or not a graph should be associated with one or more species, e.g., yeast or human, so that the terms that have never been used to annotate proteins from the species can be trimmed from the graph. The GOProteinGraph is a special case of an undirected, unweighted graph in which protein nodes are added to the graph with edges connecting them to their associated terms. This graph may be useful in situations in which the actual protein/term associations provide meaningful biological information.The definition of the GO from the Gene Ontology Consortium can be used to create an initial instance of the GODiGraph is first created according to the definition given by the Gene Ontology Consortium (see next subsection for different information sources). This graph can be further modified to produce other GO-related graphs, e.g., undirected or weighted versions, by invoking the provided method calls. Each instance of the GODiGraph is created with a specific aspect of the Gene Ontology, e.g., Biological Process. If the attribute species of a GODiGraph instance is not set, a full graph with all GO terms will be created. If a user is primarily interested in a subgraph that is relevant to a specific species, the user can associate the created GO graph with a collection of protein annotations from one or more species. Then, the leaf nodes that have not been used to annotate any proteins from the species will be trimmed. In addition, a user can create a graph in which both GO terms and proteins are first class objects, i.e., an instance of GOProteinGraph. In this case, a GODiGraph is first created according to GO definition, then the annotated proteins are added to the graph as vertices, and finally, the graph is converted into an undirected graph. This is due to the fact that there is no parent-child relationship between a GO term and a protein.A directed unweighted graph known as a GOGrapher provides classes  needed for creating and manipulating GO-related graphs using a MySQL  databaseGODiGraph using an ontology definition file in either of the above file formats, and further association of annotated proteins to the graph can be carried out using any number of annotation files.The library is also capable of using ontology definition and annotation data files from the Gene Ontology Consortium. The Web Ontology Language (OWL) representation is a suitable format for GOGrapher due to its portability and wide use. The Open Biomedical Ontology XML (OBO-XML) format is also supported by GOGrapher. The annotation files are available in a unified format. GOGrapher can instantiate a cPickle library is used for the permanent file storage and retrieval of graphs as native Python objects. It handles the serialization and unserialization of Python objects as byte streams to and from files on the user's machine.An instance of a GO graph class can be stored in several forms, including as an image or a serialized format. An image of a GO graph can be created and stored using the GOGrapher functions that are inherited from the PyGraphviz library . All graA weighting class that implements a set interface  and Windows versions . All performance tests were conducted with a graph corresponding to the biological process ontology, which contains 15,157 terms relevant to human proteins. It took under two and a half minutes to create and save a complete GO graph (including time to parse an ontology and an annotation file) on a Windows Server 2003 machine with a 2.4 GHz processor and 1 GB of RAM. A computer running Debian with a 2.4 GHz processor and 1 GB of RAM takes slightly less than two and half minutes. On both machines it takes fewer than ten seconds to simply save or load a graph.Creating an image of a large graph can be time consuming. This expense is primarily due to the running time of the Graphviz layout algorithms. It is suggested that only images for relatively small graphs should be created. Additionally, there are currently no Windows binaries of Pygraphviz released, essentially relegating image creation to the Linux, Unix, and Mac OS X distributions. In most cases the creation of an XGMML file may be the best choice; this method is supported on all platforms. A XGMML file can be created by GOGrapher and then imported into a visualization program like the cross-platform application Cytoscape .programming library available for the manipulation and analysis of the Gene Ontology graphs. Most of the other tools are distributed as independent applications, either available for download or provided as online applications, that cannot be extended to provide a framework for additional forms of analysis. GOGrapher is useful as a library upon which new tools can be built. As a library, it reduces the redundancy and complexity that come from recreating the same functionality involved in creating GO graphs, for instance, implementation of a parser for annotation files and gene ontology files. GOGrapher also provides programmers with a variety of types of network analysis functionality by the means of inheriting anther foundation library, NetworkX. As an open source library, GOGrapher library can be extended with functionalities that meet the needs of future tool developers.To our best knowledge, GOGrapher is currently the only . The site contains a short tutorial and an online version of the API. Minimally, Python [The GOGrapher library is freely available under the GNU General Public License version 3 at , Python  and Netw, Python ,10 must , Python  and Pygr, Python  must alsThe authors declare that they have no competing interests.XL conceived the project. BM lead implementation, and all authors contributed to coding and testing of the library."}
+{"text": "Biomedical and chemical databases are large and rapidly growing in size. Graphs naturally model such kinds of data. To fully exploit the wealth of information in these graph databases, a key role is played by systems that search for all exact or approximate occurrences of a query graph. To deal efficiently with graph searching, advanced methods for indexing, representation and matching of graphs have been proposed.This paper presents GraphFind. The system implements efficient graph searching algorithms together with advanced filtering techniques that allow approximate search. It allows users to select candidate subgraphs rather than entire graphs. It implements an effective data storage based also on low-support data mining.GraphFind is compared with Frowns, GraphGrep and gIndex. Experiments show that GraphFind outperforms the compared systems on a very large collection of small graphs. The proposed low-support mining technique which applies to any searching system also allows a significant index space reduction. Application domains such as bioinformatics and cheminformatics represent data as graphs where nodes are basic elements  and edges model relations among them. In these domains, graph searching plays a key role. For example, in computational biology locating subgraphs matching a specific topology is useful to find motifs of networks that may have functional relevance. In drug discovery, the main task is to find novel bioactive molecules, i.e., chemical compounds that, for example, protect human cells against a virus. One way to support the solution of this task is to analyze a database of known and tested molecules with the aim of building a classifier which predicts whether a novel molecule will be active or not. Future chemical tests can focus on the most promising candidates. Users may ask to find molecules containing the query graph (exact search) or subgraphs similar to the one described by the query (approximate querying)  and a query graph Q (e.g pattern), find all graphs in D containing Q as a subgraph. Moreover, all occurrences of Q in those graphs should be detected. In many important application D consists of a single huge graph. Since most of these problems involve solutions of the graph isomorphism problem, an efficient exact solution can not exists. In order to make searching time acceptable research efforts have tried to improve the following steps [The graph searching problem can be formalized as follows. Given a database of graphs Reduce the search space by filtering. For a database of graphs a filter limits the search to only possible candidate graphs. For a single-graph database only the possible candidate subgraphs are identified. The common idea is to extract structural features of graphs and store them in a global index. When a query graph is presented, its own structural features are extracted and compared with the features stored in the index to check compatibility [1. tibility -6. Most tibility -9.Store Data. In order to scale to very large databases of graphs indexing structures and data must be stored in secondary memory. Applications make use of advanced database management systems [2.  systems .Match. After candidate graphs have been selected, an exhaustive search on these graphs must be performed. This step is implemented either by traditional (sub)graph-to-graph matching techniques [3. chniques ,11 or bychniques .In this paper, GraphFind, an enhancement of the application-independent graph searching system GraphGrep ,12, is pGraphFind locates all exact and approximate occurrences of a query graph in collections of graphs. It combines filtering techniques described in  with a rGraphGrep ,12 findsDaylight  is a comData mining techniques have been applied to reduce index construction (space and time) complexity. Related recent work includes ,9  is not shown since it does not yield any speed-up with respect to the case of pl = 4.Preprocessing time and index size of GraphFind using pl = 10 compared to pl = 4 discards more graphs, but is slower.gIndex filtering with In Figure Figure Finally, the Min-Hashing algorithm was applied to reduce the index size of GraphFind and gIndex , the graph may be partitioned into components based on a minimum cut strategy (e.g. locate hubs and cut at them). Future work will include the design and the experimental analysis of a GraphFind distributed version on web-scale databases. Moreover, methods to rank outputs will be added on specific domains of application. This will be a domain-specific extension. Datasets, software and results are freely available at .node-id) and a label (node-label). An id-path of length n is a list of n + 1 node-ids with an unlabeled edge between any two consecutive nodes. A label-path of length n is a list of n + 1 node-labels. Label-paths and the id-paths of the graphs in a database are used to construct the index of the database and to store the data graphs.GraphFind models the nodes of data graphs as having an identification number . Each graph is stored in a set of Berkeley DB tables each corresponding to a label-path-set  nodes labeled with a special wildcard symbol \u201c?\u201d, which can match any label; (b) approximate paths (represented by a wildcard symbol \u201c*\u201d) which are paths of any length that can connect two nodes.A database graph, for which at least one value in its fingerprint is less than the corresponding value in the fingerprint of the query, is filtered out. The remaining graphs are candidates for matching , where N is the number of nodes in the query.After filtering, subgraph matching on the possible matching candidates is performed by applying the VF2 algorithm  to each M be the fingerprint of a graph database. Rows correspond to graphs, columns are patterns and each entry is the number of occurrences of each pattern in that graph. Two patterns are similar if a large number of graphs have the same number of occurrences of it. More precisely, let the similarity Sim of two columns be the percentage of non null rows in which the two columns have the same value. The aim of the Min-Hashing algorithm [s*. It generates k random permutations, say jp : {1,\u2026,m} \u2192 {1,\u2026,m} for j = 1,\u00b7\u00b7\u00b7,k, of row indices of M. i-th element of the permutation jp. Let signature matrix of M. Each entry t of the first row in M in which t if and only if s <t, Sim of two columns iC and jC be defined as s* is not a user parameter. The system is designed to find pairs of columns (patterns) with similarity s* = 100% in the fingerprint database. Therefore, two patterns that have the same occurrence in each graph will be represented in the matrix using only one column indexed by both patterns. Notice that, by reducing the similarity threshold s*, correctness is maintained and the compression ratio may be higher. However, this implies a loss in filtering efficiency and therefore greater searching time. Figure Let lgorithm  is to qu\u222aCj|. In  the auth3D: Three-DimensionalDB: DatabaseG : Number of GraphsGB: GigabyteNT: GraphFind FingerprintGraphFindGFrowns: Graph Frowns, Implementation of Frowns for General GraphL : Number of Different Node Labelspl: Length of Label PathOS: Operating SystemN: Number of NodesSQL: Structured Query LanguageSAGA: Substructure Index-based Approximate Graph AlignmentVF2: Graph Matching Algorithm by Vento Foggia et al.The authors declare that they have no competing interests.All authors designed, analyzed, implemented and tested the proposed algorithm. Each author contributed equally in writing the paper. All authors read and approved the final manuscript."}
+{"text": "Group B coxsackieviruses (CVB) are associated with viral-induced heart disease and are among the leading causes of aseptic meningitis worldwide. Here we show that CVB entry into polarized brain microvasculature and aortic endothelial cells triggers a depletion of intracellular calcium stores initiated through viral attachment to the apical attachment factor decay-accelerating factor. Calcium release was dependent upon a signaling cascade that required the activity of the Src family of tyrosine kinases, phospholipase C, and the inositol 1,4,5-trisphosphate receptor isoform 3. CVB-mediated calcium release was required for the activation of calpain-2, a calcium-dependent cysteine protease, which controlled the vesicular trafficking of internalized CVB particles. These data point to a specific role for calcium signaling in CVB entry into polarized endothelial monolayers and highlight the unique signaling mechanisms used by these viruses to cross endothelial barriers. Enteroviruses are associated with a number of diverse syndromes such as myocarditis, febrile illness, and are the main causative agents of aseptic meningitis. No effective therapeutics exist to combat non-poliovirus enterovirus infections. A better understanding of the mechanisms by which these viruses infect host cells could lead to the design of effective therapeutic interventions. In this study, we found that intracellular calcium stores in polarized endothelial monolayers are depleted upon exposure to coxsackievirus B (CVB) and that this release is mediated by viral attachment to its receptor decay-accelerating factor. We also discovered that the calcium release requires the activation of signaling molecules involved in calcium signaling such as Src tyrosine kinases, phospholipase C, and the inositol 1,4,5-trisphosphate receptor isoform 3 on the ER membrane. Furthermore, we found that a calcium-activated cystein protease, calpain-2, was activated and necessary for proper viral trafficking inside the cell. Interestingly, we found that this signaling cascade was critical for CVB internalization into the endothelium, but was not involved in CVB entry into the epithelium. This is an important advance in our understanding of how enteroviruses hijack host endothelial cell signaling mechanisms in order to facilitate their entry and eventual spread. Coxsackievirus B (CVB), a member of the enterovirus family, is associated with a number of diverse syndromes including aseptic meningitis, myocarditis, febrile illness, and diabetes The binding of viruses to receptors on host cells often initiates elaborate signaling pathways aimed at facilitating viral uptake. The coxsackievirus and adenovirus receptor (CAR) mediates attachment by all six CVB serotypes i2+) following lateral crosslinking of these receptors has also been documented i2+Although DAF is anchored to the outer leaflet of the plasma membrane via a GPI anchor (and thus does not contain an intracellular domain), DAF and other GPI-anchored membrane proteins can be induced to form larger raft patches upon lateral crosslinking (most commonly with antibodies) i2+) homeostasis is under tight regulation by the cell. The free cytoplasmic calcium concentration is maintained around 50\u2013100 nM whereas intracellular stores such as the ER (endoplasmic reticulum) maintain much higher free concentrations (\u00b5M amounts). Intracellular calcium levels rise upon a stimulus (such as ligand-receptor interaction on the cell surface) and often converge on phospholipase C (PLC), an enzyme that mediates the hydrolysis of phosphatidylinositol-4,5-bisphophate (PIP2) into diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3). IP3 diffuses through the cytoplasm and binds to IP3 receptors (IP3R) localized on the ER membrane. Cytoplasmic calcium levels are brought back down to basal concentrations by multiple calcium channels such as the plasma membrane Ca2+-ATPase (PMCA), as well as the sarco-endoplasmic reticulum ATPase (SERCA) pump. As Cai2+ levels regulate a variety of cellular processes, it is not surprising that many viral pathogens have evolved strategies to exploit Ca2+-mediated signaling events to promote mechanisms required to facilitate viral entry, replication, and/or spread Calcium is one of the most prominent second messengers in the cell. It is involved in many signaling cascades that have diverse outcomes depending on the spatiotemporal aspects of the calcium release. For this reason, intracellular calcium (Cai2+ in facilitating CVB entry into human brain microvascular endothelia cells (HBMEC), an in vitro model of the blood-brain barrier. These studies have revealed that CVB-induced clustering of DAF induces an immediate depletion of Cai2+ stores. CVB-induced Cai2+ mobilization is regulated by several host cell factors including the Src family of tyrosine kinases, PLC, and is mediated specifically by the IP3R isoform 3. We also show that the calpain family of Ca2+-activated proteases plays a role in mediating the trafficking of CVB-containing vesicles within the cell. Interestingly, we also find that Cai2+ release is involved in mediating CVB entry into primary human aortic endothelial cells, but is not required for CVB entry into polarized epithelial cells, suggesting that the intracellular signaling molecules hijacked by CVB to facilitate entry are distinct between the endothelium and epithelium.Our previous studies have highlighted the intracellular signals that regulate CVB entry into polarized epithelial cells Nonenveloped viruses gain entry into host cells by endocytic mechanisms that may include clathrin- or caveolar-mediated endocytosis, and macropinocytosis (1) dynasore, a cell-permeable inhibitor of dynamin First, we used three independent methods to alter dynamin II activity \u2013We next determined the effect of dominant-negative mutants of various endocytic pathways for their effects on CVB infection of HBMEC. These studies revealed that CVB infection of HBMEC was significantly impaired when mutants of the caveolar pathway were expressed (caveolin-1 and -3), consistent with what we observed previously in Caco-2 cells We have shown that CVB entry into polarized epithelial Caco-2 cells requires the activation of intracellular signaling molecules to facilitate viral endocytosis i2+i2+ stores. We found that in cells pretreated with Bapta-AM , infection was significantly reduced compared to no inhibitor controls   . We founs (HAEC) . In addis (HAEC) , indicat2+ chelation inhibited CVB infection . Following a brief period to establish baseline levels of Cai2+ (t\u200a=\u200a50 sec), CVB (MOI\u200a=\u200a50) was added directly to monolayers. To prevent Ca2+ influx due to alterations in membrane permeability, monolayers were bathed in Ca2+-free HEPES-buffered saline. The addition of CVB resulted in an almost immediate release (<20sec) of Cai2+  and positive [(+) overnight infection with CVB] are shown. (D)35S-labeled virus particle at various stages of internalization were recovered by cell lysis with sucrose gradient lysis buffer . Cell lysates were overlaid on linear 15-30% sucrose gradients and centrifuged at 39,000 rpm for 150 min at 4\u00b0C in a Beckman SW41Ti rotor. Fractions (400 \u00b5l) were collected from the top of the gradient and radioactivity was measured.CVB-induced Ca(0.32 MB TIF)Click here for additional data file.Figure S2(A) HBMEC were transfected with control, CAR, or DAF siRNAs and exposed to S35-labeled CVB  at 16\u00b0C for one hour. Following binding, cells were washed, lysed, and radioactivity was counted. (B) Confocal micrographs of HBMEC immunostained for the basolateral-localized Na+/K+ ATPase pump (green) and the tight junction marker ZO-1 (red) (DAPI - blue). (C) Confocal micrographs of CAR (green) and ZO-1 , or E-cadherin .CAR is sequestered in the tight junctions of HBMEC. (1.97 MB TIF)Click here for additional data file.Figure S33R-1 and -2 siRNAs have modest effects on CVB-induced Cai2+ mobilization. (A) Intensity ratio graph of HBMEC transfected with control, IP3R-1, or IP3R-2 siRNAs, loaded with Fura-2AM and exposed to CVB (55 sec). (B) Still images of Fura-2-loaded HBMEC transfected with control, IP3R-1, or IP3R-2 siRNAs and exposed to CVB.IP(3.27 MB TIF)Click here for additional data file.Figure S4i2+ release in HAEC. (A) Intensity ratio graph of HAEC pre-treated with control (no inhibitor) or genistein and exposed to CVB (55 sec). (B) Still images of Fura-2 loaded HAEC with or without genistein and exposed to CVB.Tyrosine kinases are required for CVB-induced Ca(1.54 MB TIF)Click here for additional data file.Figure S53R1, IP3R2, IP3R3, or PLC\u03b31 (PLCG1). For immunoblots, membranes were stripped and reprobed with GAPDH as a loading control. For RT-PCR, cDNA was amplified using GAPDH primers.Efficacy of siRNA silencing in HBMEC. Western blot or RT-PCR analysis in HBMEC transfected with the indicated siRNAs: control (CON), calpain-1 (CALP1), calpain-2 (CALP2), CAR, DAF, dynamin II (DNMII), IP(0.39 MB TIF)Click here for additional data file.Figure S6(A) Caco-2 monolayers were treated with the indicated calpain inhibitors and infected with CVB (MOI\u200a=\u200a1) for 7hrs (Caco-2). Inhibitor was added to cultures 1 hr before infection (pre-treat) or 2 hrs p.i. Dashed line indicates the infection level of control cells. (B) Primary HAEC cells were treated with calpain inhibitor III and infected with CVB. Inhibitor was added to cultures 1 hr before infection (pre-treat) or 2 hrs p.i. (C) Quantification of vesicles (with diameter >500nM) in HBMEC in the absence or presence of calpain inhibitors. Data are presented as the percent of total cells containing vesicles >500nM in diameter . (D) Representative images of the quantification shown in (C). VP1 (green) and DAPI (blue). (E) Quantification of vesicles (with diameter >500nM) in HBMEC transfected with control siRNA, PLCG1 siRNA, and IP3R-3 siRNA. (F) Confocal images of HBMEC stained for calpain 2 (red) and stained with mouse monoclonal Rab5 GTPase (green) .Calpain-2 is required for viral trafficking in HAEC and HBMEC. (1.63 MB TIF)Click here for additional data file.Figure S7(A) Extent of PI uptake in HBMEC following 7 hr incubation with the indicated inhibitors. Toxicity was calculated as the percent of cells positive for PI/total cells. (B) Induction of type I interferon signaling in HBMEC transfected with a luciferase reporter plasmid and then select siRNAs. Data are presented as a fold increase in comparison to control (no siRNA) levels.Toxicity panels for pharmacological inhibitors and siRNAs. (0.93 MB TIF)Click here for additional data file.Movie S1Intracellular calcium store depletion is observed immediately after exposure of HBMEC monolayers to CVB3. Time-lapse movie of HBMEC loaded with Fura-2AM and exposed to CVB3 (50 PFU/ml) in real time. Movie is pseudocolored for better visualization of calcium .(6.36 MB MOV)Click here for additional data file.Movie S2Intracellular calcium store depletion is also observed immediately after exposure of HAEC to CVB3. Time-lapse movie of HAEC monolayers loaded with Fura-2AM and exposed to CVB (50 PFU/cell) in real time. Movie is pseudocolored for better visualization of calcium .(8.60 MB MOV)Click here for additional data file.Movie S3Epithelial Caco-2 monolayers exposed to CVB3 do not mobilize intracellular calcium. Time-lapse movie of Caco-2 monolayers loaded with Fura-2AM and exposed to CVB (50 PFU/cell) in real time. Movie was pseudocolored for better visualization of calcium .(10.37 MB MOV)Click here for additional data file.Movie S4CVB4 does not induce intracellular calcium release of HBMEC monolayers. Time-lapse movie of HBMEC monolayers loaded with Fura-2AM and exposed to CVB4 (50 PFU/cell) in real time. Movie was pseudocolored for better visualization of calcium .(9.93 MB MOV)Click here for additional data file.Movie S5Intracellular calcium store depletion in response to CVB3 is not dependent on CAR. Time-lapse movie of HBMEC monolayers transfected with CAR siRNA, loaded with Fura-2AM, and exposed to CVB3 (50 PFU/ml) after 1 min. Movie is pseudocolored for better visualization of calcium .(6.78 MB MOV)Click here for additional data file.Movie S6PLCG1 is required for calcium store depletion in response to CVB3. Time-lapse movie of HBMEC monolayers transfected with PLCG1 siRNA, loaded with Fura-2AM, and then exposed to CVB3 (50 PFU/ml) after 1 min. Movie was pseudocolored for better calcium visualization .(10.32 MB MOV)Click here for additional data file.Movie S73R1 siRNA has a modest effect on calcium mobilization in response to CVB3. Time-lapse movie of HBMEC monolayers transfected with IP3R-1 siRNA, loaded with Fura-2AM, and exposed to CVB3 (MOI\u200a=\u200a50) after 1 min. Movie was pseudocolored for better calcium visualization .IP(10.19 MB MOV)Click here for additional data file.Movie S83R-2 siRNA has a modest affect on calcium store depletion in response to CVB3. Time-lapse movie of HBMEC monolayers transfected with IP3R-2 siRNA, loaded with Fura-2AM, and exposed to CVB3 (MOI\u200a=\u200a50) after 1 min. Movie is pseudocolored for better calcium visualization .IP(10.89 MB MOV)Click here for additional data file.Movie S93R-3 siRNA reveals its involvement in calcium store depletion upon exposure to CVB3. HBMEC monolayers were transfected with IP3R-3 siRNA, loaded with Fura-2AM, and exposed to CVB3 (MOI\u200a=\u200a50) after 1 min. Movie was pseudocolored for better calcium visualization .IP(10.48 MB MOV)Click here for additional data file."}
+{"text": "There were errors in the Author Contributions. The correct contributions are: Conceived and designed the experiments: GH DRS. Performed the experiments: GH SY NS KJD TS. Analyzed the data: GH DRS. Wrote the paper: GH DRS. Made the figures: GH KJD."}
+{"text": "However, there were also post-binding effects. First, the downstream, gL-independent conformation of gH became a neutralization target; gL normally prevents this by holding gH in an antigenically distinct heterodimer until after endocytosis. Second, gL\u2212 virions were more vulnerable to gB-directed neutralization. This covered multiple epitopes and thus seemed to reflect a general opening up of the gH\u2013gB entry complex, which gL again normally restricts to late endosomes. gL therefore limits MuHV-4 neutralization by providing redundancy in cell binding and by keeping key elements of the virion fusion machinery hidden until after endocytosis.Antibodies readily neutralize acute, epidemic viruses, but are less effective against more indolent pathogens such as herpesviruses. Murid herpesvirus 4 (MuHV-4) provides an accessible model for tracking the fate of antibody-exposed gammaherpesvirus virions. Glycoprotein L (gL) plays a central role in MuHV-4 entry: it allows gH to bind heparan sulfate and regulates fusion-associated conformation changes in gH and gB. However, gL is non-essential: heparan sulfate binding can also occur via gp70, and the gB\u2013gH complex alone seems to be sufficient for membrane fusion. Here, we investigated how gL affects the susceptibility of MuHV-4 to neutralization. Immune sera neutralized gL Most vaccines depend on eliciting neutralizing antibodies . Herpesv\u2212 virions, which constitutively express the downstream form of gH (\u2018gH-only\u2019), remain infectious; indeed, they show premature rather than impaired membrane fusion  were infected intranasally with MuHV-4 when 6\u20138\u2005weeks old, in accordance with local ethics and Home Office Project Licence 80/1992. Immune sera were collected and mAbs were derived at least 3\u2005months later. For the latter, spleen cells were taken 3\u2005days after an intraperitoneal virus boost and fused to NS0 myeloma cells . Hybrids\u22121, 100\u2005\u03bcg streptomycin\u2005ml\u22121 and 10\u200a% fetal calf serum. NS0 cells and the hybridomas derived from them were grown in RPMI medium, supplemented as for DMEM. MuHV-4 was propagated in BHK-21 cells  and virions were recovered from supernatants by high-speed centrifugation . gp70\u2212 -linked forms of gH, gL and gH\u2013gL (BHK-21 fibroblasts (ATCC CCL-10), NMuMG epithelial cells (ATCC CRL-1636), RAW-264 macrophages (ATCC TIB-71), 293T cells (ATCC CRL-11268), CHO\u2013gH cells (gp70\u2212 (\u2212  and gM\u2013e\u22121) to prevent infection spreading. RAW-264 cells were further treated with LPS  to activate the eGFP expression cassette maximally  before being added to the cells and assayed for infectivity as above. All sera were pooled from at least three mice. The sera within each experiment were equivalent in ELISA titre for IgG binding to Triton X-100-disrupted virions (MuHV-4 was titrated by plaque assay ( virions .1 (Invitrogen) and Alexa 568-conjugated goat anti-mouse IgG2a. Nuclei were counterstained with DAPI . Fluorescence was visualized with a Leica SP2 confocal microscope and analysed with ImageJ. None of the mAbs stained uninfected cells detectably.MuHV-4 virions (3 p.f.u. per cell) were exposed or not to antibody  then bound to cells on glass coverslips . The cells were then washed three times in PBS to remove unbound virions, and shifted to 37\u2005\u00b0C to allow endocytosis. After incubation at 37\u2005\u00b0C, the cells were fixed in 4\u200a% paraformaldehyde (30\u2005min), permeabilized with 0.1\u200a% Triton X-100 (15\u2005min) and stained with virus-specific mAbs plus Alexa 488-conjugated goat anti-mouse IgGTransfected or MuHV-4-infected cells  were trypsinized, washed in PBS and incubated  with MuHV-4-glycoprotein-specific mAbs, followed by fluorescein-conjugated rabbit anti-mouse IgG pAb (Dako Cytomation) or Alexa 633-conjugated goat anti-mouse IgG (Invitrogen). The cells were washed in PBS after each incubation and analysed on a FACScalibur (BD Biosciences).Virions were lysed and denatured by heating  in Laemmli's buffer, resolved by SDS-PAGE and transferred to PVDF membranes. The membranes were probed with the ORF17 capsid antigen-specific mAb 150-7D1 plus horseradish peroxidase-conjugated rabbit anti-mouse IgG pAb (Dako Cytomation), followed by ECL substrate development (Amersham Pharmacia Biotech).+ and gL\u2212 virions to neutralization by sera from mice infected with wild-type MuHV-4 \u2212 virions only marginally better than wild-type virions, the result was clearly different from that for gp70\u2212-immune serum, which neutralized gL\u2212 virions less well than wild-type virions. The difference was more obvious in Fig.\u20052(b)\u2212 virions being more susceptible to neutralization.We know from hybridoma analysis that even pooled mice show quite different neutralizing-antibody responses. However, the basic hierarchy between different viruses and sera was very reproducible: the neutralizations of gL\u2212 virions: they were neutralized poorly by gL\u2212-immune sera, which lack antibodies to gH\u2013gL. As MuHV-4 neutralization by immune sera correlates with a block to cell binding , LT-6E8 to gL\u2212-immune sera (no 230-4A2-type response) and both mAbs together to wild-type-immune sera. These data further supported the idea that immune sera inhibit fibroblast infection mainly by blocking heparan sulfate binding.We then tested neutralization by mAb LT-6E8 in combination with mAb 230-4A2  blocked the accumulation of perinuclear capsids The MuHV-4 gL is small \u2013 approximately 19\u2005kDa \u2013 and probably lies close to the virion membrane (\u2212 but not gL+ virions. Therefore, a possible explanation for the redundancy of MuHV-4 heparan sulfate binding \u2013 something common to many herpesviruses \u2013 is antibody evasion.gL is a small but important component of the herpesvirus entry machinery (Disrupting gL also made the gH-only conformation of gH a neutralization target. This supported the idea that gH-only, although downstream of gH\u2013gL, is still pre-fusion (\u2212 virions is conformationally normal \u2013 its instability manifests only after endocytosis (\u2212 virions were susceptible not to new gB-specific antibodies, but to those also recognizing gL+ virions. Therefore the greater vulnerability of gL\u2212 virions to gB-directed neutralization appeared to reflect a greater exposure of its normal, pre-fusion form.Finally, gL disruption made multiple gB epitopes better neutralization targets. This presumably reflected the same molecular events as the previously observed gL-dependent conformational instability of gB (Several lines of evidence indicate that disrupting gL destabilizes gB by abolishing an extracellular interaction between gB and gH\u2013gL. First, the gH\u2013gL and gB extracellular domains are both unstable when expressed alone, gH\u2013gL becoming gH-only , it is hA complete definition of MuHV-4 entry awaits gB\u2013gH\u2013gL and gB\u2013gH crystal structures, but already some points seem clear. First, the gH\u2013gL\u2013gB composite presents epitopes from both gB and gH\u2013gL. The gH\u2013gL heparan sulfate-binding site defined by mAb 230-4A2 is not made more accessible by deleting the gB N terminus , and theWhat are the implications for neutralization-based vaccines? As immunodominant viral antigens work against neutralization ("}
+{"text": "TUV C6. An exact expression for Schultz index of this molecule is also found.The study of topological indices \u2013 graph invariants that can be used for describing and predicting physicochemical or pharmacological properties of organic compounds \u2013 is currently one of the most active research fields in chemical graph theory. In this paper we study the Schultz index and find a relation with the Wiener index of the armchair polyhex nanotubes  This method has been introduced by Harold Wiener as a descriptor for explaining the boiling points of paraffins \u20133. If d(u) is the degree of the vertex u.A unified approach to the Wiener topological index and its various recent modifications is presented. Among these modifications particular attention is paid to the Hyper-Wiener, Harary, Szeged, Cluj and Schultz indices as well as their numerous variants and generalizations \u201310. The The main chemical applications and mathematical properties of this index were established in a series of studies \u201315. AlsoTUV C6, the armchair polyhex nanotube \u2502u; level k}( see l k} see . ThenS(G it is clear that Also in the graph d(u) in the graph G, when u is a vertex in level 1, we first prove the following lemma.To compute the Lemma 2.The sum of distances of one vertex of level 1 to all vertices of level k is given byProof:We calculate the value of wk. We consider that the tube can be built up from two halves collapsing at the polygon line joining x10 to xq,0 ; (p + 2),. . . . , 2p \u20131. We change the indices of the vertices of G2 in the following way:xq,0 see . The rigSee Case 1: If k \u2265 p. In the graphs G1 and for 0 i < k\u2264  we haveWe must consider two cases:G2 and for 1 \u2264.i < k we haveAlso in the graphs Case 2: If k < p. First suppose that 1 \u2264 i < k. In the graphs G1 and G2 we havek \u2264 i \u2264 p. Then in the graph G1 we can see that if k is odd, then k is even, thenG2 we havek is oddk is even.Now suppose that All of this distances give usx10 by changing transfer vertices and apply a similar argument by choosing suitable G1 and G2 and compute wk.For other vertices we can convert those to By a straightforward computation (if irem means the positive integer remainder) we can see:k \u2264 p, we haveSo, by Lemma 1, when 1 \u2264 G,Also in the graph This leads us to the following corollary:Corollary 1. For each vertex u on level 1 we havep > q. Then by lemma 2 and Now suppose that p \u2264 q, then by Lemma 1 and Also if We summarize the above results in the following propositionCorollary 2. For each vertex u on level 1, d(u) is given byCase 1: p is evenCase 2: p is oddTheorem 1. The Wiener index of G := TUV C6 nanotubes is given byCase 1: p is evenCase 2: p is oddProof: See  nanotubes is given byCase 1: p is evenCase 2: p is oddProof: According to Lemma 1 we must calculate 6W(G) \u2013\u2211ulevel 1\u2208 d(u). But by corollary 1 we have2p vertices on level 1 thereforeSince there are d(u) from corollary 1 in the Finally by replacing TUV C6 of various dimensions."}
+{"text": "Despite age-related adipose involution, T cell generation in the thymus (thymopoiesis) is maintained beyond puberty in adults. In rodents, growth hormone (GH), insulin-like growth factor-1 (IGF-1), and GH secretagogues reverse age-related changes in thymus cytoarchitecture and increase thymopoiesis. GH administration also enhances thymic mass and function in HIV-infected patients. Until now, thymic function has not been investigated in adult GH deficiency (AGHD). The objective of this clinical study was to evaluate thymic function in AGHD, as well as the repercussion upon thymopoiesis of GH treatment for restoration of GH/IGF-1 physiological levels.Twenty-two patients with documented AGHD were enrolled in this study. The following parameters were measured: plasma IGF-1 concentrations, signal-joint T-cell receptor excision circle (sjTREC) frequency, and sj/\u03b2 TREC ratio. Analyses were performed at three time points: firstly on GH treatment at maintenance dose, secondly one month after GH withdrawal, and thirdly one month after GH resumption. After 1-month interruption of GH treatment, both plasma IGF-1 concentrations and sjTREC frequency were decreased (p<0.001). Decreases in IGF-1 and sjTREC levels were correlated . There was also a decrease in intrathymic T cell proliferation as indicated by the reduced sj/\u03b2 TREC ratio (p<0.01). One month after reintroduction of GH treatment, IGF-1 concentration and sjTREC frequency regained a level equivalent to the one before GH withdrawal. The sj/\u03b2 TREC ratio also increased with GH resumption, but did not return to the level measured before GH withdrawal.In patients with AGHD under GH treatment, GH withdrawal decreases thymic T cell output, as well as intrathymic T cell proliferation. These parameters of thymus function are completely or partially restored one month after GH resumption. These data indicate that the functional integrity of the somatotrope GH/IGF-1 axis is important for the maintenance of a normal thymus function in human adults.NTC00601419ClinicalTrials.gov  The thymus is the unique lymphoid organ responsible for the generation of self-tolerant and competent naive T cells, as well as of self antigen-specific natural regulatory T cells. The diversity of T-cell receptors for antigen (TCR) results from the random recombination of gene segments encoding the variable parts of the TCR\u03b1 and \u03b2 chains. Successive rearrangements in the TCR locus generate different types of TCR excision circles (TRECs), such as signal-joint (sj) TRECs and DJ\u03b2TRECs Growth hormone (GH) and GH receptor (GHR) are related to type I cytokines and to receptors of type I cytokines, respectively This important and well-documented preclinical background has promoted recent clinical studies that are exploring the use of endocrine-based therapies aiming to enhance thymopoiesis in immunodeficient individuals, and in particular to evaluate the potential benefit of GH treatment for immune restoration through stimulation of thymopoiesis in HIV-1 \u2013 infected patients. A first pilot study showed that GH treatment reverses thymic atrophy and enhances the number of circulating naive CD4 T cells in HIV-infected adults The protocol for this trial and supporting CONSORT checklist are available as supporting information; see Twenty-two patients were enrolled in this study at the Department of Medicine in Liege University Hospital. There were 10 males and 12 females, with an age range between 27 and 69 years. The protocol was approved by the Ethical Committee of Liege Medical School and University Hospital, and each enrolled patient signed an informed consent. All patients had been diagnosed at least two years before with AGHD according to the guidelines of clinical practice established by the Endocrine Society 8 cells/ml, and stored at \u221280\u00b0C. One million cells were used either for sjTREC or D\u03b2TREC measurements.Twenty-four milliliters of blood were collected at each time of the study, and PBMCs were purified by Ficoll-Paque gradient centrifugation (Becton-Dickinson Vacutainer CPT). Cells were washed twice in HBSS, suspended in DPBS, adjusted at 105\u2032-GCCGGGACCCGGCTCTCAGT-3\u2032), 2.5-in (5\u2032-CGGCTCTCAGTGCTGGGTAA-3\u2032), 2.6-out (5\u2032-TGACCAAGAGACCCAGTA-3\u2032), 2.6-in (5\u2032-GTCTGGTTTTTGCGGGGAGT-3\u2032), 2.7-out (5\u2032-TGACCGTGCTGGGTGAGTT-3\u2032), 2.7-in (5\u2032-GGAGCTCGGGGAGCCTTA-3\u2032). All primers were purchased from Eurogentec . Three plasmids were used to generate standard curves for real-time quantitative PCR-based assay, each containing two inserted amplicons  amplified in the same run as experimental samples.Specific primers for the sjTRECs (\u03b4Rec-\u03c8J\u03b1), the 13 different DJ\u03b2TRECs , and the human CD3\u03b3-chain have been previously defined . In order to amplify the Db2\u2013Jb2.5 to Db2\u2013Jb2.7 TRECs, a set of 3 additional reverse J\u03b2 primers were added to the published ones with the following sequences: 2.5-out (5 cells. Approximately 106 PBMC were lyzed in Tween-20 (0.05%), Nonidet P-40 , and proteinase K (100 \u00b5g/ml) for 30 min at 56\u00b0C, and for 15 min at 98\u00b0C. Multiplex PCR amplification was performed for sjTREC, together with the CD3\u03b3 chain, in 100 \u00b5l  using the \u2018outer\u2019 3\u2032/5\u2032 primer pairs. These PCR conditions were used for all subsequent experiments. Following the first round of amplification, PCR products were diluted 10-fold prior to online real-time amplification using LightCycler Technology. PCR conditions in LightCycler experiments were as follows: 1 min for initial denaturation at 95\u00b0C, 1 sec at 95\u00b0C, 15 sec at 60\u00b0C, 15 sec at 72\u00b0C for 40 cycles. Fluorescence measurements were performed at the end of the elongation steps. For each PCR product, the TREC and CD3\u03b3 second-round PCR quantifications were performed in separate capillaries and in independent LightCycler experiments, but quantified on the same first-round serially diluted standard curve. This highly sensitive nested quantitative PCR assay allows the detection of one copy per PCR reaction for each DNA circle. The results are expressed as absolute number of TRECs per 105 cells. The quantification of sjTREC frequencies was performed in duplicate.Parallel quantification of each TREC together with the CD3\u03b3 amplicon was performed for each sample using LightCycler Technology . This protocol precisely measures the input DNA for quantification, thus providing an absolute number of TRECs per 10For D\u03b2TREC amplification, the first round was performed with 9 primers for different D\u03b2TREC amplification. The temperature and cycles were identical to sjTREC amplification. Light Cycler quantification of D\u03b21-J\u03b21TRECs and D\u03b22-J\u03b22TRECs were performed independently as described.Serum IGF-1 concentrations were determined using a specific radioimmunoassay .Differences between paired groups were assessed by Wilcoxon test. Spearman's test was used to assess correlation between two distinct parameters. Age- and IGF-1\u2013dependency of sjTREC were fitted to an exponential regression model As shown in 5 cells) was patient #4, a male (44 yr-old) with AGHD in the context of a treated HIV infection, the second patient (from 1000 to 2 sjTREC/105 cells) was patient #5, a female (57 yr-old) with a PRL-secreting adenoma that had been surgically treated. A significant positive correlation (P<0.01) was observed between sjTREC levels and plasma IGF-1 concentrations , as well as one month after GH resumption (P<0.01).Mean DJ\u03b2TREC frequency was neither affected by GH withdrawal, nor by GH resumption . HoweverIgf1\u2212/\u2212 deficient animals are partially or totally reversed by GH administration. While GH and IGF-1 are not essential for lymphopoiesis or lymphocyte effector function, they clearly appear to be immunostimulatory.Until now, thymopoiesis has never been investigated in humans with AGHD, and only one study has investigated the impact of GH deficiency upon immune parameters in humans Intrathymic T cell proliferation was also stimulated by GH treatment, but was not completely restored after one month of treatment. Although there is clear evidence that the magnitude of thymic output depends on the intrathymic proliferation of precursor T cells The close positive correlation observed between plasma IGF-1 concentrations and the frequency of sjTRECs in PBMCs argues for an important role of IGF-1 in mediating GH impact upon human thymic function as already suggested by others The impact of GH on the intrathymic generation of TCR diversity may also be addressed though this question was not addressed in our study. This is however a very important question, and a recent study nicely showed that infusion of ghrelin, a natural GH secretagogue, into old mice reverses the age-related changes in thymic morphology and thymocyte numbers, but also increases thymic output of naive T cells and improves TCR diversity of peripheral T cell subpopulations Checklist S1CONSORT checklist(0.05 MB DOC)Click here for additional data file.Protocol S1Trial Protocol(0.03 MB DOC)Click here for additional data file."}
+{"text": "Locally synthesized growth hormone (GH) may act as a survival factor in several tissues. Experimental studies with chick retinal ganglion cells (RGCs) suggest that GH, synthesized within the developing retina, may have autocrine or paracrine roles in the regulation of the waves of cell death characteristic of RGC differentiation. There is also evidence that GH may have a similar neuroprotective function in the rat retina, however, there is no information concerning such a role in the human retina. In this paper we extended our earlier work by determining whether the local expression of retinal GH correlates with RGC apoptosis in human retinas.terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL).In the absence of experimental approaches to survival factor function in the human retina, we have used a correlative immunocytochemical technique to determine how the expression of GH relates to cell death in RGCs. We used sections of human retinas, taken postmortem, that we double-labeled for GH and apoptotic cell death using We found that approximately 35% of cells in the ganglion cell layer (GCL) were both GH positive and GH receptor (GHR) positive, and that GH colocalized with GHR in these cells. However, none of the apoptotic cells in the GCL were GH immunoreactive. Labeling of sections with the RGC marker, synuclein, indicated that at least 95% of the cells in the GCL were RGCs, leading us to conclude that the majority of the cells that we have examined in the GCL are RGCs.The results are consistent with the earlier proposal, based on in vivo and in vitro experimental chick embryo studies, that GH promotes survival in adult human RGCs. We have previously shown that growth hormone (GH) is present in the retina and vitreous of the developing chick embryo , in periSince GH is present in adult human and mammalian retinas ,3, we haterminal deoxynucleotidyl transferase dUTP nick end-labeling (TUNEL). We found that none of the cells in the ganglion cell layer (GCL) that expressed GH were TUNEL-positive, suggesting that the presence of GH in the RGCs is likely involved in the promotion of cell survival.In the present study, we have examined sections of human retinas for the presence of GH in the cells of the RGC layer, and correlated this with the occurrence of RGC death using the method of Paraffin wax-embedded sections of human retinas, taken postmortem, were obtained from Dr. Yeni Yucel, Department of Ophthalmology and Vision Sciences, University of Toronto . Experiments were performed after approval by the Health Research Ethics Board of the University of Alberta. The formalin-fixed specimens used in this study were taken from three different cadavers: a 74-year-old male ; an 81-year-old male ; and a 69-year-old male . Results were consistent between sections from each of these individuals.2HPO4, 1.48 g/l; KH2PO4, 0.43 g/l. After washing, sections were then incubated overnight in 30\u00a0\u03bcg/ml Mab 263, a mouse anti-human GH receptor (GHR) monoclonal antibody . Sections were then washed and incubated for 2 h with 1:200 goat-anti-mouse Alexa Fluor 594 . After washing, sections were then incubated with 4\u2019, 6\u2019-diamino-2-phenylindole (DAPI) for 2 min to stain nuclei. The labeled sections were then examined by a confocal microscope , equipped with appropriate lasers. In negative controls, the two primary antibodies were replaced with non-immune rabbit serum and mouse IgG. The primary antibodies have been used previously for GH and GHR localization in human tissues [For immunocytochemical double labeling, the sections were dewaxed and blocked for 1 h in 3% BSA (BSA) and then incubated overnight, at 4\u00a0\u00b0C, with a 1:200 dilution of rabbit anti-human GH , followed by a 2 h incubation in a 1:200 dilution of goat-anti-rabbit secondary antibody that was conjugated to Alexa-Fluor 488 . All washings mentioned in this paragraph were done in phosphate buffered saline (PBS). The PBS contained: NaCl, 7.2 g/l; Na tissues ,14.To confirm the identity of cells in the GCL, we used C-20 , a polyclonal antibody, against \u03b3-synuclein ,16. ThisFor the TUNEL technique, sections were dewaxed and washed in PBS before they were treated with 2.5\u00a0\u03bcg/ml proteinase K for 10 min at room temperature. Sections were then treated for 5 min with a TdT buffer that consisted of 30\u00a0mM Trizma base, 140\u00a0mM sodium cacodylate, and 1\u00a0mM cobalt chloride (pH 7.2). Tissue was incubated with the reaction mixture for 1.5 h at 37\u00a0\u00b0C in a humid chamber, using the kit from Roche Molecular Biochemicals  at a volume of 20\u00a0\u03bcl per sample. A volume of 100\u00a0\u03bcl contained: double distilled water, 81\u00a0\u03bcl; TdT buffer, 6.5\u00a0\u03bcl; cobalt chloride, 3.26\u00a0\u03bcl; biotin-16-dUTP stock, at a concentration of 1 nmol/\u00b5l, 1.86\u00a0\u03bcl; dUTP, 5.5\u00a0\u03bcl; and TdT, at a concentration of 10 units/\u03bcl, 2\u00a0\u03bcl. Samples were then washed in PBS three times for 5 min each, and blocked with 3% skimmed milk in PBS containing 0.5% Tween-20 for 30 min. Samples were washed in PBS three times for 5 min each, and the fluorochrome, Streptavidin-FITC, was added at a concentration of 1:200, for 1 h at room temperature. Following 3 washes in PBS for 10 min each, the samples were taken through the immunocytchemistry procedure described above, using Alexa-Fluor 594 as the secondary antibody, and mounted on slides with Vectashield . All cell counting was performed by manually counting each cell seen in the confocal images. All images of the retina were obtained from within approximately 5\u00a0mm of the optic nerve head. Sample sizes (n) are the combined numbers of cells from all three retina samples.Immunocytochemical localization of GH and GHR in human retina sections  indicateTo confirm the identity of cells in the GCL, we labeled sections with an antibody against \u03b3-synuclein, a marker for RGCs ,16. The Double labeling cells with GH and TUNEL for apoptotic DNA fragmentation  showed tIn There are limited experimental options available for use in attempts to establish a functional role for endogenous GH in adult human RGCs. In this study, we chose to correlate the presence of immunoreactive GH with a marker of cell death in the GCL from sectioned human retinas. We found that cells of the GCL that contained TUNEL-positive nuclei never expressed GH immunoreactivity in their nucleus or cytoplasm. Of the remaining cells that contained TUNEL-negative nuclei, two-thirds had GH in the cytoplasm as well as nuclei. Labeling of sections with the RGC marker synuclein ,16, indiOne third of the TUNEL-negative RGCs apparently did not express GH. We conclude that GH is sufficient, but not necessary, for RGC survival. Presumably, such cells may receive survival signals from other molecules, since GH is by no means the only neuroprotective molecule present in the retina .We found that 46% of the cells in the GCL of our samples were TUNEL-positive. This number of apoptotic cells may be attributed not only to natural cell death in this layer, but also possibly to postmortem cell death, since fixation of the specimens was performed between 2 and 13 h postmortem. However, evidence from examination of retinas after optic nerve transection  indicateThat GH and GHR are mostly colocalized to the nuclei is not unexpected; it has long been known that both GHR and GH are associated with the nucleus . TechnicOn the basis of these results, the question arises as to whether or not patients with low systemic GH levels experience retinal cell death or other retinopathies. Bearing in mind that systemic levels of pituitary GH may not be relevant to the ocular levels of locally produced GH , the litWe conclude that in the human retina, the presence of GH in the RGCs correlates with the survival of these cells. This conclusion is consistent not only with our previous experimental results ,8,9, but"}
+{"text": "Objective: Cement burns account for relatively few admissions to a burn unit; however, these burns deserve separate consideration because of special features of diagnosis and management. Cement burns, even though potentially disabling, have rarely been reported in literature. Methods: A retrospective review was performed of all patients admitted with cement burns injuries to the national burns unit at the St James's Hospital in Dublin, Ireland, over a 10-year period for the years 1996\u20132005. Results: A total of 46 patients with cement burns were admitted. The majority of patients were aged 16\u201374 years (mean age = 32 years). Eighty-seven percent of injuries occurred in an industrial and 13% in a domestic setting. The upper and lower extremities were involved in all the patients, and the mean total body surface area affected was 6.5%. The mean length of hospital stay was 21 days with a range of 1\u201340 days. Thirty-eight (82%) were surgically managed involving debridement and split-thickness skin graft (SSG) and four (9%) were conservatively managed. A further four did not have data available. Conclusion: Widespread inexperience in dealing with this group of cement burns patients and delays in referral to burns unit highlights the potential for greater levels of general awareness and knowledge in both prevention and treatment of these burns. As well, early debridement and split-thickness skin grafting at diagnosis constitutes the best means of reducing the high socioeconomic costs and allows for early return to work. Contacts with cements occurring in the industry or home are primarily accidental, and the costs of treatment tend to be high due to absence from the workplace. The lack of information and education regarding risks related to cement handling has been identified as a potential risk factor for this type of injury. Of many published articles, only a few rather recent publications report more substantial series,This is a review of our experience in the management of this patient population and highlights the need for improvements in education and early diagnosis and treatment of these costly injuries.A 10-year retrospective study was conducted in the national burns unit at the St James's Hospital (SJH), Dublin, Ireland. All patients treated for cement burns between 1996 and 2005 were identified by review of meticulous record of inpatients kept by nursing staff within the unit.Full medical records for these patients were then examined for age, sex, and occupation of the patients. Length of hospital stay, circumstances of the accident, type of cement used, length of exposure, site of injury, knowledge of risks, total body surface area (TBSA) affected, initial treatments, delay before medical and surgical management, follow-up, time to return to work, and possible occurrence of sequelae or residual problems were also examined. The distinction between domestic and industrial settings was made, and modes of treatment were either surgical or conservative.During the years 1996\u20132005, there were 2118 patients' admissions to the burns unit. Of these, 46 were admitted for cement burns, accounting for 2% of the total. Of those admitted, 45 were male and only 1 was female with a mean age of 32 years (range: 16\u201374 years) (Table No information regarding patients' occupations was given in 19 patients (41%), 20 patients (43%) had occupation within the construction industry or related area , and 7 patients (15%) belonged to other occupational groups.Six (13%) of the cement burns cases reported occurred during do-it-yourself work, and 33 (71%) cases were work accidents. No information was available in 7 (15%) cases. The majority of cement burns affected the lower leg and ankles due to spilling of wet cement over the top of boots or the penetration of cement through defective protective shoes . In these cases, it is notable that most patients did not take off their boots to clean them, but continued to wear them until finishing work, even if symptoms had already begun. Another frequent mode of injury was kneeling without additional protection for the knees, when leveling the concrete or cement, 5 (11%) of the cases described. Mean exposure time to cement was 60 minutes (1 min\u201324 hours). Only 5 (11%) patients had initial treatment with irrigation of the wound and 41 patients (89%) were treated with dressings \u00b1 antibiotics initially and later referred to the burn unit.Thirteen (28%) patients presented to general practitioner on the same day, 6 (13%) on the following day, 2 (4%) after 2 days, and 15 (32%) presented more than 2 days with maximum delay up to 5 weeks, while 10 patients (22%) did not have data available.The time to return to work after a mean of 4 months with average hospital stay was 21 days (range: 1\u201340 days)  were surgically managed involving debridement and split-thickness skin graft (SSG), and 4 (9%) were conservatively managed. A further 4 patients did not have data available.Most of the patients received delayed surgical treatment, and that was due to delay in referral to burns unit from the time of injury. However, all but 4 of these 46 patients were surgically treated relatively promptly within 4.5 days of admission.Records of the effect of cement on the skin date back to the 1700s and were presumed to be due to a contact dermatitis.4Cement burns have an insidious onset. Most patients comment that they notice only mild irritation initially. Cement contains lime , which will potentially penetrate clothing and react with sweat causing an exothermic reaction. Even when not exposed to moisture, the dry powder is very hygroscopic and may also cause a desiccation injury. Hydrated calcium oxide becomes calcium hydroxide that causes skin damage primarily due to hydroxyl ion.4The treatment of cement burns, though not unequivocal in the literature, is currently oriented toward early excision and grafting, once the diagnosis of full-thickness burns has been made.6The anatomical distribution of cement burns to the lower leg, foot, and ankles Fig  and to tThese burns most commonly affect the extremities with localization especially in the lower limbs, notably on ankles, foot, and knees.Longer hospitalization of patients with cement burns was required for complete skin healing than in the overall burns group. This is consistent with previous reports.Postburn sequelae include scar hypertrophy, skin fragility, and pruritis. These occur more frequently when healing is delayed for more than 3 weeks, as full-thickness burns, which are common in cement burns, do not heal by secondary intention. These sequelae can be avoided by early recognition of graft failure or inadequate debridement and any evidence of infection. After the healing period, postoperative follow-up should correspond to that of any burn graft, that is, prevention of the hypertrophic and contractile tendency of scars by the wearing of compression garments and massaging of the scars, possibly in association with physical therapy.1The incidence of cement burns has increased in our institution and now accounts for 5% of admissions to our burn unit over a 1-year period. This is due to recent increase in construction industry in Ireland and influx of workers from non\u2013English-speaking European member states with language barrier making them vulnerable to be involved in cement-related accidents at construction sites.The risks related to cement handling often go unrecognized. These burns can be avoided with good preventative education and early therapeutic management. In the case of any deep burns, surgical treatment at diagnosis constitutes the best means of reducing the high socioeconomic costs and early return to work."}
+{"text": "Mean total and LDL cholesterol, fasting insulin, and HOMA-IR were all higher, in subjects who would have been classified as GH-deficient compared with GH-sufficient. Peak GH secretion after stimulation was inversely associated with fasting insulin , HOMA-IR , total cholesterol , and LDL cholesterol  and positively associated with HDL cholesterol . These data strongly suggest a role for insulin resistance in the decreased GH secretion of obesity and that the blunted GH secretion of central obesity could be the pituitary expression of the metabolic syndrome.The aim of the present study was to evaluate the relationship between GHRH-induced GH secretion in obese premenopausal women and cardiovascular risk markers or insulin resistance. Premenopausal obese women, aged 35\u201352 years, were studied. GH secretion, IGF-I, serum cardiovascular risk markers, insulin, leptin, mid-waist and hip circumference, total body fat, and truncal fat were measured. Subjects were classified as meeting the criteria for GH deficiency (GHD) when peak GH after stimulation with GHRH was \u22643\u2009 Several classic studies have shown that GH deficiency (GHD) in adults is associated with abnormalities in body composition, metabolic derangements, and suboptimal physical performances; these impairments improve with GH replacement therapy \u20133. Hypopbody mass index (BMI), the lower the GH response to provocative stimuli [GH-Releasing Hormone (GHRH) [GH-Releasing Peptide-6 (GHRP-6) both at saturating doses, which resulted in a massive GH response for obese subjects [In obesity there is a markedly decreased GH secretion. For both children and adults, the greater the  stimuli , 16, ince (GHRH) , 18. Thee (GHRH)  or by she (GHRH) . The mossubjects . This resubjects  and GH tsubjects \u201326. A resubjects . tumour necrosis factor-\u03b1  (TNF- \u03b1 ) receptor I higher, in young overweight or obese women meeting GHD criteria than in women with GH sufficiency. These differences remained significant after controlling for age plus BMI, waist circumference, or trunk fat; there were no differences in measures of insulin resistance [However, little is known about whether the association between decreased GH secretion and increased cardiovascular risk markers observed in patients with GHD and hypopituitarism occurs in obese patients without organic hypothalamic or pituitary disease. There are some recent interesting studies that have evaluated the relationship between GH secretion, evaluated by GHRH-arginine testing and cardiovascular risk markers or central adiposity measures. Makimura et al. found that the GH response to GHRH-arginine testing is reduced in both overweight and obese men and negatively associated with indices of central abdominal obesity including waist circumference, trunk fat, and visceral adipose tissue. They also found that the use of waist circumference adds predictive information to the determination of GH response, independent of BMI . Utz et sistance . Carmichsistance .The most clearly altered GH secretion test in obesity is GHRH-induced GH secretion , 30, 31,2, were studied , with a BMI of 36.0 \u00b1 6.4\u2009kg/m studied . None ofBetween 08:30 and 09:00\u2009AM, after an overnight fast and while seated, a peripheral venous line was obtained. Fifteen minutes later GHRH  was administered. We obtained blood samples for GH at baseline (0 minutes) and then at times 15, 30, 60, 90, and 120 minutes. Fasting blood was drawn for IGF-I, serum cardiovascular risk markers, and hormonal determinations. Mid-waist circumference was measured as the midpoint between the iliac crest and the lowest rib, with the patient in the upright position. Measurement of the hip circumference was performed at the widest point, also with the subject in an upright position. Total body fat was calculated through bioelectrical impedance analysis (BIA). BIA is based on measurement of the transmission speed of a 1/4 volt electrical pulse between electrodes at the feet and hands. Because fat-free mass is comprised of water, proteins, and electrolytes, and conductivity is greater in fat-free mass than in fat mass . Resista\u03bcg/L) was measured by a solid-phase, two-site chemiluminescent enzyme immunometric assay  with a sensitivity of 0.01\u2009\u03bcg/L and with intrassay coefficients of variation of 5.3%, 6.0%, and 6.5% for low, medium, and high plasma GH levels, respectively; and with interassay coefficients of variation of 6.5%, 5.5%, and 6.6% for low, medium, and high plasma GH levels, respectively. IGF-I (ng/mL) was determined by a chemiluminescence assay  and with intrassay coefficients of variation of 4.8%, 5.2%, and 4.4% for low, medium and high plasma IGF-I levels, respectively, and with interassay coefficients of variation of 7.7%, 7.4%, and 4.7% for low, medium, and high plasma IGF-I levels, respectively. Insulin (\u03bcU/mL) was measured with a solid-phase two-site chemiluminescent immunometric assay  and with intrassay coefficients of variation of 5.5%, 3.3%, and 3.7% for low, medium and high plasma insulin levels, respectively, and with interassay coefficients of variation of 7.3%, 4.1%, and 5.3% for low, medium, and high plasma insulin levels, respectively. Leptin (ng/mL) was measured by radioimmunoassay  and with intrasay and interassay coefficients of variation of 5.3% and 13.6%, respectively. Glucose, total, HDL, and LDL cholesterol, triglycerides, glutamic oxalacetic transferase (GOT), glutamic pyruvic transferase (GPT), and gamma glutamyl transferase (GGT) were measured using standard laboratory previously described methods [Serum samples were collected and stored at \u221280\u2009C. Serum GH  was calculated by a trapezoidal method. Insulin resistance was calculated on the basis of fasting values of plasma glucose and insulin, according to the homeostasis model assessment (HOMA-IR) method  as folloIntragroup comparisons were based on Mann-Whitney test. Numerical correlations were analyzed using Spearman's correlation test. P values \u2264 .05 were considered to be significant. For graphic presentation we use mean values \u00b1 SEM. The SPSS software 12.0  was used to produce statistical analysis.The results are presented as mean values \u00b1 SEM. All comparisons were based on univariate, nonparametric tests. 2. Subjects were arbitrarialy classified as meeting the criteria for GH deficiency (GHD) when peak GH after stimulation with GHRH was \u22643\u2009ng/mL; although GHRH alone is not a well-validated test for the diagnosis of GH deficiency, this cutoff point is based on standard criteria used to diagnose adults with hypopituitarism after various stimuli [Clinical characteristics, cardiovascular risk markers, and hepatic aminotransferases are shown in  stimuli , 38. GH 2, with a midwaist circumference of 117 \u00b1 9.2\u2009cm, significantly higher than in obese patients with GH sufficiency (P = .007 for BMI and P = .039 for midwaist cicumference). The group of patients with peak GH after stimulation \u22643\u2009\u03bcg/L had a tendency to a higher mean age than the group of patients with peak GH after stimulation >3\u2009\u03bcg/L, 42.3 \u00b1 9.0 versus 30.4 \u00b1 9.4 , respectively, although the difference was not significant.Clinical characteristics, cardiovascular risk markers, and hepatic aminotransferases in GH-Deficient and GH-Sufficient obese women are presented in \u03bcg/L) for patients above or below the median, respectively (P = .005) . Peak GH secretion was strongly and inversely associated with waist circumference , , and trucal fat . These associations remained significant after controlling for age.When the patients were divided in two groups, above or below BMI median, peak GH secretion was 15.2 \u00b1 2.0 and 5.6 \u00b1 1.8 ( = .005) . BMI wasP = .039 and P = .044, resp.)    . Mean se, resp.) . Mean fa, resp.) . These dR = \u22120.532, P = .034) and LDL cholesterol  and positively associated with HDL cholesterol . Peak GH secretion after stimulation with GHRH was inversely associated with serum hepatic aminotransferase, GOT , GPT , and GGT . Peak GH secretion after stimulation with GHRH was inversely associated with fasting insulin  and HOMA-IR . These correlations were no longer significant after controlling for measures of adiposity whether BMI, mid-waist circumference, or trunk fat.Correlations between GH secretion or IGF-I and cardiovascular risk markers or aminotransferases are shown in R = \u22120.577, P = .024) and percentage of total body fat . IGF-I was strongly negatively associated with LDL cholesterol  and positively associated with HDL-cholesterol . IGF-I was strongly negatively associated with HOMA-IR . These correlations were no longer significant after controlling for measures of adiposity whether BMI, mid-waist circumference, or trunk fat. HOMA-IR was strongly and positively associated with serum hepatic aminotransferases, GOT , GPT , and GGT .IGF-I was strongly and inversely associated with BMI  syndrome."}
+{"text": "The broad range in growth observed in response to growth hormone (GH) treatment is mainly caused by individual variations in both GH secretion and GH sensitivity. Individual GH responsiveness can be estimated using evidence-based models that predict the response to GH treatment; however, these models can be improved. High-throughput proteomics techniques can be used to identify proteins that may potentially be used as variables in such models in order to improve their predictive ability. Previously we have reported that proteomic analyses can identify biomarkers that discriminate between short prepubertal children with idiopathic short stature (ISS) who show good or poor growth in response to GH treatment. In this study we used a pharmaco-proteomic approach to identify novel factors that correlate with the growth response to GH treatment in prepubertal children who are short due to GH deficiency or ISS. The study included 128 short prepubertal children receiving GH treatment, of whom 39 were GH-deficient and 89 had ISS. Serum protein expression profiles at study start and after 1 year of GH treatment were analyzed using SELDI-TOF. Cross-validated regression and random permutation analyses were performed to identify significant correlations between protein expression patterns and the 2-year growth response to GH treatment.2 = 0.73). After 1 year of treatment, a combination of four peaks in the GH-deficient group (R2 = 0.64), eight peaks in the ISS group R2 = 0.47) and eight peaks in the total study group correlated with the 2-year growth response R2 = 0.38).At start of treatment we identified a combination of seven protein peaks that correlated with the 2-year growth response in the GH-deficient group (RThe peaks identified corresponded to apolipoproteins A-I, A-II, C-I, C-III, transthyretin and serum amyloid A 4, which are all part of the high-density lipoprotein.Using a proteomic approach we identified biomarkers related to the lipoprotein profile that could be used to predict growth response to GH treatment in prepubertal children who are short as a result of GH-deficiency or who have ISS.These results support our previous findings that apolipoproteins and transthyretin may have a role in GH sensitivity. Growth during childhood depends, among other things, on the balance between the level of endogenously secreted growth hormone (GH) and the responsiveness of the target tissue to GH. Furthermore, a broad range of serum GH levels has been observed in children with similar growth rates  and it iWe have previously used surface-enhanced laser desorption/ionization time-of-flight mass spectrometry (SELDI-TOF MS) to identify biomarkers that discriminate between good and poor responders to GH treatment among a group of children with ISS . We showIn this study we used the same technique to search for biomarkers that correlated with growth response to GH treatment in short prepubertal children, who were either GH-deficient or of ISS. Serum samples taken at the start of a clinical trial of GH and after 1 year of treatment from children with a broad range of levels of GH secretion at start were analyzed. We found that serum markers related to nutrition and fat transport in the body correlated with the 2-year growth response.The protocol was approved by the ethical boards of the Universities of Gothenburg , Ume\u00e5, Uppsala and Malm\u00f6 and the Medical Product Agency of Sweden. Written informed consent was obtained from all parents and from children if old enough. The trial was performed in accordance with the Declaration of Helsinki and Good Clinical Practice guidelines.The per-protocol study population from the GH dose clinical trial (TRN 98-0198-003) consists of 128 short prepubertal children of Caucasian origin receiving GH treatment; see  for moremax) \u2265 32 mU/L on an arginine-insulin tolerance test (AITT) or of the spontaneous GH secretion over a 24 h period was used to classify the patients as having either ISS (n = 89) or short stature due to GH deficiency (n = 39). Clinical data for the patient groups are presented in Table The maximum peak GH secretion . H50 arrays were washed with 200 \u03bcl 50% acetonitrile (ACN)  2 \u00d7 5 min, equilibrated twice with 150 \u03bcl binding buffer ). After equilibration, a 10 \u03bcl sample and 90 \u03bcl binding buffer were applied to duplicate samples on the arrays and mixed at room temperature using a DPC MicroMix 4 for 1 h (CM10 and IMAC30) or 1.5 h (H50). After protein binding, the arrays were washed three times with 150 \u03bcl binding buffer, rinsed twice with 150 \u03bcl 1 mM HEPES, and air-dried. Afterwards, 0.6 \u03bcl of a 50% solution of sinapinic acid (SPA) (Bio-Rad Laboratories) in 0.5% trifluoroacetic acid and 50% ACN were applied twice to each spot as a matrix.Serum samples were thawed, denatured and fractionated using anion-exchange beads in a serum fractionation kit  according to protocols provided by Bio-Rad Laboratories. Based on results from a previous study , serum fTime-of-flight spectra were generated using a PBS IIc ProteinChip reader (Bio-Rad Laboratories). Instrument settings for the analysis were optimized in the mass range of 2.3-20.0 kDa and data were averaged from 180 transients for each protocol. To minimize experimental variation, all samples were randomized and analyzed concurrently within 1 week by the same operator. In addition, one reference serum sample was randomly applied on each array and evaluated. The mass accuracy was calibrated in the molecular range of 5-18 kDa using external calibrators from Bio-Rad Laboratories. The same calibration equation was used for all samples.Data handling was performed using ProteinChip Data Manager (Bio-Rad Laboratories). All spectra were baseline-subtracted and normalized according to total ion current. Settings for peak identification and clustering of peaks across multiple spectra were first pass signal-to-noise ratio (S/N) > 3 in 15% of all spectra and second pass S/N > 2, with a cluster mass window of 0.3% of the mass.Spectra were visually inspected and patients were excluded from further data analysis if profiles clearly differed between the duplicate samples or if the overall quality was low in one or both of the spectra . This process resulted in the identification of 147 valid peaks for CM10 (n = 67), IMAC30 (n = 46) and H50 (n = 34) in the mass/charge (m/z) area between 2.3 and 30.0 kDa. The average coefficient of variations (CV) for the peaks detected in all of the reference samples was 30.1% for CM10, 34.1% for IMAC30 and 32.8% for H50.Only patients for whom there were two high-quality mass spectra for the relevant array and time point were included in further statistical analysis. This resulted in a study population of 128 children for the CM10 analyses at all time points. For analyses of peak data from the three different arrays merged together, the study populations were 121 children at the start of the study, 124 children after 1 year and 120 children for the change between baseline and 1 year (delta 0-1 year).ACN precipitation was performed, as previously described , on the For all analyses the 2-year growth response (delta height SDS 0-2 years)  was usedMultivariate data analysis was performed with Matlab software  on the mean intensity levels of the duplicate samples. Cross-validated stepwise regression was computed to find subsets of peaks that correlated with the delta height SDS 0-2 years. Final selection of reliable subsets of predictive peaks was based on a random permutation test. The identified peaks were analyzed thereafter using multidimensional scaling (MDS) to explore the relationships between the peaks.To estimate the reliability of the peaks compared with their biological range, the ratio of the between-duplicate variation and the total variation was computed, giving the proportion of variance explained by duplicates. A low value for a certain peak meant that there was relatively little variation between the duplicates compared with the total expected biological and instrumental variation.Using stepwise regression, subsets of peaks were selected with leave-one-out cross-validation to examine the correlation of the peaks with delta height SDS 0-2 years. Sets of potential regression models were generated using between 1 and a maximum of 15 peaks.2. For each number of peaks, we tested for 999 permutations if the permuted cross-validated R2 was equal to or above 90% of the calculated true cross-validated R2. In other words, we assessed if there was a significant gap (10%) between the calculated true cross-validated R2 and the distribution of all permuted cross-validated R2. Random permutation tests resulting in a p-value < 0.05 were considered significant. For each number of peaks, the best regression model was selected based on a significant p-value in the permutation tests, in combination with a relatively low number of peaks in the regression model and a relative high cross-validated R2.To study the robustness of the data analyses, random permutation tests were performed on the complete stepwise regression procedure described above including the selection of subsets of peaks based on the highest cross-validated RStepwise regression was used to analyze the impact of systematic errors on the results. No systematic errors were found.2, were obtained using data from only CM10 on pooled fractions 5 and 6. All data were analyzed for the GH-deficient group, the ISS group and for the total group.Data from the spectra generated were analyzed both as merged peak data from all analyzed surfaces and in terms of each individual surface. Best results, with respect to the lowest permutation test p-value in combination with high cross-validated R2 = 0.73, p = 0.032)     Table . In the 5) Table . In the 3) Table .2 = 0.59, p = 0.026)   Table . There w3) Table .The protein expression patterns that provided the best predictive peaks for the 2-year growth response in the GH-deficient group, the ISS group and the total group, included a total of 23 unique peaks , this peak most likely represented Apo C-III. However Apo A-I was also present in the sample, but with a lower Mascot search result score . The 12.607 kDa peak was identified as serum amyloid A 4 (SAA 4). The identity of the remaining peaks could not be determined accurately using MS.To verify the identities obtained from MS analyses of the proteins, depletion experiments using specific antibodies were performed. The depletion experiments using anti-Apo C-I and anti-Apo C-III antibodies  confirmed that the 6.857 peak represented Apo C-I Figure  and the The change in absolute peak intensities during the first year of GH treatment for the Apo A-I, Apo A-II, Apo C-I, Apo C-III, TTR and SAA 4 proteins found in this study were fairly small. Apo A-II and SAA4 are significantly decreased  while Apo C-I and Apo C-III are significantly increased . Apo A-I and TTR remained unchanged.In this study we have identified serum protein profiles that correlated with the 2-year growth response to GH treatment in prepubertal children with GH deficiency and ISS. By using a combination of the specific peak patterns within the spectra, MS identification, and serum depletion experiments, proteins representing a subset of peaks within the profiles were identified. The majority of the proteins identified represent different apolipoproteins; Apo A-I, Apo A-II, Apo C-I and Apo C-III. Other proteins identified were TTR and SAA 4. These results support previous data suggesting that Apo A-II and TTR may have a role in determining GH sensitivity. The change in intensity of these peaks has been shown to allow the classification of children with ISS as good or poor responders to GH treatment .All proteins identified in the current study are part of the HDL -24, but From this study it is not possible to draw conclusions as to whether the markers identified are actually involved in the regulation of longitudinal growth or if they are indirect markers of the effects of GH on HDL levels during treatment. The different levels of the identified proteins may be a consequence of the altered levels of HDL and changes in the homeostasis of the lipoproteins. Interpretation of the results is also complicated by the presence of different regulated isoforms and cleavage products of Apo A-II as described in the legends to Figures On the target tissue level one can say that both the GH-deficient and the ISS child are GH-deficient; the deficient one due to low levels of secreted GH, and the idiopathic short child due to GH insensitivity in the target tissue, which often can be overcome by a higher dose of GH treatment . The undThe optimal time period needed to detect changes in patterns of protein peaks that may be of utility in predicting long term growth is likely to be different for different variables and in different subset of the population. Previously we have shown that growth over the first year of treatment is a good predictor of long-term growth in response to GH (1-7 years) in prepubertal children . HoweverCurrently, the best models for predicting growth in response to GH treatment are based on early growth data, auxological data of the child and the parents, and hormone levels during the pretreatment year ,8,11. HoDuring the last decade there has been growing interest in proteomics and systems biology in general. A main focus has been exploring the use of new technology to study complex multigenetic diseases, to predict drug response, to individualize treatment and to discriminate between healthy and diseased individuals -41. We hThe reproducibility and reliability of the SELDI-TOF proteomic system have been discussed -47. ConcMuch effort has been put into creating a robust and reliable strategy for the statistical analysis of peak data. Combinations of between-duplicate variation ratio, cross-validated stepwise regression and random permutation tests were performed in order to make certain that the results obtained were robust and reliable.In summary, analysis of serum protein expression patterns can be used to identify markers of growth response in short prepubertal children with either GH-deficiency or ISS receiving GH treatment. Our results support previous findings that apolipoproteins and TTR may have a role in GH sensitivity and could be used to predict growth in response to GH treatment in short prepubertal children. The next step will be to test whether or not the incorporation of information on these peaks (either in addition to or in place of existing variables) in our prediction models for prepubertal growth ,8 will hmax: maximum peak of GH secretion; HDL: high-density lipoprotein; IGF-I: insulin-like growth factor I; IGFBP-3: IGF-binding protein 3; ISS: idiopathic short stature; MS: mass spectrometry; LC -MS/MS: liquid chromatography/tandem MS; m/z: mass/charge; LDL: low-density lipoprotein; SDS: standard deviation score; SELDI-TOF-MS: surface-enhanced desorption/ionization time-of-flight mass spectrometry; S/N: signal-to-noise ratio.AITT: arginine-insulin tolerance test; Apo A-II: apolipoprotein A-II; CV: coefficient of variation; FT/ICR: Fourier transform ion cyclotron; GH: growth hormone; GHD: GH-deficient; GHKAW declares that she received an unrestricted research grant from Pharmacia/Pfizer until 2005. AFMN works for Muvara, Multivariate Analysis of Industrial and Research Data Statistical Consultation, The Netherlands.GH, BA and ZH declare that they have no competing interests.BA, GH, AFMN, ZH and KAW have all given substantial contribution to conception and design, analysis and interpretation of the data. BA, GH and KAW have designed the experiment and BA has carried out all the SELDI-TOF and additional experiments. AFMN performed most of the statistical analyses, the rest have been performed by BA. GH, BA, AFMN, ZH and KAW have all been involved in drafting the manuscript and have revised it critically for intellectual content."}
+{"text": "Aggressive Angiomyxoma (AAM) is a rare mesenchymal benign myxoid tumor of the pelvis and perineum which occurs almost exclusively in adult females. We are presenting a case of 64 year old male patient with a slowly growing scrotal swelling which has been regarded as hydrocele for 2 years. The patient was referred to scrotal exploration. At surgery a huge mass adjacent to the bulbar urethra was found, not involving the testicles. The morphological picture and the special stains were compatible with aggressive angiomyxoma of the scrotum and peritoneum. Aggressive Angiomyxoma (AAM) is a rare mesenchymal benign myxoid tumor of the pelvis and perineum which occurs almost exclusively in adult females. It is usually arising from the soft tissues of the pelvic region, perineum, vulva and buttock. Overall, its incidence is about 6-folds higher in females  and it iA 64-year-old healthy patient presented with a slowly growing scrotal swelling which has been regarded as hydrocele for 2 years. Physical examination revealed a nontender scrotal swelling between the testicles which were of normal volume and consistency. Ultrasonography demonstrated diffuse median scrotal swelling accompanied with edema and small fluid pockets. Similar appearance was visualized on computed tomography  and the Since 1983, when aggressive angiomyxoma was first described by Steeper and Rosai, there were about 100 cases reported worldwide . It often occurs in middle-aged patients ranging in age between 13 and 78 years (mean age 46). In men, AAM is usually derived from the pelviperineal interstitial tissue involving the scrotum (38%), spermatic cord (33%), perineal region (13%) and intrapelvic organs such as the bladder (8%) [AAM in the scrotal region may present as a scrotal mass, wrongly diagnosed as hernia or hydrocele, as has been previously reported in few cases , 4. It iSurgery is the principal treatment to date and because of high risk of local recurrence 36\u201372%) a long-term postoperative followup with either US or CT is recommended \u201372% a lo. HoweverIn summary, AAM is a very rare benign neoplasm which is more predominant in females. In males, scrotal AAM may be misdiagnosed as hernia or a hydrocele mainly because of the lack of awareness of this entity."}
+{"text": "Adult onset GH deficiency (GHD) is characterized by abnormalities of serum lipoprotein profiles and GH replacement results in favourable alterations in serum total and low density lipoprotein (LDL)-cholesterol. Preliminary evidence has indicated that the effect of GH replacement in this respect may be additive to that of HMG CoA reductase inhibitor (statin) therapy. We have examined this possibility during prospective follow-up of adult onset hypopituitary patients enrolled in KIMS , a pharmacoepidemiological study of GH replacement in adult hypopituitary patients.Lipoprotein profiles were measured centrally at baseline and after 12 months GH replacement therapy.Sixty-one hypopituitary patients  on maintenance statin therapy (mean 2\u00b75 \u00b1 2\u00b77 SD years before GH) (statin group \u2013 SG) and 1247  patients not on hypolipidaemic therapy (nonstatin group \u2013 NSG) were studied. All patients were na\u00efve or had not received GH replacement during the 6 months prior to study. Patients who developed diabetes mellitus during the first year of GH therapy or in the subsequent year and those with childhood onset GHD were excluded from this analysis. An established diagnosis of diabetes mellitus was present in 18% SG and 4\u00b74% NSG at baseline.Serum concentrations of total, high density lipoprotein (HDL)-cholesterol, triglycerides and IGF-I were measured centrally in all patients and LDL-cholesterol was estimated using Friedewald's formula.P < 0\u00b70001, SG vs. NSG). After 12 months GH replacement  serum total and LDL-cholesterol decreased by a mean (\u00b1SD) of 0\u00b748 (\u00b1 1\u00b725) mmol/l (P < 0\u00b70004) and 0\u00b753 (\u00b1 1\u00b708) mmol/l (P < 0\u00b70001) in SG and by 0\u00b730 (\u00b1 0\u00b789) mmol/l (P < 0\u00b70001) and 0\u00b728 (\u00b1 0\u00b780) mmol/l (P < 0\u00b70001) in NSG, respectively. There were no significant changes in HDL-cholesterol or triglycerides in either group (SG vs. NSG: NS). A relationship between LDL-cholesterol at baseline and the decrease in LDL-cholesterol after 12 months GH was evident in both groups  and a similar relationship for cholesterol was observed.The relative frequency of various statin use was simvastatin 52% , atorvastatin 30% (14\u00b74 \u00b1 7\u00b78 mg), pravastatin 9\u00b78% (31\u00b76 mg \u00b1 13\u00b79 mg), lovastatin 6\u00b76% (17\u00b75 \u00b1 5 mg) and fluvastatin 1\u00b76% (40 mg). Baseline serum total and LDL-cholesterol (mean \u00b1 SD) were 5\u00b72 \u00b1 1\u00b74 and 3\u00b71 \u00b1 1\u00b73 mmol/l in SG and 5\u00b78 \u00b1 1\u00b72 and 3\u00b77 \u00b1 1\u00b70 mmol/l in NSG, respectively (These data indicate that GH replacement exerts additional beneficial effects on lipoprotein profiles in patients on maintenance statin therapy, confirming that the effects of these interventions are complementary rather than exclusive. A number of retrospective studies have demonstrated that hypopituitarism is associated with a significant increase in standardized mortality ratio, particularly in females16The beneficial effects of GH replacement on serum lipoprotein profiles are particularly evident in relation to LDL-cholesterol, the durable decrement in which accounts for the changes in serum total cholesterol observed.KIMS is the Pfizer International Metabolic Database and pharmacoepidemiological survey of adult hypopituitary (GHD) patients treated with GH replacement therapy (Genotropin\u00ae). Enrolment into KIMS currently stands at approximately 12 000 patients from 28 countries. Following enrolment, patients are seen in local clinics at a frequency determined by the treating physician but with one visit per year being mandatory. At each visit, data are collected on specific case record forms and entered into a central database. The quality of data collection is monitored by clinical research representatives according to Good Clinical Practice Guidelines and the accuracy of data entry into the database is monitored by internal audit.vs. 4\u00b74%) at baseline. Patients were either completely na\u00efve to GH replacement or had not received GH for at least 6 months prior to the study and the study was restricted to patients with adult onset disease. Patients who developed diabetes mellitus during the first year of GH therapy or in the subsequent year were excluded from this analysis (3 on statins and 31 not on hypolipidaemic therapy). Doses of thyroid hormone replacement were constant throughout the period of observation.Lipoprotein profiles were measured prior to and after 12 months GH replacement therapy in 61 patients  on stable maintenance statin therapy  and in 1247 patients of similar mean age and range  not on hypolipidaemic therapy . All patients were enrolled between 1994 and 2004. Details of aetiological diagnosis, additional hormone replacement therapy, prevalence of diabetes mellitus and duration of statin use are provided in All patients had severe GHD as demonstrated by a peak serum GH response of < 9 mU/l (< 3 \u00b5g/l) during insulin, glucagon or arginine testing.Until November 2002, serum IGF-I concentrations were determined by radioimmunoassay (RIA) after acid-ethanol precipitation of IGF binding proteins . Thereafter, a chemiluminescence immunoassay  was introduced.Serum concentrations of total cholesterol,Long-term reproducibility, measured during a time period of more than 1 year showed CV of < 3% in the concentration range of 4\u20136 mmol/l for total cholesterol, < 5% in range of 1\u20132 mmol/l for HDL-cholestrol, < 4% in range of 1\u20132 mmol/l for triglycerides and < 6% for LDL-cholestrol for range estimated from the above CV values.t-tests as appropriate. Statistical significance was accepted at P < 0\u00b705. Correlations between baseline serum lipid measurements and changes after 12 months of GH replacement were determined using Pearson correlation coefficients.Baseline data and changes during GH replacement are expressed as means \u00b1 SD. Comparisons of non-normally distributed data were performed using the Wilcoxon rank sum test for paired and unpaired data and normally distributed data were compared using paired and unpaired Student's vs. NSG, 0\u00b732 \u00b1 0\u00b7178 mg/day vs. 0\u00b738 \u00b1 0\u00b7197 mg/day; P = 0\u00b70067).Mean GH dose requirement was slightly but significantly lower in the SG group compared with the NSG group (SG P < 0\u00b7001) after 12 months of GH treatment in the SG group and from \u20131\u00b78 \u00b1 1\u00b775 to 0\u00b74 \u00b1 1\u00b752 (P < 0\u00b7001) in the NSG group.The IGF-I SDS increased significantly from \u20131\u00b74 \u00b1 1\u00b737 at baseline to 0\u00b77 \u00b1 1\u00b739  and serum triglycerides higher in the SG group . Serum HDL-cholesterol concentrations were similar in the two groups.Concentrations of serum total, LDL- and HDL-cholesterol and triglycerides prior to commencement of GH replacement therapy are provided in R = \u20130\u00b751, P < 0\u00b7001; and R = \u20130\u00b737, P < 0\u00b7001, respectively). A similar pattern was evident for LDL-cholesterol and this is demonstrated graphically in Serum total and LDL-cholesterol decreased significantly in both the SG and NSG groups during GH replacement ; Fig. 1.The observed decrements in serum total and LDL-cholesterol in this study are consistent with previous observations on the beneficial effects of GH replacement therapy derived from single-centre studies.The development of glucose intolerance may exert a confounding effect on the interpretation of longitudinal lipoprotein profile data. For this reason we excluded from our study all patients who developed diabetes mellitus during the period of study and extended this to a further 12 months after completion in order to eliminate the possibility that a diagnosis of diabetes mellitus had been missed in the period of observation. Similarly, maintenance of a constant thyroxine replacement dose was a requirement for inclusion in the analysis.Statin therapy and GH replacement are likely to exert beneficial effects on serum total and LDL-cholesterol by increasing numbers of LDL-receptors on hepatocytes although the mechanism underlying this phenomenon differs between the two agents."}
+{"text": "Mathematical models can be used to predict individual growth responses to growth hormone (GH) therapy. The aim of this study was to construct and validate high-precision models to predict the growth response to GH treatment of short children, independent of their GH status, birth size and gestational age. As the GH doses are included, these models can be used to individualize treatment.Growth data from 415 short prepubertal children were used to construct models for predicting the growth response during the first years of GH therapy. The performance of the models was validated with data from a separate cohort of 112 children using the same inclusion criteria.res), of 0.23 SDS. The model was improved when endocrine data  collected before starting GH treatment were included. Inclusion of these data resulted in a decrease of the SDres to 0.15 SDS (corresponding to 1.1 cm in a 3-year-old child and 1.6 cm in a 7-year old). Validation of these models with a separate cohort, showed similar SDres for both types of models. Preterm children were not included in the Model group, but predictions for this group were within the expected range.Using only auxological data, the model had a standard error of the residuals (SDThese prediction models can with high accuracy be used to identify short children who will benefit from GH treatment. They are clinically useful as they are constructed using data from short children with a broad range of GH secretory status, birth size and gestational age. Prediction models are used to determine the outcome of therapies in individual patients. Validated models for predicting individual growth responses to growth hormone (GH) treatment have been constructed for short children born appropriate for gestational age (AGA) who have a broad range of GH secretory status , for chiCatch-up growth during the first years of GH treatment correlates strongly with the rest of prepubertal growth ,9 and wimax)[The aim of this study was to develop models for individual prediction of the growth response to GH during the first years of treatment, i.e., the catch-up phase, in slowly growing and/or short prepubertal children who have different GH status, gestational age and size at birth. This would facilitate the use of an evidence-based method to identify those children who will benefit from GH treatment and to individualize their GH treatment. The methodology used was non-linear multivariate regression analysis, and the decision of which variables to use was based on previous publications ,8. Factomax), and levmax) and leptmax).Data from a model group, those children beginning biosynthetic GH therapy during the period from 1986 to 1997, were used to construct the prediction models. Data from a validation group of children with the same inclusion criteria who started GH therapy during the period from 1998 to 2001, after recruiting for the model group was closed, were used to validate the prediction models.maxof 32 mU/L (10 \u03bcg/L) from either a 24-hour GH profile (24 h profile) or an arginine-insulin tolerance test (AITT).The 415 short children were born either AGA  or SGA . SGA is defined as a birth weight and or a birth length below -2 SDS, according to Swedish reference values . IsolateThe validation group consisted of a separate independent cohort of 112 children  with (n = 92) or without (n = 20) isolated idiopathic GHD, of whom 34 were born SGA.A group of 36 preterm (30\u201336 weeks of gestation) children (Preterm model group), of whom 22 were born SGA, was studied to develop a simple general fine-tuning formula for all models. Computations were done on the model using the most readily available variables having the largest number of children included. Another preterm group of 11 children , of whom 5 were born SGA, was used for validating preterm predictions. Here, gestational age ranged from 27 to 36 weeks. Of the 47 preterm children, 24 were diagnosed as having isolated idiopathic GHD.All children were of Caucasian origin. They had an uncomplicated neonatal period, without signs of severe asphyxia (defined as an Apgar score <3 after 5 minutes) and without sepsis in the neonatal period. Height and weight have been measured since birth atneonatal units, child healthcare units and schools in Sweden. The children were well nourished and showed no clinical evidence of psychosocial disorders. Criteria for exclusion consisted of maternal history of alcohol or drug addiction, chromosomal disorders, malformations, dysmorphic features with the exception of children with Silver-Russell syndrome (n = 10), chondrodysplasia, diseases other than isolated GHD and well treated hypothyroidism. Thyroid, kidney, and liver function tests were normal. Children who missed GH injections for more than 14 days per year for the first 2 years of GH treatment were excluded. All children were prepubertal during the study period, as defined by breast stage 1  or a tesBirth weight SDS and birth length SDS used in the algorithms were calculated based on the Swedish newborn infants born 1990\u201394  from which a \"healthy\"\" subpopulation was extracted in accordance with a former reference . The impAs all children were prepubertal, heights were transformed into SDS for age and sex using a mathematical childhood component of the new Swedish reference  analogouClinical characteristics of the patients in the Model group and the Validation group are given in Table Auxological variables in the models were (a) birth weight, (b) weight and height (SDS) at start of treatment, (c) at least one height and weight measurement between birth and the start of treatment, (d) maternal height SDS and (e) paternal height SDS. The characteristics of the SGA and preterm children are shown in Table 24 h 24 h GH profiles and maximum level of GHAITT GHAITT were obtained , as described previously . Also, aAll children were treated with a daily dose of GH ranging between 25 and 66 \u03bcg/kg based on the body weight (kg) of the child. The exact dose was adjusted every 3 months.All analyses were performed at the lab of V\u00e4xthuset, accredited no 1899.GH concentrations were measured using a time-resolved immunofluorometic assay , with the WHO First International Reference Preparation (IRP) 80/505 as the standard [standard . If anotstandard . AccrediIGF-I was measured by an IGFBP-blocked radioimmunoassay (RIA) without extraction and in the presence of an approximately 250-fold excess of IGF-II  [Germany) . AccrediLeptin was measured by RIA . The detection range of the assay was 0.22 to 100 ng/ml and, the intra-assay coefficients of variation were 7.0% at 2.4 ng/mL and 4.9% at 14.0 ng/ml. The corresponding values for the interassay coefficients of variation were 9.6% and 6.7% [and 6.7% . Accredires, because they are independent of the numerical value of the predicted growth response. The R2 analysis is too sensitive for the range of the predicted extremes, [res for the validation group of patients is in the same range as the group of patients used to derive the model.We present analyses of the standard error of the residuals SDsponders). The modThe technique used is described as non-linear data fitting  and empirical testing. The non-linear approach was chosen because a non-linear relationship was found between the growth response and other variables. Overfitting was prevented, by selecting stepwise subsets of non-linear transformed original variables that gave the best overall prediction result. As the growth response curve is non-linear, a non-linear correction for differences in measurement time (1 year \u00b1 3 months) was developed. The modeller had no access to the data from the validation group and testing of the final prediction models with the validation group, was performed by another statistician. A computer program for calculation of the prediction was constructed for each of the five models presented in the results section, using the algorithms presented in Additional file In the set of possible predictor variables we have added some derived variables, based on auxological measurements, which were not included in our previous model . A well-res were similar, we present only the linear dose models.In most biological systems, the response to dose is logarithmic, as it is for GH . HoweverThe GH treatment studies were approved by the Ethical Committees of the Medical Faculties of the Universities of G\u00f6teborg, Lund, Link\u00f6ping, Uppsala and Ume\u00e5 and of the Karolinska Institute. Informed consent was obtained from all children (if old enough) and their parents.res. As measurement of birth length is not performed in some countries, the weight SDS was used in the models. Five prediction models were developed. The auxological model was constructed first. The different endocrine variables were then added to produce the endocrine models. Results are calculated for the first 1, 2 and 3 years of GH treatment  giving an SDres for the Model group of 0.19 SDS.2. GHAITT+IGF-I+leptin: The peak value of the GHAITT and IGF-I and leptin at the start of treatment were added to the auxological model, giving a similar SDres as above (0.19 SDS). Thus, addition of GHAITT did not improve the model.3. GH24 h: Information from the spontaneous GH profile was obtained and the peak value (found to be most informative) was selected, and used together with the auxological model, giving an SDres of 0.16 SDS.4. GH24 h+IGF-I+leptin: When IGF-I and leptin at the start of treatment were added to the GH24 h model, the SDres decreased to 0.15 SDS, indicating that this is the most accurate model.The results from the validation indicated that the prediction accuracy was consistent with the results from all the Model groups, indicating that all the models are valid statistically . This is possible due to non-linear modelling and the inclusion of new mathematically derived growth variables, based on clinical knowledge. In the future, new prediction models adding data such as bone markers [We here present growth prediction models to be used when GH treatment is given to short prepubertal children independent of GH status, gestational age or birth size. This study presents validated prediction models with the most accurate estimates of the growth response to GH treatment available. The model with the best accuracy using auxological and endocrine variables has a 2 SDres) as those with a broader range in birth size.As the models described here were developed in a group of children with a wide range of values in the variables used, these models tend to be more robust  than thoThe value of our multivariate algorithms is strengthened by the use of one group of children to develop the models, and use of a separate group of children for validation. The algorithms, therefore, fulfil the criteria of prediction models . The nonres for the different models is a sign of the low ratio of extreme residuals, i.e. high predictive accuracy for most individual children. The greater the accuracy in the model the smaller the prediction error, and the lower the risk of making a sub-optimal clinical decision about a treatment. The models presented serve as a practical clinical tool for selecting children for successful GH treatment.Compared with the KIGS prediction model for children born SGA , we obtamax value from the spontaneous profile was the most informative variable, and more predictive than the GH peak in the provocation test, was known previously [max has nearly the same predictive value for the growth response to GH treatment as the maximum level from 24 h GH sampling. The profile GHmax was informative to the point that adding IGF-I and leptin data to the 24 h model improved the prediction interval only slightly. These variables, however, improved the prediction interval if added to the auxological model. The effect of GH on fat tissue seems to be closely related to the growth response to GH treatment [In the prediction models we use indirect variables for fat (weight and leptin), liver (IGF-I) and bone (linear growth). The finding that the GHeviously , and refeviously ,32. The eviously  that nigreatment ,33. Leptmax from the profile. To make a more informed selection of those children who will benefit from GH treatment, a decision can be made among the more simple auxological model, keeping in mind the sub-optimal SDres, or the more precise endocrine models with GHmax or IGF-I and leptin. Although the latter models are more costly in terms of the investigations required, they are improved for selecting children for treatment.In clinical practice, if it is not possible to perform a spontaneous GH profile, IGF-I and leptin are informative, although not as useful as adding the GHAuthorities in Europe and the USA have approved GH treatment for short children born SGA, regardless of their GH secretory status. Various treatment regimens have been studied with high-dose GH treatment, based on the observation of elevated circulating GH concentrations in SGA newborns ,35. A coThe models presented here are independent of birth size and provide the highest prediction accuracy available. They serve as a tool to identify those children who may benefit from GH treatment, and to help choose the optimal GH dose during the first years of treatment in order to optimize the individual catch-up growth response.AGA appropriate for gestational ageAITT arginine-insulin tolerance testDiff SDS the intra-family difference in SDS (i.e. the difference in height SDS of the child compared to his/her MPH SDS)AITT the estimated maximal GH level from AITTGHGHD GH deficientmax the estimated maximal GH level from the spontaneous GH profileGHIGF-I insulin-like growth factor-IIGF-II insulin-like growth factor-IIIGFBP-3 IGF binding protein 3MPH mid-parental height SDSSDS SD scoreres root mean square error of the residualsSDSGA small for gestational age24 h maximal GH level during a 24 h profileGHAITT peak GH at AITTGHKerstin Albertsson Wikland (KAW) declares that she have an unrestricted research grant from Pharmacia/Pfizer. Berit Kristrom (BK) has received reimbursement for expert consultant work for Pfizer but has no shares or received any salary. Andreas FM Nierop (AFMN) works for Muvara, Multivariate Analysis of Industrial and Research Data Statistical Consultation, The Netherlands.JD, BK, AN, SR, AFMN and KAW have all given substantial contribution to conception and design, analysis and interpretation of the data. AN have performed all the modelling work. JD, BK, AN, AFMN and KAW have been involved in drafting the manuscript and have revised it critically for important intellectual content. JD, BK, AN, SR, AFMN and KAW have given final approval of the version to be published.The pre-publication history for this paper can be accessed here:AlgorithmsClick here for file"}
+{"text": "Trypanosoma brucei requires the specific interaction of a guide RNA with its cognate mRNA. Hundreds of gRNAs are involved in the editing process, each needing to target their specific editing domain within the target message. We hypothesized that the structure surrounding the mRNA target may be a limiting factor and involved in the regulation process. In this study, we selected four mRNAs with distinct target structures and investigated how sequence and structure affected efficient gRNA targeting. Two of the mRNAs, including the ATPase subunit 6 and ND7-550 (5\u2032 end of NADH dehydrogenase subunit 7) that have open, accessible anchor binding sites show very efficient gRNA targeting. Electrophoretic mobility shift assays indicate that the cognate gRNA for ND7-550 had 10-fold higher affinity for its mRNA than the A6 pair. Surface plasmon resonance studies indicate that the difference in affinity was due to a four-fold faster association rate. As expected, mRNAs with considerable structure surrounding the anchor binding sites were less accessible and had very low affinity for their cognate gRNAs. In vitro editing assays indicate that efficient pairing is crucial for gRNA directed cleavage. However, only the A6 substrate showed gRNA-directed cleavage at the correct editing site. This suggests that different gRNA/mRNA pairs may require different \u201csets\u201d of accessory factors for efficient editing. By characterizing a number of different gRNA/mRNA interactions, we may be able to define a \u201cbank\u201d of RNA editing substrates with different putative chaperone and other co-factor requirements. This will allow the more efficient identification and characterization of transcript specific RNA editing accessory proteins.Mitochondrial mRNA editing in  One of the most striking examples of small RNA regulation of gene expression is the process of RNA editing in the mitochondria of trypanosomes RNA editing begins with two linked processes: the recognition and assembly of a gRNA onto its cognate target, followed by the assembly of the correct editosome ) onto the paired substrate in vitro editing at the correct editing site, suggesting that some accessory factors may be involved in RNA folding and proper presentation of the correct site to the editosome. This suggests that different gRNA/mRNA pairs may require different \u201csets\u201d of accessory factors for efficient editing. By characterizing a number of different gRNA/mRNA interactions, we may be able to define a \u201cbank\u201d of RNA editing substrates with different putative chaperone requirements. This may allow the more efficient identification and characterization of transcript specific RNA editing accessory proteins.In this study, we show that the ability of the gRNA to efficiently pair with its cognate target is dependent on both the degree of secondary structure surrounding the anchor-binding site and the base composition of the targeting region. Efficient pairing however, does not guarantee 5\u2032AAAAACAUGACUACAUGAUAAGUACAAGAGGAGACAGACGACAGUGUCCACAGCACCCGUUUCAGCACAG-3\u2032.All oligodeoxynucleotides (ODNs)  were pur32P-labeled 3\u2032 half to 1 nmol of the 5\u2032 half  and CYb templates were PCR amplified using the forward and reverse primers listed in  5\u2032 half , using 132P]-ATP, using T4 Polynucleotide Kinase (Invitrogen) and standard procedures. All RNAs were gel purified on 8% (mRNA) or 15% (gRNA) polyacrylamide gels containing 8M urea. The RNAs were eluted in an RNA elution buffer  in the presence of phenol, recovered by ethanol precipitation, and quantified using a Cary 50 spectrophotometer.RNAs were transcribed using the T7 RiboMax kit (Promega) according to manufacturer directions. For 5\u2032 end-labeling, RNAs were treated with calf intestinal alkaline phosphatase (New England Biolabs) followed by labeling with 50 \u00b5Ci of [mRNAf]/[complex]. Where: complex\u200a=\u200agRNA bound to mRNA; [gRNAfree]\u200a=\u200a[gRNAtotal]\u2212[complex]; [mRNAfree]\u200a=\u200a[mRNAtotal]\u2212[complex] D value is an average of four experiments and the standard error was calculated from the difference in these values.Binding affinities were determined by electrophoretic mobility shift assays (EMSA) as previously described, except that the gRNA/mRNA hybridization time was increased to three hours in vitro with the exception of ND7-550 that was chemically synthesized by Dharmacon Inc. The mRNAs were ligated to the 3\u2032BigSK-biotin ODN tag by annealing the tag to the 3\u2032 end of the appropriate mRNA using a bridging ODN 2, and 100 mM KCl). The biotinylated mRNA was diluted to 10 nM and 50\u2013150 resonance units (RU) of mRNA was attached at a 5 \u00b5l/min to a streptavidin coated SA sensor chip . Two cells were immobilized with mRNA, one was left unmodified to serve as a reference cell, and one cell was immobilized with the ODN tag as a control cell. Binding studies were carried out at 27\u00b0C on a BIACORE 2000  running all four cells in series with respective cycles: 1) 100\u2013300 \u00b5l gRNA injection at 5\u201310 \u00b5l/min (to obtain association at varying concentrations of gRNA). 2) Buffer flow (for dissociation of gRNA) 5\u201310 \u00b5l/min for 60\u2013180 min. 3) Regeneration (50 \u00b5l injection of regeneration buffer (8 M Urea), two 250 \u00b5l injections of running buffer at 50 \u00b5l/min). Separate fits for each association and dissociation curves were analyzed globally from each experiment to obtain kon and koff, individually, and the results were averaged. The dissociation equilibrium constant (KD) was calculated from the averages of the rate constants using the equation: The mRNA/gRNA pairs used in this study were all synthesized 10 cell equivalents/ml) was then separated by glycerol gradient sedimentation as previously described 32P-labeled mRNA (60 Kcpm) and 1 pmol of cognate gRNA were heated to 70\u00b0C (3 min), slow cooled (2\u00b0C/min) to 27\u00b0C and incubated at 27\u00b0C for 30 min. Then, 2 \u00b5l of purified editing complexes or 10 \u00b5l of the glycerol fraction were added and the reaction incubated for an additional hour in 10 mM KCl-MRB buffer . The cleavage reaction was terminated by the addition of 2 \u00b5l of stop buffer  followed by phenol/chloroform/isoamyl alcohol (25\u223624\u22361) extraction and ethanol precipitation. Samples were resolved on 8% (w/v) denaturing polyacrylamide gels. The cleavage product amount was calculated as the percentage of total input mRNA.Procyclic-form mitochondria were isolated, lysed and cleared by centrifugation. The extract  by heating to 70\u00b0C for 3 min, slowly cooling to 27\u00b0C, and keeping at 27\u00b0C for approximately 1h. The single stranded specific Mung Bean Nuclease  was then added  and the sample was incubated at 27\u00b0C for 10 min. The reaction was phenol/chloroform/isoamyl alcohol (25\u223624\u22361) extracted and treated as described in the gRNA directed cleavage assays.To probe for single stranded regions in the ND7-550/gND7-550 complex, 5\u2032-Four different mRNA/gRNA pairs were used to investigate the role of sequence and structure in gRNA targeting; A6U/gA6-14, CYbU/gCYb-558, ND7UHR3/gND7-506, and ND7-550/gND7-550 . Both th27\u00b0C\u200a=\u200a\u22128 Kcal mole\u22121). In contrast, CYbU forms a stable stem-loop with its ABS located mostly in a double-stranded region within the stem . The structures obtained by enzymatic and chemical solution structure probing of A6U and CYbU support the computer predicted structures 27\u00b0C\u200a=\u200a\u221215.9 kcal mole\u22121 and ND7-550, \u0394G27\u00b0C\u200a=\u200a\u221210.8 kcal mole\u22121). ND7UHR3 was predicted to have the ABS within a double-stranded region with internal loops, while the ABS for ND7-550 was mainly in a single-stranded region. In addition, the ND7-550 target sequence is unusual in that it is very C-rich.Computer modeling of the mRNAs indicate that they have distinct secondary structures around the ABS . A6U for32P-labeled mRNA were renatured in vitro . RNase H and a 10\u201311 nt oligodeoxyribonucleotide (ODN) complementary to the ABS were concomitantly added to the folded mRNA and aliquots were taken for analysis. The relative accessibility of the target sequence was evaluated by using different ratios of mRNA to ODN, including 1\u22361, 1\u22365, 1\u223610, and 1\u223630 ratios, and by assaying for cleavage at three different time points . The reactions were specific and demonstrated reproducible and expected cleavage products  calculated. Surprisingly, the observed KD for the ND7-550 pair was almost 10 fold lower than the KD measured for the A6 pair (KD-ND7-550\u200a=\u200a0.3\u00b10.2 nM vs KD-A6U\u200a=\u200a2.7\u00b10.5 nM). As predicted, the binding affinity for the ND7UHR3 was weaker, KD\u200a=\u200a84.5\u00b17.7 nM, but still considerably better than CYb. In addition, for all gRNA/mRNA pairs, the U-tail increased the affinity of the gRNA for its cognate mRNA. The U-tail contribution was minimal for the A6U/gA6-14 interaction, decreasing the observed KD approximately 2-fold. In contrast, a difference in binding affinity of over 10-fold was observed in the presence of the U-tail for the ND7-550 pair. This indicates that the gRNA U-tail can significantly contribute to the binding affinity even for those gRNAs that show high affinity for their targets.To correlate ABS accessibility and sequence with efficiency of RNA duplex formation we determined the binding affinity for the mRNA/gRNA pairs using EMSA, as previously described observed . Complexon) and dissociation (koff) rate constants of the mRNA/gRNA interaction, surface plasmon resonance (SPR) was employed 2, and 100 mM KCl) was injected over the immobilized mRNAs to monitor association. The dissociation phase was obtained by chasing the gRNA with buffer for up to three hours. The long injection times and the regeneration procedures used between two binding assays progressively affect the mRNA integrity during the experiments \u22125 s\u22121. In contrast, the association rates differed significantly, with the gND7-550 gRNA binding its target \u223c4 fold faster than gA6-14 (5.1\u00d7104 M\u22121s\u22121 vs 1.2\u00d7104 M\u22121s\u22121). Using the measured rate constants, the affinity constants (KD) for both RNA pairs were calculated to be 2.5 nM and 0.56 nM for the A6U and ND7-550 pairs, respectively. The calculated KDs were very similar to the KDs observed by EMSA, indicating that increase in affinity observed for the ND7 pair was due to the difference in association rate.The efficacy of RNA-dependent systems has been correlated to fast annealing kinetics 2M\u22121s\u22121) and its dissociation rate significantly faster (2.7\u00d710\u22123M\u22121s\u22121). These rate constants probably reflect the difficulty in displacing the stable stem-loop structure formed by the 5\u2032 end of the CYbU transcript. This suggests that this complex rarely forms in vivo without help from an annealing factor, allowing for the observed regulated editing of CYb during the complex life cycle.In contrast, the gCYb-558 association rate with CYbU was very slow  was due to a four-fold faster association rate constant for gND7-550. This was initially surprising as we observed a much faster RNase H ODN directed cleavage of the A6 mRNA in the accessibility assays. This may be explained by the fact that the ODN is a short piece of DNA and interaction with its target may not require the intermolecular rearrangements necessary for the larger gRNA interaction. The difference in the A6 and ND7-550 SPR-measured association rate could also be correlated with the G-C content of both anchor-binding sites. The ND7-550 ABS contains 7 G-C pairs versus only 4 in the A6 , other substrates, like ND7-550, may need additional accessory factors for proper folding and correct presentation. In contrast to both A6 and ND7-550, the two substrates with anchor-binding sites found within highly structured region were not able to either efficiently pair with their gRNAs or assemble with the core editosome. These targets probably require accessory proteins for efficient gRNA pairing.Only the two most accessible mRNAs, A6 and ND7-550, were cleaved by a gRNA-dependent endonuclease activity present in the mitochondrial extract. However, in contrast to the A6 mRNA, which was specifically cleaved one nucleotide upstream of the anchor duplex, the ND7-550 was cleaved at multiple upstream editing sites. Cleavages upstream of the first editing site have been previously reported to happen In summary, the results of these experiments indicate that target structure and sequence can significantly affect the ability of the gRNA to effectively target a substrate for RNA editing. The variety of secondary and tertiary features that must be disrupted for gRNAs to bind suggests that different gRNA/mRNA pairs might require different \u201csets\u201d of accessory factors for efficient editing. By dissecting the requirements for effective RNA targeting and hybridization, we can obtain an improved understanding of the requirements for functional interactions between small RNA and their targets."}
+{"text": "In this retrospective study, we reviewed the medical records and histopathology findings of 135 patients who underwent renal biopsies at two special hospitals affiliated to Kermanshah medical university during a six-year period (2003-2007). All were performed using Tru-Cut needle under ultrasound guidance. Twenty four specimens were unsatisfactory. There were 38 males (34.2%) and 73 females (65.7%) in 111 patients with adequate specimens (each specimen has more than 5 glomeruli); the mean age was 16.5 years (range 2-64 years). Side effects of the renal biopsies included pain at the site of biopsy in 2 (2.7%), gross hematuria in 1 (0.9%). Nephrotic syndrome was the most common indication for biopsy followed by acute renal failure of unknown etiology and nephritic syndrome. Primary glomerular disease was reported in 78 patients (70.2%) and also secondary glomerular disease in 33 patients (29.7%). Among the primary glomerulonephritis disease, minimal change disease and membranous glomerulonephritis were the commonest findings in children below the age of 16 years. Minimal change disease ranked first in adults whole membranous glomerular disease and focal segmental glomerulosclerosis were more common in the elderly. In all patients lupus glomerular disease was the commonest secondary glomerular disease. We conclude that study on renal biopsy makes final diagnosis which is associated with an acceptably low rate of complications in our practice, and in all, the patterns of renal histology in our study vary slightly from those reported from other countries. Epidomiologic studies on renal biopsies is the best way to monitor glomerular disease trends and to make policies for early detection and to control of existing glomerular disease. Therefore histological examination of the biopsied kidneys have remained the gold standard for renal diagnosis yet.In this study we report our experience with renal biopsy and the histopathological patterns of renal disease in a referral hospitals in west of Iran over six years period.This retrospective study aimed at answering three questions: What are the indications of renal biopsy in the West of Iran? What is the rate of unsatisfactory renal needle biopsy specimen? Do we have a different complication rate? And does the pattern of renal disease differ from other countries?A retrospective study of all patients who underwent percutaneous renal biopsies in our center over the last six years was performed. We reviewed all renal biopsies and referral slides pertaining to renal parenchymal disease in the archives of the department of pathology in two hospitals by two pathologists and one nephropathologist from 2003 to 2007.The indications for performing the biopsies were nephrotic syndrome, nephritic syndrome, renal failure of unknown etiology, persistent or recurrent asymptomatic hematuria or proteinuria.Patients were excluded if they had bleeding problems, uncontrolled hypertension, single kidney, and morbid obesity or were unco-operative. Prior to the biopsy procedure, clotting profile including platelet count, bleeding time, clotting time, prothrombin and partial thromboplastin time were performed. Only a small numbers of patients needed correction for one or more abnormalities of these parameters before performing the biopsies.\u00ae needles performed all biopsies guided by ultra-sonographic localization of the kidneys. Two specimens were subjected to only light and immunoflorescent microscopic studies . Each specimen consists of atleast two fragments and before staining each specimen was evaluated for enough numbers of giomeruli by light microscopic examination. Each fragment should be consisted about more than five numbers glomeruli. Electron microscopy was not available for use in this study. Biopsy samples were considered satisfactory for diagnosis if they contained five or more glomeruli. We examined with light microscopy stained sections; one with Hematoxylin and Eosin, one with periodic Schiff, one with Massons Trichrome and one with Jones Silver.Nephrologists using Tru-cutThe most common complications of the procedure were pain at biopsy site in 2 patients, microscopic hematuria in eight numbers patients, gross hematuria in one patient, and hematuria requiring blood transfusion in zero patient. None of patients needed open surgical intervention or nephrectomy and there is no death during the procedure of renal biopsy.During the past six years, a total number of 111 adequate renal biopsies were performed in our centers. thirty one (27.9%) were less than 16 years old (group I), 56 (50.4%) were more than 16 years old and less than 50 years old (Group II) and 24 (21.6%) more than 50 years old (group III) in two patters; primary and secondary glomerulonephritis. There were 38 males (34.2%) and 73 females (65.7%). The male to female ratio was 0.5.Indication for performing the biopsies among different age groups were nephrotic syndrome in 47 patients (42.3%), renal failure (unknown etiology) in 36 patients (32.4%), nephritic syndrome in 20 patients (18.0%), asymptomatic hematuria in 8 (7.2%) .As expected, minimal change disease(MCD) and membranous glomerulonephritis (MGN) were the commonest patterns in groups I and II. Membranous glomerulonephritis and focal segmental glomerulonephritis (FSGN) were more common in group III Tables  and 3. TIn our study the nephrotic syndrome was the commonest indication of performing biopsy (42.3% of cases) which is higher than other studies.\u20133 The ov53et al., reported that 2.7% of children < 16 years had IgA nephropathy[Minimal change disease was the most common histological pattern encountered in the adult group(groug II) followed by membranous glomerulonephritis; both accounted for 50% and 22.5%, respectively. This is in contrast to lower incidence of these two entities in the international and regional reports,251012\u201318251019phropathy We concl"}
+{"text": "In a cooperative agreement starting January 1995, prior to the FDA's licensure of the varicella vaccine on March 17, the Centers for Disease Control and Prevention (CDC) funded the Los Angeles Department of Health Services\u2019 Antelope Valley Varicella Active Surveillance Project (AV-VASP). Since only varicella case reports were gathered, baseline incidence data for herpes zoster (HZ) or shingles was lacking. Varicella case reports decreased 72%, from 2834 in 1995 to 836 in 2000 at which time approximately 50% of children under 10\u00a0years of age had been vaccinated. Starting in 2000, HZ surveillance was added to the project. By 2002, notable increases in HZ incidence rates were reported among both children and adults with a prior history of natural varicella. However, CDC authorities still claimed that no increase in HZ had occurred in any US surveillance site. The basic assumptions inherent to the varicella cost\u2013benefit analysis ignored the significance of exogenous boosting caused by those shedding wild-type VZV. Also ignored was the morbidity associated with even rare serious events following varicella vaccination as well as the morbidity from increasing cases of HZ among adults. Vaccine efficacy declined below 80% in 2001. By 2006, because 20% of vaccinees were experiencing breakthrough varicella and vaccine-induced protection was waning, the CDC recommended a booster dose for children and, in 2007, a shingles vaccination was approved for adults aged 60\u00a0years and older. In the prelicensure era, 95% of adults experienced natural chickenpox \u2014these cases were usually benign and resulted in long-term immunity. Varicella vaccination is less effective than the natural immunity that existed in prevaccine communities. Universal varicella vaccination has not proven to be cost-effective as increased HZ morbidity has disproportionately offset cost savings associated with reductions in varicella disease. Universal varicella vaccination has failed to provide long-term protection from VZV disease. The initial infection is followed by a variable latency period, after which the lifelong VZV in the dorsal root ganglia can subsequently reactivate as herpes zoster (HZ), commonly known as shingles, a secondary infection. Following short-term safety and efficacy clinical trials in the US, the varicella vaccine, Merck's Varivax\u00ae, was licensed for use in children 12\u00a0months and older by the US Food and Drug Administration (FDA) on March 17, 1995. On July 12, 1996, the US Centers for Disease Control and Prevention (CDC) published the recommendations of its Advisory Committee on Immunization Practices (ACIP) for universal varicella vaccination of all healthy, susceptible children aged 12- to 18-months with a single 0.5-mL vaccine dose The varicella-zoster virus (VZV) is a member of a family of viruses known as Alphaherpesvirinae  andThus, two population-based studies, conducted in two different, stable communities where (1) there was moderate varicella vaccination coverage (with greater than 50% of children under 10\u00a0years of age vaccinated) and (2) dramatic 70% reductions in wild-type varicella incidence rates relative to the pre-licensure era rates, reported significant HZ increases 4\u20138\u00a0years after the start of the universal varicella vaccination program The inter-relationship of varicella incidence and expected HZ incidence rates is not very complicated as shown in Other studies with conflicting conclusions that reported no HZ increases Finally, it is constructive to consider additional reasons why several other studies conducted among adult populations reported low annual percentage increases in HZ incidence rates ranging from 5.6 to 9.1% 7half the story; shingles incidence rates should surely be reported alongside chickenpox incidence.\u201d Seward's response to this deficiency was as follows:Because the population sizes in the varicella active surveillance sites are not sufficient to monitor age-specific herpes zoster incidence, the CDC has funded two other sites\u2014Massachusetts Department of Public Health and Group Health Cooperative (GHC) in Seattle\u2014to conduct population-based varicella and herpes zoster surveillance and monitor age-specific incidence rates. Massachusetts has monitored incidence through a statewide telephone survey since 1998, while GHC is examining its automated medical records since 1992. To date, no increase in herpes zoster is evident in any age group in either site . [Italicization added for emphasis.] In 2002, Brisson et al., in a letter to the editor 7.1The phone survey  conducted by the Massachusetts Department of Public Health included only 4916 and 3123 respondents reporting HZ cases among individuals aged 1\u201319\u00a0years in 1999 and 2000, respectively\u2014for a total of 7319\u00a0p-y. During an overlapping 2-year period 2000\u20132001, the AV-VASP study region, comprised of 118,685 individuals in that same age group, accumulated a total observation time of 237,370\u00a0p-y, exceeding the Massachusetts study by more than 30-fold.Notably, the varicella-vaccination coverage level in this Massachusetts study region was not as high as in the VASP study region. Thus, any increase in HZ incidence rates among the Massachusetts study population would be expected to be lower in magnitude relative to the VASP study region where approximately 50% of all children under 10\u00a0years of age had been administered the vaccine by 2000 7.2The GHC study had an annual average enrollment of 350,000 of all ages. It was similar to the 1995 population of 300,000 in the Antelope Valley region, yet Seward et al., in an author reply to Brisson et al., had indicated such population sizes were generally inadequate to monitor age-specific HZ incidence rates The study reported that the age-adjusted HZ incidence rate declined 14.2% from a peak of 4.05/1000\u00a0p-y in 1992 to a nadir of 3.47/1000\u00a0p-y in 2000. However, based on the data plotted in that study's \u201cFig. 1\u201d, HZ incidence rates began to rise\u2014increasing 8% from the nadir in 2000 to about 3.75/1000\u00a0p-y in 2002 The serious population-sample limitation of the GHC study was confirmed by the reported 1992\u20131996 varicella incidence rates of 14.54, 8.2, and 1.9 cases/1000 among children aged 1- to 4-years, 5- to 9-years, and 10- to 19-years, respectively, which were only 14.5%, 9.9%, and 15.6% of the respective \u201cgold standard\u201d 1990\u20131994 rates reported by NHIS in these same age categories . By contThus, the GHC study was severely compromised by: (1) extreme under-reporting of cases (without the ability to perform ascertainment-correction), (2) a significantly lower level of vaccination coverage relative to the Antelope Valley communities under active surveillance, (3) variability associated with the enrollment in the records-tracking data system of the GHC, a Health Maintenance Organization (HMO), that was ever-changing over the 11-year study period, and (4) selection bias due to such factors as cost of enrollment and employers offering the HMO plan. Therefore, the conclusion that \u201cthe vaccination-associated decrease in varicella disease did not result in an increase in the incidence of HZ\u201d, drawn from the GHC study data, was based on selective endpoint data that, given the preceding factors, was, at best, only somewhat representative of HZ incidence rates in the sample population enrolled and, therefore, could not be representative of true population trends for HZ incidence rates. Ironically, although not achieving statistical significance, the data suggest that, beginning in the post-vaccine year 2000, when the varicella incidence rate finally declined to less than 50% of the prior 1992\u20131999 mean rate, the age-adjusted HZ incidence rates (that included adults) increased through the 2002 study endpoint. Concomitantly, increasing HZ incidence rates were specifically noted by the study's authors among both vaccinated and unvaccinated children under 10\u00a0years of age.7.3In view of the preceding facts, the CDC had funded two different studies  having fundamentally flawed methodologies with the apparent intent to dilute the AV-VASP findings and minimize the significance of Hope-Simpson's exogenous boosting hypothesis The American Society for Microbiology was held in San Diego, California. During the Symposium on Varicella-Zoster Virus from 8:30 to 11:00\u00a0a.m., Dr. John Edmunds presented, \u201cPotential Changes in Zoster Epidemiology with Childhood Immunization\u201d. During the question phase, Dr. Jane Seward was acknowledged and stated categorically that in the U.S., at the various active surveillance sites, no increases had been seen in HZ incidence during the post-vaccination years\u2014quoting statistics from both the Massachusetts Department of Public Health and GHC studies.On September 2002, the 42nd Interscience Conference on Antimicrobial Agents and Chemotherapy (ICAAC) sponsored by Later in 2002, Roche In 2010, Australia also reported increases in HZ that started after the introduction of varicella vaccination 8p\u00a0<\u00a00.02) in the 10- to 19-year-olds Civen et al., in a VASP/CDC study presenting the cumulative incidence rate of HZ during 2000\u20132006 9In the Civen et al. study of HZ incidence, VASP/CDC authors conceded: \u201cThe possible reasons for this increased incidence [63% among those 10\u201319\u00a0years of age] cannot be confidently explained\u201d true HZ incidence rate was actually constant over the age range 0\u201319\u00a0years, being approximately the same in both age categories, 0\u20139 and 10\u201319\u00a0years. For the next three decades, those 20\u201349\u00a0years of age, the rate approximately doubled again to about 250/100,000\u00a0p-y, and then doubled again to about 500/100,000\u00a0p-y among adults aged 50\u201359\u00a0years To explain the high incidence in this cohort, consider the findings published by Hope-Simpson in which the crude HZ incidence rate reported in children aged <10\u00a0years is 74/100,000\u00a0p-y. This rate was slightly more than half that of the next age category, 10\u201319\u00a0years, or 138/100,000\u00a0p-y Presuming Dr. Hope-Simpson's hypothesis was correct, as exogenous exposures diminished in an age category comprised of individuals with a previous history of varicella, those individuals would increasingly reactivate with HZ at an incidence rate approaching 500/100,000\u00a0p-y\u2014the same rate currently found among adults with relatively few opportunities for immunologic boosting. Thus, the high HZ incidence rates in the post-licensure period, especially among children with a previous history of natural varicella, based on AV-VASP data Moreover, the study in Japanese pediatricians aged 50\u201369\u00a0years Of course, elderly adults both the pre- and post-licensure periods continue to experience a sharp increase in HZ incidence rates due to an age-related immune-system decline that begins at around 60\u00a0years and older 10In 1994, Lieu et al. modeled the cost-effectiveness of a routine varicella vaccination program for US children. From a medical perspective alone, varicella vaccination was not cost effective since the annual vaccination costs of approximately $162 million exceeded the annual medical cost savings of $80 million . However, by considering the cost of a parent's absence from work to care for a child with varicella, estimated at $392 million annually, single-dose varicella vaccination was now justified as being cost-effective from this societal perspective The preceding historical cost-effectiveness study was based on four key, but incorrect, assumptions: (1) vaccination cost is $35.00 per dose with only a $5.00 administration fee, (2) a single vaccine dose would confer life-long immunity, (3) vaccine efficacy would be high (85\u201395%) with negligible costs attributed to adverse effects associated with the varicella vaccine, and (4) universal varicella vaccination had no adverse effect on the occurrence of the closely related HZ in older individuals who had had natural varicella or on those who were administered the varicella vaccine.The preceding assumptions all turned out to be seriously flawed. First, after FDA approval, the vaccine pricing has increased to nearly double the modeled cost. Moreover, as varicella vaccination coverage increased, a single vaccine dose was found to no longer confer long-term protection from either natural or vaccine-strain VZV infection. Additionally, HZ incidence rates were increasing in the near absence of the natural boosting that previously occurred in communities with annual varicella epidemics. For infants, the updated recommendation was that the first dose be given at age 12\u00a0months with a second (booster) dose given at age 4\u20136\u00a0years Earlier, in 1999, Schuette and Hethcote developed a computer simulation model to evaluate the effects of a vaccination program for varicella using parameters estimated from epidemiological data. This simulation, which acknowledged discussions on varicella and HZ with John Glasser at the National Immunization Program CDC, concluded, \u201czoster incidence increases in the first three decades after initiation of a vaccination program\u201d Prior to the licensure of a varicella vaccine, two UK university researchers, Garnett and Grenfell, had examined the implications of a universal varicella vaccination program and, in 1992, concluded, \u201cUnder some conditions, mass application of such vaccines may have the impact of increasing herpes zoster incidence\u2026\u201d Many updated cost\u2013benefit analyses and studies of reduced morbidity and mortality focus on outcomes involving solely varicella\u2014entirely ignoring the negative impact on HZ epidemiology In 2005, Zhou of the National Immunization Program (NIP) performed an economic evaluation of the universal varicella vaccination program that included HZ in vaccinees and outbreak management costs, but excluded increasing HZ among those with a previous history of varicella and \u201cpotentially higher future post-vaccination incidence due to further accumulation of susceptible persons and future outbreaks\u201d Vaccine postpone a publication titled, \u201cCost\u2013benefit analysis of varicella taking into account the closely related herpes-zoster epidemiology\u201d, which was accepted October 4, 2003. This computer model, without even addressing the costs of serious adverse reactions to the varicella vaccine, reported that universal varicella vaccination had the impact of an additional 14.6 million HZ cases (or 42% increase) among adults aged <50\u00a0years during a 50-year period at a substantial medical cost burden of $4.1 billion or $80 million annually utilizing a very conservative estimated mean healthcare provider cost of $280 per HZ case By contacting the Elsevier life science editor, the CDC succeeded in having the journal 11Vaccine efficacy refers to the effectiveness of a vaccine to prevent disease. In 1995, the CDCs ACIP claimed, \u201cIn clinical trials, the vaccine has proven to be effective for greater than 10\u00a0years in preventing varicella\u201d During the first years following licensure of the varicella vaccine, vaccine efficacy based on studies in clinical practices When exogenous exposures (boosts) became rare, the vaccine was less effective and children soon needed a booster varicella vaccination. In 2002, Gershon suggested, \u201cthe time for exploring the possibility of routinely administering two doses of varicella vaccine to children seems to have arrived\u201d z\u00a0=\u00a01.96), it was significant at the 94% confidence level (z\u00a0=\u00a01.88). By July/August 2002, the varicella vaccine's one-dose efficacy had declined to 58.4% (95% C.I. 13.7\u201379.9%) which was statistically significantly lower than the peak 1999 efficacy The AV-VASP investigated the secondary attack rate among household contacts aged 1\u201314\u00a0years during 1997\u20132001 1212.1Consider a child that is administered the live Oka-strain varicella vaccine and is subsequently exposed to an individual shedding VZV\u2014either: (a) a child with varicella or HZ infection or (b) an adult with HZ infection. If the VZV strains are sufficiently heterologous , a second case of varicella can result. There are at least five VZV genotype variations or virus clades known at this time, in addition to 4 rarely-reported provisional clades. Asymptomatic reinfection of a second strain can occur and establish latency, thus increasing the potential for HZ since both strains are subject to reactivation 12.2Initial modeling of the cost effectiveness of universal varicella vaccination program assumed that vaccinated individuals would incur negligible adverse vaccine reactions and thus, vaccine-associated medical costs were not included in any of the models Morbidity of even rare serious adverse events reported after varicella vaccination (some of which were enumerated in the preceding paragraph) contribute to offsetting the benefits of varicella vaccination 12.3The following anecdotal reports from parents demonstrate the challenges associated with diagnosing and treating children experiencing multiple HZ reactivations. Interestingly, both US and foreign studies demonstrating reductions in varicella morbidity since the start of universal varicella vaccination Case 1: \u201cMy daughter [\u2018Sarah\u2019\u2014name changed for confidentiality] has suffered from recurring childhood shingles since January 2003. Her last episode has just been resolved in early September 2004, because I was finally able to get her on the right antiviral medication with the proper dosage. Sarah was seen by two pediatricians, one allergist and two dermatologists, including one of the top pediatric dermatologists in our nation. Perhaps because childhood shingles is so rare, her case was misdiagnosed as atopic dermatitis. The treatment for this condition, as you know, includes baths to keep the skin moist and topical agents to keep it lubricated. This only worsened Sarah's viral sores.\u201dSarah was prescribed 23 different oral and topical medications, including many doses of cortisone and antihistamines in 20\u00a0months. From the onset, I felt that my daughter's condition was systemic. It was only through my research and relentless questioning that lab-work was done. In July 2004, Sarah's blood-work showed elevated levels of varicella-zoster virus. Although the physician she was working with at the time felt this was the result of her having chickenpox when she was two, I upon learning she could and should be re-tested within a month, requested this test. Her blood levels [of zoster] virus had nearly doubled.\u201d\u201c\u201c\u2026I am writing to you with the hope that you can help educate and advocate for this information to be made more available to the general public. As rare as childhood shingles is, by not catching this early on through the proper tests and the proper prescriptions for treatment, my daughter has suffered terribly. She now has post-herpetic neuralgia (PHN) as well\u2026\u201dCase 2: On November 5, 2007, parents of a daughter with shingles reported: \u201c\u2026Our oldest daughter who is only 16 recently suffered from her second bout with shingles. She first had an episode of shingles at the age of 13. Our daughter NEVER had chickenpox, but was given the varicella vaccine in 1995. We were never told or even warned that it could cause shingles. We find it unbelievable that the \u2018solution\u2019 we are being provided is to go to the Infectious Disease Department at a local University Hospital in order to have them \u2018help us manage\u2019 this for the rest of our daughter's life. Now we have to remedy the shingles and we are altogether convinced that there will be many, many other young people adversely affected by what is a dangerous vaccine with awful side effects that stay with you for a lifetime\u2026far worse than chickenpox in one's youth. Our daughter missed a week of school each time and suffered incredibly\u2026\u201dCase 3: On September 22, 2008, a nurse contacted Goldman to share the following experience: \u201cMy son, who had natural chickenpox at 3\u00a0years of age, and who is now 16\u00a0years old, has been recovering for the past 6\u00bd months from herpes zoster (with a rash in the T1 dermatome). He experienced vomiting and severe headaches that lead to a diagnosis of viral meningitis from central nervous system (CNS) complications of herpes zoster.\u201dInterestingly, the nurse indicated that the physician treating her son had encountered another teen with the same diagnosis a week prior to her son's case.13\u00ae for adults aged 50\u00a0years and older, but the CDC has, thus far, declined to recommend it for mass use. In late 2007, the CDCs ACIP recommended that the Zostavax vaccine, originally approved and licensed by the FDA in 2006, be given to all adults aged 60\u00a0years and older. Administering it is claimed to provide a boost to the adult immune system that helps to suppress or postpone the onset of HZ. However, natural boosts were previously available at no cost to adults from their periodic exposures to children who were actively shedding VZV in the community. Thus, the shingles vaccine raises the issue of not only achieving weak protective outcomes in adult vaccinations, but adults also tend to experience a higher rate of adverse vaccination effects relative to children, including a higher rate of serious adverse effects .In 2011, the FDA approved Merck's Zostavax\u00ae or Walgreens pharmacy fee), the costs per year to prevent one case of HZ and one case of PHN were, respectively: $35,000  and $217,400 (where NNV\u00a0=\u00a01087) Based on the randomized, double-blind, placebo-controlled HZ trial by Oxman et al. which tracked 38,546 healthy subjects aged 60\u00a0years and older (median age 69\u00a0years) for a mean duration of 3.13\u00a0years The placebo group (without exogenous boosting or those not administered the HZ vaccine) demonstrated an HZ incidence rate of 11.12 cases/1000\u00a0p-y, approximately 100% higher than the HZ incidence rate of 5.42 cases/1000\u00a0p-y among the cohort receiving the HZ vaccine over their lifetime is 11 and 43, respectively Interestingly, Brisson, using parameters obtained from the same Oxman study, assuming no waning of vaccine protection, and using a different, more conservative definition of NNV, estimates for adults 65\u00a0years and older that the NNV to prevent one case of HZ and one case of PHN 14The human immune system is not fully understood\u2014in fact man understands only the fringes of this complex system that involves much more than a balance between Th1 and Th2 responses in a system where there are more than 17 identified types of T cells (bone marrow immune-system cells [B cells] that mature in the thymus gland) Canniff et al. reported an association between those individuals with clinical or laboratory evidence of varicella-zoster virus (VZV) infection and lower risk of glioma In addition, Posner found that both the genetic background and previous immunological history of an individual play important roles in determining whether a person will be either: (a) protected from or (b) susceptible to adverse reactions caused by his or her exposure to viral antigens Further, Silverberg et al. also reported that wild-type VZV infection up to 8\u00a0years of age was found to be protective against atopic disorders that are thought to be \u201cmediated by suppression of IgE production and allergic sensitization, as well as altered leukocyte distributions\u201d Unfortunately, it is not possible to fully estimate the negative repercussions of the universal varicella vaccination program on such natural-chickenpox-protective outcomes as mentioned above.15Prior to the universal varicella vaccination program, 95% of adults experienced natural chickenpox"}
+{"text": "Varicella has an important impact on public health. Starting in 2004 in Taiwan, nationwide free varicella vaccinations were given to 1-year-old children.Our study investigated the epidemiological characteristics of varicella from 2000 to 2008, and assessed the change of varicella epidemiology after the mass varicella immunization. ICD-9-CM codes related to varicella or chickenpox  were analyzed for all young people under 20 years of age through the National Health Insurance database of Taiwan from 2000 to 2008.Case numbers of varicella or chickenpox significantly declined after the nationwide immunization in 2004. Winter, particularly January, was the epidemic season of varicella. We found a significant post-vaccination decrease in incidence among preschool children, especially 3 to 6 year-old children-- the peak incidence was 66 per thousand for 4 and 5 year-old children before the nationwide immunization (2000 to 2003), and the peak incidence was 23 per thousand for 6 year-old children in 2008 (p < 0.001). Varicella-related hospitalization also significantly decreased in children younger than 6 years after the nationwide immunization.The varicella annual incidence and varicella-related hospitalization markedly declined in preschool children after nationwide varicella immunization in 2004. Varicella is the primary disease caused by the varicella-zoster virus. It is a common and highly contagious disease and has a significant health impact on children. Although the clinical course of varicella is usually mild and self-limiting, varicella does cause complications and mortality resulting in financial expense -3. ChickIn Taiwan, some areas including Taipei City, Taichung City and Taichung County gave the public free varicella vaccinations for 1-2 year-old children before 2004. Taipei City started the free varicella vaccination from 1998 and Taichung City and Taichung County from 1999. Other areas did not provide free varicella vaccination, but people could receive varicella vaccination at their own expense before 2004. Since 2004, free mass varicella immunization has been given to all one year-old children throughout Taiwan.2. Its population density is 633/Km2. Taiwan's NHI covered most of the health care costs for 98% of its population in 2006 [Since the implementation of National Health Insurance (NHI) in 1995, there has been a healthcare database in Taiwan. Taiwan has a population of 22.9 million people and the land area of 36188 KmThe administration of a live attenuated varicella vaccine was licensed in Taiwan in 1997. Both Merck and GlaxoSmithKline, pharmaceutical companies, provided the varicella vaccines in Taiwan. In 2004 the varicella vaccine was incorporated into Taiwan's national immunization program, and all 1-year-old children could receive the varicella vaccine for free. The varicella coverage rate for 1-year-old children was 94% for the 2003 birth cohort, 95% for the 2004 cohort, and 97% for the 2005, 2006, and 2007 birth cohorts according to Taiwan's National Immunization Information System which was developed in the early 1990s [Taiwan's National Health Insurance (NHI) covered most of the health care costs for 98% of its population. Taiwan's NHI database includes health care data collected from over 95% of the hospitals in Taiwan for more than 98% of the population receiving health care. From this database, hospitalization and outpatient healthcare records were collected from 2000 to 2008, and International Classifications of Diseases, Ninth Revision, Clinical Modification (ICD-9-CM) codes related to varicella or chickenpox were analyzed for all the population. The age-specific annual incidence and hospitalization rate were calculated. For calculating the annual population-based incidence, the annual incidence was calculated by dividing the number of varicella-related diseases by the population, which was obtained from Department of Statistics, Ministry of the Interior, Taiwan from 2000 to 2008 .ICD-9-CM codes for chickenpox or varicella include the following: 052 chickenpox; 052.0 post-varicella encephalitis, post-chickenpox encephalitis; 052.1 varicella (hemorrhagic) pneumonitis; 052.7 with other specified complications; 052.8 with unspecified complication; 052.9 varicella without mention of complication.For complications, we define varicella or chickenpox patients to have complications in cases where the patients had both ICD-9-CM codes for varicella or chickenpox (052 and the other related codes) and also ICD-9-CM codes for varicella-related complications which include the following: central nervous system including 320 meningitis, 322 cerebellitis, 323 encephalitis, 348 encephalopathy, 351 facial palsy, 331.81 Reye's syndrome, 780.3 febrile convulsion/seizure; skin and soft tissue including 680-686 cellulites and abscess, 035 erysipela, 728 pyomyositis and necrotizing fasciitis, 373 & 376.01 blepharitis, 034 & 041 scarlet fever and streptococcal or staphylococcal infection; skeletal system including 711 arthritis, 730-733 osteomyelitis; lower respiratory tract infection including 480-487 pneumonia, 510-519 pneumonitis, 466 & 490 bronchitis; hematological system- 287 thrombocytopenia, 283 & 285 anemia, 288 neutropenia; 038 & 790 & 995.91-995.92 for sepsis and bacteremia; 040-041 for other bacterial infection; 422 cardiomyopathy, 425 myocarditis; 070.5 & 070.9 & 573 for hepatitis.t test. The difference of annual incidence among various age groups, the difference of annual incidences in different years, and the difference in seasonal distribution were measured with appropriate \u03c72 test. A p value of < 0.05 was considered to be statistically significant. All statistical analyses were performed with SAS software, version 9.0.In univariate analysis, categorical variables were compared with chi-square or Fisher's exact test; continuous variables were analyzed with Student's The monthly distribution of case numbers from 2000 to 2008 is demonstrated in Figure Overall age-specific case numbers and the cumulative percentage of varicella in children from 2000 to 2008 are shown in Figure Figure The proportion of the number of varicella-related hospitalization to the number of overall varicella cases was the highest in infants and declined with age in children. Figure Among the 21829 hospitalized cases, 561 (2.57%) had central nervous system complications, 2721 (12.47%) had skin or soft tissue infections, 4740 (21.71%) had lower respiratory tract infections, 493 (2.26%) had hematological complications, 281 (1.29%) had septicemia or bacteremia, and 721 (3.30%) had hepatitis.Twelve children died and Table Nationwide varicella immunization has resulted in a marked reduction of varicella incidence and varicella-related hospitalization in children younger than 6 years of age in Taiwan. The impact of mass varicella immunization has so far made it possible for most preschool children to be free of varicella and varicella-related hospitalization in Taiwan. However, children beyond 7 years of age had similar annual incidence before and after the mass immunization.As Figure We found that the annual incidence of children beyond 7 years of age was similar before and after mass immunization. It's because most of the school children were not allowed to receive the free varicella vaccine. Thus, the varicella incidence of the school children did not change significantly after the mass immunization in this study. We suppose that the annual incidence of school children may decrease several years later if the immunized children grow up to be 6 to 12 years old. However, we have to follow up on the impact of mass immunization on school children to prove the above assumption several years later.The infants had the highest annual incidence of varicella-related hospitalization both before and after the mass immunization Figure . InfantsThere were 12 cases of fatality, of which 5 of them had underlying diseases. Children with underlying diseases such as acute leukemia are more susceptible to getting severe varicella with complications and have a significantly higher mortality rate [Currently, the varicella vaccine program consists of a single-dose vaccination in Taiwan, as it is in Canada, Korea and Australia . HoweverThe major limitation of this study is that we could not verify the diagnoses because we could just analyze the NHI database rather than detailed medical charts. However, at the very least the nationwide database can let us outline the comprehensive picture of varicella epidemiology in Taiwan and sketch the impact of nationwide immunization.In conclusion, nationwide varicella immunization significantly decreased the varicella annual incidence and varicella-related hospitalization in preschool children in Taiwan. The impact of the varicella vaccine on schoolchildren may be followed up on several years later.The authors declare that they have no competing interests.LYC, LMH and ISC designed the study. LYC and FYT analyzed the data. LYC wrote the paper. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/11/352/prepub"}
+{"text": "Pseudomonas species appeared as the most abundant organisms in Alert soils right after contamination with diesel and excavation (t\u200a=\u200a0) and one month after the start of the bioremediation treatment (t\u200a=\u200a1m), when degradation rates were at their highest, but decreased after one year (t\u200a=\u200a1y), when residual soil hydrocarbons were almost depleted. This trend was also reflected in hydrocarbon degrading genes, which were mainly affiliated with Gammaproteobacteria at t\u200a=\u200a0 and t\u200a=\u200a1m and with Alphaproteobacteria and Actinobacteria at t\u200a=\u200a1y. RT-qPCR assays confirmed that Pseudomonas and Rhodococcus species actively expressed hydrocarbon degradation genes in Arctic biopile soils. Taken together, these results indicated that biopile treatment leads to major shifts in soil microbial communities, favoring aerobic bacteria that can degrade hydrocarbons.As human activity in the Arctic increases, so does the risk of hydrocarbon pollution events. On site bioremediation of contaminated soil is the only feasible clean up solution in these remote areas, but degradation rates vary widely between bioremediation treatments. Most previous studies have focused on the feasibility of on site clean-up and very little attention has been given to the microbial and functional communities involved and their ecology. Here, we ask the question: which microorganisms and functional genes are abundant and active during hydrocarbon degradation at cold temperature? To answer this question, we sequenced the soil metagenome of an ongoing bioremediation project in Alert, Canada through a time course. We also used reverse-transcriptase real-time PCR (RT-qPCR) to quantify the expression of several hydrocarbon-degrading genes.  With the ongoing global rise in temperature, there is increased political, scientific and economic interest in the Arctic regions. The resulting increased activity in the Arctic is raising the risk of accidental hydrocarbon spills as hydrocarbons, like diesel, are used for heating, transportation and electricity. In remote areas, like the Canadian high Arctic, on-site bioremediation is the only feasible clean-up option for hydrocarbon spills. A number of studies have demonstrated that microorganisms, in particular bacteria, are capable of degrading hydrocarbons at the extreme temperatures typically encountered in polar and alpine environments ex situ approach  had a larger and more consistent influence on the microbial community structure and activities than the in situ approach (where soils were fertilized in place to keep soil structure intact) and resulted therefore in higher rates of hydrocarbon degradation. In the ex situ biopile experiment, located at Alert, Nunavut, Canada, a clear reorganization of the microbial community and a large increase in the expression of hydrocarbon degrading genes were observed one month after starting the treatment. However, information is still missing as to which microorganisms and which functional genes are associated with bioremediation experiments having high degradation rates, like the one at Alert. This gap in knowledge hampers the design of bioremediation strategies targeting specific microorganisms associated with high degradation rates. A targeted approach could lead to more rapid bioremediation, an important factor considering that ambient temperatures are above freezing for less than 2 months during the Arctic summer. The microorganisms and functional genes associated with high hydrocarbon degradation rates could also be useful indicators of the potential of soils for hydrocarbon bioremediation and could be interesting model organisms to study cold temperature bioremediation and as a source of cold-adapted enzymes.A recent study from our group identified some of the factors influencing the microbial community structure, the expression of genes involved in bioremediation and the subsequent rate of hydrocarbon mineralization alkB. CYP153, an enzyme of the CYP superfamily, can also catalyze the hydroxylation of alkanes Microbial degradation of complex hydrocarbon mixtures, such as diesel, requires several different genes and pathways. Diesel fuel is composed of both saturated aliphatic  and aromatic hydrocarbons. We therefore focused our data mining effort on alkane hydroxylases and aromatic-ring-cleavage dioxygenase genes. Hydroxylation of an alkyl group catalyzed by oxygenases is usually the first step in the degradation of organic compounds. There are several categories of alkyl-group hydroxylases, including cytochrome P450s (CYP) and alkane hydroxylase Pseudomonas, Rhodococcus, Sphingomonas, Caulobacter). The relative dominance of these bacteria varied over time, likely a result of changes in the quality and availability of various hydrocarbons and nutrients during bioremediation.The main goal of this study was to monitor the microbial communities in Alert biopiles over time to identify microorganisms and functional genes linked to the high hydrocarbon degradation rates previously observed in these soils undergoing treatment. In order to accomplish this goal, we needed an unbiased, culture- and PCR-independent method that could yield insights into community composition and functional potential at the same time. We therefore sequenced the metagenome of Alert soil biopiles through a time course and compared results with uncontaminated soil. We also quantified the expression and the abundance of key functional genes for abundant microorganisms identified in the metagenomic datasets. From our results, we concluded that hydrocarbon contamination and biopile treatment  dramatically changed soil microbial communities, favoring aerobic organisms that have the potential to degrade various hydrocarbon compounds  to specifically stimulate aerobic microorganisms. An uncontaminated control soil was collected from an area directly adjacent to the original spill site at a depth of approximately 30 cm, but was not excavated, aerated or fertilized. It is representative of the soil conditions before excavation or contamination by hydrocarbons. More details about the experimental design and the site characteristics were previously published For the present study, we analyzed a subset of the samples used previously in Yergeau and colleagues Soil analyses and mineralization assays were previously described and published in Yergeau and colleagues free kit . Average DNA yields were: t\u200a=\u200a0: 445.4 ng; t\u200a=\u200a1m: 1248.2 ng; t\u200a=\u200a1y: 1433.9 ng; uncontaminated: 834.4 ng. Average RNA yields were (after digestion): t\u200a=\u200a0: 781 ng; t\u200a=\u200a1m: 6110 ng; t\u200a=\u200a1y: 4966ng; uncontaminated: 2289 ng.Soil DNA was extracted from 0.5 g soil sub-samples using the MoBio DNA Power Soil kit , while soil RNA was extracted from a 2.0 g soil sub-sample using the MoBio RNA Power Soil kit. Residual DNA in RNA extracts was removed using the Turbo DNA-alkB and ndoB genes of Pseudomonas strains and the alkB1 and alkB2 genes of Rhodococcus strains previously isolated from high Arctic contaminated soils Pseudomonas alkB: alkB(PspEu5)qF1 (GGG CTT GAG GAA CAA CG) with alkB(PspEu5)qR1 (CAC CAM CCG AAA GCC AT), Rhodococcus alkB1: alkB1(Q15)qF1 (GAT TTG AGC GTT CTC TCC AAT A) with alkB1(Q15)qR2 (TCG AGG TAG AAG TGA CCG TAA G), Rhodococcus alkB2: alkB2-Rh-F (CCT GGC TCG GAA TCG AC) with alkB2-Rh-R (GAA GTG GCC GTA AAA CGA CT) and Pseudomonas ndoB: ndoB-Ps-F (CTC CAA CGG TGA ACT GCA) with ndoB-Ps-R (CAA CCT TGC CTG GAG GAC). Although these primers were designed some time ago, their specificity was re-examined by blasting them against NCBI-nr and looking at alkB sequences that perfectly matched both primers. The majority of the hits for the Pseudomonas alkB primers were related to a variety of Pseudomonas species, but several hits to other genera were also observed. All these hits were identical to Pseudomonas alkB genes over 870 bp and were all produced in the same study Rhodococcus sp. alkB1 and alkB2 primers matched a variety of Rhodococcus sequences but also the alkB genes of three other species that shared 98\u201399% sequence similarity with Rhodococcus. The Pseudomonas ndoB primers perfectly matched a variety of Pseudomonas species and no other species. For all the non-specific hits mentioned above, the bacteria associated with the genes were either not retrieved or retrieved at very low abundance in the metagenomic datasets. Standards were made from 10-fold dilutions of linearized plasmids containing the gene fragment of interest cloned from DNA amplified from pure strains. For all reactions, several no-reverse-transcriptase and no-template controls were included and yielded no detectable signals.RT-qPCR was performed in 20 \u00b5l volumes using the iScript One-Step RT-PCR kit with Sybr green  on a Rotor-Gene 3000 apparatus , as previously described 5 copies per \u00b5l) were mixed. When the recovery of lambda in RT-qPCR and qPCR reactions was below 100%, quantification values for all other genes were corrected accordingly. PCR inhibition ranged from 6.2% to 45.1% (RNA) and from 0.0% to 51.4% (DNA).qPCR were performed in 20 \u00b5l volumes using the QuantiTect SYBR Green PCR kit  on a Rotor-Gene 3000 apparatus . Reactions were set-up as per the manufacturer's instructions, with 1.5\u201310 ng of total soil DNA. The qPCR conditions, primers and standards were as in the RT-qPCR runs, except that the reverse transcription step was eliminated, the initial denaturation was extended to 15 min and the annealing temperature was raised to 60\u00b0C. Lambda DNA was used to correct for potential PCR inhibitors present in soil DNA and RNA extracts P\u200a=\u200a0.001) and the hydrocarbon-degrading gene microarray . We therefore sequenced four DNA samples: one composed of samples taken before the bioremediation treatments (t\u200a=\u200a0), one composed of samples taken one month after the beginning of the treatments (t\u200a=\u200a1m), one composed of samples taken one year after the beginning of the treatments (t\u200a=\u200a1y) and one control sample that was uncontaminated. DNA from the different treatments was sent for two runs of Roche 454 GS FLX Titanium sequencing at The Centre for Applied Genomics, The Hospital for Sick Children, Toronto, Canada.At the time of sequencing, the amount of DNA needed for 454 shotgun library preparation was 5 \u00b5g. Since Arctic soils have relatively low biomass, we could not retrieve such large amounts from our DNA extractions. For that reason, we pooled the different biological replicates before metagenomic sequencing. This also maximized the depth of sequencing within the limits of the financial resources available. This decision was further supported by the fact that 16S rRNA and hydrocarbon-degrading gene microarray analyses previously showed that within treatment (i.e. same sampling times) variation was small compared to between treatment (i.e. different sampling times) variation \u22125 and the minimum alignment length was set to 50 bp. Taxonomic profiles based on all annotated fragments were normalized by dividing the number of fragments matching an organism by its genome size to correct for the fact that, for the same abundance, organisms with larger genomes will have more hits than organisms with smaller genomes. Taxonomic profiles were also made using the fragments matching 16S rRNA genes. These sequences were retrieved from MG-RAST and classified to the genus level using the \u201cClassifier\u201d tool of the Ribosomal Database Project  with a bootstrap value of 50% (which is the level recommended by RDP for short sequences). For the 16S rRNA gene taxonomic profiles to be comparable with the taxonomic profiles based on all fragments, only sequences that could be classified at the phylum level were used.Data analyses were essentially carried out as previously described \u221230 generally did not match the protein of interest in subsequent blast searches, indicating that our procedure recruited all sequences related to the gene of interest. The number of hits was summed for each genus and normalized per 100 genomes  to account for differences in dataset sizes. For comparison purposes, normalization was also performed by randomly selecting 100,000 sequences from each of the datasets and re-running the BLAST analyses. The two normalization procedures provided highly similar results .Since most hydrocarbon-degrading genes are not clearly annotated in the SEED and are thus not classified in MG-RAST subsystems, we used BLAST to fish out all the major genes involved in hydrocarbon degradation from the datasets. Each individual metagenomic dataset was used as a BLAST database against which reference protein sequences from one Gram-positive and one Gram-negative species were compared (when available). The reference sequences used were : alkane-1 monooxygenase protein , cytochrome P450 alkane hydroxylase (CYP153) protein , protocatechuate 3,4-dioxygenase , catechol 1,2-dioxygenase , gentisate 1,2-dioxygenase , homogentisate 1,2-dioxygenase , catechol 2,3-dioxygenase , protocatechuate 4,5-dioxygenase . All hits having an E-value below 0.10 were considered as significant and the corresponding sequences were recruited from the metagenomic datasets. We used a very low E-value for recruiting sequences, to not miss any sequences that might be from distantly related organisms. This procedure allowed our analysis to be as inclusive as possible. The recruited sequences were then subjected to blastx against the NCBI non-redundant protein sequences (nr) and the best match was kept to determine the taxonomic affiliation of the recruited sequence. Sequences recruited from our datasets using reference catechol 2,3-dioxygenase sequences also matched sequences related to biphenyl-2,3-diol 1,2-dioxygenase (EC 1.13.11.39) or 1,2-dihydroxynaphthalene dioxygenase (EC 1.13.11.-), which are closely related, and these sequences were kept. In all other cases, the recruited sequences not clearly related to the proteins of interest were discarded. We determined that sequences recruited with E-values above 10 results \u20135, andr using the \u201ccor\u201d function.All statistical analyses were performed in R . When necessary, data was log or square root transformed to meet the assumptions of parametric ANOVA. Normality was tested using the \u201cshapiro.test\u201d function. ANOVA and subsequent Tukey HSD tests were carried out using the \u201caov\u201d and \u201cTukeyHSD\u201d functions, respectively. When transformations failed to normalize data, Kruskal-Wallis and associated multiple comparison tests were carried out using the \u201ckruskal.test\u201d and the \u201ckruskalmc\u201d functions of the \u201cpgirmess\u201d library, respectively. Correlation analyses were based on Spearman's http://www.ncbi.nlm.nih.gov/bioproject?term=PRJNA56113).Metagenomic datasets were deposited in the NCBI sequence read archive (SRA) under accession number SRA025056. The metagenomic project can also be accessed in NCBI under GenomeProject ID 56113 , marine Actinobacterium PHSC20C1 (t\u200a=\u200a1y) and the Acidobacteria Solibacter usitatus Ellin6076 (uncontaminated). The genera that dominated the retrieved 16S rRNA gene fragments were Pseudomonas  and an unclassified GP4 Acidobacteria (uncontaminated).Contamination and soil excavation resulted in the increase of the abundance of several bacterial phylum/classes, like the bacteria . In contbacteria . The conecreased . In the  species . The relo t\u200a=\u200a1y . For thet t\u200a=\u200a1m . Among talkB; normalized per 100 genomes) was stable over the time course, but ten times lower in the uncontaminated sample  genes  was similar in the t\u200a=\u200a0 and t\u200a=\u200a1m samples, but higher in the t\u200a=\u200a1y samples and slightly lower in the uncontaminated sample  were very similar. Functional profiles were also very similar at deeper levels within the subsystem hierarchy . In contrast, there were large changes in the abundance and taxonomic affiliation of the genes encoding enzymes responsible for diesel degradation  through the time course \u20135. Thed sample . The t\u200a=0 sample . In the d sample . In all bacteria .Gammaproteobacteria was generally the main phylum/class linked to IARCD sequences in contaminated samples, with some exceptions where the Actinobacteria or the Betaproteobacteria were the most frequently observed phylum/class  sequences were more abundant in the t\u200a=\u200a0 sample . This waum/class . Gentisaum/class . The Betxygenase . In contxygenase . The mosd sample .Pseudomonas alkB and ndoB genes and Rhodococcus alkB1 and alkB2 genes  showed a decrease through the time course, with their abundance being significantly lower in the t\u200a=\u200a1y samples, compared to the t\u200a=\u200a1m  or the t\u200a=\u200a0 (for the ndoB) samples. In contrast, the abundance of the Rhodococcus alkB genes was usually lower in the t\u200a=\u200a0 samples, but this difference was not always significant. There were significant correlations between the soil hydrocarbon content and the abundance of Pseudomonas alkB and ndoB genes .We quantified the abundance and the expression of four genes in all replicates: B2 genes . The numB2 genes . The PsePseudomonas alkB and ndoB was higher in the t\u200a=\u200a1m samples. In contrast, Rhodococcus alkB genes were more expressed in the t\u200a=\u200a1y samples.The expression of all genes was very low in the uncontaminated samples. There was a significant correlation between hexadecane mineralization and the expression of Pseudomonas alkB genes . Based on total alkB RT-qPCR quantification of a previous study using the same samples, which were 1.26\u00d7106 (t\u200a=\u200a0), 2.26\u00d7106 (t\u200a=\u200a1m), 1.72\u00d7105 (t\u200a=\u200a1y) and 3.89\u00d7102 (uncontaminated) copies per ng of RNA Pseudomonas sp. alkB gene expression represented 16.07%, 13.37%, 27.91% and 44.38% of the total alkB gene expression for samples t\u200a=\u200a0, t\u200a=\u200a1m, t\u200a=\u200a1y and uncontaminated, respectively. Similarly, Rhodococcus sp. alkB gene expression  represented 0.46%, 0.38%, 16.59% and 31.80% of the total alkB gene expression for samples t\u200a=\u200a0, t\u200a=\u200a1m, t\u200a=\u200a1y and uncontaminated, respectively.The expression of the same genes measured by RT-qPCR followed a somewhat different pattern . The expalkB and polyaromatic hydrocarbon ring hydroxylating dioxygenase genes). However, the methods used in this previous study did not allow us to identify the microorganisms that might be involved in hydrocarbon degradation. We therefore used shotgun metagenomic sequencing, a method that is unbiased, culture- and PCR-independent, to reveal the main hydrocarbon degraders present in these soils showing high degradation rates. Based on the results of metagenomic sequencing, the expression and the abundance of key functional genes for two of the most dominant microorganisms were quantified.A previous study from our group showed that, as compared to other high Arctic bioremediation experiments, Alert soils had very high hydrocarbon degradation rate Pseudomonas, Rhodococcus, Caulobacter and sphingomonads appeared to be enriched in well-aerated soils with larger amounts of nutrients (N) and carbon (diesel) as compared to intact uncontaminated soils. In the early stage samples (t\u200a=\u200a0 and t\u200a=\u200a1m), a large number of the identified metagenomic fragments (>25% in the t\u200a=\u200a0 sample) could be mapped to Pseudomonas species. A previous study showed that Pseudomonas is enriched following contamination events Pseudomonas hydrocarbon degrading genes (by qPCR) and soil hydrocarbon content. Pseudomonas species were hypothesized to be one of the major alkane and aromatic hydrocarbon degraders in polar soils Pseudomonas genes were more often detected in Alert soils as compared to the other soils Pseudomonas species are psychrotolerant Pseudomonas species are taking advantage of their ability to degrade various hydrocarbons and their capacity to grow rapidly at low temperatures The largest differences in bacterial communities were observed between the uncontaminated, undisturbed soil and the contaminated biopile soils. One of the keys to successful and rapid bioremediation is to specifically stimulate the fast-growing, hydrocarbon-degrading bacteria that are already present in the soils, and such a dramatic shift was therefore expected and desired. Well-known hydrocarbon degraders like Pseudomonas abundance decreases. For instance, Alphaproteobacteria were among the most abundant groups of polyaromatic hydrocarbon degraders. Together with Pseudomonas, the Alphaproteobacteria sphingomonads were reported as the typical aromatic-degrading bacteria isolated from polar soils 15N monoammonium phosphate DNA-SIP experiment in high Arctic diesel-contaminated soils showed that, after one month of incubation, the family of bacteria most actively incorporating 15N in its DNA was Sphingomonadaceae, suggesting an important role for this group of bacteria in the degradation of hydrocarbons in high Arctic soils Sphingomonas isolated from Antarctic soils was shown to degrade the aromatic fraction of diesel at low temperature without nutrient amendment Alphaproteobacteria had an intriguing presence among the alkane degraders, as they are not reported as typical alkane degraders in polar soils. Caulobacter species have the capacity to degrade alkanes, but are more frequently associated with heavy metal resistance Caulobacter are typically found in low nutrient environments and some species were reported to be resistant to freezing Caulobacter species were also isolated as part of a chlorophenol-degrading community in cold groundwater The other major hydrocarbon-degrading genera detected could also have important roles in bioremediation, especially in the later steps of the bioremediation process (i.e. in the t\u200a=\u200a1m and t\u200a=\u200a1y samples), where they reach their maximum abundance and Rhodococcus was previously hypothesized to be one of the predominant alkane degrading genera in polar soils Actinobacteria was the most abundant phylum associated with cytochrome P450 alkane hydroxylases genes in contaminated soils. The presence of cytochrome P450 alkane hydroxylases has been previously linked to an expanded hydrocarbon degradation capacity Actinobacteria in diesel-contaminated soils especially in the later steps of the bioremediation process. Rhodococcus alkB genes were also highly present and active, especially in the t\u200a=\u200a1y samples. In fact, Rhodococcus relative abundance decreased between t\u200a=\u200a0 and t\u200a=\u200a1m, but then increased to its maximum value between t\u200a=\u200a1m and t\u200a=\u200a1y. However, Rhodococcus species were not very abundant in the metagenomic data based both on total sequences  and on 16S rRNA gene-related sequences . More research would be needed to clearly define the role of Alphaproteobacteria and Actinobacteria species and their interaction in cold temperature soil hydrocarbon degradation.Acidobacteria, Planctomycetes, Deltaproteobacteria, Chlorobi and Firmicutes). This resulted in a higher taxonomic diversity in the uncontaminated sample. Interestingly, uncontaminated soils at Alert appear to be a good source of hydrocarbon degrading bacteria, as we observed several bacteria and functional genes that are involved in hydrocarbon degradation in these soils. Although they are usually present in small numbers in uncontaminated soils, these bacteria can increase and even become dominant following contamination events. For instance, Pseudomonas, Rhodococcus and Caulobacter species were present at very low abundance in uncontaminated soils, but became more abundant in the contaminated soils and during the bioremediation treatment. The fast-growing species that are stimulated by the bioremediation treatment may be less able to compete in undisturbed soil environments with other bacterial taxa that may be better adapted to low levels of carbon, oxygen and nutrients The uncontaminated control soil was used to help determine which microorganisms were stimulated by the hydrocarbon contamination and subsequent biopile treatment. Several bacterial phyla/classes showed a preference for uncontaminated soils, having lower abundance in contaminated soils  since they were also present in high numbers in uncontaminated samples. Others were highly enriched in contaminated soils , which indicate that hydrocarbon contamination and biopile treatment is selecting for microorganisms having the capacity to degrade hydrocarbons.Pseudomonas and Rhodococcus species were actively expressing alkane hydroxylase and naphthalene dioxygenase genes. This was important to confirm in the context of this study since metagenomic data only gives an indication of the genetic potential for a function and not whether the gene responsible for this function is actually expressed. Pseudomonas was responsible for \u223c20% of the total alkB expression in soil, which is consistent with its relative abundance. Similarly, Rhodococcus alkB expression was consistent with its relative abundance in t\u200a=\u200a0 and t\u200a=\u200a1m samples. However, Rhodococcus alkB relative expression (\u223c15%) was higher than Rhodococcus relative abundance (\u223c5%) in the t\u200a=\u200a1y samples, indicating that Rhodococcus were very active in these samples.Using real-time PCR, we confirmed that Caulobacter could be involved in alkane degradation in Arctic soils, a role that has not been previously reported. We also reported a number of sequences that were related to uncultured microorganisms or that could not be classified, which might represent novel hydrocarbon degradation genes. Furthermore, shotgun metagenomic approaches do not suffer from most of the biases associated with culturing microorganisms and PCR-based methods since it involves direct sequencing of fragmented genomic DNA. Interestingly, the fact that the most abundant bacteria in the t\u200a=\u200a0 and t\u200a=\u200a1m samples were Pseudomonas species indicates that, in this particular case, culture-based methods might have provided valuable information, since Pseudomonas species are generally amenable to culture.To the best of our knowledge, the present study represents the first shotgun metagenomic sequencing analysis of a soil bioremediation experiment. This approach is particularly interesting in less-well studied environments like the Canadian high Arctic, since it allows for the discovery of novel genes and organisms that might be missed using traditional PCR- or culture-based techniques. For instance, we reported here that Pseudomonas strain isolated from the Canadian high Arctic carried alkane and naphthalene degradation genes on distinct plasmids Sphingomonas strain RhodococcusRhodococcus strain Actinobacteria, the majority of the CYP450 genes were related to them in our study. In contrast, a cold-adapted strain of Rhodococcus did not require any of its two plasmids for alkane mineralization Proteobacteria). Ideally, the sequences would have been clustered and grouped without prior taxonomic classification However, shotgun metagenomics through 454 sequencing is not completely free of biases, which can still occur during DNA extraction, DNA fragmentation, adaptor ligation, or emulsion PCR. Another more serious drawback of the method used, is that the functional genes screened in this study might be carried on mobile genetic elements, which could decrease the reliability of the taxonomic affiliation made. There is often a lack of congruence between the phylogenies of catabolic genes subjected to horizontal gene transfer (HGT) and 16S rRNA gene phylogenies Pseudomonas, Rhodococcus, Caulobacter and sphingomonads, were detected in large numbers in the biopiles and their relative abundance varied over time, probably linked with the variation in hydrocarbon and nutrient quantity and quality.Contamination and biopile treatment resulted in clear shifts at both the taxonomic and the functional levels, including an increase in the abundance of several hydrocarbon-degrading genes, suggesting that hydrocarbon contamination and biopile treatment in high Arctic soils selects for a bacterial community that is able to degrade hydrocarbons. Several hydrocarbon-degrading bacteria, like"}
+{"text": "Southeastern Asia is a recognised hotspot for emerging infectious diseases, many of which have an animal origin. Mammarenavirus infections contribute significantly to the human disease burden in both Africa and the Americas, but little data exists for Asia. To date only two mammarenaviruses, the widely spread lymphocytic choriomeningitis virus and the recently described W\u0113nzh\u014du virus have been identified in this region, but the zoonotic impact in Asia remains unknown. Here we report the presence of a novel mammarenavirus and of a genetic variant of the W\u0113nzh\u014du virus and provide evidence of mammarenavirus-associated human infection in Asia. The association of these viruses with widely distributed mammals of diverse species, commonly found in human dwellings and in peridomestic habitats, illustrates the potential for widespread zoonotic transmission and adds to the known aetiologies of infectious diseases for this region.DOI:http://dx.doi.org/10.7554/eLife.13135.001 Rodents have long been notorious for spreading disease among humans. Often the animals can carry viruses and transmit them to humans without becoming ill. Certain species thrive in cities and agricultural areas where they come in close contact with humans; this creates many opportunities to spread infection. As humans urbanize and farm larger swaths of previously wild lands, the risk of rodent-transmitted infections increases. As a result, some scientists are working to identify viruses carried by rodents in human settlements and hopefully prevent them from spreading to humans.The mammarenavirsuses are a group of rodent-transmitted viruses that commonly cause illness in people in Africa and Latin America. Each year, one such virus \u2013 the Lassa virus \u2013sickens as many as 300,000 people in Africa and kills 5,000. So far, only two mammarenaviruses have been found in Asia: one called the W\u0113nzh\u014du virus and another called LCMV. However only LCMV is known to cause human illness and many cases of illness caused by mammarenaviruses in Asia may go undetected because they often cause mild symptoms similar to the common cold.Blasdell et al. have now tested lung samples from 20 species of rodents collected at 7 sites in Cambodia, Thailand, and Laos to look for molecules produced by mammarenaviruses. The tests revealed a strain of W\u0113nzh\u014du virus circulating in Cambodian rats that often live in urban areas. A new mammarenavirus was also detected in rodents that live in Thai rice fields. However, infecting wild and domestic rodents with the viruses in the laboratory did not cause many noticeable signs of illness.Blasdell et al. then tested samples from Cambodian patients who either had influenza-like symptoms or more serious symptoms that are associated with a condition called Dengue fever (which is common in the area). Some patients with respiratory symptoms tested positive for the W\u0113nzh\u014du virus. Because the symptoms are mild and similar to those of other common diseases it is likely that the W\u0113nzh\u014du virus may be spreading more widely among humans in Asia.The next challenges are to provide a better estimate of the frequency of this disease in the human population in Asia and to describe the full spectrum of disease that might be associated with this newly discovered infectious disease.DOI:http://dx.doi.org/10.7554/eLife.13135.002 Rodents of several species are known hosts of numerous zoonotic pathogens , and areRattus species, Niviventer niviventer and in Asian house shrews (Suncus murinus), but has not yet been associated with disease. However, LCMV is zoonotic, is primarily hosted by the widespread house mouse (Mus musculus), and consequently has the widest known distribution of any mammarenavirus (Rattus norvegicus) and Pacific rats (R. exulans), which are commonly found in proximity to humans. We also identified a novel mammarenavirus species in Thailand in rice-field associated greater bandicoot rats (Bandicota indica), Savile\u2019s bandicoot rats (B. savilei) and an Indomalayan niviventer (Niviventer fulvescens). In addition, we detected W\u0113nzh\u014du virus in several Cambodian patients presenting with fever and respiratory symptoms, indicating that this virus may be causally related with human disease.Mammarenaviruses are predominantly rodent-borne viruses, several of which have been associated with human disease. In Western Africa, Lassa virus (LASV) infection causes an estimated 100,000 to 300,000 infections and approximately 5000 deaths annually , whilst enavirus . Human ienavirus . This prenavirus  should tenavirus , the appenavirus  is surprenavirus . Here, iTo assess whether mammarenaviruses are present in Southeastern Asian small mammals, we used a previously described RT-PCR  Supplem to screeArenaviridae study group has also recommended the use of the PASC tool for the assessment of novel arenaviruses. Cut-off values chosen for classifying arenaviruses belonging to the same species using this tool are >80% and >76% nucleotide sequence identity in the S and L segments respectively  with the abbreviation LORV. Although the Cambodian virus is the first mammarenavirus to be associated with Pacific rats (R. exulans) and Cambodia is geographically distant to the Chinese region in which W\u0113nzh\u014du virus was originally detected, the sequence homology to W\u0113nzh\u014du virus and the association with rodents of a common host species (R. norvegicus), indicates that the Cambodian virus represents a genetic variant of W\u0113nzh\u014du mammarenavirus  of random amplified RNAs from the lungs of Wistar laboratory rats inoculated with either the C0649 or R5074 lung homogenate ; L segment accession KC669690, length 7181nt. R5074: S segment accession KC669698, length 3345nt; L segment accession KC669693, length 7186nt). Primers were designed based on this sequence and in conjunction with a previously published protocol  Supplem, were usectively . The Thaenavirus . We propIn maximum likelihood phylogenetic analyses, the Southeastern Asian viruses, along with the Chinese isolates of W\u0113nzh\u014du virus, formed an independent clade within the Old World mammarenaviruses. The Cambodian virus sequences clustered with the W\u0113nzh\u014du virus sequences, whilst LORV sequences clustered independently. This Asian mammarenavirus clade formed a sister clade to Ippy virus (IPPYV) in both full RNA-dependent RNA polymerase (L) and NP gene analysis, and to the African Lassa-related viruses as a whole in glycoprotein precursor (GPC) gene analysis .10.7554/8\u20131011 cDNA copy/mg) detected in several organs from 7dpi in Pacific rats and 11dpi in Wistar laboratory rats. Specifically, high copy numbers were detected in the liver, spleen and lung of most individuals, with the latter suggesting the potential for respiratory transmission. Mammarenavirus RNA was detected in most inoculated Wistar laboratory rats killed between 3-56dpi  and Pacific rats killed between 3-37dpi , although no animals were tested beyond these time points. Mammarenaviruses are known to cause both acute and chronic infections in their rodent hosts 17 and the duration of infection observed here is comparative to that seen in experimental infections of the natural hosts of other mammarenaviruses , or in primary cell lines from lungs obtained from a Wistar laboratory rat. Experimental infections were therefore conducted using homogenised lung tissue from wild-caught RNA-positive animals to infect both Wistar laboratory rats and wild-caught or first generation Pacific rats captured in the Mondulkiri site. Male and female adult animals were used. Due to logistical limitations, parallel experiments were not conducted for LORV. Of 85 animals inoculated intraperitoneally with the Cardamones variant of W\u0113nzh\u014du virus-positive homogenate, 77  were successfully infected as measured by detection of viral RNA by RT-PCR in organs and/or seroconversion by IFA\u00a0and/or\u00a0ELISA . Organs aviruses . Howeveraviruses .In both species, we observed horizontal transmission, but only between pups and their dams . VerticaClinical signs are rarely seen in mammarenavirus rodent reservoirs, although more subtle signs including reduced weight and body mass index have been observed . To estaThe peridomestic nature of the mammalian hosts of W\u0113nzh\u014du virus , indicatet al. . There was no liver cytolysis , the creatinine was normal (40\u00a0\u00b5mol/L) as was glycaemia (5.0\u00a0mmol/L). The chest radiograph which was retrospectively reviewed by an expert pulmonologist was normal and the final clinical diagnosis was of an acute bronchiolitis of probable viral origin. The patient received amoxicillin, gentamicin and bronchodilators for 4 days and was discharged after full recovery. The second hospitalized case (case 6) was a 3 month-old boy, admitted with a history of fever but with a normal body temperature at the time of medical examination, associated with productive cough, cardiac frequency of 132bpm, respiratory rate of 50/min, dyspnea and wheezing. The blood cell count  and renal function (creatinine: 47\u00a0\u00b5mol/L) were normal for the patient\u2019s age. A hypoglycaemia of 2.8\u00a0mmol/L was reported. SGOT and SGPT were at 53 U/L and 44 U/L, respectively. The independent expert pulmonologist who reviewed the chest radiograph retrospectively described patchy infiltrates and confirmed the initial diagnosis of acute bronchiolitis of probable viral origin made by the hospital paediatrician. The patient fully recovered and was discharged after 3 days of treatment with bronchodilators, amoxicillin and gentamicin. In both of the hospitalised cases a rhinovirus was also detected in the nasopharyngeal swab samples, but it should be noted that rhinovirus infection is not always associated with symptomatic disease  was also detected. Case 2 was a 9 year-old male with no known underlying disease sampled 2 days after onset of fever associated with cough, rhinorrhea, nausea, vomiting and severe headache. Case 3 was a 31 year-old male farmer, who presented 2 days after the onset of fever associated with productive cough, rhinorrhea, nausea and severe headache. Case 4 was a 45 year-old female farmer sampled 1 day after onset of fever associated with productive cough, rhinorrhea, nausea, severe headache and muscle pain. None of these 4 patients reported other signs and symptoms often associated with influenza  or dengue . Hospitalization was not required in any of these cases. In group 6 the first case (case 5) was that of an 8 month-old female with a recent history of fever (<4 days) who presented to hospital with fever (38\u00b0C), productive cough, cardiac frequency at 130bpm, respiratory rate at 46/min, dyspnea and wheezing. The blood cell count performed at admission demonstrated anaemia (haemoglobin: 93\u00a0g/L), a normal white cell count and formula  . NeverthR. exulans sympatric to infected individuals of the known host, R. norvegicus, expands both the geographic and host range of this mammarenavirus species. Although LCMV was not identified in this study    of the Ani tribe . As such thought .Rattus spp. could be called into question based on the pathologies observed in some animals experimentally infected with Cardamones variant of W\u0113nzh\u014du virus, detrimental effects of infection have been observed in the natural host of another mammarenavirus, Mopeia virus  or urban settings (Rattus spp.)   and as sOur results suggest that the ecology of both viruses, through their association with peridomestic rodents of several species, mirrors that observed for known zoonotic mammarenaviruses. Like LORV, JUNV is associated with agricultural pest species , whilst Confirmation of causality however is made problematic by the mild and indistinctive clinical presentation observed, the detection of co-infecting pathogens capable of producing a similar clinical picture in three out of six cases   and the Although our findings indicate that novel mammarenaviruses are present in Southeastern Asia and that humans appear to be regularly infected in the region, there are several issues that still need to be addressed. A major one was our lack of success in isolating both Cardamones variant of W\u0113nzh\u014du virus and LORV in tissue culture. This was surprising as samples clearly contained viable virus as evidenced by successful experimental infection of rats. It was also inhibitive to downstream analyses, as a successful method of isolation could greatly aid in the development of serological tests and in confirming proof of causality in suspected cases of human disease. The reasons behind our inability to isolate these viruses are unknown. It is possible that the viruses may have replicated too slowly to be detected by the methods used but this seems unlikely based on the successful isolation of other arenaviruses under similar conditions . More liGlobally infectious diseases remain a major cause of mortality and morbidity resulting in more than 15 million deaths per annum . HoweverNo species included in this study are considered to be endangered or threatened and none are included on either the CITES list or the Red List (IUCN). Approval notices for trapping and investigation of rodents were provided by the Ministry of Health Council of Medical Sciences, National Ethics Committee for Health Research (NHCHR) in Laos (number 51/NECHR) and by the Ethical Committee of Mahidol University, Bangkok, Thailand (number 0517.1116/661) and permission to trap in Cambodia was granted by the Cambodian Ministry of Environment. As Cambodia has no ethics committee overseeing animal experimentation, animals were treated in accordance with the guidelines of the American Society of Mammalogists, and within the European Union legislation guidelines (Directive 86/609/EEC). Rodents were trapped in the Cambodian provinces of Mondulkiri  and Veal Renh , the Thai provinces of Buriram , Loei  and Nan  and the Laotian provinces of Champasak  and Luang Prabang  as part of the CERoPath (Community Ecology of Rodent-borne Pathogens) project (www.ceropath.org). Sites representing a range of habitats with differing degrees of human disturbance were trapped at each location. Two sampling sessions were conducted at each locality with 30 lines of ten traps set over four nights during each session, amounting to 1,200 trap nights per session. Locally made, wire live-traps (approx 40*12*12 cm) were used at each locality and were baited with cassava, banana or sticky rice. Captured rodents were collected each day, humanely euthanized and blood pellet, serum and organs were harvested, stored temporarily in liquid nitrogen and then transferred to long-term storage at -80\u00baC. Selected samples were subjected to RT-PCR (see below) for evidence of arenavirus infection.Rodent lung samples were homogenised using the MagNA Lyser instrument and bead system . Tissue samples were placed in tubes containing ceramic-beads and 500\u00a0\u00b5l of pre-chilled sterile 1X PBS, subjected to oscillation at 3500\u00a0rpm and the lysate centrifuged at 6,200rpm for 5\u2009min on a bench-top centrifuge. The RNA from homogenised rodent lung samples, human sera and respiratory specimens was extracted using the QIAmp Viral RNA mini kit  as per the manufacturer\u2019s protocol.Rodent samples were screened using a one-step RT-PCR targeting a conserved 395bp region of the L segment, using primers designed for Old World mammarenavirus detection and described previously by Vieth et al. . To allohttp://soap.genomics.org.cn), the mouse (Mus musculus) genome 'NCBI37/mm9 assembly' reference genome, was used to filter out rodent genome-derived reads. Remaining reads were assembled using 3 different softwares: Velvet (www.ebi.ac.uk/~zerbino/velvewww.ebi.ac.uk/~zerbino/velvet), SOAPdenovo (http://soap.genomics.org.cn) and CLC Genomics Workbench (www.clcbio.com). Overlapping contigs assigned to an 'arenavirus' taxonomy were merged together to form longer sequences.To obtain enough material for full genome sequencing, filtered supernatant from homogenized lung (50\u00a0mg in 500\u00a0\u03bcl PBS) from an infected, wild-caught Pacific rat (C0649) and from an infected, wild-caught Savile\u2019s bandicoot rat (R5074) were each used to inoculate one adult male Wistar laboratory rat by intra-peritoneal injection (500\u00a0\u03bcl). Both rats were sacrificed at 7 days post inoculation (dpi) and organs collected (see below for methodology). Total RNA from homogenised lungs were extracted using standard Trizol reagent as per the manufacturer\u2019s instructions  and confirmed mammarenavirus-positive by RT-PCR (see above). Synthesis of cDNA, amplification, Illumina sequencing (on HiSeq 2000) and bioinformatics analysis were performed as described previously . Using tPrimers were designed based on the sequences generated by Illumina sequencing and used to obtain the coding complete genome sequences from two further isolates , and analysed using the default parameters.Coding complete sequences for both segments of each virus were loaded into the PASC tool, accessible at the National Center for Biotechnology Information (NCBI) website . Animals were kept in polyester filter bonneted cages, within a laminar flow Bio-isolator unit. Manipulations were carried out in a class 2 biosafety cabinet inside the BSL3 facilities. Animals were inoculated by intra-peritoneal injection, with 500\u00a0\u00b5l (adults) or 100\u00a0\u00b5l (juveniles) volumes and negative control animals were mock-inoculated with sterile PBS. At the end of each experiment animals were euthanized by exposure to chloroform followed by cervical dislocation. Personal protective equipment worn by the laboratory personnel comprised also a 3M Jupiter Tyvek laminate cape powered respirator , disposable gowns, shoe covers, and latex rubber gloves. Randomisation and blinding were not performed.Experiments were set up to test for: 1) the potential for infection and its estimated duration; 2) the potential for horizontal transmission; 3) the potential for vertical transmission. Animals used to estimate duration of the infection were housed individually. For horizontal transmission experiments, animals were housed in pairs  and dams were housed with their pups for vertical transmission experiments and neonatal inoculations. As numbers of animals were limited, experiments used to approximately estimate the duration of infection and potential for horizontal and vertical transmission were conducted at a number of time points with the number of animals available see . All aniFor electron microscopy lung tissue from infected animals were collected, cut into small pieces, fixed in 2.5% glutaraldehyde 0.1\u2009mol/L phosphate  and post-fixed in 2% osmium tetroxide solution. After dehydration and embedding in Epon, semi-thin sections were cut and stained with toluidine blue. Ultra-thin sections were stained with uranyl acetate and lead citrate and then examined with an electron microscope (Jeol 100 CX II). For histopathological analysis organ samples were fixed in RCL2  for 24\u2009hr then dehydrated with pure alcohol. Samples were embedded in low melting wax , sectioned  and stained with hematoxylin-eosin, periodic acid-Schiff and reticulin. For chromogenic immunohistochemistry human serum from a patient positive by ELISA (see below) was incubated overnight at 4\u00b0C with rodent tissue sections, in a buffer containing 0.5% bovine albumin. Samples were then exposed to a biotinylated donkey anti-human secondary antibody at 1:200  followed by streptavidin-conjugated to horse radish peroxidase revealed by the AEC, a red chromogen at 1:400 . Sections were counterstained with haematoxylin. Negative controls comprised tissue sections incubated with normal polyvalent human immunoglobulins at the same concentration as the human sera used for mammarenavirus detection and incubated in the absence of immunoglobulins.2 atmosphere for 7 days and the process was repeated 3 times. At each passage, the presence of the virus was detected by mammarenavirus qRT-PCR as described above. The presence of Mycoplasma contamination was not systematically checked before inoculation.Attempts to isolate the mammarenavirus from infected rodents\u2019 organs was conducted using VERO (ATCC CRL-1586), MDCK (ATCC CCL-34) and BHK-21 (ATCC CCL-10) cell lines previously described to isolate other mammarenaviruses. Briefly, each organ was homogenized using MagNA lyser instrument  as describe above and the homogenate was diluted at 1/100 with filtered culture medium  supplemented with 5% of foetal calf serum (GIBCO) and 1% of a solution of penicillin-streptomycin  before inoculation onto each cell line. The cells were incubated at 37\u00b0C in a 5% COSerological screening of experimentally infected rodents was initially performed by immune fluorescence assay (IFA) using LCMV-infected cells due to their availability and because this assay can detect numerous Old World mammarenavirus species. Sera were tested in pooled batches of five and sera from positive pools were then re-tested individually. Sera were diluted to 1:20 in PBS, added in 30\u00a0\u00b5l volumes to each well and placed at 37\u00baC for 1\u2009hr. Sera were aspirated from each well and slides were then washed three times in sterile PBS for 5 min each, rinsed in distilled water for 1 min, then allowed to air-dry. A secondary antibody  at a dilution of 1:50 was then added in 30ul volumes to each well. Slides were placed at 37\u00baC for 1\u2009hr, then washed and rinsed as before. Once dry, PBS containing 30% glycerol was added in small quantities to each slide and a cover-slide placed firmly on top. Slides were visualized with a UV microscope.As the lack of a tissue culture isolate precluded the production of more IFA slides and in an attempt to produce a test more specific to W\u0113nzh\u014du virus, once the coding complete genome sequence of Cardamones variant of W\u0113nzh\u014du virus was obtained, a Sandwich ELISA (enzyme-linked immunosorbent assays) based on the nucleoprotein gene was developed. In order to do this, the nucleoprotein gene of this virus (GenBank accession number KC669696) was cloned into the plasmid pIVEX-MBP, and transformed in BL21 AI E. coli. After incubation and cell lysis, the lysate was purified by IMAC  to separate the fusion protein, (NP-ARV), from the host proteins. The fusion protein was cut at the TEV site, and a second IMAC purification was used to separate NP-ARV from 6His-MBP and 6His-TEV. SDS-PAGE demonstrated that NP-ARV was in the non retained fraction and that the purity was 83.3%. The protein was then concentrated on cellulose membrane  to a final concentration of 0.8\u00a0mg/ml. To obtain monoclonal antibodies (MAbs), BALB/c mice were immunized six times subcutaneously with 10\u00a0\u00b5g of purified NP-ARV antigen. The first immunization was carried out with complete Freund adjuvant (CFA) and the second two weeks later with incomplete Freund adjuvant (IFA). The MAbs exhibited different affinities for different epitopes: G14-95 with very low affinity (<10\u20137M) and H24-20 with good affinity (1.10\u201310M).2SO4 and plates were measured at an absorbance of 450 nm. The means and standard deviations for each plate were calculated using 4 negative control serum samples. The cut-off value for the assay was defined as the mean plus three standard deviations (sd) following the formula: cut-off = mean + 3 sd + 10%. Each sample was tested twice in independent assays and when the results led to different conclusions, the sample was retested a third time. To verify the absence of cross-reactivity, human serum positive for anti-LCMV IgM and IgG  was tested in four independent series and found to test consistently negative for anti-W\u0113nzh\u014du IgG detection. Three positive controls (OD varying from low to high) were included in replicates in each plate and the intra-assay variation was considered as acceptable when the ODs of the positive controls were maintained within the ranges of their expected standard deviation values.Sandwich ELISAs were conducted using MAb H24-20. This MAb was diluted in dilution buffer  and added to 96-well NUNC-immuno plates with a Polysorp surface  at 1\u00a0ug/ml per well. Plates were incubated at 4\u00b0C overnight, then washed four times with wash buffer . Plates were blocked with blocking buffer  for 1\u2009hr at 37\u00b0C then washed four times with wash buffer. A 100\u00a0\u03bcl volume of NP-ARV diluted to 0.8\u00a0ug/ml in PBS 1X was added per well and incubated for 1\u2009hr at 37\u00b0C. Plates were then washed four times with wash buffer. Sera (human or rodent) diluted 1:100 in dilution buffer were added to wells in 100\u00a0\u00b5l volumes, incubated for 1\u2009hr at 37\u00b0C, and then washed seven times with wash buffer. Peroxidase-labelled goat anti-human IgG  or peroxidase-labelled goat anti-rat IgG  was diluted 1:10,000 in dilution buffer and 100\u00a0\u00b5l added to each well. Plates were incubated for 1h at 37\u00b0C then washed four times with wash buffer. The substrate solution TMB  was added in 100\u00a0\u03bcl volumes per well. The reaction was stopped by adding 100\u00a0\u03bcl of 1N HSeroconversion was defined as when the acute sample was negative and the convalescence sample of the same patient was positive, or when the convalescent sample demonstrated an increase of 50% or more of the OD value of the acute sera.A total of 372 human serum samples and 7 experimentally infected rodent serum samples  were tesHuman serum, respiratory and cerebro-spinal fluid samples used in this study were collected previously by the Institute Pasteur in Cambodia (IPC) within the framework of several research projects approved by the Cambodian National Ethics Committee for Health Research (NECHR) and stored in IPC\u2019s biobank. At the time of sample collection, a written consent form from each patient or their legal guardian was obtained and the NECHR also specifically authorized the use of these stored specimens for the purpose of the present study (NECHR No. 0205). The use of samples collected for dengue and influenza national surveillance and the use of stored and prospectively collected respiratory samples for the negative control groups were all approved by the NECHR. All the samples were anonymised for the purpose of this study. Samples were tested using the W\u0113nzh\u014du virus IgG ELISA or by semi-nested RT-PCR dependent on sample type (see above).Eight groups of human samples were tested for evidence of mammarenavirus infection . Group 1Streptococcus pneumoniae, Streptococcus suis, Haemophilus influenzae, Neisseria meningitidis, Orientia tsutsugamushi). Group 4 consisted of randomly selected sera, obtained during the acute febrile phase from 253 patients. These patients, who originated from different parts of Cambodia, presented between 2009 and 2011 with signs and symptoms suggestive of dengue fever, dengue hemorrhagic fever and dengue shock syndrome. However all tested negative for dengue, Japanese encephalitis and chikungunya virus infections by RT-PCR and serology . Group <0.05 for all parameters and 95% of confidence interval was used. Categorical variables between groups were compared by Chi2 test or Fisher\u2019s exact test and t-test or Wilcoxon-Mann-Whitney test were used for continuous variables.All statistical analyses were performed using Stata/SE version 12.0 . Significance was assigned at p In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.eLife. Your article has been reviewed by Jens Kuhn and Peter Horby, and the evaluation has been overseen by Simon Hay as the Reviewing Editor and Richard Losick as the Senior Editor.Thank you for submitting your work entitled \"Evidence of human infection by new arenaviruses endemic to Southeast Asia\" for consideration by The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. You will see that we have garnered two very detailed and useful reviews that will help you improve the manuscript. Please run systematically through all comments and respond fully to the reviewers.Reviewer #1:\"Evidence of human infection by new arenaviruses endemic to Southeast Asia\" by Blasdell et al. provides the fundamental biological insight that at least two mammarenaviruses other than LCMV are endemic to Southeastern Asia and that one of them may infect people on a regular basis. One virus, Loei River virus is a new discovery; the second virus, which is associated with human disease, has recently been described in Eastern Asia, but until now was not considered a human pathogen. These findings are of considerable importance as they put mammarenaviruses on the list of possible etiological agents of orphan diseases.In the first paragraph of the Introduction and in the last paragraph of the subsection \u201cIdentification of two arenaviruses in Southeast Asia\u201d: the authors need to decide (using scientific methods) what they have discovered. If the virus they have discovered is a genetic variant of W\u0113nzh\u014du virus, then the virus needs to be called W\u0113nzh\u014du virus, not Cardamones virus . I see no problem with replacing \"Cardamones\" throughout with \"W\u0113nzh\u014du\".W\u0113nzh\u014du mammarenavirus), i.e. whether this species will have two members (Cardamones virus and W\u0113nzh\u014du virus), or whether Cardamones virus needs to be classified in its own species.If the new virus is clearly distinct from W\u0113nzh\u014du virus, then the name Cardamones virus could be justified (and a unique abbreviation should be introduced). If so, then the authors need to determine whether Cardamones virus belongs to the same species as W\u0113nzh\u014du virus (the recently proposed and by now ICTV-accepted Arenaviridae Study Group (not the 9th ICTV Report as they have done): PMID: 25935216. Most important would be the placement of both novel viruses in PASC (S and L segment) \u2013 the results of which should be described in the manuscript. The last paragraph of the subsection \u201cIdentification of two arenaviruses in Southeast Asia\u201d should then be updated accordingly and the reference be replaced (or PMID: 25935216 added in addition to the 9th ICTV Report).To come to a decision, the authors should follow the updated guidelines published by the ICTV In the last paragraph of the subsection \u201cHuman arenavirus infections in Cambodia\u201d: what was the closest hit when the 302bp piece was BLASTed? That is, how specific is that piece truly for W\u0113nzh\u014du virus? The results of such a BLAST should be presented, as it is this small piece that is used to convince the reader that human infections are occurring.The manuscript lacks precision and needs to be edited.Reviewer #2:General assessment:This is an interesting manuscript that describes novel findings. It describes efforts to detect Old World arenaviruses in wild rodent species in Thailand, Cambodia, and Laos. Whilst I am not an expert in the laboratory aspects described, the successful experimental infection of animals using lung tissue that was positive for arenavirus RNA and the accompanying RT-PCR, serology and electron microscopy findings support the conclusion that the wild rodents were infected with an arenavirus. The virus is termed Cardamones virus in the manuscript but it is unclear that the virus represents a novel strain deserving of a new name. The failure to culture the virus is disappointing and the potential reasons for this require some discussion.The manuscript then describes efforts to seek evidence of human infection with Cardamones virus. The evidence of human infections is based on serology and RT-PCR findings. The data presented do provide evidence of human infection with an arenavirus in Cambodia however the causal association between virus detection and illness is not wholly convincing.Substantive concerns:Whether the serological results indicate the infecting arenavirus is Cardamones virus infection, or another related and cross-reactive arenavirus, is uncertain, but this is addressed by the authors. Since serology results are a large component of the evidence for human infections with an arenavirus, more supportive data on the specificity of the serological assay would be helpful. Seroepidemiological surveys of novel viruses should ideally compare the seroprevalence in exposed populations to the seroprevalance in populations who have likely not been exposed to the animal reservoir and should report efforts to validate the assay in virologically-confirmed cases. The limitations of the validation of the specificity of the ELISA should be addressed in more detail and more clarity about the serology methods would be helpful:a) What was the inter-assay correlation of the IFA and ELISA? b) What was the intra-assay reproducibility of the replicate independent IgG assays described in the subsection \u201cCardamones virus IgG ELISA\u201d? Were acceptable replication parameters set?c) Please describe the definitions of 'seropositive' and 'seroconversion' more explicitly.The serology positive rates and mean age of positive cases were not significantly different between healthy individuals and patients with a febrile illness, which leaves some doubt about the causal association between arenavirus antibody detection and illness. The seroconversions in unwell individuals is however an indicator of a possible causal link. Data on the interval between acute and convalescent samples for these seven cases should be presented. Presentation of the serology data could be improved \u2013 e.g. how were the +ve samples distributed by acute / convalescent samples?Arenavirus PCR +ve respiratory samples were identified in 6 of 999 subjects with an acute respiratory illness compared to zero of 504 healthy controls. However, the control group was significantly older (28 vs. 16.7 years). This again leaves some doubt about the causal association between arenavirus detection and respiratory illness, since the statistical association may be confounded by age. This is particularly important since the highest antibody prevalence was in the 6-10 year old age group. I would suggest an age-stratified analysis of the PCR data if feasible. Reviewer #1:\"Evidence of human infection by new arenaviruses endemic to Southeast Asia\" by Blasdell et al. provides the fundamental biological insight that at least two mammarenaviruses other than LCMV are endemic to Southeastern Asia and that one of them may infect people on a regular basis. One virus, Loei River virus is a new discovery; the second virus, which is associated with human disease, has recently been described in Eastern Asia, but until now was not considered a human pathogen. These findings are of considerable importance as they put mammarenaviruses on the list of possible etiological agents of orphan diseases.In the first paragraph of the Introduction and in the last paragraph of the subsection \u201cIdentification of two arenaviruses in Southeast Asia\u201d: the authors need to decide (using scientific methods) what they have discovered. If the virus they have discovered is a genetic variant of W\u0113nzh\u014du virus, then the virus needs to be called W\u0113nzh\u014du virus, not Cardamones virus . I see no problem with replacing \"Cardamones\" throughout with \"W\u0113nzh\u014du\".If the new virus is clearly distinct from W\u0113nzh\u014du virus, then the name Cardamones virus could be justified (and a unique abbreviation should be introduced). If so, then the authors need to determine whether Cardamones virus belongs to the same species as W\u0113nzh\u014du virus (the recently proposed and by now ICTV-accepted W\u0113nzh\u014du mammarenavirus), i.e. whether this species will have two members (Cardamones virus and W\u0113nzh\u014du virus), or whether Cardamones virus needs to be classified in its own species.To come to a decision, the authors should follow the updated guidelines published by the ICTV Arenaviridae Study Group (not the 9th ICTV Report as they have done): PMID: 25935216. Most important would be the placement of both novel viruses in PASC (S and L segment) \u2013 the results of which should be described in the manuscript. The last paragraph of the subsection \u201cIdentification of two arenaviruses in Southeast Asia\u201d should then be updated accordingly and the reference be replaced (or PMID: 25935216 added in addition to the 9th ICTV Report).R. exulans) not previously associated with W\u0113nzh\u014du virus, in addition to rodents of the species R. norvegicus, which has been, we don\u2019t believe this supports the case for the Cardamones virus as a separate species. The previous study by Li et al., 2014 demonstrated that W\u0113nzh\u014du virus is clearly capable of infecting rodents of a range of species, including several Rattus species, so it\u2019s presence in another one that is sympatric to R. norvegicus fits well with its seemingly promiscuous nature. The PASC results and discussion around the categorization of the Cambodian virus have been included in the Results and Discussion . However, as the identities between the Chinese and Cambodian sequences were relatively low by intra-species standards and because they were identified in geographically distinct regions, we propose that the Cambodian sequences represent a variant of W\u0113nzh\u014du virus, with the proposed name Cardamones. The name Cardamones virus has been replaced with W\u0113nzh\u014du virus throughout the text, or referred to as the Cardamones variant of W\u0113nzh\u014du virus. Although the Cardamones variant was identified in rodents of a species  demonstrated 91% similarity to W\u0113nzh\u014du virus in BLAST analysis. The 302bp region from the human samples demonstrated 98-99% similarity to the sequences from the Cambodian rodent samples in pairwise alignment analysis, and 89-91% similarity to W\u0113nzh\u014du virus in BLAST analysis. This has now been included in the Results section.The manuscript lacks precision and needs to be edited.This has now hopefully been addressed.Reviewer #2:General assessment:This is an interesting manuscript that describes novel findings. It describes efforts to detect Old World arenaviruses in wild rodent species in Thailand, Cambodia, and Laos. Whilst I am not an expert in the laboratory aspects described, the successful experimental infection of animals using lung tissue that was positive for arenavirus RNA and the accompanying RT-PCR, serology and electron microscopy findings support the conclusion that the wild rodents were infected with an arenavirus. The virus is termed Cardamones virus in the manuscript but it is unclear that the virus represents a novel strain deserving of a new name. The failure to culture the virus is disappointing and the potential reasons for this requires some discussion.A full description of the culture method has been now included into the Materials and methods section. Some discussion has also been included around the possible reasons for failing to isolate the virus. Although the authors are unsure as to exactly why this was the case, as the Chinese strains of W\u0113nzh\u014du virus were isolated in a cell line not available in our laboratory, a suggestion to perform future isolation attempts in this cell line has been included in the Discussion.The manuscript then describes efforts to seek evidence of human infection with Cardamones virus. The evidence of human infections is based on serology and RT-PCR findings. The data presented do provide evidence of human infection with an arenavirus in Cambodia however the causal association between virus detection and illness is not wholly convincing.We agree and have tried to tone down this aspect. We have tried to make it clear that though an arenavirus appears to be causing human infections in Cambodia, we cannot confirm its identity or whether it is truly causing disease.Substantive concerns:Whether the serological results indicate the infecting arenavirus is Cardamones virus infection, or another related and cross-reactive arenavirus, is uncertain, but this is addressed by the authors. Since serology results are a large component of the evidence for human infections with an arenavirus, more supportive data on the specificity of the serological assay would be helpful. Seroepidemiological surveys of novel viruses should ideally compare the seroprevalence in exposed populations to the seroprevalance in populations who have likely not been exposed to the animal reservoir and should report efforts to validate the assay in virologically-confirmed cases.We agree that such surveys should compare exposed and unexposed populations. Unfortunately, we did not have access to samples from an unexposed population and no longer have the resources to perform additional surveys at this stage. We did try to include samples from foreigners in our survey, but only few were available and it was unknown how long these individuals had been in the region for, so some may have been exposed. We have stated this in the Discussion and have also stated that such a comparison should be performed in future studies that should be easier to perform and to get funded after the publication of this manuscript. We have also stated that isolation of virus from suspect disease cases should be made in order to aid confirmation of causality.The limitations of the validation of the specificity of the ELISA should be addressed in more detail and more clarity about the serology methods would be helpful:a) What was the inter-assay correlation of the IFA and ELISA?and ELISA were used to test the rodent sera. Only limited volumes were obtained for the majority of samples. The ELISA results for the extremely limited number of experimentally infected rat samples that we were able to use were however consistent with the results found by IFA  conducted later when there was no IFA slide left, ELISA was able, as expected, to detect IgG antibodies in those 2 PCR-positive animals starting at day 7 and day 15 respectively  which sub) What was the intra-assay reproducibility of the replicate independent IgG assays described in the subsection \u201cCardamones virus IgG ELISA\u201d? Were acceptable replication parameters set?The intra-assay coefficients of variability ranged from 0 to 13.5%.We systematically included 3 positive controls (OD varying from low to high) in replicates in each plate and the intra-assay variation was considered as acceptable when the ODs of the positive controls were maintained within the ranges of their expected standard deviation values.This has now been added into the Materials and methods section.c) Please describe the definitions of 'seropositive' and 'seroconversion' more explicitly.The cut-off threshold was calculated as follows: (mean of negative +3SD) +10% and is mentioned in the Materials and methods section.Out of the 510 patients tested, only a single sample collected during the acute phase of the febrile episode was available for 98 patients, whilst only a single serum sample collected during the convalescent phase was available for 214 individuals. Paired samples, one collected during the acute phase and one during the convalescence phase was available from a further 198 patients. In this context seropositive is defined as when acute and/or convalescent samples returned a value above the cut-off of the assay. Seroconversion was defined as when the acute sample was negative and convalescence sample of the same patient was positive or when an increase of more than 50% of OD value between acute and convalescent sera was measured. This has now been added to the Methods.The serology positive rates and mean age of positive cases were not significantly different between healthy individuals and patients with a febrile illness, which leaves some doubt about the causal association between arenavirus antibody detection and illness. The seroconversions in unwell individuals is however an indicator of a possible causal link. Data on the interval between acute and convalescent samples for these seven cases should be presented. Presentation of the serology data could be improved \u2013 e.g. how were the +ve samples distributed by acute / convalescent samples?We agree with the reviewer that a prospective study that includes IgG arenavirus serology in addition to the assays testing for the other main etiologies of febrile illnesses in the region would provide much better evidences. Unfortunately, as stated earlier, the data reported here used archived samples as the discovery of these new arenaviruses and their involvement in human infection was not expected when the CEROPATH study  was designed. We hope that the publication of this paper will help ourselves and other groups to design, fund and conduct such clinical prospective studies in a near future.In regards to seroconversion, the interval between the acute and convalescent samples of the 7 cases  ranged between 2 and 15 days with a mean of 7.42 days. The intervals of the 3 seroconverted samples were 6, 9 and 15 days. Additional information on positive samples by acute or convalescent samples has been added to Arenavirus PCR +ve respiratory samples were identified in 6 of 999 subjects with an acute respiratory illness compared to zero of 504 healthy controls. However, the control group was significantly older (28 vs. 16.7 years). This again leaves some doubt about the causal association between arenavirus detection and respiratory illness, since the statistical association may be confounded by age. This is particularly important since the highest antibody prevalence was in the 6-10 year old age group. I would suggest an age-stratified analysis of the PCR data if feasible.We thank the reviewer for this suggestion and have added We agree that it is unfortunate that the healthy control group did not perfectly match the age distribution of the patient\u2019s group but again this is due to the retrospective approach based on availabilities of clinical specimens that made it extremely difficult to achieve a perfect age match. If unfortunately the sample size of the young age control groups is too small to reach statistical significance, a significant association was still observed in the group of adults over 30 years as well as for the all-age population."}
+{"text": "Few studies have investigated the management of human immunodeficiency virus (HIV)-associated end-stage renal failure particularly in low-resource settings with limited access to renal replacement therapy. We aimed to evaluate the effects of HIV infection on continuous ambulatory peritoneal dialysis (CAPD)-associated peritonitis outcomes and technique failure in highly active antiretroviral therapy (HAART)-treated HIV-positive CAPD populations.We conducted a single-center prospective cohort study of consecutive incident CAPD patients recruited from two hospitals in Durban, South Africa from September 2012-February 2015. Seventy HIV-negative and 70 HIV-positive end-stage renal failure patients were followed monthly for 18\u00a0months at a central renal clinic. Primary outcomes of peritonitis and catheter failure were assessed for the first 18\u00a0months of CAPD therapy. We assessed risk factors for peritonitis and catheter failure using Cox regression survival analysis.P\u2009<\u20090.001). When the baseline CD4 count was below 200 cells/\u03bcL, the peritonitis rate rose to 3.69 episodes/person-years , while a baseline CD4 count above 350 cells/\u03bcL was associated with a peritonitis rate of 1.60 episodes/person-years . HIV was associated with increased hazards of peritonitis relapse . Independent predictors associated with increased peritonitis risk were HIV , diabetes  and a baseline CD4 count\u2009<\u2009200 cells/\u03bcL . Catheter failure rates were 0.34 (HIV-positive cohort) and 0.24 (HIV-negative cohort) episodes/person-years . Peritonitis , average hemoglobin concentrations , and average serum C-reactive protein levels were independent predictors of catheter failure.The HIV-positive cohort had a significantly increased rate of peritonitis compared to the HIV-negative cohort (1.86 vs. 0.76 episodes/person-years, respectively; hazard ratio [HR], 2.41; 95% confidence interval [CI], 1.69\u20133.45, HIV infection in end-stage renal disease patients managed by CAPD was associated with increased peritonitis risk; however, HIV infection did not increase the risk for CAPD catheter failure rate at 18\u00a0months. Continuous ambulatory peritoneal dialysis (CAPD) is the dialysis modality of choice for many patients with end-stage renal disease (ESRD) and a cost-effective option easily implemented in low-resource settings \u20133. HowevHIV infection presents a unique challenge in patients with ESRD managed with CAPD. As HIV impairs local host defense mechanisms , the risThe study protocol was approved by the University of KwaZulu-Natal Biomedical Research Ethics Committee (BE 187/11), and research was conducted in accordance with the principles of the Declaration of Helsinki. All participants provided written informed consent prior to study enrollment.We recruited patients for a prospective cohort study from two hospitals in Durban, South Africa between September 2012 and February 2015. King Edward VIII Hospital (KEH) is a 799-bed regional referral center with limited specialist services. Inkosi Albert Luthuli Central Hospital (IALCH) is an 846-bed specialist referral hospital for KwaZulu-Natal province and covers a catchment area of approximately 10 million people. The renal unit based in IALCH offers CAPD , hemodialysis (150 patients), and transplantation services.th generation HIV enzyme-linked immunosorbent assays (ELISA) performed by the South African National Health Laboratory Service (NHLS) before enrollment, screening for HIV performed using a HIV Ag/Ab Combo (CHIV) assay  and confirmation using HIV Combi and HIV Combi PT assays . HAART management was left to the discretion of the local clinic. Tenckhoff catheter insertion was performed by experienced surgeons by laparoscopy (66 HIV-negative and 35 HIV-positive patients) at IALCH, and by trained nephrologists percutaneously at KEH (4 HIV-negative and 20 HIV-positive patients) and IALCH (15 HIV-positive patients). All CAPD patients utilized Y-sets, twin-bag systems, and conventional peritoneal dialysis (PD) solutions . They were trained predominantly as outpatients by the same nursing team, and generally performed four exchanges per day.We enrolled 70 HIV-negative and 70 HIV-positive patients with end-stage renal failure who underwent dialysis with a newly inserted double-cuffed coiled Tenckhoff catheter at the two hospitals. Patients with incident CAPD aged 18\u201360 years were consecutively recruited soon after Tenckhoff insertion until each cohort reached the 70-patient target. Peritonitis rate differentials reported by previous similar studies were used to calculate the sample size required to achieve a power of 80% and an \u03b1 error probability of 0.05 ) and were compared using the Student\u2019s P\u2009=\u20090.003). Fifty-one percent of HIV-positive patients were either newly diagnosed with HIV or had recently started HAART (less than six months before insertion of the Tenckhoff catheter). However, 57.1% of HIV-positive patients had a suppressed viral load  at the time of enrollment. While the median baseline viral load was 4230 copies/mL  for patients with detectable viral loads, the median dropped below the detectable limit (IQR <150\u20132990) when including patients with undetectable viral loads. Twenty-one percent of HIV-positive patients had CD4 counts >500 cells/\u03bcL, 20.0% had <200 cells/\u03bcL, and the remainder (58.6%) had 200\u2013500 cells/\u03bcL. Other details of the study population are outlined in Table\u00a0The mean patient age was 39.1\u2009\u00b1\u200911.7 (HIV-negative) and 37.0\u2009\u00b1\u20099.4 (HIV-positive) years with women accounting for 42.9 and 52.9% of the two cohorts, respectively. All patients (100%) in the HIV-positive cohort were of African ethnicity compared to 84.3% in the HIV-negative cohort (P\u2009=\u20090.002). Technique failure occurred in 24.3% (17/70) of the HIV-negative cohort and 27.1% (19/70) of the HIV-positive cohort (P\u2009=\u20090.699), whereas 18.8% (13/70) and 40.0% (28/70), respectively, died (P\u2009=\u20090.005). One HIV-negative cohort participant and two HIV-positive participants had their Tenckhoff catheters removed due to improved renal function. One HIV-negative participant underwent kidney transplantation from a live related donor, and one HIV-positive participant left the study to undergo private hemodialysis and was lost to follow-up.After 18\u00a0months, 54.3% (38/70) of the HIV-negative cohort and 28.6% (20/70) of the HIV-positive cohort were alive with a patent catheter (P\u2009=\u20090.011). Fifty-one percent (36/70) of the HIV-positive cohort participants had one or more peritonitis episodes in the first 180\u00a0days following Tenckhoff catheter insertion compared to 24.3% (17/70) in the HIV-negative cohort (P\u2009=\u20090.002). Nine percent (5/54) of peritonitis episodes in the HIV-negative cohort and 13.8% (13/94) in the HIV-positive cohort were relapse episodes (P\u2009=\u20090.602). Eleven percent (6/54) of peritonitis episodes in the HIV-negative cohort and 7.4% (7/94) in the HIV-positive cohort were repeat episodes with the same organism (P\u2009=\u20090.448), while 18.5% (10/54) in the HIV-negative cohort and 23.4% (22/94) in the HIV-positive cohort were repeat episodes with a different organism (P\u2009=\u20090.487) (Table\u00a0There were 54 peritonitis episodes observed in 44.3% (31/70) of the HIV-negative cohort and 94 episodes in 65.7% (46/70) of the HIV-positive cohort during the follow-up period (P\u2009=\u20090.038). Culture-negative results were seen in 18.5% (10/54) of HIV-negative and 28.7% (27/94) of HIV-positive cohort episodes (P\u2009=\u20090.17)  compared to the HIV-positive cohort  P\u2009=\u20090.08. Cultur4/54 comprelapse episodes, were 0.765 (HIV-negative cohort) and 1.855 (HIV-positive cohort) episodes/person-years , with a Cox univariate proportional hazard ratio of 2.41 , 1.69\u20133.45, P\u2009<\u20090.001) associated with HIV infection. Kaplan-Meier peritonitis-free survival rates were 6.0% (HIV-positive cohort) and 32.3% (HIV-negative cohort) at 18\u00a0months (P\u2009<\u20090.001) , while a baseline CD4 count above 350 cells/\u03bcL was associated with a peritonitis rate of 1.599 episodes/person-years . The peritonitis relapse rate was 0.078 (HIV-negative cohort) and 0.298 (HIV-positive cohort) episodes/person-years  , diabetes, and a baseline CD4 count less than 200 cells/\u03bcL were found to be independent predictors of peritonitis . Kaplan-Meier technique survival rates at 18\u00a0months censored for death, catheter removal not related to technique failure, and loss to follow-up were 71.4% (HIV-negative cohort) and 58.2% (HIV-positive cohort), respectively (P\u2009=\u20090.295) . Fungal peritonitis was responsible for 11.8% (2/17) (HIV-negative cohort) and 21.0% (4/19) (HIV-positive cohort) of the technique failures (P\u2009=\u20090.662). Multivariable proportional hazard analysis identified peritonitis , average hemoglobin concentration and average serum CRP level as independent predictors of technique failure (Table\u00a0P\u2009<\u20090.0001)  and 0.338 (HIV-positive cohort) episodes/person-years  of developing peritonitis with rates of 1.86 episodes/person-years compared to 0.76 episodes/person-years for HIV-negative CAPD patients. Our HIV-negative peritonitis rate was higher than the target rate of 0.67/year-at-risk advocated by the 2010 International Society for Peritoneal Dialysis (ISPD) guidelines, probably reflecting a higher intrinsic risk in our patient population which is predominantly impoverished with few available choices for alternative hemodialysis .The few retrospective studies that have examined the outcomes of CAPD in HIV-infected patients have demonstrated improvements in survival and reductions in peritonitis rates associated with the use of HAART and advances in CAPD , 17, 26.P\u2009<\u20090.001). This probably reflects compromised host defense mechanisms against infectious organisms at lower CD4 counts. A baseline CD4 count above 350 cells/\u03bcL was associated with a 2-fold increased hazard for peritonitis , further highlighting the inherent risk associated with HIV infection even with higher CD4 counts. The peritonitis risk was demonstrated to manifest early, as within 180\u00a0days following Tenckhoff catheter insertion half of the HIV-positive cohort had at least one documented episode of peritonitis. This risk was shown to persist, as demonstrated by the peritonitis-free survival rate of only 6.0% at 18\u00a0months.Although HIV and diabetes were identified as independent predictors of poor peritonitis outcome, the immunologic state also modified the HIV-associated risk. A baseline CD4 count <200 cells/\u03bcL increased the hazards for peritonitis more than 4-fold compared to HIV-negative CAPD patients , possibly reflecting a greater susceptibility to touch contamination-related infection due to compromised local defense mechanisms contributing to the HIV-associated peritonitis risk. This finding suggests a role for a prophylactic antibiotic strategy, particularly in the first six months following catheter insertion when the peritonitis risk is highest and more so among patients with low CD4 counts. The HIV-positive cohort also had a significantly increased culture-negative peritonitis rate compared to the HIV-negative cohort . Culture negative cases accounted for 28.7% of the HIV-positive cohort\u2019s total peritonitis episodes; this percentage is above the 20% recommended by the 2010 ISPD guidelines. This finding could indicate a higher prevalence of fastidious organisms and mycobacteria in this group [The HIV-positive cohort showed an increased gram-positive peritonitis rate compared to the HIV-negative cohort  or peritonitis-associated technique failure rates . This inconsistency may be partially explained by the significantly higher proportion of gram-negative peritonitis episodes documented in the HIV-negative cohort ; gram-negative organisms were also the major causative organism group for technique failures in both cohorts . It may be that HIV infection does not increase the risk of catheter-threatening peritonitis in the first 18\u00a0months following insertion but instead increases the risk for treatable peritonitis episodes. However, increased relapses and multiple episodes raise concern about the long-term risk of technique failure. Further, the disproportionately higher mortality rate in the HIV-positive cohort contributed to a dropout rate of 44.3% compared to 21.4% in the HIV-negative cohort; this may have introduced bias, resulting in a lower apparent rate of technique failure in the HIV-positive cohort.Peritonitis was shown to be the predominant cause of technique failure in both cohorts and was further identified as an independent predictor of this outcome. Although HIV was associated with an increased risk of peritonitis as well as an increased risk for subsequent episodes, it was not shown to significantly influence all-cause technique failure rates (HR 1.42, The major limitation of our study is that it is a single-center observational study, which inherently limits causation inferences that can be drawn from observed associations. Statistical power, particularly relating to technique failure outcomes, was limited by the relatively small sample size and short follow-up period. The matching strategy of restricting the inclusion age to 18\u201360 years may limit the generalizability of our results to only this age group. This matching strategy was employed to minimize age as a confounding factor, as HIV-positive CAPD populations are typically younger than their HIV-negative counterparts . More stOur study indicates that HIV infection can adversely influence CAPD-associated peritonitis rates, and this association is further modified by the immunological state of the infected patient. The peritonitis risk attributable to HIV infection manifests early in the course of CAPD treatment and increases the risk for subsequent episodes, but it was not shown to result in increased technique failure rates at 18\u00a0months. Early detection of CKD and HIV with the initiation of HAART before significant immunological compromise and careful management of comorbid conditions can help minimize the risk. Prophylactic antibiotics should be considered and investigated as possible strategies to help improve peritonitis outcomes."}
+{"text": "Desulfovibrio profundus strain 500-1 was isolated in the Japan Sea from a sediment layer at 500-m depth under a water column of 1,000\u00a0m. Here, we report the genome sequence of this strain, which includes a 4,168,905-bp circular chromosome and two plasmids of 42,836 bp and 6,167 bp.Piezophilic  Desulfovibrio profundus, isolated by Bale and collaborators during the Ocean Drilling Program Leg 128, site 798B . An optical map of the D.\u00a0profundus 500-1 genome was produced using an Argus system (OpGen). The annotation was performed using the Microscope platform (Genome sequencing was performed mixing Illumina technology and Oxford Nanopore technology (ONT). First, a multiplexed overlapping paired-end library, with 546-bp insert size, was constructed and loaded on an Illumina MiSeq instrument (2\u00a0\u00d7\u00a0300\u00a0bp). In parallel, genomic DNA was tagmented to create an ONT library following the manufacturer's recommendations. This library was loaded on MinION R9.4 SpotON flow cells. The Illumina and ONT data, around 270- and 20-fold coverage, respectively, were assembled using SPAdes version 3.6.0  were predicted for the chromosome, as well as 8 pseudogenes, 11 miscellaneous RNAs (misc-RNA), 3 rRNA operons, and 57 tRNA genes. A total of 43 CDSs and 1 misc-RNA were predicted for the largest plasmid, and 7 CDSs were predicted for the second plasmid. Among the NCBI Genomic Reference sequences, the top genome homologous to D.\u00a0profundus is available in GenBank/EMBL under the accession no. LT907975 to LT907977 for the chromosome and the plasmids, respectively.The \ufb01nal annotated genome of"}
+{"text": "Malignant melanoma brain metastases (MBM) are the third most common cause for brain metastases (BM). Historically Whole-brain radiotherapy (WBRT) was considered the goldstandard of treatment even though melanoma cells are regarded as very radioresistant. Therapeutic possibilities have fundamentally changed since the availability of stereotactic radiotherapy (SRT), where it is possible to apply high ablative doses in a very precise manner. In this work we analyze prognostic factors of overall survival (OS) after SRT in patients with MBM and evaluate the applicability of popular prognostic indices that mainly stem from the WBRT-era.This work is a retrospective analysis of OS of 80 malignant melanoma (MM) patients who received SRT for intracranial melanoma metastases between 2004 and 2014 who had not received prior treatment for MBM in terms of surgery or WBRT. Potential prognostic factors were analyzed using univariable and multivariable analysis. Existing prognostic scores  were calculated and tested using log-rank analysis.p-value but did not show adequate division when looking at the two intermediate risk subgroups. RADES did not show any statistically significant prognostic value. In univariable as well as in multivariable analyses a higher Karnofsky-Index, a single BM, and non nodular melanoma (NM) histology were positive predictors of survival.Eighty patients, respectively 177 brain metastases, were irradiated. The median survival time from radiation was 7.06\u00a0months. Overall, GGS, GPA and DS-GPA were significant predictors of survival. The MM-specific index DS-GPA showed the best The existing prognostic scores do not seem to ideally fit for this special group of patients. Our results indicate that the histologic subtype of MM could add to the prognostic value of specialized future indices. Brain metastases (BM) are the most common intracranial malignant tumor  and 20-4In general we have seen an increase in BM in the last decades mainly due to high life-expectancy, better imaging technology and the development of new systemic drugs that in many cases do not adequately penetrate the blood-brain barrier .The median overall survival of a patient with BM is less than 12\u00a0months, but OS varies significantly interindividually depending on a plethora of factors like. Karnofsky performance status (KPS), extracranial metastasis (ECM), number of metastases, lesion size and volume, and histologic subtype .Historically the goldstandard of treatment for patients with BM was whole brain radiotherapy (WBRT), a therapy that may improve OS and quality of life (QOL) . HoweverAs a consequence, many authors have tried to identify prognostic factors of survival in order to predict the individual patient\u2019s potential survival time. Indices based on such prognostic factors include the Golden grading system (GGS), the graded prognostic index (GPA) the disease-specific graded prognostic index (DS-GPA) as well as the prognostic index published by Rades et al. in 2011 (RADES) . While tIn this study we evaluated the prognostic value of these four indices in MBM patients who received SRT as primary BM treatment.We performed a retrospective analysis of 80 patients  with MBMs who had undergone stereotactic radiotherapy as their primary treatment between 2004 and 2014 in our department. Treatment decisions had been based on a vote by an interdisciplinary medical team. Doses applied in multiple fractions were considered fractionated stereotactic radiotherapy (FSRT) and high single doses were considered SRS. Larger tumors in close proximity to critical structures were assigned to FSRT, while smaller tumors distant to critical structures were treated with SRS.10, synchronous vs. metachronous diagnosis of BM  diagnosis was considered metachronous), tumor localization, presence of ECM and interval from BM diagnosis to radiotherapy. The prognostic scores, GPA, DS-GPA, GGS and RADES, were calculated and tested using the log-rank test. Prognostic parameters were identified using uni-and multivariable analyses.Patients were stratified according to age, gender, KPS, histologic subtype, Stage, number of BM, cumulative planning target volume (PTV), highest and lowest BEDPatients with tumor progress could undergo salvage SRS, WBRT or a resection of the BM. Follow-up examinations, including MRI as well as clinical and neurologic examinations were usually performed at 3\u00a0months intervals after radiotherapy or if clinically indicated.Patients were treated using Novalis\u00ae (BrainLab\u00ae) with beam shaping capability, built-in multi-leaf collimator (MLC) and image guidance. Novalis ExacTrac\u00ae image guided frameless system enabled us to image the patient at any couch position using a frameless positioning array. All patients received diagnostic contrast enhanced cranial magnetic resonance imaging (ceMRI) and cranial computed tomography (CT) imaging before CT/MRI-fusion planning was performed. The three-dimensional treatment planning system iplanRT\u00ae was used. Gross tumor volume (GTV) was defined as the area of contrast enhancement on T1-weighted MRI images, the PTV included a 2\u00a0mm isotropic safety margin. The dose was prescribed to the 80% isodose at the PTV margin.\u03b1/\u03b2-ratio.The biologically effective dose (BED) was calculated according to the following formula, where n is the number of fractions and d the dose per fraction. Following the Linear quadratic model, a value of 10 was used for the p-value of less than 0.05 was considered statistically significant. A p-value of less than 0.1 was considered a trend and was the criterion for the inclusion in multivariable analysis. All statistical analyses were performed using IBM SPSS Statistics 19 .OS was calculated starting with the first day of irradiation and estimated using Kaplan-Meier method. Subgroups were compared using the log-rank test for univariable analysis and the Cox proportional hazard model for multivariable analysis. A Patient characteristics are summarized in detail in Table\u00a010 was 91.1\u00a0Gy (39-91.1\u00a0Gy).Almost half of the patients (43.8%) were treated for a single brain metastasis. Median cumulative lesion volume was 2.47 ccm (0.02-41.68 ccm). Median BEDOf patients alive at last follow-up, median follow-up time was 7.06\u00a0months;OS rate was 58.2% after 6\u00a0months and 29.5% after 12\u00a0months.Univariable and multivariable analysis of prognostic factors is shown in Table\u00a0In multivariable analysis KPS, single BM and non-NM histology were significant prognostic factors.p-value was seen for the DS-GPA. while the RADES gave a poor result. However, none of the four indices gave a full set of non-intersecting survival curves for the respective subgroups  use the KPS. A significant predictor in univariable and multivariable analysis of survival in our cohort.The number of BM was a significant predictor in our univariable and multivariable analysis and is used in the two indices with the best prognostic value (the GPA and the DS-GPA). The GGS does not use this factor but still gives significant prognostic values. The RADES uses the number of BM but fails to give significant prognostic values. Likhacheva et al.  were theThe factor age was not significant in univariable or multivariable analysis in our cohort. Of the examined indices all but the DS-GPA use the factor age for calculation. Another factor not significant in our cohort was ECM. This factor is used in the GGS, GPA and the RADES index.The interval from diagnosis to radiotherapy is used in the RADES index. In our analysis we did not identify this factor as significant neither in univariable nor in multivariable analysis.One factor we did find to be of significant value both in univariable and multivariable analysis was NM histologic subtype, a factor which has not been used before in any of the other examined indices. The primary tumor in NM tumors normally presents with greater thickness than other subtypes of melanoma and therefore metastasizes earlier than other histologic subtypes . HoweverLooking at the original publications by Sperduto, Rades and Golden, it must be remembered that the patient cohort analyzed here is much more homogeneous in terms of treatment than in the original works. We excluded all patients that had received WBRT or MBM resection as primary BM treatment \u201314.The fact that the DS-GPA gave the best results can be explained by the fact, that it solely relies on the two most significant predictors of OS in our multivariable analysis: KPS and number of BM. The fact that patients are grouped in four classes in the DS-GPA instead of three classes like the GPA and the RADES makes the DS-GPA even more outstanding.n\u00a0=\u2009132) or craniotomy (n\u00a0=\u200965) earlier. The authors compared the recursive partitioning analysis (RPA), the Score Index for Radiosurgery (SIR), the Basic Score for Brain Metastases (BSBM), and the DS-GPA. The authors found the DS-GPA to be the most proved most balanced and prognostic [Kano et al. compared 4 prognostic indices in a cohort of 422 patients who had been treated with Gamma Knife SRS for melanoma BM. The patient cohort included patients who had received WBRT (ognostic .The limitations of this study should also be mentioned. Firstly, the retrospective nature of the analysis is prone to bias. Secondly, the number of patients may have been too low to find significance of some potential prognostic factors or even of the RADES index itself. Thirdly different regimes of systemic therapy may represent a potential bias.Several authors have developed prognostic indices for BM and MBM patients, the ideal index has not been defined yet and further research into alternative approaches is needed. Of the indices examined here, the DS-GPA gave the best results in our analysis in this patient cohort with MBM treated with SRT. Apart from showing the best result in our analysis the DS-GPA is also the easiest index to calculate examined in this work. Our results indicate that the histologic subtype NM might improve the prognostic value of MBM-specific indices."}
+{"text": "Beta vulgaris L. spp. vulgaris) known as beetroot, is a rich source of betalains, which major forms are betanin (red to purple) and vulgaxanthin (yellow). Betalains and phenolic compounds are secondary metabolites, accumulation of which is often triggered by elicitors during plant stress responses. In the present study, pre-harvest applications of ethephon (an ethylene-releasing compound) and postharvest UV-B radiation were tested as elicitors of betalains and phenolic compounds in two beetroot cultivars. Their effects on quality parameters were investigated, and the expression of biosynthetic betalain genes in response to ethephon was determined.Betanins have become excellent replacers for artificial red-purple food colourants. Red beet , determining the formation of both betanin and vulgaxanthin, increased in response to ethephon treatment, as did the expression of the betalain pathway activator BvMYB1. In the postharvest environment, the use of short-term UV-B radiation (1.23\u2009kJ\u2009m\u2212\u20092) followed by storages for 3 and 7\u2009days at 15\u2009\u00b0C resulted in increased betanin to vulgaxanthin ratio (51%) and phenolic content (15%).Ethephon was applied as foliar spray during the growth of beetroot, resulting in increased betanin (22.5%) and decreased soluble solids contents (9.4%), without detrimental effects on beetroot yield. The most rapid accumulation rate for betanin and soluble solids was observed between 3 and 6\u2009weeks after sowing in both untreated and ethephon-treated beetroots. Overall, the expression of the betalain biosynthetic genes (The results of this study provide novel strategies to improve key profitability traits in betalain production. High betanin concentration and high betanin to vulgaxanthin ratio increase the commercial value of the colourant product. In addition, lowering soluble solids levels facilitates higher concentration of beetroot colour during processing. Moreover, we show that enhanced betanin content in ethephon-treated beetroots is linked to increased expression of betalain biosynthetic genes. Beta vulgaris L. ssp. vulgaris), known as beetroot. Nowadays, beetroot colourants are widely used in dairy products, frozen desserts and meat [Over the past 20\u2009years, the market of natural food colours has grown substantially owing to legal restrictions and consumer concerns , 2. Currand meat .Beetroot colourants are commercialised as either juice concentrate  or dehydrated powder. In addition to the lower stability of natural pigments, the main constrains to extraction and use of beetroot concentrates as food colourants are the relatively low concentration of betalain in root juice and the high content of sugars. Since sugar contents are 80 to 200 times higher than betalain contents in the root, lowering soluble solids levels in the red beet would facilitate concentration of beetroot colour during processing, increasing the commercial value of the product , 5. CompBetalains comprise two groups of water-soluble pigments: the red\u2013purple betacyanidins and the yellow betaxanthins. Betacyanidins are conjugates of cyclo-DOPA and betalamic acid, and betaxanthins are conjugates of amines or amino acids and betalamic acid. Betacyanidins are normally glycosylated, in which case they are called betacyanins. In mature beetroots, red\u2013purple betacyanins comprise the major part of pigments, and of these a single compound, betanin, comprises 75\u201395%. Yellow betaxanthins account for a minor part of beetroot pigments, vulgaxanthin I being the most abundant form , 9. BetaBetalains account for 70\u2013100% of the total phenolic content of beetroot . Other pBetalains and phenolic compounds are secondary metabolites, and their accumulation can be affected by abiotic factors or stressors from the environment. To our knowledge, there are no studies reporting increased betalain content by the use of elicitors in red beet plants in vivo. Recently, the betalain biosynthetic pathway of beetroot has been fully elucidated , 17. HowIn the present study, ethephon and UV-B radiation were used in pre- and postharvest environments, respectively, as enhancers of betalain content. Ethephon, an ethylene-generating compound, was applied as foliar spray during the growth of red beet. In this respect, preharvest application of ethephon has been reported previously to increase pigmentation in orange and black carrots , 19. In Red beet \u2018Monty Rz\u2019 and \u2018Belushi Rz\u2019 were selected based on their high betanin content from a previous screening on 16\u2009weeks-old beetroots of 15 commercial varieties . Seeds were provided by Rijk Zwaan , and the two cultivars were used in both field and postharvest experiments.\u2212\u20091 active ingredient were performed as described previously [Field trials were conducted at the University of Copenhagen, Hoejbakkegaard (Denmark) in 2015, in accordance with local legislation and international guidelines. Three-row plots were arranged in randomised block designs with three replicates. Small plots (4.5\u2009m-long rows) were harvested a single time, whereas large plots (12\u2009m-long rows) were harvested multiple times form distant row segments. Foliar applications of ethephon  at a concentration of 360\u2009g\u2009haeviously . Ethepho\u2212\u20092, corresponding to a UV-B radiation fluence rate of 17.5\u2009W\u2009m\u2212\u20092 for 70\u2009s. The whole root surface was exposed by turning the beetroot at the middle of the treatment (35\u2009s). UV-B radiation was measured using a RM-12 Ultraviolet Light Meter equipped with a UVB sensor . After the UV-B radiation treatment, beetroots were stored at 15\u2009\u00b0C and 98\u2013100% relative humidity (RH) in darkness, for 3 and 7\u2009days. Each treatment included five biological replicates each consisting of eight beetroots.Beetroots of \u2018Monty Rz\u2019 and \u2018Belushi Rz\u2019 not subjected to previous field treatment were harvested on 22 May 2015, topped, and stored at 4\u2009\u00b0C to be treated the following day. At time zero, beetroots were placed at a distance of 60\u2009cm from the UV-B lamps  and irradiated with a UV-B radiation fluence of 1.23\u2009kJ\u2009mw/w) and subsequently mixed with milliQ water or 70% ethanol as described [At harvest, biological replicates consisting of twenty beetroots (field experiment) or eight beetroots (postharvest experiment) were washed and cut in halves. Of these, one pool of halves were homogenised in a 3% sulfuric acid solution , and the absorption was measured at 476\u2009nm and 538\u2009nm for Bn and Vx, respectively, by means of a UV-visible spectrophotometer . Bn and Vx concentrations were expressed in mg kg\u2212\u20091 of root fresh weight (FW), using the corresponding absorbance, molecular weight and extinction coefficient for Bn and Vx.Bn and Vx were measured spectrophotometrically as described previously  with sliw/v) sodium carbonate. The samples were thereafter incubated for 2\u2009h in the dark, and the absorbance of the mix was determined at 760\u2009nm using a UV-visible spectrophotometer (Thermo Scientific Evolution\u2122 220). Based on the measured absorbance, the TPC mg of gallic acid equivalent (GAE) per kg of fresh weight was deduced from the calibration curve.TPC was calculated according to the Folin\u2013Ciocalteau method . BrieflyOne mL of beetroot extract was filtered through 0.45\u2009\u03bcm membrane filters, and TSS was subsequently measured with a manual refractometer in the 0 to 85% Brix range  operating.DM was determined after samples were dried to a constant weight at 100\u2009\u00b0C for 24\u2009h, based on the difference in mass between the fresh and dry samples. DM was then expressed as a percentage of the dry matter.Total RNA was extracted from ground beetroots with RNeasy\u00ae Plant Mini Kit  and then treated with DNase I Amplification Grade  according to the manufacturers\u2019 instructions, to eliminate residual DNA. Agarose gel electrophoresis and a NanoDrop\u2122 1000 Spectrophotometer  were used to evaluated RNA quality and integrity. Two micrograms of RNA from each sample were utilised to synthesise cDNA in a 20\u2009\u03bcl reaction volume using the cDNA iScript\u2122 Synthesis Kit  according to the manufacturer\u2019s instructions.Actin, CYP76AD1, CYP76AD5, CYP76AD6, DODA1, and MYB1 were designed using Primer3 online software and assessed prior to use. The RT-qPCR reactions were conducted as described previously [BvActin Ct (\u0394Ct) [To assess the expression levels of genes involved in betalain biosynthesis in response to ethephon, primers specific for eviously , and theeviously . Primer Ct (\u0394Ct) . Nucleotp\u2009\u2264\u20090.05 was considered to indicate statistical significance.At least three biological replicates were utilised, and data were subjected to statistical analysis using the R 3.0.0 statistical package . Data from the accumulation curves were analysed with the lmer function of the lme4 R package . Treatments were compared using one- or two-way analysis of variance (ANOVA) followed by a Tukey post-hoc test. When the assumption of a normal distribution of the data was rejected, data were analysed using the Kruskal-Wallis test followed by a Nemenyi post-hoc test. \u2212\u20091 FW, representing an increase of 25% compared with the values of untreated plants (1872\u2009\u00b1\u2009105 to 1972\u2009\u00b1\u200983\u2009mg\u2009kg\u2212\u20091 FW). Similarly, Bn content in roots of treated plants of \u2018Belushi Rz\u2019 displayed mean values of 1575\u2009\u00b1\u200926 to 1584\u2009\u00b1\u200921\u2009mg\u2009kg\u2212\u20091 FW, whereas the corresponding values in untreated plants ranged from 1240\u2009\u00b1\u200922 to 1418\u2009\u00b1\u200927\u2009mg\u2009kg\u2212\u20091 FW  , followed by a gradual decrease until the end of the growing period , a transitional stage determined by a small decrease in TSS, and a later increase during the last 3\u2009weeks of growth, reaching 18.1 and 17.0 \u00b0Brix in roots of treated plants of \u2018Monty Rz\u2019 and \u2018Belushi Rz\u2019, respectively  and the betalain pathway activator BvMYB1 was quantified in untreated and ethephon-treated beetroots of \u2018Monty Rz\u2019  compared with the levels in untreated plants, whereas the accumulation of BvCYP76AD1 and BvCYP76AD6 was either constitutive or below the levels in untreated plants . The mean DM increased during storage, being significant solely in non UV-B-treated roots (11%) Fig.\u00a0a. In turBeta vulgaris L. ssp. vulgaris cultivars Monty Rz and Belushi Rz  redundantly catalyse the hydroxylation of tyrosine to form L-DOPA  [Remarkably, DODA1, which lead to the formation of betalamic acid, the basic backbone of red and yellow betalain biosynthesis, , 42, reanthesis) , 17, theIn the second part of this study, we showed a decrease of Vx content upon short-time storage at 15\u2009\u00b0C and 98\u2013100% RH, whereas Bn content remained unchanged  were reported to enhance phenolic content of sliced carrots [In addition, exposure of beetroots to a UV-B radiation fluence of 1.23\u2009kJ\u2009m carrots . Using t carrots . Since UBvMYB1 transcription factor correlated with that of betalain accumulation. These facts reinforce the existence of common regulatory networks for anthocyanin and betalain synthesis. In the postharvest environment, a low UV-B fluence treatment of the roots, followed by short-time storages for 3 and 7\u2009days resulted in increased TPC and Bn:Vx, without detrimental effects on beetroot quality.In summary, our findings demonstrate that field application of ethephon on \u2018Monty Rz\u2019 and \u2018Belushi Rz\u2019 beetroots results in increased betanin per unit of biomass and betanin to vulgaxanthin ratio, and decreased TSS. Furthermore, the patterns of expression of betalain biosynthetic genes and the BvMYB1.Field-applied ethephon and postharvest UV-B radiation improved quality of beetroot by increasing betanin to vulgaxanthin ratio, betanin and phenolic contents, and decreasing soluble solids content. Betanin content in ethephon-treated beetroots correlated to increased expression of betalain biosynthetic genes and the betalain pathway activator"}
+{"text": "Lignin, while economically and environmentally beneficial, has had limited success in use in reinforcing carbon fibers due to harmful chemicals used in biomass pretreatment along with the limited physical interactions between lignin and polyacrylonitrile (PAN) during the spinning process. The focus of this study is to use lignin obtained from chemical-free oxidative biomass pretreatment (WEx) for blending with PAN at melt spinning conditions to produce carbon fiber precursors. In this study, the dynamic rheology of blending PAN with biorefinery lignin obtained from the WEx process is investigated with the addition of 1-butyl-3-methylimidazolium chloride as a plasticizer to address the current barriers of developing PAN/lignin carbon fiber precursors in the melt-spinning process. Lignin was esterified using butyric anhydride to reduce its hydrophilicity and to enhance its interactions with PAN. The studies indicate that butyration of the lignin (BL) increased non-Newtonian behavior and decreased thermo-reversibility of blends. The slope of the Han plot was found to be around 1.47 for PAN at 150 \u00b0C and decreased with increasing lignin concentrations as well as temperature. However, these blends were found to have higher elasticity and solution yield stress (47.6 Pa at 20%wt BL and 190 \u00b0C) when compared to pure PAN (5.8 Pa at 190 \u00b0C). The results from this study are significant for understanding lignin\u2013PAN interactions during melt spinning for lower-cost carbon fibers. Significant improvements have been made in blending lignin into different polymers in order to reduce cost, increase biodegradability, or to produce specific properties of importance for the applications of the specific polymer. Lignin is the second most abundant renewable resource after cellulose in the terrestrial ecosystem and is typically available as a by-product from wood pulping and cellulosic biorefineries. Several polymer/lignin blends have been reviewed, related especially to their self-interactions, interactions with the polymer, and their effect on the properties of the final product ,2. TheseThe unique properties of high strength and modulus, low density, excellent creep, and chemical resistance make carbon fiber an emerging material for manufacturing advanced composites which have application for the automotive, aerospace, windmill, and sporting goods industries . HoweverLignin is a promising candidate for producing carbon fibers because of its carbon-rich aromatic chemical structure and low cost. Extensive research efforts have been invested in manufacturing carbon fibers with 100% lignin  as the primary carbon source . HoweverRecently, it was proposed that blending (or in-mixing) of lignin with polymers such as polyacrylonitrile (PAN) can overcome some of these problems and also reduce the overall processing cost of carbon fibers. Several studies have been done using low-temperature spinning techniques such as solution spinning  and elecHowever, direct melt-spinning of lignin/PAN blends is challenging primarily due to the high melting point of around 300 \u00b0C for PAN, and PAN begins to undergo decomposition at these temperatures. Also, at temperatures around 220 \u00b0C, PAN undergoes a series of complex intra- and inter-molecular cyclization reactions primarily due to its C\u2261N groups preventing thermoplastic fabrication and resulting in a non-conformational rheology at melt spinning conditions, thereby requiring internal or external plasticization . InternaExternal plasticization can also be used to decouple the nitrile\u2013nitrile interactions resulting in a lowering of the polymer softening point below its decomposition temperature and making a pseudo-melt spinning process. Some of the commonly used plasticizers include water, dimethyl formamide, ethanol, and acetonitrile, or a mixture of them . These sO\u20134-linkages in the proto-lignin structure, resulting in the onset of complex condensation processes that resulted in weaker interactions with polymers and eventually the lower tensile strength of the final product Cl was measured as a function of angular frequency at different temperatures and shown in g) and melting temperature (Tm) Cl, 1-methylimidazole (1-MI), and butyric anhydride were obtained from Sigma-Aldrich . Biorefinery lignin was provided by CleanVantage LLC.  and was obtained after wet explosion pretreatment and enzymatic hydrolysis of poplar (Populus) sanders dust. The biomass was converted into sugars, resulting in a by-product stream, the biorefinery lignin, which was washed in water and ethanol.Polyacrylonitrile-N-methylimidazole as catalyst was added to 10 g of lignin along with 75 mL of butyric anhydride and reacted at 65 \u00b0C in a round bottom flask. The mixture was stirred 24 h under reflux, and Deionized (DI) water was added to quench the reaction. After natural cooling to room temperature, the precipitated lignin was vacuum-filtrated and washed three to five times with 500 mL DI water to remove catalyst and free acid. The modified lignin was then freeze-dried for at least 3 days. The dried lignin powder was stored in a desiccator before use.Biorefinery lignin was esterified using a modified butyration method . In this13C cross polarization-magic angle spinning (CP/MAS) NMR analysis has been previously used Cl as external plasticizer has been previously described . The wei\u22121 to 10 s\u22121 at a temperature of 180 \u00b0C. This was done to demonstrate the equivalence between the steady and the dynamic shear viscosities.Rheological characterization of all melt-spun samples was conducted using Discovery Hybrid Rheometer  in parallel plate geometry, with a 25-mm plate on top and Peltier plate on the bottom with a 500-\u03bcm gap size in between. In one set of experiments, isochronal temperature scans of polymer melts were performed at 1 rad/s. The Peltier plate was maintained at 150 \u00b0C before loading the samples. A thin layer of silicone oil was applied to cover the exposed surface of polymer melt to prevent moisture absorption after the polymer samples were loaded between the parallel plates. Ten minutes after loading the samples , samples were heated to 200 \u00b0C, followed by cooling down from 200 \u00b0C to 150 \u00b0C. The heating and cooling rates were controlled at 2 \u00b0C/min, and the rheological data were continuously collected. In the second set of experiments, dynamic frequency sweep measurements from 0.1 to 100 rad/s were conducted at a temperature range of 150 \u00b0C to 200 \u00b0C, with an increment of 10 \u00b0C. The temperature range was chosen to provide an understanding of polymer melts during expected fiber processing window, which is below the initial degradation temperature of PAN polymer at around 220 \u00b0C. In the third set of experiments, steady-state shear rheology was determined under a shear rate from 0.01 sThe thermal melting behavior of PAN and PAN-lignin blends in [BMIM]Cl was evaluated using a differential scanning calorimeter . Approximately 5\u201310 mg of the pure or blended samples were heated from 30 to 220 \u00b0C at a heating rate of 10 \u00b0C/min under a nitrogen atmosphere with a purge flow of 50 mL/min. The DSC parameters of the endotherms, including initiation temperature, final temperature, and peak temperature were obtained and analyzed using Proteus software .These studies have shown significant evidence for polymeric entanglements and intermolecular interactions with an increase in the concentration of butyrated lignin in PAN at melt spinning temperatures. It was also found that, while an increase in BL resulted in increased yield stress at different temperatures, the optimal melt spinning temperatures varied with varying BL concentration primarily to maintain good thermo-reversibility and pseudo-plastic behavior during heating and cooling zones. Furthermore, melt spinning PAN-BL blends above the predicted gel points can result in significant decreases in the homogeneity of the fibers and most likely, mechanical properties of any carbon fiber product. The presence of BL also had an effect on the cyclization reactions between PAN and [BMIM]Cl, resulting in a deviation of linearity in the solution activation energy model that has been previously observed for PAN in [BMIM]Cl. Further studies on the chemical interactions between the modified (butyrated) biorefinery lignin with the PAN-[BMIM]Cl solution using techniques such as FTIR  and NMR"}
+{"text": "Oxidative stress is a risk for and cause of various disease, however, measurements of oxidative stress are either time-consuming or non-specific. Here, we established a rapid method of using high performance liquid chromatography (HPLC) to measure serum oxidized albumin in a rat model. We optimized HPLC conditions for rat oxidized albumin. To validate our method, three-week-old male Sprague-Dawley rats were uninephrectomized and treated normal diet, high salt diet or high salt diet with Tempol, a superoxide dismutase (SOD) mimetic. After 4 weeks of treatment, we analyzed serum oxidized albumin. The main findings are listed as below. (i) Our method of oxidized albumin measurement only takes 16\u2009minutes, with an intra-day and inter-day deviation within 1% and a detection limit concentration of 6.4\u2009mg/ml. (ii) Oxidized albumin levels were significantly higher in the high salt diet group than in the normal salt diet group, and this effect was reversed by Tempol. (iii) Oxidized albumin levels also correlated with urinary protein and 8-isoprostane levels. In conclusion, we have established a simple method for evaluating rat serum oxidized albumin using HPLC. Our method is rapid and has an advantage over conventional methods and may be useful for animal models of oxidative stress. To measure oxidative stress levels, many biomarkers has been used, such as 8-isoprostane, malondialdehyde (MDA), nitrotyrosine levels, and serum antioxidant capacity. Each of them has distinct characteristics, but does not necessarily reflect a ubiquitous oxidative stress level. To overcome these problems, we and others have investigated the levels of the oxidized form of albumin as a new marker of oxidative stress9. Albumin is a mixture of reduced albumin  and oxidized albumin  in extracellular fluid such as serum. Reduced albumin has one free sulfhydryl group in Cys-34, while oxidized albumin has a ligand bound to the sulfhydryl group in Cys-349. Reduced albumin is bound with its mixed disulphide with cysteine or glutathione8. Oxidized albumin has more oxidized products such as sulfenic (-SOH), sulfinic (-SO2H) or sulfonic (-SO3H) states9.Oxidative stress has elicited high levels of interest in the field of biology for a long time. It has been reported that oxidative stress plays pivotal roles in a variety of disease conditions as well as in aging8. Hayashi T et al. has developed a method by HPLC which can separate both reduced and oxidize albumin in rat serum9. However, Hayashi\u2019s method takes about one hour to measure one sample in room temperature. Here, we established a simple and rapid method for measuring oxidized albumin in rat serum. We validated this method by using an established rat model of high oxidative stress which also demonstrated proteinuria and hypertension12.A former study reported that oxidized rat serum albumin cannot be clearly separated from reduced albumin by conventional HPLC methodBy systematically screening of measurement conditions, we eventually determined the optimal condition for measuring rat oxidized and reduced albumin: 25\u2009mM phosphoric acid buffer with 60\u2009mM sodium sulfate, plus 1.5% ethanol  and 1000\u2009mM magnesium chloride (solution II). After balancing the column, the flow rate was set to 1\u2009ml/min. The oven temperature was set to 40\u2009\u00b0C, and the samples volume was 3 microliters. The whole process of the serum analysis lasted for 12\u2009minutes, and the linear gradient was 0\u201365% from solution I to solution II. Thus, only a total time of 16\u2009minutes was needed to analyze one sample . A representative chromatograph is shown in Fig.\u00a0The reproducibility of our analysis method is summarized in Supplemental Table\u00a0Our result showed that 20\u2009minutes of incubation at room temperature caused a significant increase in the percentage of oxidized albumin in a sample, and that the oxidation of albumin is time-dependent Fig.\u00a0. We nameWe also conducted an \u201cinterference evaluation\u201d study. In brief, we used commercially available oxidized albumin standards to calculate the percentage of oxidized albumin, and demonstrated a positive correlation between standard albumin/total albumin and oxidized albumin Fig.\u00a0.10. As expected, high salt-loading resulted in significantly higher systolic blood pressure (176.1\u2009\u00b1\u200934.6\u2009mmHg) in rats with uninephrectomy (UNx) compared to normal salt treated UNx rats (126.4\u2009\u00b1\u20099.4\u2009mmHg), and additional Tempol in drinking water attenuated high salt loading-induced elevation in systolic blood pressure (140.4\u2009\u00b1\u200915.0\u2009mmHg) in rats  than that from normal salt diet group (8.59\u2009\u00b1\u20098.95\u2009mg/day), and after treatment with Tempol, the effect of high salt diet on urinary protein was abolished (4.82\u2009\u00b1\u20095.29\u2009mg /day) Fig.\u00a0.Serum oxidized albumin in high salt diet group (35.43%\u2009\u00b1\u20094.39%) was significantly higher compared to that from normal salt diet group, and Tempol significantly reversed this effect of high salt loading (26.98%\u2009\u00b1\u20092.19%) Fig.\u00a0.15, the 8-isoprostane level in high salt diet group (36.7\u2009\u00b1\u200945.9\u2009ng/day) was significantly higher than that in normal salt diet group (10.5\u2009\u00b1\u20097.4\u2009ng/day), and Tempol reversed this effect (11.0\u2009\u00b1\u200916.6\u2009ng/day)  Fig.\u00a0.There are positive correlations between oxidized albumin% and both proteinuria Fig.\u00a0 and 8-isIn the present study, we described a simple, adapted method for the measurement of rat oxidized albumin. The total time taken to measure oxidized albumin with our method was only a short 16\u2009minutes, with an intra-day and inter-day deviation within 1% and a detection limit at a concentration of 6.4\u2009mg/ml. Our method is sensitive and rapid, and has an advantage over conventional methods and may be useful for future studies of animal models of oxidative stress.9.The gradual increase in oxidized albumin in the intra-day reproducibility analysis may resulted from auto-oxidation. Our experiments have shown that auto-oxidation occurs as quickly as 20\u2009minutes, making it necessary to measure the samples over a short period of time. The total time taken to analyze a sample using our method is as short as 16\u2009minutes (column equilibrating time included). Our method is rapid and capable of separating peaks clearer than former reports18.These two states of oxidized albumin may represent different pathophysiology19. In our model, the new method has not shown separation of these two peaks. Further research in different model should be conducted.For the peaks to be sharp and be clearly separated, we needed optimal concentrations of magnesium chloride and ethanol. The acidity of the solutions are also important when combining solutions I and II, whereby the acidic II solution was added gradually to solution I to obtain an optimized linear gradient. The pH values of solution I are 6.0 and 5.3 in the human and rat, respectively, which is due to the isoelectric point difference between humans and rats. Both the ion-exchange and hydrophilic interaction of the resin can contribute to the separation of oxidized albumin and reduced albumin by the column, which is further enhanced by varying magnesium concentration and the pH of solution I. It is also noteworthy that there are also limitations of our method. It is reported that both in human and rat cases, oxidized albumin is the mixture of NA-1 and NA-2For the interference study, we did an \u201cinterference evaluation\u201d. As standard oxidized albumin (100% oxidized) increased by 8%, the percentage of oxidized albumin increased by 7.42% (AVE). There is a positive correlation between the percentage of standard albumin/total albumin and oxidation albumin. Our result showed that our method for measuring oxidized albumin closely reflect the actual amount of standard albumin. Based on the intra-day and inter-day reproducibility, the method was sensitive enough to measure rat oxidized albumin at a concentration as low as 6.4\u2009mg/ml.21 and animal models26. In vitro studies have also shown that oxidized albumin itself is toxic27. Previous animal study has also shown oxidative changes in the blood and serum albumin in rats with monoarthritis and polyarthritis28. To validate our method, we utilized an established rat model of high in oxidative stress which is associated with proteinuria and hypertension10. The results from our study showed that the percentage of oxidized albumin was significantly higher in the disease model than in the control group and that this change was reversed by the anti-oxidant drug Tempol. These results were consistent with human renal function data29. To further confirm our results, we have compared serum oxidized albumin with urinary 8-isoprostane levels, which is a commonly used marker to indicate the oxidative stress. The high salt group also showed a significantly higher 8-isoprostane level than the other two groups, and it positively correlated with our measurement of serum oxidized albumin. These findings suggest that our method of measuring oxidized albumin is in accordance with the currently using marker 8-isoprostane and has the potential to be applied to other disease models. Our correlation data between oxidized albumin and urinary protein also suggests that measured oxidized albumin may be a better marker for oxidative stress-related organ damage.Previous reports have shown that many diseases are associated with high oxidative stress levels in both humans30, which is found in cell membrane phospholipids and is a target of reactive oxygen species31, whilst urinary protein is a representative marker to evaluate renal damage32 and reflects glomerular damage. A previous report shows that 8-isoprostane is not a prerequisite for renal damage33. Taken together, oxidized albumin is a useful marker for oxidative stress-induced kidney disease, and appear to be an advanced marker compared to 8-isoprostane. A reduction in the percentage of oxidized albumin may also be a target for the prevention of renal diseases.8-Isoprostane is formed by the peroxidation of arachidonic acidIn conclusion, we have established a simple and rapid method for measuring oxidative stress levels with oxidized albumin. We validated this method by using an established rat model of proteinuria and hypertension which demonstrate high levels of oxidized albumin and 8-isoprostane. Our method is sensitive and rapid, and has an advantage over conventional methods and may be useful for future studies of animal models of oxidative stress.Three-week-old male Sprague Dawley (SD) rats (body weights ranging from 40\u2009g to 50\u2009g) were subjected to left uninephrectomy and then randomly divided into the following 3 groups: the normal salt diet ; high salt diet  and high salt diet treated with a superoxide-dismutase mimetic, namely, 4-hydroxy-2,2,6,6-tetramethyl-piperidine-N-oxyl, also known as Tempol . After 4 weeks of treatment, blood samples were collected by cardiac puncture.Rats were maintained in a humidity- (60\u2009\u00b1\u20095%), temperature- (23\u2009\u00b1\u20091.5\u2009\u00b0C), and light cycle-regulated (0700\u20131900 h) room and had free access to food and drinking water. Reasearch Ethics Committee of the University of Tokyo approved this investigation (No:P14\u2013145), which was conducted according to the guidelines for the care and use of laboratory animals of the University of Tokyo, Graduate School of Medicine.Body weight and systolic blood pressure (SBP) were measured prior to sacrifice. SBP was measured using the tail-cuff method . Twenty-four-hour urine samples were collected at the end of the 4-week treatment using metabolic cages to measure both the urinary protein and the 8-isoprostane levels.The HPLC system  comprised of a degasser (DGU20A3R), two pumps (LC-20AT), an autosampler (SIL30AC), a thermostatic oven (CTO-20AC), a fluorescence detector (RF-20Axs) and a system controller (CBM-20 A).The polyvinyl alcohol cross-linked gel (9\u2009\u00b5m in diameter)  which was dried in a vacuum for more than 16\u2009hours was then suspended in 10\u2009ml of dimethyl sulfoxide  per gram of the dried gel. Next, to suspend the gel, 20\u2009mmol of epichlorohydrin were added to per gram of the dried gel for 20\u2009hours at 30\u2009\u00b0C. The activated gel was then filtrated, followed by an addition of 10% aqueous solution of diethyl amine  for another 20\u2009hours. Finally, the gel was packed in a stainless column (50\u2009\u00d7\u20097.6\u2009mm I.D.). By using the above prepared column which is of high resolution and anion exchanged, the analysis condition to separate rat reduced albumin and oxidized albumin was screened by optimizing the factors\u2014buffers, pH value, ethanol concentration, flow rate, the linear gradient of magnesium concentration, oven temperature and sample volume.All of the reagents were either HPLC grade or a special grade .35.The fluorescence detection wavelengths were 280\u2009nm and 340\u2009nm. Two eluent buffers contained 60\u2009mM sodium sulfate and 25\u2009mM phosphoric acid buffer. Three microliters of serum or plasma samples was directly injected into the system. The flow rate was 1\u2009ml/min, and the analytical temperature was 40\u2009\u00b0C. The peaks for reduced albumin and oxidized albumin were then confirmed. Based on the peak areas, the results were expressed as Oxidized albumin%\u2009=\u2009Oxidized albumin/\u2009\u00d7\u2009100%The intra-day reproducibility was checked 10 times continuously in one day, and inter-day reproducibility was checked on 10 continuous days.To study the detection limit of rat oxidized albumin in our method, we used serum samples from healthy rats and diluted them with PBS. Oxidized albumin level was measured as described above.To investigate the time-dependent auto-oxidation of albumin at room temperature, we measured control samples of serum albumin every 20\u2009minutes for a total 120\u2009minutes.We added standard albumin . Briefly, the plate was incubated with the sample at room temperature on a plate shaker at 120\u2009rpm for 120\u2009minutes and then washed 5 times using washing solution. After incubating at room temperature with a solution of p-nitrophenyl phosphate in buffer for 45\u2009minutes without shaking and adding stop solution, the optical density was measured at 420\u2009nm. The concentration of 8-isoprostane was calculated. Urine samples and standard samples were all run in duplicate.Data are expressed as the mean\u2009\u00b1\u2009SEM. All urinary protein levels were logarithmically transformed prior to statistical analysis by ANOVA with Tukey\u2019s post hoc test because they had a heteroscedastic distribution. Statistical analysis among the 3 groups was performed by one-way ANOVA followed by Tukey\u2019s test. The receiver operating characteristic (ROC) curve for oxidized albumin and 8-isoprostane was drawn to compare the diagnostic value. P\u2009<\u20090.05 was considered to be statistically significant.Supplemental information"}
+{"text": "Hepatic dysfunction and coagulopathy are common in acute dengue illness. We analyzed the trajectories of the above parameters in the survivors and fatal patients in the outbreak in Tainan, 2015.A retrospective study was conducted using data from a tertiary hospital between January and December 2015. Multilevel modeling (MLM) was used to identify the changes in aminotransferase (AST), alanine aminotransferase (ALT), activated partial thromboplastin time (aPTT), and platelet counts from Day 0 to Day 7 of the onset of dengue infection. The machine-learning algorithm was used by purity measure assumption to calculate the accuracy of serum transaminases and coagulation variables to discriminate between the fatal and survival groups.i.e., early mortality). Case fatality rate was the highest for those aged \u226570 years. Both AST and ALT values of the fatal group were significantly higher than those of the survivor group from Day 3  of illness onset and peaked on Day 6 . AST \u2265 203 U/L, ALT \u2265 55 U/L, AST2/ALT criteria \u2265337.35, or AST/platelet count ratio index (APRI) \u2265 19.18 on Day 3 of dengue infection had a high true positive rate, 90%, 78%, 100%, or 100%, respectively, of early mortality. The platelet counts of the fatal group declined significantly than those of the survivor group since Day 3 of illness onset , and aPTT values of the fatal group significantly prolonged longer since Day 5 .There were 4,069 dengue patients, of which 0.9% died in one week after illness onset  is currently one of the most severe public health problems. Clinical presentations of dengue are diverse and non-specific, often with unpredictable clinical progression and outcome. Hepatic dysfunction and abnormal coagulation factors are common in acute dengue illness, reflected by abnormal alanine aminotransferase (AST), aspartate aminotransferase (ALT), activated partial thromboplastin time (aPTT), and platelet counts. However, there is no information available about the monitoring frequency required, which could help identify those dengue patients who are likely to die, especially during epidemic outbreaks with limited healthcare resources. We examined all the laboratory-confirmed dengue patients who admitted to the major tertiary hospital in Tainan during the 2015 dengue outbreak, and the different trajectories of hepatic function and coagulation factors between survivors and rapidly fatal dengue patients were analyzed. Although there were no differences in AST, ALT, aPTT, and platelet counts between the survivor and fatal groups on the day DF symptoms first appeared, the differences increased from the early stages of infection and became more prominent during the early stages of the illness. The necessity of monitoring the AST, ALT, aPTT, and platelet count frequently during the febrile phase is emphasized by this study. Dengue incidence has risen 30-fold in the past fifty years globally, with the South-East Asia and Western Pacific Regions being the most affected regions with an approximately 1% fatality rate . Among tHepatic dysfunction and abnormal coagulation are common during the acute stage of dengue infection. About 61%\u201396% of dengue patients have elevated liver enzyme levels of aspartate aminotransferase (AST) and alanine transaminase (ALT), which peak at around day 7 of the onset of the illness , 6, whilLimited studies have included the involvement of liver function and coagulation factors in their data collection. The investigators in Vietnam  determinThis study analyzed the trajectories of hepatic function and coagulation factors between survivors and fatal dengue patients who were treated at a tertiary hospital during the 2015 outbreak in Tainan. Our research findings provide supportive evidence that the frequent assessment of hepatic and coagulation markers can help to identify the patients with higher risk to be rapidly fatal.The study protocol was approved by the Institutional Review Board (IRB), National Cheng Kung University Hospital (NCKUH) (A-ER-104-386). The IRB waived the need for informed consent, and all data analyzed were anonymized.A retrospective study was conducted using 20,213 laboratory test results from 4,069 patients who were diagnosed with DF at NCKUH, a major tertiary hospital in Tainan city, between January and December 2015. Only those dengue patients who had at least one of the following WHO laboratory diagnosis criteria confirmed by Taiwan Centers of Disease Control (Taiwan CDC) were enrolled in this study: (1) viral isolation and serotype identification; (2) a positive reverse transcriptase-polymerase chain reaction (RT-PCR) ; (3) a positive nonstructural antigen 1 (NS1) reaction; (4) a positive enzyme-linked immunosorbent assay for specific immunoglobulin M (IgM) or IgG antibodies for dengue virus in their blood serum during the acute phases; (5) IgM seroconversion in paired sera or IgG seroconversion in paired sera or fourfold IgG titer increase in paired sera during the acute phases and convalescent stage , 23. SerAll DF patients were divided into two groups according to whether they died within one week after the onset of illness or not . The management of different classification of dengue was evaluated at hospital admission in clinical practice according to the WHO criteria . In thist-test, the Mann\u2013Whitney U test, and the chi-squared test. Multilevel modeling (MLM) was used to identify the values of change in hepatic and coagulation markers from Day 0 to Day 7 for fatal and survivor groups. P-value and 95% confidence interval were considered significant if \u22640.05. MLM accounts for multiple observations of the same dengue patient in the current study, and a multilevel model is needed to determine if mean values of laboratory results vary notably across patients. The intraclass correlation coefficient (ICC) was used to explain a variation in laboratory results occurs across patients. All statistical analysis was conducted by using R Version 3.4.1 .The differences between fatal and survivor groups were examined using 2/ALT, aPTT, and AST/platelet count ratio index (APRI), the proved predictor of severe dengue ) . Of thesp values <0.001) .Panel A and B in  <0.001) . The Maneach day . The levp < 0.001) (p = 0.01)   (Panel C and D of < 0.001) . In addi = 0.01) . The Man< 0.001) . The dif= 0.003) .2/ALT (Panel C), aPTT (Panel D), and APRI (Panel E) in each day among dengue patients. Using AST criteria \u2265 203 U/L on Day 3 of dengue infection to identify mortality within 8 days of DF onset resulted in TPR of 90% and an area under the ROC curve (AUC) of 95%, while ALT criteria \u2265 55 U/L on Day 3 of dengue infection resulted in TPR of 78% and AUC of 83%. When considering both AST and ALT in AST2/ALT criteria \u2265337.35 on Day 3 of dengue infection, the TPR was 100% and AUC was 95% Click here for additional data file.S1 Fig(TIF)Click here for additional data file.S2 Fig(TIF)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file."}
+{"text": "Background: The introduction of the MinION sequencing device by Oxford Nanopore Technologies may greatly accelerate whole genome sequencing. Nanopore sequence data offers great potential forde novo assembly of complex genomes without using other technologies. Furthermore, Nanopore data combined with other sequencing technologies is highly useful for accurate annotation of all genes in the genome. In this manuscript we used nanopore sequencing as a tool to classify yeast strains.Methods: We compared various technical and software developments for the nanopore sequencing protocol, showing that the R9 chemistry is, as predicted, higher in quality than R7.3 chemistry. The R9 chemistry is an essential improvement for assembly of the extremely AT-rich mitochondrial genome. We double corrected assemblies from four different assemblers with PILON and assessed sequence correctness before and after PILON correction with a set of 290 Fungi genes using BUSCO.Results: In this study, we used this new technology to sequence andde novo assemble the genome of a recently isolated ethanologenic yeast strain, and compared the results with those obtained by classical Illumina short read sequencing. This strain was originally namedCandida vartiovaarae (Torulopsis vartiovaarae) based on ribosomal RNA sequencing. We show that the assembly using nanopore data is much more contiguous than the assembly using short read data. We also compared various technical and software developments for the nanopore sequencing protocol, showing that nanopore-derived assemblies provide the highest contiguity.Conclusions: The mitochondrial and chromosomal genome sequences showed that our strain is clearly distinct from other yeast taxons and most closely related to publishedCyberlindnera species. In conclusion, MinION-mediated long read sequencing can be used for high qualityde novo assembly of new eukaryotic microbial genomes. Saccharomyces cerevisiae strains2, non-classical ethanologenic yeasts are also being considered as production organisms4. In particular, aspects concerning the ability to use both C6 and C5 C-sources and feedstock derived inhibitor resistance have been identified as important for the industrial applicability of different production hosts3. In our previous studies we have identified a novel ethanologenic yeast,Wickerhamomyces anomala, as a potential candidate3. Based on this research, a further screen for alternative yeast species was initiated  Here we describe the isolation and genomic characterization of one of these new isolates, which was typed asCandida vartiovaarae based on ribosomal RNA analysis.With the development of robust second generation bioethanol processes, next to the use of highly engineered5. Assembling short read data into large contigs proved to be difficult because the short reads do not contain the information to span repeated structures in the genome. Approaches to sequence the ends of larger fragments partially mitigated this problem6.With the arrival of next generation sequencing and the assemblers that can use this type of sequencing data, whole genome shotgun sequencing of completely novel organisms has become affordable and accessible. As a result, a wealth of genomic information has become available to the scientific community leading to many important discoveries. While generating whole draft genomes has become accessible, these genomes are often fragmented due to the nature of these short read technologies7. Assemblies using this type of data are often more contiguous than assemblies based on short read data9.The new long read platforms from Pacific Biosciences and Oxford Nanopore Technologies made it possible to obtain reads that span many kilobasesCandida vartiovaarae strain. The same DNA was also used to prepare a paired end library for sequencing on the Illumina HiSeq2500. The sequence data were used in various assemblers to obtain the best assemblies.We have employed the Oxford Nanopore Technologies MinION device to sequence genomic DNA from the isolated3, a screening approach was developed to select for potential ethanologens using selective growth on industrial feedstock hydrolysates. Based on this approach, a previously identified microflora from grass silage was screened for growth on different hydrolysates from both woody and cereal residues. From this microflora, a strain was isolated (DDNA#1) after selection on a growth medium consisting of 10% acid-pretreated corn stover hydrolysate, which was shown to be most restrictive in growth due to the presence of relatively high amounts of furanic inhibitors.In our previous researchSaccharomyces cerevisiae S288C using a Qiagen Genomic-tip 100/G column, according to the manufacturer\u2019s instructions.Cells were grown at 30\u00b0C on plates with YNB (without amino acids) medium supplemented with 0.5% glucose. Cells were scraped from plates and resuspended in 5 ml TE. High MW chromosomal DNA was isolated from yeast isolate DDNA#1 andIn order to determine the size of intact chromosomes of DDNA#1, a BioRad CHEF Genomic DNA Plug Kit was used. Briefly, yeast cells were treated with lyticase and the resulting spheroplasts were embedded in low melting point agarose. After incubation with RNase A and Proteinase K, the agarose plugs were thoroughly washed in TE. The DNA in the agarose plugs was separated on a 0.88% agarose gel in 1xTAE buffer on a Bio-Rad CHEF DRII system. The DNA was separated in four subsequent 12 hour runs at 3V/cm; run one and two used a constant switching time of 500 seconds, and in run three and four the switching time increased from 60 seconds to 120 seconds. The gel was afterwards stained with ethidium bromide and imaged.10 v2.2.6 on the Illumina data. From the paired end reads, only the first read was truncated to 100 bp to avoid the lower quality part of the read. The second read was omitted from this analysis to avoid counting overlapping k-mers. Different k-mer sizes were used ranging from k=17 to 23. After converting the k-mer counts into a histogram format, this file was analyzed using the Genomescope11 tool, available athttp://qb.cshl.edu/genomescope/ andhttps://github.com/schatzlab/genomescope.A k-mer count analysis was done using JellyfishSaccharomyces cerevisiae S288C was sheared using a nebulizer (Life Technologies). The sheared DNA was used to make genomic DNA libraries using the Truseq DNA sample preparation kit, according to the manufacturer\u2019s instructions (Illumina Inc.). In the size selection step, a band of 330\u2013350 bp was cut out of the gel to obtain an insert length of ~270 bp. From the resulting libraries, 4.5 million fragments were sequenced in paired end reads with a read length of 150 nt on an Illumina HiSeq2500, according to the manufacturer\u2019s instructions. The HiSeq control software (HCS) and real time analysis (RTA) software, versions were 2.2.38 and 1.18.61, respectively, were used. To ensure data integrity we have visualized read quality distributions with FastQC12 v0.11.7 and merged overlapping paired end reads, including trimming of low quality regions, using flash13 v1.2.11. Only trimmed and merged reads are used as input data for both Spades14 assemblies and assembly polishing.High molecular weight DNA from both DDNA#1 andThe genomic DNA was sequenced using nanopore sequencing technology. First the DNA was sequenced on R7.3 flow cells. Subsequently, multiple R9 and R9.4 flow cells were used to sequence the DNA. For R7.3 sequencing runs, we prepared the library using the SQK-MAP006 kit from Oxford Nanopore Technologies. In short, high molecular weight DNA was sheared with a g-TUBE (Covaris) to an average fragment length of 20 kbp. The sheared DNA was repaired using the FFPE Repair Mix, according to the manufacturer\u2019s instructions (New England Biolabs). After cleaning the DNA with bead extraction, using a ratio of 0.4:1 Ampure XP beads (Beckman Coulter) to DNA, the DNA ends were polished and an A overhang was added with the NEBNext End Prep Module (New England Biolabs). Then, prior to ligation, the DNA was again cleaned by extraction using a ratio of 1:1 Ampure XP beads to DNA. The adaptor and hairpin adapter were ligated using Blunt/TA Ligase Master Mix (New England Biolabs). The final library was prepared by cleaning the ligation mix using MyOne C1 beads (Invitrogen).To prepare 2D libraries for R9 sequencing runs, we used the SQK-NSK007 kit from Oxford Nanopore Technologies. The procedure to prepare a library with this kit is largely the same as with the SQK-MAP006 kit. 1D library preparation was done with the SQK-RAD001 kit from Oxford Nanopore Technologies, which tags high molecular weight DNA using a transposase. The final library was prepared by ligation of the sequencing adapters to the tagmented fragments using the Blunt/TA Ligase Master Mix (New England Biolabs).The prepared libraries were loaded on the MinION flow cell, which was docked on the MinION device. The MinKNOW software (v0.50.2.15 for SQK-MAP006 libraries and v1.0.5 for SQK-NSK007 and SQK-RAD001 libraries) was used to control the sequencing process and the read files were uploaded to the cloud based Metrichor EPI2ME platform for base calling. Base called reads were downloaded in fastq format. We filtered the data to a per read average maximum error-rate distribution of 10% and a minimum of 10 kbp for quality and length, respectively. Only reads that meet these filtering thresholds were used for assemblies and post-assembly error correction.The sequence data from the Illumina platform was assembled using Spades v3.6.0, we performed a two-branch assembly strategy using either exclusively Illumina data or a hybrid approach combining both Illumina and nanopore data sets.15 v1.3, Miniasm16 v0.2, TULIP17 v0.4 and Smartdenovo18 v1.07. These assemblers perform all vs. all alignments on filtered nanopore data to generate the final contigs, with the exception of TULIP, which aligns reads to a set of random 1,000 bp seed sequences comprising 0.5 times the estimated ~12 Mbp genome size. Contigs of all assemblers were post-assembly corrected using Racon19, excluding Canu generated contigs, since Canu contains an integrated self-correction procedure prior to assembly. To obtain optimum sequence correctness the resulting contigs of these four assemblers were polished with Illumina data using PILON20 v1.18 in a double iterative fashion.A set of four different assemblers is used to generate contigs exclusively based on nanopore data, Canuhttp://www.ebi.ac.uk/ena/data/view/PRJEB19912.The sequencing data, including the final assembly, has been submitted to the European Nucleotide Archive and can be accessed at21 v3.0.2. We assessed our nanopore exclusive assemblies both before and after PILON correction using lineage database Fungi 0db9 containing 290 genes. BUSCO genome assembly assessments on Spades contigs correspond to assessments after PILON correction for nanopore derived contigs, since Spades contigs are based on Illumina data and do not require a post-assembly PILON correction. BUSCO identifies genes in genomic assemblies either as partial, single or double copy, or completely absent.As successful sequence polishing plausibly improves the accuracy of gene prediction, we assessed both assembly quality and PILON correction effects using BUSCOet al.22 have constructed a phylogenetic tree. From that phylogenetic tree we have observed that the closest relative for which whole genome sequences are available isCyberlindnera jadinii. To compare our draft genome assembly to this yeast species, we retrieved assemblies of twoCyberlindnera jadinii strains, namely NBRC 0988  and CBS1600 . We also usedSaccharomyce cerevisiae S288C  in this comparison. We aligned those assemblies to the corrected draft assembly of our strain using MUMmer\u2019s alignment generator NUCmer23 v3.1). NUCmer\u2019s output was filtered and the filtered results parsed to MUMmerplot, generating full-genome visualization between the pairs of different yeast species. Since Spades assembly-lengths are roughly twice the estimated genome size we additionally evaluated alignments between Spades hybrid and TULIP contigs. Alignments were performed using BWA-mem24 v0.7.15 with -x ontd2 settings and visualized using genome viewer Tablet25 v1.17.08.17.From 26S ribosomal RNA sequences available in the nucleotide database, ChenCandida vartiovaarae mitochondrial genome  using Bowtie226 v2.2.5. Reads generated on the MinION platform were aligned using Minimap227 v2.3-r546-dirty. Resulting bam files were sorted and viewed in IGV viewer v2.3.Reads generated on the Illumina platform were aligned to the published28 (ITS1 and ITS4).From a screen on 10% acid-pretreated corn stover hydrolysate, about 70 individual clones were obtained, only five of which were able to grow well on purely synthetic YNB-based medium. To determine the taxonomic status of these clones, chromosomal DNA was isolated and used for PCR amplification of the ribosomal ITS sequence using ITS-specific primersCandida vartiovaarae (Torulopsis vartiovaarae: NCBI accession number KY102493)BLAST analysis of these ITS sequences of all 5 isolates revealed a 100% identity toAll five isolates were grown on different C-sources and showed growth on glucose, mannose, cellobiose, xylose and glycerol, while growth on L-arabinose was variable. No significant growth was found on galactose and rhamnose. Good growth (on glucose) occurred between 20\u201330\u00b0C, at pH3-7 . Based on the results, we concluded that all five isolates originated from a single source in the grass silage sample. Subsequent experiments were therefore carried out with a single isolate now named DDNA#1.C. jadinii strains, namely CBS1600 and NBRC 0988.As a further means to validate our assembled contigs and determine if they match the actual chromosome length, we have separated the chromosomes on an agarose gel using pulsed field gel electrophoresis. The gel image inC. vartiovaarae has strong heterozygous properties  and one hybrid assembly. The first approach used reads exclusively produced by the Illumina platform. After merging paired end reads we obtained ~1.7 Gbp of ~240 bp reads. Contigs generated by Spades remained short and the overall assembly was heavily fragmented. The N50 of this assembly was only ~4.3 kbp, its longest contig ~35 kbp. Spades generated 10,121 contigs and the entire assembly length was nearly twice the estimated ~12 Mbp haploid genome size. We also assembledSaccharomyces cerevisiae and DDNA#1 exclusively based on Illumina data highlights that Spades clearly struggles to reconstruct the genome of our isolate, possibly due to complex SNP arrangements. From these results we take that, even under high coverage conditions, ~240 bp reads do not provide sufficient power to resolve complex SNP distributions for highly heterozygous genomes. This illustrates the necessity of increased read length to fully reconstruct complex genomic structures such as those found in DDNA#1.Assembly comparison ofSecondly, we used Spades to generate a hybrid assembly that takes both Illumina and nanopore data as input. We used ~1.7 Gbp and ~208 Mbp Illumina and nanopore data sets, respectively. This hybrid approach performed by Spades resulted in an N50 of ~379 kbp, with the longest contig ~1.1 Mbp, and a total of 653 contigs and, although still relatively fragmented, it is interesting that it yielded a similar assembly length compared to the assembly exclusively based on Illumina data. The improvement of assembly statistics strongly indicates the positive effect of longer reads in resolving complicated genomes.Hereafter, the four remaining approaches are all based on data solely generated by the Oxford Nanopore Technologies platform. Assembly lengths in particular are fairly similar between all four assemblies and all approximate the estimated ~12 Mbp haploid genome size. However, Miniasm, TULIP and Smartdenovo outperform Canu on N50, number of contigs and longest contig . Lengths9.It is clear from these results that assemblies based on exclusively nanopore data achieve the most contiguous assemblies, as has been shown previously30, it is reduced for R9 chemestry, indicating technical enhancement and suggesting improved genomic reconstruction even for low complexity regions,. Both after long read self-correction using Canu as well as for post-asssembly correction using Racon the contig sequences still contain errors15. We have used PILON and the complementary Illumina data from this strain to correct the assembled contigs twice. Homopolymer streches are paricularly difficult to base call accurately due to low complexity and lengths are usually underestimated. PILON correction leads to a minor assembly length increase since corrected homopolymer lengths adds to the final assembly size.We also used the nanopore datasets made with the R7.3 and R9 chemistry separately in the Canu assembler. The most notable difference between these assemblies is found in the mitochondrial genome. Only 16 kbp of this 33 kbp genome could be assembled with the R7.3 data, whereas the R9 assembly contained a complete mitochondrial genome . The mitochondrial genome has a very low GC content (21%) and in the extragenic regions more A and T homopolymers are found. Very few R7.3 reads mapped to this region, but in the R9 dataset there are many more reads that represent this region . It has BUSCO identifies the majority of genes from database Fungi 0db9 on nanopore derived assemblies. The number of single copy genes identified ranges from 145 to 188, between 45 and 57 genes are partially recognized, and 53 to 92 genes are classified absent before PILON correction . After PC. vartiovaarae isolate DDNA#1 strain to yeast genome sequences that are already deposited in the nucleotide database. Comparison of our yeast strain with the well characterizedS. cerevisiae assembly showed negligible genomic similarity. From 26S ribosomal RNA sequences available in the nucleotide database, Chenet al.22 have constructed a phylogenetic tree. The closest relatives for which whole genome sequences are available areC. jadinii strains CBS1600 and NBRC 0988. An initial comparison between CBS1600 and NBRC 0988 revealed that these two strains show high homology  The Tulip assembler require a set of seeds as input, but the authors did not mentioned how those seeds were obtained. 2) Table 2 refers to a dataset of 11,344 nanopore reads (representing 17X). Does it represent the entire dataset (R7.3 and R9 runs)? In the first version, the authors reported a dataset of 2.05Gb . Please clarify this issue by, for example, adding a table which describes the produced dataset and the input dataset used by each assembler. 3) The filter parameters of the NUCmer output are not mentioned.We have read this submission. We believe that we have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however we have significant reservations, as outlined above. The authors have addressed my concerns sufficiently to recommend indexing of the manuscript in its current form.I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. The authors have addressed the comments in my initial review and the genome assemblies are now public. I have a few minor comments on this revised version. In Table 1, I would recommend removing the top row and instead in the table title referring to the kmer size and sequence coverage, or alternatively to merge the cells in the top row- as is, those cells appear to refer to the columns below and not the entire table. For Table 2- the Spades Hybrid has the same read stats as the other nanopore only assemblies but lists using both illumina and nanopore data. For Figure 4- was the 'before' data computed for the 2 Spades assemblies- seems odd that there were no BUSCO hits in those pre-pilon versions.I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. et al.\u00a0used Oxford Nanopore Technology with other short read sequencing technology, HiSeq 2500, to perform high-qualityde novo genome assembly and classify yeast strain isolates,Candida vartiovaarae DDNA#1 from\u00a0Saccharomyces cerevisiae S288C andCyberlindrena jadinii CBS1600/NBRC 0988. They also exploited\u00a0two versions of Nanopore flowcell chemistry and related software. Especially AT-rich mitochondria assembly using R7.3 and R9 comparison is very interesting.\u00a0Jansen\u00a0 Using similar short read data, N50 of DDNA#1 is 2.2kbp and that of S277C was 124Kbp. Probably authors want to perform repeat analysis for both strains to further study what makes such a performance gap.\u00a0 For assembly approach two and three, authors used Canu to correct Nanopore reads with short reads.\u00a0 So basically all three approaches adopted short reads for correction or assembly purpose. Since Canu can perform self-correction with only long reads, it would be very interesting to compare self-corrected Nanopore reads assembly contiguity vs. short reads corrected Nanopore reads assembly contiguity.\u00a0 Authors used two error correction methods; Canu and PILON, It would be helpful to consistently compare the correction performance of two software.\u00a0C. jadinii stains are proposed to be the closest strain, given Figure 4, S288C looks much closer to DDNA#1. Probably authors want to take a close\u00a0look at this.\u00a0 Although All sequencing data should be available online for reproducibility.I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. We hope to have shown that the performance gap can be overcome using long reads. Using long reads in either hybrid or with data exclusively from nanopore decreased fragmentation and increased contiguity. Suggesting genomic complexity caused initial difficulties during assembly of this strain. For assembly approach two and three, authors used Canu to correct Nanopore reads with short reads. So basically all three approaches adopted short reads for correction or assembly purpose. Since Canu can perform self-correction with only long reads, it would be very interesting to compare self-corrected Nanopore reads assembly contiguity vs. short reads corrected Nanopore reads assembly contiguity.We have compared Canu (self-corrected) results to assemblies made with Miniasm, TULIP and Smartdenovo corrected with Racon. It appears the assembly strategy is a crucial difference to contiguity and fragmentation as opposed to self- or post-assembly correction. Authors used two error correction methods; Canu and PILON, It would be helpful to consistently compare the correction performance of two software.The comparison between different assemblers and correction procedures should be more consistent now that we have separated the two task more prominently. AlthoughC. jadinii stains are proposed to be the closest strain, given Figure 4, S288C looks much closer to DDNA#1. Probably authors want to take a close look at this.Although alignment hits between C. jadinii and S288C are more targeted towards the diagonal in this figure the alignment length is very short and the number of alignment hits is significantly lower compared to the other two strains. This underlines the poor synteny conservation between C. jadinii and S288C as compared to CBS1600 and NBRC 0988. C. jadinii compared to these two strains show many more alignment hits hence these strains are taken to be more similar. All sequencing data should be available online for reproducibility.Data has status in process, should be publicly accessible very soonUsing similar short read data, N50 of DDNA#1 is 2.2kbp and that of S277C was 124Kbp. Probably authors want to perform repeat analysis for both strains to further study what makes such a performance gap. et al describes comparison ofde novo assemblies generated using Illumina or Oxford Nanopore sequence for the yeast Candida varitovaarae.\u00a0 The sequenced isolate was collected from a screen for new ethanologenic yeast species.\u00a0 Genomic DNA was sequenced using both platforms andde novo assemblies compared for overall metrics and representation of the mitochondrial genome.\u00a0 The final assembly was compared to those of other related yeast species to view conservation of synteny.This report by Jansen Overall this is an interesting study in showing the advantage of utilizing long Oxford nanopore reads for assembly of a genome that was difficult to assemble using Illumina data. This description would be more compelling if the authors could address a few issues with the presentation of this data.de novo assembly are the repetitive sequence content, GC content, and level of heterozygosity.\u00a0 The authors suggest that repetitive sequence could explain large number of contigs; this could be directly addressed by identifying repetitive sequences in the assembly and evaluating contig ends. However there is also the suggestion in the text of some level of heterozygosity, which could better account for the low contig N50 they report in the Illumina assemblies.\u00a0 Whether or not the species is diploid and if so the level of heterozygosity is important to address in evaluating the performance of the two sequencing approaches and documenting the genomes for which long reads are most useful. This could be addressed for example using the Illumina data to identify heterozygous variants across the assembly. 1. In addition to genome size, the major factors that can influence the outcome of a 2. The authors use Pilon to correct the assembled contigs with Illumina data and note that this led to a minor increase in size of the assembly, suggesting there were some misassembled regions in the original Canu assembly. As the other genomes compared using Nucmer are distantly related, with many rearrangements, this could not be used to validate the Canu assembly.\u00a0 It would be helpful if the authors could more fully describe the errors identified and fixed by Pilon.\u00a0 3. Along the same lines, which statistics are for the final, best version of the assembly?\u00a0 Table 1 compares different combinations of Oxford Chemistry, however the authors also describe an additional step of Pilon polishing. It would be useful to contrast metrics, including sequence coverage levels and GC content, to those from the 2 Spades assemblies, as well as note which assembly is the final version. 4. In Figure 1, the top scale is too small to read. Plotting the GC as a separate track would be helpful to compare to the R7 coverage level. 5. For the PFG in Figure 3, a longer run may help separate the bright high MW band into separate chromosomes. 6. The data does not appear to be submitted to a public repository; both the raw sequence and the final best assembly should be submitted to NCBI or the ENA.I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. de novo assembly are the repetitive sequence content, GC content, and level of heterozygosity. The authors suggest that repetitive sequence could explain large number of contigs; this could be directly addressed by identifying repetitive sequences in the assembly and evaluating contig ends. However there is also the suggestion in the text of some level of heterozygosity, which could better account for the low contig N50 they report in the Illumina assemblies. Whether or not the species is diploid and if so the level of heterozygosity is important to address in evaluating the performance of the two sequencing approaches and documenting the genomes for which long reads are most useful. This could be addressed for example using the Illumina data to identify heterozygous variants across the assembly.The estimated genome size comparison between nanopore mediated assemblies and hybrid Spades assembly is a first indication of the polyploid genome of our strain. Together with the abundant double gene copy BUSCO gene identification analysis and Spades hybrid contigs alignment to TULIP contigs we hope to have shown the diploid characteristics of DDNA#1, at least to partial extend. \u00a01. In addition to genome size, the major factors that can influence the outcome of ade novo genome assembly.Increased assembly length after PILON correction is mainly due to corrected homopolymer stretches that are often underrepresented due to sequencing complexities of low complexity regions. This explanation has been added to the manuscript under results and discussion \u2013 Illumina and MinION \u00a02. The authors use Pilon to correct the assembled contigs with Illumina data and note that this led to a minor increase in size of the assembly, suggesting there were some misassembled regions in the original Canu assembly. As the other genomes compared using Nucmer are distantly related, with many rearrangements, this could not be used to validate the Canu assembly. It would be helpful if the authors could more fully describe the errors identified and fixed by Pilon.de novo genome assembly. We have added sequence data statistics such as coverage and total amount of data. And aimed to highlight the error correction effect using BUSCO gene identification analysis. The final assembly is now described under results and discussion \u2013 Illumina and MinION \u00a03. Along the same lines, which statistics are for the final, best version of the assembly? Table 1 compares different combinations of Oxford Chemistry, however the authors also describe an additional step of Pilon polishing. It would be useful to contrast metrics, including sequence coverage levels and GC content, to those from the 2 Spades assemblies, as well as note which assembly is the final version.GC-content is now added to this figure and numbers and text have been made more clear. \u00a04. In Figure 1, the top scale is too small to read. Plotting the GC as a separate track would be helpful to compare to the R7 coverage level.We have tried many different run conditions and failed to properly resolve the largest bands. This may be different on a different system but we do not have access to such a system. \u00a05. For the PFG in Figure 3, a longer run may help separate the bright high MW band into separate chromosomes.Data has status in process, should be publicly accessible very soon6. The data does not appear to be submitted to a public repository; both the raw sequence and the final best assembly should be submitted to NCBI or the ENA. et al. titled \u201cDe novo whole-genome assembly of a wild type yeast isolate using Nanopore sequencing\u201d with great interest. Authors describe their strategy to sequence and assemble a yeast strain using different methodologies: a short read strategy with Illumina reads alone and two hybrid approaches, the first one combining both short and long reads for the assembly and the second using long reads for the assembly and short reads for the correction of the consensus. In general, we think that this is a well put together study that reflects the current standard approaches for assembling genomes with both short and long reads. However, we have some questions/remarks that we would like the authors to answer.de novo assembly. If some regions are heterozygous, it should lead to a higher than expected assembly size. We think the authors should describe in more details the Illumina-only assembly especially the cumulative size (add a column in Table 1). As the error rate is low, with a high level of SNPs, both (Is the DDNA#1 isolate is a diploid yeast?) haplotypes should be segregated. On the contrary, the assembly length of the nanopore-only assemblies seems to be near the expected size (12Mb), does it mean that the error rate prevent to distinguish haplotypes? We think the authors should discuss in more details how haplotypes are resolved in their different assemblies.It seems that the high level of polymorphism complicate theThe whole dataset  should be submitted in public repository to ensure full reproducibility.de novo genome assembly, line 38. Illumina and MinIONContigs were polished using the Pilon tool but line 7 of the same paragraph, authors indicate that the Spades assembly that was generated from Illumina reads alone was highly fragmented possibly due to a high level of SNPs in the DDNA#1 isolate. I think that to verify if the Pilon correction didn\u2019t do more harm than good, authors could run the Busco tool (http://busco.ezlab.org/) on the assemblies, or annotate genes, before and after correction to verify if it didn\u2019t introduce errors in the consensus due to heterogeneous input reads.ParagraphIllumina and MinION de novo genome assembly, lines 14-15 it is said that the cumulative size of reads that was given as input to Canu was 2.05 Gb and that the corrected reads cumulative output size was equal to 389 Mb. I think that by default Canu only corrects 30X of the input read set (controlled by the corOutCoverage parameter) and since it is relatively close to 30-fold coverage of a yeast genome, I was wondering if authors leaved this parameter as default or if they moved up the limit and it could only correct around 30X of coverage. If this parameter was changed, I think it would be a good idea to indicate it.ParagraphAuthors should add a table that contains standard metrics about the sequencing data (nanopore and illumina): number of reads, cumulative size, coverage, average read length\u2026Full genome comparison, lines 12-15 it is said that the Nucmer\u2019s ouput was filtered with the delta-filter software; please add the parameters used to filter out alignments. Moreover, if the yeast genomes used for the comparison are highly variable the nucmer software is not the best suited; maybe lastz (https://github.com/lastz/lastz) should better perform.Paragraphhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC5466710/), it would be interesting to compare their results with a smartdenovo assembly.The smartdenovo assembler has been successfully applied to yeast genomes . As the error rate is low, with a high level of SNPs, both (Is the DDNA#1 isolate is a diploid yeast?) haplotypes should be segregated. On the contrary, the assembly length of the nanopore-only assemblies seems to be near the expected size (12Mb), does it mean that the error rate prevent to distinguish haplotypes? We think the authors should discuss in more details how haplotypes are resolved in their different assemblies.Statistical information on the Illumina derived assembly is now added to Table 1. Indeed the majority of assemblies based exclusively on nanopore data are haploid genomes, this comes together with the notion that most of these assembler are designed to reconstruct bacterial genomes. However Canu should be able to differentiate diploid haplotypes, that is for high coverage datasets. It appears 17x coveragehigh quality long length read data is insufficient to resolve the  diploid genome of DDNA#1. \u00a01. It seems that the high level of polymorphism complicate the2. The whole dataset  should be submitted in public repository to ensure fullThese should be publicly available now \u00a0reproducibility.Illumina and MinION de novo genome assembly, line 38. Contigs were polished using the Pilon tool but line 7 of the same paragraph, authors indicate that the Spades assembly that was generated from Illumina reads alone was highly fragmented possibly due to a high level of SNPs in the DDNA#1 isolate. I think that to verify if the Pilon correction didn\u2019t do more harm than good, authors could run the Busco tool (http://busco.ezlab.org/) on the assemblies, or annotate genes, before and after correction to verify if it didn\u2019t introduce errors in the consensus due to heterogeneous input reads.Thank you for your suggestion this is now incorporated into the manuscript under methods/ results and discussion \u2013 genome assembly assessment based on gene expectation using BUSCO \u00a03. ParagraphIllumina and MinION de novo genome assembly, lines 14-15 it is said that the cumulative size of reads that was given as input to Canu was 2.05 Gb and that the corrected reads cumulative output size was equal to 389 Mb. I think that by default Canu only corrects 30X of the input read set (controlled by the corOutCoverage parameter) and since it is relatively close to 30-fold coverage of a yeast genome, I was wondering if authors leaved this parameter as default or if they moved up the limit and it could only correct around 30X of coverage. If this parameter was changed, I think it would be a good idea to indicate it.In our Canu version corOutCoverage is set to 40x coverage by default and has not been changed. \u00a04. Paragraph5. Authors should add a table that contains standard metrics about the sequencing data (nanoporeTable is now added. \u00a0and illumina): number of reads, cumulative size, coverage, average read length\u2026Full genome comparison, lines 12-15 it is said that the Nucmer\u2019s ouput was filtered with the delta-filter software; please add the parameters used to filter out alignments. Moreover, if the yeast genomes used for the comparison are highly variable the nucmer software is not the best suited; maybe lastz (https://github.com/lastz/lastz) should better perform.Thank you for your suggestion, we have performed similar whole genome alignments with Lastz and mummer, however we didn\u2019t observe a noticeable difference based on whole genome comparison alone. It appears the assembly algorithm and input data characteristics are the major factors that influenced the contiguity and fragmentation of our assemblies. \u00a06. ParagraphThank you for your suggestion, Smartdenovo has now been added to the set of assemblers and results are denoted in our manuscript. Indeed Smartdenovo is an assembler that performs relatively well on the dataset of our yeast strain.7. The smartdenovo assembler has been successfully applied to yeast genomes (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5466710/), it would be interesting to compare their results with a smartdenovo assembly. de novo whole-genome assembly of a wild type yeast isolate using nanopore sequencing. They tried three different approaches to assemble the genome: using Illumina reads only, using both Illumina and nanopore reads in a hybrid approach, and using the only nanopore reads for assembling and Illumina reads for polishing. The third approach resulted in the most contiguous assembly. In they work they use nanopore datasets made with R7.3, R9 and R9.4 chemistries.The authors presentedUsing minimap+ miniasm assembler in combination with Racon consensus tool and PILONUsing Canu + racon + PILONTry to polish nanopore assembly using Nanopolish Although they used a correct procedure for genome assembly it would be interesting to compare their results with the following methods in the third approach: In addition, it would be valuable if they make their data publicly available to enable others to reproduce their results.I have read this submission. I believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Thank you for your suggestion, this strategy is now included in our study. \u00a0Using minimap+ miniasm assembler in combination with Racon consensus tool and PILONSince Canu contains an integrated self-correction procedure prior to assembly we have not corrected the Canu contigs with Racon, however the combination Canu \u2013 PILON correction is part of our study, thank you. \u00a0Using Canu + racon + PILONThank you for your suggestion, however, since we have combined different data sets from different chemistries and different laboratories, at different times, including filtering of these data, it\u2019s relatively complicated to polish such datasets with Nanopolish. To balance out the effort-result ratio we have performed a double iteration PILON correction which shows to be sufficient to identify the majority of genes stored in the Fungi 0db9 database used by BUSCO. \u00a0Try to polish nanopore assembly using NanopolishData has status in process, should be publicly accessible very soonIn addition, it would be valuable if they make their data publicly available to enable others to reproduce their results."}
+{"text": "Short-read sequencing technologies have made microbial genome sequencing cheap and accessible. However, closing genomes is often costly and assembling short reads from genomes that are repetitive and/or have extreme %GC content remains challenging. Long-read, single-molecule sequencing technologies such as the Oxford Nanopore MinION have the potential to overcome these difficulties, although the best approach for harnessing their potential remains poorly evaluated.We sequenced nine bacterial genomes spanning a wide range of GC contents using Illumina MiSeq and Oxford Nanopore MinION sequencing technologies to determine the advantages of each approach, both individually and combined. Assemblies using only MiSeq reads were highly accurate but lacked contiguity, a deficiency that was partially overcome by adding MinION reads to these assemblies. Even more contiguous genome assemblies were generated by using MinION reads for initial assembly, but these assemblies were more error-prone and required further polishing. This was especially pronounced when Illumina libraries were biased, as was the case for our strains with both high and low GC content. Increased genome contiguity dramatically improved the annotation of insertion sequences and secondary metabolite biosynthetic gene clusters, likely because long-reads can disambiguate these highly repetitive but biologically important genomic regions.Genome assembly using short-reads is challenged by repetitive sequences and extreme GC contents. Our results indicate that these difficulties can be largely overcome by using single-molecule, long-read sequencing technologies such as the Oxford Nanopore MinION. Using MinION reads for assembly followed by polishing with Illumina reads generated the most contiguous genomes with sufficient accuracy to enable the accurate annotation of important but difficult to sequence genomic features such as insertion sequences and secondary metabolite biosynthetic gene clusters. The combination of Oxford Nanopore and Illumina sequencing can therefore cost-effectively advance studies of microbial evolution and genome-driven drug discovery.The online version of this article (10.1186/s12864-018-5381-7) contains supplementary material, which is available to authorized users. Microbial genome sequencing has revealed how microorganisms adapt, evolve, and contribute to health and disease , 2. Althrhs toxins, secondary metabolite biosynthetic gene clusters, and many others . In. InPseudIn summary, our data highlights the ability of long-read, single-molecule MinION sequencing to overcome current limitations of short-read sequencing, particularly its inability to disambiguate repetitive genome regions and avoid biases introduced during library preparation. Overcoming these limitations greatly improves the annotation of many clinically- and biotechnologically-important genomic regions such as insertion sequences and BGCs Figs.  and 7. HShort read genome assemblies struggle to disambiguate genomic repeats and are subject to technical biases. These biases are especially pronounced for genomes with extreme GC content. Our study validates a framework to overcome these biases by combining Oxford Nanopore MinION long reads with high-accuracy Illumina short reads. Genome assembly using long reads followed by polishing using short reads typically generated assemblies that were both contiguous and that facilitated accurate annotation. This includes improved annotation of complex genomic features such as secondary metabolite biosynthetic gene clusters and insertion sequences. An increase in frame shift errors was observed in some assemblies constructed from long reads, but anticipated improvements in base calling are likely to reduce these errors. These advances, coupled with the increasing cost-effectiveness of genome sequencing, will significantly improve studies of microbial evolution and genome-based drug discovery.Additional file 1:Commands used for the analyses in this study. Note that the original file paths have been retained here, even though analyses were conducted on different servers. (DOCX 95 kb)Additional file 2:Figure S1. Summary of Illumina Nextera-based assemblies for Pseudonocardia strains JKS002056, JKS002072, and JKS002128. Figure S2. BRIG analysis for Pseudonocardia strain JKS002128. The Canu+Pilon assembly was used as the reference strain. Each ring represents a different assembly type, Canu+Nanopolish (dark blue), Canu (pink), Unicycler Hybrid (green), Spades Hybrid , Unicycler (orange), and Spades (purple). The inner rings describe GC content (black) and GC skew (purple/green). Figure S3. Analysis showing the ratio of SNPs and Indels present in homopolymeric regions ranging from 1 to 8 basepairs long for each Ps JKS002128, Av JG3, and Fs ARS-166-14 assembly relative to the Canu+Pilon assembly. Results for Ps JKS002128 did not detect SNPs present in homopolymeric regions 7 or 8 basepairs long in either the SPAdes, Unicycler, SPAdes-hybrid, or Unicycler-hybrid assemblies; these data points are therefore missing in this panel. Figure S4. Anvi\u2019o Pangenome display for all strains. The Anvi\u2019o (v.5.2) pangenome pipeline was used following the developer\u2019s pipelines for importing Prokka gene annotations and for performing HMM analyses. Assembly methods are abbreviated as follows: S (SPAdes), U (Unicycler), SH (SPAdes-hybrid), UH (Unicycler-hybrid), P (Canu+Pilon), N (Canu+Nanopolish), and C (Canu). A. Pseudonocardia strains. B. Aeromonas strains. C. Flavobacterium strains. Figure S5. Alignments of Biosynthetic Gene Cluster family 6 (see Fig. see Fig. . Some Ca"}
+{"text": "Genome sequencing yields the sequence of many short snippets of DNA (reads) from a genome. Genome assembly attempts to reconstruct the original genome from which these reads were derived. This task is difficult due to gaps and errors in the sequencing data, repetitive sequence in the underlying genome, and heterozygosity. As a result, assembly errors are common. In the absence of a reference genome, these misassemblies may be identified by comparing the sequencing data to the assembly and looking for discrepancies between the two. Once identified, these misassemblies may be corrected, improving the quality of the assembled sequence. Although tools exist to identify and correct misassemblies using Illumina paired-end and mate-pair sequencing, no such tool yet exists that makes use of the long distance information of the large molecules provided by linked reads, such as those offered by the 10x Genomics Chromium platform. We have developed the tool Tigmint to address this gap.To demonstrate the effectiveness of Tigmint, we applied it to assemblies of a human genome using short reads assembled with ABySS 2.0 and other assemblers. Tigmint reduced the number of misassemblies identified by QUAST in the ABySS assembly by 216 (27%). While scaffolding with ARCS alone more than doubled the scaffold NGA50 of the assembly from 3 to 8 Mbp, the combination of Tigmint and ARCS improved the scaffold NGA50 of the assembly over five-fold to 16.4 Mbp. This notable improvement in contiguity highlights the utility of assembly correction in refining assemblies. We demonstrate the utility of Tigmint in correcting the assemblies of multiple tools, as well as in using Chromium reads to correct and scaffold assemblies of long single-molecule sequencing.Scaffolding an assembly that has been corrected with Tigmint yields a final assembly that is both more correct and substantially more contiguous than an assembly that has not been corrected. Using single-molecule sequencing in combination with linked reads enables a genome sequence assembly that achieves both a high sequence contiguity as well as high scaffold contiguity, a feat not currently achievable with either technology alone. Assemblies of short read sequencing data are easily confounded by repetitive sequences larger than the fragment size of the sequencing library. When the size of a repeat exceeds the library fragment size, the contig comes to an end in the best case, or results in misassembled sequence in the worst case. Misassemblies not only complicate downstream analyses, but also limit the contiguity of the assembly. Each incorrectly assembled sequence prevents joining that chimeric sequence to its true neighbours during assembly scaffolding, illustrated in Fig.\u00a0de novo assemble complex genomes in the gigabase scale [Long-read sequencing technologies have greatly improved assembly contiguity with their ability to span these repeats, but at a cost currently significantly higher than that of short-read sequencing technology. For population studies and when sequencing large genomes, such as conifer genomes and other economically important crop species, this cost may be prohibitive. The 10x Genomics  Chromium technology generates linked reads from large DNA molecules at a cost comparable to standard short-read sequencing technologies. Whereas paired-end sequencing gives two reads from a small DNA fragment, linked reads yield roughly a hundred read pairs from molecules with a typical size of a hundred kilobases. Linked reads indicate which reads were derived from the same DNA molecule , and so should be in close proximity in the underlying genome. The technology has been used previously to phase diploid genomes using a reference [se scale , and furse scale , 4.A number of software tools employ linked reads for various applications. The Long Ranger tool maps reads to repetitive sequence, phases small variants, and identifies structural variants , while Sde novo sequencing projects, it is challenging yet important to ensure the correctness of the resulting assemblies. Tools to correct misassemblies typically inspect the reads aligned back to the assembly to identify discrepancies. Pilon [In s. Pilon  inspectss. Pilon  uses Ills. Pilon . Linked Tigmint first aligns linked reads to an assembly, and infers the extents of the large DNA molecules from these alignments. It then searches for atypical drops in physical molecule coverage, revealing the positions of possible misassemblies. It cuts the assembled sequences at these positions to improve assembly correctness. Linked reads may then be used again to scaffold the corrected assembly with ARCS  to identTigmint identifies misassembled regions of the assembly by inspecting the alignment of linked reads to the draft genome assembly. The command tigmint-molecule groups linked reads with the same barcode into molecules. The command tigmint-cut identifies regions of the assembly that are not well supported by the linked reads, and cuts the contigs of the draft assembly at these positions. Tigmint may optionally scaffold the genome using ARCS . A blockl, where l is the read length. Reads with the same barcode that map within a specified distance, 50 kbp by default, of the adjacent reads are grouped into a molecule. A BED (Browser Extensible Data) file [A typical workflow of Tigmint is as follows. The user provides a draft assembly in FASTA format and the linked reads in FASTQ format. Tigmint first aligns the linked reads to the draft genome using BWA-MEM . The alita) file  is constPhysical molecule depth of coverage is the number of molecules that span a point. A molecule spans a point when one of its reads aligns to the left of that point and another of its reads (with the same barcode) aligns to the right of that point. Regions with poor physical molecule coverage indicate potentially problematic regions of the assembly. At a misassembly involving a repeat, molecules may start in left flanking unique sequence and end in the repeat, and molecules may start in the repeat and end in right flanking unique sequence. This seemingly uninterrupted molecule coverage may give the appearance that the region is well covered by molecules. Closer inspection may reveal that no molecules span the repeat entirely, from the left flanking sequence to the right flanking sequence. Tigmint checks that each region of a fixed size specified by the user, 1000 bp by default, is spanned by a minimum number of molecules, 20 by default.Tigmint constructs an interval tree of the coordinates of the molecules using the Python package Intervaltree. The interval tree allows us to quickly identify and count the molecules that span a given region of the draft assembly. Regions that have a sufficient number of spanning molecules, 20 by default, are deemed well-covered, and regions that do not are deemed poorly-covered and reveal possible misassemblies. We inspect the molecule coverage of each contig with a sliding window of 1000 bp (by default) with a step size of 1 bp. Tigmint cuts the assembly after the last base of a well-covered window before a run of poorly-covered windows, and then cut the assembly again before the first base of the first well-covered window following that run of poorly-covered windows, shown in Listing 1. The coordinates of these cut points are recorded in a BED file. The sequences of the draft assembly are split at these cut points, producing a corrected FASTA file.Tigmint will optionally run ARCS  to scaffTigmint will optionally compare the scaffolds to a reference genome, if one is provided, using QUAST  to compuWe have evaluated the effectiveness of Tigmint on assemblies of both short and long read sequencing data, including assemblies of Illumina paired-end and mate-pair sequencing using ABySS and DISCOVARdenovo, a Supernova assembly of linked reads, a Falcon assembly of PacBio sequencing, a Canu assembly of Oxford Nanopore sequencing, and an ABySS assembly of simulated Illumina sequencing  reads. We downloaded PacBio reads assembled with Falcon from NCBI  and OxfoMost software used in these analyses were installed using Linuxbrew  with theCorrecting the ABySS assembly of the human data set HG004 with Tigmint reduces the number of misassemblies identified by QUAST by 216, a reduction of 27%. While the scaffold NG50 decreases slightly from 3.65 Mbp to 3.47 Mbp, the scaffold NGA50 remains unchanged; thus in this case, correcting the assembly with Tigmint improves the correctness of the assembly without substantially reducing its contiguity. However, scaffolding the uncorrected and corrected assemblies with ARCS yield markedly different results: a 2.5-fold increase in NGA50 from 3.1 Mbp to 7.9 Mbp without Tigmint versus a more than five-fold increase in NGA50 to 16.4 Mbp with Tigmint. Further, correcting the assembly and then scaffolding yields a final assembly that is both more correct and more contiguous than the original assembly, as shown in Fig.\u00a0Correcting the DISCOVARdenovo + BESST assembly reduces the number of misassemblies by 75, a reduction of 13%. Using Tigmint to correct the assembly before scaffolding with ARCS yields an increase in NGA50 of 28% over using ARCS without Tigmint. Correcting the DISCOVARdenovo + ABySS-Scaffold assembly reduces the number of misassemblies by 35 (5%), after which scaffolding with ARCS improves the NGA50 to 23.7 Mbp, 2.6 times the original assembly and a 40% improvement over ARCS without Tigmint. The assembly with the fewest misassemblies is DISCOVARdenovo + BESST + Tigmint. The assembly with the largest NGA50 is DISCOVARdenovo + ABySS-Scaffold + Tigmint + ARCS. Finally, DISCOVARdenovo + BESST + Tigmint + ARCS strikes a good balance between both good contiguity and few misassemblies.Correcting the Supernova assembly of the HG004 linked reads with Tigmint reduces the number of misassemblies by 82, a reduction of 8%, and after scaffolding the corrected assembly with ARCS, we see a slight (<1%) decrease in both misassemblies and NGA50 compared to the original Supernova assembly. Since the Supernova assembly is composed entirely of the linked reads, this result is concordant with our expectation of no substantial gains from using these same data to correct and scaffold the Supernova assembly.T less than -2.7. Setting T = -2.4, NxRepair reduced the number of misassemblies from 790 to 611, a reduction of 179 or 23%, whereas Tigmint reduced misassemblies by 216 or 27%. NxRepair reduced the NGA50 by 34% from 3.09 Mbp to 2.04 Mbp, unlike Tigmint, which did not reduce the NGA50 of the assembly. Tigmint produced an assembly that is both more correct and more contiguous than NxRepair with T = -2.4. Smaller values of T corrected fewer errors than Tigmint, and lager values of T further decreased the contiguity of the assembly. We similarly corrected the two DISCOVARdenovo assemblies using NxRepair with T = -2.4, shown in figure Fig.\u00a0We attempted to correct the ABySS assembly using NxRepair, which made no corrections for any value of its z-score threshold parameter The assemblies of SMS reads have contig NGA50s in the megabases. Tigmint and ARCS together improve the scaffold NGA50 of the Canu assembly by more than double to nearly 11 Mbp and improve the scaffold NGA50 of the Falcon assembly by nearly triple to 12 Mbp, and both assemblies have fewer misassemblies than their original assembly, shown in Fig.\u00a0The alignments of the ABySS assembly to the reference genome before and after Tigmint are visualized in Fig.\u00a0The default maximum distance permitted between linked reads in a molecule is 50 kbp, which is the value used by the Long Ranger and Lariat tools of 10x Genomics. In our tests, values between 20 kbp and 100 kbp do not substantially affect the results, and values smaller than 20 kbp begin to disconnect linked reads that should be found in a single molecule. The effect of varying the window and spanning molecules parameters of Tigmint on the assembly contiguity and correctness metrics is shown in Fig.\u00a0We simulated 434 million 2 \u00d7250 paired-end and 350 million 2 \u00d7125 mate-pair read pairs using wgsim of samtools, and we simulated 524 million 2 \u00d7150 linked read pairs using LRSim , emulatiThe primary steps of running Tigmint are mapping the reads to the assembly, determining the start and end coordinate of each molecule, and finally identifying the discrepant regions and correcting the assembly. Mapping the reads to the DISCOVAR + ABySS-Scaffold assembly with BWA-MEM and concurrently sorting by barcode using Samtools  in a pipWhen aligning an assembly of an individual\u2019s genome to a reference genome of its species, we expect to see breakpoints where the assembled genome differs from the reference genome. These breakpoints are caused by both misassemblies and true differences between the individual and the reference. The median number of mobile-element insertions for example, just one class of structural variant, is estimated to be 1218 per individual . MisasseTigmint uses linked reads to reduce the number of misassemblies in a genome sequence assembly. The contiguity of the assembly is not appreciably affected by such a correction, while yielding an assembly that is more correct. Most scaffolding tools order and orient the sequences that they are given, but do not attempt to correct misassemblies. These misassemblies hold back the contiguity that can be achieved by scaffolding. Two sequences that should be connected together cannot be when one of those two sequences is connected incorrectly to a third sequence. By first correcting these misassemblies, the scaffolding tool can do a better job of connecting sequences, and we observe precisely this synergistic effect. Scaffolding an assembly that has been corrected with Tigmint yields a final assembly that is both more correct and substantially more contiguous than an assembly that has not been corrected.Linked read sequencing has two advantages over paired-end and mate-pair reads to identify and correct misassemblies. Firstly, the physical coverage of the large molecules of linked reads is more consistent and less prone to coverage dropouts than that of paired-end and mate-pair sequencing data. Since roughly a hundred read pairs are derived from each molecule, the mapping of the large molecule as a whole to the draft genome is less affected by the GC content and repetitiveness of any individual read. Secondly, paired-end and mate-pair reads are derived from molecules typically smaller than 1 kbp and 10 kbp respectively. Short reads align ambiguously to repetitive sequence that is larger than the DNA molecule size of the sequencing library. The linked reads of 10 \u00d7 Genomics Chromium are derived from molecules of about 100 kbp, which are better able to uniquely align to repetitive sequence and resolve misassemblies around repeats.Using single-molecule sequencing in combination with linked reads enables a genome sequence assembly that achieves both a high sequence contiguity as well as high scaffold contiguity, a feat not currently achievable with either technology alone. Although paired-end and mate-pair sequencing is often used to polish a long-read assembly to improve its accuracy at the nucleotide level, it is not well suited to polish the repetitive sequence of the assembly, where the reads align ambiguously. Linked reads would resolve this mapping ambiguity and are uniquely suited to polishing an assembly of long reads, an opportunity for further research in the hybrid assembly of long and linked reads.Project name: TigmintProject home page:https://github.com/bcgsc/tigmintOperating system: Platform independentProgramming language: PythonLicense: GNU GPL v3.0"}
+{"text": "Illumina technology currently dominates bacterial genomics due to its high read accuracy and low sequencing cost. However, the incompleteness of draft genomes generated by Illumina reads limits their application in comprehensive genomics analyses. Alternatively, hybrid assembly using both Illumina short reads and long reads generated by single molecule sequencing technologies can enable assembly of complete bacterial genomes, yet the high per-genome cost of long-read sequencing limits the widespread use of this approach in bacterial genomics. Here we developed a protocol for hybrid assembly of complete bacterial genomes using miniaturized multiplexed Illumina sequencing and non-barcoded PacBio sequencing of a synthetic genomic pool (SGP), thus significantly decreasing the overall per-genome cost of sequencing.We evaluated the performance of SGP hybrid assembly on the genomes of 20 bacterial isolates with different genome sizes, a wide range of GC contents, and varying levels of phylogenetic relatedness. By improving the contiguity of Illumina assemblies, SGP hybrid assembly generated 17 complete and 3 nearly complete bacterial genomes. Increased contiguity of SGP hybrid assemblies resulted in considerable improvement in gene prediction and annotation. In addition, SGP hybrid assembly was able\u00a0to resolve repeat elements and identify intragenomic heterogeneities, e.g. different copies of 16S rRNA genes, that would otherwise go undetected by short-read-only assembly. Comprehensive comparison of SGP hybrid assemblies with those generated using multiplexed PacBio long reads (long-read-only assembly) also revealed the relative advantage of SGP hybrid assembly in terms of assembly quality. In particular, we observed that SGP hybrid assemblies were completely devoid of both small (i.e. single base substitutions) and large assembly errors. Finally, we show the ability of SGP hybrid assembly to differentiate genomes of closely related bacterial isolates, suggesting its potential application in comparative genomics and pangenome analysis.Our results indicate the superiority of SGP hybrid assembly over both short-read and long-read assemblies with respect to completeness, contiguity, accuracy, and recovery of small replicons. By lowering the per-genome cost of sequencing, our parallel sequencing and hybrid assembly pipeline could serve as a cost effective and high throughput approach for completing high-quality bacterial genomes. De novo genome assembly is a valuable tool for studying the biology of bacteria. From understanding the evolutionary processes underlying host adaptation  and deveOn the other hand, single molecule sequencing technologies such as Pacific Biosciences (PacBio) and Oxford Nanopore Technologies generate sequencing reads of several kilobases, which can resolve the majority of repeat elements in bacterial genomes and improve the contiguity of assemblies. However, long reads generated by these platforms are error-prone , resultiTo address this limitation, we devised a methodological framework for hybrid sequencing and assembly of complete bacterial genomes without the need for multiplexing PacBio libraries. The driving idea behind our approach is that contigs generated by de novo assembly of barcoded short reads can be leveraged for sorting non-barcoded long reads of individual genomes within a moderately complex synthetic genomic pool. Subsequently, sorted long reads can be used to scaffold and resolve fragmented short-read assemblies via hybrid de novo assembly .Alistipes onderdonkii GC304, genome size\u2009=\u20093.75Mbp, N50\u2009=\u20093.73Mbp, chromosomal contigs\u2009=\u20093; and Coprobacillus cateniformis GC273, genome size\u2009=\u20093.69Mbp, N50\u2009=\u20093.68Mbp, chromosomal contigs\u2009=\u20093), and one partially fragmented genome   than the other 8 genomes subjected to multiplexed PacBio sequencing  or Illumina reads (Flye_Pilon assemblies), and hybrid assemblies of barcoded Illumina and PacBio reads (barcoded hybrid assemblies). Among all assemblies tested, SGP hybrid assemblies were consistently the most contiguous, achieving N50 values equal to or greater than barcoded hybrid and long-read assemblies .We further evaluated the ability of each assembly protocol to recover putative mobile elements . For this purpose, the sequences of extrachromosomal circular assemblies detected by hybrid or long-read assemblies of each genome were aligned to different assemblies of that genome. Overall, SGP and barcoded hybrid assemblies performed best in the recovery of small replicons. Across all 20 genomes tested, SGP hybrid assembly recovered a total of 15 small replicons with high similarity to plasmid sequences in the NCBI nucleotide database  units of PacBio SMRT cells . This reng reads .Christensenella minuta GC250 and Pseudoflavonifractor phocaeensis GC444 contained plasmid sequences, in the range of 5-6Kbp, that did not match any region of the Flye assemblies of these genomes. As mobile elements play critical roles in evolution of bacteria, including acquisition of antimicrobial resistance via plasmids \u201d.Additional file 2. Comparison of the cost of PacBio SMRT library preparation between standard multiplexing approach and SGPAdditional file 3.\u00a0\u00a0Quast summary statistics of assembly qulaities.Additional file 4. Length and genome coverage of PacBio long reads for both SGP and barcoded hybrid assemblies.Additional file 5.\u00a0Blast results of extrachromosomal replicons against NCBI nucleotide database.Additional file 6.\u00a0Intragenomic heterogeneity in 16S rRNA genes.Additional file 7. Reference-based assessment of the accuracy of different assemblies. The accuracy of individual assemblies of each isolate were assessed by performing whole genome alignment between the barcoded hybrid assembly of each isolate as the reference genome and all other assemblies of that isolate using nucmer. The top panel shows the frequency of single base substitutions, the middle panel shows the frequency of single nucleotide deletions and the bottom panel shows the frequency of single nucleotide insertions in various assemblies of each isolate in relation to its barcoded hybrid assembly.Additional file 8. Miniaturized shotgun library preparation protocol for Illumina sequencingAdditional file 9.\u00a0Detailed description\u00a0of required bioinformatics packages, command lines and parameters used for each step of the bioinformatics pipeline."}
+{"text": "Bioelectrical impedance analysis (BIA) was performed using the single frequency of 50 kHz and fat-free mass (FFM) was calculated using a BIA specific, impedance based equation. Somatotype components were estimated according to the Heath-Carter method. The participants were randomly split into development (n = 117) and validation groups (n = 56). New anthropometric and BIA based models were developed . Cross validation revealed R2 of 0.84, 0.80, and 0.87 for endomorphy, mesomorphy, and ectomorphy, respectively. The new proposed equations allow for the integration of the somatotype assessment into BIA, reducing the number of collected measurements, the instruments used, and the time normally required to obtain a complete body composition analysis.The accurate body composition assessment comprises several variables, causing it to be a time consuming evaluation as well as requiring different and sometimes costly measurement instruments. The aim of this study was to develop new equations for the somatotype prediction, reducing the number of normal measurements required by the Heath and Carter approach. A group of 173 male soccer players (age, 13.6 \u00b1 2.2 years, mean \u00b1 standard deviation; body mass index, BMI, 19.9 \u00b1 2.5 kg/m Young soccer players are one of the most studied populations in sports science. In fact, there is a tremendous number of studies focusing on the search for talent and on the development of new techniques for evaluating physical features and their improvement in order to achieve high level performance ,2. VariaIn addition to the molecular level of the BC, other parameters are also frequently scrutinized in sports. In particular, these parameters include the morphological characteristics which belong to the whole body level, the fifth organizational level of BC proposed by Wang and collaborators . In thisHowever, the evaluation of the somatotype according to the Heath and Carter method requires the measurement of 10 specific anthropometric dimensions by a qualified anthropometrist and dependence on the measurement instruments, including possible technical errors that mitigate the accuracy of the evaluations . In fact2), from the under 10 to under 17 age categories, registered in a professional Italian soccer team participating in the first division (Serie A), were selected to participate in the study. The players voluntarily decided to participate and their parents provided informed consent after a detailed description of the study procedures. The project was conducted according to the Declaration of Helsinki and was approved by the Bioethics Committee of the University of Bologna .173 soccer players . Height was measured to the nearest 0.1 cm using an anthropometer . Body weight was measured to the nearest 0.1 kg using a calibrated electronic scale. BMI was calculated as body mass in kilograms divided by the square of height in meters. Somatotype components were calculated according to the Heath-Carter method , for whin = 117) or a cross validation group (n = 56). Stepwise regression analysis was used to evaluate the ability of variables  to predict endomorphy, mesomorphy, and ectomorphy in the development group. During model development, normality of residuals and homogeneity of variance were tested. The criterion for inclusion of a predictor was significant at p \u2264 0.05. If more than one variable remained in the model, a variance inflation factor (VIF) for each independent variable was calculated and values below five were considered as not having multicollinearity [2/n1/2, where Y\u00a8 is the predicted variable, Y is the observed variable, and n is the number of participants [\u03c1c = \u03c1 Cb): where \u03c1 is the Pearson correlation coefficient, which measures how far each observation deviates from the line of best-fit and is a measure of precision, and Cb is a bias correction factor that measures how far the best fit line deviates from the 45\u00b0 line through the origin and is a measure of accuracy. Finally, agreement between the developed models and the reference procedure was assessed using the Bland-Altman method [Descriptive statistics were performed to characterize the sample. All variables were checked for normality, using the Kolmogorov-Smirnov test. Stratified random assignment based on age categories was used to assign participants to either a development group . Concerning the regression analysis, the methods were highly correlated . The predictive models developed in phase I for the three somatotypes explained 84%, 80%, and 87% of the variability observed in the values of the reference methods for endomoorphy, mesomorphy, and ectomorphy, respectively. The precision and accuracy of the methods was higher than 0.89 and 0.99, respectively, with a CCC between the new method and the reference procedure superior to 0.89 . Moreover, precision and accuracy between the new predictive equations and the reference procedure were analyzed with concordance correlation coefficient analysis. In this regard, a moderate strength of agreement [Recently, Rudnevet al.  proposedgreement  between greement . TherefoIn addition to the classical BIA approach, the vector variant (BIVA) has also proved useful for the evaluation of the somatotype. Indeed, recent studies ,24,25 haThe somatotype assessment represents a highly informative analysis for the BC of athletes. Mesomorphic component is linked to individual sports that require muscle strength, such as ball games , while eA strong point of this work is represented by the fact that in these new equations, the measurements required for the calculation of the somatotype are reduced, eliminating three adipose skinfold thicknesses  out of four and two diameters (humerus and femur), thus avoiding the use of the bone caliper for their measurement. In this regard, although the evaluation of morphology is an important aspect, it is not often integrated into routine evaluations due to the numerous measurements and tools required, which can involve a high operator dependent error as well as long processing times .Some limitations inherent in this study need to be mentioned. First of all, despite being a large sample, the new equations were developed and validated on a sample of young male soccer players, so the results of this study are not extendable to all young athletes, adults, or female athletes. Furthermore, BIA was performed using a single frequency and this does not guarantee the reproducibility of the results with different impedance devices . On the BIA is widely used and often favored over other assessment methods in sports because it provides a wide range of BC parameters in an easy, fast, and low operator dependent manner. On the contrary, the evaluation of the morphological characteristics according to the Heath and Carter approach requires the use of different tools and the collection of many measurements that are often time consuming. The new proposed equations make it easier to integrate the somatotype assessment with BIA, thus obtaining a complete analysis of the BC in youth elite soccer players."}
+{"text": "The developed models including resistance2/stature, FM%, FFM, contracted arm and calf circumference, triceps, and supraspinal skinfolds had high predictive ability for endomorphy  = 0.16) mesomorphy , and ectomorphy . Cross validation revealed R2 of 0.80, 0.84, 0.87 for endomorphy, mesomorphy, and ectomorphy, respectively. The proposed strategy allows the integration of somatotype assessment to BIA in soccer players, reducing the number of instruments and measurements required by the Heath and Carter approach.Easy-to-apply and quick methods for evaluate body composition are often preferred when assessing soccer teams. This study aimed to develop new equations for the somatotype quantification that would reduce the anthropometric measurements required by the Heath and Carter method, integrating the somatotype assessment to the bioelectrical impedance analysis (BIA). One hundred and seventy-six male elite soccer players (age 26.9 \u00b1 4.5 years), registered in the Italian first division (Serie A), underwent anthropometric measurements and BIA. Endomorphy, mesomorphy, and ectomorphy were obtained according to the Heath and Carter method, while fat mass (FM) and fat free mass (FFM) estimated using a BIA-derived equation specific for athletes. The participants were randomly split into development ( Body composition evaluation is among the most common assessments used on soccer players, given its relationship with physical performance . It has Body composition can be interpreted and measured according to five organizational levels . An exhaAnthropometric features and somatotype vary according to the sport practiced and the position played ,9. GenerThe measurement of a wide range of body composition variables requires different measuring instruments and specific expertise. Unfortunately, the use of reference methods for body composition assessment such as hydrostatic weighing, dilution techniques, and dual X-ray absorptiometry is not always possible due to the high cost and experience required. Bioelectrical impedance analysis (BIA) allows for the estimation of elements such as FM, FFM, and the measurement of raw parameters such as phase angle, which represents the ICW/ECW ratio ,14. CondThe development of a new strategy capable of reducing the number of anthropometric measurements required by the Heath and Carter method would enable the measurements of different body composition variables using a simpler and faster procedure. Reducing the number of instruments used and the measurements collected for the evaluation of the somatotype would permit the integration of the analysis of morphological characteristics to BIA, thus allowing the analysis of a large number of variables belonging to different levels of body composition in a practical way and in short amount of time. Therefore, this study aimed to develop and validate new equations by integrating anthropometric and bioimpedance measurements in order to estimate the three somatotype components in elite soccer players.n = 8 goalkeepers, n = 50 defenders, n = 62 midfielders, and n = 56 forwards). The players voluntarily decided to participate and provided informed consent after a detailed description of the study procedures. The project was conducted according to the Declaration of Helsinki and was approved by the Bioethics Committee of the University of Bologna .One hundred and seventy-six male soccer players (age 26.9 \u00b1 4.5 years), registered in a professional Italian soccer team participating in the first division (Serie A) were selected to participate in the study (2). Girths were taken to the nearest 0.1 cm using a tape measure  and breadths using a sliding caliper , while skinfold thicknesses were measured to the nearest 0.1 mm using a skinfold caliper . Somatotype components were calculated according to the Heath\u2013Carter method [PhA = Xc/R \u00d7 180\u00b0/\u03c0.FFM, FM, and FM% using a specific equation for athletes as follow : FFM = \u22122.261 + 0.327 \u00d7 stature2/R + 0.525 \u00d7 body weight + 5.462 \u00d7 1;FM = Body weight \u2212 FFM;FM% = FM/body weight \u00d7 100.All anthropometric measurements were profiled by a 1 Level ISAK accredited anthropometrist (T.B.) following the International Society Advancement Kinanthropometry guidelines . The tecr method . The rawr method ,23; bioin = 117) or a cross validation group (n = 59). Stepwise regression analysis was used to evaluate the ability of variables  to predict endomorphy, mesomorphy, and ectomorphy in the development group. During model development, normality of residuals and homogeneity of variance were tested. The criterion for inclusion of a predictor was significance at p \u2264 0.05, removal criteria were set at p \u2264 0.10. If more than one variable remained in the model, a variance inflation factor (VIF) for each independent variable was calculated, and values below five were considered as not having multicollinearity. To cross-validate the developed models, the resulting equations were applied to the cross-validation group according to the statistics method described elsewhere [n is the number of participants [Descriptive statistics was performed to characterize the sample. Normality of the investigated variables was assessed using the Kolmogorov\u2013Smirnov test. Stratified random assignment was used to assign participants to either a development group . The predictive models developed in this study for the three somatotypes explained 80%, 84%, and 87% of the variability observed in the values of the reference methods for endomorph, mesomorph, and ectomorph somatotypes, respectively , cellular (ICW and ECW), and whole-body (somatotype) levels, in a reduced time and with fewer operator dependent errors. 2 \u2265 0.80). Additionally, precision and accuracy between the new predictive equation and the reference procedure were assessed with concordance correlation coefficient analysis. A moderate strength of agreement [A cross validation was performed, and a very strong correlation was observed between the developed equations and the reference method (Rgreement  between greement  where noIn this study, the measured bioelectrical parameters and somatotypes are in line with previously reported research on elite soccer players. In fact, a PhA of 7.9\u00b0 was measured in this study and by Levi et al.  and MascIt has been shown how the somatotype assessment can provide meaningful information in sports where morphology can impact the biomechanical movement and resulting performance ,32. QuanIt is essential to highlight the strength of this study which is represented by the large sample size of elite soccer players. This allowed for the creation of two different groups, one for development and one for equation validations. This represents an important point as the accuracy of the predictive models was ensured on a different sample other than the one on which they were developed.However, some limitations should be addressed. First of all, these equations may not be applicable to athletes practicing sports other than soccer or to athletes of a different gender. Secondly, the new models may lose accuracy when applied to BIA devices working at a different frequency than that used in this study . Lastly,Quantification of somatotype components can provide important insight into body composition research. The traditional method proposed by Heath and Carter requires the use of different instruments and long measurement times often unsuitable for field evaluations. In this study, three new equations for estimating somatotype components in soccer players are provided. The new strategy proposed in this study allows for a minimal number of measurements and instruments for assessing somatotype, integrating anthropometry and BIA for an exhaustive evaluation of the body composition in soccer players."}
+{"text": "The effect of obtained pectins on viscoamylograph pasting and DSC thermal parameters of corn starch was evaluated. The contents of galacturonic acid, degree of methylation, acetylation, and ferulic acid content were higher in the pectin extracted by SWE, while the molecular weight was lower. Similar chemical groups were characterized by FTIR in both SWE and CE pectins. Color attributes of both pectins were similar. Solutions of pectins at lower concentrations displayed nearly Newtonian behavior. The addition of both pectins to corn starch decreased pasting and DSC gelatinization parameters, but increased \u0394H. The results offered a promising scalable approach to convert the beet waste to pectin as a value-added product using SWE with improved pectin properties.The objective of this study was to characterize the properties of pectin extracted from sugar beet pulp using subcritical water (SWE) as compared to conventional extraction (CE). The research involved advanced modeling using response surface methodology and optimization of operational parameters. The optimal conditions for maximum yield of pectin for SWE and CE methods were determined by the central composite design. The optimum conditions of CE were the temperature of 90 \u00b0C, time of 240 min, pH of 1, and pectin recovery yield of 20.8%. The optimal SWE conditions were liquid-to-solid (L/S) ratio of 30% ( Beta vulgaris L.) pulp (SBP), a by-product of the sucrose producing factory, undergoes processing steps including pressing and drying. Pulp drying is an energy-consuming process and uses about one-third of the whole energy needs of a sucrose factory [Sugar beet  was present in SBP. This result suggests there was not much inorganic matter in the pulp. The protein content of SBP was 6.1% DW (dry weight), which was in agreement with the values (6\u201310.3%) found in the literature [The results of the composition analysis of SBP showed that low ash content  implied that this model could explain a high percent of the variation in the observed data. According to CCD, the optimal conditions of SWE were at levels 1, \u22121, and \u22121 (codded), showing that a temperature of 130 \u00b0C, extraction time of 20 min, and L/S ratio of 30% (v/w) were the optimal conditions for SWE method. The verification of the experiments was conducted under optimal conditions in order to compare the predicted and the actual values of yield. The actual values (n = 3) were yield = 20.65, with 0.97 for the value of the desirability function. The highest yield, which achieved on these optimized conditions, was 20.65%. The rather low pectin yield could be attributed to the applied pressure and temperature of the extractor used for SWE in our study. Chen et al. [In the case of SWE, the value of Rn et al.  reportedp-value = 0.0003), while lack-of-fit value was insignificant , showing that the suggested model was significantly well-fitted. Additionally, an important correlation degree was observed between experimental and predicted data with an R2 value of 0.91. In the case of SWE, analysis of variance showed that the generated model was significant (p < 0.0001) and the lack-of-fit was insignificant (p = 0.1). The insignificant lack-of-fit is a good sign for model fit for the SWE method.The analysis of variance (ANOVA) results of the suggested model for the conventional extraction based on CCD  noticed p < 0.05), while the L/S ratio showed a negative linear impress on the pectin yield (p < 0.05).The steepness of response surface according to extraction time (B) and L/S ratio (C) showed that extraction time and L/S ratio had a great influence with the change of extraction conditions b. Furthep = 0.0003) and the lack of fit was insignificant (p = 0.66). The R2, adj R2, and CV values were 0.91, 0.84, and 6.76, respectively, indicating that the model can be used to navigate the design space. Optimization of conventional extraction conditions indicated that time and temperature showed positive, while the pH showed a negative, linear impact on the pectin yield. Extraction temperature (70\u201390 \u00b0C), extraction time (2\u20134 h), and pH (1\u20131.5) were considered as the conventional extraction variables. The ratio of solid to liquid was chosen to be constant (1:20) for all treatments [n = 3) were yield = 20.38, with 0.93 for the value of the desirability function. Extraction using the optimized conditions of conventional process achieved the best yield of 20.38%. The optimal conditions of conventional acid extraction include the highest temperature and time, and lower pH values.For the CE pectin yield, analysis of variance of the model showed that the generated model was significant p = 0.000 and the p > 0.05) and temperature (p < 0.05) showed positive linear impacts on the yield of pectin, while the pH showed a negative linear impact on the yield (p < 0.05). The extraction temperature exerts a linear effect on the pectin yield. Hence, the yield increased linearly with the increase in the extraction temperature within a range of 60\u2013100 \u00b0C. To sum up, SWE was more efficient for pectin extraction than CE method, reporting the same yields (SWE = 20.65% vs. CE = 20.38%) in a much shorter time (SWE = 20 min vs. CE = 240 min). In other words, the yield of SWE pectin for the extraction time of 20 min gained 20.65%, which is not significantly different from the CE method\u2019s yield (20.38%) after 240 min. Thus, by the application of subcritical water only for 20 min, the pectin extraction accelerated in comparison with the conventional extraction.The obtained range of conventional extraction yield at times, temperatures, and pH values, which were applied in the CCD, were 11.9\u201322.46%. It could be attributed to the pH of the suspension and the temperature of the water bath used for conventional extraction. Time (\u22121 indicated the ester carbonyl groups (COOR), and bands between 1620 and 1640 cm\u22121 indicated carboxylic ion (COO\u2212). Both conventional acid extraction and SWE pectins spectra exhibited bands at around 1518 and 1743 cm\u22121, which refer to the COOR and COO\u2212 groups. A broad absorption band found at 3400\u20133800 cm\u22121 on both of the extracted pectins was related to the stretching vibration of O\u2013H bonds. As shown in The infrared spectroscopy is a fast and convenient method for investigation of functional groups of polysaccharides. In order to confirm the pectin identity and the effect of SW on the structural properties of extracted pectin, the sample was analyzed by Fourier Transform Infrared Spectroscopy (FT-IR) and compared to the spectra of conventionally extracted pectin. FTIR allowed the determination of similar chemical groups in the SW and conventional acid extracted pectin. w/w) indicates the more pure pectin recovered from SWE compared to CE procedure, suggesting the great ability of this extraction technology to release pectin [w/w) and CE (68% w/w) pectins were both higher than the value reported by Huang et al. [w/w). Comparing these results with those obtained with other emerging extraction techniques, similar contents (73\u201376% w/w) were found by other authors in pectin obtained from fig (Ficus carica L.) skin by ultrasound-microwave assisted extraction [w/w), respectively. Pectins with high feruloyl groups tend to form stronger cross links [The chemical composition of pectin obtained under the optimal conditions is shown in e pectin . GalA cog et al.  for pecttraction . In conttraction . Based otraction . The ferss links . As showss links . The resss links . The ranss links . In thisss links ,30.The pectin color is a critical quality parameter for applications in food industry, preferring light-colored or colorless pectins for commercial applications .The lightness (L*), redness (a*), and yellowness (*b) values of SWE and conventionally extracted pectin were shown in Pectins from SBP are generally characterized by dark-color and have a high content of phenolic material . The polw/w were shown in w/w). In all solutions, viscosity was decreased with increasing the shear rate, showing a shear-thinning behavior. These observations were in agreement with the results found for pectin extracted from sugar beet pulp in other studies [The pectin sample obtained under optimal extraction condition was used for rheological tests. Shear stress and apparent viscosity of pectin extracted by SWE and conventional heating as a function of shear rate at concentrations of 0.5%, 0.75%, and 1%,  studies ,33, and  studies .0) increased from 1.2 to 1.52 mPa\u00b7s for SWE pectin solutions, and increased from 1.22 to 2 mPa\u00b7s for conventionally extracted pectin solutions with an increase in concentration from 0.5% to 1% w/w. One explanation for this trend could be that higher pectin concentration caused a nearly shear thinning behavior [As can be observed in behavior . The hig\u22121 is shown in The temperature dependence of the apparent viscosity of pectin solutions was also investigated. The apparent viscosity of both pectin types at a constant shear rate of 50 sThe pasting properties of the mixtures containing corn starch with water or corn starch/pectin with water at a concentration of 1%  showed tAnother elucidation for this result was that increasing the temperature caused hydration and blistering of the corn starch granules; thus, the concentration of the pectin in the fluid phase increased, and subsequently, the viscosity of the fluid phase increased. The relatively low peak viscosity (PV), due to the addition of pectin, implied that the mixture was suited for products requiring low gel strength and elasticity. The viscosity at the beginning of cooling or hot paste viscosity (HPV) of the corn starch pectin mixture increased in comparison to the corn starch. Final viscosity (FV) involves the molecular element present in the phenomenon of retrogradation with the beginning of molecular re-association together with increasing the viscosity. Reduction in FV indicated that the product contained corn starch, and added pectin could present viscous quality after cooking or cooling and also resist to shear stress during stirring . Accordip < 0.05) between onset temperature (TO), gelatinization peak temperature (TP), and complete temperature (TC) of corn starch with or without the addition of pectin. Therefore, the presence of pectin influenced the gelatinization characteristics of starch. A significant increase in TO was observed with the addition of CE pectin solution, which is in agreement with the results found by Chen et al. [O). The TP and TC of the corn starch and SWE pectin mixture were lower than those of corn starch (C \u2212 TO) also decreased. The possible explanation for this trend was that the association of SWE pectin and starch immobilize water molecules and reduce free water to starch ratios [The effects of SWE pectin at a concentration of 1% on the thermal properties of corn starch were investigated and results were illustrated in n et al. ; howevern starch . The phah ratios ,41, and h ratios . The enth ratios . Higher The wet sugar beet pulp (SBP) came from the pulps transported to the pulp press in the Khoy sugar factory . All sugar beets used in this factory were of Flores and Virginia varieties. Starch from corn  was used for pasting and thermal analysis.The moisture, protein, and ash contents of SBP were determined using AACC methods of 44.15 A, 46.13, and 08.01, respectively. Lipid and crude fiber contents were also determined according to the AACC methods of 30.10 and 32.10, respectively .SBP was oven-dried at 40 \u00b0C (moisture content less than 3%), ground using a desktop hammer mill  and sifted through 60 mesh sieve.The extraction of pectin from the dried pulp (moisture content less than 3%) was carried out using a laboratory-built batch-type instrument .The different parts of this system were a deionized water feed tank, a high-pressure metering pump (Comet type: MTP AX 2/70 m), an extraction vessel (70 mL) with heating wires wrapped around it, and a thermometer. The maximum pressure and temperature of the system were 5 MPa and 220 \u00b0C, respectively. The extraction vessel was heated before each run and the temperature was set to the desired value for extraction. When the temperature reached to pre-set value, extraction time was counted. After extraction, the obtained extract was filtered through a filter paper (20 \u03bcm) and chilled in an ice receptacle, then was precipitated with 2 volumes of anhydrous ethanol for 1 h. After that, a centrifugation at 15,000 rpm for 20 min was undertaken, and the assembled pectin was vacuum dried in an oven at 40 \u00b0C for 24 h. The extraction yield was measured using the equation below:The conventional extraction (CE) of pectin from the dried pulp (moisture content less than 3%) was carried out according to the method described previously . 1), extraction time (min) (X2), and liquid-to-solid (L/S) ratio (X3), on the yield of pectin recovered by SWE, and extraction temperature (X1), extraction time (h) (X2), and pH (X3) were considered as CE variables. Thus, a three-variable-three-level central composite design (CCD) consisting of 20 experimental runs was used to determine the optimal conditions for maximum yield of pectin achieved (2), adequate precision, and standard deviation. The effect of variables was displayed in 3D response surfaces.Response surface methodology (RSM) was used to determine the integrated effects of three independent variables, extraction temperature , prepared from a Milli-Q water purification system , for 15 h and centrifuged at 9072 g during 20 min at room temperature in a LABOFUGE ll centrifuge  to remove WIF. The supernatants were filtered through 11 and 3 \u00b5m Millipore membranes , respectively. The filtrates were oven-dried at 40 \u00b0C for 12 h to recover the \u201cpurified\u201d pectin, and weighed. The obtained pectins were used for the characterization.In order to eliminate the water-insoluble fraction (WIF), which could consist of cellulose, hemicellulose, and lignin, the pectic substances extracted from the conventional procedure or subcritical water at the optimum conditions were purified by a centrifugation process. The dried pectic substances were dissolved in fresh Milli-Q water .The pectin identity and the effect of SW on the structural properties of extracted pectin were determined through infrared spectra of pectin with a KBr -pellet technique using a Tensor 27 FTIR spectrometer  at the range of 400\u20134000 cmw/w%).The galacturonic acid  content of pectin was determined using high-performance anion exchange chromatography with a pulsed amperometric detector (HPAEC-PAD) according to the method described by Garleb et al. , which wv/v), containing 0.4 M sodium hydroxide, and held at a temperature of 4 \u00b0C for 2 h. The suspension was then centrifuged, and 20 \u03bcL of the clear supernatant was injected in the column [Thirty milligrams of pectin sample was suspended in 1 mL of isopropanol-water mixture . Twenty-five microliters of this material were injected into a WellChrom system HPLC equipped with a Perfectsil Target ODS-3 C18 column  coupled on line with an UV detector. Elution was carried out with 75% solvent A (Milli-Q water + 0.05% TFA) and 25% solvent B (acetonitrile + 0.05% TFA) at constant temperature of 25 \u00b0C and at a flow rate of 1 mL/min. Ferulic acid  was used as an external standard. The ferulic acid content was expressed as weight fraction of total pectin weight (w/w%).The ferulic acid content was determined by HPLC after saponification and extraction according to Yapo et al. . Pectin 3 0.1 M in water at a flow rate of 1 mL/min and detected by a refractive index detector. Six polysaccharides of MW of 12,200 to 830,000 g/mole including T1.5, GPC Standard 50, Glucose, T40, T10, and T750 were used for the calibration of the column.The molecular weight was determined by gel permeation chromatography (GPC), in combination with a high-performance liquid chromatography instrument  equipped with an Ultrahydragel Linear column . The purified pectin solution was centrifuged and passed through 0.45 \u03bcm and 3 \u03bcm filters; 50 \u03bcL of this solution were applied to a gel-filtration chromatographic column maintained at a temperature of 35 \u00b0C, eluted with NaNO0, a0, and b0 are color values of RAL color (1013). The comparison was carried out between lab color values of conventionally and SW extracted pectin.Pectin color was measured in the CIELAB space using a Minolta CR-300 portable colorimeter (standard illuminant D65) in terms of L* value (lightness), a* value (redness and greenness), and b* value (yellowness and blueness), as an average of three measurements at three different locations. The instrument was standardized against a white RAL color (1013)  before measurements. From these values, the total color difference (\u0394E) was calculated according to the following equation:w/w) of the two pectins obtained under conventional or SW extraction, were loaded onto a strain-controlled rheometer Anton Paar (DG26.7) with a 40 mm concentric cylindrical geometry, which was joint with a temperature-controlled water bath. Steady shear measurements were made in a range of shear rates from 0.1 to 100 s\u22121 at 25 \u00b0C.In order to define rheological characteristics, three different concentrations . The mixture was stirred manually for 1 min. The pectin-induced changes in pasting properties of normal corn starch were determined with a Brabender viscoamylograph (4.1.0) with a 700 cmg cartridge fitted with the rotation speed set at 75 RPM. The heating and cooling cycles were programmed in the following manner: the sample was heated at 7.5 \u00b0C/min from 30 to 95 \u00b0C, then held for 20 min at 95 \u00b0C, cooled to 50 \u00b0C at 7.5 \u00b0C/min, and then held for 20 min at 50 \u00b0C. The influence of adding pectin on thermal characteristics of normal corn starch was measured according to the method described by Chen et al. (2015) with slight modification. To identify how extracted pectins change the thermal characteristics of normal corn starch, differential scanning calorimetry (NETZSCH DSC200F3) was used. Normal corn starch (4 mg) was weighed into stainless steel pans, distilled water (20 \u03bcL) or pectin solution (1% w/w) was added, and the pans were hermetically sealed. After 1 h at 25 \u00b0C, the sample was heated from 30 to 95 \u00b0C at 5 \u00b0C/min. The DSC instrument was calibrated with indium and distilled water.The influence of adding pectin on pasting characteristics of normal corn starch was measured according to the method described by Chen et al.  with sliNormal corn starch  was used for measuring pasting properties (pasting temperature (Tp), peak viscosity (PV), hot paste viscosity (HPV), final viscosity (FV), breakdown (BD) and setback (SB)) and thermophysical characteristics of starch with and without conventional or SW extracted pectin.All experiments were done in triplicates. Optimization was carried out using Design-Expert software, version 10 . Normal distribution and homogeneity of variance were previously tested (Shapiro\u2013Wilk). The results of thermodynamic properties were assessed with the Independent-Samples T-Test, using the statistical software SPSS 16.0 .v/w). The maximum yield of pectin achieved in optimum conditions was 20.65%. The optimum conditions of conventional extraction were a temperature of 90 \u00b0C, time of 4 h, and pH of 1, and the highest pectin yield using these optimized conditions was 20.38%. SWE was more efficient than CE method, reporting the same extraction yields (SWE = 20.65% vs. CE = 20.38%) in a much shorter time (SWE = 20 min vs. CE = 240 min). Therefore, SWE was nearly 12 times faster than CE method. The rheological measurements indicated that the pectin solution exhibited Newtonian behavior in the concentration range of 0.5\u20131%. Addition of pectin decreased pasting parameters (except hot paste viscosity) and DSC gelatinization parameters of starch , while shifted \u0394H to higher values. The TO of starch was minimally affected by the addition of pectin. Brabender viscoamylograph results were in good agreement with the DSC results. The results offered a promising approach to convert the beet waste to a value-added product such as pectin. SWE as a green procedure can reduce pectin extraction time on an industrial scale. In addition, this method facilitates the achievement of the pectin with improved specifications.The purpose of this research was to use the subcritical water fluid as a novel technology and ecofriendly way for the extraction of pectin from SBP to maximize pectin extraction efficiency. The optimum extraction conditions by SW were as follows: temperature of 130 \u00b0C, time of 20 min, and liquid-to-solid (L/S) ratio of 30 ("}
+{"text": "In this study, the parameters for the microwave-assisted extraction of pectin were screened and optimized using Response Surface Methodology. The pectin was purified and then subjected to characterization. Results showed that the optimum extraction conditions were 195\u00b0C, 8% solid-liquid ratio, and pH\u20093 hydrochloric acid (HCl), with predicted and actual yields of 12.8% and 14.2%, respectively. The subsequent purification method increased the purity of pectin by 300%. The pectin was found to be low-methoxy in nature and had an average particle size of 300\u2009nm. The pectin application in whey protein isolate resulted in a shear-thinning fluid, with an improved viscosity compared to a control. When applied to a commercial orange juice, the  Musa acuminata x Musa balbisiana)) cultivar, whose stem can attain a height of four meters. Simultaneously, its bunches can have 8 to 16 hands having 12 to 20 fingers per hand. The fruits are short, stubby, and highly angular with thick green peels when unripe and yellow peel when ripe. The pulp is creamy white, fine-textured with well-developed cores and occasional seeds. The \u201cSaba\u201d cultivar is usually consumed fresh in its ripened state and processed to provide variety to the food product.Banana is a locally-grown fruit in the Philippines that is available in the market year-round. It is a very abundant agricultural produce such that in 2019, the Philippines ranked second in terms of world export, next to Ecuador [According to the most recent Philippine survey, 25% of the country's net banana production, or around 2 million metric tons for 2019, undergo food processing [Pectin is used as a gelling agent, thickener, and stabilizer for food products like jams and jellies. Its application is also extended to beverages such as fruit juices and soft drinks. A significant advantage of adding pectin in food is that it reduces cooking time, improves texture and color, and increases the shelf-life. Aside from its function as a food ingredient, there were also claims of nutritional benefits from pectin. It is a soluble fiber that can draw water from the digestive system, forming a gel that helps slow down digestion.Microwave-assisted extraction, one of the advanced ways of extracting pectin, has shown potential in saving time and energy and solvent consumption. The extraction of solutes from plant material using microwave involves penetration of solvent into the solid material, hydrolysis, diffusion to the surface, and external mass transfer to the solution . In the Studies involving microwave-assisted extraction of pectin have been performed for some substrates, including passion fruit , sour orGiven the abundance of banana peel waste and the understanding of its viability as a pectin source, it is an objective of this study to valorize the waste by extracting a high-value food ingredient from the banana peel. More importantly, the microwave-assisted extraction parameters were screened and optimized to maximize the yield of pectin\u2014also, the properties of the pectin from banana peel waste. Finally, an actual application to a food product was performed to assess the pectin's performance in improving some food qualities.The objective of this study is to evaluate and optimize the parameters , and pH) of the microwave-assisted extraction of pectin from \u201cSaba\u201d banana peel waste, characterize the pectin, and evaluate its thickening effect on beverages.2) and then dried at 50\u00b0C until constant weight. The dried banana peel was powdered using a countertop blender  and stored in a desiccator at room temperature (25\u00b0C). Common chemicals and reagents, unless otherwise stated, were analytical reagent grade purchased from Fisher Scientific, USA.Fresh peels from mature unripe \u201cSaba\u201d banana were obtained from a banana chip processing plant in Santa Cruz, Marinduque, Philippines. It was sliced into small pieces . The filtrate was separated, and an equal volume of 95% (v/v) ethanol was slowly added with continuous mixing. The mixture was incubated at 4\u00b0C for 2\u2009h. The resulting microwave-extracted pectin (MEP) was recovered by filtration. It was washed twice with the same volume of 95% (w/w) ethanol and then dried at 40\u00b0C until constant weight. The percent yield was calculated using the following equation. The extraction of pectin was done using a microwave digester  with adjustable temperature and irradiation time. Depending on the SLR specified in the experimental design, powdered \u201cSaba\u201d banana peel waste was added to hydrochloric acid of different pH. The mixture was placed in the middle of the microwave digester's rotating disc and then exposed to varying temperatures within a specified length of time. Microwave power, the reserved energy, was set at 1,000 Watts. After the extraction process, the mixture was cooled to room temperature (25\u00b0C) and then filtered using a Grade 1 qualitative filter paper (11\u2009w/v)), and pH (1-3) were evaluated.Screening using a full-factorial experiment was performed to determine which of the microwave-assisted extraction parameters have significant main effects on the pectin yield. Four parameters: temperature (80-140\u00b0C), time (30-90\u2009s), SLR (5-20% (w/v)), and pH (1-3) were evaluated. Meanwhile, the irradiation time for the extraction was standardized at 60\u2009s.A Central Composite Design was used to generate the combination of parameters for the microwave-assisted extraction of pectin from \u201cSaba\u201d banana peel waste. Three parameters: temperature (80-200\u00b0C), SLR . For the latter, the software analyzed the responses using multiple regressions, and the resulting significance coefficients were evaluated using The predicted optimum condition was validated by performing microwave-assisted extraction of pectin from \u201cSaba\u201d banana peel waste in triplicate and comparing the yield with the predicted value.w/v) was dispersed in deionized water. The mixture was homogenized with a dispenser  at 5,000\u2009rpm for 5\u2009min, and then stirred for 4\u2009h. It was then centrifuged  at 10,000 \u00d7 g for 15\u2009min. The supernatant was filtered with a Miracloth to remove any remaining residue. The filtrate volume was measured, and the purified microwave-extracted pectin (PMP) was precipitated by the addition of an equal volume of 95% ethanol. The mixture was centrifuged, and the PMP was collected by filtration using Miracloth. It was subjected to freeze-drying , and the yield was calculated using the following equation. Dried MEP  ratio.The pectin's total protein was measured using the protocol described by Walker . Solutio\u03bcg of bovine serum albumin (BSA) was used. The concentration of the protein, in terms of BSA, was derived from the standard curve.Two milliliters of solution C was added to a 0.1\u2009mL sample, mixed using a vortex, then incubated at 60\u00b0C for 15\u2009min. It was then cooled in an ice bath to reach room temperature (25\u00b0C). The absorbance was read against a blank (without sample) at 562\u2009nm. For the standard, 0- 60\u2009\u03bcm syringe filter. The filtered sample was diluted to 1\u2009:\u200910.The total pectic content was measured following the method described by Blumenkrantz and Asboe-Hansen . Seven aOne milliliter of the diluted sample/standard was drawn out and transferred to a test tube in an ice bath. Six milliliters of cold sulfuric acid/sodium tetraborate mixture (4.77\u2009g sodium tetraborate in 1\u2009L of sulfuric acid) was added to the sample. It was mixed thoroughly and kept cool. Tubes were boiled for 5\u2009min at 100\u00b0C and then placed immediately in an ice bath. One-tenth milliliters of 0.0125\u2009M m-hydroxydiphenyl  was added. The sample was repeatedly mixed in a vortex until it reached room temperature (25\u00b0C). The absorbance of the sample was read at 520\u2009nm against a blank after 20\u2009min.\u03bcg/mL of galacturonic acid in deionized water was used. For the blank, 0.1\u2009mL of 0.5% sodium hydroxide, instead of m-hydroxydiphenyl, was added. In terms of galacturonic acid, the concentration of the total pectic substance was derived from the standard curve.For the standard, 0-100\u2009\u22121) was bombarded to the sample at a resolution of 4\u2009cm\u22121 with data spacing every 1.928\u2009cm\u22121 for 64 scans. The resulting spectra were used to identify relevant peaks. A commercial  slow set low-methoxy pectin (LMP) was also analyzed for comparison.Approximately 12.5\u2009mg of pectin was mixed with 250\u2009mg potassium bromide. The mixture was finely pulverized and put into a pellet-forming die. A force was applied manually to form transparent pellets. For background measurement, a pellet holder containing potassium bromide (without pectin) was inserted into the sample chamber . Infrared radiation (400-4000\u2009cmw/v) was dissolved in deionized water through continuous stirring for 4\u2009h. The resulting solution was adjusted to pH\u20096 and then subjected to centrifugation at 10,000 \u00d7 g for 15\u2009min. The decantate was separated, sonicated for 5\u2009min to break any possible aggregates, and then diluted to a factor of 1,000 in deionized water. The particle size was then measured at 25\u00b0C using the Zetasizer Nano Series . A He\u2013Ne laser was used as the light source while an avalanche photodiode (APD) served as the detector.Pectin  of the concentration of WPI to that of pectin were 5, 10, and 15. The final pH was adjusted to 5, using 0.1-0.5\u2009M of hydrochloric acid or sodium hydroxide.For the effect of pH, pectin was dissolved in a WPI solution such that the ratio of the concentration of WPI to that of pectin was 10. The final pH was adjusted to 4, 5, and 6 using 0.1 to 0.5\u2009M of hydrochloric acid or sodium hydroxide.The resulting mixture was homogenized at 3,000\u2009rpm for 30\u2009s. It was subjected to one cycle of freezing and thawing (FT)\u2014equivalent to 24\u2009h of freezing at -18\u00b0C and 24\u2009h of thawing at 10\u00b0C. A control, composed of a WPI solution without pectin, was prepared for every pH condition. Moreover, incubation at 10\u00b0C for 48\u2009h was also done to simulate the condition without freezing.\u22121) was performed at 25\u00b0C.The resulting complex was carefully transferred to the rheometer's lower plate, and the surplus was removed using a plastic spatula after lowering the head of the rheometer to the trim position. Viscosity testing at varied shear rates (2-200\u2009sin vitro digestion viscosity of orange juice was tested following the protocol used for dietary fibers [w/v), was transferred to a 125\u2009mL Erlenmeyer flask with 4 \u00d7 1\u2009cm glass beads. Seven milliliters of simulated gastric fluid (SGF: 0.2% sodium chloride (w/w) in 0.7% hydrochloric acid (w/v)) was added. SGF also contains pepsin such that the latter's final concentration was 3.2\u2009mg/mL. The final solution was adjusted to pH\u20092.0 using 0.1-0.5\u2009M hydrochloric acid. It was then incubated in a shaking water bath at 37\u00b0C, at a 175\u2009rpm speed, for 2\u2009h to imitate gastric digestion. The viscosity at physiological shear rates [The pectin effect on the y fibers , with slar rates  was measTo the solution used in gastric digestion, 2\u2009mL of 750\u2009mM calcium chloride, 4.6\u2009mL of simulated bile fluid , and 12\u2009mL of simulated intestinal fluid  were added. The incubation with shaking was continued for 2\u2009h. The viscosity of the solution was measured in the first hour and at the end of the digestion.The major component of fresh \u201cSaba\u201d banana peel waste was water (86%). Other nutritional components, including ash (1.79%), crude fat (1.11%), and crude fiber (0.74%), were found to be minimal in quantity.p < 0.05) individual parameter was SLR. In addition, the 2-way interaction between SLR and temperature and the 3-way interaction between temperature, SLR, and pH were found to be significant (p < 0.05). The 3-way interaction has the highest level of effect on pectin's yield, followed by the 2-way interaction and SLR, accordingly.A factorial experiment was performed to screen and identify the significant parameters for the microwave-assisted extraction of pectin from \u201cSaba\u201d banana peel waste. The yield of crude pectin (data not shown) ranged from 1-10%. The ANOVA (data not shown) showed that the only significant  individual parameters. Their 2-way interaction was also significant (p < 0.05) and the square of SLR.The three parameters  identified in the factorial experiment were considered for the optimization study. A CCD  was usedThe response surface model  shows thThe level of effect of pH on the pectin yield was lower than that of temperature. In general, the pectin yield decreased as the acidity of the extracting solvent increased, except when the temperature of the extracting solvent was at the upper extreme.w/v) SLR, pH\u20093 HCl, and 195\u00b0C, with a yield of 12.8%. Upon validation, the yield was 14.20 \u00b1 0.01% or an 11% increase from the predicted yield. The obtained yield was greater than the microwave-extracted pectin from passion fruit (13%) [The model's equation in terms of coded parameters is shown in the following equationit (13%) .Upon characterization, the purity of MEP was found to be 8.83%. Upon repurification (redissolution and reprecipitation) of the MEP, purified microwave-extracted pectin (PMP) was obtained. The PMP has a 25.78% purity. As expected, the increase in the purity resulted in decreased yield\u2014from 14.2% to 4.8%. The said value is lower than that of the previously mentioned passion fruit, jackfruit rind, and sour orange peel.Results showed that the equivalent weight of MEP  was higher than its purified counterpart, PMP . Due to MEP's crude nature, it might contain other groups that contributed to the pectin's unit weight relative to the replaceable hydrogen. Moreover, PMP's lower equivalent weight may be attributed to a higher partial degradation during the extraction . In termThe total pectic content, which determines pectin's purity, was based on the appearance of a chromagen when uronic acid (upon heating at 100\u00b0C with sulfuric acid/tetraborate) was reacted with meta-hydroxydiphenyl. Results showed that the purity of MEP and PMP were 9% and 26%, respectively.The protein contents for MEP and PMP were 0.5% and 1.4%, respectively. The amount of protein in pectin is an important consideration for some food applications, particularly in an emulsion. The protein acts as the anchor between the pectin and the formed oil droplets in an emulsion, resulting in a more stable system .\u22121 were considered. This is the pectin's fingerprint region, where relevant functional groups absorb energy from the infrared source [\u22121, which accounts for the carboxyl group's symmetrical stretching vibration. A peak at around 1740\u2009cm\u22121, which describes the C=O bond's stretching in both the ester and carboxyl groups, was also present in LMP but not in MEP and PMP. These findings confirmed the result of the characterization that LMP (7.61%) has more methoxyl groups than MEP (0.16%) and PMP (2.01%). Despite the differences, all three pectins' methoxyl contents fall within the normal range for low-methoxy pectin, which is 0.1-7% [For the analysis of the FTIR, bands from 1800-1500\u2009cmd source .  Figures 0.1-7% .The particle size of materials, such as food ingredients, is particularly important in the food industry. Knowledge of particle sizes influences the production and handling of ingredients and the formulation, processing, and quality control of food and beverage products. Among the several methods for particle size determination, this study employed dynamic light scattering. The principle is based on a Brownian movement, wherein the fine particles in constant random thermal motion diffuse at a speed related to their size. The smaller the particles are, the faster is the diffusion.\u03bcm-6.5\u2009\u03bcm.Upon measurement of the apparent viscosities, the results  showed tThe mixing ratio and pH of a pectin-protein complex affect the rheological behaviour of a fluid. In this study, varying the shear rates did not generalize the effects of the mixing ratio and pH on the viscosity. However, under specific shear rates, the differences in the viscosities can be evaluated. Hence, a food process with a known shear rate can identify an appropriate mixing ratio and pH to achieve the desired viscosity of a fluid. On the effect of storage conditions, freezing and thawing resulted in almost the same viscosity of the complex as that of without freezing.\u22121 [p < 0.05) difference between the apparent viscosity of PMP-fortified orange juice and the control (without PMP). During gastric digestion, both PMP and LMP increased the viscosity of orange juice at a low physiological shear rate. At the same time, only the LMP showed an improved viscosity at a high physiological shear rate. In the remaining hours of the in vitro digestion, both pectins improved the juice's viscosity at the low physiological shear rate. Still, they exhibited the same viscosity as the control at a high shear rate. This finding agrees with the results of a related study wherein commercial brands of pectin were found to increase the viscosity of orange juice [For the rheology testing of pectin-fortified fruit juice, the viscosity was measured at physiological shear rates:10 and 50\u2009s\u22121 , as showge juice .A study correlating food viscosity with satiety suggested that fullness during a meal is higher for highly viscous food . Hence, w/v)), and pH . Further purification of the microwave-extracted pectin (MEP) resulted in a lower yield (5%) but higher-quality pectin .This study showed that microwave irradiation could be used to assist the extraction of pectin from \u201cSaba\u201d banana peel waste. Moreover, the model obtained to predict the optimum microwave-assisted extraction condition was valid, as shown by the close agreement between the predicted (12.8%) and actual yield (14.2%) of pectin. The identified significant parameters (and corresponding optimum conditions) were temperature (195\u00b0C), SLR (8% (in vitro digestion viscosity of orange juice, an improvement of viscosity was observed at low shear rate digestion. Overall, the pectin extracted using the optimized microwave-assisted extraction has shown potential for food applications as a thickener.The rheological study showed that the WPI-PMP complex exhibits a shear-thinning property. Moreover, the effects of both mixing ratio and pH can only be evaluated at specific shear rates. On pectin's effect on the"}
+{"text": "Between patients with a large breast volume, only a higher prevalence of ER (+) tumors was found  compared to those with small breast volumes. The obese BC patients showed significantly higher rates of large tumors , axillary invasion , undifferentiated tumors (38.2% vs. 23.2%) and unfavorable NPI (p\u2009=\u20090.04) than non-obese women. Those with WHR\u2009\u2265\u20090.85 presented higher postsurgical tumor stages , higher axillary invasion , more undifferentiated tumors , higher lymphovascular infiltration , and a higher NPI . No statistically significant differences were found according to menopausal status. We conclude that obesity, but especially central obesity can be associated with a more aggressive tumour phenotype. No relation between breast volume and tumoral prognostic factors was found, except for a higher proportion of ER (+) tumor in women with higher breast volume.The objective\u00a0of this study was to investigate whether the BC tumor biology in women with larger breast volume, in obese women and especially in women with central adiposity at the moment of diagnosis of BC is more aggressive than in those women without these characteristics. 347 pre- and postmenopausal women with a recent diagnosis of BC\u00a0were analyzed. In all patients, anthropometric measurements at the time of diagnosis was collected. In 103 of them, the breast volume was measured by the Archimedes method. The Breast volume, BMI, WHR and the menopausal status were related to different well-known pathological prognostic factors for BC. At the time of diagnosis, 35.4% were obese (BMI\u2009>\u200930\u00a0kg/m Some recognized anthropometric factors influence BC prognosis. A high body mass index (BMI) is associated with worse prognosis in premenopausal and postmenopausal women7.There is a growing interest in the association between obesity and breast cancer (BC). Epidemiological data have revealed an association of increased BC incidence and mortality with obesity, particularly in postmenopausal women8. It is still unclear whether a higher BMI is associated with positive estrogen receptor (ER) or progesterone receptor (PR) BC. Some, but not all9, studies11 have suggested a higher percentage of ER (+) BC among obese postmenopausal patients than among nonobese patients.Some studies have revealed a worse BC prognosis  among obese postmenopausal women than among nonobese women13. In addition, a high waist circumference has been associated with an advanced histological grade in postmenopausal patients and with larger tumors in premenopausal women13.Abdominal (waist) circumference is a parameter used to measure and diagnose central obesity, which is closely related to the prognosis of BC. Consequently, a high waist circumference is associated with a worse BC prognosis in premenopausal and postmenopausal women14. However, other authors have described a higher WHR as an independent poor prognostic factor in ER-positive postmenopausal women after adjusting for BMI15. A high WHR can be used as an indirect marker of a high testosterone/estrogen ratio and, possibly and most importantly, of insulin resistance and high fasting insulin, pro-insulin and C-peptide levels in women18. Hyperinsulinemia could also be associated with a worse outcome in advanced BC patients21.After adjusting for BMI, an association between a higher waist\u2013hip ratio (WHR) and worse prognosis of BC has been suggested in patients with premenopausal BC but not in those with postmenopausal BC26. Although breast size is strongly correlated with BMI27, only one-third of the genes that contribute to breast size have been shown to influence BMI28. In young women who are nonusers of oral contraceptives, during the follicular phase, breast size was significantly positively associated with insulin-like growth factor-129. In addition, a large breast size at age 20 has been described as a predictor of type 2 diabetes mellitus in middle-aged women, even after adjusting for BMI and WHR30. Patients with ER-negative BC and type 2 diabetes have a higher risk of metastasis and mortality than patients without diabetes, but this was not observed in patients with ER-positive BC31.In some studies, the size and volume of the breast have been associated with more aggressive characteristics of the tumor at the time of diagnosis in pre- and postmenopausal women32. However, different manufacturers have an inconsistent bra cup sizes33. On the other hand, the use of cup size alone without taking rib cage circumference into account is a poor surrogate for actual breast volume, even when BMI is taken into consideration33. The measurement of breast volume using plastic cubes used by plastic surgeons performing breast reductions and reconstructions leads to more reproducible results34. This system, based on Archimedes' method, has been rarely used and allows us to better evaluate whether the breast volume itself has an impact on the type or growth pattern of the tumor. The identification of prognostic factors makes it possible to better adapt the treatment and can also help to identify pathophysiological pathways and therapeutic innovations in this area.Studies that investigate the size of the breast in relation to BC have frequently used bra cup size  as a reference measureThe goal of this study was to investigate whether the BC tumor biology in women with larger breast volume, in obese women and especially in women with central adiposity at the moment of diagnosis of BC is more aggressive than in those women without these characteristics.A cross-sectional study was carried out in Caucasian pre- and postmenopausal women with BC. Before surgical treatment for their primary BC, in all women, a gynecological and nutritional history was performed, and anthropometric measurements and breast volume measurements were performed. The patients were excluded if they had a previous history of breast plastic surgery (mammoplasties to increase volume or reduction surgery) and/or history of breast\u2010conserving surgery (that deformed the breast), had previously undergone abdominoplasty surgery, were receiving neoadjuvant therapy currently or received it in the last 12\u00a0months, were receiving or had received any hormonal therapy (HT) during the last 12\u00a0months, had gone on a strictly restricted diet in the last 12\u00a0months, had lost\u2009>\u20093\u00a0kg in the last year, suffered from carcinoma in situ , claimed to not understand the object of the investigation, or did not sign the informed consent form in order to take part in the study.2), and obesity was defined as a Quetelet Index\u2009\u2265\u200930\u00a0kg/m2 according to the World Health Organization (WHO) definition. Waist circumference was measured using a plastic tape measure with metric graduation and a minimum increment of 1\u00a0mm (mm). This tape measure was placed at the midpoint between the lowest rib and the iliac crest, with the patient standing after gentle expiration. Hip circumference was measured by placing the tape measure around the top of the hips and buttocks at the widest point. Waist-hip ratio (WHR) was calculated in all women. A WHR\u2009\u2265\u20090.85 indicated central obesity. The breast volume was measured by the Archimedes method by introducing the breast in a container with warm water and measuring the volume of the displaced water. In fluid mechanics, we speak of displacement (or dislodged volume) when an object is immersed in a fluid and displaces it. The volume of the displaced fluid can be measured, and from this, the volume of the submerged body can be deduced . Displacement can be used to measure the volume of a solid object, even if its shape is not regular. We have used the method by which the object (the breast) is immersed in a completely filled container of water, causing it to spill over. Then, the spilled water is collected in another larger container placed below the previous container, and its volume is measured, which will be equal to the volume of the object introduced (the breast). All measurements were taken by the same observer to reduce intraobserver error. Large breasts are considered when they have a volume\u2009>\u2009600\u00a0cc (median). Women with amenorrhea\u2009\u2265\u20091\u00a0year and FSH levels\u2009>\u200940 UI/l were defined as menopausal.Weight was determined with a tested precision electronic scale that displayed weight in 0.1\u00a0kg (kg) increments; the patients did not wear heavy clothes or shoes. Height was determined in 0.5-cm (cm) increments with the patient barefoot on a stadiometer. Body mass index (BMI)\u2009=\u2009mass (kg)/height . The study of estrogen receptors (ERs), progesterone receptors (PRs), c-erbB2 and Ki-67 was carried out through immunohistochemistry techniques. Triple-negative tumors (TNs) were defined as ER negative, PR negative, and c-erbB2 negative. In the BC patients who needed neoadjuvant treatment (chemotherapy and/or endocrine treatment), all the pathological factors of the tumor were determined from the previous diagnostic biopsy, except the possible axillary affectation, which was evaluated as negative in the clinical exploration or positive if fine needle aspiration biopsy or core needle biopsy of axillary adenopathy was performed before neoadjuvant treatment.35. Approval was obtained from our hospital ethics committee (Research ethics committee of Cadiz/CEI/15032016).This study was conducted according to the guidelines of the Declaration of Helsinki and resolution 196/96 of the National Health Council on Research Involving Human Subjectsp value\u2009<\u20090.05.Data were compiled and analyzed using SPSS 15.0 for Windows . All data are expressed as the mean\u2009\u00b1\u2009standard deviation. Clinical and anthropometric variables of patients were compared between the two different groups of women . Prognostic tumor characteristics in patients with BC were analyzed according to their breast volume, BMI, WHR, and menopausal status. The relationship between breast volume and BMI in all patients with breast cancer was calculated. Statistical analysis was carried out by calculating frequencies, means and standard deviations. Generally, percentages are reported in relation to responses to specific questions and may vary between items. Chi-square or Fisher's exact tests were adopted for comparisons of frequencies, and Student's t-test was used for comparisons of means. The nonparametric Mann\u2013Whitney U-test or Kruskal\u2013Wallis test (when appropriate) was used to assess the differences in the distribution of the prognostic factors in the different groups. The bivariate correlation coefficient of Pearson's r was used to determine whether there was a linear relationship between breast volume and age, BMI or WHR. Statistical significance was indicated by a This study was conducted according to the guidelines of the Helsinki Declaration and resolution 196/96 of the National Health Council on Research Involving Human Subjects. Approval of our hospital ethics committee was obtained (Research ethics committee of Cadiz/CEI/15032016).All participants signed an informed consent before taking part in the study.The study included 402 consecutively enrolled patients; 365 (90.7%) did not meet the exclusion criteria, and 347 agreed to take part (participation rate of 86.3%). For the study of breast volume, information was only obtained for 103 patients (103/347\u2009=\u200929.68%).2), 64.5% were nonobese, 60.2% had a WHR\u2009\u2265\u20090.85, 39.8% had a WHR\u2009<\u20090.85, 68.8% were postmenopausal, and 31.1% were premenopausal. Of the 103 patients assessed for this variable, 44.7% had a breast volume considered \"large\" (>\u2009600\u00a0cc), compared to 55.3% with \"small volume\u201d breasts (<\u2009600\u00a0cc). There were no systematic differences in age, TNM classification, or the use of adjuvant endocrine treatment between BC patients who participated and those who declined participation (data not shown).Of these women, at the time of diagnosis, 35.4% were obese . The mean WHR was 0.87\u2009\u00b1\u20090.74, which was also significantly greater in the group with large breasts  , and the WHR was also significantly higher than that of premenopausal women (0.88\u2009\u00b1\u20090.10 vs. 0.84\u2009\u00b1\u20090.07)  and in patients with a high WHR . Although the postmenopausal women also presented more voluminous breasts , the differences were not significant  and WHR  (data not shown), and the correlation was even stronger with BMI   compared to those with small breast volumes  tumors was found , a higher percentage of axillary involvement , a higher proportion of undifferentiated tumors (38.2% vs. 23.2%) and higher rates of unfavorable NPIs (p\u2009=\u20090.04) than in the nonobese group (Table p\u2009=\u20090.03), higher axillary invasion , more undifferentiated tumors , higher lymphovascular infiltration , and a higher NPI   Table .Table 5PThe main finding of this study was that compared to nonobese women, obese women with BC, especially BC patients with central adiposity, present several tumor factors indicating worse prognosis, regardless of menopausal status. On the other hand, we did not find an inverse relation between breast volume and tumor prognosis; rather, we observed a greater number of ER (+) tumors in patients with larger breasts.26, which conclude that women with larger breasts have more aggressive tumor characteristics than women with smaller breasts. In our study, we found a very consistent relationship between breast volume and BMI, but the relationship between breast volume and central obesity was less consistent. As stated before, central obesity (with hyperinsulinemia), not general obesity, could be associated with tumoral factors associated with worse prognosis. Thus, the volume of the breast would not be so related to the tumor prognosis because its relationship with the central adiposity is much lower. Most likely, the investigation of the fat/gland ratio of the breast or the mammographic density in these women could be of great value to assess the pathological risk in a more precise way27, but this was not part of this study.Therefore, our findings are not in agreement with previous studies10, it is not clear whether the associations found here are linear or they would change in individuals with more extreme BMI values.The measurements in this study were taken before surgery by the same person, a nurse trained for this purpose, to minimize the risk of bias. We do not know if our results can be extrapolated to patients of other races or to another population with a higher prevalence of obesity. On the other hand, taking into account that many previous studies were carried out in groups of patients with a greater range of BMI than what was observed in our study population36. Some studies have indicated a clear association between cancer and the insulin/IGF-1 axis40. Three of the studies demonstrated the participation of these factors in BC40. In conjunction with our finding of more ER (+) cancers in women with larger breasts, in the meta-analysis conducted by Key et al. in 2010, it was shown that the increase in IGF-1 levels was only associated with the risk of ER-positive BC40. In the follicular phase of the menstrual cycle, IGF-1 levels were positively associated with breast size in young null gravid women who did not use oral contraceptives29. In line with this finding, Hartmann et al41 showed that the success rate of breast augmentation resulting from estrogen stimulation was dependent on a subsequent increase in IGF-1 concentrations in women. On the other hand, high IGF-1 has been linked to mammographic density in premenopausal women, and mammographic density is significantly associated with mortality from BC43. According to these works, a larger breast size may therefore be a substitute marker for high levels of IGF-1. However, we cannot provide additional evidence since we have not analyzed the circulating levels of IGF-1 in our patients because it was not the objective of our study. Similarly, as we found that a large proportion of patients with larger breast sizes had ER-positive breast tumors, the measurement of estrogen levels in these patients would be an interesting point to be addressed, but we did not measure estrogen levels because this was not the objective of our study. A WHR\u2009>\u20090.85 was associated with more aggressive tumor characteristics in our study. A high WHR can be an indicator of a number of unfavorable conditions, such as a high testosterone/estrogen ratio44, increase in cortisol in response to stress or metabolic problems17 or hyperinsulinemia45.A plausible mechanism that could underlie the association between breast size and cancer prognosis may be an increase in IGF-1 levels46. Measurements of circulating androgens, insulin, IGF-1, and cortisol may be beneficial for patients with a high WHR, as these measures may provide information regarding which pathway to target during BC treatment. There are ongoing trials with metformin47 and a phase II trial of nonsteroidal antiandrogen bicalutamide in women with ER (\u2212)/PR(\u2212)/AR(+) (androgen receptors) BC .Consequently, hyperinsulinemia (associated type II diabetes) associated with increased CHF could be important for the prognosis of BC. In mice, visceral fat has been shown to increase inflammation and aromatase expression in the mammary gland48, in our study, patients with a BMI\u2009\u2265\u200930\u00a0kg/m2 had larger tumors. Similar to Markkula et al48, we found no association between BMI\u2009\u2265\u200930\u00a0kg/m2 and hormone receptor status, in contrast to the results of Enger et al10. In the Enger study, only 73% of the tumors were ER positive, compared to more than 85% in the Markkula study and 85.4% in our study.Consistent with previous studies48, despite finding larger tumors in the obese population, the researchers did not find a significant association between obesity and the prognosis of BC. This differs from the results of Petrelli et al8, who analyzed 2,852 deaths from BC in postmenopausal women with a follow-up of 14\u00a0years and found a worse vital prognosis among obese women.In one studyIn conclusion, the present study demonstrates, in our environment, the relationship of obesity, especially central obesity, with several tumor biological factors indicating poor prognosis. On the other hand, in the global population , we have not been able to find any association between breast volume and prognostic factors of BC, except for a greater proportion of ER (+) tumors in women with larger breast volumes. Menopausal status was not related to prognostic variables.For future research, we believe that the acquisition of additional data is required to support our conclusions. In particular, the serum levels of insulin, IGF-1 and 17b-estradiol and their correlation with prognostic parameters in lean and obese patients should be assessed. This would support the role of central obesity in worse prognosis.Our results justify the performance of a simple, fast and inexpensive anthropometric measurement (WHR) in mammary oncology clinical practice; this measure could provide important prognostic information beyond what is obtained through the report of pathology anatomy and clinical evaluation. Therefore, the results could be taken into account to adapt the intensity and modality of the treatment and follow-up of these patients with central obesity and to propose preventive treatments for the related and nonrelated morbidity and mortality . We believe we should continue investigating the possible relationship of breast volume with the prognosis of BC, especially in postmenopausal women with ER (+) BC."}
+{"text": "The achievement of structural color has shown advantages in large-gamut, high-saturation, high-brightness, and high-resolution. While a large number of plasmonic/dielectric nanostructures have been developed for structural color, the previous approaches fail to match all the above criterion simultaneously. Herein we utilize the Si metasurface to demonstrate an all-in-one solution for structural color. Due to the intrinsic material loss, the conventional Si metasurfaces only have a broadband reflection and a small gamut of 78% of sRGB. Once they are combined with a refractive index matching layer, the reflection bandwidth and the background reflection are both reduced, improving the brightness and the color purity significantly. Consequently, the experimentally demonstrated gamut has been increased to around 181.8% of sRGB, 135.6% of Adobe RGB, and 97.2% of Rec.2020. Meanwhile, high refractive index of silicon preserves the distinct color in a pixel with 2\u2009\u00d7\u20092 array of nanodisks, giving a diffraction-limit resolution. Here, the authors fabricate a metasurface with high brightness and large gamut structured colors by combining a silicon metasurface with a refractive index matching layer. The experimentally demonstrated gamut is 181.8% of sRGB, 135.6% of Adobe RGB, and 97.2% of Rec.2020. The most frequently used colors are produced by pigments and dye. Such colors are formed by absorbing certain wavelength range in visible3. They are typically dim and has a tiny gamut. The spot sizes of pigments are on the order of 25\u2009\u00b5m, resulting in a poor resolution below 1000\u2009dpi. To tackle the obstacles of pigments, the colors from structured materials have been revisited and several technologies are developed. One prominent example is the plasmonic structural color7. The interplay between light and plasmonic nanostructures such as gratings9, nanogaps11, and nanoparticles13 can produce vivid colors covering the entire visible spectrum. The local surface plasmon of individual Mie scatter has even pushed the imaging resolution to the resolution-limit of a bright-field microscope16. All-dielectric structural color is another important approach19. The electric/magnetic dipole modes and the collection resonance make the metasurfaces selectively transmit or reflect particular wavelengths. As some dielectrics are transparent in the visible, all-dielectric structural color are usually more vibrant and their gamut can be several times larger20. Recently, dynamically reconfigurable structural color have also been demonstrated by applying liquid crystals, microfluids, phase transition materials, or gain materials23.Colors, arising from the light-matter interaction, play vitally important roles in the world in which we live24, digital displays25, molecules sensing26, optical security27, and information storage28 are still restricted. This is because both types of structural color only possess one or a few the above unique characteristics, far from the commercial requirements. This predicament is more overt in Fig.\u00a029. All-dielectric nanostructures such as TiO2 metasurfaces are distinct and vibrancy in bright-field30. But their spatial resolutions are an order of magnitude lower than their plasmonic counterparts. In addition, the record gamut area in experiment is only 68% of the Rec.202031, far below the industrial requirements. Up to now, there is no structural color that can match all the above critical criterion simultaneously. Herein, we propose and experimentally demonstrate an all-in-one solution for structural color. By combing Si metasurface with a refractive index matching layer, high-brightness and distinct structural color with diffraction-limit resolution has been realized. The corresponding gamut area has been increased to 181.5% of sRGB.Despite of the above continuous successes, the practical applications of structural color in surface decoration34. The sophisticated design on nanostructures gives the possibility of concealing its shortage and improving the color impression37. In addition, the large refractive index of Si enables simple structures for high-performance structural color, essential for the cost-effective nanofabrication39. Fig.\u00a0R and lattice size l. The thickness is fixed at h\u2009=\u2009100\u2009nm. Panel I in Fig.\u00a029.To achieve an ultimate solution, we revisited the Si metasurfaces. From the material side, silicon is extremely stable and compatible to the modern CMOS technologies, naturally matching the requirements on mass-manufacturability and long-time durability40, the destructive interference between electric dipole resonance and magnetic dipole resonance shall further decrease the undesirable reflection outside the main reflection peak. Meanwhile, the electrical dipole resonance is localized closer to the boundaries and is more sensitive to the environmental refractive index changes than the magnetic dipole. As a result, the refractive index matching layer can push the electric dipole resonance to the magnetic dipole resonance and thus narrow the FWHM of reflection spectrum. Figure\u00a0n\u2009=\u20091.48. As expected, both the white-background and the FWHM are well suppressed by the Kerker condition, which are caused by the reduced refractive index contrast and the different responses of electric and magnetic dipole resonances  are also independent to the incident angle  with a combined process of electron-beam lithography and reactive ion etching (see the \u201cMethods\u201d section). To test the influences of refractive index matching layer, the metasurfaces were integrated into a microfluidic channel after the fabrication and simply infiltrated with dimethyl sulfoxide (DMSO) with n\u2009=\u20091.48. The color performances were optically characterized with a bright-field optical microscope (see the \u201cMethods\u201d section). Figure\u00a02 metasurfaces43 and 40% narrower than the ones in air  wafer . This is because the fabrication technologies of different materials are in-compatible and the top layers are usually deformed during the etching of bottom materials. In current experiment, only single-crystalline silicon has been employed in the nanofabrication process. The CMOS compatible fabrication technology of Si is mature and highly reproducible. As a result, the nanostructures can be well produced by lithography and transferred to silicon via reactive ion etching. The high-resolution tilt-angle SEM images show that the roughness is smaller than 10\u2009nm and the sidewall is nearly 90\u00b0 in the vertical direction 45.In summary, we have proposed and experimentally demonstrated structural color produced by the Si metasurfaces. By applying an index matching layer, the structural color from Si metasurfaces can possess a series of unique properties, i.e. high reflectance (76% at 600\u2009nm), narrow FWHM (~34\u2009nm), negligible background reflection. As a result, the gamut area has been pushed to a record value around 97.2% of Rec.2020. and the spatial resolution is increased to the diffraction limit without spoiling the color uniformity and impression. As the nanostructures are purely made of silicon, they naturally inherit the mass-manufacturability and long-time stability characteristics of silicon photonics. As the stars plotted in Fig.\u00a0The simulations of the reflectance spectrum are calculated by the commercial software Lumerical FDTD Solutions and the COMSOL Multiphysics. The periodic condition is used in the plane to mimic the periodic structures. Perfectly matched layers are applied in the transmission and reflection directions to absorb the outgoing waves. The refractive index of single-crystalline silicon is taken from the material date of the software. The refractive index of sapphire is fixed at 1.76. A MATLAB code is used to calculate the xy coordinates, which are plotted in International Commission on Illumination (CIE) 1931 chromaticity diagram (see details in Supplementary Note\u00a0The Si metasurfaces are fabricated with electron beam lithography technique followed by a reactive ion etch (RIE) process in an Oxford Plasma System (Oxford 80). Basically, the inversed nano-pattern is generated within a PMMA electron beam resist . The pattern is transferred to Cr mask via a lift-off process. Then the Si nanostructures are produced by the RIE process and removing the Cr mask with the chromium etchant  stage associated with a home-made optical setup to control the polarization and incident angle. The reflection spectrum is recorded with a spectrometer under the \u00d750 objective lens (NA\u2009=\u20090.55), see details in Supplementary Note\u00a0Supplementary Information"}
+{"text": "Ionizing radiation is a common tool in medical procedures. Monte Carlo (MC) techniques are widely used when dosimetry is the matter of investigation. The scientific community has invested, over the last 20 years, a lot of effort into improving the knowledge of radiation biology. The present article aims to summarize the understanding of the field of DNA damage response (DDR) to ionizing radiation by providing an overview on MC simulation studies that try to explain several aspects of radiation biology. The need for accurate techniques for the quantification of DNA damage is crucial, as it becomes a clinical need to evaluate the outcome of various applications including both low- and high-energy radiation medical procedures. Understanding DNA repair processes would improve radiation therapy procedures. Monte Carlo simulations are a promising tool in radiobiology studies, as there are clear prospects for more advanced tools that could be used in multidisciplinary studies, in the fields of physics, medicine, biology and chemistry. Still, lot of effort is needed to evolve MC simulation tools and apply them in multiscale studies starting from small DNA segments and reaching a population of cells. Ionizing radiation (IR) is used in several medical procedures either for therapeutic and/or for imaging/diagnostic procedures. When used for therapeutic purposes, e.g., to effectively treat cancer, the main goal is to successfully irradiate malignant cells while ensuring healthy tissues absorb the lowest possible dose. Following this technique, malignant cells are killed while healthy cells remain healthy, avoiding possible genetic aberrations or cell death ,2,3,4. TThe scientific community has invested a lot of effort in understanding the response mechanisms initiated and generally involved in IR-induced DNA damage. Particularly, the exact radiochemical mechanisms that produce single strand breaks (SSBs), double strand breaks (DSBs), and clustered/complex DNA damage (CDD) which can consist of multiple DSBs and/or closely spaced (within 10\u201320 base pairs) non-DSB lesions, such as oxidized bases and abasic sites ,6, as weThe present review article aims to improve the understanding of the field of IR-DDR in general by providing an overview of Monte Carlo simulation studies that try to explain several aspects of cancer treatment using IR. Some mathematical studies on the investigation of DDR have also been included.www.scopus.com), the relevant documents in \u201cDNA damage\u201d and \u201cMonte Carlo simulations\u201d total almost 380 over the last 30 years  where tMonte Carlo track structure (MCTS) codes are widely used for simulating the transportation of ionizing particles in biological matter at small scales (nm-\u03bcm). Thus, they offer a valuable theoretical tool for mechanistic radiation effect studies, especially in quantifying DNA damage under different radiation qualities, which still presents a major challenge in radiobiology research . This isTo reach a spatial resolution at the DNA level, it is necessary to adopt a more detailed description of particle transport, as shown in MCTS codes for water have been used for over 40 years in radiation biophysics, and more than a dozen such codes have been reported in the literature , with th6 MeV/u). It is noteworthy that the TOPAS-nBio software [The aforementioned MCTS codes are not publicly available. Therefore, in recent years, there have been efforts to implement track-structure models into some general-purpose MC codes to enable simulations at both the macro and microscopic scale. The most notable examples are the Monte Carlo N-Particle version 6 (MCNP6) , PENELOPsoftware , which esoftware  to the  and therefore they introduce a wide uncertainty to the simulation of track structures. This undoubtedly influences the results of MCTS simulations, e.g., the number of interactions within a certain volume, which is very critical when it comes to nanodosimetry (somewhat less for microdosimety). Thus, there is an urgent need for benchmarking MCTS codes with some efforts being done recently . The comCurrently, there are two methods used to estimate DNA damage. The first method is to estimate potential DSBs by superimposing DNA geometry to the radiation track structure ,96,97,98The RADAMOL ,109 toolA recent addition on simulating radiation chemistry and track structures at the subcellular scale is the MPEXS-DNA, GPU-based Monte Carlo simulator . MPEXS-D56Fe), with kinetic energies up to a few GeV [The Monte Carlo Damage Simulation (MCDS) ,103 algo few GeV ,103,104. few GeV . Conside few GeV . It musthttp://www.rcsb.org/) is a big database that contains high detailed DNA molecules, but it does not contain every DNA molecule. In Geant4-DNA, there is an example  . PDB (ht(PDB4DNA ) that inhttps://simtk.org/projects/simbody/) and Molmodel (https://simtk.org/projects/molmodel). These algorithms allow the implementation of specified joint constrains using coordinates, which allow the user to control the flexibility of the generated molecule. MMB can simulate the interactions between bases, which are exploited to produce the geometry of any combination of base pairs. An analytical classification of base pairs can be found in the Leontis\u2013Stombaugh\u2013Westhof catalog [A DNA simulation tool is MacroMoleculeBuilder (MMB) , which h catalog . The catFurthermore, Howell et al. proposed a simulation algorithm for the modelling of B-DNA . They exCumberworth et al.  introducThe above-described DNA simulation models have not yet been used in MC simulations. Recently, DnaFabric  has beenCellular response to IR has been investigated for years, showing the dependence of DNA damage on the deposited energy , on the delivery time-frame, on the dose rate, on the radiation particle type and energy, and in general on the quality of radiation. Mechanistic simulations and mathematical modeling have been extensively used in biological and medical applications of IR. They simulate, estimate and quantify the absorbed dose, calculate the dose distribution, provide information on the radiation source and assess the biological effects of specified radiation. In addition, they help to integrate the knowledge acquired by the experimental data into a quantitative frame and finally to understand, analyze and inter-/extrapolate observed tendencies. The literature proposes that the main determinant of detrimental effects of IR is the complex DNA damage as presented in Several types of IR are exploited in medical science, either for low-dose procedures  or for higher doses , from X-rays and gamma rays to electron, protons and heavier ions, with a variety of dose rates. As already noted, they are used because of their special interaction with biological matter i.e., photons experience photoelectric effect and Compton scattering as well as pair production and Rayleigh scattering, while charged particles interact through other mechanisms. In general, the damage that is produced by the IR is categorized into two mechanisms, direct and indirect damage. \u22121), produced by the electromagnetic interaction of radiation with matter, interact chemically with tissues, cells, and DNA. Moreover, IR can also be categorized by the energy loss of radiation per unit path length, called linear energy transfer (LET), which is an indicator of the resulting biological effect, to (a) high-LET and (b) low-LET radiation. It must be noted that some of the work with radiobiological modelling at the nanometer scale is to search for a way to characterize IR other than LET. It is important to point out that even though LET is widely used, it has limitations when it comes to characterizing IR in terms of biological outcome. More specifically, we refer to the shortcomings of the relative biological effectiveness (RBE) vs LET relationship due to broad LET distribution, as in a single spread-out Bragg peak (SOBP) or in multiple overlapping radiation fields as discussed in [Direct damage is produced when primary particle or secondary electrons, which have been produced by the interaction of primary radiation with matter, interact electromagnetically with tissues, cells, and the DNA. Indirect damage occurs when free radicals 2 to DNA strand breakage and the DNA fragmentation dependency to LET. Their results were compared with published data by the fast Monte Carlo damage simulation (MCDS) tool [Friedland et al., in a very extended article , simulatDS) tool ,104,131.Karamitros et al.  presenteMeylan et al.  simulateTang et al.  simulateA theoretical framework was presented by Cuhna et al.  that canRecently, Tsai et al.  and Lai A very important parameter that must be considered when trying to simulate the DNA damage induced by IR is that the cell has the ability to repair itself. In most simulation codes, it is difficult, because of the time barrier, to take into account this fact, in parallel with the DNA damage calculation. However, there are a few studies that have calculated this variable.Friedland et al. ,59 have Barnard et al.  explaineIn a very preliminary study, Warmenhoven et al. ,156 inveThere have been groups that have only studied the modeling of the repair processes after the production of DSBs. A very preliminary study was one by Cucinotta et al.  that anaTaleei et al.  developeRahmanian et al.  describeWoods et al.  presenteCleri et al.  simulateTello Cajiao et al.  extendedRecently, Li and Cucinotta  developeApart from these Monte Carlo codes, which attempt to describe mechanistic DNA damage and repair kinetics, there are also many radiobiological phenomenological macroscopic models which have been developed to describe the response of cells under irradiation, which correlate cellular reaction to the delivered dose and other parameters expressing cell sensitivity, and which are currently used in clinical practice for treatment planning. The most common example is the linear quadratic (LQ) cell survival model  which prThere are also other approaches which extend research further down in scale, such as MBN explorer which models the interactions between molecules . Recently, the RITCARD  algorithm was introduced, which even though it is not a MC code can model the human chromosome geometric configuration as well as simulate the radiation-induced breaks and their repair, which lead to various chromosome aberrations ,177. RITThis study reviewed several Monte Carlo techniques incorporating DDR to ionizing irradiation. As demonstrated in this review, the need of accurate techniques for RBE quantification is crucial, as it becomes a clinical need to evaluate DDR for a variety of applications including both low- and high-energy radiation. Scientific interest for radiobiology studies using Monte Carlo methods has been continuously increasing over the last twenty years, providing great perspectives in the field of radiation physics. Radiation transport codes and MCTS codes have been used to simulate DNA damage induction due to IR. For charged particle radiation, there are few experimental data available, and therefore MC codes have proved to be a unique but sophisticated tool for the satisfactory qualitative and quantitative interpretations of the experimental data. These codes contribute a lot to our understanding of the underlying action mechanisms of the radiobiological interactions on the cellular level. They are based on simulation of stochastic processes using random number generators.The DDR network includes pathways of high complexity that represent obstacles towards the optimization of cancer treatment. A better understanding would undoubtedly lead to further improvement on the therapeutic clinical protocols. There is still a very long way to go to model DDR to a similar level of detail as has been done for damage induction, and an even longer way before the results might be used in medical applications. A better understanding on the DDR mechanisms would identify synthetic lethal relationships that could be exploited to improve the cancer therapy in general, and also to develop personalized therapies based on patient-specific DDR of tumors ,180,181.To summarize, in this review the challenges and advances in the detection, modelling, simulation, and correct estimation of the biological importance of IR-induced DNA damage are presented. Detection ventures are considered the most severe obstruction towards the establishment of definite relationships between the damage induced by IR and the prediction of biological reactions on the DNA level, but more specifically, going a step further to the organ level, studying groups of cells.Monte Carlo simulations are a well-established tool for use in radiobiology as there are clear prospects for developing more advanced tools that could be used in multidisciplinary studies involving physics, medicine, biology and chemistry. Still, lots of effort is needed to evolve simulation tools and to be able to apply them on studies of cells and cell population (tissues) or even (in the far future) on human organs. There is a clear need for more experimental data that may quantify DNA damage and study the DDR. Despite the current limitations, MC techniques seem to provide a very promising tool, incorporating recent advances in computing science that could even lead to simulations of personalized radiobiological studies during IR medical applications."}
+{"text": "CASR loss- or gain-of-function mutations cause familial hypocalciuric hypercalcemia type 1 (FHH1) or autosomal-dominant hypocalcemia type 1 (ADH1), respectively, but the population prevalence of FHH1 or ADH1 is unknown. Rare CASR variants were identified in whole-exome sequences from 51,289 de-identified individuals in the DiscovEHR cohort derived from a single US healthcare system. We integrated bioinformatics pathogenicity triage, mean serum Ca concentrations, and mode of inheritance to identify potential FHH1 or ADH1 variants, and we used a Sequence Kernel Association Test (SKAT) to identify rare variant-associated diseases. We identified predicted heterozygous loss-of-function CASR variants (6 different nonsense/frameshift variants and 12 different missense variants) in 38 unrelated individuals, 21 of whom were hypercalcemic. Missense CASR variants were identified in two unrelated hypocalcemic individuals. Functional studies showed that all hypercalcemia-associated missense variants impaired heterologous expression, plasma membrane targeting, and/or signaling, whereas hypocalcemia-associated missense variants increased expression, plasma membrane targeting, and/or signaling. Thus, 38 individuals with a genetic diagnosis of FHH1 and two individuals with a genetic diagnosis of ADH1 were identified in the 51,289 cohort, giving a prevalence in this population of 74.1 per 100,000 for FHH1 and 3.9 per 100,000 for ADH1. SKAT combining all nonsense, frameshift, and missense loss-of-function variants revealed associations with cardiovascular, neurological, and other diseases. In conclusion, FHH1 is a common cause of hypercalcemia, with prevalence similar to that of primary hyperparathyroidism, and is associated with altered disease risks, whereas ADH1 is a major cause of non-surgical hypoparathyroidism.The calcium-sensing receptor (CaSR) regulates serum calcium concentrations.  CASR on chromosome 3q21.1, is a 1,078 amino acid class C G protein-coupled receptor that is highly expressed in calcitropic tissues including parathyroid glands and kidneys.2+ , a heptahelical transmembrane domain , and a cytoplasmic carboxyl terminal domain .11) and the adaptor related protein complex-2 \u03c3-subunit (AP2\u03c3) to mediate signaling via intracellular Ca2+ (Ca2+i) mobilization and mitogen-activated protein kinases.,2+ homeostasis is confirmed by germline loss-of-function mutations in CASR , GNA11 (MIM: 145981), and AP2S1 (MIM: 600740) that cause familial hypocalciuric hypercalcemia types 1\u20133 (FHH1-3), respectively. FHH1 accounts for \u223c65% of cases, and is an autosomal-dominant condition characterized by lifelong elevations of serum calcium concentrations and normal or elevated serum parathyroid hormone (PTH) concentrations.2+ excretion, i.e., \u223c80% of FHH-affected individuals are hypocalciuric (Ca creatinine clearance ratio [CCCR] < 0.01) versus <20% of PHPT individuals with CCCR < 0.01,,The calcium-sensing receptor (CaSR), encoded by CASR (MIM: 601198) and GNA11 (MIM: 615361) cause autosomal-dominant hypocalcemia types 1\u20132 (ADH1-2), respectively.14In contrast, germline gain-of-function mutations of R MIM: 6098 and GNR MIM: 6098 and GNin silico pedigree analysis of individuals harboring rare CASR variants. The broad expression of CaSR in cells and tissues that do not directly contribute to serum Ca2+ homeostasis argues that FHH1-affected individuals may have altered risks of non-calcitropic diseases. However, systematic assessment of these potential risks in FHH1 variant carriers has not been possible to date due to the small numbers of individuals identified in most FHH1 pedigrees. We therefore capitalized on the numbers of FHH1-affected individuals identified in this cohort to apply an unbiased, rare variant binning approach to examine the non-calcitropic disorders associated with elevated serum Ca concentrations and/or reduced CaSR function.The major goal of this study was to use whole-exome sequencing and clinical laboratory data from a single large US health system to identify individuals with FHH1 and ADH1 and to estimate the population frequencies of these rare disorders. To achieve this, we combined rare variant pathogenicity triage with serum Ca measures from the electronic health record (EHR) and verified clinically identified potential FHH1 or ADH1 individuals by heterologous expression and functional analyses of predicted pathogenic variants. Clinical validation of FHH1- and ADH1-associated variants was further bolstered by The initial Geisinger cohort consisted of 51,289 individuals, including 563 individuals below the age of 18, who consented to participate in the MyCode Community Health Initiative,alb) = total serum Ca (mg/dL) + 0.8\u2217). At least one serum Ca measure was available in the EHR for 50,208 of 51,289 individuals in the cohort (\u223c98%). When available in the EHR, we report intact PTH levels, measured as part of routine care by electrochemiluminescence at Geisinger Medical Laboratories, with a reference interval of 15-65 pg/mL. To determine the contribution of carriers of rare CASR hypercalcemia-associated variants to the fraction of patients having overt hypercalcemia, i.e., mean serum Ca \u2265 10.2\u00a0mg/dL, we identified the subset of individuals in the cohort not treated with either cinacalcet or vitamin D and with at least 5 measures of serum Ca in their EHR as an indicator of persistent hypercalcemia. Likewise, we determined the number of individuals having persistent hypocalcemia that were not treated with either cinacalcet or vitamin D and had at least 5 serum Ca measures and mean serum Ca of \u2264 8.5\u00a0mg/dL.All recorded clinical and biochemical measurements and unique International Classification of Disease-9 (ICD9) codes for each individual were extracted from the EHR in a de-identified manner through an approved data broker in accordance with Institutional Review Board approvals. Medians and means of all available outpatient serum and urinary biochemical and clinical parameters were analyzed. For individuals with available albumin concentrations, serum calcium (denoted as serum Ca) was adjusted for serum albumin concentration as follows: adjusted Ca  for case numbers \u2265 200, assuming unbalanced case-control ratios (as expected for different ICD9 codes), resulted in >90% power to detect associations and had well-controlled type I error.2, and first four principal components (SKAT R package).We performed a binned genetic association analysis of CASR transcript  in genome build GRCh37.p13. Nonsense and frameshift variants were assessed for nonsense-mediated decay by in silico analysis (NMDEscpredictor). We used a stepwise approach to identify all possible impactful missense variants. Initial triage focused on all rare genetic variants and their predicted pathogenicity as determined by the bioinformatics pipeline  for each individual. The final step in variant triage examined individual patient EHR to assess potential comorbidities that might impact serum Ca measurements . In cases where individuals presented with potential serum Ca modifying comorbidities, we plotted the timeline of serum Ca values to determine whether there were non-random trends. Variants present in one or more individuals were examined for familial associations.Variants were identified relative to the longest  RMPath, , designaPrevalence of FHH1 or ADH1 in unrelated individuals of the cohort was determined after removal of one individual of each related pair of carriers of LoF (denoting frameshift or nonsense variants) and mLoF (denoting missense loss of function) variants (FHH1) or mGoF (denoting missense gain of function) variants (ADH1). Familial penetrance was determined as the fraction of related carriers with the serum Ca phenotypes  normalized to total related carriers.NM_000388.4, 1,078 amino acid residues; missing amino acid residues 537\u2013547 of the longest predicted CaSR transcript [GenBank: NM_001178065.2]) in a FLAG-tagged CaSR cDNA (FLAG-CaSR in pcDNA3.1), were confirmed by sequencing (Genewiz) and transiently transfected into HEK293 cells . Plasma membrane targeting was determined by enzyme-linked immuno-absorbance assays (ELISA) with HRP-conjugated anti-FLAG antibody (Sigma-Aldrich) as previously described.Point mutations, generated by polymerase chain reaction in the most prevalent human CaSR transcript (GenBank: 2+ (Ca2+e)-evoked changes in Ca2+i, since this is the pathway to which CaSR preferentially couples and is most commonly used for human variant analysis.2+i responses induced by graded increases in Ca2+e in cells loaded with the Ca2+ indicator dye Fluo-4 were measured with a PHERAstar instrument (BMG Labtech) at 37\u00b0C, as previously described  or non-coding  variants . The four variants that were localized in the ECD  were predicted to undergo nonsense-mediated mRNA decay (NMD), while two variants in the CaSR CT  escape NMD and are predicted to result in truncated receptors. The variants subject to NMD were identified in 13 individuals and had an aggregate mean serum Ca concentration significantly higher than the 7 individuals with non-NMD variants . Individuals with either class of nonsense/frameshift variant had mean serum Ca concentrations significantly higher than individuals having no rare variants and homozygous for the reference (REF) haplotype   (\u2217) had longitudinal EHR data that documented the effect of the allosteric activator of CaSR, cinacalcet (Sensipar), on serum Ca concentrations. Serum Ca was consistently elevated (10.2\u201312\u00a0mg/dL) prior to treatment  . Availaby ANOVA) . The indNM_001178065.2). Despite the means of all individual carriers for each ClinVar variant being in the middle quartiles of the normal serum Ca concentration range (8.925\u20139.775\u00a0mg/dL), individuals with p.Ser247Phe and p.Arg1041Trp variants had significantly lower mean serum Ca concentrations than individuals homozygous for the reference CASR haplotype . However, neither p.Gln936Arg  nor p.Gly1041Ser  significantly altered mean serum Ca concentrations relative to CASR REF. Similar analyses were done on the 14 pLP and pP variants having serum Ca concentration distributions at the outer limits of the normal range. We identified 13 hypercalcemic individuals (mean serum Ca concentrations \u2265 10.2\u00a0mg/dL) who were carriers of 9 distinct rare variants consistent with missense loss-of-function (mLoF) variants, and 3 variants in 8 individuals were associated with serum Ca concentrations that were significantly elevated relative to the CASR REF haplotype (p < 0.0001), i.e., in the upper quartile of normal (9.775\u201310.2\u00a0mg/dL). Two missense variants were associated with low serum Ca concentrations (means \u2264 8.5\u00a0mg/dL) in 3 individuals, consistent with missense gain-of-function (mGoF) mutations , an NCBI archive of medically important human variation, and were scored as variants of unknown significance (VUS)  or benign/likely benign (c.3121G>A [p.Gly1041Ser])  who were not taking cinacalcet or vitamin D; the 3 individuals with rare CASR mGOF variants represent 0.18% of hypocalcemic individuals.In 41,489 individuals not treated with cinacalcet or\u00a0vitamin D, we identified 333 individuals (0.78%) with overt hypercalcemia ; the 25 individuals with rare LoF or mLoF CASR haplo-insufficiency in elevated mean/median serum Ca concentrations  construct by site-directed mutagenesis, and transiently transfected wild-type (WT = REF) or mutant constructs into HEK293 cells, as described.The means of all serum Ca measures combined for all individuals heterozygous for each ClinVar and potential FHH1 or ADH1 missense variants are plotted in 2+i mobilization in response to alterations in Ca2+e concentrations in transiently transfected cells.2+e concentration-response curves , were combined for burden testing using the Sequence Kernel Association Test (SKAT). All significant associations are listed in CASR loss-of-function variants were associated with neck of femur fractures  non-calcitropic diseases in the U.S. population.Overall, the benefits of our study are the ability to consider a broad range of clinical conditions in an unbiased manner and to corroborate results with quantitative clinical measures. Limitations of the approach include use of de-identified genomic and clinical data, precluding individual contact for more extensive phenotyping, and lack of specialized clinical data and/or testing to support particular diagnoses. Nevertheless, the large numbers of individuals and extensive clinical measures allowed for statistically significant findings, which can be followed up with specifically recruited cohorts. Finally, replication of FHH1/ADH1 prevalence estimates and FHH1 disease associations should be possible as independent population sequencing efforts combining WES and EHR data come to fruition.2+ dysregulation and/or altered CaSR function.In conclusion, we used a DiscovEHR cohort to develop a triage method for rapid identification of FHH1 and ADH1 candidate variants, verified by expression and functional studies. We estimate the prevalence of FHH1 and ADH1 and reveal that FHH1 may be >60-fold more common than previously reported. As sequencing in clinical practice becomes more routine, identifying FHH1 and ADH1 individuals in large cohorts may improve clinical care of these individuals, particularly as we identify comorbidities that accompany serum CaThe authors declare no competing interests.Regeneron Genetics Center members: Goncalo Abecasis, Xiaodong Bai, Suganthi Balasubramanian, Nilanjana Banerjee, Aris Baras, Christina Beechert, Andrew Blumenfeld, Michael Cantor, Giovanni Coppola, Yating Chai, Amy Damask, Colm O\u2019Dushlaine, Aris Economides, Gisu Eom, Caitlin Forsythe, Jan Freudenberg, Erin D. Fuller, Claudia Gonzaga-Jauregui, Nehal Gosalia, Zhenhua Gu, Lauren Gurski, Paloma M. Guzzardo, Lukas Habegger, Young Hahn, Alicia Hawes, Julie Horowitz, Marcus B. Jones, Shareef Khalid, Michael Lattari, Alexander Li, Nan Lin, Daren Liu, Alexander Lopez, Kia Manoochehri, Jonathan Marchini, Anthony Marcketta, Evan K. Maxwell, Shane McCarthy, Lyndon J. Mitnaul, John D. Overton, Charles Paulding, John Penn, Kavita Praveen, Jeffrey G. Reid, Thomas D. Schleicher, Claudia Schurmann, Maria Sotiropoulos Padilla, Karina Toledo, Louis Widom, Sarah E. Wolf, Manasi Pradhan, Alan Shuldiner, Jeffrey C. Staples, Dylan Sun, Tanya Teslovich, Ricardo H. Ulloa, Cristopher Van Hout, Ashish Yadav, and Bin Ye."}
+{"text": "Most of us do not ask the plumber, carpenter, electrician, baker, auto mechanic, butcher, or other trade people how they do what they do. We do not know how to do what they do and, anyway, we do not have the time to do it (and do not want to do it). That is why we pay them to do it, particularly on a Saturday night. If the product or end result is satisfactory, we probably return to them the next time an emergency occurs. If we are not satisfied, we do not call them, we call someone else and hope for the best. We cannot do this with a physician, veterinarian, dentist or others who do things to our bodies, our family members\u2019 bodies, or to the bodies of our domesticated or non-domesticated animals. Sometimes it is too late to have a second try at finding help.However, there is something we can at least partially control in regard to medicine. It has been jokingly said that half of practicing physicians graduated in the lower half of their class. Not quite true but we get the point; not all clinicians are of equal expertise. So, what can we do? What do we do?Imagine the confusion or concern of the average layperson (the taxpayer) who is seen by a clinician and told this or that and then, not knowing what the hell the physician means when s/he says s/he will remove one of the patient\u2019s kidneys (\u201cYou have two.\u201d) or lung, leg, ear, ovary, testicle, or eye (\u201cYou have two.\u201d), or tonsils, appendix or gall bladder (\u201cYou do not absolutely need them.\u201d), or replace a hip or knee , or reconstruct an ulnar collateral ligament (\u201cYou will be better than ever.\u201d), so we say \u201cSure. Sounds like a good idea.\u201d, as though the patient was purchasing a vehicle or a sweater.Here is a real example. For 30 years I suffered lower back pain . Each time I went through an incapacitating bout of this, I considered seeing a specialist. Because I was athletic and exercised regularly, I did physical therapy, and took pain relievers but nothing gave me permanent relief. Therefore, I spoke with (interviewed) orthopedists who were said to be experts but I never thought they were taking me very seriously or they spoke words that might have been in another language. At the beginning of last year, I mentioned all this to a friend who is an ophthalmologist and he said, \u201cSee Dr. X\u201d [name omitted to protect the innocent]. I took his advice and had with me a copy of the lumbar magnetic resonance image I had had taken a few months earlier. When I visited his office, he explained the problem so that I could understand him clearly and he told me he could fix the problem in 20 minutes! This frightened me as much as had he told me he could not repair the problem, but he showed me the arthritic irregularities causing the spinal stenosis that was the problem. A week later, he smoothed the foramen through which the sciatic nerve passes and 20 minutes later he was done and I went home not long after. I did not need pain medication, not even an aspirin.I am now, more than ever, convinced that all patients should be educated regarding their bodies, what strangers are plotting to do things to them, why it is important for patients to faithfully follow the instructions given to them, what to do and who to ask when s/he does not understand the instructions, and more. Of course, not all patients (perhaps not even most patients) can be or do not want to be educated but it might help if we tried. At the time of writing this, during the severe acute respiratory syndrome coronavirus-2 pandemic, we have multiple vaccines said to be effective against this virus and it will soon be obvious whether they are indeed effective. However, the public is even less confident about their effectiveness than are clinicians and scientific investigators, and questions regarding the efficacy of these vaccines seem to unduly, even negatively, influence their acceptance. How can we expect otherwise when some people are prescribed antibiotics for a given period and do not take them for the entire period suggested? Does anyone emphasize to them why they should take the complete dose, or are they simply told to \u201cDo this\u201d?It seems to me that there is a need for more education. When I retired, I volunteered to teach reading to second graders (about 8 years old) for an hour twice a week in a school near my home. I know how to read and I thought it would be easy, and enjoyable for me, to teach the students. I was wrong. I began my first classes each year by telling them that I was not planning to teach them to read, that they already knew how to read (words), and that I would be teaching them what those words mean in the context of understanding the writer\u2019s intent for the sentences.They all did fabulously those years  and we (the students and I) all had fun. However, I realized that second graders knew just about nothing . Therefore, I educated them the best I could. At the end of each teaching year, they learned more than how to read words.There is much for all of us to learn, simply to stay well-informed about our specialty, no matter what that is. Adding more to everyone\u2019s schooling means we must make more than ordinary efforts. Unfortunately, we live in an age in which scientists no longer receive as much public respect as in the past, and some of our politicians manipulate the truth not only for their own benefit, but to the detriment of those they supposedly represent. For an obvious example, propaganda, lies, and pseudoscience were used by the previous US president when discussing the pandemic, which he said would disappear \u201clike magic.\u201d Many believed him and the pandemic inevitably resulted in a national and international disaster. Only education, including about Critical Thinking, Logic, and Reasoning, can overcome such nonsense. I suggest that those responsible for education consider adding these subjects to the current curriculum, which means adding the teaching of such subjects to the teachers\u2019 syllabus at the school where they themselves are trained.This likely would help improve the public\u2019s understanding of and need for attention to details and, as important, to emphasize that with knowledge and background regarding what they are doing, and what people are doing to them, they will know why they are doing it. If nothing else, this could lead to lowered stress in patients. In addition, and of immediate value, we, the investigators and clinicians, might consider participating in frequent informal talks  to public groups. These might include sessions on what it takes to become a laboratory scientist, what \u201can ordinary day in the life of a laboratory scientist or clinician\u201d is like, how we recognize previously unknown viruses and other infectious agents and the diseases they cause, how vaccines are manufactured, why and how vaccines are first tested for safety and efficacy, which segments of the population might first be selected to receive new vaccines, how commercial manufacturers decide on pricing of their products (This might take a long night of bickering!), and so on.My colleagues and I at Colorado State University and numerous others at other institutions throughout North America and elsewhere have been holding such sessions locally and state-wide and I believe we have been successful. Furthermore, educating the public, no matter the age group, makes our professional lives easier. Non-scientists are now asking informed questions, only some of which I can answer."}
+{"text": "In recent years, multiscale modelling approach has begun to receive an overwhelming appreciation as an appropriate technique to characterize the complexity of infectious disease systems. In this study, we develop an embedded multiscale model of paratuberculosis in ruminants at host level that integrates the within-host scale and the between-host. A key feature of embedded multiscale models developed at host level of organization of an infectious disease system is that the within-host scale and the between-host scale influence each other in a reciprocal  way through superinfection, that is, through repeated infection before the host recovers from the initial infectious episode. This key feature is demonstrated in this study through a multiscale model of paratuberculosis in ruminants. The results of this study, through numerical analysis of the multiscale model, show that superinfection influences the dynamics of paratuberculosis only at the start of the infection, while the MAP bacteria replication continuously influences paratuberculosis dynamics throughout the infection until the host recovers from the initial infectious episode. This is largely because the replication of MAP bacteria at the within-host scale sustains the dynamics of paratuberculosis at this scale domain. We further use the embedded multiscale model developed in this study to evaluate the comparative effectiveness of paratuberculosis health interventions that influence the disease dynamics at different scales from efficacy data. In the field of mathematical biology, we are beginning to witness an overwhelming appreciation of multiscale modelling in studying infectious disease systems dynamics  ) to denote the percentage reductions of R0 when the two health measures are implemented. Therefore, the percentage reductions of the two health measures of PTB disease dynamics are calculated using the following expression:e = v = d = 0.1, comparative effectiveness at medium efficacy level (CEM-eff) which is taken to be e = v = d = 0.4, and comparative effectiveness at high efficacy level (CEH-eff) which is taken to be e = v = d = 0.8 using each of the basic reproductive number of the multiscale model system (R0). The results of the comparative effectiveness of the PTB health intervention strategies and their respective combinations are tabulated in The ranking of the percentage reductions of these two health interventions of PTB disease dynamics ranges from 1 to 8 based on the different combinations of the PTB health interventions. In the ranking, 1 corresponds to the highest comparative effectiveness, and 8 corresponds to the lowest comparative effectiveness. In this study, we use a notation  followed by the combinations of the killing of the within-host MAP bacteria effect and vaccination effect, while the combination of environmental-hygiene management effect and vaccination effect has a much lower comparative effectiveness and ranking the fifth when each individual intervention is assumed to have the same efficacy value. Therefore, a treatment that cures an infected ruminant with PTB infection complement with the good sanitation and hygiene practices of farmers is considerable good for the ruminant population in the herd because they reduce the risk of PTB transmission among the ruminantsR0 with an increase in efficacy from low level of 10% to moderate level of 40% and high level of 80%Finally, we considered the comparative effectiveness of the PTB interventions when all the components of the two PTB interventions (EHM and MBPT) are implemented together. We note from the results that this combination has the highest comparative effectiveness than any of the other combination interventions considered in this study for all efficacy levels . Therefore, a joint introduction of environmentally management, vaccination, and drug therapy can lead to a more considerable percentage reduction of The main innovation of this study is the development of an embedded multiscale modelling framework that enables investigation of the role of superinfection plays in paratuberculosis (PTB) disease dynamics of in ruminants. Unlike hybrid multiscale models (HMSMs), our multiscale model uses pathogen load as a common metric for infectiousness and disease transmission potential across the microscale and the macroscale. In HMSMs such as in , 22, patR0 indicate that the variation of the within-host scale parameters in particular the decay rate of the within-host MAP bacteria population have significant affect disease dynamics in the ruminant population. Therefore, considering that there are no drugs for PTB infection, the results of sensitivity analysis reveal that the development of a drug that kills and restricts replication of MAP bacteria at the within-host scale would have beneficial effect on the reduction of the transmission risk of the disease among the ruminants at between-host scale. We further used the multiscale model to assess the comparative effectiveness of two PTB health interventions which are (i) environmental-hygiene management (EHM) and medical-based preventive and treatment (MBPT). The comparative effectiveness results show that administration of drug treatments that kill MAP bacteria at individual ruminant level has a higher comparative effectiveness than other two PTB health interventions . The results also show that employing all PTB control measures could lead to a more considerable reduction of the disease at the start of infection. The embedded multiscale model developed in this study provides new insight into the role that superinfection plays on the dynamics of environmental disease systems with obligate pathogens that cannot replicate outside the host. The embedded multiscale model in this article also provides a better understanding about the reciprocal influence between the replication of pathogen load at within-host scale and transmission at between-host scale. We were also able to identify, through the sensitivity analysis of the basic reproductive number and the numerical simulations of the multiscale model, the key target parameters for eliminating paratuberculosis infection in ruminants. Although this study was focused on PTB infection in ruminants, the multiscale modeling framework itself is general enough and is applicable to guide control and elimination of many other environmentally transmitted diseases with obligate pathogens beyond the specific case study of PTB disease system.In this study, we established that superinfection of the ruminant does not significantly alter the total pathogen load within an infected ruminant. Collectively, the numerical results in this study establish that once the infection has successfully established at the within-host scale the replication of MAP bacteria sustains PTB disease dynamics. Further, the results of sensitivity analysis of"}
+{"text": "The COVID-19 pandemic has had ramifications for most healthcare activities, including medical education and communication aspects. Virtual educational meetings and activities (VEMAs) have been utilised tremendously in the pandemic era, reflecting a transition to new horizons of cyberspace. This creates the need to explore possible challenges for the implementation of such services in the rapidly evolving field of oncology. The aim of our study is to explore the impact of the COVID-19 pandemic on VEMAs in the oncology community in Egypt. It focused on the evaluation of current attitudes, satisfaction and expectations of Egyptian oncologists during and beyond the COVID-19 era. The study is a cross-sectional study using a survey that was distributed through social media. It targeted Egyptian oncologists during the months of May and June 2020. A total of 118 participants completed the survey and most of them were younger than 35 years (71%). Most participants (93.2%) agreed that COVID-19 affected the stream of live medical educational meetings. About three-quarters of them attended VEMAs during the COVID-19 period compared to 50% prior to the pandemic. The majority reported that evening hours after 8 PM was the best time to attend VEMAs and 1 hour is the optimal duration for a virtual meeting. Although the COVID-19 pandemic appeared as an unprecedented challenge for medical education, it can be a catalyst for VEMAs, especially in a rapidly evolving field such as oncology. Further research is needed to assess whether learners are ready and willing to make greater use of online educational platforms and investigate the possible barriers and strategies to enhance their use. Coronavirus disease 2019 (COVID-19) was first recognised in December 2019 in the city of Wuhan, China, and has spread to more than 200 countries in the world to date . The WorA few drugs and some vaccines have been approved for COVID-19. Prevention of the disease relies mainly on infection control measures such as hand washing, wearing masks, social distancing and quarantine , 6. ManyThese decisions have impacted healthcare education as many scheduled conferences, workshops and educational meetings in all fields including oncology have been cancelled, postponed or turned into a virtual format during the pandemic , 10. VirHerein, we aim to evaluate Egyptian oncologists\u2019 experience with virtual educational meetings and activities (VEMAs) during the COVID-19 pandemic, to correlate their use and attitude with different socio-demographic factors and to describe their needs and expectations for the post-COVID-19 era.This cross-sectional study was conducted through an online survey for 2 months, i.e., between May and June 2020. The survey was completely anonymous. Data were collected through an online Google Forms platform. The inclusion criteria included clinical, medical, radiation and surgical oncologists practicing in the Egyptian healthcare system. The only exclusion criterion was practicing outside Egypt. The link of the survey was shared on social networking sites, including Facebook and WhatsApp groups, to the target population.The survey questionnaire was designed in English and consisted of four sections. The first section covered the socio-demographic characteristics of the participants. The second section evaluated the oncologists\u2019 attitudes towards participation in the educational activities in the year 2019, prior to the COVID-19 pandemic. Questions in the third section assessed the participants\u2019 experience and satisfaction with the VEMAs during the COVID-19 pandemic. The last section of the survey explored their needs and expectations regarding the future of the VEMAs in the post COVID-19 world.A preliminary phase was conducted to assess the validity and reliability of the questionnaire before its use. Initially, the first and the third authors, who are experts in the field of oncology and education, were asked to assess the degree to which items in the questionnaires are relevant to the goals of the study. Then, the questions were modified according to their response. After that, we tested the survey on 15 participants who completed it twice 2 weeks apart. The questionnaire had a high level of internal consistency and test-retest reliability, as determined by a Cronbach\u2019s alpha of 0.814 and Pearson\u2019s correlation of 0.66.The sample size was determined using the Epi Info 7 software. Depending on the previous study discussing the prevalence of attendance in E-learning classes , it reached to 5%; thus, assuming that the confidence level was 95% with a type I error of about 5%, the minimal sample size was 73 participants .p was considered significant if \u22640.05.The statistical analysis was carried out by Minitab 17.1.0.0 for Windows . Continuous data were presented as mean and standard deviation (SD), and categorical data as number and percentage (%); the normality of data was examined using the Shapiro\u2013Wilk test. The correlation between the attendance in VEMAs and participant characteristics was evaluated using chi-square test. The general linear model (GLM) was used to estimate the association between the different socio-demographic characteristics of the participants and the degree of agreement about VEMAs after the COVID-19 era, which is illustrated in three different questions using the Likert-type scale. All tests were two-sided, A total of 118 oncologists had completed the survey. Most of the participants (93.2%) agreed that COVID-19 affected the stream of live face-to-face medical educational meetings. About three-quarters of them attended VEMAs during the COVID-19 pandemic with a maximum of once or twice a week (80.7%). Smartphones and laptops  were the most used devices to attend VEMAs and Zoom was the most preferred platform (85.6%) .The evening after 8 PM was the best time to attend VEMAs in the opinion of the majority (83.9%). The optimum frequency and duration of VEMAs were once weekly (83.05%), and for 1 hour (64.41%), respectively.Among the advantages of VEMAs, saving more time for family and social activities ranked number one (66.9%), followed by saving travel expenses (65.3%) and the availability of free educational content (62.7%). Sixty-seven percent believed that VEMAs fulfilled their educational goals and expected learning outcomes. On the other hand, problems with Internet connections ranked number one as a barrier for participation in VEMAs (66.9%), followed by the absence of travelling experience and the absence of interaction with other participants .While more than three-quarters of the participants believed that the information gained from VEMAs can be implemented in their practice, around half of them thought that VEMAs are generally useful for their work and development.p < 0.001), especially consultants (p = 0.01) with more experience (p = 0.05). There was no significant impact of age, sex, qualification degree or job facility sectors on the VEMAs attendance. The correlation between socio-demographic characteristics of the participants and attendance of VEMAs during the COVID-19 pandemic is illustrated in During the COVID-19 era, attendance of VEMAs was significantly associated with clinical and medical oncology specialty . On the other hand, doctors who work in the Ministry of Health (MOH) and private sectors showed significant disagreement about continuation of VEMAs after the COVID-19 pandemic .The correlation between socio-demographic characteristics of the participants and degree of perception about VEMAs in the post-COVID-19 world , quantifOur study revealed a significant increase in participation in VEMAs, which is a reflection of the impact of the COVID-19 pandemic on the educational activities shifted to the virtual domain.Most participants in this survey were young oncologists \u226435 years old. About half of them were in the middle of their career, being specialists and had their master\u2019s degrees, which is the first step for specialisation in Egypt. At this point in their career, medical doctors seek knowledge to advance their skills and to establish their career in the field, while striving to get acceptable financial revenue. However, they do not have great scientific contributions, and they are not very well known to the scientific community. This is evident from the number of lectures/abstracts/posters presented by these participants in traditional educational activities, where about two-thirds of them presented only between 0 and 3 presentations last year. Also, data reflect the fact that conference attendance increases with career stages , and thiet al [Approximately 70% of the participants strongly agree that the COVID-19 pandemic affected the traditional live medical educational meetings. As a result of this, there was an increase in their participation and experience with the VEMAs in comparison to the pre-COVID-19 era (74.58% versus 50%), which means that about a quarter of the participants had this educational experience for the first time due to the current circumstances. These results are in accordance with the findings of Chatziralli et al  in theirSelection of the right time, frequency and duration of educational activities is important to ensure that the message is delivered effectively. For example, The European Molecular Biology Organisation organised a virtual conference (T6SympoZOOM) between 15 and 17 April, 2020, during the pandemic. In the post-conference survey, 131 out of 181 respondents found the conference schedule with 2-hour sessions, 3 consecutive days and 10\u201315 minute talks as the most appropriate for them . As a reThe affordable and easy access to smartphones in everyday social and work life of participants made them the preferred tool to be used in the VEMAs (72.9%). In one of the studies conducted on university students, it was found that 66% use mobile devices for e-learning, 45% used a mobile phone and 38% a laptop .Zoom application was the preferred platform in our study to conduct VEMAs. Although not completely free, the application became very popular during social distancing time, recruiting millions of users and achieving great profits . The appEducation comes with a cost. Although free educational courses are now available online on multiple platforms, international conferences and workshops are expensive especially for early and mid-career physicians in developing countries . SalarieBurnout is common among oncologists including Egyptians as they have a stressful career \u201334. The However, VEMAs lack some advantages which are provided by live events. Conferences and live educational meetings represent good opportunities for attendees to interact with their peers in the field as reported in a survey of travel behaviour among scientists in Germany. This is particularly important for early career doctors and scientists, where they can also have a chance to know about different cultures , 37. A sInternet connection speed in Egypt improved in 2020 to rank number no. 2 in Africa, in comparison to 2017 , where EA great majority of our participants believed that the information learnt from VEMAs can be implemented in their practice. This is similar to the results proved by other healthcare professionals, where distance learning was found to be effective for oncology nurses and neurosurgeons training , 44. HowCertainly, the world will change after this pandemic in different aspects, including education with fears of a new recession and financial collapse . VEMAs np < 0.001), especially consultants (p = 0.01) with more experience (p = 0.05), mostly because most participants were clinical or medical oncologists. Having more senior physicians attending these activities may reflect a targeted marketing to attract this particular group, or the ability to manage their time better to attend the meeting or being more experience in identifying these events and connecting with them. Around 1,000 Libyan doctors participated in a survey about the interaction of pharmaceutical company representative with doctors. There was a statistically significant difference in visiting rates based on the age group and all doctors older than 45 years who communicated with pharmaceutical company representatives [In the present study, the attendance of VEMAs during the COVID-19 era was significantly associated with the clinical and medical specialty (ntatives . Likewisntatives .E-learning may be more favourable for women through its flexible and interactive learning approach . InteresThe proposed strategies that could encourage oncologists to engage in future VEMAs include using attractive platforms for conferences as for instance the 3D interactive virtual platform and organising the VEMAs schedules to avoid overlapping. Moreover, CME accreditation and offering the lectures in recorded forms to be retrieved in the convenient time will up skill the oncologists\u2019 carrier in real life. On the other hand, providing the chance for the junior oncologists to directly reach and get in touch with the oncology international experts and mentees in different fields virtually can greatly motivate them to attend these events and overcome financial obstacles for oversees collaborations and training. Finally, providing post-meeting satisfaction surveys for the speakers and attendees will help in evaluating and improving these services and upgrade its content.To the best of our knowledge, there is no published data yet on the evaluation of the impact of the COVID-19 pandemic on virtual educational practices in the oncology field in Egypt or Arab countries. This research aims to explore the socio-demographic attributes of oncologists\u2019 willingness to achieve virtual education, identifying the possible barriers for participation in these activities and clarify their needs for future events. In an attempt to improve the implementation of the VEMAs in the post-COVID-19 era, this study will enhance the technical skills of oncologists to use the virtual platforms in order to maximise the benefits of attending such meetings.This study illustrated several important results by taking a snapshot for the current perspective towards VEMAs amid the COVID-19 pandemic. However, some limitations should be considered. Firstly, this survey was conducted and administered through social networking sites, including Facebook and WhatsApp groups, and this may result in sampling bias, e.g., most participants were young as only those who were interested and familiar with social media answered the survey. Secondly, the cross-sectional design of this study. Thirdly, limited sample size was among the study limitations. Fourthly, we did not evaluate the speakers or moderators\u2019 experience as they may have different perspectives or needs. Fifth, we did not ask about hybrid meetings since they were not common options at the time of the distribution of the survey. Finally, and importantly, the participants\u2019 perspective regarding the curriculum or the content of VEMAs was not deeply explored. VEMAs may represent a golden opportunity to exchange knowledge and experience with experts in the fields and follow the latest updates, but it is difficult to learn manual skills through them or utilise them when direct interaction with patients is needed. So, it is not possible to generalise this type of educational activities to all specialties and fields, which mandates a separate evaluation for other disciplines.The COVID-19 pandemic has led to new opportunities for virtual education. Curricula for this type of education should be developed and tailored according to the needs of target groups. Virtual registration and free content should be added as an option in future international scientific events to help young physicians in developing countries improve their knowledge and skills, without the need to bear the costs for travel and accommodation.The authors declare that they have no conflicts of interest.No source of external funding was received for this research."}
+{"text": "Background: COVID-19 clinical features include a hypercoagulable state that resembles the antiphospholipid syndrome (APS), a disease characterized by thrombosis and presence of antiphospholipid antibodies (aPL). The relationship between aPL-presence and the appearance of thrombi as well as the transience or permanence of aPL in COVID-19 patients is not sufficiently clear. Methods: A group of 360 COVID-19 patients were followed-up for 6 months. Classic aPL, anti-B2GPI IgA, anti-phosphatidylserine/prothrombin IgG/M and anti-SARS-CoV-2 antibodies were determined at acute phase and >12 weeks later. The reference group included 143 healthy volunteers of the same age-range distribution. Results: aPL prevalence was similar in COVID-19 patients and the reference population. aPL presence in both determinations was significantly associated with thrombosis (OR: 2.33 and 3.71), strong agreement being found for classic aPL and anti-B2GPI IgA (Weighted kappa: 0.85\u20130.91). Thrombosis-associated aPL occurred a median of 17 days after hospital admission (IQR: 6\u201328) vs. 4 days for the rest (IQR: 3\u20137). Although anti-SARS-CoV-2 antibodies levels increased during convalescence, aPL hardly changed. Conclusions: Most COVID-19 patients would carry these aPL before the infection. At least two mechanisms could be behind thrombosis, early immune-dysregulation-mediated thrombosis after infection and belated-aPL-mediated thrombosis, with SARS-CoV-2 behaving as a second hit. COVID-19 is a pathology characterized by a wide spectrum of clinical profiles ,3. TheseThe COVID-19 hypercoagulable state appears to be a mixture of other prothrombotic situations ,7. AmongClassification criteria for thrombotic APS require the presence of at least one laboratory criterion and one clinical criterion . Laboratory criteria include the following: lupus anticoagulant (LA), anti-cardiolipin (anti-CL) or anti-B2-Glycoprotein-I (anti-B2GPI) of IgG/IgM isotypes in two consecutive determinations distanced 12 weeks apart . RecentlThe prevalence of aPL in COVID-19 patients, with or without thrombotic events, varies between 21\u201370%, according to the methods used in its detection and whether the presence of LA is assessed or not ,21. In aIt is well known that aPL can appear in the context of various infections ,28. To aIt has been reported that some infections like hepatitis C, herpes zoster and Q fever may be involved in triggering APS events, including the APS catastrophic form ,30,31. TZhang et al. reported three patients with stroke with positive anti-CL IgA and anti-B2GPI IgG and IgA . HarzallThis work has aimed to evaluate the variability in the levels of aPL at the time of diagnosis of COVID-19 and at least 180 days after the first sample and the association of those aPL with COVID-19 complications in a prospective series of 360 patients who recovered from the infection. aPL dynamics were compared to the evolution of anti-SARS-CoV-2 antibodies.We performed a prospective observational study including COVID-19 patients followed-up for at least 180 days from hospital admission. Classic and extra-criteria aPL serum levels were determined at admission and in a second sample obtained at least 12 weeks later.Patients were enrolled in the \u201cHospital Universitario 12 de Octubre\u201d from March to October 2020. Inclusion criteria were: (1) Patients over 18 years with symptoms of acute COVID-19 infection; (2) Clinical characteristics that required hospital admission; (3) Confirmed diagnosis by RT-PCR; (4) Clinical follow-up for at least 6 months; (5) Quantification of aPL in a sample taken on the first day after hospital admission and in a second sample taken at least 12 weeks later.A total of 201 out of the 561 patients selected initially were excluded either because a second serum sample was not available or because clinical follow-up was interrupted). Finally, 360 COVID-19 patients  were enrolled in this study. Age: mean 58.1 years and median 59 years (IQR: 46.5\u201369). The algorithm of disposition and outcomes is described in A reference group formed by 143 healthy individuals with a representative age-range of the real age-distribution in general population of the same geographic area was selected to compare COVID-19 patients with a healthy population of the same area. Age: Mean 61.3 years; median 64 years (IQR: 50\u201375).Blood donors generally constitute an excellent reference population of healthy people; however, this entails a bias of people over 50 years and those over 65 years are not included, so the most common age range in COVID-19 patients in our environment (over 50 years) are underrepresented. The reference group consisted of 33 blood donors and 110 volunteers recruited from people over 40 years who underwent a preoperative study for minor conditions not related to any major disease . The selected patients had no history of serious systemic or vascular pathologies and no symptoms other than minor age-related symptoms at the time of the medical examination.COVID-19 case was defined as a positive result for SARS-CoV-2 according to reverse transcription polymerase chain reaction (RT-PCR) assay performed on nasal swab sampling from patients with COVID-19 consistent symptoms.Ventilatory failure: was defined as a PaO2/FiO2 < 300 , or the need for mechanical ventilation .Classic aPL: The aPL included in the Sidney\u2019 APS classification criteria  excludinExtra-criteria aPL: aPL not included in the APS classification criteria : IgA a\u03b22Sera from coagulated whole blood samples were collected in the first 24 h after hospitalization (First sample) and at least 12 weeks later (Second sample).IgG and IgM isotypes of anti-B2GPI and anti-CL were determined by addressable laser bead immunoassay (ALBIA) using BioPLex 2200 multiplex immunoassay system APLS . The cutoff to consider IgG and IgM anti-B2GPI and anti-CL as positive was 18 U/mL, according to the 99th percentile evaluated in a healthy population. LA was measured in a sample of 67 patients using HemosiL dRVVT (cutoff ratio 1.2) and HemosiL Silica Clotting Time (cut-off ratio 1.3) assays .IgA anti-B2GPI were quantified using the QUANTA Lite B2 GPI IgA , due to the low sensitivity of bead-based immunoassays for these antibodies . Anti-PS\u00ae Analyzer .ELISA procedures were performed in a Triturus \u00ae2200 SARS-CoV-2 IgG Panel . The manufacturer\u2019s recommended cutoff was used. Samples showing antibody levels above the detection limit of the system were normalized to the detection limit value.IgG antibodies against the receptor-binding domain (RBD), spike 1 (S1), spike 2 (S2), and nucleocapsid (NCap) structural proteins of SARS-CoV-2 were quantified in paired samples of 126 COVID-19 patients using ALBIA technology with the BioPlexClinical data including vascular and thrombotic events, Intensive Care Unit (ICU) admission and ventilatory failure were collected from the electronic medical records and integrated into an anonymized database. Biological and immunological markers were also included.Results of discrete variables were expressed as absolute frequency and percentage. Association between qualitative variables was determined with Pearson\u2019s chi-square test or Fisher\u2019s exact test, when appropriate. The relative measure of an effect between subgroups of patients was expressed as relative risk based on a 95% CI when considering the aPL positivity as the exposure.Results of the continuous variables were expressed as median accompanied by the interquartile range (in parentheses) and mean with standard deviation. Mann\u2013Whitney U test was used for comparisons. The non-parametric Wilcoxon Signed-Rank test was used to compare continuous variables (paired data) that were not normally distributed. Inter-rater reliability for qualitative variables was measured using weighted Cohen\u2019s kappa (\u03ba); strength of agreement was interpreted using a rule of five described previously .p-value < 0.11 in a previous univariate analysis. The relative measure of an effect was expressed as odds ratio.Multivariate analyses were performed through logistic regression model using variables that presented a Probabilities under 0.05 were considered significant. Data were analyzed with MedCalc for Windows version 19.3 .This study was conducted in accordance with the principles of the Declaration of Helsinki and was approved by the Clinical Research Ethics Committee of Hospital Universitario 12 de Octubre . The mean separation time between the two serum samples was 21 weeks (SD: 6.2) and the median was 19.9 (IQR: 16.4\u201324.3).Median age of the 360 COVID-19 patients was 59 years (IQR: 46.5\u201369) with a discrete smaller proportion of women (41%), however no significant differences were observed in ages between men and women: 59 (IQR: 47\u201368.3) vs. 59 (IQR: 46\u201370.8), n = 34) were negative for the other aPL (Isolated positives). The number and type of aPL positivity in the first and second samples can be seen in We found 63 (17.5%) patients positive for the aPL in the first blood sample collected during the acute phase of the disease. We observed that 16 (4.4%) of the patients presented as least one classic aPL, whereas 47 (13.2%) patients were positive for at least one extra-criteria aPL, 40 patients (11.1%) for anti-B2GPI of IgA isotype and 15 (4.2%) for anti-PS/PT (any isotype). A total of 85% of IgA anti-B2GPI positive patients (p = 0.663) were observed D-dimer levels in aPL positive  versus aPL negative . Patients with thrombotic events, had higher levels  than those without thrombi .Median D-dimer levels in COVID19 patients was 715 ng/mL (IQR: 434\u20131349), 70% of patient had D-dimer above the cutoff (500 ng/mL). No significant differences  had ventilatory failure and 36 (10%) patients required admission to the ICU, however, no association was found between these outcomes and the presence of aPL . A totalp = 0.174).The most common TE was pulmonary embolism (PE) with 24 patients, followed by eight who had had thrombotic stroke, and four patients who had deep vein thrombosis . Two PE patients also had DVT (they were classified in the subgroup of PE). Median time of onset of the first TE with respect to the patient\u2019s admission was 6 days (IQR: 3\u201312.8) and mean time was 12.5 days. Patients with TE were younger than the rest of the patients. No significant differences were observed in the sex ratio, cardiovascular risk factors or ICU requirement A. In the acute phase (first sample), aPL positivity was not associated with the development of TE A, ventilp = 0.003). Dot and Line diagram of the paired samples for each aPL in patients with thrombotic events is shown in The presence of aPL in the second sample was significantly associated with the occurrence of thrombotic events , anti-B2GPI IgA  and anti-PS/PT . The positivity of anti-SARS-CoV-2 antibodies in the first and second samples was not associated with thrombosis  (see p = 0.006). Analyzing the three types of aPL , only IgA anti-B2GPI positive patients showed a significantly longer time to the onset of the first thrombotic event than the negative aPL patients  than in aPL positive patients  see b. When a016) see c, medianpatients .p-value less than 0.11 were subjected to a multivariate analysis with a logistic regression model: presence of aPL in the first sample, age and hypertension (p = 0.043) was identified as a significant and independent variable. (p = 0.001) was a thrombosis-associated independent variable (p = 0.046).The variables associated to TE with a rtension B. Presenariable. B. The muvariable B. The muvariable  showed tIn this study we have demonstrated that the presence of aPL in COVID-19 patients is similar to that observed in the general population of the same geographical area and that these antibodies persist after the appearance of the disease with very small variations. Additionally, we have observed that aPL positive patients have a higher incidence of thrombosis compared to aPL negative patients and that thrombotic events occurred significantly later in the first group.The presence of aPL in APS is necessary but not sufficient to induce thrombosis formation. The concurrence of a \u201csecond hit\u201d that involves activation of innate immunity and a proinflammatory microenvironment is necessary to trigger thrombotic episodes. This second hit could be severe infection, surgery, vascular procedures or trauma ,38,39. IAmong the main inflammation-associated molecules that are proposed as activators of thrombosis, the High mobility group box-1 (HMGB-1) stands out. HMGB-1 is a damage-associated molecular pattern protein that, when is secreted by damaged cells, exerts a strongly inflammatory activity binding to receptors as receptor for advanced glycation end products (RAGE) and Toll-like receptors 3 and 4. The link between HMGB-1 and thrombosis appears to be focused on the interaction with platelets, NET and coagulation and fibrinolysis factors ,43,44.The fact that thrombotic events in aPL patients occurred later than in aPL negative ones suggests that the mechanism involved in these aPL positive patients may be different and additional to that directly related to the infection.The presence of autoantibodies  is more frequent in the elderly than in young individuals ,46. MostThe prevalence differences found in the literature are mainly due to the number of parameters analyzed and the methodology used. There are studies where only anti-CL and anti B2GPI IgG/M are compared, other groups also incorporate the IgA isotype and others include LA. Very few also incorporate anti-PS/PT.The prevalence and the titer of aPL scarcely varied between the acute phase of the disease and post-convalesce, while the antibodies against SARS-CoV-2 antigens were strongly increased. These facts suggest that the presence of aPL is independent of infection in most patients with aPL. SARS-CoV-2 infection, in patients who carried aPL, hardly affects the presence of these antibodies.In a minority of patients with aPL with a low titer close to the cutoff, SARS-CoV-2 infection has been a stimulus to increase the production of antibodies to place them above the cutoff point in the second sample. The SARS-CoV-2 infection had a dual role, main as a \u201csecond hit\u201d and in some patients as a stimulus for the production of aPL. The fact that the association of aPL with thrombosis is significant only when we assess the post-event serum sample (second sample) does not imply any limitation since the presence of aPL is being assessed a posteriori. In the APS patients the determination of aPL is usually done after the occurrence of the thrombotic event. Except in cases of aPL-related thrombosis in SLE and after transplant surgery, it is extremely rare to find aPL evaluations prior to the second hit .The classic aPL were the main subgroup of aPL significantly involved in COVID-19 associated thrombosis. Secondly, the association with anti-B2GPI of the IgA isotype also stands out. The detection of these IgA antibodies was not carried out with ALBIA (as was done with the classic aPL) but rather was done with a solid phase assay test because the tests based on antigen coated-beads have low sensitivity for this antibodies . The stuSome authors have proposed that the presence of aPL and thrombotic events in COVID-19 patients could represent a secondary form of APS ,53. The Based on the data provided here, the presence of aPL in COVID-19 patients cannot continue to be considered as an epiphenomenon. Patients with aPL in our study who had thrombotic events after SARS-CoV-2 infection strictly comply with the Sidney criteria: presence of an event and positivity of aPL in two samples separated by 12 weeks. What remains to be determined is whether these patients can continue to suffer new thrombotic events in the face of future activations of the immune response that act as a second hit. Faced with this possibility, we suggest that, as has been done in Primary-APS patients, aPL positive patients should be kept under observation during a longer period as well as that 4 months of prophylaxis should be considered (as done in any other APS patient)  especialThe two main strengths of this work are the size of the cohort, one of the largest prospective cohorts that analyzes the effect of aPL on COVID-19 thrombosis, and that comparisons of prevalence and levels of aPL in patients with COVID -19 are performed in front of a healthy people group who have the same age structure as the general population, so they are more real and not as artificially high as when compared with blood donors. However, this work has several limitations. One of the main limitations is that it is a single-center study with a relatively small sample size. Although the size is sufficient to assess the influence of aPL in convalescence and determine the association of the presence of aPL with thrombotic events, further investigation is needed to assess the individual impact of different aPL on thrombosis risk. Therefore, the association of the presence of aPL with thrombotic events should be studied more carefully in subsequent studies with a greater number of patients.The presence of LA was only evaluated in 67 patients. Although these patients only represent 20% of the cohort, this is a sufficient number to verify the prevalence and the lack of association with COVID-19 complications. Our results are in line with many studies that have highlighted the increased positivity rate in LA in COVID-19 patients ,58,59 anPrevalence of aPL in COVID-19 patients is similar to the healthy population of the same age range. The majority of aPL carriers at the onset of the disease remain positive after more than 12 weeks of convalesce. Moreover, aPL in COVID-19 are associated with belated thrombotic risk. Thrombotic events in COVID-19 patients might be produced by at least two mechanisms: early thrombus mediated by thrombophilia and immune dysregulation inherent to tissue damage after infection and the belated thrombus mediated by the activation of a latent APS before the concurrence of a second hit, as is the strong immune response to infection. These conclusions should be validated by subsequent studies with a larger multicenter series."}
+{"text": "While the resistance rates of commonly detected uropathogens are well described, those of less frequent Gram-negative uropathogenic bacteria have seldom been reported. The aim of this study was to examine the resistance rates of less frequent uropathogenic Gram-negatives in a population of patients treated in a Department of Urology of a tertiary referral centre in Central Europe over a period of 9\u00a0years.Acinetobacter spp. (n\u2009=\u200974), Citrobacter spp. (n\u2009=\u200960), Enterobacter spp. (n\u2009=\u2009250), Morganella morganii (n\u2009=\u2009194), Providencia spp. (n\u2009=\u200953), Serratia spp. (n\u2009=\u200982) and Stenotrophomonas maltophilia (n\u2009=\u200927). Antimicrobial agents selected for the survey included: ampicillin, amoxicillin/clavulanic acid, piperacillin/tazobactam; cefuroxime, cefotaxime, ceftazidime and cefepime; ciprofloxacin and ofloxacin; gentamicin and amikacin; ertapenem, meropenem and imipenem; trimethoprim-sulfamethoxazole (co-trimoxazole), nitrofurantoin and colistin.Data on all positive urine samples from urological in- and out-patients were extracted form the Department of Clinical Microbiology database from 2011 to 2019. Numbers of susceptible and resistant isolates per year were calculated for these uropathogens: Acinetobacter spp. and S. maltophilia). Susceptibility to fluoroquinolones is limited. Amikacin is somewhat more efficient than gentamicine but susceptibilities for both safely exceed 80%. Nitrofurantoin shows virtually no efficiency. Cotrimoxazole acts well against Citrobacter spp., Serratia spp. and it is the treatment of choice for S. maltophilia UTIs. Among carbapenems, ertapenem was less efficient than meropenem and imipenem except for S. maltophilia whose isolates were mostly not suceptible to any carbapenems.Penicillin derivatives have generally poor effect except piperacillin/tazobactam. Cefuroxime is not efficient unlike cefotaxime (except against Uropathogenic microorganisms covered in this report are noteworthy for their frequently multi-drug resistant phenotypes. Knowledge of resistance patterns helps clinicians choose the right empirical antibiotic treatment when the taxonomical assignment of the isolate is known but sensitivity results are pending.The online version contains supplementary material available at 10.1186/s12894-021-00821-8. Escherichia coli, Klebsiella spp. and Proteus spp. are their most common causative agents. UTIs occur more frequently among women than in men: 50% of females will experience at least one UTI in their lifetime [With approximately 150\u2013250\u00a0million cases occurring globally per year [lifetime . Recurrelifetime . ComplicAntimicrobial resistance (AMR) has become a major concern threathening many an advance of medicine in the twenty-first century. Uropathogenic microorganisms are no exception to this: rates of AMR among Enterobacteriaceae are increasing globally, albeit with temporal and spatial differences \u201315. AntiInternational guidelines for UTI treatment are freely available; yet, poor antibiotic prescription remains common. Thirty percent of primary care antibiotic prescriptions were inadequate in a report from the United States . ApproprE. coli, Klebsiella spp., Proteus spp., Pseudomonas aeruginosa etc. have been widely reported, less attention has been devoted to microbes at the bottom of the prevalence ladder. These microorganisms constitute only a small fraction of UTI etiological agents but frequently display a multi-drug resistant phenotype, presenting a therapeutic challenge [One of the ways to improve the quality of antibiotic prescribing is antibiotic stewardship including the monitoring of local antimicrobial susceptibility patterns . While Ahallenge , 22. Furhallenge , 24 and The aim of this retrospective observational study was to report the AMR patterns for seven less frequent causative agents of UTIs in a Central European tertiary referral centre Department of Urology over a period of nine years.Acinetobacter, Citrobacter, Enterobacter, Morganella, Providencia, Serratia and Stenotrophomonas. Urine cultures may have originated from spontaneously voided midstream samples, aseptic catheterisation during theatre procedures, indwelling catheters, suprapubic catheters, nephrostomy tubes and uretero-ileostomies. Because of the small prevalence of these uropathogens, inpatient and outpatient samples were included in the analysis. Duplicates were eliminated, allowing only one isolate of a given pathogen per patient per year. Prevalence of uropathogenic organisms and their antimicrobial susceptibility patterns (including trends where appropriate) were analysed.Similar to our previous related work , urinaryThe method used for culture and susceptibility testing has been described elsewhere . Briefly5 colony-forming units/mL .Antibiotic susceptibility testing was performed by the disc diffusion method on Mueller\u2013Hinton agar  and by the MIC dilution method  Erba-Lachema, Brno, Czech Republic). EUCAST MIC breakpoint tables were used. Intermediate results were excluded from this analysis. The cut-off used for significant bacterial presence was 10This survey covers the following antimicrobial agents: ampicillin, amoxicillin/clavulanate and piperacillin/tazobactam; cefuroxime, cefotaxime, ceftazidime and cefepime; ciprofloxacin and ofloxacin; gentamicin and amikacin; ertapenem, meropenem and imipenem; trimethoprim-sulfamethoxazole (co-trimoxazole), nitrofurantoin and colistin.Cochrane-Armitage test was used to assess statistical significance of trends. Statistical analyses were performed in XLSTAT 2020.1.3 . Alpha level of 0.05 was considered significant.Enterobacter spp. was the most prevalent uropathogen during the study period  followed by Morganella morganii . The isolates identified included Acinetobacter spp. (n\u2009=\u200974), Citrobacter spp. , C. freundii (n\u2009=\u20092), C. koseri (n\u2009=\u200923)), Enterobacter spp. , E. cloacae (n\u2009=\u200912)), Morganella morganii (n\u2009=\u2009194), Providencia spp. , P. rettgeri (n\u2009=\u200911), P. stuartii (n\u2009=\u200932)), Serratia spp. , S. marcescens (n\u2009=\u200910), S. odorifera (n\u2009=\u20091)) and Stenotrophomonas maltophilia (n\u2009=\u200927).From a total of 15,909 positive urine cultures (duplicates excluded) between 1 January 2011 and 31 December 2019, the pathogens surveyed in the present study were detected in 740 samples  from 607 patients. Of these, 466 (76.8%) were males and 141 (23.2%) were females. Mean age (interquartile range) was 70.3 (64\u201377) and 69.2 (59\u201376) for men and women, respectively. Two-thirds of urine samples (n\u2009=\u2009482) originated from out-patients and 258 from in-patients  to second-generation cephalosporine, cefuroxime. S. maltophilia. Resistance rates to ofloxacin were somewhat lower but never less than 15%. Additional file Resistance rates of all uropathogens to ciprofloxacin exceeded 20% and approximated 60% in the case of Citrobacter spp. and Serratia spp. resistance to gentamicin was just above 6%. Resistance rates of the other uropathogens to gentamicin varied between 12.4% and 33.3%. All but Acinetobacter spp. and S. maltophilia retained good susceptibility to amikacin  to all carbapenems, resistance rates to ertapenem exceeded 10% in all other bacteria examined. S. maltophilia resistance rate to all three carbapenems was above 60%; Additional file While bility <\u20090% to allCitrobacter spp. (28.6%). Resistance rate to nitrofurantoin approached 100% for all but Citrobacter spp. (38.6%). Cotrimoxazole resistance rates fluctuated between 10 and 30%. Cotrimoxazole was, however, the antibiotic S. maltophilia had the highest susceptibility to  from a tertiary Spanish hospital. Their resistance rates oscillate in line with ours except our three-fold and 5.5-fold higher resistance rate to cefepime and nitrofurantoin, respectively [C. freundii was included in the Spanish study which may account for this difference. Fajfr et al. report on Citrobacter spp. (n\u2009=\u200997) resistance rates for ampicillin, ciprofloxacin and cotrimoxazole similar to our data [There is a limited amount of data on antimicrobial susceptibility of ectively . Of noteour data .Enterobacter, the most frequent pathogen in our study, retained extremely good susceptibility (>\u200990%) to amikacin, meropenem and imipenem only; clinically useful susceptibility rates were seen for ceftazidime, cefepime, ofloxacin, aminoglycosides and ertapenem. Cefepime resistance has shown a decreasing trend but this may be related to small numbers of Enterobacter isolates in the first half of the study period  and more resistant to ciprofloxacin (31% vs. 19%). The inclusion of only a particular species (E. cloacae) in the Spanish study may account for these differences.Serratia spp. isolates exhibited highest resistance rates to ampicillin, amoxicillin/clavulanic acid, 2nd generation cephalosporins, colistin and nitrofurantoin, in line with its characteristics described in the literature [Our terature . Gajd\u00e1csterature  report oProvidencia spp. had been presumed to be more resistant to antimicrobial drugs than Morganella spp. [Providencia spp. retained very good susceptibility to piperacillin/tazobactam and cefepime and no resistant strains were isolated to amikacin and all carbapenems. No report on urinary isolates AMR rates for Providencia was found in the literature. For M. morganii, Jim\u00e9nez-Guerra et al. report twice lower resistance rates to ciprofloxacin and cotrimoxazole and ten times higher resistance to imipenem (11% vs. 1.1%) [M. morganii resistance rates for some of the relevant antibiotics  showed statistically significant increasing trends. Interestingly, resistance to cotrimoxazole was decreasing   when comS. maltophilia are respiratory tract infections [S. maltophilia resistance rate exceeded 50% for all antibiotics tested (including carbapenems); only aminoglycosides and cotrimoxazole showed more favourable resistance profiles. Its resistance to cotrimoxazole was in fact among the lowest in the present survey, despite a  increasing trend in our and others\u2019 data [Although the majority of infections caused by fections , 30\u2014it irs\u2019 data .The limitations of the present report that need to be acknowledged include (1) the combination of both in- and out-patients in the analysis; due to small numbers of isolates cultured from urinary samples, the authors did not find further division of the study population feasible  suggests that our data are applicable in a wider geographic area and not just in our own institution.Monitoring of antibiotic resistance patterns is an important contribution to (1) providing a better service to patients by the likely best choice of antimicrobial empirical treatment; (2) economically rational allocation of resources in healthcare; and (3) the prevention of the global rapid spread of antibiotic resistance, a phenomenon that jeopardises many advances in medicine and surgery achieved over the last century. The knowledge of most efficiently acting antimicrobial agents  should however not lead to their indiscriminate use as empirical treatment\u2014perhaps with the exception of the gravest clinical scenarios.Acinetobacter spp. and S. maltophilia). Susceptibility to fluoroquinolones is limited. Amikacin is somewhat more efficient than gentamicine but susceptibilities for both safely exceed 80%. Nitrofurantoin shows virtually no efficiency. Cotrimoxazole acts well against Citrobacter spp., Serratia spp. and it is the treatment of choice for S. maltophilia UTIs. Among carbapenems, ertapenem was less efficient than meropenem and imipenem except for S. maltophilia whose isolates were mostly not suceptible to any carbapenems.The uropathogens described in this report are important microorganisms not for their prevalence but for their high resistance rates to a majority of commonly used antibiotics. Penicillin derivatives have generally poor effect except piperacillin/tazobactam. Cefuroxime is not efficient unlike cefotaxime, ceftazidime and cefepime (except against Additional file 1. \u00a0Tables S1-S6: Yearly antimicrobial resistance rates of uropathogens to different antibiotics.Additional file 2.Table S7: Yearly numbers of isolates for each uropathogen in the in-patient\u00a0and out-patient population."}
+{"text": "Isotopically heavy metallic iron in sublithospheric diamonds reveals deeply subducted serpentinized oceanic peridotite. 56Fe = 0.79 to 0.90\u2030) and unradiogenic osmium (187Os/188Os = 0.111). These iron values lie outside the range of known mantle compositions or expected reaction products at depth. This signature represents subducted iron from magnetite and/or Fe-Ni alloys precipitated during serpentinization of oceanic peridotite, a lithology known to carry unradiogenic osmium inherited from prior convection and melt depletion. These diamond-hosted inclusions trace serpentinite subduction into the mantle transition zone. We propose that iron-rich phases from serpentinite contribute a labile heavy iron component to the heterogeneous convecting mantle eventually sampled by oceanic basalts.Subducting tectonic plates carry water and other surficial components into Earth\u2019s interior. Previous studies suggest that serpentinized peridotite is a key part of deep recycling, but this geochemical pathway has not been directly traced. Here, we report Fe-Ni\u2013rich metallic inclusions in sublithospheric diamonds from a depth of 360 to 750 km with isotopically heavy iron (\u03b4 Global subduction of oceanic lithosphere is a fundamental characteristic of terrestrial plate tectonics. An integral feature of this recycling is that oceanic lithosphere interacts with seawater over millions of years before it subducts into the mantle, having profound implications for the geochemical cycle of water and other volatiles. Seawater circulation in faults associated with ridges, transforms, and slab bending (13C = \u221226.9 to \u22123.8\u2030) link CLIPPIR diamond source fluids to subducted slabs . An56Fe = 0.79 to 0.90\u2030, where \u03b456Fe is the parts per mil deviation of the 56Fe/54Fe ratio relative to the IRMM-014 standard) and are best explained if the iron is derived from magnetite and/or Fe-Ni alloys precipitated during serpentinization of the peridotitic mantle portion of slabs before deep subduction. This finding specifically traces a hidden but common geochemical pathway produced by subduction. The measurements also have implications for mantle iron isotope systematics. Subduction recycling of heavy iron in the form of iron-rich and relatively fusible phases could help explain the longstanding problem of the variable and heavy iron isotopic signatures of oceanic basalts (\u03b456Fe \u2248 0.1\u2030) relative to mantle peridotites and chondrites (both near 0.0\u2030) 187Os/188Os ratios of 0.1115 \u00b1 2 and 0.1109 \u00b1 2 (TRD) of about 2.5 Ga. While Re and Os concentrations are not reported for practical reasons , these extremely low Os isotopic compositions, by their nature, imply such a low time-averaged Re/Os that corrections for differential ingrowth of radiogenic Os since emplacement of the Letseng host kimberlite at 90 Ma are inconsequential relative to model age uncertainties.As an additional isotopic constraint on the origin of the metallic Fe-Ni-C-S inclusions, osmium isotopic compositions were measured from two separate inclusions in diamond sample Letseng_889 . The inclusions were of similar size and mineralogy  to those1109 \u00b1 2 . These v0) was created by Fe2+ disproportionation (3Fe2+ \u2794 2Fe3+ + Fe0) within Fe3+-bearing silicates, a process thought to produce widespread metal saturation in the mantle at depths greater than 250 \u00b1 30 km  that would shift the metal toward heavier isotopic compositions  can be estimated to be less than +0.4\u2030  based on theory, experiments, and natural samples. Iron isotope fractionation factors are simply not big enough at these high temperatures to produce the requisite isotopic shifts from a near-chondritic mantle . Although the high-temperature gradient at the core-mantle boundary may conceivably produce a suitably heavy \u03b456Fe signature by thermodiffusion (Soret effect) (Other high pressure-temperature processes such as core formation (90-92), as well as orthopyroxene and clinopyroxene, in peridotite (~7 to 8 weight % Fe) to form the secondary minerals serpentine, brucite, and magnetite, among other secondary phases (3O4) is the dominant iron-rich secondary mineral, although iron partitioning between  serpentine, brucite, and magnetite can vary  lowers the oxygen fugacity such that Fe-Ni alloys  often precipitate from the fluid in partially serpentinized peridotite , which is more nickel-rich than the observed Fe-Ni-C-S inclusions, the sparse data on metallic phases in serpentinites show that their compositions can vary and that other alloys, such as native Fe, can also form during serpentinization depending on the conditions , the metal phase melts and may become mobile, interacting with surrounding solids to evolve into the Fe-Ni-C-S melt now seen trapped as inclusions. It is also possible that the metal interacts with a slab-derived hydrous/carbonatitic melt that could provide carbon to the metal while simultaneously oxidizing some of the iron and driving the carbon content toward saturation, similar to experiments on metal-carbonatite melt interaction  lens, and the 514.5-nm line of an argon ion laser set to 150-mW output power. The 520.5-cmMetallic inclusions were exposed by polishing the diamond using conventional diamond polishing methods on a scaife. After cleaning the diamond surface with distilled acetone, distilled ethanol, and Milli-Q water, a small drop of Crystalbond  was applied to the diamond surface to cover the exposed metallic inclusion. The diamond fragment, with the metallic inclusion being protected by Crystalbond, was then placed in a Teflon vial and soaked in 0.4 to 3 ml of 6 M HCl at room temperature for 12 to 48 hours to further clean the diamond surface from any residual iron that might have remained from polishing on the scaife or from past handling with tweezers. The amount of iron in the cleaning acid was monitored and estimated to be within 6, 1, and 0.05% of the inclusion signals for Letseng_889 inclusion E & F, inclusion I, and Letseng_890 inclusion E, respectively. Chemical and iron isotopic compositions of potential anthropogenic contaminants, the steel polishing scaife and the stainless steel tweezers, were also measured and found to be distinct from the inclusions (table S2).After cleaning in 6 M HCl, the Crystalbond on the diamond was removed by repeatedly washing the diamond surface with distilled acetone, distilled ethanol, and Milli-Q water. The exposed metallic inclusion was subsequently dissolved out of the diamond by bathing the whole sample in 0.4 to 1 ml of 6 M HCl at room temperature for 2 to 3 days (90\u00b0C overnight for Letseng_889 inclusion E & F). The dissolution approach was tested initially on a mineral assemblage of troilite, taenite, and cohenite that simulates the mineralogy of the metallic inclusions, and complete dissolution was achieved. After dissolution of the metallic inclusion, about 5% of the analyte solution was used to determine its Fe, Ni, V, Cr, Mn, Co, and Cu concentrations on a Thermo Fisher Scientific iCap Q quadrupole ICP-MS (inductively coupled plasma mass spectrometer) at the Carnegie Institution for Science. The rest of the original solution was used for iron isotopic analyses.2O2. After removing the matrix by eluting 1.2 ml of 6 M HCl + 0.001% H2O2 through the column, the Fe fraction of the sample was eluted from the resin in 2 ml of 0.1 M HCl. The purified Fe solution was evaporated to dryness, taken up in 5 \u03bcl of concentrated HNO3 and 400 \u03bcl of concentrated H2O2, and then left at ~90\u00b0C overnight to decompose eluted organic compounds from the resin. The sample was then evaporated to dryness again and taken up in 1 ml of 0.4 M HNO3 for iron isotopic analyses. The column procedure gives an Fe yield of ~100%. Because of the use of concentrated H2O2, a small percentage of Fe could occasionally be lost during evaporation, making the total yield 90 to 100%. To ensure that there was no isotopic fractionation when that occurred, we performed multiple rounds of calibrations to show that there was no measurable effect (table S1). The procedural blank for Fe is less than 1 ng and negligible compared to the amount of Fe in the samples.Iron was purified from the matrix using one-step ion-exchange chromatography on heat-shrink Teflon columns loaded with 0.1 ml of Bio-Rad AG 1-X8 resin (100 to 200 mesh). The sample was loaded in 50 \u03bcl of 6 M HCl + 0.001% H+ peaks from isobaric interferences of ArN+, ArO+, and ArOH+. Potential isobaric interference from 54Cr+ was monitored at mass 53Cr+ and subtracted from Fe signals as necessary. The monitored intensity on 53Cr+ is <1 mV, and the correction on 54Fe+ is within 0.3 mV, insignificant to cause any measurable fractionation as tested on isotope standards. The instrument mass fractionation was corrected using the standard-sample bracketing method with the peak intensities matched to <10% difference. Each sample was analyzed four to eight times, with each analysis including 20 cycles of 4-s integrations. A sensitivity of 45 to 90 V/ppm  was achieved for 56Fe. Iron isotopic compositions are reported relative to IRMM-524a, which has the same iron isotopic composition as the international standard IRMM-014  at the Carnegie Institution for Science. Sample solutions were diluted to 200 parts per billion (ppb) in concentration and introduced to the mass spectrometer in dry plasma mode using an Aridus 3 desolvating nebulizer. Measurements were performed in high-resolution mode to resolve FeTo check the accuracy of the MC-ICP-MS analyses, three geological standards  were purified following the \u201cshort-column\u201d procedure of Craddock and Dauphas  were made on a Thermo Fisher Scientific Triton thermal ionization mass spectrometer at the Carnegie Institution for Science using the same microchemical extraction and negative thermal ionization techniques as used in studies of sulfide inclusions in lithospheric diamonds . To faciRoom-pressure, room-temperature NRIXS analysis was conducted at sector 3-ID-B of the Advanced Photon Source (APS) at Argonne National Laboratory. Energy spectra were obtained from \u221290 to +130 meV around the elastic peak with a step size of 0.25 meV and a collection time of 3 s per step. A total of 20 scans were conducted for the sample. A millimeter-size piece of awaruite from Josephine County in Oregon (NMNH 106125) was sliced and polished to expose a fresh surface for NRIXS analyses. The awaruite slice was checked under scanning electron microscopy for impurities before the analyses. Data reduction was done with the software packages PHOENIX ("}
+{"text": "The building and construction industry consumes a significant amount of virgin resources and minimizing the demand with alternative waste materials can provide a contemporary solution. In this study, thermal components of kraft fibres (KFs) derived from waste cardboard are investigated. The mechanical properties containing KFs within concrete composites are evaluated. Metakaolin (MK) and KFs were integrated into concrete samples as a partial substitute for cement. Silica Fume (SF) was applied to the KF (SFKFs) with a view to enhancing the fibre durability. The results indicated that there was a reduction in compressive strength of 44 and 56% when 10% raw and modified KFs were integrated, respectively. Raw, fibre and matrix-modified samples demonstrated a 35, 4 and 24% flexural strength reduction, respectively; however, the tensile strength improved by 8% when the matrix was modified using MK and SFKF. The morphology of the fibres was illustrated using a scanning electron microscope (SEM), with an energy dispersion X-ray spectroscopy (EDS) provision and Fourier transform infrared spectroscopy (FT-IR) employed to gain insights into their chemical nature. The thermal, calorimetric and combustion attributes of the fibres were measured using thermogravimetric analysis (TGA), differential scanning calorimetry (DSC) and pyrolysis combustion flow calorimetry (PCFC). SFKFs showed a lower heat release capacity (HRC), demonstrating a lower combustion propensity compared to raw KFs. Furthermore, the 45% decreased peak heat release rate (pHRR) of SFKFs highlighted the overall reduction in the fire hazards associated with these materials. TGA results also confirmed a lower mass weight loss of SFKFs at elevated temperatures, thus corroborating the results from the PCFC runs. In recent times, researchers have been highly focused on investigating novel sustainable construction materials due to the negative environmental impacts caused by excessive virgin material consumption ,2,3. Glo2) and the stabilization of the alkali content. Research integrating KFs within cement-based composites has predominantly focused on the mechanical properties [Due to the abundance of residential waste, these materials are becoming increasingly researched as a potential source of building and construction material. In recent years, there has been a strong interest towards the integration of waste cardboard within cement and mortar materials ,14,15. T2O3), which has been shown to enhance the hydration of cement in the early stages [2, which in turn reduces the alkali attack on fibre walls [2), which can consume Ca(OH)2 at later stages of hydration. These factors can also increase the bond between the fibre and the matrix. An important factor of natural-fibre-reinforced cementitious composites is the materials\u2019 level of decomposition that can occur with increased temperature. Previous research  has repoy stages . This fare walls ,21,28,29re walls ,15. It cThis paper aims to evaluate the thermal performance of cardboard, cardboard pulp, and raw and SF surface-modified KFs. The mechanical strength properties of the kraft fibre concrete composite materials are also presented with a view to illustrating and exemplifying the physical attributes of the fibrous material. The main objective of the present study is to demonstrate the successful integration of cardboard waste material as a partial cement substitute within concrete composite materials for further applications within the building and construction industry. The main constituent materials used to reduce the consumption of OPC within the mix design of the concrete specimens were waste corrugated cardboard and MK. A mortar mixer was used to prepare concrete specimens. The raw materials were dry mixed for 5 min before adding water. After adding water, the materials were mixed for an additional 5 min. Upon completion of the mixing process, concrete was poured into various moulds in three separate layers with twenty compactions for each layer using a steel rod to maintain uniform compaction. The specimens were prepared at a room temperature of 20 \u00b0C for 24 h, before curing was applied in water baths for 7, 14 and 28 days. Raw KFs and SFKFs were thermally analysed to evaluate their degradation characteristics. The mechanical properties of concrete when reducing OPC with SFKFs, raw KFs and MK were analysed. Three bespoke mix designs were analysed in this study, with the mix code correlating to the constituent materials that were used in the concrete. For example, the SFKF105 sample is the integration of 10% SFKFs and 5% MK, whereas, correspondingly, SFKF10 is 10% SF modified fibres and KF10 is 10% raw KFs. The total reduction of OPC within each mix design is shown in \u22121 and 60 \u00b0C min\u22121, and from 30 to 900 \u00b0C, with a gas flow rate of 50 mL min\u22121. The second heating rate of 60 \u00b0C min\u22121 was chosen with a view to directly comparing the results with those from the pyrolysis combustion flow calorimetry (PCFC) experiments.Thermogravimetric analysis (TGA) is generally performed in order to gain insights into the thermal and thermo-oxidative behaviour of solid materials. In the present study, the TGA runs were conducted on samples  of waste cardboard (CB), waste cardboard dried pulp (CBDP), raw KFs and SFKFs. Generally, TGA provides data relating to the material\u2019s decomposition and can demonstrate the degradation kinetics and char formation propensities. A Mettler Toledo instrument was used in this study, in accordance with ASTM E1131 . The tes\u22121 (from 30 to 550 \u00b0C). Accurately weighed samples (ca. 15 mg) were initially taken into aluminium crucibles, with these crucibles subsequently sealed with aluminium lids that contained pinholes, thus facilitating the escape of any gaseous products that were formed, especially at elevated temperatures.The differential scanning calorimetry (DSC) analyses of the samples were performed with a view to identifying phase changes and measuring the energetics of the pyrolytic reactions. For this purpose, DSC tests were conducted on some of the pristine specimens, and fibrous component (KFs) and its admixture with silica fumes (SFKFs). For these measurements, a Mettler Toledo instrument was employed, with the tests conducted in an atmosphere of nitrogen and at a heating rate of 10 \u00b0C min\u22121 in the attenuated total reflectance (ATR) mode. In each case, a few milligrams of the test sample were used as neat and it was mounted onto the diamond crystal stage. A plot of absorbance versus wavenumber was generated for each of the samples, after appropriate baseline correction for each run , which aided in identifying the various functional groups present within them. Fourier transform infrared spectroscopy (FT-IR) was used to obtain information relating to the chemical nature of the test samples. A PerkinElmer 1600 Series spectrometer was used in this study in accordance with ASTM E1252 . The tesThis technique, also known as \u201cmicroscale combustion calorimetry\u201d (MCC), is a small-scale calorimetric testing method used to analyse the fire behaviour of various solid materials when subjected to a forced non-flaming combustion, under anaerobic or aerobic conditions. This is conducted in accordance with ASTM D7309 . The sem\u22121, applying an FTT microscale calorimeter using method A, i.e., in an atmosphere of nitrogen.The main advantage of using PCFC is that only a very small quantity (mg) of a sample is required, and the test method often provides information regarding useful combustion parameters, such as peak heat release rate (pHHR), temperature to pHHR, total heat released (THR), heat release capacity (HRC), effective heat of combustion (EHC) and percentage of char yield. Although PCFC can provide some of the useful data regarding heat-related parameters in the smaller scale, correlation of the available data with real fire scenarios is still limited. In the present work, PCFC runs were conducted in some chosen substrates (mainly step-growth polymers) at 1 \u00b0C minCompressive strength was determined using concrete cylinders of 100 mm diameter and 200 mm length. The load rating applied to the specimens was 20 MPa/min in accordance with AS 1012.9 . The fleA scanning electron microscopy (SEM) with an energy dispersion provision (EDS) was used to analyse the morphological features of the samples. This was conducted on the Phenom XL G2 Desktop SEM operating at 10 kV via 1000 magnitude. Samples were reduced to 2\u20135 mm in diameter using a diamond cutting saw. The EDS report illustrated the chemical composition of the samples provided.\u22121 owing to -O-H stretching and -C-H stretching occurring in the region of 2900 cm\u22121), and generated a typical fingerprint region of a ligno-cellulosic material, in their respective spectrum  exhibited specific absorptions . It is relevant to note here that the general profiles of the thermograms for test samples were similar regardless of the heating rate and consisted of the following distinctive steps: 1. Initial loss of water  up to 180 \u00b0C; 2. Main chain degradation, including dehydration reactions up until about 400 \u00b0C; 3. Secondary degradation of the carbonaceous residue until the end of the run (900 \u00b0C). This is also in accordance with researchers stating that there are three main stages of weight loss with natural fibres [\u22121) is shown in The TGA runs were conducted in an inert atmosphere of nitrogen and at two heating rates, 10 and 60 \u00b0C minl fibres ,27. Firsl fibres  also deml fibres  conducteAs shown in As expected, the DSC curves of the samples  showed at least two distinctive peaks which mirrored their corresponding TGA thermograms. Evidently, these represent endothermic peaks that correspond to the loss of physically bound water (between 30 and 180 \u00b0C) and main chain pyrolysis reactions (occurring between 250 and 400 \u00b0C). A broader endothermic peak beyond 400 \u00b0C (and until the end of the run: 550 \u00b0C) could be indicative of slow degradation reactions of the residue that was left after the main chain degradation see .2 (SF) to the fibrous matrix. On\u00e9sippe et al. [The relevant parameters obtained through PCFC runs are tabulated in e et al.  noted the et al. . Increase et al. ,46. Dried cardboard pulp exhibited a higher combustibility rate than its cardboard and fibrous counterpart; Inorganic materials such as SF can reduce the overall flammability of natural fibrous materials;A 10% KF integration exhibited satisfactory strength results for non-structural concrete; Waste cardboard can be utilized within cementitious composites; Matrix modification using MK enhances the mechanical strength of fibre-reinforced concrete; Using KFs derived from waste cardboard can reduce virgin resources requirement and divert waste in landfill management systems.In this study, thermal and mechanical evaluations of fibres derived from cardboard waste within cementitious composites were conducted. Research highlighted the abundance of cardboard waste and a novel approach was defined to reduce potential accumulation in landfill areas, promoting a sustainable approach in construction. SF was implemented as the fibre surface modification technique and MK was used as the matrix modifier to enhance fibre durability. Cardboard waste was subjected to mechanical and thermal processing methods. These processes created KFs, ready for composite integration. Mechanical properties were determined via compressive, tensile and flexural testing methods. Morphology of the fibres was established using an SEM with an EDS provision. FT-IR was employed to illustrate the chemical nature of the materials. Thermal, calorimetric and combustion attributes of the fibres were measured using a TGA, DSC and PCFC, respectively. The SEM/EDS reports illustrated the successful application of SF onto the KF walls. This factor of surface modification using SF exhibited a reduction in the HRC when comparatively analysed with raw KFs, cardboard and cardboard pulp. This also gave SFKFs a relatively lower level of combustibility, which can ultimately lead to an improved durability of the fibres within cementitious composites when exposed to elevated temperatures/fires. The TGA results also favourably compared with the corresponding data obtained from the PCFC runs, especially in terms of the char residues obtained. DSC curves showed a broader endothermic peak beyond 400 \u00b0C, indicating a slow pyrolysis reaction following the main chain degradation. The FT-IR spectrum showed signals that are typical of ligno-cellulosic material with a character fingerprint region. The microstructure data revealed that the chemical processing applied to produce KFs does not affect the thermal composition of the cellulose matter. The integration of 5% MK within the cementitious matrix enhanced the compressive, tensile and flexural properties compared to non-modified matrixes. However, compressive and flexural strength was reduced when fibre integration occurred. Tensile strength properties were greater than the control when MK and SFKFs were integrated in the composite. This demonstrated the durability enhancement of surface modification using SF. Future research can be directed towards the fire performance of KF concrete and the reaction of isothermal conditions on the fibre durability. The major findings of this research are summarized as follows:"}
+{"text": "In 2018, South Africa\u2019s National Department of Health provided additional resources for ward-based primary healthcare outreach teams (OT) with support from the U.S. President\u2019s Emergency Plan for AIDS Relief. The intervention package included a new training curriculum, enhanced staffing, revised management and supervisory structures, and more intensive monitoring and evaluation (M&E). The goal was to strengthen OT and their impact on both primary healthcare and HIV-specific services. We conducted a process evaluation of this intervention package during its second year and examined implementation successes and challenges.We conducted a mixed-methods evaluation at 20 purposively selected facilities in Bojanala and City of Tshwane districts, including surveys with 222 community health workers (CHWs) and outreach team leaders (OTLs); key informant interviews and online surveys with 28 policy and program stakeholders; 70 in-depth interviews with health facility staff; 20 focus group discussions with 194 CHWs; 20 structured health facility assessments; directly-observed time-motion studies; and review of program documents.Most participants highlighted the hiring and training of CHWs and OTLs as a key implementation success because this had partially alleviated staffing shortages and helped clarify CHWs\u2019 and OTLs\u2019 responsibilities and supervisory structures. The new monitoring tools were welcomed for their potential to improve data collection and program tracking. However, participants highlighted many program challenges: short-lived gains in CHWs\u2019 knowledge and skills due to lack of ongoing training and mentoring; insufficient integration of OT into health facility management structures; persistent shortages of equipment, supplies, transportation, and workspace for CHWs; and insufficient remuneration for staff.Strengthening and expanding CHW programs, such as OT, requires intensive support and continuous investments. To sustain improvements in training, supervision, and job satisfaction, CHWs must be equipped with needed resources, provided with ongoing supportive supervision, and strengthened by optimized program management, monitoring and processes. Community health workers (CHWs) are widely used in resource-constrained and middle-income countries to provide primary healthcare (PHC) services and bridge the gap between health facilities and communities in the context of healthcare worker shortages. They are also seen as a key contributor to the attainment of health-related Sustainable Development Goals 3 and 6  by actinThe district health system adopted by South Africa\u2019s first democratic government in 1994 did not include CHWs, but a framework was created in 2004 to support the development of a national CHW program . This waIn 2018, South Africa\u2019s National Department of Health (NDoH) and the U.S. President\u2019s Emergency Plan for AIDS Relief (PEPFAR) announced a USD1.2 billion increase in funding and activities aimed at identifying an additional two million people living with HIV in South Africa and initiating them on antiretroviral therapy (ART) . In suppThe inclusion of OT in the provision of HIV service delivery was a purposeful attempt to improve access to those services and bridge the gap between facility-based and community-based HIV programs . Since CPrior to 2018, known challenges related to OT effectiveness included inconsistent supervision, sub-optimal integration into health facility systems, overly broad CHW scopes of work and limited CHW in-depth knowledge and skills , 16, 17.NDoH Policy Framework and Strategy for Ward Based Primary Healthcare Outreach Teams 2018/19\u20132023/24 .\u2013Policy and program stakeholder, KIIPerceived challenges. Most CHWs felt the training was too short considering the extensive amount of information covered. They highlighted continuing gaps in their knowledge  and recommended extending the length of the training to cover topics in greater detail.Sometimes they might give us medication that we don\u2019t know and when we get to our patient, she will ask me what it is, and I won\u2019t even know how to explain it\u2026. Sometimes it ruins our reputation\u2026when I get to the office, my team leader doesn\u2019t know too. We need more [training] as we work with medicine\u2026\u2013CHW, FGDKII, IDI and FGD participants also reported that some CHWs did not receive training in all aspects of the new curriculum. Additionally, although the training implementation plan included ongoing supportive supervision and refresher trainings, these activities had not been implemented at all sites at the time of the evaluation. CHWs suggested continual in-service training and supportive supervision to advance their skills and stay abreast on new health information, procedures, and medications.The trainees\u2019 perception that their training was too brief to retain knowledge was echoed by the results of their repeat testing in the KAP survey. A second major theme was the managerial relationship between the OT and health facility staff, including challenges with role clarity, communication, and staffing levels.Perceived strengths. All participant cadres highlighted the recent introduction of a clear management structure for the teams as another key strength of the program. The quantitative data showed that most CHWs and OTLs had reported having a written job description detailing their roles and responsibilities , received a formal evaluation of their OT work in the past 12 months  and \u201cstrongly\u201d or \u201csomewhat\u201d agreed when asked if they \u201cconsistently had the supervision needed to perform their duties\u201d . Furthermore, most OTLs  had conducted formal evaluations of CHWs.These survey findings were reinforced by the qualitative data. In IDIs, OTLs reported that facility managers checked in with them to ensure they had the needed resources to lead their teams and that it was easy to reach their managers and have concerns addressed in a timely manner.Sometimes even if she doesn\u2019t come to us, she phones us even if we are the one having a problem, any time we can access a phone, call her, or make SMS, she\u2019ll respond\u2026 and she comes to us and visits us any time.\u2013OTL, IDIAdditionally, both OTLs and CHWs described their relationships and communication with each other as being good overall, despite some previous tension over supervisory styles. CHWs noted that relationships had improved after the expansion, especially after OTLs received supervisory training.I think our relationship with them has improved because there were times when they would speak to us in a hurtful way, but afterwards  we would go to them and have a conversation that the way you spoke to us was hurtful and we did not like it. Then we all apologize, and we move on.\u2013CHW, FGDOTLs, in turn, reported that any problems that emerged were effectively addressed at team meetings and that the teams worked well together.The relationship is like my relationship with my kids in my household. Sometimes we are happy, sometimes we fight, sometimes we eat together, sometimes we don\u2019t\u2026 they also say what doesn\u2019t make them happy. So work is like my household. The nice thing is, we always talk to each other. There\u2019s never been a time when we are so mad about each other that we don\u2019t talk. It\u2019s like our household, we strive for peace every day.\u2013OTL, IDIFinally, CHWs also prided themselves on teamwork, explaining that they supported each other:\u2018We have team spirit. When one needs help in the group, we help out and not belittle the person. We don\u2019t point fingers asking why the person doesn\u2019t know. We work in unity. We discuss, come up with a solution, and work carries on.\u2013CHW, FGDPerceived challenges. Despite the generally positive experiences around supervision, communication challenges between CHWs and OTLs emerged as an ongoing concern among CHWs. CHWs characterized some OTLs as having poor communication skills and lacking tact and reported being talked down to and shouted at.Some [OTLs] are not okay, honestly. Sometimes we put so much effort in our work \u2026 and then be told you didn\u2019t do a great job. That\u2019s very hurtful. It affects us to a point of feeling like quitting our work.\u2013CHW, FGDIntegration of OTLs into the overall health system was reported across all participant cadres as a key challenge. Policy and program-level stakeholders in both the KIIs and survey noted that the teams were poorly integrated into the health facilities at the beginning of the expanded program, and that this had contributed to a lack of adequate support, such as dedicated resources and workspace, from health facility leadership.The facility managers they just don\u2019t understand it [Outreach Teams], and they don\u2019t want to hear about it\u2026 [they] will always prioritize what\u2019s happening inside the clinic, they will tell you that \u2018l\u2019m a clinical person\u2019 and all those things\u2026if we can [only] get full buy-in from the clinic managers\u2026.\u2013Policy and program stakeholder, KII\u2018Many CHWs and OTLs, in turn, considered the lack of dedicated workspace and resources as an indication of their overall marginalization and under-appreciation as healthcare workers. They suggested that having a workspace in the clinics would heighten recognition of the important role that the teams play in service delivery and also help improve their relationships with facility staff.The problem is that we don\u2019t have a place where we say this is our home, our health post. We are squatting wherever we are\u2026and then we walk miles.\u2014OTL, IDIPolicy and program stakeholders attributed lack of integration to the generally fragmented management of PHC services in the country, whereas CHWs attributed it to their work in the community not being immediately visible to health facility staff.\u2026 the outreach teams are managed by [a] different manager while the facility that the team report to is managed by another. This leaves them without resources as they belong to a different cost center\u2026.\u2013Policy and program stakeholder, Online Survey\u2026we are not recognized for the work we do\u2026they say the community health workers from [clinic] are not working, whereas the patients themselves commend what we do but some members of the staff at the clinic do not commend us. There is no recognition.\u2013CHW, FGDOngoing staffing challenges emerged in both the qualitative and quantitative data as additional examples of the poor integration of OTLs into health facilities. In the KAP survey, only 58% (n = 18/31) of OTLs and 66% (n = 127/191) of CHWs \u201cstrongly\u201d or \u201csomewhat\u201d agreed that their workload was manageable. In the IDIs, OTLs reported that team sizes were too large for them to manage and supervise adequately, with some reporting having as many as 50 CHWs on their teams while the recommended number is 6\u201310 CHWs per OTL.Sometimes l feel like there is too much community care workers, sometimes the load\u2026 you feel that you are supervising many people\u2026 lot of people is difficult to manage compared to small number.\u2013OTL, IDICHWs further noted that OTLs were unevenly distributed across health facilities, which meant that they did not always receive the supervision they needed.\u2026it\u2019s not enough because at times you go to a certain patient, and you find the situation too difficult, and you end up wishing that you could have gone with the supervisor. Like with a patient that suffers from TB MDR, you would wish that your supervisor could come with you so that he could advise you because we don\u2019t have more knowledge. And without the supervisor, we might get infected.\u2013CHW, FGDUnderstaffing at some health facilities led to demanding workloads, especially when OTLs were asked to support non-OT-related clinic work. During the field-based observations, research staff noted that only 12% (n = 8/65) of team visits had an OTL present. The field observations also showed that limited time was allotted to logistics planning and preparing for the day with the team and OTLs. Logistics planning occurred in only 14% (n = 9/65) of the observations and a meeting with the OTLs ensued prior to community visits in only 3% (n = 2/65) of the observations.OTLs and policy and program stakeholders attributed staff shortages to perceived high staff turnover due to career advancement and retirement.I think the solution is for them, those from the clinic, hiring enough staff to help them because when I [got hired]\u2026 they didn\u2019t say I will go and help at the clinic and\u2026[also] work with the Outreach Teams. They said you are an outreach team leader. They didn\u2019t say you will work at the clinic.\u2013OTL, IDI\u2026we have tried to recruit young ones, the young ones now they want to upgrade their careers. They want to go to school. We try to hire the old ones, the old ones they work for few years and then they retire\u2026 so it\u2019s a challenge.\u2013Policy and program stakeholder, KIIThe work environment for the teams emerged as a third theme. Findings from both the qualitative and quantitative data showed that all participant cadres believed that the program was delivering high quality of care to communities and that CHWs and OTLs had high levels of job satisfaction. Reported challenges in the work environment included lack of supplies and material resources to support community-based activities.Perceived strengths. All participant cadres noted that the surge in funding and support enabled scale-up of OT services in communities and that the teams had been successful in multiple domains: tracing and linking community members back to care; distributing medications in the community, thereby improving treatment adherence, increasing collaboration with other community organizations, and alleviating the burden on health facilities by reaching patients in their homes.\u2026So, we use them [OT] for community awareness because with us we are mainly focused on the facility, but they are our eyes outside there in the community. They the ones that will go and see whatever is happening in the community, they will come and report back\u2026they will take some of the services out there to the community.\u2013Facility manager, IDIField observations showed a high rate of successful household visits by the teams. Of the 215 households visited during the 65 field-based observations, patients were located for 86% (n = 184/215) of the visits, enabling CHWs to provide services.Another success was the high level of job satisfaction among CHWs and OTLs, many of whom viewed the teams as providing high-quality services to community members. CHWs noted that the teams had successfully re-connected many community members with health facilities and that home visits were making healthcare more easily accessible to community members.Household registration, we are good at that. We are good at tracing even though sometimes the patient, they give us the wrong address and telephone numbers, but tracing of TB and HIV patients, we are good at it.\u2013OTL, IDIOur work is greater than any other. We have saved lives, eradicated illnesses, and avoided funerals in helping and nursing our community members back to health. When we arrived, the elders did not know how to consume their medication. Some overdosed, but now they do it diligently without us to monitor.\u2013CHW, FGDThe positive feelings that OTLs and CHWs expressed about their work and contributions to improving community healthcare were affirmed in the KAP surveys: 84% (n = 161/191) of CHWs and 87% (n = 27/31) of OTLs rated the quality of the community-based care by the teams as \u201cgood\u201d or \u201cexcellent\u201d and 75% (n = 143/191) of CHWs and 84% (n = 26/31) of OTL were of the view that the services they provide meet the needs and expectations of the community. Additionally, 82% (n = 156/191) of CHWs and 84% (n = 26/31) of OTLs \u201cstrongly\u201d or \u201csomewhat\u201d agreed with the statement, \u201cif it were up to me, I would continue to work on the Outreach Teams for quite some time\u201d.Perceived challenges. Inadequate office equipment , personal supplies , weather conditions, lack of transportation, difficulty reaching and locating patients due to long distances between homes and incorrect contact information, and safety concerns were identified as key barriers in the work environment, as shown in In 60% (n = 39/65) of field visits, CHWs were observed working under harsh weather conditions without protective supplies, such as umbrellas or sun hats. Some CHWs reported that they did not pack a lunch due to concern that it would spoil in the heat. Lack of adequate transportation for CHWs was observed in 49% (n = 32/65) of field visits. CHWs often walked long distances to reach their patients in excessive heat and without proper walking shoes. Travel time  between the clinic and one or two households took over 30 minutes in 45% (n = 29/65) of observations. In the qualitative data, CHWs suggested that having uniforms would improve their safety by making them recognizable in the community as well as confer respect and credibility.We walk in the sun and in the rain without uniforms. We\u2019ve been promised boots and raincoats. We\u2019re getting old, about to go on the pension fund, and we\u2019re still waiting for uniforms. The shoes we use are usually worn out by the end of the month. Some can\u2019t even afford these R30 shoes.\u2013CHW, FGDFurthermore, in the IDIs, OTLs reported that they had to use their own transportation, which was costly, and thus impeded their ability to supervise CHWs on a frequent basis.CHWs complained that they lacked supplies for monitoring patients\u2019 health, such as sphygmomanometers and glucometers, and personal protective equipment when dealing with patients with a communicable disease, such as those with tuberculosis.If you are dealing with a high blood [pressure] patient, you need to keep checking their vitals, but without that machinery, it is pointless.\u2013CHW, FGDYou would sometimes be called to attend to a TB patient, but when you get to evaluate, you find that the TB has escalated to MDR stage. It is possible for it to spread\u2026We don\u2019t get shielded in any way, nor do we have the equipment to protect ourselves from those illnesses. They do not recognize us in that regard. We do not have benefits.\u2013CHW, FGDIn 51% (n = 33/65) of the observations, study staff confirmed that CHWs did not have the supplies and monitoring equipment needed to provide some services to their patients, such as condoms, sphygmomanometers, HIV testing kits, gloves, masks, glucometers, and/or medication. CHWs also lacked the paper-based forms/tablets to register patients and collect patient data in 20% (n = 13/65) of the observations. Additionally, in the KAP surveys, only 52% (n = 99/191) of CHWs and 32% (n = 10/31) OTLs \u201cstrongly\u201d or \u201csomewhat agreed\u201d that they consistently had the supplies they needed to perform their duties.Another major challenge reported was an insufficient stipend. In the KAP surveys, only 42% (n = 13/31) of OTLs and 13% (n = 25/191) of CHWs reported satisfaction with their pay. This was also expressed in FGDs by CHWs who reported that they often had to use their own funds for photocopying, airtime, transportation, uniforms and weather-protective gear.\u2026[the] weekly sheets that we use, they end up finishing, yes, they finish. The problem is that we struggle to get them when they finish, but we do go to the office to collect them but then we are asked to photocopy for ourselves. So at times even photocopying for yourself is expensive, they might charge you R2 [14 cents] per page, and that delays the work that we [are] supposed to do, because of you not having enough material to work with.\u2013CHW, FGDA few participants reported that they had to pay for the repair or replacement of damaged work equipment, particularly the tablets they used for electronic data capturing. Many policy and program stakeholders acknowledged these funding challenges and expressed concerns about program sustainability given the lack of standardized compensation and payment scale for CHWs. They noted a disconnect between CHWs and their employers: although CHWs are on contracts, they wanted the same benefits as permanent employees.When programs are contract-based, you are appointed for two years and you\u2019re not sure what\u2019s gonna happen to you after two years\u2026 it creates a lot of uncertainty\u2026 we [should] stop appointing people short-term contracts, let\u2019s appoint them on permanent contracts. Just like anybody else in the country.\u2013Policy and program stakeholder, KIIAlthough research teams noted that patient homes were located and patients were reached in 86% (n = 184/215) of households visited during field observations, patient tracing was reported as a challenge for the teams. In the FGDs, CHWs reported that they are sometimes given incorrect addresses and/or the patients are not home when they arrive for the visit. This creates inefficiencies once in the field and causes delays in providing services in the community. CHWs also reported safety concerns, such as the fear of being physically or sexually attacked during household visits or on the street.We face problem such as being intimidated. For example, you\u2019re carrying a schoolbag and it has pills or sometimes you are carrying a plastic and it\u2019s visible that there\u2019s pills inside. Then someone intimidates you and take[s] pills and injections since people sell injections too these days.\u2013CHW, FGDThe impact of the revised M&E strategy emerged as a fourth theme. Expanded M&E activities included new program indicators, data collection and database management processes, and mobile health  tools and systems. Both updated M&E strategies and mHealth tools had only recently been introduced in the selected districts at the time of the evaluation.Perceived strengths. Policy and program stakeholder KII participants and facility-level IDI participants noted that the introduction of the standardized indicators had the potential to enable more systematic data collection. Furthermore, use of mHealth enabled real-time and timely data collection, facilitated identification of households and follow-up visits, and has the potential to enhance supervision of CHWs, reduce data loss, improve data quality, and increase data confidentiality.It is working except that there are technical issues that we come across\u2026but it\u2019s really working and it reduced paperwork\u2026and there is clean data\u2026and confidentiality\u2026now you don\u2019t just see papers lying around.\u2013Policy and program stakeholder, KIIPerceived challenges. Policy and program-level stakeholders indicated that it was unclear to them how OT data were synthesized and entered into the central database and then used to inform practice. They also noted shortcomings in the presentation of data summaries, particularly the inability to disaggregate results by district or facility. Additionally, the lack of dedicated data capturers at health facilities made it difficult to conduct routine M&E activities and reduced the potential of the revised M&E and mHealth tools to increase overall program efficiency.It\u2019s just that it\u2019s tough to break [the data] down\u2026it\u2019s for this clinic, it\u2019s for that clinic\u2026everything just goes in there\u2026It\u2019s not segregated.\u2013Policy and program stakeholder, KIII feel, personally, if maybe they can give us more of trainings on that part, and also maybe we empower some of community healthcare workers to be at least the data capturers \u2026because \u2026 again we don\u2019t have data capturers. Those team leaders they have to be supervising and doing everything at the end of the month\u2026So, at least, if we\u2019ve got this M&E people who are like on daily basis doing such things, it will be better.\u2013Policy and program stakeholder, KIICHWs, in turn, felt that the phones and tablets that they used for data capturing made them vulnerable to theft and they lacked the necessary security to feel safe while traveling and visiting homes. Some CHWs commented that the amount and complexity of information to collect on the electronic forms prolonged household visits, which frustrated patients and caused tension. Connectivity problems caused the tablets and phones to freeze, further adding to patients\u2019 and CHWs\u2019 frustration.As for me, the problems that I have encountered started from the phone when we register. They welcome us well, but when you keep following the questions that are emerging from phones, they accuse us of taking time. There are many questions that are ask[ed] on the phones and they take time. You cannot just rush to the last question without answering the previous questions. The questions are many, hence people accuse us of wasting time.\u2013CHW, FGDIn the FGDs, some CHWs highlighted the need for updated and functional servers and mHealth devices to preclude the need to revert to paper-based reporting. The research team observed low rates of both electronic and paper-based data entry during field visits: only in 9% (n = 6/65) of the visits were CHWs observed entering data electronically  and only in 17% (n = 11/65) were they observed using paper-based documentation . No sites were exclusively using electronic tools; twelve reported only using paper-based M&E data tools and the remaining eight sites reported using a combination of paper-based and electronic tools.Some CHWs had lost their phones and tablets to thieves and had to pay out-of-pocket for replacements. CHWs also felt that the phones and tablets placed them under greater scrutiny from supervisors who could check up on them via Global Positioning System (GPS).They didn\u2019t trust us, and we do our work. They don\u2019t trust us still. That\u2019s why they brought these phones that track our every movement.\u2013CHW, FGDOur findings highlight the complexities involved in strengthening and expanding a national public-sector CHW-based program. We provide insights into program components that are easier to implement versus those that are more complex and require longer-term and expanded investments. As we show in Many of the factors highlighted by our study\u2013training, frequent and supportive supervision, ongoing mentorship, integrating CHWs with health facility-based providers, and financial and non-financial incentives to enhance CHW motivation\u2013have been identified in the literature as key components of successful CHW programs \u201326. CHW However, many studies caution that CHW training programs must be supported by regular refresher courses and ongoing supervision if their benefits are to be sustained , 28 becaThe ongoing supportive supervision and in-service refresher trainings planned for CHWs had not been fully implemented at the time of our study. Despite improvements in management and in relationships between OTLs and CHWs, we noted challenges with supervision attributable to staff shortages and other resource constraints. Some OTLs in our study were responsible for supervising as many as 50 CHWs and could not provide them with routine supportive supervision and mentorship. OTLs were also pulled into non-OT tasks at health facilities, which limited their availability for field-based supervision, as did their limited access to transportation. This was confirmed by field observations in which outreach teams were accompanied by their OTLs on only 12% of observed community visits and CHW teams almost never met with OTLs to plan and/or debrief before and after visits. This differs from the NDoH\u2019s scope of work for OTLs, which states that OTLs are expected to spend 70% of their time in the field supporting CHWs during home visits and 30% time on administrative responsibilities at the health facility [Supportive supervision is a continuous process that encompasses a range of activities, including on-the-job training, coaching and mentoring, performance feedback, strengthening relationships, building problem-identification and problem-solving skills, and working to improve resource allocation . It has Communication between facility managers and the teams in our study was not ideal and suggests that the program is not yet fully integrated into the health system. This is consistent with findings from an earlier South African study that reported strained relationships and lack of debriefings between CHWs and health facility staff , 17 and Expanding the scope of training to include organizational relations, coordinating mechanisms, teamwork, and planned communication structures that allow for consistent dynamic interactions among all personnel involved in the OT initiative is one strategy to build organizational support for the program and for CHWs to feel the work they do is respected. However, a combination of non-financial and financial incentives is required, including supportive supervision to facilitate cohesion across all team members and other health facility staff, equity in pay, as well as respect and recognition. A review of 16 CHW programs in low- to middle-income countries noted that consistent management and supervision were the most frequently reported program design and management enabling factors for scale-up and sustainability, whereas insufficient incentives for CHWs, followed by weak management and supervision, were the most frequently cited barriers .Policy and program stakeholders saw the revised M&E tools and the use of mHealth technology as an important innovation but acknowledged that the impact of these innovations was limited during the initial months of implementation, and that the new tools were not yet utilized to their fullest potential. In the early stages of implementation, the new M&E strategy also had some unintended consequences. Despite standardizing data collection, improving data quality and making data collection more efficient, in some instances tablet/smart phone-based data collection increased CHWs\u2019 workload and may have contributed to reporting errors. Electronic data collection was challenged by network connectivity and hardware problems that slowed down data capture and made home visits too long and frustrating for patients and CHWs. CHWs also expressed concerns about their security when moving around in their communities with the tablets, which could be stolen, and about their work habits and performance being scrutinized by supervisors via GPS on their tablets.Some of these issues have been corroborated in systematic reviews , 41. A qSeveral evaluations of CHW programs in South Africa have used mHealth strategies to assess CHWs\u2019 performance, although several reviews have not provided strong evidence to support their effectiveness , 44. An mHealth applications are being increasingly used in low- to middle-income countries to facilitate work performance of CHWs and improve delivery of health services. mHealth M&E systems enable immediate data entry and thus real-time data monitoring and supportive supervision in the field. M&E systems are key to assessing the effectiveness of CHW programs. Although use of mHealth tools by CHWs has been increasing and the technology employed in mHealth has changed and evolved over time, there still are relatively few formal outcome evaluations and limited mHealth applications of CHW programs operating at scale in low- to middle-income countries .Concerted and more intensive efforts are needed to improve CHWs\u2019 comfort with expanded data collection and the use of mHealth technology to improve efficiency, quality and use of data for program improvement. Supervisors of frontline workers will need to be trained in mHealth data collection and see the benefits of this technology for OT health reporting systems. Regular debriefing meetings and review of daily logs, registers and weekly reports with supervisors to ensure that CHWs understand the meaning of and rationale for data categories collected could help to improve the quality of the data recorded by CHWs , as doneThe effectiveness of the increased PEPFAR funding and NDoH support for the expanded program was compromised by shortages of critical equipment and supplies. CHWs in our study reported working without blood pressure machines, glucometers, or gloves, face masks, and other personal protective equipment. OTLs and CHWs alike complained about insufficient transportation support, which impeded regular supervision. These findings are consistent with earlier studies of CHWs in South Africa , 47\u201351. The issue of standardized CHW pay and benefits remains controversial and is further compounded by the effects of the global COVID-19 pandemic. CHWs in South Africa have carried out intermittent strike actions to protest non-standardized pay, benefits, and hours . These cMany of the challenges noted in earlier studies of CHW programs in South Africa and elsewhere in sub-Saharan Africa continue to be prevalent in South Africa\u2019s OT program despite the 2018 surge of funding and technical assistance. These highlight the larger structural issue of sub-optimal integration of the OT into the public sector healthcare system. Smooth translation of health policy changes into efficient service delivery does not happen overnight, as it entails undoing routine operational practices of health systems and health facility staff and unlearning norms that militate against wholehearted acceptance of CHWs as essential workers. Providing CHWs with professional recognition, benefits and job security may be as critical to their integration into the health system as ongoing training and professional development activities.This study complements the growing literature on the OT program in South Africa and to our knowledge, is the only published study following the scale-up and revitalization brought about by new funding initiatives. With its focus on implementation of a specific \u201csurge\u201d of material and technical support provided by NDoH, PEPFAR and other stakeholders in 2018\u20132019, it contributes to our understanding of how the program works, and what is needed to enhance its performance. Analytic rigor was strengthened by triangulating the use of multiple quantitative and qualitative data collection methods from diverse stakeholders to enhance internal validity of evaluation results, in addition to large sample sizes for most data sources.Several limitations of this evaluation must be noted. The evaluation was limited to 20 health facilities in two purposively-selected districts in two provinces and findings may not reflect the experience of OTLs and CHWs elsewhere in South Africa. While sample sizes were generally robust for the data collection methods, the online policymaker and program implementer survey sample, a supplemental data collection method to the KIIs, was small. The IDIs and KAP surveys were conducted in English. This may be a limitation due to language restrictions and potentially constrained generalizability. For the CHW and OTL knowledge test, the same CHWs and OTLs completed the I-TECH-administered pre- and post-test at the 20 participating sites in Bojanala and Tshwane; however, the repeat test administered with the KAP survey did not include all of the CHWs and OTLs who took the original pre- and post-test. The lack of repeat tests from all participants may have biased the results. By design, the study did not assess the perspective of patients or communities receiving OT services. Finally, as a formative process evaluation, the study assessed OT program implementation, not its impact, so we cannot determine whether the intensified support for OT improved health outcomes for beneficiaries.Given the prioritization of PHC and South Africa\u2019s decentralization to a district health management system, the importance of CHWs as a bridge between the healthcare system and the community continues to grow. In addition to their role supporting health promotion and health education, OTs provide critical linkages to services for maternal and child health, tuberculosis, HIV, and other chronic conditions and are well poised to engage with emerging health issues such as the global COVID-19 pandemic . CurrentS1 File(PDF)Click here for additional data file.S2 File(PDF)Click here for additional data file.S3 File(PDF)Click here for additional data file.S4 File(PDF)Click here for additional data file.S5 File(PDF)Click here for additional data file.S6 File(PDF)Click here for additional data file.S7 File(PDF)Click here for additional data file.S1 Table(PDF)Click here for additional data file."}
+{"text": "Tyrosine kinase inhibitors (TKIs) have dramatically improved the survival in chronic myeloid leukemia (CML), but residual disease typically persists even after prolonged treatment. Several lines of evidence suggest that TKIs administered to CML patients upregulate interferon \u03b3 (IFN\u03b3) production, which may counteract the anti-tumorigenic effects of the therapy. We now show that activated T cell-conditioned medium (TCM) enhanced proliferation and counteracted imatinib-induced apoptosis of CML cells, and addition of a neutralizing anti-IFN\u03b3 antibody at least partially inhibited the anti-apoptotic effect. Likewise, recombinant IFN\u03b3 also reduced imatinib-induced apoptosis of CML cells. This anti-apoptotic effect of IFN\u03b3 was independent of alternative IFN\u03b3 signaling pathways, but could be notably diminished by STAT1-knockdown. Furthermore, IFN\u03b3 upregulated the expression of several anti-apoptotic proteins, including MCL1, PARP9, and PARP14, both in untreated and imatinib-treated primary human CD34+\u00a0CML stem/progenitor cells. Our results suggest that activated T cells in imatinib-treated CML patients can directly rescue CML cells from imatinib-induced apoptosis at least partially through the secretion of IFN\u03b3, which exerts a rapid, STAT1-dependent anti-apoptotic effect potentially through the simultaneous upregulation of several key hematopoietic survival factors. These mechanisms may have a major clinical impact, when targeting residual leukemic stem/progenitor cells in CML. A previously almost universally fatal malignancy has now been converted into a chronic disorder with near normal life expectancy.4 However, even after more than decade-long periods of continuous TKI administration, the majority of CML patients cannot stop their treatment without disease relapse.5 One explanation, perhaps the most plausible, to this limited potential of achieving cure with only TKI, is resistance of the CML stem/progenitor cell population to ABL1-specific TKI monotherapy. Such resistance can be mediated by either a BCR-ABL1-dependent mechanism or by the intrinsic or microenvironment-induced activation of various signaling pathways, which are also required for the survival of normal hematopoietic cells.2Chronic myeloid leukemia (CML) is characterized by the reciprocal translocation t, which forms the Philadelphia chromosome. As a result, the fusion oncogene, BCR-ABL1 is formed and translated into a constitutively active tyrosine kinase, which plays an essential role in the pathogenesis of the disease.in vitro, due to the complexity of the immune system, TKI treatment in vivo upregulates interferon \u03b3 (IFN\u03b3) production, especially in the tumor cell microenvironment.6 Accordingly, serum IFN\u03b3 levels have been shown to significantly increase during TKI treatment of CML patients in chronic phase.8TKI treatment can affect a broad range of immune cells, including dendritic, T and natural killer cells. Although TKIs mainly inhibit the function of these cells 10 several lines of evidence suggest that the increased production of IFN\u03b3 during TKI treatment might play a negative effect on the therapeutic response of CML patients. For example, in CML patients the ratio of IFN\u03b3 positive T cells significantly increased during imatinib treatment, and was continuously elevated in patients without a major cytogenetic response, while in major responders the proportion returned toward values obtained in healthy controls.11 Furthermore, Held et al.12 showed in transwell experiments that soluble factors secreted by phorbol myristate acetate/ionomycin-activated T cells or interleukin (IL)-12/IL18-activated NK cells significantly inhibited the TKI-induced apoptosis of CML cell lines and peripheral blood mononuclear cells (PBMCs) of CML patients in chronic phase. Since only IFN\u03b3 (one of the most abundantly secreted soluble factors of activated T and NK cells), but not IFN\u03b1, tumor necrosis factor \u03b1, IL6, IL12, granulocyte-macrophage colony-stimulating factor (GM-CSF) or soluble CD40 ligand exerted an anti-apoptotic effect on TKI-treated CML cells, the authors suggested IFN\u03b3 as the key anti-apoptotic factor of the activated T and NK cell secretome.Although, in most cancer types, IFN\u03b3 exerts strong anti-tumorigenic effects,13We have previously shown that IFN\u03b3 upregulated several anti-apoptotic members of the BCL2 and BIRC  gene families, including the long isoform of MCL1 (MCL-1L) in the imatinib-treated CML cell line JURL-MK1. Accordingly, the anti-apoptotic effect of IFN\u03b3 on JURL-MK1 cells was counteracted by the presence of the selective MCL1 inhibitor A-1210477, suggesting that IFN\u03b3 might exert its anti-apoptotic effect on CML cells through the upregulation of MCL-1L.Based on these observations, our primary aims were to directly assess whether the inhibition of the pro-apoptotic effect of imatinib by activated T cell secretome depends on IFN\u03b3, and to characterize the effect of IFN\u03b3 on the imatinib-induced apoptosis of CML cells, including primary human CD34+\u00a0CML stem/progenitor cells.14 and K56215 CML lines were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ) and cultured in RPMI 1640 medium containing 10% heat-inactivated fetal bovine serum, and 1\u00a0mM L-glutamine (complete medium). The cell lines were PCR-tested and found to be mycoplasma free.The JURL-MK1Recombinant human IFN\u03b3 (PeproTech) was dissolved as recommended by the manufacturer. Imatinib  and ralimetinib  were dissolved in water. Wortmannin , SCH772984 , JNK-IN-8 , and SC75741  were dissolved in dimethyl sulfoxide (DMSO). DMSO concentration was equalized in each well of a particular experiment.PBMCs were separated from peripheral blood of untreated CML patients at the time of diagnosis (chronic phase of the disease) by leukapheresis. CD34+\u00a0cells were purified from PBMCs using the Dead Cell Removal Kit (Miltenyi Biotec) and the human CD34 MicroBead Kit (Miltenyi Biotec). Flow cytometric analysis using FITC-conjugated mouse anti-human-CD34 , or FITC-conjugated mouse IgG2a  antibodies confirmed that in all cases more than 95% of the isolated cells were CD34+.All human CML samples were obtained with informed consent and were used in accordance with the Declaration of Helsinki. Regional Ethical Committees at Stockholm and Link\u00f6ping approved the study .6 cells/ml density in complete or StemSpan SFEM medium and were left untreated or activated for 48\u00a0hours by Human T-Activator CD3/CD28 Dynabeads . Conditioned medium was purified by pelleting the cells with centrifugation, followed by magnetic cleanup of beads and filtration of the supernatants through a 0.22\u00a0\u00b5m pore size filter.PBMCs were separated from buffy coats of healthy blood donors by Ficoll-Paque density gradient centrifugation. T cells from PBMCs were enriched by negative selection using CD19 Pan B Dynabeads  according to the manufacturer`s instructions, followed by the removal of cells adherent to tissue culture dishes. T cells were seeded at 104 (batch No. 1) or 3\u00a0\u00d7\u00a0104 (batch No. 2) cells/well or CD34+\u00a0CML stem/progenitor cells seeded at 3\u00a0\u00d7\u00a0104 cells/well in 96-well plates were cultured for the indicated hours in the indicated ratios of a mixture of fresh complete or StemSpan SFEM medium and non-activated or activated T cell-conditioned medium (TCM), in the absence or presence of the indicated concentrations of imatinib and isotype control  and/or rat IgG2a, \u03ba (clone RTK2758); both from BioLegend) and/or neutralizing mouse anti-human IFN\u03b3  and/or neutralizing rat anti-human GM-CSF  antibodies. TCM was incubated with the antibodies for 30\u00a0minutes at room temperature, before adding to the cells.JURL-MK1 cells seeded at 8\u00a0\u00d7\u00a010The proportion of active caspase-3 positive (apoptotic) cells was quantified by flow cytometry. The ratio of active caspase-3/7 positive (apoptotic) cells was quantified by fluorescence live cell microscopy, in which the culture medium was supplemented with 2.5\u00a0\u03bcM IncuCyte Caspase-3/7 Green Reagent for Apoptosis (Essen Bioscience). The number of viable cells was manually counted using a hemocytometer and trypan blue exclusion, performed blind by two independent observers.Negative Control No. 1, or STAT1 (s277) specific Silencer Select siRNAs  were transiently transfected into JURL-MK1 cells with the Nucleofector system (Amaxa) using solution V with program T-16 according to the manufacturer\u2019s instructions. Forty\u00a0hours after transfection, dead cells were eliminated by the Dead Cell Removal Kit, and then the cells were seeded and treated as described. STAT1 knockdown efficiency was analyzed by immunoblot using cell lysates prepared immediately before the indicated treatment.4 cells/well in 96-well plates and then left untreated or treated for 18\u00a0hours with 1\u00a0\u03bcM imatinib and/or 5\u00a0ng/ml IFN\u03b3, followed by the quantification of the proportion of apoptotic cells by flow cytometry.JURL-MK1 cells transfected with control- or STAT1-specific siRNAs were seeded in complete medium, at 8\u00a0\u00d7\u00a0104 cells/well in 96-well plates were pre-incubated with the indicated concentrations of ralimetinib, wortmannin, SCH772984, JNK-IN-8, SC75741 or solvent (in the absence or presence of 1\u00a0\u03bcM imatinib) for 1 hour, and then left untreated or treated with 5\u00a0ng/ml IFN\u03b3 for 18\u00a0hours, followed by the quantification of the proportion of apoptotic cells by flow cytometry or fluorescence live cell microscopy.JURL-MK1 cells seeded in complete medium, at 8\u00a0\u00d7\u00a0104 cells/well or K562 cells seeded at 2\u00a0\u00d7\u00a0104 cells/well in 96-well plates, in phenol-red free complete medium supplemented with 1.25\u00a0\u03bcM IncuCyte Caspase-3/7 Green Reagent for Apoptosis (Essen Bioscience), were left untreated or treated with 1\u00a0\u03bcM imatinib and/or 5\u00a0ng/ml IFN\u03b3, followed by the quantification of the proportion of apoptotic cells by fluorescence live cell microscopy.JURL-MK1 cells seeded at 3\u00a0\u00d7\u00a0104 cells/well, in 96-well plates were pre-incubated with 10\u00a0\u03bcM A1210477 or solvent (in the absence or presence of 5\u00a0\u03bcM imatinib) for 1 hour, and then left untreated or treated with 5\u00a0ng/ml IFN\u03b3 for 24\u00a0hours, followed by the quantification of the proportion of apoptotic cells by flow cytometry.Primary human CD34+\u00a0CML stem/progenitor cells seeded in StemSpan SFEM medium (StemCell Technologies), at 6\u00a0\u00d7\u00a01016 (recombinant human Flt3-ligand (FL), stem cell factor (SCF) and thrombopoietin (TPO); 100\u00a0ng/ml each; StemSpan CC110; StemCell Technologies), at 105 cells/well, in 48-well plates were left untreated or treated for 90\u00a0minutes or 18\u00a0hours with 5\u00a0\u03bcM imatinib and/or 5\u00a0ng/ml IFN\u03b3, when total cellular RNA and/or total cell lysates were prepared.Primary human CD34+\u00a0CML stem/progenitor cells seeded in StemSpan SFEM medium without supplementation or supplemented with early acting cytokinesTotal cell lysates were prepared and analyzed by SDS-polyacrylamide gel electrophoresis and immunoblotting, using mouse anti-STAT1 , rabbit anti-MCL1 antibody ; Cat. No.: 5453), rabbit anti-Bcl-XL , rabbit anti-PIM1 , rabbit anti-PIM2 , rabbit anti-PARP9 , rabbit anti-PARP14  and mouse anti-\u03b2-actin  antibodies.IFN\u03b3 concentration was measured in TCMs using the human IFN-gamma DuoSet Elisa (R&D Systems).Total cellular RNA was isolated with Quick RNA MiniPrep Kit (Zymo Research) and quality checked on Agilent Technologies 2200 TapeStation. One hundred nanograms of total RNA were used to prepare cDNA following the GeneChip WT PLUS Reagent Kit labeling protocol. The samples were then hybridized to Human Clariom D arrays and scanned using the Affymetrix GeneChip Scanner 3000 according to standard protocol. Generated CEL files were analyzed using Applied Biosystems Transcriptome Analysis Console  using SST-RMA summarization on gene and exon level.T method, using EEF1A1 as an endogenous control gene.Total cellular RNA was isolated with Quick RNA MiniPrep Kit and then reverse transcribed using the SuperScript VILO cDNA Synthesis Kit (Invitrogen). cDNAs were subjected to real-time PCR in a StepOnePlus Real\u2010Time PCR System, using the Power SYBR Green PCR Master Mix (ThermoFisher Scientific) with primers listed in Cells were stained with PE Active Caspase-3 Apoptosis Kit  according to the manufacturer`s instructions, followed by the measurement of fluorescence intensities with a NovoCyte 3000 flow cytometer (Acea Biosciences). Data obtained by flow cytometry were analyzed using FlowJo software, version 9.4.11 (Tree star).Fluorescence live cell microscopy was performed with an IncuCyte S3 Live Cell Analysis System (Essen Bioscience). Nine planes of view were collected per well, using the 20x objective. The obtained data were analyzed with the IncuCyte S3 Cell-by-Cell Analysis Software Module (Essen Bioscience).Statistical analysis was performed with GraphPad Prism 8.0. Normality of the data was tested using the Kolmogorov\u2013Smirnov test. Paired T-test was used to analyze mean differences between treatments. P <\u00a0.05 was considered as significant.To analyze the role of IFN\u03b3 in the effect of activated T cell secretome on imatinib-treated CML cells, we performed IFN\u03b3 neutralization experiments on the JURL-MK1 CML cell line using conditioned medium of T cells enriched from PBMCs of healthy blood donors . In the To characterize the kinetics of the anti-apoptotic effect of IFN\u03b3 on CML cells, the proportion of active caspase-3/7 positive cells was analyzed in JURL-MK1 and K562 cells left untreated or treated with imatinib and/or IFN\u03b3 with fluorescence live cell microscopy . Imatini17 Since inhibition of phosphatidylinositol 3\u00b4-kinase (PI3K), extracellular signal-regulated kinases (ERK1/2), p38 mitogen-activated protein kinase, c-Jun N-terminal kinases (JNK1/2/3) and NF-\u03baB  only minimally affected or did not prevent at all the anti-apoptotic effect of IFN\u03b3 on imatinib-treated JURL-MK1 cells  kinases PIM1 and PIM2,19 PARP9,20 PARP1421 and IFN\u03b1 inducible protein 6 .23 Since the anti-apoptotic effect of IFN\u03b3 proved to be rapid in CML cells, we also analyzed the expression of these genes in CD34+\u00a0CML stem/progenitor cells  left untreated or treated for 90\u00a0minutes with IFN\u03b3 and/or imatinib , followed by validation with real time reverse transcription PCR. We found, that 18\u00a0hours of IFN\u03b3 treatment both in the absence and presence of imatinib markedly upregulated the mRNA expression of several key anti-apoptotic genes beside MCL-1L , includiimatinib . This shAnalysis of MCL-1L, BCL-XL, PIM1, PIM2, PARP9, and PARP14 protein expression with western blot showed that 18\u00a0hours of IFN\u03b3 treatment both in the absence or presence of imatinib consistently upregulated MCL-1L, PARP9, and PARP14 protein expression in primary human CD34+\u00a0CML stem/progenitor cells obtained from three additional patients. On the other hand, PIM1 and PIM2 proteins could not be detected or were only minimally expressed, and BCL-XL protein expression did not show any consistent response upon IFN\u03b3 treatment in the analyzed samples .21 their prompt simultaneous upregulation followed by the delayed induction of MCL-1L expression might explain the marked anti-apoptotic effect of IFN\u03b3 on imatinib treated CML stem/progenitor cells.Since the rapidly upregulated PARP9 and PARP14 genes encode key survival proteins with strong anti-apoptotic effects in hematopoietic cells,24 several publications show that it can also exert direct anti-apoptotic, pro-proliferative and pro-clonogenic effects on CML cells, both in the absence and presence of TKIs.25Several lines of evidence suggest a key role for IFN\u03b3 in the mechanisms behind resistance to TKI treatment in CML patients, a remaining problem of major clinical significance. While IFN\u03b3 seems capable of acting as an anti-tumorigenic factor in CML patients ,et al.12 demonstrated that soluble factors produced by activated T or NK cells significantly inhibited the imatinib- or nilotinib-induced apoptosis of CML cell lines and PBMCs of untreated CML patients in chronic phase. In contrast, non-activated T or NK cells did not exert this effect. Since among the several cytokines tested, only IFN\u03b3 counteracted the pro-apoptotic effect of TKIs on CML cells, the authors suggested that IFN\u03b3 might be the key soluble anti-apoptotic factor produced by activated T and NK cells, although this assumption has not been proven by neutralization experiments. Furthermore, Schurch et al.25 showed that transfer of activated leukemia-specific effector cytotoxic T cells into a mice model of CML induced the proliferation of leukemic stem cells through IFN\u03b3 secretion, while IFN\u03b3 treatment in vitro increased the proliferation and colony formation of primary human CD34+\u00a0CML stem/progenitor cells. We now show that activated TCM exerts strong pro-proliferative and anti-apoptotic effects on CML cells (including primary human CD34+\u00a0CML stem/progenitor cells). Experiments with neutralizing antibodies showed that at early time-points IFN\u03b3 is a major, while GM-CSF is a minor anti-apoptotic component of the activated T cell secretome. However, at later time-points, simultaneous neutralization of these two cytokines only partially blocked the anti-apoptotic effect of the activated TCM on CML stem/progenitor cells, suggesting that additional soluble factors may also contribute to the noted effect.Held 13 demonstrated that exogenously added IFN\u03b3 exert strong anti-apoptotic effect on CML cell lines and PBMCs of CML patients, but did not analyze its anti-apoptotic effect on CML stem/progenitor cells, the cell population responsible for residual disease.2 Our results now revealed that exogenously added IFN\u03b3 markedly counteracts imatinib-induced apoptosis of CML stem/progenitor cells.Previous reports27 The molecular mechanism, by which STAT1 signaling exert divergent effects in different cancer and/or cell types is however not well known and needs to be further elucidated.Using chemical inhibitors or siRNA knockdown we could demonstrate that the major alternative IFN\u03b3 pathways, i.e. PI3K, p38, ERK1/2, JNK1/2/3 and NF-\u03baB, are not essential, while STAT1 signaling plays a significant role in the anti-apoptotic effect of IFN\u03b3 on CML cells. This result was unexpected, as STAT1 signaling is generally considered to be pro-apoptotic and anti-proliferative. On the other hand, STAT1 signaling has also been shown to exert anti-apoptotic and pro-proliferative effects in certain cancer types.ex vivo IFN\u03b3 treatment enhanced in a BCL6-dependent manner the cluster formation of imatinib-treated primary human CD34+\u00a0CML stem/progenitor cells. On the other hand, BCL6 knockdown did not inhibit, while the presence of 10\u00a0\u03bcM A-1210477 completely counteracted the anti-apoptotic effect of IFN\u03b3 on imatinib-treated JURL-MK1 cells.13 We now show that although MCL-1L is upregulated by IFN\u03b3 in CML stem/progenitor cells, inhibition of MCL1 activity with 10\u00a0\u03bcM A-1210477 only partially counteract the anti-apoptotic effect of IFN\u03b3 in these cells. This result suggests that other mechanisms may also contribute to the observed anti-apoptotic effect of IFN\u03b3. Although genome-wide analysis of mRNA expression revealed that IFN\u03b3 strongly upregulated several key anti-apoptotic genes in imatinib-treated CML stem/progenitor cells, including MCL-1L, BCL-XL, BCL2A1, PIM1, PIM2, PARP9, PARP14, and IFI6, western blot analysis could confirm the IFN\u03b3-induced consistent upregulation of only MCL-1L, PARP9, and PARP14. MCL1 is a key anti-apoptotic member of the BCL2 gene family, that is frequently overexpressed in several hematopoietic cancer types, including CML.29 PARP9  plays an essential role in the survival of a subclass of high-risk diffuse large B cell lymphomas associated with a prominent inflammatory infiltrate.20 The macro-PARP subfamily member PARP14 is a binding partner of STAT6 and plays a central role in the anti-apoptotic effect of IL-4 on B cells.21 These well-characterized effects on various hematopoietic cell types suggest that the concomitant upregulation of these genes might explain the strong anti-apoptotic effect of IFN\u03b3 on CML stem/progenitor cells. Identification of the key actors in this complex interplay balancing pro- and anti-apoptotic events related to TKI treatment will be of paramount interest in the quest to successfully eradicate residual leukemic cells and thereby achieving cure of CML.We have previously shown that IFN\u03b3 upregulates the expression of several genes with potential anti-apoptotic function, including BCL6 and MCL-1L, in JURL-MK1 cells. We have also shown that"}
+{"text": "Macaca spp.) in peri-urban environments in Asia, we collected behavioral data using event sampling of human\u2013macaque interactions within the same time and space, and focal sampling of macaques\u2019 social interactions with conspecifics and overall anthropogenic exposure. Model-predicted outbreak sizes were related to structural features of macaques\u2019 networks. For all three species, and for both anthropogenic (co-interactions) and social (grooming) contexts, outbreak sizes were positively correlated to the network centrality of first-infected macaques. Across host species and contexts, the above effects were stronger through macaques\u2019 human co-interaction networks than through their grooming networks, particularly for rhesus and bonnet macaques. Long-tailed macaques appeared to show intraspecific variation in these effects. Our findings suggest that among wildlife in anthropogenically-impacted environments, the structure of their aggregations around anthropogenic factors makes them more vulnerable to zooanthroponotic outbreaks than their social structure. The global features of these networks that influence disease outbreaks, and their underlying socio-ecological covariates, need further investigation. Animals that consistently interact with both humans and their conspecifics are important targets for disease control.Pandemics caused by pathogens that originate in wildlife highlight the importance of understanding the behavioral ecology of disease outbreaks at human\u2013wildlife interfaces. Specifically, the relative effects of human\u2013wildlife and wildlife-wildlife interactions on disease outbreaks among wildlife populations in urban and peri-urban environments remain unclear. We used social network analysis and epidemiological Susceptible-Infected-Recovered models to simulate zooanthroponotic outbreaks, through wild animals\u2019 joint propensities to co-interact with humans, and their social grooming of conspecifics. On 10 groups of macaques ( Global population expansion, and consequential human activities causing aquatic and land-use perturbations, ecotourism, and wildlife trade, have all increased spatial overlap and contact rates between humans and wildlife4. The resultant HWIs are now widely recognized as \u2018hotspots\u2019 for the transmission of zoonotic infectious agents of animal origin that spillover into and spread through human populations from wildlife6. There are also growing concerns of the inverse effect of zooanthroponotic (infectious agents originating from humans or wildlife that spillback from humans) transmission and consequential outbreaks among wildlife8. Such risks are especially high in urban and peri-urban environments, where generalist wildlife live in dense populations and frequently encounter humans11. Nevertheless, there exists little quantitative, and in particular comparative research that unravels cross-population differences, and indeed cross-contextual differences within the same population in terms of the kinds of interactions they experience, in their vulnerability to the spread of zooanthroponotic agents. From an evolutionary perspective, such assessments can provide insights into how infectious disease risk influences, and is in-turn influenced by, adaptive responses in wildlife socioecology, behavioral flexibility, and risk-taking in such environments13. From a conservation and public health perspective, they are critical to identify \u2018edge\u2019 wildlife, that is individual animals or species ranging at HWIs which can further transmit infectious agents into other wildlife and overlapping humans14.The COVID-19 pandemic has highlighted the importance of understanding infectious disease transmission among wildlife populations at human\u2013wildlife interfaces (HWIs)15. In reality, however, wild animals at HWIs can interact with both other animals and with humans and these interactions vary across individuals, time, and space, forming patterns of associations that could influence infectious agent transmission. Social Network Analysis (SNA), through promising quantitative ways to evaluate animals\u2019 tendencies to interact differently with different socioecological aspects of their environment , offers exciting avenues to capture such associations and their impact on disease transmission18. To date, however, the majority of studies that have implemented SNA\u00a0to understand disease transmission among wildlife have focused on single behavioral features that define animal-animal interactions . Some examples of wildlife-wildlife social networks that have been associated with increased risk of infectious agent transmission include shared use of space , contact associations , aggression , and social grooming . Yet, the transmission of zooanthroponotic agents among wildlife at HWIs can be influenced by multiple, potentially interplaying types of interactions. Aside from animals\u2019 interactions with conspecifics, zooanthroponosis within wildlife systems may, for instance, also be influenced by animals\u2019 aggregations around anthropogenic factors, such as contaminated water, soil, human foods, livestock, feral mammals, and indeed humans11. Among generalist, urban and peri-urban wildlife populations in particular, it is therefore crucial to assess the relative effects of multiple (rather than single or specific) types of interactions, e.g. spatial and social interactions with conspecifics, but also co-occurrence or joint interactions with humans or other anthropogenic factors, on zooanthroponotic transmission and resultant disease outbreaks.Research on disease transmission among wildlife populations at HWIs can be hampered by conceptual and methodological limitations. Traditional research on wildlife populations assumed that the probability of acquiring an infectious agent is equal across individuals within a defined area or cohort23. In this regard, network approaches have been extensively combined with compartmental \u2018Susceptible-Infected-Recovered (SIR)\u2019 models, that simulate disease transmission and outbreaks by causing entities, such as humans or other animals, to move across \u2018susceptible\u2019, \u2018infected\u2019, and \u2018recovered\u2019 disease states25. They do so at dynamic probabilities that, based on user specifications of model complexity, can depend on a combination of one or more pathogen-specific epidemiological variables , host contact patterns , and host attributes  or intrinsic states . To date, studies that have implemented SIR models in combination with wildlife spatial and social networks have revealed strong associations between network connectedness or centrality of the first-infected individual and simulated zooanthroponotic disease outcomes, such as pathogen extinction times  and outbreak sizes 28. Others have implemented cross-species comparative approaches, to reveal associations between simulated disease outcomes and global features of social networks, such as community modularity or clustering, network fragmentation, and network centralization which is the variation or skew in centrality across animals within a group29. Nevertheless, SIR models are yet to be implemented to understand the relative effects of wildlife social interactions with their conspecifics and their joint aggregations around anthropogenic factors, on disease outcomes.Mathematical models offer critical insights into the occurrence of real-world epidemiological processes30, several nonhuman primate (hereafter NHP) taxa have shared ecological niche space with humans for long periods of their evolutionary history , or following relatively recent exposure to human activities like ecotourism and habitat encroachment  (reviewed in33). Unsurprisingly, human\u2013primate interfaces are \u2018hotspots\u2019 for inter- and intraspecies disease transmission35. Indeed, NHPs are vulnerable to many diseases contracted from or spilling-back from humans , or act as natural reservoirs of pathogens that can invade and cause epidemics in otherwise uninfected human and wildlife populations.Human\u2013nonhuman primate interfaces are well-suited to address the above gaps. Beyond sharing close evolutionary histories with humansMacaca are among the most ecologically and behaviorally flexible of all nonhuman primates. In the wild, many macaque species, particularly rhesus macaques, long-tailed macaques (M. fascicularis), and bonnet macaques (M. radiata), are considered \u2018edge\u2019 wildlife species that form \u2018synanthropic\u2019 associations37 with humans across a variety of peri-urban landscapes  where they experience highly spatiotemporally variant overlap with humans39. Influenced by their ecology and evolutionary history, macaques also show marked variation in social behavior with their conspecifics and (consequently) social networks42. While zooanthroponotic agents have been extensively documented among macaque populations synanthropic with humans (reviewed in11), the pathways that underlie their transmission and consequential disease outbreaks remain unclear.The genus 43. To capture patterns of macaque-macaque social interactions, we constructed social \u2018grooming networks\u2019 that linked macaques based on the proportions of time they spent engaging in grooming their conspecifics, given the extensive previous literature on the importance of grooming patterns in defining primate social structure45. In a previous study, we revealed that macaques\u2019 grooming relationships did not predict their tendencies to co-interact with humans43.\u00a0Through this finding, we established a premise to expect that the patterning and distribution of such co-interactions with humans can be different, somewhat independent pathways for disease transmission than their social structure defined through the patterning and distribution of macaque grooming of conspecifics43.Across human\u2013macaque interfaces in India and Malaysia, we used network approaches combined with SIR models to evaluate the dynamics of zooanthroponotic transmission and outbreaks among multiple groups and species of macaques living in urban or peri-urban environments. In doing so, we evaluated the relative vulnerability of these wildlife populations to human-induced disease outbreaks, through both their joint aggregations around and co-interactions with humans, and through their social interactions with conspecifics that underlie their social structure. To capture patterns of macaques\u2019 co-interactions with humans, we constructed networks of macaques\u2019 (nodes) tendencies to jointly co-occur around and engage with humans (edges) within the same time and location in the context of anthropogenic spaces28, we examined the impact of the behavioral ecology of wildlife host species at HWIs on disease transmission and outbreaks. Specifically, we examined the effects of cross-contextual  variation in network structure for a given species, and cross-species  variation in network structure within a given context, on disease outbreak sizes as predicted by epidemiological models. Rhesus and long-tailed macaques, compared to bonnet macaques, typically show greater ecological flexibility and overlap with anthropogenic environment47. In many parts of their range, including in our own study locations, such differences in anthropogenic overlap may also be characterized by greater propensities for animals to form denser aggregations around anthropogenic factors and interactions with humans47, thereby leading to more well-connected human co-interaction networks compared to among bonnet macaques. In terms of their social structure, however, rhesus macaques and long-tailed macaques are hypothesized to show greater degrees of nepotism and despotism that, compared to bonnet macaques, may be characterized by grooming networks that may be less well-connected42. Given these expected similarities and differences in network structure, we tested the following specific predictions.Independent of pathogen \u2018transmissibility\u2019\u00a0(defined below) from an infected individual to a susceptible individual during its infectious periodWe first predicted that the connectedness, or (hereafter) centrality, of the first-infected macaque, irrespective of context, group, or species, would be positively correlated to outbreak sizes. Based on expected cross-context and cross-species differences in overall network connectedness and structure, we further predicted that the strength of these effects of individuals\u2019 centrality on outbreak sizes would vary across contexts and across species, while controlling for intraspecific\u00a0variation. Across contexts for a given species, we predicted that for rhesus and long-tailed macaques, co-interaction networks would lead to greater outbreak sizes compared to grooming networks. That is, the centrality of first-infected individuals would have a stronger impact on outbreak sizes through their co-interaction networks than the centrality of first-infected individuals through their grooming networks. On the other hand, we predicted that bonnet macaques would show the opposite effects: a greater effect of the centrality of first-infected individuals on outbreak sizes through their grooming networks compared to their co-interaction networks. Across host species for a given context, we predicted that for human co-interaction networks, rhesus and long-tailed macaques would show a stronger effect of the centrality of first-infected individuals on outbreak sizes compared to bonnet macaques. On the other hand, we predicted the opposite effects for grooming networks: that bonnet macaques would show a stronger effect of the centrality of first-infected individuals on outbreak sizes compared to rhesus and long-tailed macaques.26, we also examined the effects of inter-individual differences in the sociodemographic characteristics  of first-infected macaques on outbreak sizes, through both types of networks. Since females and high-ranking individuals form the core of macaque grooming networks41, we expected that across species, outbreak sizes through grooming networks would be higher when the first-infected individuals were females  and higher-ranking (versus lower-ranking) individuals. On the other hand, given the exploratory and increased risk-taking behavior of males resulting in their being more well-connected in co-interaction networks compared to females47, we expected that outbreak sizes through co-interaction networks would be higher when the first-infected individuals are males . We also explored whether inter-individual differences in their overall anthropogenic exposure  impacted model-predicted outbreak sizes through both types of networks.Furthermore, following a previous study by other researchers on barbary macaque tourist interactions49. Subjects were adult male and female macaques which were pre-identified during a 2-month preliminary phase prior to data collection at each location. More details regarding the study locations, macaque group compositions and subjects, and observation efforts, can be found in our previous publications49 and in Supplementary Table We observed 10 macaque groups representing three different species at human\u2013primate interfaces across three locations in Asia \u2013 four groups of rhesus macaques in Shimla in Northern India  between July 2016 and February 2018, four groups of long-tailed macaques in Kuala Lumpur in Malaysia  between September 2016 and February 2018, and two groups of bonnet macaques in Thenmala in Southern India  between July 2017 and May 2018. All macaque groups were observed in urban to peri-urban environments, and their home ranges overlapped with humans and anthropogenic settlements\u2014Hindu temples , recreational parks , roadside areas \u2014to varying extents47). All data were collected for 5\u00a0days a week, between 9:00\u00a0am and 5:00\u00a0pm. To record spatiotemporal variation in human\u2013macaque socio-ecological interactions for the construction of co-interaction networks, we used an event sampling procedure51. For this we divided pre-identified parts of the home range of each macaque group in which human\u2013macaque interactions were most likely to occur, into blocks of roughly equal area and observability. We visited these blocks in a pre-identified, randomized order each day. Within a 10-min sampling period, we recorded interactions between any pre-identified subject macaque and one or more humans that occurred within that block, in a sequential manner. Human\u2013macaque interactions included all contact and non-contact behaviors  initiated by macaques towards humans or vice-versa, that occurred within a three-meter radius of each other (more details in49).We collected behavioral and demographic data noninvasively using observation protocols that were standardized across observers within and across locations  that was followed by submission , between the focal animal and its group conspecifics. We also recorded interactions between the focal animal and one or more humans in a continuous manner (see above for definitions). Once every two minutes, we ceased recording continuous data to conduct a point-time scan50 of the focal animal\u2019s main activity\u2014one of resting, locomotion, socializing, interacting with a human, foraging on natural food, or foraging on anthropogenic food.To record macaques\u2019 social behavior, and their overall anthropogenic exposure independent of spatiotemporal context, we used 52.We entered all data into Samsung Galaxy Tablets using customized data forms created in HanDBase\u00ae application (DDH software). From these we exported and tabulated all the data into MS Excel and MS Access databases daily. All observers within and across locations passed inter-observer reliability tests using Cohen\u2019s kappa (>\u20090.85)43 , per unit of event sampling observation time during which both members of the pair were present in the group and (thereby) observable43 Fig.\u00a0. We also54. Among other wild animal social groups,\u00a0measures like betweenness and eigenvector centrality that incorporate indirect network connections have been shown to not add any more meaningful information than strength, to the prediction of disease outcomes54. For each macaque group, we re-scaled strength centrality to range between 0  and 1 . Such standardization not only accounts for between-group differences in size, but is also particularly well-suited for the purposes of evaluating cross-network (context-type and species) differences in the effects of the centrality of first-infected macaques on outbreak sizes, as was required here.For each co-interaction network and grooming network, we calculated individual animals'\u00a0weighted degree or strength centrality, i.e. the sum of\u00a0all the edge-weights of an individuals\u2019 direct network connections. We used this measure because it generally performs better than other measures of centrality  in predicting both individuals\u2019 risk of infection and group-specific outbreak sizesPerc in R55). Perc is a network-based ranking method, that has been shown to yield animal rank orders that are consistent with those yielded by other, popularly used ranking methods in behavioral ecology, such as David\u2019s score, I&SI ranks, and Elorating57. As with network centrality, we converted ordinal ranks of macaques within each group into percentile values that ranged between 0  and 1 . We also calculated, for each macaque, its overall frequency of interactions with humans per unit focal observation time, and its time spent foraging on anthropogenic food as the ratio of the number of point-time scans in which it was foraging on anthropogenic food (Fa) to the total number of scans in which it was foraging on either anthropogenic food (Fa) or natural food (Fn): Fa/(Fa\u2009+\u2009Fn) (more details in49).From the data on dyadic agonistic interactions with clear winners and losers, we calculated macaques\u2019 dominance ranks for each group, separately for male-male and female-female interactions, using the network-based Percolation and flow-conductance method with a maximum path-length of four steps . For these reasons, we anticipated that these measures would, at the most, be weakly correlated with macaques\u2019 centrality within human co-interaction networks (confirmed by collinearity diagnostics performed below).Epimdr R package58)  and macaque group, we ran 5000 model simulations, 500 for each of 10 different values of \u03c4 ranging from 0.05 to 0.50 in increments of 0.05. These selections were based on the human literature that indicates that these values of \u03c4 correspond to pathogens that range from low , to moderate , to high  contagiousness, and average basic reproduction numbers (R0) of between 1.6\u201314.028. We thus ran a total of 100,000 simulations (5000 per macaque group times 10 groups times two network types). In each simulation, we deemed all macaques within a group to be initially \u2018susceptible\u2019, and then infected one individual (node) at random with an artificial pathogen of a given \u03c4. A simulation proceeded using a discrete time, chain binomial method61 that dynamically and temporally tracked the spread of infection through a weighted, undirected network through time. In each simulation, animals were allowed to transition from \u2018susceptible\u2019 to \u2018infected\u2019 states, as a function of their network connections to individuals already in \u2018infected\u2019 states and the pathogen \u03c4 value. \u2018Infected\u2019 individuals were then allowed to transition into \u2018recovered\u2019 states at a fixed recovery rate (\u03b3) of 0.2 that corresponds to an average infectious period of 5\u00a0days28. Each simulation was allowed to proceed until the disease proceeded to extinction when there were no remaining infected individuals in the network. At the end of each simulation, we calculated the disease outcome of \u2018mean outbreak size\u2019, as the average % of infected macaques  across all time-units of the simulation. We also extracted, for each simulation, the identity of the first-infected macaque  on macaques\u2019 co-interaction networks and grooming networks, we ran a series of SIR models (using the 58) Fig.\u00a0. We defientclass1pt{minimaglmmTMB62) to test our predictions. In all GLMMs, we set \u2018mean outbreak size\u2019, calculated as the proportion of the number of infected individuals divided by the total group size, as the outcome variable. This was calculated at the level of individual macaques, as the average outbreak size across all the simulations in which it was the first-infected individual, for both co-interaction networks and grooming networks. To examine the effects of cross-context differences for a given host species on outbreak sizes, we ran three GLMMs, one model for each macaque species. In these, we included, as main effects, the network strength centrality of the first-infected macaque, network type to define the context (co-interaction versus grooming), and an interaction term of network centrality by network type to determine whether the magnitudes of the effects of network strength on outbreak sizes were different across co-interaction networks and grooming networks. We also included, as main effects, the sociodemographic attributes  and the overall anthropogenic exposure  of the first-infected macaque. In all three models, we also included a random-effects term of macaques\u2019 strength centrality, dominance rank, frequencies of interactions with humans, and foraging on anthropogenic food as random slopes, all nested within macaque \u2018group ID\u2019 as a random intercept, to control for between-group, within-species differences.We used General Linear Mixed Models (GLMMs) with a beta error structure , and an interaction term of strength centrality by species to determine whether the magnitude of the effect of network strength on disease outbreaks was different across the three species. As in the first three models above, we also included first-infected macaques\u2019 sociodemographic attributes  and overall anthropogenic exposure  as main effects. Likewise, we also included a random-effects term, of macaques\u2019 strength centrality, dominance rank, frequencies of interactions with humans, and foraging on anthropogenic food as random slopes, nested within macaque \u2018group ID\u2019 as a random intercept.63 and collinearity diagnostics (using the performance R package64). The latter showed no strong correlations (Pearson\u2019s r\u2009<\u20090.28) between continuous main effects variables . All statistical tests were two-tailed, and we set the p values (extracted from the model outputs) to attain statistical significance to be\u2009<\u20090.05.All GLMMs met the necessary assumptions of model validity including the distribution of residuals, residuals plotted against fitted valuesThe protocols used in the study were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of California, Davis (protocol # 20593). The research was performed strictly in accordance with the guidelines and regulations drafted in this protocol. Observers did not engage in any contact or non-contact interactions with the animals while recording their natural behavior. No biological samples were collected. Since exclusively observational data were collected on both the monkeys and humans, with no identifying information collected on the humans and no interactions between the experimenters and the humans, no human subjects were enrolled to directly participate in this study. This protocol, along with the guidelines and regulations, was designed in consultation with the Himachal Pradesh Forest Department and the Indian Institute of Science Education and Research Thiruvananthapuram in India, and Universiti Putra Malaysia and Universiti Sains Malaysia in Malaysia. They complied with the legal requirements of India and Malaysia.In support of our prediction, we found that independent of context (human co-interactions and grooming) and host species , the strength centrality of the first-infected macaque was significantly, positively correlated to mean outbreak size Tables  and 4. MAcross different contexts for a given host species, we found a significant interaction between context and network strength centrality for rhesus macaques and bonnet macaques, but not for long-tailed macaques Table ; Fig.\u00a03.Across host species in a given context, we found no significant interactions between species and network strength centrality, for both co-interaction networks and grooming networks Table . That isFor grooming networks, but not for co-interaction networks, we also found a significant effect of sex and dominance rank of the first-infected individual on mean outbreak sizes\u2014outbreak sizes were higher when first-infected macaques within grooming networks were females compared to males, and higher-ranking compared to lower-ranking individuals Table . However29) in some important ways; we evaluated both cross-contextual and cross-species differences in network-mediated outbreak sizes, and did so using behavioral datasets that were collected using sampling methods that were identically implemented across populations.We addressed a critical gap in our understanding of disease ecology at HWIs, by showing cross-contextual and cross-species differences in the vulnerability of wildlife populations living in peri-urban environments to zooanthroponotic outbreaks. Moreover, our approaches built on previous comparative studies of disease outbreaks through wildlife behavioral networks . Among the most widespread, ecologically flexible of all mammals outside of the family Rodentia, wild macaques, in many parts of their range, live in dense populations in a variety of anthropogenic environments , where they frequently interact with humans. From socio-ecological perspectives, our findings should therefore encourage future studies on other, group-living wildlife populations that better distinguish between, and evaluate the relative effects of, wildlife co-occurrence and interactions with anthropogenic factors and\u00a0their social behaviour towards conspecifics, on disease transmission and outbreaks .In all three macaque species, we found that outbreak sizes were positively predicted by the centrality of first-infected macaques within both their co-interaction networks and their grooming networks. That is, zooanthroponotic transmission and outbreaks were influenced by the connectedness and emergent network structure of macaques\u2019 joint aggregations around humans and their social interactions with conspecifics. By comparing the relative risk of disease outbreaks posed by animals\u2019 joint interactions with humans with that posed by their interactions with conspecifics, we build on previous, network-based studies that have focused on modelling disease outbreaks among wildlife populations through animal social structure alone , that may also underlie greater sub-grouping within rhesus macaque grooming networks42. Such sub-grouping, while facilitating pathogen transmission within clusters, may also inhibit transmission between sub-groups, and thereby the sizes of group-wide outbreaks68. Yet animals that show sub-divided social networks can also be vulnerable to outbreaks through other types of associations, and often in specific socio-ecological contexts around human-provisioned food that may cause wild animals to aggregate together69 and co-interact with humans. In rhesus macaques, greater connectedness and other emergent properties of co-interaction networks seem to more likely facilitate rather than inhibit zooanthroponotic transmission. Corroborating these explanations await more in-depth socio-ecological investigations of the relative effects of macaques\u2019 kin structures and the distribution of anthropogenic food on the extent of sub-grouping  within their networks, and their consequential effects on disease outbreaks.For a given context, there were no cross-species differences in the effect of network centrality on outbreak sizes. Nevertheless, we found that the relative degree or extent of cross-contextual differences in the effects of network centrality on outbreak sizes varied across species. As predicted, rhesus macaques were more vulnerable to disease outbreaks through co-interaction networks, and less vulnerable through their grooming networks. One reason for this could be the typically high degrees of preference towards affiliating with close kin in this species .Contrary to our predictions the effects of co-interaction networks on outbreak sizes in bonnet macaques were significantly greater (rather than lesser) than the effects of grooming networks, and were in fact within the range of rhesus macaques. One reason for this may be the spatial distribution of human\u2013wildlife interactions in this population. Bonnet macaques are less geographically widespread and ecologically flexible compared to rhesus macaques48. On the other hand, we observed two other groups in at a recreational park at the edge of the city bordering a fragmented forest area, where interactions with humans were comparatively less frequent48. Moreover, long-tailed macaques also showed marked differences in their grooming behavior across these locations as a response to interactions with humans48, which may underlie differences in their grooming network structure. A more comprehensive assessment of the disease vulnerability of these populations would therefore require within-species, cross-group comparisons of network structure, and the socio-ecological factors that underlie them.Contrary to our prediction, long-tailed macaques showed no differences in outbreak sizes across network types. At least one explanation for this may be intraspecific variation, which seems to be supported by the separate groupings for the relationships between individuals\u2019 network centrality and outbreak sizes for long-tailed macaques, even for the same network type Fig.\u00a0. Such in65. It was therefore important to evaluate the effects of such factors on disease outbreaks. As predicted, outbreak sizes through macaques\u2019 grooming networks were generally higher when the first-infected individuals were females compared to when they were males, or when the first-infected individuals were higher-ranking compared to lower-ranking. Nevertheless these effects, despite reaching statistical significance, were a lot weaker compared to effects of individuals\u2019 network centrality, suggesting that outbreaks are influenced more directly by network connectedness as such rather by animal attributes such as sex and rank that might influence outbreaks through such connectedness26. Furthermore, macaques\u2019 overall frequencies of interactions with humans and foraging on anthropogenic food showed no effects on outbreak sizes. In general, individual animals that interact more frequently with anthropogenic factors may be the focal points of zooanthroponotic spillback events8. However, the likelihood of such spillback developing into group-wide outbreaks would\u00a0seem to depend more on the extent to which macaques\u2019 interactions with anthropogenic factors are isolated events, versus occur systematically across time and space with multiple (rather than single) animals involved. Our construction of human co-interaction networks effectively captured the latter\u00a0type of effect, and thereby more clearly predicted outbreak sizes than animals\u2019 overall anthropogenic exposure.In many wildlife species, animals\u2019 sociodemographic attributes like their sex and dominance rank influence their life-history, behavioral strategies, and adaptive responses to changing (anthropogenic) environments70. To date, research on disease transmission through wildlife populations has identified \u2018superspreaders\u201971 of pathogens that, in lieu of being more well-connected to other individuals and populations, can function as effective targets for disease control . Our findings suggest that macaques which are central in their human co-interaction networks can be especially effective targets, since these individuals can both function as intraspecies superspreaders, as well as pose a high risk of interspecies  disease transmission events since they inter-connect humans with whom they interact within and across time and space. Confirmation of this awaits future studies that implement multi-modal networks, in which we include pre-identified individual wild animals, but also anthropogenic factors  as nodes that are interlinked based on spatial and/or social interactions13. These would enable quantitative risk-assessments of disease spillover (wildlife\u2009\u2192\u2009humans) and spillback (humans\u2009\u2192\u2009wildlife)8, which are of utmost importance for preventing or controlling future epidemics and pandemics32. They also await studies that simulate pathogen transmission along with targeted disease control interventions  of select-animals within specific macaque groups and network types based on the results from this studies (as in27).Our findings have implications for conservation, and in particular One Health approaches28. However, this is not always the case. For instance, joint interactions with humans would mean that macaques, while within three meters of each other, may or may not engage in direct physical contact as they would while grooming. In that regard, social proximity to their conspecifics would be more comparable (than grooming) with co-interactions with humans. However, proximity captures patterns of affinitive, rather than affiliative (as is the case with grooming in nonhuman primates), interactions between animals that may or may not underlie meaningful social structure72. Moreover, our previous work showed strong correlations between proximity networks and human co-interaction networks43. Thus, our choice of comparing grooming rather than proximity to co-interactions with humans more readily catered towards our goal of assessing the effects of clear, cross-contextual  differences in animals\u2019 overall vulnerability to outbreaks rather than the relative likelihoods of dyadic, distance-based transmission events.Our approaches had important limitations and considerations. First, comparisons of disease outbreaks across different behavioral networks often make the underlying assumption that different behaviors would manifest in equal likelihoods of contact28, but also the degree of sub-group formation or community modularity73, or the efficiency of information flow73, were the most likely to influence outbreak sizes. Such assessments would be necessary in order to further corroborate the possible socio-ecological explanations for our findings offered earlier. Given our sample size of just 10 macaque groups nested within three species, a more robust assessment of the links between socio-ecological factors, global network measures, and disease outcomes might look to focus on intraspecific, temporal variation among macaque groups. These would look to dynamically track changes to individual behavior and resultant global network features that influence, and are in turn influenced by, disease outcomes, across epidemiologically relevant time-frames that reflect real-world pathogen progression (as in27).Second, we examined the effects of rescaled, rather than the absolute, values of animals\u2019 network centrality on outbreak sizes. This approach was suitable for our objective of examining variation in slopes, specifically cross-contextual and cross-species differences in the effects of centrality and emergent network structures on outbreak sizes that were calculated through weighted, undirected networks. Moreover, rescaling was necessary to account for between-group differences in group size. Nevertheless, we fell short of examining which global structural feature(s) of networks, e.g. average or mean centrality across individuals0 values), can strongly impact disease outbreaks. We chose to account for, rather than quantitatively evaluate, the effects of a suite of respiratory pathogens of different transmissibility based on the human literature , that typically spread through social interactions, might enter wildlife populations from human or livestock carriers and are capable of causing disease in primates27. Pathogen transmissibility may interact with animal ecology in complicated ways to influence outbreak sizes. For instance, the effects of animal social interactions on disease outbreaks can diminish for pathogens of exceptionally high transmissibility, which can reach high outbreak sizes irrespective of social connections28. Yet other studies have revealed that social interactions have stronger effects on outbreak sizes for pathogens of intermediate compared to low or high transmissibility54. Given the current lack of disease parameters on these macaque populations, our pathogen transmissibility values were also based on the human epidemiological literature . Inter-host and inter-pathogen differences would need to be considered in future studies that construct more sophisticated but system-specific epidemiological models.Third, our results were independent of pathogen-specific transmissibility which, through influencing basic reproduction numbers (RSupplementary Tables."}
+{"text": "Devices with the modified structure outperformed devices without the addition of MgI2 in terms of response time and impact-sensing applications.It is becoming increasingly important to develop innovative self-powered, low-cost, and flexible sensors with the potential for structural health monitoring (SHM) applications. The mechanoluminescence (ML)-perovskite sensor is a potential candidate that combines the light-emitting principles of mechanoluminescence with the light-absorbing properties of perovskite materials. Continuous in-situ SHM with embedded sensors necessitates long-term stability. A highly stable cesium lead bromide photodetector with a carbon-based electrode and a zinc sulfide (ZnS): copper (Cu) ML layer was described in this article. The addition of a magnesium iodide (MgI Structural health monitoring (SHM) aims to ensure the diagnostics of the host structure\u2019s conditions, as well as its safety and integrity, on a continuous basis. The advancement of SHM technologies is inextricably linked to the overall safety of structures. Real-time SHM systems for advanced composite structures are in high demand ,2,3. To 3  all-inorganic cesium-lead halide perovskites are gaining popularity due to their ability to increase a device\u2019s inherent stability by replacing volatile organic cations with an inorganic cesium cation (Cs+) [3 materials are promising for optoelectronics due to their excellent light absorption, high charge carrier mobility, and long carrier diffusion length. Aside from its optoelectronic properties, the CsPbBr3 could withstand high temperatures of up to 580 \u00b0C, whereas the more common perovskite MAPbI3 began to lose performance at around 200 \u00b0C.Unfortunately, the organic\u2013inorganic lead halide perovskites decompose due to chemical instability and susceptibility to moisture, heat, oxygen, and other environmental conditions. To address the aforementioned instability, an all-inorganic perovskite active layer is an alternative and promising candidate. CsPbXon (Cs+) ,15. All 3 perovskite solar cells barely deteriorated after three months in humid air [3 photodetectors have been reported, but their performance is still lacking.Furthermore, the CsPbBrumid air ,17,18. Humid air ,19. SeveIn high-performance organic\u2013inorganic perovskite solar cells, interfacial contact is critical. The interfacial contact is directly related to the chemical interaction between the perovskite and the electron transport layer (ETL). Interfacial contact is also important in the development of high-performance all-inorganic perovskites . It is w3 perovskite thin film [Several techniques have been used to reduce defect levels in perovskite films, including additive passivation, heterojunction engineering, and interface modification ,20,21,22hin film ,25,26,27Most photoelectronic devices require a constant electrical power source for operation or performance enhancement. That is detrimental for applications of the sensor in embedded structures, where the device needs to be functional for long periods, and any additional device, such as a battery, can cause a detrimental intrusiveness effect in a composite structure. The self-powered architecture allows the sensor to work while embedded in a structure without needing batteries or power sources. Self-powered photovoltaic devices have recently attracted considerable attention ,35,36,373 perovskite as a photo-absorbing layer and ZnS:Cu as a light-emitting ML layer is described in this paper. A simple vertical device structure of indium tin oxide (ITO)/tin (IV) oxide (SnO2)/magnesium iodide (MgI2(0\u201310 mg\u00b7mL\u22121)/CsPbBr3/carbon electrode was used to evaluate the device\u2019s photo-detection performance. MgI2 was added to the SnO2/perovskite interface to modify it. The addition of MgI2 reduced interface defects and improved the performance of the self-powered ML-perovskite sensor. The device had a faster response time of 0.65 ms. The light emitted from the ML layer was efficiently collected and converted into distinct electrical signals for SHM applications, according to impact testing and mechanical three-point bending tests.The integration of a self-powered, all-inorganic CsPbBr2, 15% in H2O colloidal dispersion, and lead bromide (PbBr2) were purchased from Alfa Aesar. Anhydrous dimethyl sulfoxide , and cesium bromide (CsI), were obtained from Sigma Aldrich. ZnS:Cu (GL29/B-C1) was purchased from Phosphor Technologies. All of the materials were used without further treatment.SnO2 colloid precursor was diluted (1:6) with deionized water and stirred overnight. The SnO2 solution was spin-coated for 30 s at 3000 rpm onto PET/ITO substrates before being annealed in ambient at 100 \u00b0C for 60 min, followed by 5 min of plasma treatment. MgI2 was dissolved in methanol in various concentrations and spin-coated onto the PET/ITO/SnO2 substrates for 30 s at 3000 rpm before being annealed at 100 \u00b0C for 15 min. CsBr (0.3 M) and PbBr2 (0.3 M) were mixed in 1 mL DMSO to produce the CsPbBr3 precursor. The perovskite precursor was spin-coated on the substrates for 45 s at 1500 rpm before being annealed at 70 \u00b0C for 3 min and then at 105 \u00b0C for 20 min. 3 thin film fabrication procedure. Carbon paste electrodes were applied to the substrates with a doctor blade and dried for 15 min at 80 \u00b0C. The active area of the devices was set at 0.06 cm2.Hydrochloric acid and zinc powder were used to etch ITO-coated polyethylene terephthalate (PET) substrates. The substrates were then cleaned with nano pure water, acetone, and isopropanol. After cleaning, the flexible substrates were treated for 5 min with oxygen plasma. SnOThe device was built using our previously described method for ML layer integration ,6. UsingMultifunctional composites with embedded impact sensors were produced using plain weave carbon fiber fabric as reinforcing fibers and vinyl-ester resin as the system\u2019s matrix. As shown in 2 intensity. The time-dependent response was obtained with a NI-6210 DAQ and boosted with a Hamamatsu C7319 on a low bandwidth setting and 105 gain. The data were processed using MATLAB. The impact testing was carried out with the help of a customized drop-tower setup, and the cyclic 3-point bending test was carried out with the help of a Shimadzu mechanical testing system. The sensor\u2019s response signal was collected using the same configuration for I\u2013V measurements. An Agilent Cary 5000 was used to obtain the ultraviolet-visible (UV-Vis) absorption spectra. The current-voltage (I\u2013V) parameters were measured with a Keithley 2410 and LabView under a white light-emitting diode (LED) lamp with a 100 mW/cm2 solution ratios of 1, 5, and 10 mg\u00b7mL\u22121 were used to investigate the ETL/perovskite interface modification. Mg2+ and I\u2212 ions effectively inhibit the formation of deep trap states at the ETL/perovskite interface, promoting surface passivation and decreasing device carrier recombination. Mg2+ ions can also diffuse into the interstitial regions of the perovskite lattice, resulting in an active passivation action [3 films with and without MgI2 treatment. As shown in 3 films, they can be used as an active layer for visible photo-detection, particularly in the green light region. The MgI2 layer improved the absorption of the perovskite films, implying that the interface between the ETL and the perovskite was effectively modified. Further research was carried out to determine the effect of the interfacial modifier on the crystal quality of the inorganic CsPbBr3 perovskite. The crystallinity of the perovskite films was investigated using X-ray diffraction (XRD). 3 perovskite films on PET substrates. The XRD pattern\u2019s break region attempts to remove the strong diffraction from the PET substrate. Because PET flexible substrates were used, the inorganic perovskite annealing temperature was kept constant at 105 \u00b0C. The intensities of the peaks increased as MgI2 concentration increased, indicating that the films were more crystalline. The XRD pattern of CsPbBr3 perovskite shows strong and prominent peaks with a high degree of crystallinity, which is beneficial for efficient charge transfer. Higher crystallinity, as well as larger grain size with fewer grain boundaries, are both indicated by a narrower and stronger X-ray diffraction peak, which is directly related to photovoltaic performance. Crystallinity was increased in thin films with 1 and 5 mg\u00b7mL\u22121 additions.MgIn action ,24,27. TD, K, \u03bb, B, and \u03b8 are the crystallite size (nm), Scherrer constant, X-ray wavelength (nm), Full Width at Half Maximum (FWHM) (radian), and XRD peak position (degree), in that order. 2 concentrations. The film containing 5 mg\u00b7mL\u22121 MgI2 had an average crystallite size of 74.54 nm, whereas the pristine films had 55.35 nm. These findings also suggested that the interface modification improved crystallinity and reduced defects, thereby improving the photophysical capabilities of the device.The crystallite size of the perovskite film was calculated using Scherrer\u2019s equation, as shown in Equation (1) .(1)D=K\u03bb3 films with and without the addition of MgI2 at various concentrations were compared. The pristine CsPbBr3 film has some discontinuities and numerous pinholes, as shown in 2 concentration increases, with greater coverage uniformity and fewer minor pinholes. The thin film with a MgI2 concentration of 5 mg\u00b7mL\u22121 appears to have the best film coverage, with very compact grain boundaries and few pinholes. The films with a concentration of 10 mg\u00b7mL\u22121 showed signs of degradation, including poor film coverage and dissolved grain boundaries. The degradation of the films with a higher concentration of MgI2 may indicate saturation of the Mg layer, which prevents the perovskite layer from crystallizing properly. The disproportional addition of the compound can disbalance the perovskite crystallization, leading to an incomplete reaction and the formation of PbI2, preventing the full development of perovskite crystals on the film [2 can help improve the morphology and crystallization of the CsPbBr3 film.SEM images of the obtained CsPbBrthe film ,43,44,452/MgI2/CsPbBr3/carbon structure was used to investigate the photo-detection response of the CsPbBr3 photodiode. When light is absorbed by the perovskite layer, electron and hole pairs are separated. Electrons from the light-absorbing layer of the perovskite are carried into the conduction band of the perovskite, where they are injected into the SnO2 electron transport layer (ETL) and collected by the ITO electrode. To complete the electrical circuit, the carbon contact electrode collects the holes. Under a 0 V bias, the devices were tested with a pulsing white light LED at 1 Hz. \u22121 of MgI2 improves sensor performance  and fall  times, which are the times it takes for a photodiode to reach 90% and 10% of steady-state values, respectively . The device containing 5 mg\u00b7mL\u22121 MgI2 has a rise and fall time of 0.65 ms and 0.69 ms  was combined with ZnS:Cu-PDMS and mechanically tested to evaluate the possibility of the modified CsPbBr3 devices for constructing ML-perovskite impact sensors. Light emission in ML materials is caused by mechanical stress. As a result, photon emission is predicted as the ML layer is stressed. The perovskite photodiode then captures the photons and converts them into an electrical current. Upon photoexcitation, electron-hole pairs are generated in the perovskite layer. Then, photogenerated carrier pairs, in the presence of the inherent electric field, are extracted and collected by the electron-transport layer and electrodes, generating electrical current [I represents the electrical current measured during the test and I0 represents the sensor\u2019s baseline electrical current, also known as the dark current. The mechanical energy applied to the composite is transmitted to the sensor, causing ML emission. The perovskite layer absorbs light and converts it into an electrical current. The intensity of an impact has a linear effect on the sensor signal [A perovskite photodiode with a MgI current ,40,58. Tr signal .A mechanical three-point bending test was performed to evaluate the capability of the modified ML-Perovskite sensor for SHM applications. To investigate the sensor\u2019s potential for impact sensing, an in-house drop tower testing setup was used to impact a composite laminate with an embedded sensor with varying impact energies ranging from 0.4 J to 4 J. To evaluate the sensor\u2019s low-energy impact-sensing capabilities, impact samples were subjected to ten successive impacts of increasing energies. The strikes were delivered directly to the surface of the composite structure, right on top of the sensor. The impact testing setup is depicted in The minimum observable signal was obtained for an impact energy of 0.4 J. The minimal detectable impact energy could be reduced by improving the dark current of the perovskite photodetector. E is the impact energy value. The sensor\u2019s sensitivity could be estimated as the change of sensor output due to the input parameter change (impact energy). The estimated sensitivity for the optimized sensor is 0.74 J\u22121. The load applied to the ML materials produces a linear relationship between pressure and light emission. A regression model was used to analyze the experimental data and is shown in the following equation:2 to the interface can increase the intensity of the resulting signal.The higher the energy applied to the ML crystals, the higher the expected emission of photons. The photocurrent of a perovskite photodetector increases linearly with increasing light intensity. As a result, the system\u2019s output signal should rise linearly as the applied load increases. In other words, as the impact energy increases, the signal intensity increases, demonstrating that the sensor can be used for structural health monitoring of composite structures. The addition of MgI3 perovskite with a carbon-based electrode flexible photodetector can be utilized for the ML sensing and SHM of composite structures. The overall performance of the sensor was improved by the incorporation of MgI2 into the interfacial layer that is located between SnO2 and perovskite. The UV-vis data demonstrate that the device\u2019s absorption spectrum has been enhanced, and as a result, it is now appropriate for monitoring ML emissions. The optimized flexible photodetector with a PET/ITO/SnO2/MgI2/CsPbBr3/carbon basic construction demonstrates excellent photoresponse when exposed to white light as the illumination source. According to the findings, the sensors could detect various loads throughout the composite structure. This enabled a correlation to be established between the sensor signal and the impact distance or composite displacement. The ML-perovskite sensor has demonstrated strong potential in SHM applications involving composite materials.In conclusion, we discuss how an inorganic CsPbBr"}
+{"text": "Coronavirus disease 2019 (COVID-19) pandemic has had a negative impact for mental health. ULS-Guarda in cooperation with Portugal National Health Service, provided the population of the district of Guarda with a mental health helpline (MHHL).st\u00a0and September 20th\u00a0of 2020.Provide a descriptive data analysis of the MHHL calls received between April 1TM\u00a0was utilized.The data was obtained through the filling out of questionnaires. It included fields for gender, age, the type of service provided, relation to COVID-19, symptoms displayed and the number calls made per patient. For the statistical analysis, Microsoft Excel\u00a0MHHL received 191 calls. The largest volume was received during April, which saw 116 instances of patients seeking the MHHL. The number of calls then tapered progressively throughout the following months. The services provided were split between psychiatric assistance, psychologic assistance, and the renovation of medical prescriptions, in 44%, 31% and 19% of the cases, respectively. The 101 patients who resorted to the MHHL were unevenly distributed in gender, being 74 female and 27 male individuals. Their ages were mostly between 50 and 69 years old. The most common symptoms were anxiety, depressed humor and insomnia, in 35%, 16% and 11% of the cases, respectively.The largest influx of calls coincides with the home confinement period, and decreased alongside the relaxation of the confinement measures held. The MHHL had enough adherence to warrant consideration of it being an alternative means of healthcare access, especially in situations where physical access to healthcare is restricted."}
+{"text": "In aerospace engineering applications, lightweight material structures are considered to perform difficult service conditions and afford energy efficiency. Therefore, composite materials have gained popularity due to their light weights and high performances in structural design. Mechanical loads and environmental conditions primarily create damage to structural materials, thus numerous studies have considered the repair of the damaged structure. Bonded composite repairs are generally chosen, as they provide enhanced stress-transfer mechanisms and joint efficiencies with the increased use of advanced composite materials in primary and secondary aircraft structural components. Thus, it is essential to have reliable and repeatable bonded repair procedures to restore damaged structural components. However, composite bonded repairs, especially with primary structures, present several scientific challenges in the current existing repair technologies. In this review, a study has been done on the bonded composite repair of damaged structures with the stress-intensity factor (SIF) as the parameter for defining the extent of failure by composite repair and unrepaired material structures. In this work, various types of repair methods and the techniques used by researchers are critically reviewed, and future opportunities are explored. The present study was limited to the composite and aluminium materials that are common in aerospace applications. In an aircraft structure, a high amount of maintenance is required to ensure safety, as aircraft bodies can present slight signs that may lead to initiation of a crack, damages, and failure if not replaced with a new structure. Damage types such as delamination, notches, and cracks are inevitable in different fields of engineering application, especially in the aerospace field, and these damages are mostly due to fatigue, corrosion, and accidents. In such studies, a fundamental addition was made by fracture mechanics to the theory of crack propagation of aircraft materials, as well as other important aspects ,2. FigurFracture mechanics is the study of the mechanical behaviour of a cracked structure subjected to an applied load. A crack is essentially a fracture occurring at the interface of two adjacent layers . The iniBonded composite repair has been presented as an effective and efficient technique to increase the service life of cracked components. In early attempts, researchers repaired the cracked plate using different types of composite patches ,10,11,12Guruprasad et al.  numericaThe material used in aerospace structures should have a high strength-to-weight ratio . We obseAluminium material has been used as a primary material for structural components in aircraft since the 1920s, and aluminium alloys are an irresistible choice for the fuselage, wing, and supporting structures of commercial airliners, military cargo planes, and transport aircraft . DevelopA composite material is defined as \u201ca material that consists of two or more constituents which combined at a macroscopic level and insoluble to each other\u201d . MouritzFibrous composites are found in aircraft applications from the first flight of the Wright Brothers\u2019 Flyer 1 in 1903 to the plethora of usage now enjoyed by them in military and civil aircraft. Their growing use has risen due to their high specific strengths and stiffnesses when compared to the more conventional materials . BotelhoComposite materials are also applicable in the possibility of replacing a network of sensors with a wireless network, which is of interest in the monitoring of aerospace structures, as it eliminates wiring and batteries, resulting in reduced bulk and weight, and greatly simplifies the maintenance of the system . NeverthThis section describes the three approaches that are used by researchers for bonded composite repair in calculating the SIF. The approaches are: mathematical formulation, numerical simulation, and experimental investigation.Ratwani  was the Bouiadjra et al.  analyticOuinas et al.  calculatAhn et al.  introducd repair , where BReddy et al.  performeHattori et al.  used theBased on the existing work, we observed that theoretical and analytical methods were found to be effective approaches in evaluating the SIF of thin-plate structures. Most of the SIFs were found for cracked plates without repairing considering the crack-closer method, Rose\u2019s analytical approach, VCCT, superposition method, and weighted function. Indeed, Rose\u2019s analytical method and the weighted function method were found to be effective in reducing the crack damage, and the results were found to be close to those of the benchmark studies. A further critical analysis is discussed in In this section, we critically review the literature regarding the study of bonded-composite repairs using numerical methods. Numerous software programs have been developed and used in the study of bonded-composite repairs. To compute structural problems, most of the research work over the years has been done using the FRANC2D/L FE code, while in some earlier studies, the MSC NASTRAN FE code was used to validate the existing results. We observed that in recent years, ANSYS and ABAQUS have been the most widely used for simulation and validation purposes.Ratwani  used theBassetti et al.  used ABAMohammadi et al.  performeThe von Mises criterion was used to determine whether the stress in the materials caused plastic flow, and the Newton\u2013Raphson iterative method was used as an approach to resolve the nonlinear finite element equations. Albedah et al.  used ABALei et al.  used theReddy et al.  numericaAndersson et al.  evaluateBenzineb et al.  analysedOne of the most cost-effective methods used to investigate reductions in the SIF is the numerical approach, and this review provides research studies and their analyses. Based on the current review of the numerical approach, we found numerous studies that have shown a reduction in the SIF using FEM via ANSYS, StarCCM, ABAQUS commercial software\u2019s also fracture analysis code: Franc2D, and Franc3D Cornell Fracture Group. It was observed that meshing was critical to obtaining accurate results, while other effects such as modelling, proper boundary conditions, and a high-speed processor were also important. However, the best results are derived from meshing; therefore, most researchers performed mesh-independence tests and mesh-sensitivity analyses for optimum results, Furthermore, FEM results were validated with experimental work once results were validated by performing parametric studies. Experimental outcomes are very significant, as they form the benchmark for validation of analytical methods and numerical simulations. In this section, a review of such experimental work conducted on bonded composite repairs is carried out. The prototype preparation of the specimen for aerospace structures, such as the plate/panel, were tested using the available equipment and facilities for benchmark results to validate the analytical and numerical results.Anderson et al.  experimeHosseini-Toudeshky et al.  carried Lam et al.  repairedSrilakshmi and Ramji  repairedMaleki and Chakherlou  used a ZZarrinzadeh et al.  experimeApart from the SIF, the fatigue life of fractured 2024-T3 aluminium ,98,99 anG is the shear modulus of the cracked aluminium specimen; \u03b5aa\u00a0is the measured strain along the radial line from the crack front; r is the radial location of the strain gauge from the crack front; and \u03b8 and \u03b1 are the strain gauge\u2019s angular location and orientation, respectively.Regarding experimental works, we found very few studies that were recognised as compared to those that used the FEM. Most of the studies only determined the SIF for damaged structures, and only a few works were found that determined the SIF for repaired structures. In experimental works, strain gauges were used to determine the order to define the SIF value using the below formula:To determine the SIF, some studies used the digital image correlation method and found it to be effective. However, no studies were recognised in which DIC was used for the repaired plates; this review presented guidelines for researchers when utilising this method on repaired structures. A further critical analysis of the review is given in Katnam et al.  reviewedA structure can be damaged by low-energy effects, and cracks initiated in its inner layer may propagate and cause the failure of the whole structure. These types of damages will lead to significant reductions in the mechanical properties of the material. For the repair of such damaged isotropic plates, composite material patches have been widely used, and have proven useful. After an in-depth and exhaustive review of previous works on the passive repairs of structures, we found that the work was done based on three methods: analytical, numerical, and experimental, as shown in Excellent work has been reported using numerical methods while considering the linear elastic fracture mechanics (LEFM) method and extended FE (XFEM) method. We also observed that there are numerous software programs available to evaluate the SIF, and most of the work done was by using ABAQUS and FRANC2D/L software. Initially, the FRANC2D/L FE code could only solve simple two-dimensional FE problems; later, Cornell University developed a new version of this software, the FRANC3D/L FE code, which can solve three-dimensional FE problems, but it has not been widely used, as many researchers opted for the ANSYS software, which is versatile in modelling and analysis due to an advanced pre-processor and post-processors. Mathematical modelling of a cracked structure was studied by some researchers ,54,59,60We found that approximately 60% of the work was done in mode-I compared to mode-II and mode-III (or mixed-mode). Meanwhile, researchers can also examine the repair of the shearing mode and tearing mode with bonded composite material patches. We noted that the effects of patch size, patch thickness, patch material, and several applied patches on the SIF need to be studied, as they had a substantial impact on mode-I results. We also observed that most of the work was performed on edge-cracked plates compared to centre-cracked plates in bonded composite repair. Subsequently, it is a signed mark for researchers to look at the repair of the centre-cracked plate. The use of the composite material is now open with new advanced technology and several types of composites as specified in section one is used for different engineering application, especially for aerospace structure.Structural bonded repairs need to be precisely analysed and designed to re-establish damaged components. Structural repairs should maximise the repair\u2019s effectiveness and minimise the risk of material failure under service conditions. However, the performance of bonded patches depends on numerous factors, such as processing, materials, and geometrical constraints, and thus it may be expected that the patch behaviour will be complicated. Advanced computational modelling techniques  could offer accurate numerical solutions for reliable and optimised repair. Human errors and inconsistencies in repair processes can significantly influence the structural strength and durability of bonded composite repairs.In this work, different methods to determine the SIF for a cracked structure were reviewed. Subsequently, a study was made of the composite materials used for the repair of cracked structures, and we found that the most widely used composite material was boron/epoxy due to its attractive combination of properties. Numerous works on the repair of plate, pipe, and shell structures using a composite patch have been reported in the last four decades. Different techniques were employed to study the effects of composite patches on the SIF, and we found an approximately 55% to 65% reduction in the SIF for single-sided patches and an 80% reduction in the SIF for double-sided patches after repair of the cracked plate in mode-I and mixed-mode loads. In addition, we found that adhesively bonded repairs were adequate to transmit stresses, and the correct selection of the adhesive was vital in the manufacturing of engineering structures. In this review, guidelines were established for researchers who seek to use composite patches in aerospace engineering applications. These guidelines regard the types of composite materials selected and the repair methods for a cracked structure. Moreover, the discussion and critical review can offer scholars a wide vision and suggestions for further exploration of gaps that must be closed by future research."}
+{"text": "Shenkang injection has been used clinically to lower creatinine levels. This study explored the mechanism of Shenkang injection on protecting kidney function from hyperglycemia-mediated damage.This study utilized a STreptoZotocin (STZ)-induced rat model of diabetes. In total, 60 rats were randomized into either the control group (n\u2009=\u200915) injected with vehicle or treatment group (n\u2009=\u200945) injected with STZ to induce hyperglycemia. Eight weeks after diabetes onset, diabetic rats were further randomized to receive different treatments for 4 consecutive weeks, including vehicle , Shenkang (n\u2009=\u200915), or Valsartan (n\u2009=\u200915). At 12 weeks, a series of urine and blood measures were examined and damage to the kidney tissue was examined using histology. Expression of nephrin and transforming growth factor-\u03b21 (TGF-\u03b21) were characterized using immunohistochemistry and Western blot.Compared to the control group, rats in the diabetic nephropathy group showed significant kidney damage demonstrated by high kidneyindex, high levels of urinary albumin, albumin/creatinine ratio (ACR), blood urea nitrogen as well as histological evidence. Shenkang injection significantly improved kidney function in the diabetic rats by decreasing kidney index, ACR, and serum creatinine. Shenkang treatment also mitigated kidney damage, improved nephrin expression, and decreased TGF-\u03b21 expression in the kidneys.Shenkang treatment protected renal function in diabetic rats by increasing nephrin expression, which protects diabetic rats from hyperglycemia-mediated kidney damage.The online version contains supplementary material available at 10.1186/s12906-023-04078-6. According to the International Diabetes Federation, the incidence of diabetes is expected to be at least 783.2\u00a0million by 2045 . About 3During the pathogenic process of diabetic nephropathy, hyperglycemia stimulates abnormal cell cycling and increases matrix production and matrix protein glycation, leading to renal hypertrophy and increasing glomerular basement membrane thickness . Intra-gRheum officinale Baill), astragalus , salvia miltiorrhiza , and safflower (Carthamus tinctorius L.) [Shenkang is an injectable medicine containing mixed extracts from four traditional Chinese medicines, including rhubarb (rius L.) . Chemicarius L.) , 16. Therius L.) . Previourius L.) \u201320. Its rius L.) . Shenkanrius L.) \u201323. HoweIn this study, we employed a rat model of diabetic nephropathy to examine the treatment effect of Shenkang on kidney function and its potential role in regulating nephrin expression and glomerular basement membrane integrity.Six- to seven-week old male Wistar rats (220\u2009\u00b1\u200920\u00a0g) were obtained from the Animal Laboratory of Jilin University, Changchun, China and housed individually in a specific pathogen-free facility with a cycle of 12:12-h light/dark and free access to standard rat chow and water. The experiments were performed according to the Guidelines for the Care and Use of Laboratory Animals, and the experimental protocol was approved by the Animal Research and Care of Committee, Jilin University.After being acclimatized in the experimental environment for one week, 60 male Wistar rats were grouped randomly according to the random number table method. Fifteen rats were injected intraperitoneally with vehicle  as the control group, and 45 rats were injected intraperitoneally with 65\u00a0mg/kg streptozotocin  to induce hyperglycemia. Blood glucose levels were measured using the OneTouch blood glucose meter . When the blood glucose concentration was \u2265\u200916.7 mmol/L for two consecutive days, the rats were diagnosed with diabetes. Eight weeks after diabetes onset, the rats were randomized to receive one of the following treatments: (1) vehicle PBS (no treatment) by intraperitoneal injection as the diabetes nephropathy group (n\u2009=\u200915); (2) Shenkang treatment  by intraperitoneal injection as the Shenkang group (n\u2009=\u200915) ; or (3) At the end of the experiment (12 weeks after diabetes onset), body weights of individual rats were measured. The 24-h urine samples were collected from individual rats in metabolic cages . After centrifugation, the urine samples were used to measure levels of urinary protein, albumin, creatinine, and urea nitrogen. In addition, abdominal aortic blood was collected from individual rats and their serum samples were prepared for measuring the levels of serum cholesterol, triglyceride, low density lipoprotein, urea nitrogen, and creatinine. Subsequently, the rats were anaesthetized by inhalation of 4% isoflurane and sacrificed by cervical dislocation, and their kidneys were dissected and wet-weighed to calculate the kidney index (the ratios of kidney weight to body weight). One part of the kidney samples was fixed in 10% formalin overnight and paraffin-embedded. The remaining kidney samples were immediately frozen in liquid nitrogen and stored at -80\u00a0\u00b0C.The levels of serum cholesterol, triglyceride, low density lipoprotein, urea nitrogen and creatinine, urinary protein, albumin, nitrogen, and creatinine in individual rats were measured using an auto-biochemical analyzer  in the First Hospital of Jilin University.The paraffin-embedded kidney tissue Sect.\u00a0(4\u00a0\u03bcm) were dewaxed, rehydrated, and stained with hematoxylin and eosin (H&E). The other kidney tissue sections were stained with periodic acid-Schiff\u2019s (PAS), as described previously . A total3) from individual kidney tissues were fixed with 4% glutaraldehyde (Sigma) for 2\u00a0h, and 1% osmic acid  for 1\u00a0h. After dehydration, the samples were embedded in Epon epoxy resin 812. Ultrathin Sect.\u00a0(80\u00a0nm) were stained with uranyl acetate and lead citrate (Sigma). The sections were photographed under a TEM .Renal cortex specimens  in a pressure cooker for 10 min. After being blocked with 3% bovine serum albumin, the tissue sections were incubated with goat anti-nephrin or anti-TGF-\u03b21  overnight at 4\u00b0C. Normal goat sera (10%) served as the negative control. After being washed, the bound antibodies were reacted with biotinylated rabbit anti-goat IgG . Subsequently, the sections were incubated with peroxidase (HRP)-conjugated streptavidin (Sigma) and visualized using 3,3\u2019-diaminobenzidine . The kidney glomeruli were imaged and photographed under a light microscope.The impact of Shenkang on nephrin and TGF-\u03b21 protein expression in the glomeruli of rats was determined using immunohistochemistry, as previous described . BrieflyWestern blot analysis was performed as previous described . The colP-value\u2009>\u20090.05 suggesting normal distribution. Differences among groups were tested using analysis of variance (ANOVA) given normally distributed data and Kruskal-Wallis test by ranks for non-normally distribute data. A P-value\u2009<\u20090.05 was considered statistically significant. Post hoc comparisons were performed using the Tukey HSD test given significant effects in ANOVA and using the Pairwise Wilcoxon Rank Sum test given significant effects in the Kruskal-Wallis test. Effect sizes were calculated to quantify the size of the difference between two groups, \u03b72 and \u03c92  for ANOVA [Body, urine, and blood measures in different groups of rats are descriptively reported as mean and standard deviation (SD). Normality in data distribution was examined using the Shapiro-Wilk test, with a or ANOVA , \u03b72 for or ANOVA . The intor ANOVA . Analyseor ANOVA .P\u2009<\u20090.05) followed by Pairwise Wilcoxon Rank Sum test , as well as the control group of healthy rats were reported in Table\u00a0st Table\u00a0.P\u2009<\u20090.01, \u03b72\u2009=\u20090.4, \u03c92\u2009=\u20090.36). Mean ratios of kidney body weight in the diabetic nephropathy group were significantly higher than that in the control group (P\u2009<\u20090.01). Compared with rats in the diabetic nephropathy group, the rats that received Shenkang (P\u2009=\u20090.01) and Valsartan (P\u2009=\u20090.02) had significantly reduced ratios of kidney to body weight. The kidney index in the Shenkang group was similar to that of control group (P\u2009=\u20090.06).There were significant differences in kidney index (KW/BW) among the groups \u2009=\u200912.28, P\u2009<\u20090.01, \u03b72\u2009=\u20090.22), urine creatinine , and albumin/creatinine ratio (ACR) . Compared to the rats in the control group, those in the diabetic nephropathy group had significantly higher levels of urinary albumin (P\u2009<\u20090.01) and ACR (P\u2009<\u20090.01). The Shenkang (P\u2009<\u20090.01) and Valsartan (P\u2009=\u20090.03) groups showed significantly lower ACR compared with the diabetic nephropathy group. For urinary albumin, despite the Valsartan group showing a significantly lower level compared with the diabetic nephropathy group (P\u2009<\u20090.01), both the Shenkang (P\u2009=\u20090.12) and Valsartan (P\u2009=\u20090.93) groups showed similar levels compared with the control group. The urine creatinine level was lower in the Valsartan group compared to the control group (P\u2009=\u20090.02) and Shenkang group (P\u2009=\u20090.04). No significant difference was found among the four groups for urinary protein  or urine urea nitrogen .For urine measurements, there were significant differences in urinary albumin , triglyceride , low-density lipoprotein \u2009=\u20094.14, P\u2009=\u20090.01, \u03b72\u2009=\u20090.18, \u03c92\u2009=\u20090.14), blood urea nitrogen , and serum creatinine \u2009=\u20099.76, P\u2009<\u20090.01, \u03b72\u2009=\u20090.34, \u03c92\u2009=\u20090.30). Rats in the diabetic nephropathy group only showed significantly higher levels of blood urea nitrogen compared with the control group (P\u2009<\u20090.01). The mean level of blood urea nitrogen in the Shenkang group was lower compared with the diabetic nephropathy group, but the difference was not statistically significant (P\u2009=\u20090.09). All three blood lipid measures, including cholesterol (P\u2009=\u20090.53), triglyceride (P\u2009=\u20090.23), and low-density lipoprotein (P\u2009=\u20090.91), were similar between the Shenkang and diabetic nephropathy groups. The Valsartan group had significantly lower levels of cholesterol compared to the diabetic nephropathy group. It is worth noting that the rats that received Shenkang treatment had significantly reduced serum creatinine levels compared to all other groups (P\u2009<\u20090.01).Significant group differences were also found in all blood measures, including total cholesterol .Next, we examined the effect of Shenkang treatment on hyperglycemia-induced kidney tissue damage in the different groups of rats. There was an increase in the kidney glomerular areas with proliferative mesangial cells in the diabetic nephropathy group compared with the control group Fig.\u00a0A-B. SimiTEM analysis showed that the integrity of glomerular basement membrane and the normal structure of the foot process were maintained in the kidney glomeruli of the control group, while the basement membrane was irregular and thickened and there were extensively fused epithelial cell foot processes in the kidney glomeruli of the diabetic nephropathy groups Fig.\u00a0. In contP\u2009<\u20090.01), which was similar to that of the control group . A similar pattern for the relative TGF-\u03b21 expression was detected among the different groups using Western blot analysis , astragalus , salvia miltiorrhiza , and safflower (Carthamus tinctorius L.) in Shenkang can improve blood circulation and systemic blood rheology, as well as reduce blood viscosity in the glomeruli of diabetic rats. Jiang found that danshensu, an active ingredient, acted as an anti-oxidant, conferring heart protection, renal protection, anti-inflammation, and antithrombosis properties. Danshensu was present at the highest concentration in Shenkang in vivo based on the analytical ultracentrifugation (AUC) data [Hyperglycemia can cause chronic inflammation and oxidative stress in the glomeruli during diabetic nephropathy , 7. ThesUC) data . PreviouUC) data , 20, 22.Our study demonstrated protective effects of Shenkang on mitigating hyperglycemia-mediated kidney damage and ameliorating kidney dysfunction in diabetic rats. Shenkang treatment reduced the level of hyperglycemia-stimulated TGF-\u03b21 expression and increased nephrin expression in the kidney tissues of diabetic rats. Our findings suggest that Shenkang improves kidney function in diabetic rats by maintaining the integrity of the glomerular basement membrane. These findings provide new insights into the pharmacological mechanism by which Shenkang ameliorates kidney dysfunction under diabetic conditions. In a follow-up study, the mechanism by which Shenkang regulates hyperglycemia-stimulated TGF-\u03b21 expression and the relationship between the nephrin and TGF-\u03b21 expression will be investigated in vitro or in vivo.Below is the link to the electronic supplementary material.Supplementary fig. 1Additional file 1: Supplemental table 1. Tests of group differences between diabetic rats in randomized groups. Supplemental table 2. Pairwise group comparison of diabetic rats in randomized groupsAdditional file 2:"}
+{"text": "Purpose: To categorise and evaluate the quality and readability of the web-based information about the treatment of the variety of forms of dental hypomineralization.Methods: An internet search using two different search terms regarding treating dental hypomineralization was conducted using the Google search engine. The first 100 websites from each search were analysed. Data recorded included DISCERN instrument scores, the Journal of the American Medical Association (JAMA) benchmarks, and the Health on the Net seal (HON). Flesch Reading Ease Scores (FRES), Flesch-Kincaid Grade Level (FKGL), the Simplified Measure of Gobbledygook Index (SMOG), and the Coleman-Liau index were calculated to assess readability.Results: A search for \"Treatment of hypomineralized teeth\" on Google yielded 48,500 results. After excluding irrelevant websites, only 25 were evaluated based on affiliation with universities/medical centers, non-profit organizations, commercial entities, or government agencies. The majority of the content was medical facts presented as text and visuals such as images and videos. The study found that the scores for questions about the benefits and risks of treatment were low, while alternative treatments had high scores. Only one website met the HON code criteria, and a minority of websites achieved JAMA benchmarks. The readability ratings varied across different tests used in the study.Conclusion: Most websites had university or medical center affiliation but only partially related to the specialty. Two-thirds of websites used images. The online information was inaccurate, poor quality, and hard to read for the average person. Dental professionals should be aware of this information's quality and work to improve it. Enamel, dentin, and cementum are the three hard tissues forming the tooth, formed by specialized cells. The formation of the tooth is through biological and cellular complex pathways that are controlled by genes and affected by environmental and epigenetic factors. Alterations in genes controlling tooth development result in reduced quantity and quality of the hard tissues forming the tooth. According to the affected gene, the defect will result in dental malformation or other organs will also be involved .Amelogenesis imperfecta (AI), dentinogenesis imperfecta (DI), dental fluorosis (DF), and molar incisor hypomineralization (MIH), are all examples of structural malformation affecting the quality and the quantity of the hard tissues forming the tooth . The preReducing the risk mentioned before in both enamel defects  and dentin defects  requires early diagnosis, preventive care, and regular follow-ups. To reduce the caries risk, topical fluoride application is recommended every three to six months. Since the tooth structure is weak and prone to fracture under slight masticatory force, full coverage restoration is advised as soon as the tooth erupts. In addition, children with a family history of amelogenesis imperfecta or with a systemic disease known to be related to dental malformation should be screened early as soon as the teeth erupt .In regard to the chronic nature of the disease and previously mentioned side effects, these malformations are common among related populations hence individuals with enamel or dentin malformation are likely to require or wish to have the appropriate knowledge to help them to correctly seek the required advice along with increasing their awareness about the treatment options and perhaps the complications of the disease and the suggested therapeutic interventions.In this regard, patients usually consider the Worldwide Web as one of the most approachable sources of healthcare information and patient self-education. Although such online information is easily accessible and plentiful, there are concerns regarding the availability of inaccuracy, poor quality, and difficult readability of the related information sources that may augment the risk of consumption of low-quality related information, hampering the person-professional relationship. Thus, online information could be misleading and hence hinder patient\u2019s participation in the clinical decisions regarding their healthcare needs and the risks and benefits of the treatment options being considered.Therefore, with the increasing patients\u2019 esthetic demands and the possible complications that can arise from these dental malformations and the need for early diagnosis and treatment intervention, it is crucial to assess the quality and readability of web-based information concerning dental hypomineralization, hence the aim of the present study was to categorise and evaluate the quality and readability of the web-based information about the treatment of the variety of forms of dental hypomineralization including AI, DI, DF and MIH.SearchGoogle.com [Google.com, the initial 100 websites were included in the study to ensure a comprehensive evaluation of the available online information [An online search started in June 2023 using ogle.com  using twormation . The dupormation  definitiQuality assessmentBefore data extraction, two reviewers underwent training, and a third reviewer resolved disagreements. The quality was assessed independently using two instruments, the DISCERN instrument  and the The DISCERN instrument, comprising 16 items developed by the University of Oxford, was utilized to assess the reliability of online content and its treatment information. This tool evaluates both the overall reliability of information and specific treatment details. The first eight questions explore reliability and the next seven questions specific details of treatment with an additional question for an overall rating of the material\u2019s quality. The questions are rated on a numerical scale from 1 to 5  .The JAMA benchmarks were used to determine the readability and accuracy of websites, which include the clarity of authorship of medical content, attributions, statements of disclosure, and indication of currency .Health on the Net (HON) is a non-profit organization that was founded in 1995 with the aim of helping people assess the credibility of medical information and sources available online. Websites that meet criteria stating the qualifications of authors and differentiating between advertising and editorial content are eligible to display the HON seal.Readability assessmentTo understand the written texts, a readability assessment is applied which is used to determine the reading comprehension level of a person by a systematic formula . There wThe FRES is based upon a formula that incorporates the average sentence length and the average number of syllables per word and the outcome score is a number ranging from 0 to 100. The higher the score, the easier the passage is to read . For exaThe FKGL is an improvement of FRES and is the average number of words per syllables and sentence. The SMOG index is the number of polysyllabic words per sentence which is considered to determine the level of education needed to understand a written piece. However, the CLI depends on characters per word and sentence length.www.readabilityformulas.com) [Two independent reviewers, SA and RA, assessed text readability to ensure reliability and consistency in our evaluation. A website (las.com)  was usedAvailable websitesGoogle.com about the terms treatment of enamel hypomineralization and treatment of hypomineralized teeth revealed 48,500 results; the first 100 websites from the first 10 pages are included. Of these 100 websites, 75 were excluded for the following reasons: 34 were scientific articles, 16 were not related to hypomineralization of teeth, eight contained advertisements and promotional products, three were social media-related, seven were videos, and seven were duplicates. Only 25 websites were selected to be included in the evaluation process; a directory of these sites is available in Appendix 1. The search strategy is summarized in Figure Searching on The websites were categorized based on their affiliation with university/medical centers, which accounted for 10 (40%), with non-profit organizations, which represented five (20%), with commercial entities, which accounted for nine (36%), and with government agencies, which only accounted for one (4%) website. All of the websites were partly related to the treatment of hypomineralization of the teeth. The content type comprised mainly medical facts in 22 (88%) websites, human-interest stories in 18 (72%) websites, and questions and answers in seven (28%) websites. Only one (4%) website featured clinical trials.The content was presented mainly as a test, with 17 (68%) websites having visual presentations as images, two (8%) websites containing videos, and none featuring an audio presentation. Categorization of websites based on affiliation, specialization, content type, and content presentation is summarized in Table Quality assessmentThe DISCERN scores per question varied, but the mean overall score was 3.08 (\u00b1 0.68). The lowest scores related to questions about benefits and risks of treatment (questions 10 and 11) with mean scores of 1.60 (\u00b10.91) and 1.56 \u00b10.82), respectively. However, the highest score was related to alternative treatments (Question 14), with a mean score of 4.20 (\u00b10.87). The HON code was obtained by only one website. Means and standard deviation scores for DISCERN are summarized in Table , respectRegarding JAMA benchmarks, authorship and currency were achieved in 10 (40%) websites and 11 (44%) websites, respectively. Based on the number of achieved JAMA items per website, none of the websites had all four items, and only one website had three items. Two items were achieved in seven (28%) websites, and one item was achieved in six (24%) websites. No items were achieved in 11 (44%) of the websites. The quality assessment of the websites is summarized in Table ReadabilityThe FRES rating ranged from 9.6 to 74.5 with a mean of 42.1 (\u00b1 13.12), while the FKGL had a range, with a minimum score of 7, a maximum score of 16.5, and a mean score of 11.77 (\u00b1 2.37). SMOG readability scores ranged from 7 to 14 with a mean of 10.56 (\u00b1 1.77). The CLI test yielded a mean score of 12 (\u00b1 1.83) with a maximum score of 15 and a minimum score of 7. Based on the FRES, the websites were categorized into difficulties, as shown in Figure The increase in internet use to access health information about high-occurrence conditions such as enamel hypomineralization highlights the importance of the current study. The number of websites that fulfilled this study\u2019s inclusion criteria was small. Our study\u2019s alignment with Meade and Dreyer's  researchOur results showed overall moderate quality of the included website using DISCERN. However, the contents scored poorly for some essential items, including mechanism of action and risk and benefits of enamel hypomineralization treatment options. The results of the JAMA criteria indicated poor quality of the websites, and none of them fulfilled all four criteria. Likewise, several studies investigated websites related to enamel hypomineralization and other dental conditions, such as dental caries and orthodontics, that advocated overall poor quality and reliability -16. ThisOnly one website that has been certified by the HON code met three of four JAMA criteria. To be eligible to display the HON seal on a website, eight criteria must be met, including disclosing author qualifications and maintaining a distinction between advertising and editorial content.In this research, we employed four criteria to assess the reliability of our results. The FRES scale measures readability, with higher scores indicating easier readability. On the other hand, lower scores of SMOG, FKGL and CLI indicate easier readability. The latter three indicators are commonly used to evaluate the readability of texts and often reflect the educational level in the US or UK school systems. Nevertheless, these indices have also been tested and proven reliable in languages like Hungarian, Portuguese, and Arabic ,17,18.The National Institutes of Health (NIH) suggests writing patients' health information in a language that individuals can easily understand in grades six to seven . Our resAlthough 17 (68%) of 21 websites assessed in this study presented images as visual aids, only two of the websites presented videos. Using clinical pictures would help the patient identify and recognize different lesions of enamel hypomineralization. However, written content and images may not effectively explain aesthetic treatment options such as bleaching, resin infiltration, and microabrasion. This finding is supported by the notion that treatment option items for the investigated websites displayed low DISCERN scores (< 2). Therefore, using videos could be more effective in explaining the techniques of different treatment modalities . FurtherPoor website quality and difficult readability could misinform patients regarding the diagnosis and treatment options of enamel hypomineralization. This misinformation may negatively affect patient-dentist relationships and create mistrust in professionals\u2019 opinions if it negates what patients read on unreliable websites. This issue could be even more problematic regarding aesthetic conditions such as white and brown discoloration caused by enamel hypomineralization. In contrast, if patients access health information through more reliable sources, they would positively engage in the decision-making process and improve patient-dentist relationships and trust . Hence, Regarding the limitation of this study, we focused on websites only and did not include information presented on social media. Different social media applications became common sources of information with a profound influence on public health, particularly on aesthetic issues, including enamel hypomineralization . HoweverEvaluating the web-based information related to various dental specialties is essential in recent days. This study assessed the quality and readability of web-based information regarding dental hypomineralization. Most of the websites have a university or medical center affiliation. However, it is partly related to the specialty. Around two-thirds of websites use images to present the content. The online information is inaccurate, poor quality, and challenging for an average person to read. Dental professionals should be aware of this information\u2019s quality and contribute to its improvement."}
+{"text": "Purpose: The purpose of this study is to evaluate the quality of patient education materials accessible through popular online search engines regarding anterior\u00a0cruciate\u00a0ligament (ACL) injuries and anterior\u00a0cruciate\u00a0ligament reconstruction (ACLR).\u00a0Journal of the American Medical Association (JAMA) benchmark criteria, and Flesch-Kincaid Reading Grade Level (FKRGL), respectively. The Health On the Net Code of Conduct (HONcode) certification was also utilized to assess the transparency of health information for each website.Methods: Two search terms (\u201cACL surgery\u201d and \u201cACL reconstruction\u201d) were entered into three search engines . The quality of information was scored using a novel scoring system developed and overseen by sports medicine orthopedic clinical research fellows and fellowship-trained orthopedic surgeons. Website quality, credibility, and readability were further assessed by the DISCERN score, Results: We evaluated 39 websites. The average score for all websites was 11.2\u00b15.6 out of 28 total points. Six out of the 39 websites (41%) were HONcode\u00a0certified. The websites that contained HONcode certification had a higher average JAMA benchmark score (3.5\u00b10.7) and DISCERN score (44.6\u00b114.7) when compared to the websites without the certification, 2.2\u00b11.2\u00a0and 37.6 \u00b1 15.9\u00a0for JAMA and DISCERN, respectively. The mean JAMA benchmark score was 2.7\u00b11.2 (67.5%) for all websites out of a possible four points. The average FKRGL for all 39 websites was 10.0\u00b12.0 (range: 5.4-13).Conclusion: The quality of patient education materials accessible on the internet regarding ACL injuries and ACLR can be misleading and directly impact the patient's decision-making process essential to the patient-physician relationship over the past decade.Clinical Relevance: The internet can be a helpful online resource, however, surgeon clarification and consultation with qualified healthcare professionals are strongly recommended prior to clinical decision-making regarding potential treatment options. An anterior cruciate ligament (ACL) injury is one of the most common knee injuries in orthopedics with an annual incidence of 68.6 per 100,000 person-years in the general population . There aAs of July 2020, approximately 312 million Americans had internet access totaling 95.6% of the overall population ,5,10. ThThe purpose of this study is to evaluate the quality of patient education materials regarding ACLR\u00a0over the past decade that are easily accessible through the most popular online search engines. In contrast to previous 2013 studies by Bruce-Brand et al. and Duncan et al. analyzing accessible ACLR patient education materials, our study incorporates how trending in search engine results have changed and improved over the last 10 years. Using a novel scoring system created by the authors and finalized by a sports medicine-certified orthopedic surgeon, we determine the accuracy with which each website addresses the etiology, preoperative evaluation, treatment options, risks, and prognosis of ACL tears and reconstruction. Furthermore, this study presents a proper 10-year update with a variety of scoring systems that examine\u00a0a website's overall objectivity, accuracy, quality, and readability.Google, Yahoo, and Bing were the three search engines used given their overall popularity for search.\u00a0The search terms \u201cACL surgery\u201d and \u201cACL reconstruction\u201d were used.\u00a0The first 25 results for each term were collected in each of the search engines, which resulted in a total of 6 searches  used to grade the overall quality of websites were not intended for the evaluation of videos.\u00a0Each website was categorized as academic, allied non-physician, physician, commercial, and unspecified.Once a list of websites was established, the list of websites and a scoring rubric were provided to three different independent evaluators. Two of the three graders were orthopedic clinical research fellows in sports medicine.\u00a0The scoring rubric created is author-derived with oversight from a sports medicine fellowship-trained orthopedic surgeon. The components of the scoring rubric are based on UpToDate, the American Academy of Orthopaedic Surgeons (AAOS), and the textbook \u201cACL injury and its Treatment\u201d by Mitsuo Ochi.\u00a0The rubric was initially created by the three evaluators, and it was ultimately agreed upon by the sports medicine orthopedic surgeon.\u00a0Each component is categorized into preoperative, surgical, and postoperative/prognosis components.\u00a0Each component included were those that were deemed essential for patient education.\u00a0Scoring components included the function of the ACL, symptoms and evaluation of an ACL rupture, treatments, benefits and risks, and prognosis, and each criterion was valued as one point. Once all the websites were scored, all the values were collected and the mean was calculated.\u00a0Since the author-derived rubric is based on whether\u00a0a website mentions a specific topic, the DISCERN was used to evaluate overall quality, accuracy, and bias.\u00a0DISCERN is a commonly used scoring system used to grade written consumer health information regarding the treatment options for patients.\u00a0Each of the 16 questions in the DISCERN is graded from one to five based on how effectively a website addresses each category.\u00a0The DISCERN score examines relevance, use of peer-reviewed literature, discussion of treatment options, risks and benefits for treatments, prognosis, and if the patient plays an active role in determining treatment.\u00a0The JAMA criteria score was used to evaluate the credibility of the paper.\u00a0These criteria specifically examined authorship, attribution, disclosure, and currency. Authorship requires the authors and contributors to provide their affiliations. Attribution refers to the listing of references and sources as well as copyright information. Disclosure assesses whether website ownership, conflict of interest, sponsorship, advertising, commercial funding, or conflict of interests is fully disclosed. Currency requires that each website provide\u00a0accurate dates when content is posted and updated. One point is added for each criterion met, with a maximum of four points, a score of four indicates a credible source and a score of zero indicates unreliable information.The Flesch-Kincaid Reading Grade Level (FKRGL) examined the readability of a website and assessed the difficulty in which information from each website can be understood and comprehended. FKGL indicates the academic grade level required to understand written material, determined by a formula that considers the number of words per sentence and the number of syllables per word. Scores range from 0 to 18, with 0 being a level of just learning to read, a kindergarten level, and 18 being a level on par with an academic paper, a college readability level.Health On the Net Code of Conduct (HONcode) certification is an ethical standard utilized as a mark of certification for medical and health websites to publish transparent health-related information. The presence or absence of HONcode certification is listed for each website.After filtering through the initial 150 websites found, a total of 39 websites that addressed ACL surgery and reconstruction were included. Figure Overall, the included 39 websites had an average score of 11.2\u00b15.6 out of 28 total points (Table Table The mean JAMA benchmark score was 2.7\u00b11.2 (67.5%) for all websites out of a possible four points . A FKRGL of 10 indicates readability at a ninth-grade level.ACL\u00a0injuries are among the most common knee injuries in orthopedics and the general population with the incidence of ACLR steadily increasing .\u00a0Given tThis study included 39 total websites with publicly available information regarding ACL surgery and ACLR found through the popular search engines Google, Yahoo, and Bing. The criteria with the highest percentage representation from all articles were \u201cphysical therapy (76%)\u201d and \u201crehab protocol (76%)\" and the criteria with the lowest percentage representation were \u201crole in proprioception (9%)\u201d and \u201csingle vs. double vs. triple bundle repair (10%).\u201d The five highest scored websites scored an average of 18.3 points vs. 10.3\u00a0for all remaining websites. Therefore, we conclude the impact of information on certain websites is variable and more emphasized in some versus others.HONcode certification was evaluated to assess the relationship between reliability, credibility, and transparency in relation to its quality. Sixteen out of the 39 websites were HONcode certified (41%) and websites that contained HONcode certification had a higher average JAMA benchmark score (3.5\u00b10.7) and DISCERN score (44.6\u00b114.7) when compared to the websites without the certification, (2.2\u00b11.2) and (37.6\u00b115.9) for JAMA and DISCERN, respectively. Thus, our study indicates that HONcode certification reliably identifies websites with higher quality and content scores which previous studies have also identified across various specialties in medicine -31.\u00a0ConcThe mean JAMA benchmark score was 2.7\u00b11.2 (67.5%) for all websites out of a possible four points. This JAMA score is relatively higher than other scores from previous orthopedic studies evaluating available online medical information ,32-35. WThe majority of websites in this study were academic (33.3%) with an average score of 11.2\u00b15.6 out of 28 total points. Consistent with previous studies, we report websites of an academic nature provide better information quality, and patients searching on the internet can reliably utilize academic institutions for educational resources -37.\u00a0MoreLimitationsThere are several limitations to this study we must address to establish full transparency and objectivity of our presented data. A weakness of this study is the relative subjective nature in which each website was graded. Moreover, our study results are only applicable insofar as the search terms \u201cACL surgery\u201d and \u201cACL reconstruction\u201d are used. Although we have developed a novel scoring system that took into account how trending in search engines have changed or improved over time, our scoring system does analyze similar criteria used in previous ACLR patient information studies such as the JAMA benchmark criteria, DISCERN score, and FKRGL. We have also subjectively assumed which websites provide the most reliable and transparent information for a given search engine, which is accessible to the patient. This does not take into account the patient's individual factors that can limit their ability and capacity to access health-related information on the Internet. Furthermore, current internet trends and advances in search engine technology are constantly changing\u00a0so our presented data may not accurately reflect the most up-to-date health information regarding ACLR available online.Patient education materials available on the web regarding ACL injuries and ACLR through popular search engines such as Google, Yahoo, and Bing can provide the patient with useful resources but may be of variable reliability. After a thorough analysis of available information on the web, while incorporating how trending in search engines have improved and changed over the last 10 years, we conclude that the internet can help\u00a0differentiate potential treatment options but surgeon clarification in unison with a healthcare professional team is strongly recommended before any clinical decision-making."}
+{"text": "In the era of the internet, patients seek health information ahead of getting the required treatment. Dental implant, which is among the most sought dental treatments, is not an exception. Incorrect health related information may lead to harmful deeds, so this study sought to assess the quality of web-based Arabic health information on dental implants.http://www.google.com), Yahoo! (http://www.yahoo.com), and Bing (http://www.bing.com) on 13 January 2022 for specific Arabic terms on \u201cdental implants\u201d. The first 100 consecutive websites from each engine were analyzed for eligibility. The eligible websites were assessed using JAMA benchmarks tool, DISCERN tool, and HONcode. An online tool  was used to assess readability of the websites.The following engines were searched: Google  was HONcode certified. Only 3 (4.5%) websites attained a high score (>\u200965 out of 80) based on DISCERN tool: The mean DISCERN score was 41.14\u2009\u00b1\u200912.64. The mean JAMA score was 1.69\u2009\u00b1\u20091.13; however, only five (7.6%) met all JAMA criteria. The main shortcomings were attributed to not meeting the \u201cAttribution\u201d (54 [83.1%]) and \u201cAuthorship\u201d (43 [66.2%]) criteria. The mean grade level of FKGL score was 7.0\u2009\u00b1\u20094.5. The majority of the websites (60%) scored less than 7, indicating easy content to understand. The mean grade level of SMOG score required to understand a website\u2019s text was 3.2\u2009\u00b1\u20090.6. Around 91% of the websites had reading ease scores\u2009\u2265\u200980, suggesting that the website\u2019s content was easy to read.Unfortunately, although readable, most of the easily accessible web-based Arabic health information on dental implants does not meet the recognized quality standards.The online version contains supplementary material available at 10.1186/s12903-023-02938-8. Nowadays, dental implants are the most dental prosthesis sought for tooth/teeth replacement owing to the fact they are designed to look and function like the natural teeth. Although it requires inter-professional teamwork including periodontist, surgeon, restorative dentist and laboratory, dental implant has many advantages when compared with other alternative treatments . Among these advantages are the high success rate, longevity, bone maintenance, less plaque retention, less risk of exposing adjacent teeth to caries, endodontic problems and teeth sensitivity, and high patient\u2019s satisfaction.The patients are aware about various treatment choices, and dental implants are not an exception. They will not accept any treatment unless they are saturated with adequate knowledge about all important information . PreviouRoutinely, dental personnel are questioned about dental information seen in the internet. Dental implant is one of the most common dental topics the patients used to ask about. Given such an eagerness to learn about dental implant, dental professionals must direct their patients to the reliable, readable evidence based websites. Unfortunately, this is not the case: Many studies reported that the dental implant material in the internet are unreadable and even beyond the understanding capability of the targeted readers .Incorrect health related information may lead to harmful deeds such as using unlicensed remedies, toxic herbs, and wrong prophylactic strategies. So it is mandatory that these websites be assessed for the quality of information they publish \u201312. In tRegarding the web-based Arabic health information, a few studies have been conducted addressing oral cancer, COVID-19, denture hygiene, and periodontal diseases, and revealed low quality \u201310. To ohttp://www.google.com), Yahoo! (http://www.yahoo.com), and Bing (http://www.bing.com) on 13 January 2022, following \u201cThe Pew Research Center\u2019s Internet & American Life Project\u201d[We searched, using Google Chrome, version 81.0.4044, the following engines: Google  , DISCERNThe JAMA benchmarks tool, which is published by the Journal of the American Medical Association, evaluates the following criteria: (1) authorship ; (2) attribution (mentioning references and sources from which the content was cited); (3) disclosure ; and (4) currency . Each criterion, when fulfilled (\u201cyes\u201d response) got a score of one point for the website; otherwise, it was scored zero (0) point. Accordingly, the overall JAMA score ranges from 0 where no criteria fulfilled to 4 points where all 4 criteria fulfilled .The DISCERN tool comprised 16 questions included in three main sections: questions 1\u20138 address the extent of trustfulness of the websites as sources of data with regard to selected therapies, questions 9\u201315 address therapy alternatives, and question 16 assesses the overall quality score. Each question ranges from 1 to 5, where 1 indicating a poor website and 5 indicating a good quality website. Hence, the minimum score is 16 and the maximum is 80. The obtained scores were categorized as low (16\u201332), moderate (33\u201364), and high (\u2265\u200965). Two of the authors (EH and MSA) conducted the quality assessment using the DISCERN and JAMA tools. For calibration, they independently assessed 10 websites and discussed and resolved any discrepancies, if any. Later, inter-examiner agreement was calculated for all of the websites .An online calculator tool of readability was used to evaluate the readability of the websites . The OnlAll statistical data were analyzed by SPSS  Version 22.0 software program. The test of normality was utilized using the Shapiro\u2013Wilk test. Spearman correlation coefficient test was used to evaluate the correlation between the indices. A P value\u2009<\u20090.05 was set to be a statistical significance.https://www.mayoclinic.org/ar/tests-procedures/dental-implant-surgery/about/pac-20384622) which was HONcode certified.Figure\u00a0As shown in Table\u00a0Table\u00a0This study aimed to investigate the quality and readability of Arabic health information on a very hot issue pertinent to the population: dental implants. To attain our aim, we utilized the most frequently used search engines: Google, Yahoo, and Bing. Indeed, a previous study demonstrated that many patients seek for e-health online information to initiate their quest through one of these search engines . Owing tIn this era, most, if not all, patients seek for information on preventive and therapeutic remedies for their diseases in the internet, despite the quality of such information. Unfortunately, not only new internet users but frequent internet users also tend to believe such false information they come across. Indeed, when a patient browses through websites with false information, he/she is not able to identify them as wrong, and believes what he/she read . An earlThe HONcode, DISCERN, and JAMA Benchmarks tools are the most commonly used in order to assess the reliability and quality of the information available online on medical websites \u201329. RegrRegrettably too that only three websites achieved a high DISCERN score (\u2265\u200965 out of 80). This represents 4.6% of the health information available online on dental implant in the Arabic language. The majority of the websites attained a moderate (58.5%) and low (36.9%) scores. Such below-the-recognized quality based on DISCERN was related more to the questions 1 to 8: lacking data for the aim of the website content, authorship, relevancy, source information, and publication date. However, part of the shortcomings is attributed to the questions 9 to 15 of the DISCERN tool , 10. TheOn the basis of JAMA benchmark tool, it is evident that the Arabic language websites on dental implants provide information below the recognized standards: the mean score was 1.69\u2009\u00b1\u20091.13 out of 4, i.e. a poor score. Such a low score on the JAMA benchmarks tool is largely attributed to e not mentioning the sources of the information, the authorship of the content, the date of posting, and the regular updating. In contrast, disclosure criterion of the JAMA benchmark tool was fulfilled by most of the included websites. With no doubts, it seems surprisingly a bad practice that medical websites contain information without fulfilling authorship, attribution and currency criteria.Apart from the quality of the included websites which was below the recognized standards, the texts were to be found easily readable and understandable. The majority of the websites had a lower FKGL score which means they are easy to understand by an average internet user. In support of this, all included websites were found to be easy to understand by the patient with middle school background as per the SMOG results. In support of both results, the FRE score was high, indicative easy and understandable websites , 9. ThusThe study has a few limitations worth mentioning. First, we searched only in three search engines, although they are the most famous ones. We included the first 100 websites from each engine, although it is highly likely that the internet users don\u2019t go beyond this number. There are other tools for quality assessment, other than used in our study. However, the used tools are the most frequently used in this context. The tools which used to assess the readability were developed to assess English text. However, they have been used in context of Arabic texts and reflected high validity and reliability. In future, more search engines should be included with an increased sample size across each engine to bring about results that are more accurate. Additionally, patients, their associates, and active internet users should be taken on board while developing medical-related webpages .Unfortunately, although easily readable and understandable, most of the easily accessible web-based Arabic health information on dental implants does not meet recognized quality standards.Below is the link to the electronic supplementary material.Supplementary Material 1"}
+{"text": "BackgroundEndodontic microsurgery (apicectomy) can be considered in cases of persistent infection that is resistant to conventional root canal treatment. The aim of this study was to evaluate the quality and readability of the available online information regarding the apicectomy procedure in Arabic.MethodsOnline search on the three most commonly used websites  using one keyword. The first 100 websites from each search were analyzed for quality and readability using DISCERN instrument scores, the Journal of the American Medical Association (JAMA) benchmarks, the Health On the Net (HON) seal, Flesch Reading Ease Scores (FRES), Flesch-Kincaid Grade Level (FKGL), and the Simplified Measure of Gobbledygook (SMOG) Index.ResultsSearching using the Arabic translation for \"root end resection surgery\" revealed 349,900 websites. Following the inclusion criteria, 31 websites were selected and evaluated in this study. The selected websites belonged to either non-profit organizations or commercial websites. The quality of most of the selected websites received a moderate score (83.9%) using the DISCERN tool. None of the selected websites obtained the HON seal. Quality evaluation using the JAMA benchmarks revealed that currency was the most achieved item (45.2%), followed by authorship (22.6%). Evaluation of the readability of the selected websites using the FRES, FKGL, and SMOG showed that the included websites were considered readable.ConclusionAlthough the included websites were readable, the quality of the websites was moderate. There is an urgent need to create more trustworthy and readable websites explaining the different endodontic treatments. Root canal treatment (endodontic treatment) is a dental procedure that encompasses a number of treatments that are concerned with preventing and treating inflamed and infected pulp tissues that must be removed from the root canal system to prevent further problems . There iSurgical endodontic treatment (apicoectomy) is performed to save the natural teeth when conservative endodontic treatment has failed . In thisNowadays, online information has become a highly reliable source for finding answers to all people\u2019s questions . People Searching strategySearching with the Arabic translation for \u201croot end resection surgery\u201d as \"\u0627\u0633\u062a\u0626\u0635\u0627\u0644 \u0642\u0645\u0629 \u062c\u0630\u0631 \u0627\u0644\u0633\u0646\" was carried out on the 24th of August 2023 using Bing, Google, and Yahoo search engines. This study was conducted at Taibah University at the College of Dentistry, Madinah, Saudi Arabia. The first 100 websites that appeared through Bing, Google, and Yahoo search engines for the term were explored to evaluate the content, quality, and readability of the available information. Even though most users only look at the first page of Google, we included additional websites beyond the first page . The lisQuality assessmentThe quality of the online information was assessed using the DISCERN instrument , the JouJAMA benchmarks were used to analyze the quality of the website. These benchmarks require clarity about content authorship, including authors and contributors, their affiliations, and relevant credentials; an attribution list of references and sources of information; disclosure of website ownership, sponsorship, advertising, commercial funding arrangements, conflicts of interest, and currency, i.e., dates of content posted and updated .HON is a non-profit organization founded in 1995 that promotes reliable and transparent health information online. It gives accreditation to websites that follow the HON code of ethical conduct, consisting of eight principles, including authority, privacy, attribution, transparency, financial disclosure, and advertising policy .Readability assessmentThe readability was assessed using four different measures: Flesh Reading Ease Scores (FRES), Flesh-Kincaid Grade Level (FKGL), and the Simplified Measure of Gobbledygook (SMOG). The Flesch Reading Ease (FRES) formula, developed in the 1940s, measures the readability of text by considering the average sentence length and the average number of syllables per word. A higher score indicates that the text is easier to read. A score of more than 90 equates to the reading age of a ten-year-old, while a score of 30-49 equates to the reading age of an adult. The FKGL is based on the average number of words per syllable and sentence, while the SMOG Index takes into account the number of polysyllabic words per sentence [Data analysis planData were collected and recorded in Microsoft Office Excel  spreadsheets. Descriptive statistical analyses were calculated using IBM\u00a0SPSS\u00a0Statistics for Windows, Version 26.0 . Data are presented as mean with standard deviation for quantitative data and as frequency and percentages for categorical data.Ethical considerationsIn conducting this study, we have exclusively employed publicly available data that does not include personally identifiable information, confidential data, or other sensitive content related to individual patients or participants. As such, the nature of the study design doesn\u2019t require obtaining informed consent or undergoing formal ethical review processes generally mandated for research involving human or animal\u00a0subjects.Available websitesWhen searching for the Arabic term for \"root end resection surgery\" on search engines, Google found 218,000 websites, Bing found 48,900, and Yahoo found 83,000. We evaluated the first 100 results from each engine for eligibility criteria and found 31 websites that fit the criteria. The remaining 269 websites were excluded. See Figure Checked websites were categorized, and it was found that most of them  belonged to non-profit organizations, followed by commercial websites . None of the websites were affiliated with the government, universities, or medical centers. All 31 websites contained medical content, with two (6.5%) including Q&A and only one (3.2%) including clinical trials. Five (16.1%) websites included human interest stories. Seventeen (54.8%) websites included images, six (19.4%) included videos, and only two included audio (6.5%). For a summary of the website's affiliation, content type, and presentation, see Table Quality assessmentOut of the 31 websites examined, the average DISCERN score for all of them was 2.90 (\u00b1 0.58). However, no website achieved the maximum score of 80 or the minimum score of 16. The poorest scores were for the twelfth question, \"Does it describe what would happen if no treatment is used?\" with only one website achieving a score of 25 (80.6%), and the fourth question, \"Is it clear what sources of information were used to compile the publication?\" with only 21 websites achieving a score of 67.7%. Most of the websites received moderate scores, with 26 (83.9%) falling into this category, while only five (16.1%) received low scores, and none achieved high scores. Table When interpreting JAMA benchmarks, currency was the most achieved item in 14 (45.2%) websites, followed by authorship in seven (22.6%) websites, and attributions in six (19.4%) websites. Disclosure was the least achieved item, with only three (9.7%) websites meeting this requirement. No website received a full score in the JAMA benchmarks. Table Readability assessmentAccording to Table The aim of endodontic treatment is to cure or prevent apical periodontitis . EpidemiIn this study, the most commonly used search engines, including Google, Yahoo, and Bing, were used. A search using the Arabic translation for \"root end resection surgery\" revealed 349,900 websites from the three search engines. The first 100 websites from each search engine were carefully evaluated using the eligibility criteria. Following the elimination of duplicates, 31 websites were selected, with the main reasons for exclusion being that they were not related to the topic or were advertisements. Most of the included websites belong to non-profit organizations, followed by commercial websites. All the included websites were partly related to the topic of presenting medical facts about the procedure using pictures or videos. It is difficult for the layperson to understand the concept of the apicectomy procedure. Thus, the presence of trustworthy, readable websites is crucial to simplifying the information for patients. This study highlights the need for more detailed and trustworthy websites.DISCERN is one of the most commonly used tools for the assessment of the quality of medical websites . AssessmNone of the included websites obtained the HON seal.\u00a0The HONcode certification may be absent on health websites for various reasons. Financial constraints often pose a significant barrier, with some websites unable to afford the associated fees. Compliance with HONcode principles demands ongoing effort, potentially overwhelming smaller or non-profit sites. Navigating the complexities of data privacy and content standards can be challenging, necessitating technical expertise. Moreover, HONcode guidelines may evolve over time, necessitating continuous adaptation. Autonomy is another factor; some websites prefer not to adhere to external standards, choosing to maintain control over their content and practices. Additionally, limited awareness about HONcode certification exists, leading some websites to overlook its potential benefits.Information targeting the general population should be presented in simple and clear terms so a layperson can grasp the information. Common readability tests use the average sentence length, the number of words, and the number of syllables per word to calculate the readability of a given text. Standard, well-established readability tests include FRES, FKGL, and SMOG. The text is considered readable in FKGL and SMOG if it scores seven or less, while for FRES it should score 80 or more . Based oLimitations of the study\u00a0In relation to our study's limitations, using one search term may limit the generalizability of the study findings, although we have included the first hundred results per search engine. We also focused on website content and excluded social media and videos. However, most of the tools and indices available are mainly intended to measure the quality and readability of written material. In addition, this study evaluated the Arabic content only; while this is the aim of the study, including two languages may improve the findings in future studies.This study aimed to evaluate the quality and readability of available web-based information about apicectomy published in Arabic. Although the included websites were readable, the quality of the websites was moderate. There is an urgent need to create more trustworthy and readable websites explaining the different endodontic treatments."}
+{"text": "Physalis alkekengi L. calyx (PC) extract can relieve insulin resistance and has glycemic and anti-inflammatory effects; however, the potential mechanisms related to gut microbiota and metabolites remain elusive. This study aimed to understand how PC regulates gut microbiota and metabolites to exert anti-obesogenic effects and relieve insulin resistance. In this study, a high-fat high-fructose (HFHF)-diet-induced obesity C57BL/6J male mice model with glycolipid metabolism dysfunction was established, which was supplemented with the aqueous extract of PC daily for 10 weeks. The results showed that the PC supplementation could effectively cure the abnormal lipid metabolism and maintain glucose metabolism homeostasis by regulating the expression of adipose metabolic genes and glucose metabolism genes in the liver, thereby effectively alleviating the inflammatory response. PC treatment also increased the contents of fecal short-chain fatty acids (SCFAs), especially butyric acid. PC extract could restore the HFHF-disrupted diversity of gut microbiota by significantly increasing the relative abundance of Lactobacillus and decreasing those of Romboutsia, Candidatus_Saccharimonas, and Clostridium_sensu_stricto_1. The negative effects of the HFHF diet were ameliorated by PC by regulating multiple metabolic pathways, such as lipid metabolism  and amino acid metabolism (histidine and tryptophan metabolism). Correlation analysis showed that among the obesity parameters, gut microbiota and metabolites are directly and closely related. To sum up, this study suggested that PC treatment exhibited therapeutic effects by regulating the gut microbiota, fecal metabolites, and gene expression in the liver to improve glucose metabolism, modulate adiposity, and reduce inflammation. For the past few years, the dietary structure of people has changed significantly with the improvement of the economic level to a diet rich in processed foods and beverages that are high in energy, fat, and sugar. The changes in dietary structure have resulted in the rapid growth of the global overweight and obesity populations ,2. The lThe liver, as the main organ for lipid metabolism, is an important target organ for obesity. The intake of an HFHF diet increases the burden of liver glycolipid metabolism, causes lipid peroxidation, and affects the normal physiological function of liver and belly cells ,8. MoreoIn recent years, the gut microbiota has attracted the attention of researchers working on metabolic diseases worldwide . The regOral administration is the most important mode to administer traditional Chinese medicine (TCM). After entering the intestine, TCMs are in close contact with intestinal microbiota and mainly manifested by regulating the structure of the gut microbiota or the metabolism of active components in TCM, which is an important mechanism for the pharmacological effects of TCM. Huang-Lian-Jie-Du-Decoction (HLJDD) could ameliorate hyperglycemia and restore the dysbiosis of gut microbiota . Corn siPhysalis alkekengi L. is commonly known as brocade lantern, red girl, etc., and is a perennial plant of the Solanaceae family of herbs. It is a kind of herb resource used both as food and medicine, and diabetes patients often use its calyx as tea to regulate blood glucose in China [in China . Moreovein China ,25,26,27in China . AlthougThe present study aimed to investigate the effects of PC extract on regulating gene expression in glycolipid metabolism as well as the gut microbiota composition and metabolites in feces in HFHF-diet-fed mice. This study might enhance the understanding of how PC exerts anti-obesogenic and insulin-resistance-relieving effects by modulating gut microbiota, fecal metabolites, and glycolipid metabolism gene expression.P. alkekengi was naturally dried and crushed through a 2 mm sieve followed by extraction with distilled water (90 \u00b0C) for 15 min (1:15 w/v), gently stirring, and extraction twice [3 spectrophotometric method, and total phenols measurement using the Folin\u2013Ciocalteu method. The metabolites of the PC extract were analyzed by Beijing BioMarker Technology Co., Ltd. . In total, we detected 1381 metabolites from freeze-drying the extract, and most of them belong to fatty acyls, Carboxylic acids and derivatives, Organooxygen compounds, Prenol lipids and Steroids, and steroid derivatives : in the NC group, the mice were fed with a standard diet, which contain 10% fat by energy; in the HFHF group, the mice were fed with high-fat feed (60% fat by energy) and a high-fructose diet (drinking water supplemented with 30% fructose); and in the PCL and PCH groups, the mice were fed with a high-fat high-fructose diet and administered with PC 300 mg/kg/day (PCL group) and 600 mg/kg/day (PCH group) by gavage every day  and stored at \u221280 \u00b0C for further use.Six-week-old male C57BL/6 mice, weighing 20.0 \u00b1 1.0 g, were purchased from Liaoning Changsheng biotechnology Co., Ltd. . All the animal experiments and procedures were approved by the Ethics Committee of the Laboratory Animal Center, Qiqihar Medical University, Qiqihar, China . All mice were fed by the experimental animal center of Qiqihar Medical University (SYXK (HEI) 2016-001). After one-week acclimatization, a total of 28 mice were divided into four groups randomly (The serum triglyceride (TC), total cholesterol (TG), non-esterified fatty acid (NEFA), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) levels as well as enzymes levels, including alanine aminotransferase (ALT) and aspartate aminotransferase (AST), were measured using an auto-biochemistry analyzer . The levels of inflammatory factor tumor necrosis factor \u03b1 (TNF-a), interleukin-6 (IL-6), interleukin-1\u03b2 (IL-1\u03b2), monocyte chemotactic protein-1 (MCP-1), lipopolysaccharide (LPS), and serum fasting insulin (FINS) were detected by using an ELISA kit .The mice were fasted overnight for 12 h prior to the oral glucose tolerance test (OGTT). A 2 g/kg glucose solution was intragastrically administered, and the tail venous blood was taken after 0, 30, 60, and 120 min of the intragastric administration, using a blood glucose meter . A line graph was drawn using the obtained blood glucose concentration as the vertical coordinate and the corresponding measurement time as the horizontal coordinate, and the area under the curve (AUC) was calculated using the trapezoid rule [The mice liver and adipose tissues were dissected, extracted, and then fixed with 4% paraformaldehyde. After fixation, the tissue sections were stained with hematoxylin and eosin (H&E), and the structure of liver and adipose tissues was observed and analyzed under an optical microscope .Trans Start\u00ae Top Green qPCR SuperMix  using the ABI 7500 Fast Dx PCR instrument . The relative expression levels of the quantitative genes were identified using the 2\u2212\u0394\u0394Ct method, with the \u03b2-actin set as the reference gene and the NC group as the control. The primer sequences are listed in Total RNA was extracted from the liver tissues using a Biozol reagent , as described previously . The cong for 10 min, 800 \u03bcL of the supernatant was taken, and the same amount of ethyl acetate was added for extraction, shaken, mixed for 22 min, and centrifuged at 14,000\u00d7 g for 10 min. The upper organic phase of 600 \u03bcL was mixed with 4-methylvaleric acid  as an internal standard and then added into the injection bottle for GC-MS detection. The injection volume was 1 \u03bcL, and the split ratio was 10:1. MSD ChemStation software was used to extract chromatographic peak areas and retention times. The standard curve was drawn to calculate the SCFAs in the sample [The determination of SCFAs  was performed using gas chromatography (GC) by Shanghai Personalbio Technology Co., Ltd. . First, the contents of fecal samples were collected, samples were thawed on ice, and 30 mg of the sample was placed in a 2 mL glass centrifuge tube. Then, 900 \u03bcL 0.5% phosphoric acid was added and resuspended, and the mixture was shaken for 2 min. After centrifugation at 14,000\u00d7 e sample .\u00ae DNA Isolation Kit , followed by the amplification and sequencing of hypervariable V3-V4 region in the 16S rRNA gene using the Illumina Novaseq 6000 platform by Beijing Bio Marker Technology Co., Ltd. . The detailed analysis methods are described in a previous study [Total genomic DNA was extracted from the fecal samples using the MOBIO PowerSoilus study . USEARCHus study . Then, tus study . LEfSe . The analysis mainly included thawing, grinding, extraction, vacuum drying of fecal samples, etc. The detailed steps are following the reference and our previous study ,36 and ip < 0.05 and determined with one-way ANOVA by using the Tukey\u2013Kramer post hoc test. The results were expressed as mean \u00b1 SD. The correlations found among variables were identified by Pearson\u2019s product-moment correlation coefficient. Statistical tests were performed using R software (Version 4.2.1) for Windows.Among different groups, statistical significance was set at p < 0.05). There were no differences in the daily food intake by mice among the four groups, showing that the suppressed body weight effect of PC did not come from the reduction in food consumption (p > 0.05). Consistently, the PC administration reduced the weights of liver and subcutaneous tissues as compared to those in the HFHF group. Moreover, the high-dose administration of PC also significantly reduced the weight of epididymal tissue (p < 0.01); however, the weight of kidneys did not change among the four groups (p > 0.05). H&E staining showed that the PC treatment significantly reduced the cell diameter of adipocytes . The OGTT showed that the oral glucose tolerance of the HFHF group mice was lower than that of the NC group mice, with a significantly increased AUC value (p < 0.01). Consistently, the PC administration significantly prevented the HFHF-induced impairment of OGTT. Obesity, caused by a high-fat and high-fructose diet, is also closely related to insulin resistance. As compared to the NC group, the FINS level increased significantly in the HFHF group, which was indicated by a significant increase in the HOMA-IR index and a significant decrease in the HOMA-IS index. The PC supplementation for 10 weeks significantly prevented these adverse changes, leading to a decrease in the FINS level and HOMA-IR index and a significant increase in HOMA-IS index (p < 0.05) in the PCL and PCH groups as compared to those in the HFHF group.After the 10-week experimental period, OGTT was used to evaluate glucose homeostasis . The resObesity is usually accompanied by fat accumulation and elevated blood lipids. As shown in p < 0.01). The high-dose PC supplements effectively prevented HFHF-induced liver damage by ameliorating the serum AST and ALT levels as compared to those in the HFHF group (p < 0.01); however, we did not observe significant changes in ALT levels between HFHF and PCL groups. H&E staining also showed that the PC treatment reduced the ballooning degeneration in the liver significantly . The expression levels of fatty acid oxidation genes, such as Ppar\u03b1, Cpt1\u03b1, and Acox1 significantly increased in the PCH group as compared to those in the HFHF group (p < 0.05).In order to further explore the effects of PC on glycolipid metabolism in the liver were investigated. As compared to NC, the expression levels of lipid synthesis genes A, includG6Pase and PEPCK) in the liver were determined , while that of IL-6 showed no significant changes (p > 0.05). Under the HFHF diet, the PC supplement could significantly reduce the serum levels of TNF-\u03b1, IL-1\u03b2, and MCP-1 as compared to HFHF-induced mice, and the effects of the PCH group were better than those of the PCL group. Moreover, HFHF significantly increased the mRNA expression levels of TNF-\u03b1, IL-1\u03b2, IL-6, and MCP-1 in liver tissues as compared to those in the NC group (p > 0.05). The PC supplementation significantly reduced the serum level of LPS in HFD-induced mice in a dose-dependent manner  and obtained 58,954 clean reads per sample on average. The Chao1, Shannon, and Simpson indices were measured to evaluate the effect of PC on gut microbiota community richness and microbial evenness (p > 0.05); this decrease was reversed by PC supplementation in the PCH group (p < 0.05). This indicated that PC could restore the HFHF-induced low diversity of gut microbiota.The V3-V4 hypervariable region of the 16S rRNA gene was sequenced on an Illumina MiSeq platform to assess the effects of PC on the gut microbiota composition. A total of 1,650,700 clean reads were detected after quality filtering in the 28 samples . As compared to the HFHF group, the genus unclassified_Muribaculaceae was more enriched in the PCH groups, and the genus Lactobacillus was more enriched in the NC and PCH groups. LEfSe analysis showed PCH group enrichment in unclassified_Muribaculaceae, whereas the HFHF group was enriched in Clostridium_sensu_stricto_1  and butyric acid (BA), which belonged to SCFAs. Lactobacillus showed a negative correlation with the parameters of glycolipid metabolism and inflammation except for FINS and serum TG as well as a significant positive correlation with BA.The altered glycolipid metabolism and inflammation index might reflect the functions of the gut microbiota. Therefore, the functional correlations were explored between significantly differential bacteria at the genus level and obesity parameters associated with glucolipid metabolism and inflammation D. The reUntargeted fecal metabolomic analysis based on the LC-QTOF platform and qualitative and quantitative metabolomic analysis were performed on 28 samples. A total of 10,230 peaks were detected in the positive ionization mode, among which 2417 metabolites were noted, and 10,291 peaks were detected in the negative ionization mode, among which 2025 metabolites were noted. To investigate the fecal metabolite differences among NC, HFHF, PCL, and PCH groups in mice, PCA and OPLS-DA were performed . The PCAp < 0.05, and fold change (FC) \u2265 2 was significantly altered by PC  was used to annotate and classify the differential metabolites. . The resCandidatus_Saccharimonas, Romboutsia, Clostridium_sensu_stricto_1, and Monoglobus were positively correlated with pregnenolone, pregnenolone sulfate, 19-hydroxyandrost-4-ene-3,17-dione, and glycerophosphocholine and negatively correlated with GlcCer (d18:1/16:0).Gut microbiota and metabolites are closely correlated. These correlations were explored using Spearman\u2019s correlation analysis and screened using volcano plots . The resp < 0.05). This further confirmed that hyperlipidemia and hyperglycemia could decrease SCFA production, which could be reversed by PC supplementation. Prasteron-sulfate, GlcCer (d18:1/16:0), 9-hydroxylinoleic_acid, 13(S)-HpoDE, 9(S)-HpODE, and 9,10-DiHOME, belonging to glycolipid metabolites, were strongly negatively correlated with glycolipid metabolism indices and immune factors in serum . Among them, GlcCer (d18:1/16:0) was strongly negatively correlated with Candidatus_Saccharimonas, Clostridium_sensu_stricto_1, and Monoglobus, which were positively correlated with parameters of glycolipid metabolic indices in serum. These results indicated that the HFHF-induced disturbance of serum glucose and lipid metabolism is closely related to gut microbiota and metabolites.There were multiple correlations among the serum indices, gut microbiota, and metabolites . All serAlthough it has been reported that PC has the functions of lowering blood pressure as well as anti-inflammatory, anti-tumor, and hypoglycemic activities , the effHyperlipidemia is the most common risk factor for cardiovascular and cerebrovascular diseases and is closely related to the intake of a high-fat diet . Animal FAS), acetyl-coA carboxylase 1 (ACC1), and stearoyl CoA desaturase (SCD) are the key enzymes in natural fatty acid synthesis [FAS and ACC1 in the liver and increase the lipid synthesis load in the liver as well as significantly increase the levels of TG and LDL-C [FAS, ACC1, and SCD1 in the liver. As compared to the HFHF model group, the PC supplementation also significantly downregulated the expression levels of the SREBP-1c gene. SREBP-1c mainly regulates genes related to triglyceride and fatty acid synthesis, such as ACC and SCD1 [SREBP-1c can also inhibit the transcription of insulin receptor substrate-2 (IRS-2), thereby exacerbating insulin resistance; this suggested that it might have a negative regulatory effect on insulin signaling [ChREBP\u03b1 is a transcription factor in the glucose signaling pathway, which plays an important role in regulating glucose metabolism [SREBP-1c to regulate the expression of glycolysis and fatty acid synthetase genes. In this study, the PC supplementation significantly reduced the ChREBP\u03b1 gene expression, inhibited lipid synthesis, and regulated abnormal glucose metabolism.De novo lipid (DNL) synthesis refers to the conversion of dietary glucose into fatty acids, which further synthesize TG . The livynthesis . A high-nd LDL-C ,48. The and SCD1 . Recent ignaling ,51. ChREtabolism , fat mettabolism . It actsPPAR\u03b1 plays a key role in regulating lipid metabolism, glucose homeostasis, and the anti-inflammatory response, and the upregulation of PPAR\u03b1 expression at the mRNA level could increase fatty acid catabolism and decrease fat mass, thus decreasing TG and LDL-C levels in the liver [Cpt1\u03b1 was the target gene of the PPAR\u03b1-mediated fatty acid oxidation pathway, and the Acox1 gene is a key enzyme in the peroxisome oxidation pathway. A high-fat diet can reduce the expressions of PPAR\u03b1, Cpt1\u03b1, and Acox1 genes in the liver of model group mice, indicating that the lipid oxidative metabolism pathway of non-alcoholic fatty liver mice was blocked by a high-fat diet [Fatty acid oxidation metabolism in the liver is another important pathway affecting the formation of a fatty liver. he liver ,54. Cpt1fat diet . PC suppPEPCK) and glucose-6-phosphatase (G6Pase), in mice liver were determined in this study. The deficiency of these major enzymes in T2DM resulted in the dysregulation of glucose homeostasis [G6Pase and PEPCK in mice liver were significantly downregulated in the PC treatment, which might play an important role in inhibiting liver gluconeogenesis.To verify the effects of PC on glucose homeostasis in HFHF-fed mice and reveal the mechanism of PC on improving insulin resistance, the expression levels of two gluconeogen-related genes, phosphoenolpyruvate carboxykinase  and was positively correlated with the IL-10, TNF-\u03b1, and IFN-\u03b3 levels. The current study demonstrated that the relative abundance of Monoglobus significantly decreased in PC treatment and was positively correlated with the level of proinflammatory factors. A previous study showed that Monoglobus might have a protective effect on chronic kidney disease [Monoglobus on the host under the disease state requires further clarification. In addition, the PC supplementation also significantly increased the abundance of Lactobacillus. According to previous studies, a high-fat diet could significantly decrease the abundance of Lactobacillus, which was closely related to the level of lipid metabolism. The correlation analysis of gut microbiota and related physiological and biochemical indicators in this study indicated that the relative abundance of Lactobacillus was negatively correlated to related lipid metabolic disorder indicators, and it also inhibits chronic inflammation and the exacerbation of hyperglycemia. To a certain extent, these results indicated that PC could improve the richness of probiotics in the gut microbiota of obese mice.Previous studies have demonstrated a causal relationship between gut microbiota regulation and glycolipid metabolism homeostasis. Our study found that PC supplementation could significantly reduce the relative abundance of harmful gut microbiota. nteritis ,67,68. Tg et al. . reporte disease . TherefoThe alteration of gut microbiota composition is always accompanied by significant functional alteration and unavoidably leads to alteration in the metabolites in the gut. Fecal metabolites are the key linkage between gut microbiota and host health. In order to explore the important metabolites involved in the beneficial effects of PC extract, the changes in metabolite profile and metabolic pathways were analyzed using fecal samples. The PLS-DA analysis and volcano plot suggested that the PC supplementation could regulate the metabolic profiles of the mice. Using KEGG enrichment analysis, it was found that the metabolic pathways with the highest enrichment in PC groups were mainly involved in lipid metabolism  and amino acid metabolism pathways (histidine metabolism and tryptophan metabolism). Studies have shown that histidine can promote lipid reduction, increase insulin sensitivity, and reduce the levels of systemic inflammatory markers in plasma , while tThe PC treatment could also regulate glycerophospholipid metabolism and steroid hormone biosynthesis. Glycerophospholipids are the main components of biological membranes and have significant implications for cellular functions; moreover, they are also closely related to the immune system . As a prRecently, metabolomic changes in fecal samples are related to the gut microbiota , especiaIn conclusion, this study concluded that the dietary supplementation of PC could improve the altered host metabolic homeostasis and play a role in beneficial activities against systemic inflammation. The PC treatment not only significantly altered the composition of gut microbiota but also the fecal metabolites. In subsequent studies, regulating the gut microbiota and their related metabolites can be used as a new entry point to study the mechanism of PC. As a medicine and food item, PC has great potential in the treatment and prevention of glucose and lipid metabolism disorders and their complications."}
+{"text": "At T0, diagnostic workup was completed for all patients and 7/17 (41.2%) axSpA patients presented with a clinically important improvement or were in remission. 34/36 (94.4%) patients completed at least 80% of the ePROs between T-1 and T0. Electronic and paper-administered BASDAI correlated well (r\u2009=\u20090.8 p\u2009<\u20090.0001). Student-led clinics and ePROs were well accepted by patients with NPS scores of\u2009+\u200962.0% (mean\u2009\u00b1\u2009SD 9.2/10.0\u2009\u00b1\u20090.9) and\u2009+\u200930.5% (mean\u2009\u00b1\u2009SD 8.0/10.0\u2009\u00b1\u20091.7), respectively. In conclusion, student-led clinics and ePRO monitoring were well accepted, accelerated diagnostic workup and treatment in patients with axSpA.We aimed to investigate (1) student-led clinics and (2) electronic patient-reported outcomes (ePROs) to accelerate diagnosis and treatment of patients with axial spondyloarthritis (axSpA). Patients with suspected axSpA completed an initial student-led clinic visit (T-1) prior to their planned actual rheumatologist visit (T0). Acceleration of patient appointment and NSAID therapy start, availability of diagnostic findings, and treatment response at T0 were evaluated. Beginning at T-1, patients completed electronic BASDAI questionnaires every 2\u00a0weeks. Concordance of paper-based and electronic BASDAI was evaluated. Patient acceptance of ePRO reporting and student-led clinics was measured using the net promoter score (NPS). 17/36 (47.2%) included patients were diagnosed with axSpA. Student-led clinics (T-1) significantly accelerated patient appointments by more than 2\u00a0months (T0, T-1, The online version contains supplementary material available at 10.1007/s00296-023-05392-5. Axial Spondyloarthritis (axSpA) is one of the more common inflammatory rheumatic diseases with an estimated prevalence of 0.3\u20131.4% . DespiteAs a rapid expansion of the rheumatology workforce seems unlikely, innovative new health care strategies are needed. Delegation of tasks and implementation of telehealth are being increasingly discussed and adopted as two main methods to counteract the workforce shortage . DelegatElectronic patient-reported outcomes (ePROs) enable a flexible and yet standardized disease monitoring. A recent study reported a higher adherence in axSpA patients with high disease activity and a decline after time, suggesting that especially newly diagnosed patients would be motivated to adhere. With regard to the recommended initial therapy with NSAIDS , ePRO moOur study aimed to investigate two innovative health services, including (1) the implementation of student-led clinics and (2) electronic patient-reported outcomes to accelerate diagnosis and treatment of patients with axial spondyloarthritis (axSpA).Erlangen-N\u00fcrnberg, Germany  (21\u2013357-B) and conducted in compliance with the Declaration of Helsinki. During the recruitment period (October 2021\u2013July 2022), patients referred by their (primary care) physician for rheumatologic evaluation due to the leading symptom chronic low back pain for at least 3\u00a0months and suspected axSpA were recruited. Further inclusion criteria were a minimum age of 18\u00a0years, sufficient language skills, and regular usage of a smartphone. Exclusion criteria were a known diagnosis, a previous rheumatologist appointment and unwillingness or inability to comply with the protocol. All study patients provided written informed consent prior to study participation.This prospective study was approved by the institutional review board (IRB) of the Medical Faculty of the University of Patients completed the student-led appointment (T-1) with one medical student trained for this purpose, prior to the routine rheumatology appointment (T0). Availability of medical findings was assessed at T-1 and at the actual visit with the rheumatologist (T0). Additionally, patients installed a medical app to answer disease activity questionnaires and answered a questionnaire regarding diagnostic delay. Patient acceptance was measured using the net promoter score  (NPS), wA medical student independently studied axSpA disease and shadowed rheumatology residents in dedicated axSpA clinics to learn how to carry out a standardized evaluation and axSpA diagnosis. The student then documented the medical history in a standardized fashion, performed a standardized physical examination at T-1, and was given access to laboratory and imaging results once available. After each diagnostic step, the student had to state if axSpA was present or not (yes/no). Results were compared to the final diagnosis reported on the discharge summary report. A rheumatology resident reviewed the results and discussed next steps  with the patient and student.At T-1, a medical app (ABATON) was installed on the patient\u2019s smartphone and patients were asked to complete the Bath Ankylosing Spondylitis Disease Activity Index (BASDAI)  electron for interval data and as absolute (n) and relative frequency (percent) for nominal data. Statistical differences were assessed by Mann\u2013Whitney U test, Kruskal\u2013Wallis test with Dunn\u2019s test for multiple comparisons, Spearman correlation analysis (rs), and Fisher's exact test for categorial variables. Results were reported following the STAndards for the Reporting of Diagnostic accuracy studies guideline [No formal sample size calculation was performed due to the exploratory character of the trial. Following recommendations for pilot studies , the numuideline . Diagnos17/36 (47.2%) of patients were diagnosed with axSpA. Three patients were lost to follow up due to missed appointments and one patient refused to participate. Baseline patient characteristics are shown in Table At T-1, CRP level had not been assessed in 19/36 (53%) patients, and no sacroiliac joint X-ray and lumbar/sacroiliac MRI scan was available in 31/36 (86%) and 16/36 (44%) patients, respectively  days (IQR); see Table Only a minority of patients .34/36 (94.4%) patients completed at least 80% of the ePROs between T-1 and T0 enabling remote monitoring of disease activity and therapeutic response. Electronic and paper-administered BASDAI correlated well at T0 (r\u2009=\u20090.8 Patient acceptance was high for the student-led clinic and ePRO monitoring with a NPS of\u2009+\u200962% (mean\u2009\u00b1\u2009SD 9.2\u2009\u00b1\u20090.9) and\u2009+\u200930.5% (mean\u2009\u00b1\u2009SD 8.0\u2009\u00b1\u20091.7), respectively, online supplemental material S3.To our knowledge, this is the first study to examine the added value of student-led clinics and ePROs to accelerate diagnostic workup and treatment in patients with suspected axSpA. Due to the implementation of student-led clinics, patient appointments could be accelerated by more than 2\u00a0months, so that all diagnostic workup was complete at the actual rheumatologist visit and some patients already reached the goal of clinical remission. Importantly, patients showed great acceptance and also rheumatologists enjoyed the concept as student-led clinics also drastically reduced their consultation workload. Importantly, the medical student gained valuable clinical experience. The task of a sequential diagnosis  further supported critical diagnostic thinking. The general increase in diagnostic accuracy with additional information available supports a previous study by Ehrenstein et al. , that alEarly implementation of ePROs enabled remote, yet standardized assessment of a therapeutic response and importantly timely change of treatment. The concordance of paper-based and electronic BASDAI and high adherence of ePRO monitoring in patients with high disease activity is in line with the previous work . To ensuThe small sample size and monocentric nature of the study are clear limitations. The individual student and app used for ePROs likely had a great impact on patient acceptance. The results should, therefore, be confirmed in larger studies at other centers, with different personnel and apps. The general concept could be rolled out to other diseases.The need for innovative rheumatology health service strategies is imminent. Implementation of student-led clinics and asynchronous telehealth services, such as ePROs, could contribute to accelerate diagnosis and more efficient use of limited healthcare resources. Analysis of cost-effectiveness and safety will be essential for wider implementation. Additionally, work load reduction and acceptance of physicians should be evaluated in future studies.Supplementary file1 (TIF 209 KB)Supplementary file2 (TIF 105 KB)Supplementary file3 (TIF 52 KB)Below is the link to the electronic supplementary material."}
+{"text": "BackgroundCytochrome P450 system is implicated in vascular pathologies, including stroke. Besides its role as a drug metabolizer, it also plays an important role in the metabolism of several endogenous substances like fatty acids, arachidonic acid, etc., which have pro-inflammatory effects. On the other hand, leptin and adiponectin are two of the most common adipose tissue-derived cytokines (adipokines), which are pro-inflammatory and\u00a0anti-inflammatory in nature,\u00a0respectively. Both of them are implicated in the pathogenesis of stroke.MethodsWe prospectively recruited ischemic stroke patients (within three months of occurrence of an attack of stroke). The occurrence of composite outcome (recurrence of transient ischemic attack/ischemic stroke or death)\u00a0was evaluated for association with genetic variants of CYP2C19  1/2/3/4, identified using TaqMan assays and DNA sequencing). Adiponectin and leptin levels were\u00a0determined using\u00a0an enzyme-linked immunosorbent assay. Comparisons were made between\u00a0stroke vs. control patients and between CYP2C19 intermediate metabolizer (IM)/poor metabolizer (PM) vs. extensive metabolizer (EM)/ultra metabolizer (UM) . P < 0.05 was taken as the threshold for statistical significance.ResultsA total of 204 patients and 101 controls were recruited. With regard\u00a0to the occurrence of stroke, SNP2 showed a significant positive association. Haplotypes (SNP1/SNP2) AC (OR = 1.75 (1.08-2.83), p\u00a0= 0.024) and GT (OR = 3.33 (1.53-7.22), p = 0.0026) were strongly associated with the occurrence of ischemic stroke even after adjustment for age and sex . Haplotype phenotype gender interaction was evident. Among stroke patients, with regard\u00a0to composite outcome, only SNP1 showed a positive association. The AC haplotype was significantly associated with the occurrence of composite outcome (OR = 2.27 (1.17-4.41), p = 0.016). Among stroke patients, a significant positive association was seen between death and SNP1 (OR = 2.35 (1.13-4.90), p = 0.021) and AC haplotype (OR = 2.73 (1.20-6.22), p = 0.018). However, none of the SNPs or haplotypes showed any association with recurrence.Significant higher leptin and lower adiponectin levels were observed among stroke patients compared to controls.\u00a0Leptin levels were higher in IM/PM group. IM/PM phenotypes showed a higher incidence of occurrence of composite outcome (hazard ratio = 2.07 (0.96-4.47), p = 0.056).ConclusionCYP2C19 polymorphisms may play a significant role in the pathogenesis of stroke. Leptin could serve as a prominent biomarker of atherosclerosis and inflammation in the early post-stroke period; however, further study is warranted with a larger sample size. The incidence of stroke is increasing globally. Expected global deaths due to stroke are expected to increase to over 7.8 million by 2030 and produce an immense health burden in the absence of a substantial global public health response . In IndiAtherosclerosis and thrombosis are two main processes involved in the pathogenesis of ischemic strokes. Inflammation is one of the major underlying mechanisms for the occurrence of atherosclerosis . AdipocyThe cytochrome P450 (CYP) system is a large group of enzymes expressed predominantly in the liver and majorly responsible for drug metabolism. Besides metabolizing, some enzymes of CYP\u00a0are also involved in the modulation of vascular flow and metabolism of several endogenous substances, such as fatty acids and cholesterol, including arachidonic acid, which has pro-inflammatory effects -9. CYP2CPrimary objectivesThe primary objectives were as follows: (1)\u00a0to study the dysregulation of adipocytokines  in ischemic stroke patients; (2)\u00a0to study the association between polymorphisms in CYP2C19 system and occurrence of stroke; (3) to evaluate the association between polymorphisms in CYP2C19 system and occurrence of the composite outcome of recurrence of transient ischemic attack (TIA)/stroke and death.Secondary outcomesThe secondary objectives were as follows: (1)\u00a0to evaluate the association between polymorphisms in the CYP2C19 system and the occurrence of the final outcome (live vs. death); (2)\u00a0to evaluate the association between polymorphisms in the CYP2C19 system and recurrence of TIA/ischemic stroke among live patients; (3)\u00a0to study the impact of CYP2C19 polymorphisms , allele *3 (rs4986893), allele *4 (rs28399504), and allele *17 (rs12248560)) on the production of adipocytokines production; (4)\u00a0to study the effect of adipocytokines  levels on clinical outcome (occurrence of stroke); (5)\u00a0to study the level of adipocytokines  among poor metabolizer (PM)/intermediate\u00a0metabolizer (IM) and extensive metabolizer (EM)/ultra metabolizer (UM).Definition of composite clinical outcomeIn our study, the composite outcome was defined as the composite of the occurrence of any of the following events: death, recurrent TIAs, or ischemic events.Subject selectionA prospective study was carried out on ischemic stroke/TIA patients who presented within three months of an attack. The patients were recruited from indoor/outdoor patient services of the Postgraduate Institute of Medical Education and Research,\u00a0Chandigarh, India.Study populationRegarding the inclusion of cases, we included patients \u2265 18 years of age of either gender presenting with TIA or ischemic stroke occurring within the last three months  and who were on\u00a0secondary prophylaxis for stroke with either clopidogrel or clopidogrel and aspirin. We excluded patients with intracranial hemorrhagic stroke, cardioembolic stroke, and non-atherosclerotic stroke, e.g., dissection and vasculitis. Patients with chronic disease, cancer, collagen vascular disease, HIV, congestive cardiac failure, pregnancy, and contrast allergy were also excluded.Control groupAge and sex-matched unrelated controls without any history of stroke and who were not taking any anti-inflammatory drug at least for 14 days were enrolled.Follow upThe TOAST  criteria [Clinical data collectionAll data collected were assessed by two neurologists separately in a blinded manner. The standard criteria followed for the assessment of hypertension, diabetes mellitus, smoking, and obesity have been mentioned in a previous report by Gairolla et al. .Sample collection and genotypingFive milliliters of whole blood was collected from each patient in ethylenediaminetetraacetic acid (EDTA) and sodium (Na)-heparin vials. DNA extraction was performed in an EDTA sample using PureLink Genomic DNA Kit . Genetic variants of CYP2C19 , allele *3 (rs4986893), allele *4 (rs28399504), and allele *17 (rs12248560)) were genotyped using TaqMan-based single nucleotide polymorphism (SNP) genotyping assays on real-time polymerase chain reaction (PCR) machine  as per manufacturer guidelines (Supplementary Table A1). Five microliters of TaqMan universal PCR master and DNA range from 5 to 25 ng were added to the final volume of 10 \u03bcl (Supplementary Table A2). PCR data were analyzed using StepOne software version 2.2.2. DNA sequencing for CYP2C19*3  was performed in randomly selected samples.Adipocytokine measurement Estimation of adipocytokines levels (leptin (Cat. # DLP00) and total adiponectin (Cat. # DRP 300)) was carried out in plasma sample pull out from sodium (Na)-heparin blood using quantitative enzyme-linked immunosorbent immunoassay technique purchased from R&D Systems . Plasma levels of leptin and total adiponectin (n = 204) were compared between patients (n = 204) and healthy controls (n = 50). A linearity curve was prepared for the calculation of plasma concentration using a linear equation model. Sensitivity for leptin and total adiponectin were less than 7.8 pg/ml and 0.246 ng/ml, respectively. Intra-assay variation (coefficient of variation) for leptin (1 ng/ml) and total adiponectin (125 ng/ml) was 8.6% and 14.1%, respectively.Ethical permissionInformed consent was signed by all recruited patients after ethical approval was obtained from the Institutional Ethical Committee (IEC), Postgraduate Institute of Medical Education and Research. The IEC approved the study .Sample sizeThe sample size was calculated on the basis of the genetic frequency of CYP2C19 allele *2 in the Indian population keeping 29% as frequency and confidence limits at 7%. A minimum sample size of 162 (95% CI) patients is required to accomplish the study objectives. While calculating the sample size, we followed the guideline of the Department of Biotechnology,\u00a0India. We recruited 101 healthy controls and 204 stroke patients for the\u00a0study.Statistical analysiswww.cypalleles.ki.se) [Categorical variables are expressed as percentages (%) and continuous variables, which are not normally distributed, are described in the median with interquartile range (IQR), and a non-parametric test (Mann-Whitney test) was done to determine the significance. Any deviation of allelic and genotype distribution from Hardy-Weinberg equilibrium (HWE) proportions was tested using \u03c72 or Fisher's exact test. Cox regression and survival analysis with Kaplan-Meier curves were applied to calculate the hazard ratio and cumulative event-free survival. Multivariable Cox regression analysis was done in variables that were statistically significant in univariate analysis. For base numbering and allele definitions of CYP2C, we followed the nomenclature of the Human Cytochrome P450 (CYP) Allele Nomenclature Committee (s.ki.se) . The genPoor/intermediate metabolizers and extensive/ultra metabolizers with CYP2C19 function descriptionBased on CYP2C19 genotypes , allele *3 (rs4986893), allele *4 (rs28399504), and allele *17 rs12248560)), patients were categorized into two groups as poor/intermediate metabolizers  and extensive/ultra metabolizers  [248560), The wild-type CYP2C19*1 allele is associated with functional CYP2C19-mediated metabolism. The most common CYP2C19 loss-of-function (LOF) allele is *2 . Other CYP2C19 variant alleles with reduced or absent enzymatic activity have been identified  . The CYPDemographic and clinical characteristics of the patientsA total of 204 patients with ischemic stroke/TIAs were enrolled from May 2013 to September 2018. The mean age (SD) of stroke patients was 57 \u00b1 13 years and 156 (76.5%)\u00a0patients were male. Of the patients,\u00a0184 (90.2%) had an ischemic stroke. A total of 133 (65.2%) patients had a history of hypertension and 60 (29.4%) were smokers. Of the patients,\u00a066 (32.4%) had diabetes mellitus and 28 (13.7%) had obesity. A family history of stroke was present in 12.7% of patients  (%) of CYP2C19*2  and CYP2C19*17  was 34.5% and 21.5%, respectively. Mutant and heterozygous variants of CYP2C19*3  and *4  alleles were not reported. All reported alleles and genotypes were in HWE (p > 0.05). No compound heterozygous of CYP2C19 (*2/*17) was reported. The observed genotype frequencies are mentioned in Table Impact of SNP on the occurrence of stroke: stroke vs. no stroke (control)Stroke vs. No Stroke (Control): Allelic Frequency, Genotype Frequency, and Hardy-Weinberg EquilibriumThe details of allelic and genotype frequencies of HWE\u00a0p-values of SNP1 and SNP2 are shown in Table Stroke vs. No Stroke (Control): Genetic AssociationRegarding CYP genotypes as predictors for the occurrence of stroke, we used different genetic models for the association studies. The models were decided on the basis of the Akaike information criterion (AIC) and Bayes information criterion (BIC) values of that respective model. No significant association was observed between the occurrence of stroke and SNP1.In the case of SNP2, the lowest AIC value was 385.9 and the lowest BIC value was 401.2. The models performing within two units of this lowest AIC and BIC value were recessive and the log additive model. Interestingly, SNP2 showed a significant positive association with the occurrence of stroke in both of these two models. Data are presented in Table Occurrence of Stroke: Sex and SNP Covariate InteractionTo evaluate the impact of age and sex, we further evaluated the association in the light of multivariate analysis. When adjusted by age, no significant interaction was seen between SNP and sex with the occurrence of stroke. Data are presented in Tables Haplotype Association With StrokeThe AC haplotype (OR = 1.75 1.08-2.83), p = 0.024) and GT haplotype (OR = 3.33 (1.53-7.22), p = 0.0026) were found to be strongly associated with the occurrence of stroke . Data are presented in Table -2.83, p Among females, the haplotype phenotype interaction was not observed; however, haplotype phenotype interaction was evident among males Table , and comStroke patients: composite outcomeAllelic Frequency, Genotype Frequency, and HWE Among Stroke Patients With Respect to the Occurrence of Composite OutcomeThe details of allelic and genotype frequencies of HWE\u00a0p-values of SNP1 to SNP4 with reference to the occurrence of composite outcomes among stroke patients are shown in Table All Stroke Patients: Genetic Association Data SNP1: Among stroke patients, while evaluating the association between SNP and occurrence of the composite outcome, the best-performing models in terms of lowest AIC and BIC score were the dominant model (2.31 (0.99-5.35), p = 0.043) and log-additive model (1.82 (1.02-3.27), p = 0.042). Interestingly, both these models showed a positive association between SNP1 and the occurrence of composite outcomes. Data are presented in Table SNP2: The best-performing model in terms of AIC and BIC is the dominant model. However, no association was seen between SNP2 and the occurrence of composite outcomes. Data are presented in Table Occurrence of Composite Outcome: Sex and SNP Covariate InteractionIn terms of the occurrence of composite outcome and the impact of the important covariate (sex), no significant impact of sex was observed on the occurrence of the composite outcome. Data are presented in Tables Haplotype Association With the Composite OutcomeWhile evaluating the different haplotypes of SNP1 and SNP2 and their association with the occurrence of composite outcomes, the AC haplotype was significantly associated with the occurrence of the primary outcome (OR = 2.27 (1.17-4.41), p = 0.016, global haplotype association p-value: 0.044). Data are presented in Table While evaluating the interaction between haplotypes, composite outcome, and impact of the important\u00a0covariate\u00a0(sex), no significant covariate effect was observed after adjusting for age. Data are presented in Table All stroke patients: dead vs. aliveAll Stroke Patients: Alive vs. Dead: Allelic Frequency, Genotype Frequency, and HWEThe details of allelic and genotype frequencies of HWE p-values of SNP1 to SNP2 with reference to the occurrence of the final outcome  among stroke patients are shown in Table All Stroke Patients: Alive vs. Dead: Genetic Association DataWe evaluated the impact of different SNPs and the occurrence of final outcomes  among stroke patients using different models of genetic analysis.SNP1: On the basis of AIC and BIC values, the best model was the log-additive model. A significant positive association was seen between the occurrence of the final outcome (death) and SNP1 (OR = 2.35 (1.13-4.90), p = 0.021). Data are presented in Table SNP2: On the basis of AIC and BIC values, the best model was the log-additive model. No association was seen between the occurrence of the\u00a0final outcome (death) and SNP2 (OR = 0.53 (0.20-1.45), p = 0.19). Data are presented in Table All Stroke Patients: Alive vs. Dead: Sex and SNP Covariate InteractionWhile evaluating for any covariate effect for the important covariate\u00a0(sex), no significant association was seen after adjustment for sex. Data are presented in Tables Haplotype Association With Final Outcome (Alive vs. Dead)Among different haplotypes, the AC haplotype was found to be associated with death (OR = 2.73 1.20-6.22), p = 0.018, global haplotype association p-value: 0.039). Data are presented in Table -6.22, p No significant interaction was seen between the occurrence of the final\u00a0outcome, haplotype, and sex (after adjustment by age). Data are shown in Supplementary Table\u00a0A3.All alive stroke patients: recurrence vs. no recurrenceAllelic Frequency, Genotype Frequency, and HWE: All Alive Patients: No Recurrence vs. RecurrenceThe details of allelic\u00a0and genotype frequencies of HWE\u00a0p-values of SNP1 to SNP2 with reference to the recurrence of stroke are shown in Supplementary Table\u00a0A4.All Alive Patients: No Recurrence vs. Recurrence: Genetic Association DataWe evaluated the impact of different SNPs and the occurrence of final outcomes  among stroke patients using different models of genetic analysis.SNP1: On the basis of AIC and BIC values, the best model was the recessive model. However, no association was seen with recurrence (OR = 0.38 (0.10-1.40), 0.12). Data are shown in Supplementary Table\u00a0A5.SNP2: On the basis of AIC and BIC values, the best model was the over-dominant model. No association was seen between recurrence and SNP2 (OR = 0.83 (0.44-1.59), p = 0.58). Data are shown in Supplementary Table\u00a0A5.No significant interaction was seen in the case of both SNP1 and SNP2 and the important covariate\u00a0(sex) after adjustment of age. Data are shown in Supplementary Tables A6\u00a0and A7.All Alive Stroke Patients: No Recurrence vs. Recurrence: Haplotype AssociationAmong alive patients, no significant association was seen between any of the haplotypes and recurrence. Data are shown in Supplementary Table A8.\u00a0No significant covariate effect of sex was observed after adjustment for age. Data are shown in Supplementary Table A9.Adipokine and leptin levels and their association with strokeAdipocytokine Levels Between Stroke Patients and ControlsSignificant differences in leptin (ng/ml) (median (IQR) = 6.6 2.4-16.2) vs. 4.8 (1.8-8.5), p = 0.039)\u00a0and total adiponectin levels (\u00b5g/ml) (median IQR = 3.6 (1.9-6.4) vs. 5.9 (1.9-14.5), p = 0.027) were observed between patients and controls  of IM/PM was 57.8 (118). After comparing adipocytokines levels between IM/PM and EM/UM groups, leptin levels were found to be increased in IM/PM  with respect to EM/UM   Levels on Clinical OutcomeA follow-up was carried out with 174 (85.2%) patients who were queried for any\u00a0recurrence of ischemic stroke, TIAs, and death due to vascular causes. Patients unable to visit the hospital were followed up telephonically. The endpoint was TIA/stroke/any vascular death. A total of 33 (19%) patients reached the composite endpoint of death, recurrent TIAs, and ischemic events.\u00a0The median follow-up time was 34 months (IQR: 19-46). The percentage of composite outcome (TIA/stroke/any vascular death) was higher in IM/PM (72.7%) than in EM/UM (27.3%). A trend of association was reported between the occurrence of composite vascular events and IM/PM phenotypes , p = 0.056) , allele *3 (rs4986893), allele *4 (rs28399504), and allele *17 rs12248560)) on the occurrence of stroke, occurrence of the composite endpoint (TIA/ischemic stroke/vascular death), death vs. live, and recurrence of stroke/TIA. From the knowledge of the literature, these genotypes were categorized into poor/intermediate metabolizers and extensive/ultra metabolizers [248560) oStroke vs. no stroke (control)In our study, no significant association was observed between the occurrence of stroke and SNP1. SNP2 showed a significant positive association with the occurrence of stroke in both of these two models (recessive and the log additive model). No significant covariate effect was seen with sex\u00a0when adjusted by age. The AC\u00a0(OR = 1.75 (1.08-2.83), p = 0.024) and GT haplotypes (OR = 3.33 (1.53-7.22), p = 0.0026) were found to be strongly associated with the occurrence of stroke . Among females, the haplotype phenotype interaction was not observed; however, haplotype phenotype interaction was evident among males, and compared to the GC haplotype, AC and GT haplotypes were significantly associated with the occurrence of stroke (after adjusting for age). In previous literature also, Cyp2C19 polymorphism (G681A) was found to be associated with both occurrence and recurrence of cerebral ischemic stroke . AnotherStroke patients: composite outcomeAmong stroke patients, while evaluating the association between SNP1 and the occurrence of the composite outcome, the best-performing models in terms of lowest AIC and BIC score were the dominant model (2.31 (0.99-5.35), p = 0.043) and log-additive model (1.82 (1.02-3.27), p = 0.042). Interestingly,\u00a0both these models showed a positive association between SNP1 and the occurrence of composite outcomes. However, no association was seen between SNP2 and the occurrence of composite outcomes. While evaluating the different haplotypes of SNP1 and SNP2 and their association with the occurrence of the composite outcome, the AC haplotype was significantly associated with the occurrence of the primary outcome (OR = 2.27 (1.17-4.41), p = 0.016, global haplotype association p-value: 0.044). While evaluating the interaction between haplotypes, composite outcome, and impact of important covariates (sex), no significant covariate effect was observed after adjusting for age.All stroke patients: alive vs. deadA significant positive association was seen between the occurrence of the final outcome (death) and SNP1 (OR = 2.35 (1.13-4.90), p = 0.021). However, no association was seen between the occurrence of the final outcome (death) and SNP2 (OR = 0.53 (0.20-1.45), p = 0.19).Among different haplotypes, the AC haplotype was found to be associated with death (OR 2.73 (1.20-6.22), p = 0.018, global haplotype association p-value: 0.039). No significant interaction was seen between the occurrence of the final outcome, haplotype, and sex (after adjustment by age).All live stroke patients: recurrence vs. no recurrenceNo association was seen with recurrence and SNP1 (OR = 0.38 (0.10-1.40), 0.12) and SNP2 (OR = 0.83 (0.44-1.59), p = 0.58). Among live stroke patients, no significant association was seen between any of the haplotypes and recurrence. No significant covariate effect of age was observed after adjustment for age.Adiponectin and leptin levels and occurrence of stroke and metabolic phenotypeSignificant higher levels of leptin (ng/ml) and lower levels of total adiponectin (\u00b5g/ml) were observed between patients and controls.\u00a0The levels of leptin and adiponectin levels were higher in females compared to males. After comparing adipocytokines levels between IM/PM and EM/UM groups, leptin levels were found to be increased in IM/PM with respect to EM/UM. The percentage of composite outcome (TIA/stroke/any vascular death) was higher in IM/PM (72.7%) than in EM/UM (27.3%). A trend of association was seen between the occurrence of composite vascular events and IM/PM phenotypes , p = 0.056). A subsequent study with a higher sample will be helpful in further delineating the effect size.Up to now, several studies showed the role of CYP2C enzymes on the metabolism of xenobiotic agents and drugs. However, to the best of our knowledge, an association between the CYP2C genetic system and dysregulation of adipocytokine in relation to ischemic stroke has not been studied earlier. Among all devastating neurological diseases, stroke is the leading one, which causes death or disability in developing countries, including India . Stroke The current study had a few limitations. Firstly, a single-time assessment of leptin and adiponectin levels was done, which is insufficient to understand changes in the dynamics of inflammation and thrombosis over the follow-up period. Moreover, due to inadequate sample size, the involvement of the CYP enzyme system in adipocytokines production is inconclusive.With regard\u00a0to the occurrence of stroke, SNP2 showed a significant positive association. Haplotypes  AC (OR = 1.75 (1.08-2.83), p = 0.024) and GT (OR = 3.33 (1.53-7.22), p = 0.0026) were strongly associated with the occurrence of stroke even after adjustment for age and sex . Haplotype phenotype gender interaction was evident. Among stroke patients, with regard\u00a0to composite outcome, only SNP1 showed a positive association. The AC haplotype was significantly associated with the occurrence of composite outcome (OR = 2.27 (1.17-4.41), p = 0.016). Among stroke patients, a significant positive association was seen between death and SNP1 (OR = 2.35 (1.13-4.90), p =\u00a00.021) and AC haplotype (OR = 2.73 (1.20-6.22), p = 0.018). However, none of the SNPs or haplotypes showed any association with recurrence. Significantly higher leptin and lower adiponectin levels were observed among stroke patients compared to controls.\u00a0Leptin levels were found to be increased in IM/PM phenotypes. IM/PM phenotypes showed a higher incidence of occurrence of composite vascular events.To conclude, CYP2C19 polymorphisms may play a significant role in the pathogenesis of stroke. Leptin could serve as a prominent biomarker of atherosclerosis and inflammation in the early post-stroke period; however, further study is warranted with a larger sample size. Upregulation and downregulation\u00a0of leptin and adiponectin in ischemic stroke could suggest their importance as future pharmacological targets of atherosclerosis and inflammation; however, this dysregulation due to enzymatic action of CYP2C19 phenotypes needs to be explored further in a large prospective study on ischemic stroke."
\ No newline at end of file